Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a



Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a
Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a

 

C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2615117:

МИРНА ТЕРАПЕТИКС, ИНК. (US)

Изобретение относится к области молекулярной биологии и медицины. Предложена двухцепочечная молекула РНК с тупыми концами длиной 23 пары оснований для обеспечения клетки активностью miR-34a. При этом молекула РНК содержит активную цепь, имеющую SEQ ID NO: 2 от 5' к 3', и полностью комплементарную цепь-«пассажир», имеющую нуклеотидную последовательность, состоящую из SEQ ID NO: 4. Цепь-«пассажир» содержит 2'-OMe модификации сахара в нуклеотидах в положениях 1, 2, 22 и 23, а также терминальную модификацию нуклеотида на 5'-конце. Двухцепочечные молекулы РНК по изобретению являются устойчивыми к нуклеазному расщеплению, активными и специфически гибридизующимися с правильной мРНК-мишенью. 14 з.п. ф-лы, 19 табл., 11 пр.

 

Область техники

Настоящее изобретение относится к области молекулярной биологии и медицины. В частности, предложены способы и композиции, включающие молекулы РНК, обладающие по меньшей мере функциональными свойствами miR-34 и в отдельных вариантах осуществления улучшенными характеристиками, связанными с miR-34, для лечения заболеваний и/или состояний. В отдельных вариантах осуществления молекулы РНК, которые функционируют как miR-34a или как miR-34c, обеспечены в этих контекстах.

Уровень техники

В 2001 году несколько групп использовали метод клонирования для выделения и идентификации большой группы «микроРНК» (миРНК) из С.Elegans, Drosophila и человека (Lau et al., 2001; Lee and Ambros, 2001; Lagos-Quintana et al., 2003).

Опубликованные последовательности зрелой микроРНК человека, описанные в базе данных miRBase, 15.0 (Griffiths-Jones et al., 2006), изменяются по размеру от 16 до 27 нуклеотидов в длину и происходят из более длинных предшественников. Предшественники формируют структуры, которые складываются пополам в самокомплементарных участках и процессируются нуклеазой Dicer (у животных) или DCL1 (у растений) с образованием короткой двухцепочечной зрелой миРНК. Одна из цепей зрелой миРНК интегрируется в комплекс белков и миРНК, называемый РНК-индуцированный комплекс сайленсинга (RISC). миРНК направляет комплекс RISC к мРНК-мишени, которая затем расщепляется или трансляционно подавляется в зависимости от степени комплементарности последовательности миРНК ее мРНК-мишени. В настоящее время полагают, что полная или почти полная комплементарность приводит к деградации мРНК, что чаще всего наблюдается у растений. В противоположность этому, неполное спаривание оснований, обнаруженное преимущественно у животных, приводит к подавлению трансляции. Однако, полученные за последнее время данные свидетельствуют о дополнительной сложности (Bagga et al., 2005; Lim et al., 2005), и механизмы сайленсинга генов с помощью миРНК остаются на стадии интенсивного исследования.

Исследования показали, что изменения уровней экспрессии многочисленных миРНК ассоциированы с различными видами рака (рассмотренными в Calin and Croce, 2006; Esquela-Kerscher and Slack, 2006; Wiemer, 2007). Кроме того, миРНК вовлечены в регуляцию клеточного роста, а также дифференцировку клеток и тканей - клеточные процессы, которые ассоциированы с развитием рака.

Активность различных миРНК была определена и проанализирована. Несмотря на то, что эффективные миметики миРНК были идентифицированы ранее в заявке на патент США 20080050744, которая включена в настоящее описание посредством отсылки, существует потребность в дополнительных миметиках миРНК, которые значительно улучшают одно или несколько свойств природной миРНК, в особенности тех молекул, которые передаются из лаборатории в клинику.

Сущность изобретения

Терапевтические микроРНК должны быть стабильными, активными и специфически гибридизироваться с правильной мРНК-мишенью. Варианты осуществления относятся к миметикам miR-34a и miR-34c, которые сохранили и/или повысили устойчивость к нуклеазному расщеплению, способность к гибридизации с правильными мРНК-мишенями, и/или функциональные свойства.

Варианты осуществления относятся к различным молекулам РНК, содержащим последовательность зрелой miR-34a. Молекулы РНК могут быть двухцепочечными и/или с тупыми концами, что означает, что молекула является двухцепочечной по всей молекуле и/или имеет тупые концы на обеих сторонах. Более того, варианты осуществления относятся к химическим модификациям таких молекул РНК для получения миметиков miR-34a или миметиков miR-34c с улучшенными или усиленными свойствами. Активная цепь двухцепочечной молекулы РНК содержит последовательность зрелой miR-34a. В некоторых вариантах осуществления последовательность одной цепи двухцепочечной молекулы РНК состоит из последовательности зрелой miR-34a. В других вариантах осуществления последовательность одной цепи двухцепочечной молекулы РНК состоит из последовательности зрелой miR-34c.

В отдельных вариантах осуществления имеется молекула РНК, которая является двухцепочечной, что означает, что молекула состоит из двух полинуклеотидов или цепей, которые могут быть отделены друг от друга. Двухцепочечная молекула не включает молекулу со шпилечной структурой, которая представляет собой одну цепь или полинуклеотид. В отдельных вариантах осуществления молекула РНК имеет тупые концы на одной или обеих сторонах. В двухцепочечной молекуле РНК одна или обе цепи могут представлять собой 18, 19, 20, 21, 22, 23, 24 или 25 нуклеотидов в длину, или любой диапазон, который может быть получен на основе указанных значений. В некоторых вариантах осуществления двухцепочечная молекула с тупыми концами представляет собой 22 или 23 пары оснований (bps) в длину.

Предполагается, что в отдельных вариантах осуществления двухцепочечная молекула РНК содержит две цепи, которые являются полностью комплементарными друг другу, что приводит к образованию молекулы, которая обязательно имеет тупые концы.

В некоторых вариантах осуществления молекула РНК имеет активную цепь, содержащую последовательность зрелой человеческой miR-34a (5'-UGGCAGUGUCUUAGCUGGUUGU-3') (SEQ ID NO:1) (22-mer). В некоторых вариантах осуществления последовательность зрелой miR-34a имеет последовательность SEQ ID NO:1 и дополнительный U на 3'-конце (5'-UGGCAGUGUCUUAGCUGGUUGUU-3') (SEQ ID NO:2) (23-mer). Таким образом, в некоторых вариантах осуществления молекула РНК имеет активную цепь с последовательностью нуклеотидов с 1 по 22 SEQ ID NO:2. Кроме того, предполагается, что в отдельных вариантах осуществления имеется молекула РНК, содержащая активную цепь с последовательностью нуклеотидов с 1 по 22 SEQ ID NO:2, при этом молекула РНК представляет собой 23 нуклеотида в длину, так как имеется А, С, G или U на 3'-конце последовательности. В отдельных вариантах осуществления активная цепь имеет модифицированный нуклеотид в одном или нескольких внутренних положениях.

В некоторых вариантах осуществления молекула РНК имеет активную цепь, содержащую последовательность зрелой человеческой miR-34c (5'-AGGCAGUGUAGUUAGCUGAUUGC-3') (SEQ ID NO:5) (23-mer). В отдельных вариантах осуществления активная цепь имеет модифицированный нуклеотид в одном или нескольких внутренних положениях.

Условно принимается, что описанные в настоящем документе последовательности представлены в направлении от 5' к 3', если не указано иначе. Более того, цепь, содержащая последовательность SEQ ID NO, имеет эту последовательность от 5' к 3', если не указано иначе.

Термин «внутренние положения» относится к положению, которое не является первым или последним положением в цепи. Термин «модифицированный нуклеотид» означает нуклеотид или нуклеозид (если относится к нуклеотидному основанию в положении 5') с дополнительным фрагментом или заменяющим фрагментом по сравнению с немодифицированным нуклеотидом. В отношении активных цепей, содержащих один или несколько модифицированных нуклеотидов, предполагается, что имеется, имеется не менее чем, или имеется не более чем 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 или 15 модифицированных нуклеотидов, или любой диапазон, который может быть получен на основе указанных значений. Особо предполагается, что в отдельных вариантах осуществления меньше, чем не каждый нуклеотид в активной цепи являются модифицированным, и что в некоторых вариантах меньше, чем половина нуклеотидов в активной цепи являются модифицированными. Более того, в отдельных вариантах осуществления особо предполагается, что в активной цепи, имеющей множество модифицированных нуклеотидов, не каждый нуклеотид или каждый нуклеотид в активной цепи является модифицированным. Миметики миРНК, раскрытые в настоящем документе, являются последовательность- и/или положение-специфическими.

В отдельных вариантах осуществления способы относятся к миметику miR-34a; такие миметики включают молекулы РНК, имеющие активную цепь с последовательностью, которая является идентичной или имеет 90% или более идентичности с SEQ ID NO:1 или SEQ ID NO:2. В других вариантах осуществления способы относятся к миметику miR-34c; такие миметики включают молекулы РНК, имеющие активную цепь с последовательностью, которая является идентичной или имеет 90% или более идентичности с SEQ ID NO:5. В дополнительных вариантах осуществления способы относятся к миметикам миРНК, которые обеспечивают активность miR-34a и miR-34c; такие миметики включают молекулы РНК, имеющие активную цепь с последовательностью, которая является идентичной или имеет 90% или более идентичности с SEQ ID NO:7.

В отдельных вариантах осуществления имеется двухцепочечная молекула РНК с тупыми концами длиной 22 или 23 пары нуклеотидов, содержащая: а) активную цепь, имеющую SEQ ID NO:1 от 5' к 3', и b) полностью комплементарную цепь-«пассажир», содержащую i) модифицированные нуклеотиды в первом и последних двух нуклеотидах цепи-«пассажира»; и ii) терминальную модификацию нуклеотида на 5'-конце. В некоторых вариантах осуществления эта молекула РНК представляет собой 22 пары оснований в длину, тогда как в других вариантах осуществления эта молекула РНК представляет собой 23 пары оснований в длину. В последнем случае активная цепь содержит SEQ ID NO:1, но вся последовательность представляет собой последовательность из SEQ ID NO:2. В дополнительных вариантах осуществления имеется двухцепочечная молекула РНК с тупыми концами длиной 23 или 24 пары оснований, содержащая: а) активную цепь, имеющую SEQ ID NO:5 от 5' к 3' и по меньшей мере цепь-«пассажир», содержащую i) модифицированные нуклеотиды в первом или последних двух нуклеотидах цепи-«пассажира»; и ii) терминальную модификацию нуклеотида на 5'-конце. В дополнительных вариантах осуществления, кроме того, предполагается, что эта молекула РНК содержит SEQ ID NO:1, SEQ ID NO:2 или SEQ ID NO:7 вместо SEQ ID NO:5. В отдельных вариантах осуществления активная цепь содержит по меньшей мере два модифицированных нуклеотида. В дополнительных вариантах осуществления активная цепь не имеет модифицированного нуклеотида в первых двух положениях на любом конце. В дополнительных вариантах осуществления активная цепь не содержит модифицированный нуклеотид в первых четырех положениях от 5'-конца. В дополнительных вариантах осуществления молекула РНК имеет активную цепь, которая содержит по меньшей мере два модифицированных нуклеотида, хотя модифицированные нуклеотиды не находятся в первых двух положениях на 5'-конце активной цепи. В некоторых вариантах осуществления активная цепь не содержит модифицированный нуклеотид в последних двух положениях активной цепи, а именно, последних двух положениях на 3'-конце.

В некоторых вариантах осуществления активная цепь с последовательностью SEQ ID NO:1 или SEQ ID NO:2 не имеет любых модифицированных нуклеотидов, хотя в таких вариантах осуществления цепь-«пассажир» имеет по меньшей мере терминальную модификацию и по меньшей мере одну другую модификацию. В дополнительных вариантах осуществления активная цепь по меньшей мере с 90% идентичностью SEQ ID NO:1 или SEQ ID NO:2, не имеет любых модифицированных нуклеотидов, хотя в таких вариантах осуществления цепь-«пассажир» имеет по меньшей мере терминальную модификацию и по меньшей мере одну другую модификацию. В еще дополнительных вариантах осуществления активная цепь с последовательностью SEQ ID NO:5 или SEQ ID NO:7 не имеет любых модифицированных нуклеотидов, хотя в таких вариантах осуществления цепь-пассажир» имеет по меньшей мере терминальную модификацию и по меньшей мере одну другую модификацию. В дополнительных вариантах осуществления активная цепь по меньшей мере с 90% идентичностью SEQ ID NO:5 или SEQ ID NO:7, не содержит любых модифицированных нуклеотидов, хотя в таких вариантах осуществления цепь-«пассажир» имеет по меньшей мере терминальную модификацию и по меньшей мере одну другую модификацию.

В отдельных вариантах осуществления активная цепь может содержать последовательность зрелой miR-34a SEQ ID NO:1 (5'-UGGCAGUGUCUUAGCUGGUUGU-3') или содержать последовательность нуклеотидов с 1 по 22 SEQ ID NO:2 (5'-UGGCAGUGUCUUAGCUGGUUGUU-3'). SEQ ID NO:2 имеет последовательность зрелой miR-34a SEQ ID NO:1 в сочетании с дополнительным U на 3'-конце. SEQ ID NO:2 имеет дополнительный U на 3'-конце по сравнению со зрелой человеческой miR-34a в базе данных miRBase 16.0 (Griffiths-Jones et al., 2006) (последовательность зрелой человеческой miR-34a представляет собой SEQ ID NO:1, и ее комплемент представляет собой SEQ ID NO:3). В любом из этих вариантов осуществления активная цепь содержит одинаковую последовательность. В дополнительных вариантах осуществления активная цепь имеет последовательность, которая содержит или состоит из SEQ ID NO:2. В отдельных вариантах осуществления активная цепь может иметь модифицированные нуклеотиды, при этом идентичность этих модифицированных нуклеотидов указана относительно SEQ ID NO.

В определенных вариантах осуществления модифицированные нуклеотиды в активной цепи представляют собой нуклеотиды, расположенные в положениях 3 (G), 4 (С), 11 (U), 12 (U), 13 (А), 14 (G), 15 (С), 16 (U), 17 (G) и/или 18 (G) относительно SEQ ID NO:1 и/или SEQ ID NO:2 (так как единственным различием между этими двумя последовательностями является добавление нуклеотида 23, все другие положения являются одинаковыми в обеих последовательностях), включая любую комбинацию их модифицированных нуклеотидов. Это означает, что они представляют собой нуклеотиды, соответствующие тем нуклеотидам, которые находятся в указанном положении в указанной SEQ ID NO.

Особо предполагается, что варианты осуществления, описанные в настоящем документе в контексте определенного нуклеотида и положения, также могут быть реализованы только относительно положения (от 5'-конца). Например, активная цепь с модифицированным нуклеотидом в положении 3 (G) может также быть реализована в контексте активной цепи, имеющей модифицированный нуклеотид в положении 3 от 5'-конца активной цепи.

В определенных вариантах осуществления, касающихся молекулы РНК, модифицированные нуклеотиды в активной цепи представляют собой нуклеотиды, расположенные в положениях 3 (G), 4 (С), 11 (G), 12 (U), 13 (U), 14 (А), 15 (G), 16 (С), 17 (U) и/или 18 (G) относительно SEQ ID NO:5, которая содержит последовательность зрелой человеческой miR-34c.

В случае, когда конкретное нуклеотидное основание обозначено (как "А", "С", "G" или "U") и описано «относительно» положения в последовательности (такой как SEQ ID NO:2), это означает, что модификация этого конкретного обозначенного нуклеотида предполагается в цепи, даже если его положение изменяется на 1 или 2 положения (±1 или ±2 положения) (из-за удаления или вставки относительно контрольной последовательности). В других вариантах осуществления модифицированный нуклеотид описан в отношении положения в цепи и не относительно конкретной SEQ ID NO:2; в этом случае положение относится к положению в цепи, при этом 5'-конец цепи начинается с положения 1 и продолжается через 2, 3, 4 и т.д. до достижения положения нуклеотида на 3'-конце.

Активная цепь, содержащая последовательность SEQ ID NO:1, но не состоящая из SEQ ID NO:1, может иметь добавление или вставку нуклеотида относительно SEQ ID NO:1. Это означает, что если такая активная цепь имеет модифицированный нуклеотид в положении 5 относительно SEQ ID NO:1, эта цепь имеет модифицированный А в положении 5 в цепи или в положении 6 в цепи (в зависимости от того, где находится вставка или добавление). Другими словами, если не указано иначе, модифицированные нуклеотиды в контексте SEQ ID NO являются нуклеотид-специфическими. Например, если активная цепь содержит SEQ ID NO:1 и представляет собой 23 нуклеотида в длину, это означает, что она имеет вставку относительно SEQ ID ΝΟ:1, так как SEQ ID NO:1 представляет собой 22 нуклеотида в длину. В отдельных вариантах осуществления, если такая активная цепь содержит модифицированный нуклеотид в положении 5 относительно SEQ ID NO:1, эта активная цепь будет иметь модифицированный А в положении 5 в цепи, если вставка находится после положения 5, или будет иметь модифицированный А в положении 6 в цепи, если вставка находится до или в положении 5.

В некоторых вариантах осуществления активная цепь содержит последовательность SEQ ID NO:5. В дополнительных вариантах осуществления активная цепь содержит последовательность, состоящую из последовательности, представленной SEQ ID NO:5. В конкретных вариантах осуществления активная цепь содержит последовательность SEQ ID NO:5, но последовательность указанной активной цепи не состоит из последовательности, представленной SEQ ID NO:5.

В отдельных вариантах осуществления активная цепь содержит по меньшей мере два модифицированных нуклеотида, хотя модифицированные нуклеотиды не находятся в первых двух положениях на 5'-конце активной цепи. В некоторых вариантах осуществления активная цепь не содержит модифицированный нуклеотид в последних двух положениях активной цепи, а именно, последних двух положениях на 3'-конце.

В некоторых вариантах осуществления активная цепь содержит модифицированный нуклеотид в положениях 15 (С) и 16 (U) SEQ ID NO:1 или SEQ ID NO:2. В определенных вариантах осуществления активная цепь содержит модифицированный нуклеотид в положениях 3 (G) и 4 (С) SEQ ID NO:1 или SEQ ID NO:2 вместо или дополнительно к модификациям в положениях 15 (С) и 16 (U). В дополнительных вариантах осуществления активная цепь содержит модифицированный нуклеотид в положениях 11 (U) и 12 (U) SEQ ID ΝΟ:1 или SEQ ID NO:2 вместо или дополнительно к модификациям в положениях 3 (G), 4 (С), 15 (С) и/или 16 (U). В конкретных вариантах осуществления активная цепь содержит модифицированный нуклеотид в положениях 11 (U), 12 (U), 13(A) и 14 (G) SEQ ID NO:1 и/или SEQ ID NO:2 вместо или дополнительно к модификациям в положениях 3 (G), 4 (С), 11(U), 12 (U), 15 (С) и/или 16 (U) относительно SEQ ID NO:1 и/или SEQ ID NO:2. В дополнительных вариантах осуществления активная цепь содержит модифицированный нуклеотид в положениях 17 (G) и 18 (G) SEQ ID NO:1 и/или SEQ ID NO:2 вместо или дополнительно к описанным выше модификациям в положениях 3, 4, 11, 12, 13, 14, 15 и/или 16.

В отдельных вариантах осуществления активная цепь имеет модифицированные нуклеотиды в положениях 11 (U), 12 (U), 15 (С) и 16 (U) относительно SEQ ID NO:1 или SEQ ID NO:2. В других вариантах осуществления эта активная цепь дополнительно содержит модифицированный нуклеотид в положениях 13 (А), 14 (G), 17 (G) и 18 (G) относительно SEQ ID NO:1 или SEQ ID NO:2.

В конкретных вариантах осуществления активная цепь содержит модифицированный нуклеотид в положениях 3 (G), 4 (С), 15 (С) и 16 (U) относительно SEQ ID NO:1 или SEQ ID NO:2.

В некоторых вариантах осуществления активная цепь с последовательностью SEQ ID NO:1 или SEQ ID NO:2 не имеет любых модифицированных нуклеотидов, хотя в таких вариантах осуществления цепь-«пассажир» имеет по меньшей мере терминальную модификацию и по меньшей мере одну другую модификацию.

В некоторых вариантах осуществления активная цепь представляет собой одну из следующих описанных ниже цепей:

i) активную цепь, содержащую по меньшей мере два модифицированных нуклеотида, при этом модифицированные нуклеотиды не находятся в первых двух положениях на 5'-конце;

ii) активную цепь, содержащую по меньшей мере два модифицированных нуклеотида в первом или последних двух положениях от концов;

iii) активную цепь, содержащую модифицированные нуклеотиды в положениях 3 (G), 4 (С), 11 (G), 12 (U), 13 (А), 14 (G), 15 (С), 16 (С), 17 (U) и/или 18 (G) относительно SEQ ID NO:5;

iv) активную цепь, содержащую модифицированный нуклеотид в положениях 11 (G) и 12 (U) относительно SEQ ID NO:5;

v) активную цепь, содержащую модифицированные нуклеотиды в положениях 17 (U) и 18 (G) относительно SEQ ID NO:5;

vi) активную цепь, содержащую модифицированные нуклеотиды в положениях 11 (G), 12 (U), 17 (U) и 18 (G) относительно SEQ ID NO:5;

vii) активную цепь, содержащую модифицированные нуклеотиды в положениях 3 (G) и 4 (С) и по меньшей мере один модифицированный нуклеотид в положении 11 (G), 12 (U), 13 (А), 14 (G), 15 (С), 16 (С), 17 (U) и/или 18 (G) относительно SEQ ID NO:5; или

viii) активную цепь, содержащую модифицированные нуклеотиды в положениях 3 (G), 4 (С), 11 (G), 12 (U), 13 (А), 14 (G), 15 (С), 16 (С), 17 (U) и 18 (G) относительно SEQ ID NO:5.

В отдельных вариантах осуществления молекулы РНК, которые являются двухцепочечными, содержат активную цепь, имеющую всю часть последовательности зрелой миРНК, и цепь-«пассажир», полностью или частично комплементарную активной цепи. В отдельных вариантах осуществления цепь-«пассажир» является, является по меньшей мере или самое большее на 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% комплементарной, или любой диапазон, который может быть получен на основе указанных значений, активной цепи. В некоторых вариантах активная цепь и цепь-«пассажир» являются полностью комплементарными друг другу.

В отношении цепей-«пассажиров», содержащих один или несколько модифицированных нуклеотидов, предполагается, что имеется, имеется не менее, или имеется не более 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 или 15 модифицированных нуклеотидов, или любой диапазон, который может быть получен на основе указанных значений. Особо предполагается, что в отдельных вариантах осуществления меньше, чем каждый нуклеотид в цепи-«пассажире» является модифицированным, и что в некоторых вариантах меньше половины нуклеотидов в цепи-«пассажире» являются модифицированными. Более того, в отдельных вариантах осуществления особо предполагается, что цепь-«пассажир», имеющая множество модифицированных нуклеотидов, имеет не каждый или каждый второй нуклеотид в цепи-«пассажире» модифицированным.

В таких вариантах осуществления цепь-«пассажир» содержит модификацию нуклеотида на 5'-конце, которая может называться как 5'-терминальная модификация. Такая терминальная модификация может быть относительно нуклеотида (или нуклеозида, если он лишен фосфатной группы) на 5'-конце. В частности предполагается, что в отдельных вариантах осуществления эта терминальная модификация представляет собой модификацию, которая не является модификацией молекулы сахара. В частности предполагается, что эта модификация может представлять собой одну из следующих: NH2, биотин, аминогруппа, группа низшего алкиламина, NHCOCH3, ацетильная группа, 2'O-Me, DMTO, флуоресцеин, тиол, акридин, спейсер 18 (PEG) амидит (DMT-Гекса(этиленгликоль)) или любая другая группа этого типа функциональности. В определенных вариантах 5'-терминальная модификация на цепи-«пассажире» представляет собой С6 аминовый линкер. В дополнительных вариантах осуществления нуклеотид на 5'-конце цепи-«пассажира» может иметь несахарную модификацию и сахарную модификацию.

В отдельных вариантах осуществления цепь-«пассажир» содержит по меньшей мере один модифицированный нуклеотид в первых двух или последних двух нуклеотидах цепи-«пассажира». В некоторых вариантах осуществления цепь-пассажир» содержит модифицированный нуклеотид в обоих, первых двух и последних двух, нуклеотидах. В других вариантах осуществления цепь-«пассажир» имеет, имеет по меньшей мере или самое большое 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, или более модифицированных нуклеотидов, или любой диапазон, который может быть получен на основе указанных значений. Особо предполагается, что в отдельных вариантах осуществления меньше, чем каждый нуклеотид в цепи-«пассажире» является модифицированным, и что в некоторых вариантах осуществления меньше, чем половина нуклеотидов в цепи-«пассажире» являются модифицированными. Более того, в отдельных вариантах осуществления особо предполагается, что цепь-«пассажир», имеющая множество модифицированных нуклеотидов, не имеет каждый второй нуклеотид в цепи-«пассажире» модифицированным.

В некоторых вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид, расположенный в положениях 1 (А), 2 (А), 3 (С), 4 (А), 5 (А), 6 (С), 9 (G), 10 (С), 11 (U), 12 (А), 13 (А), 14 (G), 17 (А), 18 (С), 19 (U), 20 (G), 21 (С), 22 (С) и/или 23 (А) относительно SEQ ID NO:4 (5'-AACAACCAGCUAAGACACUGCCA-3') (23-mer) и любую его комбинацию. SEQ ID NO:4 включает такую же последовательность, как SEQ ID NO:3 (5'-ACAACCAGCUAAGACACUGCCA-3') (22-mer), за исключением того, что SEQ ID NO:4 имеет дополнительный А на 5'-конце. В отдельных вариантах осуществления цепь-«пассажир» состоит или содержит SEQ ID NO:3, но не состоит или содержит SEQ ID NO:4. Модифицированные нуклеотиды относительно SEQ ID NO:4 соответствуют в SEQ ID NO:3 (5'-GGCAUUCACCGCGUGCCUUA-3') тем нуклеотидам, которые находятся в положениях 1 (А), 2 (С), 3 (А), 4 (А), 5 (С), 8 (G), 9 (С), 10 (U), 11 (А), 12 (А), 13 (G), 16 (А), 17 (С), 18 (U), 19 (G), 20 (С), 21 (С) и/или 22 (А).

В отдельных вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях i) 1 (А) и 2 (А), и/или ii) 22 (С) и 23 (А) относительно SEQ ID NO:4. В некоторых вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях 1 (А), 2 (А), 22 (С) и 23 (А) относительно SEQ ID NO:4. В дополнительных вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях i) 3 (С) и 4 (А), и/или ii) 19 (U) и 20 (G) относительно SEQ ID NO:4, которые могут быть дополнительно или вместо модификаций в положениях iii) 1 (А), 2 (А) и/или iv) 22 (С) и 23 (А) относительно SEQ ID NO:4. В некоторых вариантах осуществления цепь-«пассажир» имеет модифицированный нуклеотид в положениях i) 3 (С) и 4 (А) или ii) 19 (U) и 20 (G) в SEQ ID NO:4, но не в обоих положениях i) и ii). В других вариантах осуществления цепь-«пассажир» имеет модифицированные нуклеотиды в положениях 3 (С), 4 (А), 19 (U) и 20 (G) относительно SEQ ID NO:4. В некоторых вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях 5 (А) и 6 (С) относительно SEQ ID NO:4, которые могут быть вместо или дополнительно к другим модификациям цепи-«пассажира», описанным здесь.

В других вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях 9 (G) и 10 (С) относительно SEQ ID NO:4, которые могут быть вместо или дополнительно к другим модификациям цепи-пассажира», описанным здесь. В дополнительных вариантах осуществления цепь-пассажир» содержит модифицированный нуклеотид в положениях 11 (U) и 12 (А) относительно SEQ ID NO:4, которые могут быть вместо или дополнительно к другим модификациям цепи-«пассажира», описанным здесь. В отдельных вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях 13 и 14 относительно SEQ ID NO:4, которые могут быть вместо или дополнительно к другим модификациям цепи-«пассажира», описанным здесь. В дополнительных вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях 17 (А) и 18 (С) относительно SEQ ID NO:4, которые могут быть вместо или дополнительно к другим модификациям цепи-пассажира», описанным здесь.

В определенных вариантах осуществления цепь-«пассажир» не имеет модифицированного нуклеотида, расположенного в положениях 7 (С), 8 (А), 9 (G), 15 (А) и 16 (С) относительно SEQ ID NO:4. В других вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях 1 (А), 2 (А), 20 (G), 21 (С), 22 (С) и 23 (А) относительно SEQ ID NO:4. В других вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях 1 (А), 2 (А), 3 (С), 4 (А), 22 (С), и 23 (А) относительно SEQ ID NO:4. В отдельных вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положениях 1 (А), 2 (А), 19 (U), 20 (G), 22 (С) и 23 (А) относительно SEQ ID NO:4.

В некоторых вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид, расположенный в положениях 1(G), 2 (С), 3 (А), 4 (А), 7 (А), 8 (G), 9 (С), 10 (U), аа (А), 12 (А), 13 (С), 14 (U), 19 (U), 21 (С), 22 (С) и/или 23 (U) относительно SEQ ID NO:6 (5'-GCAAUCAGCUAACUACACUGCCU-3') (23-mer), и любую их комбинацию.

В некоторых вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид, расположенный в положениях 1 (G), 2 (С), 3 (А), 4 (А), 7 (А), 8 (G), 9 (С), 10 (U), 11 (А), 12 (А), 13 (С), 14 (U), 19 (U), 21 (С), 22 (С) и/или 23 (U) относительно SEQ ID NO:6 (5'-GCAAUCAGCUAACUACACUGCCU-3') (23-mer), или любую их комбинацию.

В некоторых вариантах осуществления цепь-«пассажир» не имеет модифицированного нуклеотида, расположенного в положениях 5 (U), 6 (С), 15 (А) и/или 16 (С) относительно SEQ ID NO:6.

Рассмотрены комбинации конкретной активной цепи и конкретной цепи-пассажира». Предполагается, что любая описанная здесь активная цепь может быть объединена с частично или полностью комплементарной цепью-«пассажиром» для формирования молекулы двухцепочечной РНК. В некоторых вариантах осуществления имеется молекула РНК с активной цепью, содержащей SEQ ID NO:5 (или последовательность, которая имеет по меньшей мере 90% идентичности с SEQ ID NO:5) и один или несколько модифицированных нуклеотидов, и одну из следующих цепей-«пассажиров»:

i) цепь-«пассажир», которая не содержит любых модифицированных нуклеотидов, за исключением терминальной модификации на 5'-конце;

ii) цепь-«пассажир», содержащая модифицированные нуклеотиды в положениях 1 (G), 2 (С), 3 (А), 21 (С), 22 (С) и/или 23 (U) относительно SEQ ID NO:6;

iii) цепь-«пассажир», содержащая модифицированные нуклеотиды, расположенные в подгруппе положений, при этом подгруппа представляет собой а) 1 (G), 2 (С), 3 (А), и/или b) 22 (С) и 23 (U) относительно SEQ ID NO:6;

iv) цепь-«пассажир», содержащая модифицированные нуклеотиды, расположенные в положениях 1 (G), 2 (С) и 3 (А) относительно SEQ ID NO:6;

v) цепь-«пассажир», содержащая модифицированные нуклеотиды, расположенные в положениях 22 (С) и 23 (U) относительно SEQ ID NO:6;

vi) цепь-«пассажир», содержащая модифицированные нуклеотиды, расположенные в положениях 1 (G), 2 (С), 3 (А), 22 (С) и 23 (U) относительно SEQ ID NO:6;

vii) цепь-«пассажир», содержащая модифицированные нуклеотиды в следующих группах положений а) и/или b), где а) представляет собой положение 1 (G), 2 (С) и 3 (А); и b) представляет собой положение 22 (С) и 23 (U) относительно SEQ ID NO:6, хотя в отдельных вариантах осуществления модифицированные нуклеотиды не расположены в обеих группах а) и b);

viii) цепь-«пассажир», содержащая модифицированные нуклеотиды, расположенные в положениях 4 (А), 7 (А), 8 (G), 9 (С), 10 (U), 11 (А), 12 (А), 13 (С), 14 (U), 19 (U) и/или 21 (С) относительно SEQ ID NO:6;

ix) цепь-«пассажир», содержащая модифицированные нуклеотиды, расположенные в положениях 1 (G), 2 (С), 3 (А), 4 (А), 7 (А), 8 (G), 9 (С), 10 (U), 11 (А), 12 (А), 13 (С), 14 (U), 19 (U) и/или 21 (С) относительно SEQ ID NO:6;

x) цепь-«пассажир», содержащая модифицированные нуклеотиды, расположенные в положениях 4 (А), 7 (А), 8 (G), 9 (С), 10 (U), 11 (А), 12 (А), 13 (С), 14 (U), 19 (U), 21 (С) 22 (С) и/или 23 (U) относительно SEQ ID NO:6;

xi) цепь-«пассажир», содержащая модифицированные нуклеотиды, расположенные в положениях 1 (G), 2 (С), 3 (А), 4 (А), 7 (А), 8 (G), 9 (С), 10 (U), 11 (А), 12 (А), 13 (С), 14 (U), 19 (U), 21 (С) 22 (С) и/или 23 (U) относительно SEQ ID NO:6;

xii) цепь-«пассажир», содержащая модифицированные нуклеотиды в положениях 1 (G), 2 (С), 3 (А), 17 (А), 18 (С), 21 (С), 22 (С) и 23 (U) относительно SEQ ID NO:6;

xiii) цепь-«пассажир», содержащая модифицированные нуклеотиды в положениях 1 (G), 2 (С), 3 (А), 17 (А), 18 (С), 21 (С), 22 (С) и 23 (U) относительно SEQ ID NO:6;

xiv) цепь-«пассажир», содержащая модифицированные нуклеотиды в положениях 1 (G), 2 (С), 3 (А), 11 (А), 12 (А), 13 (С), 14 (U), 21 (С), 22 (С) и 23 (U) относительно SEQ ID NO:6; или

xv) цепь-«пассажир», содержащая модифицированные нуклеотиды в положениях 1 (G), 2 (С), 3 (А), 11 (А), 12 (А), 13 (С), 14 (U), 17 (А), 18 (С), 21 (С), 22 (С) и 23 (U) относительно SEQ ID NO:6.

Предполагаются комбинации конкретной активной цепи и конкретной цепи-пассажира». Предполагается, что любая описанная здесь активная цепь может быть объединена с любой описанной здесь цепью-«пассажиром» для формирования двухцепочечной молекулы РНК.

В отдельных вариантах осуществления конкретная комбинация активной цепи и цепи-«пассажира» предполагается для молекулы РНК, которая обладает активностью miR-34a.

В некоторых вариантах осуществления имеется молекула РНК с активной цепью, содержащей модифицированные нуклеотиды в положениях 11 (U), 12 (U) 15 (С) и 16 (U) относительно SEQ ID NO:1 или SEQ ID NO:2, и одной из следующих цепей-пассажиров»:

i) цепь-«пассажир», которая не содержит любых модифицированных нуклеотидов, за исключением терминальной модификации на 5'-конце;

ii) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1 (А), 2 (А), 20 (G), 21 (С), 22 (С) и 23 (А) относительно SEQ ID NO:4;

iii) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1 (А), 2 (А), 3 (С), 4 (А), 22 (С) и 23 (А) относительно SEQ ID NO:4; или

iv) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1 (А), 2 (А), 19 (U), 20 (G), 22 (С) и 23 (А) относительно SEQ ID NO:4.

В дополнительных вариантах осуществления имеется молекула РНК с активной цепью, содержащей модифицированные нуклеотиды в положениях 11 (U), 12 (U), 13 (А), 14 (G), 15 (С), 16 (U), 17 (G) и 18 (G) относительно SEQ ID NO:1 или SEQ ID NO:2, и одной из следующих цепей-«пассажиров»:

i) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1 (А), 2 (А), 20 (G), 21 (С), 22 (С) и 23 (А) относительно SEQ ID NO:4;

ii) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1 (А), 2 (А), 3 (С), 4 (А), 22 (С) и 23 (А) относительно SEQ ID NO:4;

iii) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1 (А), 2 (А), 19 (U), 20 (G), 22 (С) и 23 (А) относительно SEQ ID NO:4; или

iv) цепь-«пассажир», содержащая SEQ ID NO:3 или SEQ ID NO:4, при этом цепь-«пассажир» не содержит любых модифицированных нуклеотидов, за исключением 5'-терминальной модификации.

В некоторых вариантах осуществления имеется молекула РНК с активной цепью, содержащей модифицированные нуклеотиды в положениях 3, 4, 15 и 16 относительно SEQ ID NO:1 или SEQ ID NO:2, и одной из следующих цепей-пассажиров»:

i) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1, 2, 21, 22 и 23 относительно SEQ ID NO:4;

ii) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1, 2, 3, 4, 22 и 23 относительно SEQ ID NO:4; или

iii) цепь-«пассажир», содержащая SEQ ID NO:4 и модифицированные нуклеотиды в положениях 1,2, 19, 20, 22 и 23 относительно SEQ ID NO:4.

В других вариантах осуществления конкретная комбинация активной цепи и цепи-«пассажира» предполагается для молекулы РНК, которая обладает активностью miR-34c. В некоторых вариантах осуществления имеется двухцепочечная молекула РНК, содержащая а) цепь-«пассажир», имеющую SEQ ID NO:6 и модифицированные нуклеотиды в положениях 1 (G), 2 (С), 3 (А), 17 (А), 18 (С), 21 (С), 22 (С) и 23 (U) в SEQ ID NO:6, и b) активную цепь, имеющую SEQ ID NO:5 и модифицированные нуклеотиды в положениях 11 (G), 12 (U), 17 (U) и 18 (G) относительно SEQ ID NO:5.

В конкретных вариантах осуществления имеется двухцепочечная молекула РНК, содержащая а) цепь-«пассажир», имеющую SEQ I NO:6 и модифицированные нуклеотиды в положениях 1 (G), 2 (С), 3 (А), 11 (А), 12 (А), 13 (С), 14 (U), 21 (С), 22 (С) и 23 (U) в SEQ ID NO:6 и b) активную цепь, имеющую SEQ ID NO:5 и модифицированные нуклеотиды в положениях 11 (G), 12 (U), 17 (U) и 18 (G) относительно SEQ ID NO:5.

В других вариантах осуществления имеется двухцепочечная молекула РНК, содержащая а) цепь-«пассажир», имеющую SEQ I NO:6 и модифицированные нуклеотиды в положениях 1 (G), 2 (С), 3 (А), 11 (А), 12 (А), 13 (С), 14 (U), 17 (А), 18 (С), 21 (С), 22 (С) и 23 (U) в SEQ ID NO:6; и b) активную цепь, имеющую SEQ ID NO:5 и модифицированные нуклеотиды в положениях 11, 12, 17 и 18 в SEQ ID NO:5.

В дополнительных вариантах осуществления имеется двухцепочечная молекула РНК длиной 22 или 23 пар оснований, при этом молекула РНК имеет тупые концы с обеих сторон, содержит активную цепь, имеющую последовательность SEQ ID NO:5, и отдельную и полностью комплементарную цепь-«пассажир» с модифицированным нуклеотидом на 5'-конце, при этом активная цепь содержит по меньшей мере один модифицированный внутренний нуклеотид, и при этом двухцепочечная молекула РНК является более стабильной по сравнению с двухцепочечной молекулой РНК с тупыми концами, лишенной любой модификации внутреннего нуклеотида.

В некоторых вариантах осуществления предложен миметик miR-34. В отдельных вариантах осуществления миметик представляет собой двухцепочечную молекулу РНК с тупыми концами длиной 22 или 23 пар оснований, содержащую: а) активную цепь, имеющую i) SEQ ID NO:7 (N1GGCAGUGUN2N3UUAGCUGN4UUGN5N6, где N1 представляет собой А, С, G или U; N2 представляет собой А, С, G или U; N3 представляет собой А, С, G, U или отсутствует; N4 представляет собой А, С, G или U; N5 представляет собой А, С, G или U; и N6 представляет собой А, С, G, U или отсутствует) от 5' к 3' и ii) по меньшей мере, один внутренний нуклеотид; и b) полностью комплементарную цепь-«пассажир», имеющую терминальную модификацию нуклеотида на 5'-конце. В конкретных вариантах осуществления молекула представляет собой 23 пары оснований в длину.

В дополнительных вариантах осуществления молекула РНК, содержащая SEQ ID NO:7, имеет активную цепь с модифицированным нуклеотидом в положении 3, 4, 11, 12, 13, 14, 15, 16, 17 и/или 18. Это обозначение является положение-специфическим (не нуклеотид-специфическим) относительно активной цепи. Как и в случае SEQ ID NO:2 (mir-34a) и SEQ ID NO:5 (miR-34c), в отдельных вариантах осуществления молекула РНК имеет одну из следующих активных цепей:

i) активную цепь, содержащую по меньшей мере два модифицированных нуклеотида, при этом модифицированные нуклеотиды не находятся в первых двух положениях на 5'-конце;

ii) активную цепь, содержащую по меньшей мере два модифицированных нуклеотида в первом или последних двух положениях от концов;

iii) активную цепь, содержащую модифицированные нуклеотиды в положениях 3, 4, 11, 12, 13, 14, 15, 16, 17 и/или 18;

iv) активную цепь, содержащую модифицированный нуклеотид в положениях 11 и 12;

v) активную цепь, содержащую модифицированные нуклеотиды в положениях 17 и 18;

vi) активную цепь, содержащую модифицированные нуклеотиды в положениях 11, 12, 17 и 18;

vii) активную цепь, содержащую модифицированные нуклеотиды в положениях 3 (G) и 4 (С), и по меньшей мере один модифицированный нуклеотид в положении 11, 12, 13, 14, 15, 16, 17 и/или 18;

viii) активную цепь, содержащую модифицированные нуклеотиды в положениях 3, 4, 11, 12, 13, 14, 15, 16, 17 и 18; или

ix) активную цепь, содержащую не больше, чем 11 модифицированных внутренних нуклеотидов.

В дополнительных вариантах осуществления модификации нуклеотидов, описанные в контексте каждой SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7 или SEQ ID NO:9, могут быть реализованы в контексте любой другой из SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7 или SEQ ID NO:9. Эти варианты осуществления, которые могут быть реализованы в контексте одной из этих SEQ ID NO, могут описывать модификацию нуклеотида, которая основана на нуклеотиде или основана на положении. SEQ ID NO:9 включает SEQ ID NO:7, которая включает SEQ ID NO:2 и SEQ ID NO:5. Все из этих представляющих интерес активных цепей описаны в настоящем документе.

В некоторых вариантах осуществления активная цепь содержит SEQ ID NO:5. В некоторых вариантах осуществления, включающих молекулу РНК с активной цепью, имеющей SEQ ID NO:7, цепь-«пассажир» содержит по меньшей мере один модифицированный внутренний нуклеотид дополнительно к терминальной модификации нуклеотида/нуклеозида. В отдельных вариантах осуществления цепь-пассажир» содержит модифицированный нуклеотид в положениях 1, 2, 3, 4, 9, 10, 11, 12, 13, 14, 19, 21 и/или 22. В некоторых вариантах осуществления цепь-«пассажир» не содержит модифицированного нуклеотида в положении 15 и/или 16.

В отдельных вариантах осуществления цепь-«пассажир» имеет SEQ ID NO:3. В некоторых вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положении 1, 2, 3, 5, 6, 9, 10, 11, 12, 13, 14, 17, 18, 19, 20, 21 и/или 22 в цепи-«пассажире». В других вариантах осуществления цепь-«пассажир» имеет SEQ ID NO:4. В дополнительных вариантах осуществления цепь-«пассажир» содержит модифицированный нуклеотид в положении 1, 2, 3, 4, 7, 8, 9, 10, 11, 12, 13, 14, 19, 21, 22 и/или 23.

В дополнительных вариантах осуществления модификации нуклеотидов, описанные в контексте каждой SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10, могут быть реализованы в контексте любой из SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10. Эти варианты осуществления, которые могут быть реализованы в контексте одной из этих SEQ ID NO, могут описывать модификацию нуклеотида, которая основана на нуклеотиде или основана на положении. SEQ ID NO:10 включает SEQ ID NO:8, которая включает SEQ ID NO:4 и SEQ ID NO:6. Все из этих представляющих интерес цепей-«пассажиров» являются описанными.

В некоторых вариантах осуществления имеется миметик miR-34, содержащий SEQ ID NO:7. В случае таких молекул РНК имеются варианты осуществления, в которых активная цепь содержит один или несколько модифицированных нуклеотидов, при этом модифицированный нуклеотид идентифицирован как нуклеотид-специфический. В таких вариантах осуществления имеется активная цепь, содержащая модифицированные нуклеотиды в положениях 3 (G), 4 (С), 11 (G), 12 (U), 13 (А), 14 (G), 15 (С), 16 (С), 17 (U) и/или 18 (G) относительно SEQ ID NO:7; в других вариантах осуществления активная цепь содержит модифицированный нуклеотид в положениях 11 (G) и 12 (U) относительно SEQ ID NO:7; в дополнительных вариантах осуществления активная цепь содержит модифицированные нуклеотиды в положениях 17 (U) и 18 (G) относительно SEQ ID NO:7; в дополнительных вариантах осуществления активная цепь содержит модифицированные нуклеотиды в положениях 11 (G), 12 (U), 17 (U) и 18 (G) относительно SEQ ID NO:7; в дополнительных вариантах осуществления активная цепь содержит модифицированные нуклеотиды в положениях 3 (G) и 4 (С) и по меньшей мере один модифицированный нуклеотид в положении 11 (G), 12 (U), 13 (А), 14 (G), 15 (С), 16 (С), 17 (U) и/или 18 (G) относительно SEQ ID NO:7; и еще в дополнительных вариантах осуществления активная цепь содержит модифицированные нуклеотиды в положениях 3 (G), 4 (С), 11 (G), 12 (U), 13 (А), 14 (G), 15 (С), 16 (С), 17 (U) и 18 (G) относительно SEQ ID NO:7.

В некоторых вариантах осуществления эта комбинация активной цепи и цепи-пассажира» имеет 5'-терминальную модификацию цепи-«пассажира», при этом терминальная модификация представляет собой алкиламин, такой как С6 аминовый линкер, и модификации нуклеотидов находятся на сахаре в положении 2'. В определенных вариантах осуществления модификация сахара представляет собой 2'OMe.

В дополнительных вариантах осуществления имеется двухцепочечная молекула РНК длиной 22 или 23 пар оснований, при этом молекула РНК имеет тупые концы на обеих сторонах, содержит активную цепь, имеющую последовательность SEQ ID ΝΟ:1 и отдельную или полностью комплементарную цепь-«пассажир» с модифицированным нуклеотидом на 5'-конце, при этом активная цепь содержит по меньшей мере один модифицированный внутренний нуклеотид, и при этом двухцепочечная молекула РНК является более стабильной в присутствии нуклеазы по сравнению с двухцепочечной молекулой РНК с тупыми концами, лишенной любой модификации внутреннего нуклеотида.

В отдельных вариантах осуществления молекула РНК имеет нуклеотиды, которые являются модифицированными сахарной модификацией. В определенных вариантах осуществления модификация сахара представляет собой 2'OMe.

Определенные варианты осуществления включают фармацевтические композиции, содержащие одну или несколько различных молекул РНК, способных действовать в качестве миметиков миРНК; различие может относиться к последовательности и/или типу или положению модификации. В некоторых вариантах осуществления молекулы РНК содержатся в липидных препаратах. В других вариантах осуществления молекулы РНК могут быть формулированы с липосомой, наночастицей на основе полимера, конъюгатом холестерина, циклодекстрановым комплексом, полиэтилениминовым полимером и/или белковым комплексом.

Способы обеспечения клетки активностью miR-34a также представлены в вариантах осуществления. В отдельных вариантах осуществления предложены способы обеспечения клетки активностью miR-34a, включающие введение в клетку эффективного количества молекулы РНК, обладающей активностью miR-34a. В отдельных вариантах осуществления клетка представляет собой раковую клетку. Такие молекулы РНК описаны по всему настоящему раскрытию.

Другие способы включают способ уменьшения клеточной пролиферации, включающий введение в клетку эффективного количества миметика miR-34a. Дополнительные варианты осуществления включают способы индукции апоптоза в клетке, включающие введение в клетку эффективного количества миметика miR-34a. Другие варианты осуществления относятся к способам лечения рака у пациента, включающие введение пациенту фармацевтической композиции, содержащей одну или несколько молекул РНК, которые обладают функцией миРНК. Дополнительные варианты осуществления относятся к способам ингибирования прогрессирования на протяжении клеточного цикла путем введения эффективного количества описанного в настоящем документе миметика miR-34a. В отдельных вариантах осуществления способы, кроме того, включают введение пациенту дополнительной терапии рака. В отдельных вариантах осуществления пациентов тестировали и/или диагностировали на рак. Такие способы могут включать описанные здесь двухцепочечные молекулы РНК. Более того предполагается, что множество различных миметиков miR-34a может применяться в описанных здесь способах и композициях.

Другие варианты осуществления относятся к применению молекул РНК для лечения раковых клеток или их применению для уменьшения клеточной пролиферации, индукции апоптоза или обеспечения клетки функцией miR-34a.

Способы обеспечения клетки активностью miR-34c также представлены в вариантах осуществления. В отдельных вариантах осуществления представлены способы обеспечения клетки активностью miR-34c, включающие введение в клетку эффективного количества молекулы РНК, обладающей активностью miR-34c. В отдельных вариантах осуществления клетка представляет собой раковую клетку. Такие молекулы РНК описаны в настоящем изобретении.

Другие способы включают способ уменьшения клеточной пролиферации, включающий введение в клетку эффективного количества миметика miR-34c. Дополнительные варианты осуществления включают способы индукции апоптоза в клетке, которые предусматривают введение в клетку эффективного количества миметика miR-34c. Другие варианты осуществления относятся к способам лечения рака у пациента, включающим введение пациенту фармацевтической композиции, содержащей молекулы РНК, которые обладают функцией миРНК. В отдельных вариантах осуществления способы, кроме того, включают введение пациенту дополнительной терапии рака. В отдельных вариантах осуществления пациент был тестирован и/или диагностирован на рак. Такие способы могут включать описанные в настоящем документе двухцепочечные молекулы РНК. Более того, предполагается, что множество различных миметиков miR-34c может применяться в описанных здесь способах и композициях.

Другие варианты осуществления относятся к применению молекул РНК для лечения раковых клеток или их применению для уменьшения клеточной пролиферации, индукции апоптоза или для обеспечения клетки функцией miR-34c.

Способы, описанные в контексте миметика miR-34a, могут быть реализованы с помощью миметика miR-34c, и наоборот.

Композиции и способы для их применения могут «содержать», «состоять по существу из» или «состоять из» любой из молекул или стадий, раскрытых на протяжении всего описания изобретения. В отношении промежуточного выражения «состоящий по существу из» и в одном неограничивающем аспекте базовые и новые характеристики композиций и способов, раскрытых в данном описании изобретения, включают активность миметика миРНК.

Применение слова «а» или «an», при использовании в сочетании с термином «содержащий» в формуле изобретения и/или в описании изобретения, может означать «один», но также соответствует значению «один или несколько», «по меньшей мере один» и «один или более чем один».

Предполагается, что любой вариант осуществления, описанный в данном документе, может быть реализован в отношении любого способа или композиции по изобретению, и наоборот. Более того, композиции и наборы по изобретению могут быть использованы для осуществления способов по изобретению.

По всему тексту данной заявки термин «приблизительно» используется для указания, что значение включает стандартное отклонение измерения для устройства или способа, применяемого для определения значения.

Применение термина «или» в формуле изобретения обозначает «и/или», если ясно не указано на обозначение только альтернатив или если альтернативы не являются взаимоисключающими, хотя изобретение поддерживает определение, которое относится только к альтернативам и «и/или». Также предполагается, что что-либо, перечисленное с использованием термина «или», может также быть специально исключенным.

Другие цели, признаки и преимущества данного изобретения станут очевидными из следующего подробного описания. Однако, должно быть понятно, что это подробное описание и конкретные примеры, хотя они и показывают предпочтительные варианты данного изобретения, приводятся только в качестве иллюстрации, так как различные изменения и модификации в пределах сущности и объема данного изобретения будут очевидными опытным специалистам в данной области из этого подробного описания.

Подробное описание изобретения

Варианты осуществления направлены на композиции и способы, относящиеся к миРНК, а также применению миметиков миРНК. Способы включают получение таких миметиков и применение таких миметиков для обеспечения клетки активностью или функцией миРНК. В некоторых вариантах осуществления миметики миРНК используются для терапевтических, прогностических и диагностических применений, в частности, такие способы и композиции, которые относятся к терапевтическим применениям для состояний или заболеваний, в которые вовлечена активность или функция миРНК.

I. Нуклеиновые кислоты

Нуклеиновые кислоты включают последовательности или сегменты последовательности, которые являются идентичными, комплементарными или частично комплементарными последовательностями молекулам зрелой микроРНК («миРНК» или «miR»). Молекулы зрелой миРНК, как правило, представляют собой от 21 до 22 нуклеотидов в длину, хотя сообщалось о длине от 16 до 27 нуклеотидов. Каждая миРНК процессируется из более длинной молекулы предшественника РНК («предшественника миРНК»). Предшественники миРНК транскрибируются с некодирующих белок генов. Прекурсор миРНК имеет два участка комплементарности, что позволяет им образовывать структуру типа «стебель-петля» или шпилечную «fold-back» структуру, которая расщепляется у животных ферментом нуклеазой, подобным ферменту рибонуклеазе семейства III, который называется Дайсер. Процессированная миРНК, как правило, является частью стебля.

Процессированная миРНК (также называется «зрелая миРНК») становится частью большого комплекса для понижающей регуляции определенного гена-мишени. Примеры миРНК животных включают такие миРНК, которые имеют неполное спаривание с мишенью, что подавляет трансляцию (Olsen et al., 1999; Seggerson et al., 2002). Молекулы siPHK также процессируются Дайсером, но из длинной двухцепочечной молекулы РНК. В клетках животных siPHK не обнаружены, но они могут направлять последовательность-специфическое расщепление мРНК-мишени посредством РНК-индуцированного комплекса сайленсинга (RISC) (Denli et al., 2003).

A. miR-34a и miR-34c

Ранее было показано, что miR-34 вовлечена в регуляцию множества клеточных активностей, которые представляют точки интервенции для терапии рака и для терапии других заболеваний и нарушений (заявка на патент США №11/141,707, поданная 31 мая 2005 года и №11/273,640, поданная 14 ноября 2005 года), которые включены в настоящий документ путем отсылки.

Кроме того, авторы изобретения показали, что miR-34 действует в качестве супрессора опухолей посредством его способности регулировать экспрессию ряда ключевых онкогенов (заявка на патент США №12/134932, поданная 6 июня 2008 года, полное содержание которой включено в настоящий документ путем отсылки). К числу связанных с раком генов, которые прямо или косвенно регулируются miR-34, относятся ангиогенин, Aurora В киназа, BCL10, BRCA1, BRCA2, BUB1, циклин А2, циклин D1, циклин D3, CDK-4, ингибитор циклин-зависимой киназы (CDK) 2С, FAS, онкогенный транскрипционный фактор Forkhead box M1, HDAC-1, c-Jun, MCAM, Mcl-1, c-Met, Myb L2, NF1, NF2, фосфоинозитид-3-киназа, polo-подобная киназа 1, R-RAS, SMAD3, рецептор TGF-бета, опухолевый белок D52 (TPD52) и Wnt-7b.

Таким образом, miR-34 управляет активностью белков, которые являются важными регуляторами клеточной пролиферации и выживаемости. Эти мишени часто оказываются дерегулированными в раковых заболеваниях человека.

B. Олигомерные соединения

Варианты осуществления относятся к миметикам миРНК, которые содержат молекулы, способные имитировать активность молекулы РНК. Молекула РНК содержит нуклеозид, который представляет собой комбинацию основания и сахара. Основная часть нуклеозида, как правило, представляет собой гетероциклическое основание. Двумя наиболее распространенными классами таких гетероциклических оснований являются пурины и пиримидины. Нуклеотиды представляют собой нуклеозиды, которые дополнительно содержат фосфатную группу, ковалентно связанную с сахарной частью нуклеозида. В таких нуклеозидах, которые содержат пентофуранозильный сахар, фосфатная группа может быть связана с 2'-, 3'-или 5'-гидроксильным фрагментом сахара. Предполагается, что цепь РНК будет состоять из нуклеотидов (рибонуклеотидов) и что 5'-конец может представлять собой нуклеотид или нуклеозид. Другими словами, может иметься фосфатная группа, связанная с сахарным фрагментом нуклеозида или может иметься только гидроксильная группа вместо фосфатной группы. Как описано здесь, в отдельных вариантах осуществления предложена модификация терминального нуклеозида или нуклеотида, в которой химический фрагмент или группа присоединена к сахару посредством группы, которая является или являлось прежде гидроксильной или фосфатной группой.

При формировании олигонуклеотидов фосфатные группы ковалентно связывают смежные нуклеозиды друг с другом с образованием линейного полимерного соединения. Соответствующие концы этой линейной полимерной структуры могут соединяться между собой с образованием циклической структуры путем гибридизации или путем образования ко валентной связи. Кроме того, линейные соединения могут обладать комплементарностью внутренних нуклеотидных оснований и могут, следовательно, складываться таким образом, чтобы образовывать полностью или частично двухцепочечную структуру. В структуре олигонуклеотидов фосфатные группы, как правило, рассматриваются как формирующие межнуклеозидные связи олигонуклеотида. Нормальная межнуклеозидная связь РНК и ДНК представляет собой 3'-5' фосфодиэфирную связь.

В отдельных вариантах осуществления имеется РНК, молекула РНК или аналог РНК, имеющий длину от 17 до 130 остатков. Варианты осуществления относятся к синтетическим молекулам миРНК, которые имеют, имеют по меньшей мере или самое большее 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 или 40, или более остатков в длину, включая любое целое число или любой диапазон, который может быть получен на основе указанных значений. Каждая цепь или молекула РНК в двухцепочечной молекуле РНК может иметь такие значения длины, которые указаны выше. В отдельных вариантах осуществления молекула РНК имеет тупой конец на одной или обеих сторонах. В некоторых вариантах осуществления молекула РНК имеет тупой конец на стороне, имеющей 5'-конец активной цепи. В других вариантах осуществления молекула РНК имеет тупой конец на стороне, имеющей 5'-конец цепи-«пассажира».

Молекулы РНК, описанные здесь, могут иметь одну или две цепи. В молекулах с двумя цепями две цепи могут быть гибридизированы друг с другом, но они не соединены друг с другом межнуклеозидной связью.

В некоторых вариантах осуществления такие молекулы РНК, которые содержат или состоят из SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7 или SEQ ID NO:9 (или которые состоят из последовательности, которая имеет по меньшей мере 90% идентичности с одной из указанных SEQ ID NO), имеют модифицированный нуклеотид или нуклеозид, расположенный в положении 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 и/или 23 в активной цепи (положение 1 представляет собой 5'-конец). В дополнительных вариантах осуществления модифицированный нуклеотид или нуклеозид расположен в положении 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 и/или 23 в цепи-«пассажире» (положение 1 представляет собой 5'-конец), которая содержит или состоит из SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10 (или которая состоит из последовательности, которая имеет по меньшей мере 90% идентичности с одной из указанных SEQ ID NO). Обозначение модифицированного нуклеотида является положение-специфическим в отличие от нуклеотид-специфического. Соответственно, вариант осуществления, в котором описаны нуклеотид-специфические модификации, например, «активная цепь, содержащая модифицированный нуклеотид в положениях 11 (G) и 12 (U) относительно SEQ ID NO:5», может быть реализован в других вариантах осуществления относительно положения; соответственно, в дополнительных вариантах осуществления молекула РНК может иметь, например, цепь, содержащую модифицированный нуклеотид в положениях 11 и 12.

В отдельных вариантах осуществления миметик миРНК или молекула РНК не имеет тупых концов на обеих сторонах. Предполагается, что может иметься 1, 2, 3, 4, 5 или 6 основание, выступающее на любом 3'- или 5'-конце цепи-«пассажира» или активной цепи двухцепочечного миметика или молекулы РНК.

В отдельных вариантах осуществления цепь-«пассажир» и активная цепь не являются полностью комплементарными. Предполагается, что может иметься 1, 2, 3, 4, 5, 6 или более нуклеотидов между двумя цепями, которые не являются комплементарными. В отдельных вариантах осуществления эти нуклеотиды находятся в пределах первых 10 нуклеотидов 5'-конца цепи-«пассажира».

Предполагается, что миметики РНК имеют основания РНК, которые могут быть или могут не быть модифицированными. Таким образом, миметики РНК представляют собой РНК или молекулы РНК. Более того, следует понимать, что нуклеиновая кислота, включая РНК, может иметь больше, чем одну цепь. Как описано здесь, в отдельных вариантах осуществления миметик миРНК или молекула РНК является двухцепочечной. Если не указано иное, понимается, что двухцепочечная молекула РНК или миметик миРНК имеет две цепи, которые могут быть отделены друг от друга, и которые соединены друг с другом не только шпилечным линкером. Шпилечная молекула имеет одну цепь, которая способна к внутримолекулярной гибридизации. В отдельных вариантах осуществления миметик миРНК представляет собой шпилечную молекулу. В других миметик миРНК представляет собой двухцепочечную молекулу РНК.

В некоторых вариантах осуществления терапевтические двухцепочечных нуклеиновые кислоты имеют первую активную цепь с (а) «участком миРНК», чья последовательность от 5' к 3' является идентичной всей или сегменту последовательности зрелой миРНК, и вторую цепь-«пассажир», имеющую (b) «комплементарный участок», чья последовательность от 5' к 3' является от 60% до 100% комплементарной последовательности миРНК. В некоторых вариантах осуществления эти синтетические миРНК также являются выделенными, как определено ниже, или очищенными. Термин «участок миРНК» относится к участку на синтетической миРНК, который является по меньшей мере на 75, 80, 85, 90, 95 или 100% идентичным, включая все промежуточные целые числа, всей последовательности зрелой природной последовательности миРНК. В некоторых вариантах осуществления участок миРНК является или является по меньшей мере на 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 или 100% идентичным последовательности природной миРНК, такой как последовательность миРНК человека. Альтернативно, участок миРНК может содержать 18, 19, 20, 21, 22, 23, 24 или более положений нуклеотида, как и природная миРНК, при сравнении с помощью алгоритмов выравнивания последовательности и способов, хорошо известных в данной области.

Термин «комплементарный участок» относится к участку синтетической миРНК, который является или является по меньшей мере на 60% комплементарным последовательности зрелой природной миРНК, которой идентичен участок миРНК. Комплементарный участок является или является по меньшей мере на 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 или 100% комплементарным, или любой диапазон, который может быть получен на основе указанных значений. В одноцепочечных полинуклеотидных последовательностях может иметься шпилечная структура как результат образования химических связей между участком миРНК и участком комплементарности. В других вариантах осуществления участок комплементарности находится на другой цепи нуклеиновой кислоты, отличной от участка миРНК, и в этом случае участок комплементарности находится на цепи-«пассажире» и участок миРНК находится на активной цепи.

Термин «олигонуклеотид», как понимается в данной области, относится к олигомеру или полимеру рибонуклеиновой кислоты (РНК) или деоксирибонуклеиновой кислоты (ДНК), как правило, такому, который представляет собой не более 100 оснований или пар оснований в длину. Предполагается, что олигонуклеотид может иметь нуклеозид на 5'-конце. Данный термин включает олигонуклеотиды, состоящие из природных нуклеотидных оснований, Сахаров и ковалентных межнуклеозидных связей. Термин «аналог олигонуклеотида» относится к олигонуклеотидам, которые имеют одну или несколько неприродных частей, которые функционируют аналогично олигонуклеотидам. Такие неприродные олигонуклеотиды могут обладать желательными свойствами по сравнению с природными олигонуклеотидами, такими как, например, описанные здесь, включая, но без ограничения, повышенную физиологическую активность, повышенную стабильность в присутствии нуклеаз(ы), и/или улучшенные фармакокинетические свойства.

Термин «олигонуклеозид» относится к нуклеозидами, которые химически соединены посредством межнуклеозидных связей, которые не содержат атомов фосфора. Межнуклеозидные связи включают короткоцепочечные алкильные, циклоалкильные, смешанные межнуклеозидные связи гетероатома и алкила, смешанные межнуклеозидные связи гетероатома и циклоалкила, одну или несколько короткоцепочечных гетероатомных, и одну или несколько короткоцепочечных гетероциклических межнуклеозидных связей. Такие межнуклеозидные связи включают, но без ограничения, силоксан, сульфид, сульфоксид, сульфон, ацетил, формацетил, тиоформацетил, метиленформацетил, тиоформацетил, алкенил, сульфамат; метиленимино, метиленгидразино, сульфонат, сульфонамид, амид и другие, содержащие смешанные N, О, S и СН2 комплексные компоненты. Дополнительно к описанным выше модификациям, нуклеозиды олигомерных соединений по изобретению могут иметь разнообразные другие модификации. Дополнительные нуклеозиды, подходящие для вариантов осуществления, имеющие модифицированные основные фрагменты и/или модифицированные сахарные фрагменты, описаны в патенте США №6383808 и заявке на патент PCT/US89/02323, оба из которых включены в настоящее описание путем отсылки.

Измененные основные фрагменты или измененные сахарные фрагменты также включают другие модификации, согласующиеся с назначением миметика миРНК. Такие олигомерные соединения лучше всего описаны как структурно отличающиеся, при этом функционально взаимозаменяемые с природными или синтетическими немодифицированными олигонуклеотидами. Все такие олигомерные соединения охвачены настоящим изобретением, поскольку они эффективно имитируют структуру или функцию требуемой олигонуклеотидной цепи РНК или ДНК.

В отдельных вариантах осуществления миметики РНК включают модификацию или замену основания. Природные или немодифицированные основания в РНК представляют собой аденин (А) и гуанин (G), и пиримидиновые основания цитозин (С) и урацил (U) (ДНК имеет тимин (Т)). В противоположность этому, модифицированные основания, также называемые как фрагменты гетероциклического основания, включают другие синтетические и природные нуклеотидные основания, такие как 5-метилцитозин (5-me-С), 5-гидроксиметилцитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метильные и другие алкилпроизводные аденина и гуанина, 2-пропильные и другие алкилпроизводные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галогеноурацил и цитозин, 5-пропинилурацил и цитозин, и другие алкинилпроизводные пиримидиновых оснований, 6-азоурацил, цитозин и тимин, 5-урацил (псевдоурацил), 4-тиоурацил, 8-галогено, 8-амино, 8-тиол, 8-тиоалкил, 8-гидроксил и другие 8-замещенные аденины и гуанины; 5-галогено- (включая 5-бром, 5-трифторметил и другие 5-замещенные урацилы и цитозины), 7-метилгуанин и 7 метиладенин, 2-F-аденин, 2-аминоаденин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин и 3-деазагуанин и 3-деазааденин.

Одна или несколько модификаций основания или сахара могут быть использованы для индукции 3'-эндо-конформации сахара. Нуклеозид может включать синтетические модификации гетероциклического основания, сахарного фрагмента или обоих для индукции требуемой 3'-эндо-конформации сахара. Эти модифицированные нуклеозиды используются для имитации РНК-подобных нуклеозидов таким образом, что конкретные свойства олигомерного соединения могут быть улучшены при сохранении требуемой 3'-эндо конформационной геометрии (смотри Схему 1 в заявке на патент США 2005/0261218, которая включена в настоящее описание посредством отсылки).

В отдельных вариантах осуществления миметик РНК имеет модификацию, в частности, 5'-терминального остатка в особенности цепи миметика РНК, имеющей последовательность, которая является комплементарной зрелой миРНК. Эта цепь называется в настоящем документе как «пассажирская» цепь. Без привязки к какой-либо теории оказалось, что присутствие стабильного фрагмента, отличного от фосфатной или гидроксильной группы, на 5'-конце комплементарной цепи нарушает или устраняет захват цепи-«пассажира» комплексом пути миРНК и, таким образом, способствует захвату активной цепи белковым комплексом миРНК. Модификации 5'-конца включают, но без ограничения, NH2, биотин, аминогруппу, низшую алкиламиновую группу, группу низшего алкила, NHCOCH3, ацетильную группу, 2'-кислород-метил (20-Ме), DMTO, флуоресцеин, тиол или акридин, или любую другую группу с этим типом функциональности. В других вариантах осуществления имеется Спейсер 18 (PEG) амидит (ОМТ-(Гексаэтиленгликоль)). В других вариантах осуществления имеется алкиламиновая или алкильная группа, содержащая 40 или меньше атомов углерода. В вариантах осуществления, включающих «низшую» алкиламиновую или алкильную группу, «низшая» будет пониматься как относящаяся к молекуле, содержащей 20 или меньше атомов углерода.

В определенных вариантах осуществления имеется С4-С12 аминовый линкер на 5'-конце цепи-«пассажира». В определенных вариантах осуществления имеется С6 амин на терминальном фосфате первого нуклеотида цепи-«пассажира».

В определенных вариантах осуществления имеется С12 аминовый линкер на 5'-конце цепи-«пассажира». В других вариантах осуществления имеется С8 аминовый линкер на терминальном фосфате первого нуклеотида цепи-«пассажира».

В различных миметиках миРНК, описанных здесь, эти молекулы РНК могут иметь нуклеотиды с сахарными фрагментами, которые соответствуют природным сахарам или модифицированным сахарам. Иллюстративные модифицированные сахара включают карбоциклические или ациклические сахара, сахара, содержащие группы заместителей в одном или нескольких из их 2', 3' или 4' положений, и сахара, имеющие заместители вместо одного или нескольких атомов водорода сахара. В некоторых вариантах осуществления сахар является модифицированным посредством наличия группы заместителей в положении 2'. В дополнительных вариантах осуществления сахар является модифицированным посредством наличия группы заместителей в положении 3'. В других вариантах осуществления сахар является модифицированным посредством наличия группы заместителей в положении 4'. Также предполагается, что сахар может иметь модификацию в более чем одном из этих положений, или что молекула РНК может иметь один или несколько нуклеотидов с модификацией сахара в одном положении и также один или несколько нуклеотидов с модификацией сахара в другом положении.

Модификации сахара, предполагаемые в миметиках миРНК, включают, но без ограничения, группу заместителей сахара, выбранную из: ОН; F; О-; S- или N-алкила; О-, S- или N-алкенила; О-, S- или N-алкинила; или О-алкил-О-алкила, где алкил, алкенил или алкинил могут представлять собой замещенные или незамещенные алкил от С1 до С10, или алкенил или алкинил от С2 до С10. В отдельных вариантах осуществления эти группы могут быть выбраны из: O(СН2)xOCH3, O((СН2)xO)yCH3, O(CH2)xNH2, O(CH2)xCH3, O(CH2)xONH2 и O(CH2)xON((CH2)xCH3)2, где x и y равны от 1 до 10.

В отдельных вариантах осуществления миметики миРНК содержат группу заместителей сахара, выбранную из следующих: низший алкил от C1 до С10, замещенный низший алкил, алкенил, алкинил, алкарил, аралкил, О-алкарил или О-аралкил, SH, SCH3, Cl, Br, CN, OCN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкил, гетероциклоалкарил, аминоалкиламино, полиалкиламино, замещенный силил, расщепляющая РНК группа, репортерная группа, интеркалятор, группа для улучшения фармакокинетических свойств миметика, или группа для улучшения фармакодинамических свойств миметика, и другие заместители с подобными свойствами. В одном варианте осуществления модификация включает 2'-метоксиэтокси (2'-O-СН2СН2ОСН3, также известный как 2'-O-(2-метоксиэтил) или 2'-МОЕ) (Martin et al., 1995), то есть группа алкоксиалкокси. Другая модификация включает 2'-диметиламинооксиэтокси, то есть группа O(CH2)2ON(CH3)2, также известная как 2'-DMAOE и 2'-диметиламиноэтоксиэтокси (также известный в данной области как 2'-O-диметиламиноэтоксиэтил или 2'-DMAEOE), то есть, 2'-O-СН2-O-CH2-N(CH3)2.

Дополнительные группы заместителей сахара включают аллил (-СН2-СН=СН2), -О-аллил (-O-СН2-СН=СН2), метокси (-O-СН3), аминопропокси (-OCH2CH2CH2NH2) и фтор (F). Группы заместителей сахара в положении 2' (2'-) могут находиться в арабино-положении (сверху) или рибо-положении (снизу). Одна 2'-арабино модификация представляет собой 2'-F. Другие подобные модификации также могут быть образованы в других положениях на олигомерном соединении, в частности, в 3'-положении сахара в 3'-терминальном нуклеотиде или в 2'-5'-связанных олигонуклеотидах и в 5'-положении 5'-терминального нуклеотида. Олигомерные соединения вместо пентофуранозильного сахара также могут содержать миметики сахара, например, циклобутиловые группы. Иллюстративные патенты США, которые раскрывают получение структур модифицированных Сахаров, включают, но без ограничения, патенты США №№4981957; 5118800; 5319080; 5359044; 5393878; 5446137; 5466786; 5514785; 5519134; 5567811; 5576427; 5591722; 5597909; 5610300; 5627053; 5639873; 5646265; 5658873; 5670633; 5792747; и 5700920, которые включены в настоящий документ путем отсылки в полном объеме.

Иллюстративные группы заместителей сахара включают группы, описанные в заявке на патент США 2005/0261218, которая включена в настоящее описание посредством отсылки. В конкретных вариантах осуществления модификация сахара представляет собой модификацию 2'O-Ме, модификацию 2'F, модификацию 2'H, модификацию 2'-амино, модификацию 4'-тиорибозы или модификацию фосфоротиоата на карбоксильной группе, связанной с углеродом в положении 6', или их комбинации.

Дополнительные модификации раскрыты в заявке на патент США 2010/0267814, которая включена в настоящее описание посредством отсылки. Несмотря на то, что эти ссылки раскрывают общие модификации, которые могут быть произведены, они не раскрывают того, что модификации могут быть произведены в контексте конкретной последовательности в конкретных нуклеотидах и/или в конкретных и выбранных положениях, как изложено далее в настоящем документе.

В отдельных вариантах осуществления терапевтическая нуклеиновая кислота содержит один или несколько элементов конструкции. Эти элементы конструкции включают, но без ограничения: (i) замещающую группу для фосфата или гидроксила нуклеотида или нуклеозида, соответственно, на 5'-конце комплементарного участка; (ii) одну или несколько модификаций сахара в первом или последних с 1 по 6 остатках комплементарного участка; или (iii) некомплементарность между одним или несколькими нуклеотидами в последних с 1 по 5 остатках на 3'-конце комплементарного участка и соответствующими нуклеотидами участка миРНК.

В некоторых вариантах осуществления синтетическая миРНК имеет нуклеотид на ее 5'-конце комплементарного участка, в котором фосфатная и/или гидроксильная группа заменена на другую химическую группу (называется как «дизайн замены»). В отдельных случаях фосфатная группа заменена или дополнена дополнительным фрагментом, тогда как в других гидроксильная группа заменена или дополнена дополнительный фрагментом, таким, как описано выше с С6 аминовым линкером. В конкретных вариантах осуществления фрагментом является биотин, аминогруппа, группа низшего алкиламина, ацетильная группа, 2'O-Ме (2'-кислород-метил), DMTO (4,4'-диметокситритил с кислородом), флуоресцеин, тиол или акридин, хотя другие фрагменты хорошо известны специалистам в данной области и также могут быть использованы.

В других вариантах осуществления изобретения имеется синтетическая миРНК, в которой один или несколько нуклеотидов в последних с 1 по 5 остатках на 3'-конце комплементарного участка не являются комплементарными соответствующим нуклеотидам участка миРНК («некомплементарность») (называемый как «некомплементарный дизайн»). Некомплементарность может быть в последних 1, 2, 3, 4 и/или 5 остатках комплементарной миРНК. В некоторых вариантах осуществления имеется некомплементарность по меньшей мере с 2 нуклеотидами в комплементарном участке.

Предполагается, что синтетическая миРНК по изобретению имеет одно или несколько из дизайнов замещения, модификации сахара или некомплементарности. В некоторых случаях синтетические молекулы РНК имеют два из них, тогда как в других эти молекулы имеют все три дизайна.

Участок миРНК и комплементарный участок могут находиться на одном и том же или отдельных полинуклеотидах. В случаях, когда они содержатся на или в одном и том же полинуклеотиде, молекула миРНК будет считаться как один полинуклеотид. В вариантах осуществления, в которых разные участки находятся на отдельных полинуклеотидах, синтетическая миРНК будет считаться состоящей из двух полинуклеотидов.

В случае, когда молекула РНК представляет собой один полинуклеотид, имеется линкерная область между участком миРНК и комплементарным участком. В отдельных вариантах осуществления один полинуклеотид способен формировать шпилечную структуру, как результат соединения между участком миРНК и комплементарным участком. Линкер формирует шпилечную структуру. Предполагается, что в отдельных вариантах осуществления линкерная область представляет собой, представляет собой по меньшей мере или самое большее 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, или 40 остатков в длину, или любой диапазон, который может быть получен на основе указанных значений. В некоторых вариантах осуществления линкер представляет собой от 3 до 30 остатков (включительно) в длину.

Дополнительно к наличию участка миРНК и комплементарного участка, могут иметься также фланкирующие последовательности на 5'- или 3'-конце участка. В отдельных вариантах осуществления имеется или имеется по меньшей мере 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 нуклеотидов или более, или любой диапазон, который может быть получен на основе указанных значений, фланкирующих одну или обе стороны этих участков.

Молекулы РНК с функцией миРНК могут представлять собой, представлять собой по меньшей мере или самое большее 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, или 1000 нуклеотидов в длину, или любой диапазон, который может быть получен на основе указанных значений. Такие значения длины охватывают значения длины процессированной миРНК, проб миРНК, предшественника миРНК, содержащих миРНК векторов, контрольных нуклеиновых кислот, а также других проб и праймеров. Во многих вариантах осуществления миРНК представляет собой 19-24 нуклеотидов в длину, тогда как пробы миРНК представляют собой 5, 10, 15, 20, 25, от 30 до 35 нуклеотидов в длину, включая все значения и диапазоны внутри указанных значений, в зависимости от длины процессированной миРНК и любых добавленных фланкирующих участков. Предшественники миРНК в целом представляют собой от 62 до 110 нуклеотидов у человека.

Нуклеиновые кислоты по изобретению могут иметь участки идентичности или комплементарности с другой нуклеиновой кислотой. Предполагается, что участок комплементарности или идентичности может составлять по меньшей мере 5 соседних остатков, хотя особо предполагается, что участок составляет, составляет по меньшей мере или самое большее 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, или 110 смежных нуклеотидов. Кроме того, следует понимать, что длина комплементарности в пределах предшественника миРНК или между пробой миРНК и миРНК, или геном миРНК имеет такие значения длины. Более того, комплементарность может выражаться в процентах, что означает, что комплементарность между пробой и ее мишенью является на 90% или больше идентичной по длине пробы. В отдельных вариантах осуществления комплементарность является или является по меньшей мере на 90%, 95% или 100% идентичной. В частности, такие значения длины могут применяться к любой нуклеиновой кислоте, содержащей последовательность нуклеиновой кислоты, идентифицированной в любой из SEQ ID NO, раскрытых в настоящем документе.

Может использоваться термин «рекомбинантный», и в целом относится к молекуле, которая была использована для манипуляций in vitro или которая представляет собой продукт репликации или экспрессии такой молекулы.

Термин «миРНК» в целом относится к молекуле РНК, имеющей последовательность и функцию молекулы миРНК. В определенных вариантах осуществления молекулы, рассматриваемые в настоящем изобретении, будут также включать участок или дополнительную цепь, которая является частично (между 10 и 50% комплементарности по длине цепи), значительно (больше, чем 50%, но меньше, чем 100% комплементарности по длине цепи) или полностью комплементарной другому участку той же самой одноцепочечной молекулы или другой нуклеиновой кислоте. Таким образом, нуклеиновые кислоты могут охватывать молекулу, которая содержит одну или несколько комплементарных или самокомплементарных цепей, или «комплемент(ов)» конкретной последовательности, содержащей молекулу. Например, предшественник миРНК может иметь самокомплементарный участок, который является вплоть до 100% комплементарным. Пробы миРНК или нуклеиновые кислоты изобретения могут включать, могут являться или могут являться по меньшей мере на 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 или 100% комплементарными их мишени.

Нуклеиновые кислоты по изобретению могут быть синтезированы любыми методами, известными специалисту в данной области, такими как, например, химический синтез, ферментативное получение или биологическое получение. Особо предполагается, что пробы миРНК по изобретению синтезированы химически.

В отдельных вариантах осуществления изобретения миРНК извлекают или выделяют из биологического образца. миРНК может быть рекомбинантной или может быть природной, или эндогенной клетке (полученной из клеточного генома). Предполагается, что биологический образец может быть обработан таким образом, чтобы повысить извлечение малых молекул РНК, таких как миРНК. Заявка на патент США с серийным номером 10/667126 описывает такие способы и специально включена в настоящий документ путем отсылки. В целом, способы включают лизирование клеток раствором, содержащим гуанидин и детергент.

В некоторых аспектах синтетическая миРНК представляет собой РНК или аналоги РНК. Миметики миРНК могут представлять собой ДНК и/или РНК, или их аналоги. Миметики миРНК с химическими модификациями могут обобщенно называться как «синтетические нуклеиновые кислоты».

В отдельных вариантах осуществления терапевтическая нуклеиновая кислота может иметь последовательность миРНК или синтетической миРНК, имеющую от 10-200 до 17-130 остатков, включая все промежуточные значения и диапазоны. Настоящее изобретение относится к молекулам миРНК или синтетической миРНК, которые представляют собой, представляют собой по меньшей мере или самое большее 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 140, 150, 160, 170, 180, 190, 200, или более остатков в длину, включая любое целое число или любой промежуточный диапазон значений.

В некоторых аспектах синтетические нуклеиновые кислоты имеют (а) «участок миРНК», чья последовательность или участок связывания от 5' к 3' является идентичным или комплементарным всей или сегменту последовательности зрелой миРНК, и (b) «комплементарный участок», чья последовательность от 5' к 3' является между 60% и 100% комплементарной последовательности миРНК в (а). В некоторых вариантах осуществления эти синтетические нуклеиновые кислоты также выделены, как определено ниже. Термин «участок миРНК» относится к участку на синтетической нуклеиновой кислоте, который является по меньшей мере на 75, 80, 85, 90, 95, или 100% идентичным, включая все целые числа внутри указанного диапазона, всей последовательности зрелой природной миРНК или ее комплементу. В некоторых вариантах осуществления участок миРНК является или является по меньшей мере на 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 или 100% идентичным последовательности природной миРНК или ее сегменту, или ее комплементу.

В настоящем документа описаны варианты осуществления, в которых задействованы миметики miR-34, включая специфические миметики miR-34a и miR-34с. Различные активные цепи и цепи-«пассажиры» для этих миметиков описаны в настоящем изобретении. Предполагается, что варианты осуществления, описанные в контексте конкретной SEQ ID NO, могут быть реализованы дополнительно или вместо других вариантов осуществления, описывающих ту же самую SEQ ID NO. Например, активная цепь, которая имеет по меньшей мере 90% идентичности с SEQ ID NO:5, и, кроме того, имеет замещение одного из нуклеотидов/нуклеозида, может быть объединена с вариантом осуществления активной цепи, включающей SEQ ID NO:5, которая также имеет вставку в последовательности; соответственно, активная цепь, которая имеет по меньшей мере 90% идентичности с SEQ ID NO:5, будет иметь замещение и вставку относительно SEQ ID NO:5.

В вариантах осуществления, касающихся миметика миРНК-34а, предполагается, что молекула РНК может содержать активную цепь, которая является или является по меньшей мере на 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичной, или любой диапазон, который может быть получен на основе указанных значений, SEQ ID NO:1. В других вариантах осуществления активная цепь является или является по меньшей мере на 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичной, или любой диапазон, который может быть получен на основе указанных значений, SEQ ID NO:2.

В отдельных вариантах осуществления активная цепь является на 95% идентичной SEQ ID NO:2 (5'-UGGCAGUGUCUUAGCUGGUUGUU-3') (23-MER). В некоторых вариантах осуществления активная цепь имеет следующую последовательность от 5' к 3', в которой один нуклеотид из SEQ ID NO:2 является удаленным.

В вариантах осуществления, в которых нуклеотид удален относительно SEQ ID NO:2, предполагается, что обозначение модифицированного нуклеотида может быть соответствующим образом скорректировано.

В отдельных вариантах осуществления предполагается, что активная цепь, имеющая последовательность, которая по меньшей мере на 95% идентична SEQ ID NO:1, имеет модификацию нуклеотида в одном или нескольких из следующих положений: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 или 22 относительно любого 5'- или 3'-конца цепи. В других вариантах осуществления предполагается, что активная цепь может иметь следующие нуклеотиды модифицированными: U в положении 1 относительно SEQ ID NO:1; G в положении 2 относительно SEQ ID NO:1; G в положении 3 относительно SEQ ID NO:1; С в положении 4 относительно SEQ ID NO:1; А в положении 5 относительно SEQ ID NO:1; G в положении 6 относительно SEQ ID NO:1; U в положении 7 относительно SEQ ID NO:1; G в положении 8 относительно SEQ ID NO:1; U в положении 9 относительно SEQ ID NO:1; С в положении 10 относительно SEQ ID NO:1; U в положении 11 относительно SEQ ID NO:1; U в положении 12 относительно SEQ ID NO:1; А в положении 13 относительно SEQ ID NO:1; G в положении 14 относительно SEQ ID NO:1; С в положении 15 относительно SEQ ID NO:1; U в положении 16 относительно SEQ ID NO:1; G в положении 17 относительно SEQ ID NO:1; G в положении 18 относительно SEQ ID NO:1; U в положении 19 относительно SEQ ID NO:1; U в положении 20 относительно SEQ ID NO:1; G в положении 21 относительно SEQ ID NO:1; и/или, U в положении 22 относительно SEQ ID NO:1. Это означает, что активная цепь больше не может иметь нуклеотид в этом положении, но в контексте последовательности SEQ ID NO:1 конкретный нуклеотид в активной цепи является модифицированным. Это означает, что его положение может быть изменено на ±1 или ±2; например, U в положении 7 относительно SEQ ID NO:1 может быть в положении 8 или в положении 9 в активной цепи, так как имеется вставка, которая влияет на его номер положения.

В отдельных вариантах осуществления предполагается, что активная цепь, имеющая последовательность, которая по меньшей мере на 95% идентична SEQ ID NO:2, имеет модификацию нуклеотида в одном или нескольких из следующих положений: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 или 23 относительно любого из 5'- или 3'-конца цепи. В других вариантах осуществления предполагается, что активная цепь может иметь следующие нуклеотиды модифицированными: U в положении 1 относительно SEQ ID NO:2; G в положении 2 относительно SEQ ID NO:2; G в положении 3 относительно SEQ ID NO:2; С в положении 4 относительно SEQ ID NO:2; А в положении 5 относительно SEQ ID NO:2; G в положении 6 относительно SEQ ID NO:2; U в положении 7 относительно SEQ ID NO:2; G в положении 8 относительно SEQ ID NO:2; U в положении 9 относительно SEQ ID NO:2; С в положении 10 относительно SEQ ID NO:2; U в положении 11 относительно SEQ ID NO:2; U в положении 12 относительно SEQ ID NO:2; А в положении 13 относительно SEQ ID NO:2; G в положении 14 относительно SEQ ID NO:2; С в положении 15 относительно SEQ ID NO:2; U в положении 16 относительно SEQ ID NO:2; G в положении 17 относительно SEQ ID NO:2; G в положении 18 относительно SEQ ID NO:2; U в положении 19 относительно SEQ ID NO:2; U в положении 20 относительно SEQ ID NO:2; G в положении 21 относительно SEQ ID NO:2; U в положении 22 относительно SEQ ID NO:2; и/или, U в положении 23 относительно SEQ ID NO:2. Это означает, что активная цепь больше не может иметь нуклеотид в этом положении, но в контексте последовательности SEQ ID NO:2 конкретный нуклеотид в активной цепи является модифицированным. Это означает, что его положение может изменяться на ±1 или ±2; например, С в положении 10 относительно SEQ ID NO:2 может быть в положении 8 или в положении 12 в активной цепи, так как было удаление или вставка (соответственно), что повлияло на его номер положения.

В отдельных вариантах осуществления активная цепь является на 95% идентичной SEQ ID NO:1 (5'-UGGCAGUGUCUUAGCUGGUUGU-3'). В некоторых вариантах осуществления такая активная цепь имеет следующую последовательность от 5' к 3', в которой один нуклеотид замещен другим рибонуклеотидом (А, С, G или U), как показано в виде N:

В отдельных вариантах осуществления активная цепь является по меньшей мере на 95% идентичной SEQ ID NO:2 (5'-UGGCAGUGUCUUAGCUGGUUGUU-3') с замещением нуклеотида относительно SEQ ID NO:2. В таких вариантах осуществления последовательность активной цепи включает одну из последовательностей, раскрытых выше, за исключением того, что последовательность имеет добавленный U на 3'-конце или имеется замещение последнего U в SEQ ID NO:2. В других вариантах осуществления имеется активная цепь, которая является по меньшей мере на 90% идентичной SEQ ID NO:2, за исключением того, что имеется замещение двух нуклеотидов относительно SEQ ID NO:2. В таких вариантах осуществления имеется дополнительное замещение в последовательности, раскрытой выше, за исключением того, что имеется добавленный U или имеется замещение последнего U в SEQ ID NO:2.

В отдельных вариантах осуществления активная цепь является на 95-100% идентичной SEQ ID NO:1, которая будет включать последовательности, описанные выше. Другие примеры таких активных цепей включают активные цепи со вставкой одного нуклеотида, как описано ниже, в которых следующие последовательности от 5' к 3' имеют вставку нуклеотида, обозначенную как N которая может представлять собой А, С, G или U:

В отдельных вариантах осуществления, дополнительно к одной вставке, показанной выше, имеется вторая вставка или добавление где-либо в последовательности относительно SEQ ID NO:1. Предполагается, что вторая вставка может находиться после нуклеотида вновь или ранее расположенного в положении 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 или 23. Более того, в отдельных вариантах осуществления активная цепь является на 95% идентичной SEQ ID NO:2 (5'-UGGCAGUGUCUUAGCUGGUUGUU-3'), которая включает вставку нуклеотида относительно SEQ ID NO:2. В таких вариантах осуществления последовательность активной цепи включает одну из последовательностей, раскрытых выше, за исключением того, что имеется добавленный U на 3'-конце (за исключением того, где имеется вставка на 3'-конце относительно добавленного U). Варианты осуществления включают варианты с одной или двумя вставками относительно SEQ ID NO:2.

В отдельных вариантах осуществления активная цепь является на 95-100% идентичной SEQ ID NO:2, которая будет включать последовательности, раскрытые выше. Такие активные цепи будут включены в молекулы РНК, которые могут служить в качестве миметика miR-34a. Другие примеры таких активных цепей включают активные цепи со вставкой одного нуклеотида в последовательность SEQ ID NO:2.

В некоторых вариантах осуществления активная цепь имеет последовательность, которая является или является по меньшей мере на 95% идентичной SEQ ID NO:1 или SEQ ID NO:2. SEQ ID ΝΟ:1 (22 нуклеотида в длину) является на 95.7% идентичной SEQ ID NO:2 (23 нуклеотида в длину), и фрагмент из 22 соседних нуклеотидов в SEQ ID NO:2 является на 100% идентичным SEQ ID:1.

Следует отметить, что в отдельных вариантах осуществления последовательность активной цепи состоит из SEQ ID NO:1, что означает, что активная цепь имеет последовательность, которая является на 100% идентичной SEQ ID NO:1. В других вариантах осуществления последовательность активной цепи состоит из SEQ ID NO:2, что означает, что активная цепь имеет последовательность, которая является на 100% идентичной SEQ ID NO:2. В любом из этих вариантов осуществления предполагается, что активная цепь может включать модификацию нуклеотида, расположенного в положении 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 171, 18, 19, 20, 21, 22 и/или 23 (где положение 1 представляет собой 5'-конец цепи) относительно 5'-конца активной цепи. Это означает, что нуклеотид в указанном положении является модифицированным, и это обозначение не зависит от идентичности конкретного нуклеотида в этом указанном положении. Это обозначение является основанным на положении в противоположность основанному на нуклеотиде. В других вариантах осуществления обозначения являются основанными на нуклеотиде. В некоторых вариантах осуществления обозначение может быть основанным на положении относительно 3'-конца активной цепи; в таком случае активная цепь может включать модификацию нуклеотида, расположенного на расстоянии 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 171, 18, 19, 20, 21, 22 и/или 23 нуклеотидов от 3'-конца активной цепи. В отдельных вариантах осуществления обозначения на основе нуклеотидов указывают, что активная цепь может быть модифицирована в следующих нуклеотидах: U в положении 1 в SEQ ID NO:2; U в положении 1 в SEQ ID NO:1 и в положении 2 в SEQ ID NO:2; А в положении 2 в SEQ ID NO:1 и в положении 3 в SEQ ID NO:2; А в положении 3 в SEQ ID NO:1 и в положении 4 в SEQ ID NO:2; G в положении 4 в SEQ ID ΝΟ:1 и в положении 5 в SEQ ID NO:2; G в положении 0.5 в SEQ ID NO:1 и в положении 6 в SEQ ID NO:2; С в положении 6 в SEQ ID NO:1 и в положении 7 в SEQ ID NO:2; А в положении 7 в SEQ ID NO:1 и в положении 8 в SEQ ID NO:2; С в положении 8 в SEQ ID NO:1 и в положении 9 в SEQ ID NO:2; G в положении 9 в SEQ ID NO:1 и в положении 10 в SEQ ID NO:2; С в положении 10 в SEQ ID NO:1 и в положении 11 в SEQ ID NO:2; G в положении 11 в SEQ ID NO:1 и в положении 12 в SEQ ID NO:2; G в положении 12 в SEQ ID NO:1 и в положении 13 в SEQ ID NO:2; U в положении 13 в SEQ ID NO:1 и в положении 14 в SEQ ID NO:2; G в положении 14 в SEQ ID NO:1 и в положении 15 в SEQ ID NO:2; А в положении 15 в SEQ ID NO:1 и в положении 16 в SEQ ID NO:2; А в положении 16 в SEQ ID NO:1 и в положении 17 в SEQ ID NO:2; U в положении 17 в SEQ ID NO:1 и в положении 18 в SEQ ID NO:2; G в положении 18 в SEQ ID NO:1 и в положении 19 в SEQ ID NO:2; С в положении 19 в SEQ ID NO:1 и в положении 20 в SEQ ID NO:2; С в положении 20 в SEQ ID NO:1 и в положении 21 в SEQ ID NO:2; и/или А в положении 22 в SEQ ID NO:2.

В вариантах осуществления, касающихся миметика miPHK-34c, предполагается, что молекула РНК может содержать активную цепь, которая является или является по меньшей мере на 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичной, или любой диапазон, который может быть получен на основе указанных значений, SEQ ID NO:5.

В отдельных вариантах осуществления активная цепь является на 95% идентичной SEQ ID NO:5 (5'-AGGCAGUGUAGUUAGCUGAUUGC-3') (23-mer). В некоторых вариантах осуществления активная цепь имеет следующую последовательность от 5' к 3', в которой один нуклеотид из SEQ ID NO:5 является удаленным:

AGGCAGUGUAGUUAGCUGAUUG (С ранее в положении 23 удален) (SEQ ID NO:72)

AGGCAGUGUAGUUAGCUGAUUG (G ранее в положении 22 удален) (SEQ ID NO:73)

AGGCAGUGUAGUUAGCUGAUUC (U ранее в положении 21 удален) (SEQ ID NO: 74)

AGGCAGUGUAGUUAGCUGAUGC (U ранее в положении 20 удален) (SEQ ID NO: 74)

В вариантах осуществления, в которых нуклеотид удален относительно SEQ ID NO:5, предполагается, что обозначение модифицированного нуклеотида может быть соответствующим образом скорректировано.

В отдельных вариантах осуществления предполагается, что активная цепь, имеющая последовательность, которая является по меньшей мере на 95% идентичной SEQ ID NO:5, имеет модификацию нуклеотида в одном или нескольких из следующих положений: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 или 23 относительно любого из 5'- или 3'-конца цепи. В других вариантах осуществления предполагается, что активная цепь может иметь следующие нуклеотиды модифицированными: А в положении 1 относительно SEQ ID NO:5; G в положении 2 относительно SEQ ID NO:5; G в положении 3 относительно SEQ ID NO:5; С в положении 4 относительно SEQ ID NO:5; А в положении 5 относительно SEQ ID NO:5; G в положении 6 относительно SEQ ID NO:5; U в положении 7 относительно SEQ ID NO:5; G в положении 8 относительно SEQ ID NO:5; U в положении 9 относительно SEQ ID NO:5; А в положении 10 относительно SEQ ID NO:5; G в положении 11 относительно SEQ ID NO:5; U в положении 12 относительно SEQ ID NO:5; U в положении 13 относительно SEQ ID NO:5; А в положении 14 относительно SEQ ID NO:5; G в положении 15 относительно SEQ ID NO:5; С в положении 16 относительно SEQ ID NO:5; U в положении 17 относительно SEQ ID NO:5; G в положении 18 относительно SEQ ID NO:5; А в положении 19 относительно SEQ ID NO:5; U в положении 20 относительно SEQ ID NO:5; U в положении 21 относительно SEQ ID NO:5; G в положении 22 относительно SEQ ID NO:5; and/or С в положении 23 относительно SEQ ID NO:5. Это означает, что активная цепь больше не может содержать нуклеотид в этом положении, но в контексте последовательности SEQ ID NO:5 конкретный нуклеотид в активной цепи является модифицированным. Это означает, что его положение может быть изменено на ±1 или ±2; например, II в положении 7 относительно SEQ ID NO:5 может находиться в положении 7 или в положении 8 в активной цепи, так как было удаление или вставка, соответственно, что влияет на его номер положения.

В отдельных вариантах осуществления активная цепь является по меньшей мере на 95% идентичной SEQ ID NO:5 5'-AGGCAGUGUAGUUAGCUGAUUGC-3'). В некоторых вариантах осуществления такая активная цепь имеет следующую последовательность от 5' к 3', в которой один нуклеотид является замещенным другим рибонуклеотидом (А, С, G или U), как показано в виде N:

В отдельных вариантах осуществления активная цепь является по меньшей мере на 90% идентичной SEQ ID NO:5. В таких вариантах осуществления последовательность активной цепи включает одну из последовательностей, раскрытых выше, и может иметься одна другая вставка, удаление или замещение (такие, которые описаны в настоящем документе) дополнительно к замещению, показанному выше.

В отдельных вариантах осуществления активная цепь является на 95-100%) идентичной SEQ ID NO:5. Примеры таких активных цепей включают активные цепи со вставкой одного нуклеотида, как описано ниже, в которых следующие последовательности от 5' к 3' имеют вставку нуклеотида, обозначенную как которая может представлять собой А, С, G или U.

В отдельных вариантах осуществления, дополнительно к одной вставке, показанной выше, имеется вторая вставка или добавление где-либо в последовательности относительно SEQ ID NO:5. Предполагается, что вторая вставка может находиться после нуклеотида, по-новому или ранее расположенного в положении 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 или 23.

В некоторых вариантах осуществления, включающих миметик miR-34а, цепь-пассажир» имеет последовательность, которая является или является по меньшей мере на 95% идентичной SEQ ID NO:3 или SEQ ID NO:4. SEQ ID NO:3 (20 нуклеотидов в длину) является на 90.9% идентичной SEQ ID NO:4 (22 нуклеотидов в длину), и фрагмент из 20 соседних нуклеотидов в SEQ ID NO:4 является на 100% идентичным SEQ ID NO:3.

Следует отметить, что в отдельных вариантах осуществления последовательность цепи-«пассажира» состоит из SEQ ID NO:3, что означает, что цепь-пассажир» имеет последовательность, которая является на 100% идентичной SEQ ID NO:3. В других вариантах осуществления последовательность цепи-«пассажира» состоит из SEQ ID NO:4, что означает, что цепь-«пассажир» имеет последовательность, которая является на 100% идентичной SEQ ID NO:4. В любом из этих вариантов осуществления предполагается, что цепь-«пассажир» может включать модификацию нуклеотида, расположенного в положении 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 171, 18, 19, 20, 21 и/или 22 (где положение 1 представляет собой 5'-конец цепи) относительно 5'-конца цепи-«пассажира». Это означает, что нуклеотид в указанном положении является модифицированным, и это обозначение не зависит от идентичности конкретного нуклеотида в этом указанном положении. Это обозначение основано на положении, в противоположность основанному на нуклеотиде. В других вариантах осуществления обозначения являются основанными на нуклеотиде. В некоторых вариантах осуществления обозначение может быть основано на положении относительно 3'-конца цепи-«пассажира»; в таком случае цепь-«пассажир» может включать модификацию нуклеотида, расположенного на расстоянии 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 171, 18, 19, 20, 21 и/или 22 нуклеотидов от 3'-конца цепи-пассажира».

Предполагается, что молекула РНК может содержать цепь-«пассажир», которая является или является по меньшей мере на 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичной, или любой диапазон, который может быть получен на основе указанных значений, SEQ ID NO:3. В других вариантах осуществления цепь-пассажир» является или является по меньшей мере на 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичной, или любой диапазон, который может быть получен на основе указанных значений, SEQ ID NO:4.

В отдельных вариантах осуществления цепь-«пассажир» является на 95% идентичной SEQ ID NO:3 (5'-АСААССАОШААОАСАСШССА-3') (22-mer). В некоторых вариантах осуществления активная цепь имеет следующую последовательность от 5' к 3', в которой один нуклеотид из SEQ ID NO:3 является удаленным:

В вариантах осуществления, в которых нуклеотид удален относительно SEQ ID NO:3, предполагается, что обозначение модифицированного нуклеотида может быть соответствующим образом скорректировано.

В отдельных вариантах осуществления предполагается, что активная цепь, имеющая последовательность, которая является по меньшей мере на 95% идентичной SEQ ID NO:3, имеет модификацию нуклеотида в одном или нескольких из следующих положений: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 или 22 относительно любого из 5'- или 3'-конца цепи: А в положении 1 относительно SEQ ID NO:3; С в положении 2 относительно SEQ ID NO:3; А в положении 3 относительно SEQ ID NO:3; А в положении 4 относительно SEQ ID NO:3; С в положении 5 относительно SEQ ID NO:3; С в положении 6 относительно SEQ ID NO:3; А в положении 7 относительно SEQ ID NO:3; G в положении 8 относительно SEQ ID NO:3; С в положении 9 относительно SEQ ID NO:3; U в положении 10 относительно SEQ ID NO:3; А в положении 11 относительно SEQ ID NO:3; А в положении 12 относительно SEQ ID NO:3; G в положении 13 относительно SEQ ID NO:3; А в положении 14 относительно SEQ ID NO:3; С в положении 15 относительно SEQ ID NO:3; А в положении 16 относительно SEQ ID NO:3; С в положении 17 относительно SEQ ID NO:3; U в положении 18 относительно SEQ ID NO:3; G в положении 19 относительно SEQ ID NO:3; С в положении 20 относительно SEQ ID NO:3; С в положении 21 относительно SEQ ID NO:3; and/or А в положении 22 относительно SEQ ID NO:3. Это означает, что цепь-«пассажир» больше не может иметь нуклеотид в этом положении, но в контексте последовательности SEQ ID NO:3 конкретный нуклеотид в активной цепи является модифицированным. Это означает, что его положение может изменяться на -1 или +1; например, G в положении 11 относительно SEQ ID NO:3 может находиться в положении 10 или в положении 12 в цепи-«пассажире», так как имелась вставка или удаление, которое влияет на его номер положения.

В отдельных вариантах осуществления цепь-«пассажир» является на 95%» идентичной SEQ ID NO:4 (5'-AACAACCAGCUAAGACACUGCCA-3'), которая на 2 основания длиннее, чем SEQ ID NO:2. В некоторых вариантах осуществления цепь-«пассажир» имеет следующую последовательность от 5' к 3', в которой один нуклеотид из SEQ ID NO:4 является удаленным:

В вариантах осуществления, в которых нуклеотид удален относительно SEQ ID NO:4, предполагается, что обозначение модифицированного нуклеотида может быть соответствующим образом скорректировано. В отдельных вариантах осуществления предполагается, что активная цепь, имеющая последовательность, которая является по меньшей мере на 95% идентичной SEQ ID NO:4, имеет модификацию нуклеотида в одном или нескольких из следующих положений: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 или 22 относительно любого, 5'- или 3'-конца цепи.

В других вариантах осуществления предполагается, что активная цепь может иметь следующие нуклеотиды модифицированными: А в положении 1 относительно SEQ ID NO:4; А в положении 2 относительно SEQ ID NO:4; С в положении 3 относительно SEQ ID NO:4; А в положении 4 относительно SEQ ID NO:4; А в положении 5 относительно SEQ ID NO:4; С в положении 6 относительно SEQ ID NO:4; С в положении 7 относительно SEQ ID NO:4; А в положении 8 относительно SEQ ID NO:4; G в положении 9 относительно SEQ ID NO:4; С в положении 10 относительно SEQ ID NO:4; U в положении 11 относительно SEQ ID NO:4; А в положении 12 относительно SEQ ID NO:4; А в положении 13 относительно SEQ ID NO:4; G в положении 14 относительно SEQ ID NO:4; А в положении 15 относительно SEQ ID NO:4; С в положении 16 относительно SEQ ID NO:4; А в положении 17 относительно SEQ ID NO:4; С в положении 18 относительно SEQ ID NO:4; U в положении 19 относительно SEQ ID NO:4; G в положении 20 относительно SEQ ID NO:4; С в положении 21 относительно SEQ ID NO:4; С в положении 23 относительно SEQ ID NO:4; и/или А в положении 23 относительно SEQ ID NO:4. Это означает, что активная цепь больше не может иметь нуклеотид в этом положении, но в контексте последовательности SEQ ID NO:2 конкретный нуклеотид в активной цепи является модифицированным. Это означает, что его положение может изменяться на -1 или -2; например, С в положении 11 относительно SEQ ID NO:2 может находиться в положении 10 в активной цепи, так как было удаление, которое влияет на его номер положения.

В отдельных вариантах осуществления цепь-«пассажир» является на 95% идентичной SEQ ID NO:3 (5'-ACAACCAGCUAAGACACUGCCA-3'). В некоторых вариантах осуществления такая цепь-«пассажир» имеет следующую последовательность от 5' к 3', в которой один нуклеотид замещен другим рибонуклеотидом (А, С, G или U), как показано в виде N:

В отдельных вариантах осуществления, дополнительно к одному замещению, показанному выше, имеется второе замещение где-либо в последовательности относительно SEQ ID NO:3. Кроме того, предполагается, что может иметься второе замещение с одним из замещений, описанных в цепи-«пассажире», описанной выше, или одно или два удаления нуклеотидов дополнительно к замещению, описанному выше.

В отдельных вариантах осуществления цепь-«пассажир» является на 95-100% идентичной SEQ ID NO:3, которая должна включать последовательности, раскрытые выше. Другие примеры таких цепей-«пассажиров» включают цепи-«пассажиры» со вставкой одного нуклеотида, как описано ниже, в которых следующие последовательности от 5' к 3' имеют вставку нуклеотида, обозначенную как N, которая может представлять собой А, С, G, или U:

В отдельных вариантах осуществления, дополнительно к вставке в цепи-пассажире», показанной выше относительно SEQ ID NO:3, может иметься вторая вставка где-либо в цепи. Комбинации вставок в цепях-«пассажирах», показанных выше, также предполагаются для дополнительных цепей-«пассажиров».

В отдельных вариантах осуществления цепь-«пассажир» является или является по меньшей мере на 90% идентичной SEQ ID NO:4 (5'-AACAACCAGCUAAGACACUGCCA-3'). В некоторых вариантах осуществления такая цепь-«пассажир» имеет следующую последовательность от 5' к 3', в которой один или два нуклеотида замещены другим рибонуклеотидом. В некоторых вариантах осуществления имеется одно замещение, как показано в виде N:

В отдельных вариантах осуществления, дополнительно к одному замещению, показанному выше, имеется второе замещение где-либо в последовательности относительно SEQ ID NO:4. Более того, предполагается любая комбинация замещений, показанных выше, в цепях-«пассажирах».

В отдельных вариантах осуществления цепь-«пассажир» является на 95-100% идентичной SEQ ID NO:4, которая будет включать последовательности, раскрытые выше. Другие примеры таких цепей-«пассажиров» включают цепи-«пассажиры» со вставкой одного нуклеотида в последовательность SEQ ID NO:4.

Следует отметить, что в отдельных вариантах последовательность цепи-пассажира» состоит из SEQ ID NO:3, что означает, что цепь-«пассажир» имеет последовательность, которая является на 100%) идентичной SEQ ID NO:3. В других вариантах осуществления последовательность цепи-«пассажира» состоит из SEQ ID NO:4, что означает, что цепь-«пассажир» имеет последовательность, которая является на 100%) идентичной SEQ ID NO:4. В любом из этих вариантов осуществления предполагается, что цепь-«пассажир» может включать модификацию нуклеотида, расположенного в положении 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 171, 18, 19, 20, 21 и/или 22 (где положение 1 представляет собой 5'-конец цепи) относительно 5'-конца цепи-«пассажира». Это означает, что нуклеотид в указанном положении является модифицированным, и это обозначение не зависит от идентичности конкретного нуклеотида в этом указанном положении. Это обозначение основано на положении, в противоположность основанному на нуклеотиде. В других вариантах осуществления обозначения основаны на нуклеотиде. В некоторых вариантах осуществления обозначение может быть основано на положении относительно 3'-конца цепи-«пассажира»; в этом случае цепь-«пассажир» может включать модификацию нуклеотида, расположенного на расстоянии 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 171, 18, 19, 20, 21 и/или 22 нуклеотидов от 3'-конца цепи-«пассажира».

Любые варианты осуществления, описанные в настоящем документе, в которых модифицированный нуклеотид был идентифицирован как основанный на нуклеотиде, могут быть реализованы в других вариантах осуществления, в которых модифицированный нуклеотид основан на положении, с использованием положения идентифицированного нуклеотида. Это применяется к активным цепям, а также цепям-пассажирам».

В отдельных вариантах осуществления, основанные на нуклеотиде обозначения указывают, что цепь-«пассажир» может быть модифицирована в следующих нуклеотидах: А в положении 1 в SEQ ID NO:4; А в положении 2 в SEQ ID NO:4; С в положении 3 в SEQ ID NO:4; А в положении 4 в SEQ ID NO:4; А в положении 5 в SEQ ID NO:4; С в положении 6 в SEQ ID NO:4; С в положении 7 в SEQ ID NO:4; А в положении 8 в SEQ ID NO:4; G в положении 9 в SEQ ID NO:4; С в положении 10 в SEQ ID NO:4; U в положении 11 в SEQ ID NO:4; А в положении 12 в SEQ ID NO:4; А в положении 13 в SEQ ID NO:4; в положении 14 в SEQ ID NO:4; А в положении 15 в SEQ ID NO:4; С в положении 16 в SEQ ID NO:4; А в положении 17 в SEQ ID NO:4; С в положении 18 в SEQ ID NO:4; U в положении 19 в SEQ ID NO:4; G в положении 20 в SEQ ID NO:4; С в положении 21 в SEQ ID NO:4; С в положении 22 в SEQ ID NO:4; и/или А в положении 23 в SEQ ID NO:4.

В некоторых вариантах осуществления, включающих миметик miR-34c, цепь-пассажир» имеет последовательность, которая является или является по меньшей мере на 95% идентичной SEQ ID NO:6.

Следует отметить, что в отдельных вариантах осуществления последовательность цепи-«пассажира» состоит из SEQ ID NO:6, что означает, что цепь-«пассажир» имеет последовательность, которая является на 100% идентичной SEQ ID NO:6. В любом из этих вариантов осуществления предполагается, что цепь-«пассажир» может включать модификацию нуклеотида, расположенного в положении 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 171, 18, 19, 20, 21, 22 и/или 23 (где положение 1 представляет собой 5'-конец цепи) относительно 5'-конца цепи-«пассажира». Это означает, что нуклеотид в указанном положении является модифицированным, и это обозначение не зависит от идентичности конкретного нуклеотида в этом указанном положении. Это обозначение основано на положении, в противоположность основанному на нуклеотиде. В других вариантах осуществления обозначение основано на нуклеотиде. В некоторых вариантах осуществления обозначение может быть основано на положении относительно 3'-конца цепи-«пассажира»; в таком случае цепь-«пассажир» может включать модификацию нуклеотида, расположенного на расстоянии 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 171, 18, 19, 20, 21 и/или 22 нуклеотидов от 3'-конца цепи-«пассажира».

Предполагается, что молекула РНК может содержать цепь-«пассажир», которая является или является по меньшей мере на 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичной, или любой диапазон, который может быть получен на основе указанных значений, SEQ ID NO:6.

В отдельных вариантах осуществления цепь-«пассажир» является на 95% идентичной SEQ ID NO:6 (5'-GCAAUCAGCUAACUACACUGCCU-3') (23-mer). В некоторых вариантах осуществления цепь-«пассажир» имеет следующую последовательность от 5' к 3', в которой один нуклеотид из SEQ ID NO:6 является удаленным:

В вариантах осуществления, в которых нуклеотид удален относительно SEQ ID NO:6, предполагается, что обозначение модифицированного нуклеотида может быть соответствующим образом скорректировано. В отдельных вариантах осуществления предполагается, что активная цепь, имеющая последовательность, которая является по меньшей мере на 95% идентичной SEQ ID NO:6, имеет модификацию нуклеотида в одном или нескольких из следующих положений: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или 21 относительно любого из 5'- или 3'-конца цепи: G в положении 1 относительно SEQ ID NO:6; С в положении 2 относительно SEQ ID NO:6; А в положении 3 относительно SEQ ID NO:6; А в положении 4 относительно SEQ ID NO:6; U в положении 5 относительно SEQ ID NO:6; С в положении 6 относительно SEQ ID NO:6; А в положении 7 относительно SEQ ID NO:6; G в положении 8 относительно SEQ ID NO:6; С в положении 9 относительно SEQ ID NO:6; U в положении 2 относительно SEQ ID NO:6; А в положении 11 относительно SEQ ID NO:6; А в положении 12 относительно SEQ ID NO:6; С в положении 13 относительно SEQ ID NO:6; U в положении 14 относительно SEQ ID NO:6; А в положении 15 относительно SEQ ID NO:6; С в положении 16 относительно SEQ ID NO:6; А в положении 17 относительно SEQ ID NO:6; С в положении 18 относительно SEQ ID NO:6; U в положении 19 относительно SEQ ID NO:6; G в положении 20 относительно SEQ ID NO:6; С в положении 21 относительно SEQ ID NO:6; С в положении 22 относительно SEQ ID NO:6; и/или, U в положении 23 относительно SEQ ID NO:6. В этих вариантах осуществления это означает, что цепь-«пассажир» больше не может иметь нуклеотид в этом положении, но в контексте последовательности SEQ ID NO:6 конкретный нуклеотид в цепи-«пассажире» является модифицированным. Это означает, что его положение может изменяться на -1 или +1; например, А в положении 11 относительно SEQ ID NO:6 может находиться в положении 10 или в положении 12 в цепи-«пассажире», так как имеется вставка или удаление, что влияет на его номер положения.

В отдельных вариантах осуществления цепь-«пассажир» является на 95% идентичной SEQ ID NO:6 (5'-GCAAUCAGCUAACUACACUGCCU-3'). В некоторых вариантах осуществления такая цепь-«пассажир» имеет следующую последовательность от 5' к 3', в которой один нуклеотид замещен другим рибонуклеотидом (А, С, G или U), как показано в виде N:

В отдельных вариантах осуществления, дополнительно к одному замещению, показанному выше, имеется второе замещение где-либо в последовательности относительно SEQ ID NO:6. Кроме того, предполагается, что может иметься второе замещение одним из заместителей, описанных в цепи-«пассажире», описанной выше, или одно или два удаления или вставки нуклеотидов дополнительно к замещению, описанному выше.

В отдельных вариантах осуществления цепь-«пассажир» является на 95-100% идентичной SEQ ID NO:6, которая будет включать последовательности, раскрытые выше. Другие примеры таких цепей-«пассажиров» включают цепи-«пассажиры» с вставкой одного нуклеотида, как описано ниже, в которых следующие последовательности от 5' к 3' имеют вставку нуклеотида, обозначенную как N, который может представлять собой А, С, G или U:

В отдельных вариантах осуществления, дополнительно к вставке в цепь-пассажир», показанной выше относительно SEQ ID NO:6, может иметься вторая вставка где-либо в цепи. Комбинации вставок в цепях-«пассажирах», показанных выше, также предполагаются для дополнительных цепей-«пассажиров».

Отдельные варианты осуществления относятся к молекуле РНК с активной цепью, содержащей SEQ ID NO:7. В определенных вариантах осуществления активная цепь содержит SEQ ID NO:9. Любой из вариантов осуществления, описанных выше в контексте активных цепей или цепей с последовательностями, которые содержат, состоят или имеют некоторую процентную идентичность с SEQ ID NO:1, 2 или 5, может быть реализован в контексте цепи, которая содержит, состоит или имеет некоторую процентную идентичность с SEQ ID NO:7 или 9. SEQ ID NO:7 и 9 включает каждую из SEQ ID NO:1, 2 и 5.

Некоторые варианты осуществления относятся к молекуле РНК с цепью-пассажиром», содержащей SEQ ID NO:8. В определенных вариантах осуществления цепь-«пассажир» содержит SEQ ID NO:10. Любой из вариантов осуществления, описанных выше в контексте цепей-«пассажиров» или цепей с последовательностями, которые содержат, состоят или имеют некоторую процентную идентичность с SEQ ID NO:3, 4 или 6, могут быть реализованы в контексте цепи, которая содержит, состоит или имеет некоторую процентную идентичность с SEQ ID NO:8 или 10. SEQ ID NO:8 и 10 включает каждую из SEQ ID NO:3, 4 и 6.

Термин «комплементарный участок» или «комплемент» относится к участку нуклеиновой кислоты или миметику, который является или является по меньшей мере на 60% комплементарным последовательности природной зрелой миРНК. Комплементарный участок является или является по меньшей мере на 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 или 100% комплементарным, или любой диапазон, который может быть получен на основе указанных значений. В последовательностях с одним полинуклеотидом может иметься шпилечная структура как результат образования химических связей между участком миРНК и комплементарным участком. В других вариантах осуществления комплементарный участок находится на молекуле нуклеиновой кислоты, отличной от участка миРНК, и в это случае комплементарный участок находится на комплементарной цепи и участок миРНК находится на активной цепи.

В случае, когда молекула РНК представляет собой один полинуклеотид, может иметься линкерная область между учаском миРНК и комплементарным участком. В отдельных вариантах осуществления один полинуклеотид способен формировать шпилечную структуру в результате соединения между участком миРНК и комплементарным участком. Линкер формирует шпильку. Предполагается, что в отдельных вариантах осуществления линкерная область представляет собой, представляет собой по меньшей мере или самое большее 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 или 40 остатков в длину, или любой диапазон, который может быть получен на основе указанных значений. В некоторых вариантах осуществления линкер представляет собой между 3 до 30 остатков (включительно) в длину.

А. Выделение нуклеиновых кислот

Нуклеиновые кислоты могут быть выделены с помощью методик, хорошо известных специалистам в данной области, хотя в конкретных вариантах осуществления могут быть использованы методы выделения малых молекул нуклеиновых кислот и/или выделения молекул РНК. Хроматография представляет собой метод, часто используемый для разделения или отделения нуклеиновых кислот от белка или от других нуклеиновых кислот.Такие методы могут включать электрофорез с помощью гелевой матрицы, фильтровальные колонки, капиллярный электрофорез, осаждение спиртом и/или другую хроматографию. Если миРНК из клеток подлежит использованию или оценке, методы в целом включают лизис клеток хаотропным агентом (например, гуанидин изотиоцианат) и/или детергентом (например, N-лауроилсаркозин) перед осуществлением способов выделения конкретных популяций РНК.

В конкретных способах отделения миРНК от других нуклеиновых кислот гелевая матрица приготовлена с использованием полиакриламида, хотя также может использоваться агароза. Гели могут быть классифицированы по концентрации или гели могут быть одинаковыми. Пластины или трубки могут служить для закрепления гелевой матрицы для электрофореза. Для разделения нуклеиновых кислот обычно используется одномерный электрофорез. Пластины используются для приготовления геля в блоке, тогда как трубки (стеклянные или каучуковые, как правило) могут быть использованы для приготовления геля в трубках. Выражение «электрофорез в трубках» относится к использованию трубки или системы трубок вместо пластин для формирования геля. Материалы для выполнения электрофореза в трубках могут быть без труда приготовлены специалистом в данной области или приобретены, например, у компании C.B.S. Scientific Co., Inc. или Scie-Plas.

Способы могут включать использование органических растворителей и/или спирта для выделения нуклеиновых кислот, в частности, миРНК, используемую в способах и композициях изобретения. Отдельные варианты осуществления описаны в заявке на патент США с серийным номером 10/667126, которая включена в настоящий документ посредством отсылки. В целом, данное описание изобретения обеспечивает способы эффективного выделения малых молекул РНК из клеток, включающие: добавление спиртового раствора в клеточный лизат и нанесение смеси спирт/лизат на твердую подложку перед элюированием молекул РНК с твердого носителя. В отдельных вариантах осуществления количество спирта, добавленного в лизат клеток, достигает концентрации спирта примерно от 55% до 60%. Несмотря на то, что могут быть использованы различные спирты, этанол работает лучше. Твердая подложка может представлять собой любую структуру, которая включает шарики, фильтры и колонки, которые могут включать минеральную или полимерную подложку с электроотрицательными группами. Фильтр из стекловолокна или колонка работает особенно хорошо для таких способов выделения.

В определенных вариантах осуществления способы выделения миРНК включают: а) лизис клеток в образце лизирующим раствором, содержащим гуанидин, при этом получают лизат с концентрацией по меньшей мере примерно 1М гуанидина; b) экстракцию молекул миРНК из лизата экстрагирующим раствором, содержащим фенол; с) добавление в лизат спиртового раствора с образованием смеси лизат/спирт, при этом концентрация спирта в смеси составляет примерно от 35% до примерно 70%; d) нанесение смеси лизат/спирт на твердую подложку; е) элюирование молекул миРНК с твердой подложки ионным раствором; и f) улавливание молекул миРНК. Как правило, образец полностью высушивают и ресуспендируют в жидкости и объеме, пригодном для последующей манипуляции.

В. Приготовление нуклеиновых кислот

Альтернативно, синтез нуклеиновых кислот выполняют согласно стандартным методам. Смотри, например, Itakura и Riggs (1980). Кроме того, патенты США №№4704362, 5221619 и 5583013, каждый, описывает различные способы приготовления синтетических нуклеиновых кислот. Неограничивающие примеры синтетических нуклеиновых кислот (например, синтетического олигонуклеотида) включают нуклеиновую кислоту, полученную методом химического синтеза in vitro с использованием химии фосфотриэфира, фосфита или фосфорамидита, и твердофазными методами, например, описанными в ЕР 266032, включенном в настоящий документ посредством отсылки, или посредством промежуточных соединений дезоксинуклеозид-Н-фосфонатов, как описано в Froehler et al., 1986 и патенте США №5705629, каждом, включенном в настоящий документ посредством отсылки. В способах, описанных в настоящем документе, может быть использован один или несколько олигонуклеотидов. Синтез олигонуклеотидов хорошо известен специалистам в данной области. Различные другие механизмы синтеза олигонуклетидов раскрыты, например, в патентах США№№4659774, 4816571, 5141813, 5264566, 4959463, 5428148, 5554744, 5574146, 5602244, каждый из которых включен в настоящий документ посредством отсылки.

Неограничивающим примером получения нуклеиновой кислоты ферментативным путем является получение с использованием ферментов в реакциях амплификации, таких как полимеразная цепная реакция PCR™ (смотри, например, патенты США №№4683202 и 4682195, каждый из которых включен в настоящий документ посредством отсылки), или синтез олигонуклеотида, описанный в патенте США №5645897, включенном в настоящий документ посредством отсылки. Неограничивающие примеры биологически полученной нуклеиновой кислоты включают рекомбинантную нуклеиновую кислоту, полученную (т.е. реплицированную) в живой клетке, например, вектор рекомбинантной ДНК, реплицированный в бактерии, или векторы рекомбинантной РНК или РНК, реплицированные в вирусах (смотри, например, Sambrook et al., 2001, включенный в настоящий документ посредством отсылки).

Рекомбинантные методы получения нуклеиновых кислот в клетке хорошо известны специалистам в данной области. Эти способы включают использование векторов (вирусных и невирусных), плазмид, космид и других носителей для доставки нуклеиновой кислоты в клетку, которая может представлять собой клетку-мишень (например, раковую клетку) или просто клетку хозяина (для получения больших количеств желательной молекулы РНК). Альтернативно, такие носители могут применяться в контексте бесклеточной системы, поскольку присутствуют реагенты для генерации молекулы РНК. Такие способы включают способы, которые описаны в Sambrook, 2003, Sambrook, 2001 и Sambrook, 1989, которые включены в настоящее описание посредством отсылки.

В некоторых вариантах осуществления настоящее изобретение относится к молекулам нуклеиновой кислоты, которые не являются синтетическими. В отдельных вариантах осуществления молекула нуклеиновой кислоты имеет химическую структуру природной нуклеиновой кислоты и последовательность природной нуклеиновой кислоты, такую как точная и полная последовательность одноцепочечной первичной миРНК (смотри Lee, 2002), одноцепочечного предшественника миРНК или одноцепочечной зрелой миРНК.

II. Терапевтические методы

Некоторые варианты осуществления относятся к нуклеиновым кислотам, которые выполняют функции эндогенной miR-34a или miR-34c при введении в клетки. В некоторых аспектах терапевтические нуклеиновые кислоты (называемые также нуклеиновыми кислотами) могут представлять собой синтетическую, несинтетическую или комбинацию синтетической и несинтетической последовательностей миРНК. Варианты осуществления в некоторых аспектах относятся к молекулам коротких нуклеиновых кислот (терапевтических нуклеиновых кислот), которые функционируют в качестве miR-34a или miR-34c. Как правило, молекулы нуклеиновой кислоты являются синтетическими. Термин «синтетический» относится к молекуле нуклеиновой кислоты, которая химически синтезирована с использованием аппарата или устройства и не получена естественным путем в клетке.

В некоторых аспектах молекулы РНК могут иметь последовательность, которая не вся идентична или комплементарна последовательности природной зрелой миРНК. Такие молекулы могут охватывать всю или часть ее природной последовательности или комплемента. Например, синтетическая нуклеиновая кислота может иметь последовательность, которая отличается от последовательности зрелой миРНК, но эта измененная последовательность может обеспечивать одну или несколько функций, которые могут быть достигнуты с помощью природной последовательности.

Термин «выделенная» означает, что молекулы нуклеиновой кислоты сначала отделяют от других молекул (в отношении последовательности или структуры) и нежелательных молекул нуклеиновой кислоты таким образом, что популяция выделенных нуклеиновых кислот является по меньшей мере примерно на 90% гомогенной и может являться по меньшей мере примерно на 95, 96, 97, 98, 99 или 100% гомогенной по отношению к другим молекулам полинуклеотида. Во многих аспектах изобретения нуклеиновая кислота выделена путем синтеза in vitro отдельно от эндогенных нуклеиновых кислот в клетке. Будет понятно, тем не менее, что выделенные нуклеиновые кислоты могут быть в дальнейшем смешаны или объединены вместе.

В некоторых способах имеется дополнительная стадия введения выбранного миметика миРНК или молекулы РНК в клетку, ткань, орган или организм (обобщенно «биологический материал»), нуждающийся в лечении, относящемуся к модулированию нацеленной миРНК, или нуждающийся в физиологических или биологических результатах, описанных в настоящем документе (например, в отношении конкретного клеточного пути или результата, например, уменьшения жизнеспособности клетки). Таким образом, в отдельных способах имеется стадия идентификации пациента, нуждающегося в лечении, которое может быть обеспечено миметиком(ами) миРНК. Предполагается, что в отдельных вариантах осуществления может быть введено эффективное количество миметика миРНК. В конкретных вариантах осуществления имеется благоприятный терапевтический эффект, оказываемый на биологический материал, при этом «благоприятный терапевтический эффект» относится к улучшению одного или нескольких состояний или симптомов, связанных с заболеванием или состоянием, или улучшению прогноза, продолжительности или статуса в отношении заболевания. Предполагается, что благоприятный терапевтический эффект включает, но без ограничения, уменьшение боли, уменьшение смертности, ослабление симптома. Например, в отношении рака предполагается, что благоприятным терапевтическим эффектом может являться ингибирование роста опухоли, предупреждение метастазирования, сокращение количества метастаз, ингибирование пролиферации раковых клеток, индукция клеточной гибели в раковых клетках, ингибирование ангиогенеза около раковых клеток, индукция апоптоза раковых клеток, уменьшение жизнеспособности раковых клеток или числа жизнеспособных раковых клеток, уменьшение боли, уменьшение риска повторного возникновения, индукция химио- или радиационной чувствительности в раковых клетках, продление жизни и/или задержка смерти, прямо или косвенно относящаяся к раку.

В некоторых вариантах осуществления для лечения рака применяется миметик миРНК. Рак включает, но без ограничения, злокачественные виды рака, опухоли, метастатические виды рака, неоперабельные виды рака, химио- и/или радиоционно-устойчивые виды рака и рак последней стадии.

Типы рака, которые могут быть оценены, диагностированы и/или подвергнуты лечению способами и композициями изобретения, включают раковые клетки из мочевого пузыря, крови, костей, костного мозга, мозга, молочной железы, сердечнососудистой системы, шейки матки, толстой кишки, соединительной ткани, эндометрия, эпителия, пищевода, жировой клетчатки, желудочно-кишечного тракта, гландов, десен, головы, почек, печени, легких, оболочки головного мозга, мышц, носоглотки, шеи, нервной клетки, яичников, поджелудочной железы, предстательной железы, прямой кишки, сетчатки, кожи, селезенки, желудка, семенника, вилочковой железы, щитовидной железы, языка или матки. Кроме того, рак может быть, в частности, следующего гистологического типа, хотя он и не ограничивается этими типами: неоплазма злокачественная; карцинома; карцинома недифференцированная; гигантоклеточная и веретеноклеточная карцинома; мелкоклеточная карцинома; папиллярная карцинома; плоскоклеточная карцинома; лимфоэпителиальная карцинома; базальноклеточная карцинома; рак волосяных фолликулов; переходно-клеточная карцинома; папиллярная переходно-клеточная карцинома; аденокарцинома; злокачественная гастринома; холангиокарцинома; злокачественная гепатома; объединенная злокачественная гепатома и холангиокарцинома; трабекулярная аденокарцинома; аденокистозная карцинома; полиплоидная аденокарцинома; семейный коли-полипоз; солидная карцинома; злокачественная карциноидная опухоль; бронхоальвеолярная аденокарцинома; папиллярная аденокарцинома; хромофобная карцинома; ацидофильная карцинома; оксифильная аденокарцинома; базофильная карцинома; светлоклеточный рак; зернисто-клеточная карцинома; фолликулярная аденокарцинома; папиллярная и фолликулярная аденокарцинома; некапсулированная плотная карцинома; рак коры надпочечника; карцинома эндометрия; карцинома кожи; апокринная карцинома; сальная аденокарцинома; аденокарцинома серных желез; слизеобразующий плоскоклеточный рак; цистаденокарцинома; папиллярная цистаденокарцинома; папиллярная серозная цистаденокарцинома; слизеобразующая цистаденокарцинома; муцинозная аденокарцинома; перстневидно-клеточный рак; инфильтрующая протоковая карцинома; медуллярный рак; лобулярная карцинома; воспалительная карцинома; экземоподобный рак молочной железы; ацинарноклеточная карцинома; аденосквамозная карцинома; аденокарцинома с плоскоклеточной метаплазией; злокачественная тимома; злокачественная стромальная опухоль яичников; злокачественная текома; злокачественная гранулезоклеточная опухоль; злокачественная андробластома; карцинома из клеток Сертоли; злокачественная карцинома из клеток Лейдига; злокачественная опухоль из липидных клеток; злокачественная параганглиома; злокачественная параганглиома молочной железы; феохромоцитома; гломангиосаркома; злокачественная меланома; амеланотическая меланома; поверхностная распространенная меланома; злокачественная меланома в большом пигментированном невусе; эпителиально-клеточная меланома; злокачественный меланоформный невус; саркома; фибросаркома; злокачественная фиброзная гистиоцитома; миксосаркома; липосаркома; лейомиосаркома; рабдомиосаркома; эмбриональная рабдомиосаркома; альвеолярная рабдомиосаркома; стромальная саркома; злокачественная смешанная опухоль; смешанная опухоль Мюллера; нефробластома; гепатобластома; карциносаркома; злокачественная мезенхимома; злокачественная аденофиброма яичника; злокачественная филлодиевая опухоль; злокачественная синовиома; злокачественная мезотелиома; дисгерминома; эмбриональная карцинома; злокачественная тератома; злокачественная струма яичников; хориокарцинома; злокачественная мезонефрома; гемангиосаркома; злокачественная гемангиоэндотелиома; саркома Капоши; злокачественная гемангиоперицитома; лимфангиосаркома; остеосаркома; юкстакортикоидная остеосаркома; хондросаркома; злокачественная хондробластома; мезенхимальная хондросаркома; миелодная опухоль; саркома Юнга; злокачественная одонтогенная опухоль; амелобластная одонтосаркома; злокачественная амелобластома; амелобластная фибросаркома; злокачественная пинеалома; хордома; злокачественная глиома; эпендимома; астроцитома; протоплазматическая астроцитома; фибриллярная астроцитома; астробластома; глиобластома; олигодендроглиома; олигодендробластома; простая нейроэктодермия; мозжечковая саркома; ганглионейробластома; нейробластома; ретинобластома; многофакторная нейрогенная опухоль; злокачественная менингиома; нейрофибросаркома; злокачественная нейрилеммома; злокачественная гранулярно-клеточная опухоль; злокачественная лимфома; болезнь Ходжкина; лимфома Ходжкина; парагранулема; злокачественная мелкоклеточная лимфома; злокачественная диффузная крупноклеточная лимфома; злокачественная фолликулярная лимфома; фунгоидный микоз; другие специфичные неходжкинские лимфомы; злокачественный гистиоцитоз; множественная миелома; тучноклеточная саркома; иммунопролиферативная болезнь тонкого кишечника; лейкоз; лимфоидная лейкоз; плазмоклеточный лейкоз; эритролейкоз; лимфосаркомно-клеточный лейкоз; миелоидный лейкоз; базофильный лейкоз; эозинофильный лейкоз; моноцитный лейкоз; тучноклеточный лейкоз; мегакариобластный лейкоз; миелоидная саркома и лейкоз ворсистых клеток. Кроме того, миметики миРНК могут применяться для предраковых клеток, таких как клетки метаплазии, дисплазии и гиперплазии.

Способы включают обеспечение или усиление активности одной или нескольких миРНК в клетке. Способы также относятся к индукции некоторых клеточных характеристик путем обеспечения клетки конкретной нуклеиновой кислотой, такой как определенная терапевтическая молекула нуклеиновой кислоты, т.е. молекула миметика миРНК. Терапевтический миметик миРНК может иметь последовательность, которая идентична природной миРНК с одной или несколькими модификациями конструкции.

В некоторых аспектах понимается, что конкретная молекула нуклеиновой кислоты, обеспеченная клетке, соответствует конкретной миРНК в клетке, и, таким образом, миРНК в клетке называется «соответствующая миРНК». В ситуациях, когда указанная молекула миРНК вводится в клетку, будет пониматься, что соответствующая миРНК обеспечивает функцию миРНК. В отдельных вариантах осуществления предполагается, однако, что терапевтическая нуклеиновая кислота, введенная в клетку, не является зрелой миРНК, но способна стать или функционировать как зрелая миРНК в соответствующих физиологических условиях. В случаях, когда на конкретный соответствующий ген или транскрипт гена нацелен миметик миРНК, конкретный ген или транскрипт гена будет называться «ген-мишень». Предполагается, что на множество соответствующих генов может быть нацелен один или несколько различных миметиков миРНК. В конкретных вариантах осуществления в клетку вводится более чем одна терапевтическая нуклеиновая кислота. Более того, в других вариантах осуществления в клетку вводится более чем один миметик миРНК. Дополнительно, в клетку может быть введена комбинация терапевтических нуклеиновых кислот(ы). Авторы изобретения предполагают, что комбинация терапевтических нуклеиновых кислот может действовать в одной или нескольких точках в клеточных путях клеток и что такая комбинация может обладать повышенной эффективностью в отношении клетки-мишени без вредного воздействия на нормальные или нецелевые клетки. Таким образом, комбинация терапевтических нуклеиновых кислот может оказывать минимальное отрицательное воздействие на субъекта или пациента при обеспечении достаточного терапевтического эффекта, такого как улучшение состояния, увеличение ингибирования клетки, гибель целевой клетки, изменение клеточного фенотипа или физиологии, замедление клеточного роста, повышение чувствительности к терапии второй линии, повышение чувствительности к конкретной терапии, и тому подобное.

Способы включают идентификацию клетки или пациента, нуждающегося в индукции этих терапевтических эффектов или клеточных характеристик. Также, будет понятно, что количество терапевтической нуклеиновой кислоты, которое обеспечивается клетке или организму, представляет собой «эффективное количество», которое относится к количеству, необходимому (или достаточному количеству) для достижения требуемой цели, такой как индукция конкретного терапевтического эффекта или клеточных характеристик(и), или уменьшение роста злокачественной опухоли и уничтожение злокачественных клеток, или ослабление симптомов, связанных с раком.

В некоторых аспектах способы могут включать обеспечение или введение в клетку молекулы нуклеиновой кислоты, соответствующей зрелой миРНК в клетке, в количестве, эффективном для достижения требуемого физиологического результата. Кроме того, способы могут включать обеспечение множества синтетических терапевтических нуклеиновых кислот.Предполагается, что в этих вариантах осуществления способы могут или могут не ограничиваться обеспечением только одной или нескольких синтетических молекул. В этой ситуации клетка или клетки могут быть обеспечены синтетической молекулой, соответствующей конкретной миРНК, и синтетической молекулой, соответствующей другой миРНК. Кроме того, любой способ, изложенный с использованием перечня мишеней миРНК с использованием языка группы Маркуша, может быть изложен без языка группы Маркуша и разделительного артикля (т.е., или) вместо и наоборот.

В отдельных вариантах осуществления предложен способ уменьшения или ингибирования пролиферации клеток, размножения или обновления в клетке, включающий введение или обеспечение клетки эффективным количеством (i) терапевтической нуклеиновой кислоты или (ii) синтетической молекулы, которая соответствует последовательности миРНК. В некоторых вариантах осуществления способы включают введение в клетку эффективного количества (i) молекулы миметика миРНК, имеющей последовательность от 5' к 3', которая является по меньшей мере на 90% идентичной последовательности от 5' к 3' одной или нескольких зрелых миРНК.

Некоторые аспекты изобретения включают способы лечения патологического состояния, такого как рак или предраковые состояния. В одном аспекте способ включает приведение в контакт клетки-мишени с одной или несколькими нуклеиновыми кислотами, содержащими по меньшей мере один сегмент нуклеиновой кислоты, имеющий всю или часть последовательности миРНК или ее комплемента. Сегмент может представлять собой 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 или более нуклеотидов, или аналогов нуклеотидов, включая все целые числа в указанном диапазоне. Отдельные варианты осуществления включают модуляцию экспрессии генов, экспрессии или функции миРНК, или экспрессии или функции мРНК внутри клетки-мишени, такой как раковая клетка.

Как правило, эндогенный ген, миРНК или мРНК является модулированной в клетке. В некоторых аспектах последовательность терапевтической нуклеиновой кислоты содержит по меньшей мере один сегмент, который является по меньшей мере на 70, 75, 80, 85, 90, 95 или 100% идентичным по последовательности нуклеиновой кислоты одной или нескольким миРНК, или последовательности гена, или ее комплементу. Модуляция экспрессии или процессинг гена, миРНК или мРНК клетки или вируса может осуществляться посредством модуляции процессинга нуклеиновой кислоты, при этом такой процессинг включает транскрипцию, транспорт и/или трансляцию внутри клетки. Модуляцию можно также осуществить путем ингибирования или усиления активности миРНК в клетке, ткани или органе. Такой процессинг может влиять на экспрессию кодированного продукта или стабильность мРНК.

В способах изобретения будет понятно, что клетка или другой биологический материал, такой как организм (включая пациентов), может быть обеспечен терапевтической нуклеиновой кислотой, соответствующей или нацеливающей конкретную миРНК путем введения в клетку или организм молекулы нуклеиновой кислоты, которая действует как соответствующая миРНК после попадания внутрь клетки. Таким образом, предполагается, что нуклеиновая кислота обеспечивается таким образом, что она становится процессированной в зрелую и активную миРНК после получения доступа к клеточному механизму процессинга. В некоторых аспектах особо предполагается, что введенная молекула миРНК не является зрелой молекулой, а молекулой нуклеиновой кислоты, которая может быть процессирована в зрелую миРНК или ее функциональный эквивалент после получения доступа к механизму процессинга.

Термин «несинтетическая» в контексте миРНК означает, что миРНК не является «синтетической», как определено здесь. Кроме того, предполагается, что в вариантах осуществления изобретения, которые относятся к применению синтетических миРНК, применение соответствующих несинтетических миРНК также рассматривается как аспект изобретения, или наоборот.Будет понятно, что термин «обеспечение» агентом включает «введения» агента пациенту.

В некоторых вариантах осуществления способы также включают нацеливание миРНК в клетке или организме. Термин «соответствующая миРНК» означает, что нуклеиновая кислота будет применяться таким образом, чтобы имитировать (обеспечивать активность или функцию) выбранную миРНК. В отдельных вариантах осуществления регулирование достигается с помощью синтетической или несинтетической нуклеиновой кислоты, которая соответствует нацеленной миРНК, которая эффективно обеспечивает функцию нацеленной миРНК клетке или организму (положительное регулирование).

Кроме того, предполагается, что композиции нуклеиновой кислоты могут быть обеспечены как часть терапии пациенту в сочетании с общепринятыми терапиями или профилактическими средствами. Более того, предполагается, что любой способ, описанный в контексте терапии, может применяться превентивно, в частности у пациентов, которые были идентифицированы как возможно нуждающиеся в терапии или подверженные риску состояния или заболевания, для которого терапия является необходимой.

К тому же, способы по изобретению относятся к использованию одной или нескольких нуклеиновых кислот, соответствующих миРНК и терапевтическому лекарственному средству. Нуклеиновая кислота может усиливать действие или эффективность лекарственного средства, уменьшать любые побочные эффекты или токсичность, модифицировать его биодоступность, и/или снижать требуемую дозу или частоту введения. В некоторых вариантах осуществления терапевтическое лекарственное средство представляет собой терапевтическое средство против рака. Соответственно, в отдельных вариантах осуществления предложен способ лечения предракового состояния или рака у пациента, включающий введение пациенту терапевтического средства против рака (т.е. второго терапевтического средства) и эффективного количества по меньшей мере одной молекулы нуклеиновой кислоты, которая улучшает эффективность терапевтического средства против рака или защищает нераковые клетки. Терапии рака также включают разнообразные комбинированные терапии с обеими, химио- и лучевой терапиями.

В целом, миметики миРНК можно вводить для уменьшения активности нуклеиновой кислоты, нацеленной миРНК. Способы в целом включают обеспечение или введения одной или нескольких различных молекул нуклеиновой кислоты, соответствующих одному или нескольким различным генам. Предполагается, что следующее, по меньшей мере или самое большее из следующего числа различных молекул нуклеиновой кислоты или миРНК может быть обнаружено, оценено, обеспечено или введено: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 или более, включая любое значение или диапазон, который может быть получен на основе указанных значений.

III. Фармацевтические композиции и доставка

Способы включают доставку эффективного количества терапевтической нуклеиновой кислоты, содержащей или состоящей по существу из последовательности зрелой миРНК. «Эффективное количество» фармацевтической композиции, в целом, определено как такое количество, которое является достаточным для достижения определенного желаемого результата обнаруживаемым и многократным образом, например, для улучшения, уменьшения, сведения к минимуму или ограничения распространения заболевания или его симптомов. Могут применяться другие более строгие определения, включая элиминацию, уничтожение или устранение заболевания.

В некоторых вариантах осуществления желательно уничтожить клетки, ингибировать рост клеток, ингибировать метастазирование, уменьшить размер опухоли или ткани, и/или изменить в обратную сторону развитие, или уменьшить злокачественный или пораженный фенотип клеток. Способы введения будут изменяться, естественно, в зависимости от локализации и природы поражения или участка, подлежащего воздействию, и включают, например, внутрикожное, подкожное, регионарное, парентеральное, внутривенное, внутримышечное, интраназальное, системное и пероральное введение, и формулирование. Инъекция или перфузия терапевтической нуклеиновой кислоты особо предполагается для изолированных, солидных, доступных предраков или злокачественных опухолей, или других доступных целевых областей. Локальное, регионарное или системное введение также может быть подходящим.

В случае оперативного вмешательства настоящее изобретение может применяться до операции для подготовки субъекта с неоперабельным поражением к резекции. Альтернативно, настоящее изобретение может применяться во время операции и/или после нее для лечения остаточного или метастатического процесса. Например, в ложе резецированной опухоли может быть осуществлена инъекция или перфузия препарата, содержащего терапевтическую нуклеиновую кислоту, или их комбинация. Введение может быть продолжено после резекции, например, оставляя катетер, введенный в участок хирургического вмешательства. Кроме того, рассмотрено периодическое послеоперационное лечение. Кроме того, рассмотрена непрерывная перфузия нуклеиновой кислоты.

Кроме того, при необходимости, может применяться непрерывное введение, например, когда опухоль или другая нежелательная пораженная область оперативно удалена и ложе опухоли или целевой участок обрабатывается для устранения остаточного микроскопического процесса. Предусмотрена доставка через шприц или с помощью катеризации. Такая непрерывная перфузия может иметь место в течение периода примерно от 1-2 часов до примерно 2-6 часов, до примерно 6-12 часов, до примерно 12-24 часов, до примерно 1-2 дней, до примерно 1-2 недель или дольше после начала лечения. Обычно доза терапевтической композиции при непрерывной перфузии будет эквивалентна дозе, вводимой путем одной или множественных инъекций, с учетом периода времени, в течение которого происходит перфузия.

Схемы лечения также могут изменяться и часто зависят от типа и/или локализации поражения, целевого участка, прогрессирования заболевания и состояния здоровья, состояния иммунной системы и возраста пациента. Для некоторых типов опухолей будет требоваться более агрессивное лечение. Клиницист будет лучше всего подходящим для принятия таких решений на основе известной эффективности и токсичности (в случае наличия) терапевтических композиций.

В некоторых вариантах поражение или пораженная область, подвергающаяся лечению, может не являться, по меньшей мере сначала, резектабельной. Терапии композициями изобретения могут повышать резектабельность поражения благодаря уменьшению размеров по краям или путем устранения некоторых особенно инвазивных участков. После терапий резекция может быть возможной. Дополнительные терапии после резекции могут служить для устранения микроскопического остаточного состояния в опухоли или целевом участке.

Терапии могут включать различные «стандартные дозы». Стандартная доза определена как содержащая предварительно установленное количество терапевтической композиции(й). Количество, подлежащее введению, а также конкретный способ введения и препарат находятся в компетенции специалистов в данной области. Стандартная доза необязательно вводится в виде однократной инъекции и может включать непрерывную инфузию в течение установленного периода времени. В целях удобства стандартная доза может быть описана в единицах измерения нг, мкг или мг миРНК или миметика миРНК. Альтернативно, указанное количество может представлять собой количество, вводимое как среднесуточная, средняя недельная или среднемесячная доза.

Терапевтическую нуклеиновую кислоту можно вводить пациенту в дозе или в дозах, которые составляют примерно или по меньшей мере примерно 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 нг, мкг или мг, или более, или любой диапазон, который может быть получен на основе указанных значений. Альтернативно, указанное количество может представлять собой количество, вводимое в виде среднесуточной, средней недельной или среднемесячной дозы, или может быть выражено в единицах измерения мг/кг, где кг относится к массе тела пациента и мг определено выше. В других вариантах осуществления указанное количество представляет собой любое число, описанное выше, но выраженное как мг/м (в отношении размера опухоли или площади поверхности тела пациента). В отдельных вариантах осуществления доза или схема лечения может вводиться каждые 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 часов и/или 1, 2, 3, 4, 5, 6, 7 день(дней), и/или 1, 2, 3, 4 недель, и в любом диапазоне, который может быть получен на основе указанных значений, пациенту, нуждающемуся в лечении.

В отдельных вариантах осуществления способ доставки терапевтической нуклеиновой кислоты представляет собой местное или системное введение. Однако, фармацевтические композиции, раскрытые здесь, можно также вводить парентерально, подкожно, интратрахеально, внутривенно, внутрикожно, внутримышечно или даже интраперитонеально, как описано в патентах США №№5543158; 5641515 и 5399363 (каждый из которых включен в настоящее описание путем отсылки в полном объеме).

Инъекция нуклеиновых кислот может быть доставлена с помощью шприца или любым другим способом, используемым для инъекции раствора, при условии, что нуклеиновая кислота и любые сопутствующие компоненты могут проходить через иглу конкретного размера, требуемую для инъекции. Шприцевая система также была описана для применения в генной терапии, которая допускает множественные инъекции предварительно установленных количеств раствора точно на любую глубину (патент США №5846225).

Растворы активных соединений в виде свободного основания или фармацевтически приемлемых солей могут быть приготовлены в воде, подходящим образом смешанной с поверхностно-активным веществом, таким как гидроксипропилцеллюлоза. Дисперсии могут быть также приготовлены в глицерине, жидких полиэтиленгликолях, и их смесях и в маслах. В обычных условиях хранения и применения эти композиции содержат консервант для предупреждения роста микроорганизмов. Фармацевтические формы, подходящие для применения путем инъекции, включают стерильные водные растворы или дисперсии и стерильные порошки для экстемпорального приготовления стерильных инъекционных растворов или дисперсий (патент США №5466468, специально включенный в настоящее описание во всей своей полноте путем отсылки). Как правило, форма должна быть стерильной и должна быть жидкой в такой степени, чтобы ее можно было легко вводить с помощью шприца. Она должна быть стабильной в условиях изготовления и хранения, и должна быть защищена от контаминации микроорганизмами, такими как бактерии или грибы. Носитель может представлять собой растворитель или дисперсионную среду, содержащую, например, воду, этанол, полиол (например, глицерин, полиэтиленгликоль и жидкий полиэтиленгликоль, и тому подобное), их подходящие смеси, и/или растительные масла. Надлежащая текучесть может поддерживаться, например, путем применения покрытия, такого как лецитин, путем поддержания необходимого размера частиц в случае дисперсии и путем использования поверхностно-активных веществ. Воздействие микроорганизмов можно предотвратить путем использования различных антибактериальных и противогрибковых агентов, например парабенов, хлорбутанола, фенола, сорбиновой кислоты, тимеросала и тому подобного. Во многих случаях предпочтительным будет включение изотонических агентов, например, сахара или хлорида натрия. Пролонгированное всасывание инъецируемых композиций можно осуществить путем использования в композициях агентов, замедляющих всасывание, например моностеарата алюминия или желатина.

В некоторых препаратах используются композиции на водной основе, тогда как в других композиции могут быть на основе липидов. В конкретных вариантах осуществления изобретения композиция, содержащая нуклеиновую кислоту по изобретению, представляет собой композицию на водной основе. В других вариантах осуществления препарат имеет липидную основу.

Для парентерального введения в водном растворе, например, раствор должен быть, при необходимости, соответствующим образом забуферен и предпочтительно жидкий разбавитель должен быть приготовлен изотоническим с использованием достаточного количества физиологического раствора или глюкозы. Такие специфические водные растворы особенно подходят для внутривенного, внутримышечного, подкожного, внутриопухолевого, внутриочагового и интраперитонеального введения. В связи с этим в свете настоящего описания специалистам в данной области будет известна стерильная водная среда, которая может быть использована. Например, одну из дозировок можно растворить в 1 мл изотонического раствора NaCl и либо добавить к 1000 мл жидкости для введения в подкожную клетчатку, либо инъецировать в предполагаемое место инфузии (см., например, "Remington's Pharmaceutical Sciences" 15-е Издание, страницы 1035-1038 и 1570-1580). Обязательно будет иметь место некоторая вариация в дозировке в зависимости от состояния субъекта, получающего лечение. Лицо, ответственное за введение, в любом случае будет определять соответствующую дозу для индивидуального субъекта. Более того, для введения человеку препараты должны удовлетворять стандартам стерильности, пирогенности, общей безопасности и чистоты в соответствии с требованиями FDA (Управление по контролю за качеством пищевых продуктов, медикаментов и косметических средств) на основании стандартов для биопрепаратов.

Используемый в настоящем описании термин «носитель» включает каждый и все растворители, дисперсионную среду, наполнители, покрытия, разбавители, антибактериальные и противогрибковые средства, изотонические и замедляющие всасывание агенты, буферы, растворы-носители, суспензии, коллоиды и тому подобное. Применение таких сред и агентов для фармацевтически активных веществ хорошо известно в данной области. В терапевтических композициях предусматривается применение обычных сред или агентов, за исключением случаев, когда они не совместимы с активным ингредиентом. В композиции могут быть также включены дополнительные активные ингредиенты.

Фраза «фармацевтически приемлемый» относится к молекулярным структурам и композициям, которые не дают аллергической или подобной неблагоприятной реакции при введении человеку.

Нуклеиновую кислоту(ы) вводят способом, совместимым с дозированной лекарственной формой, и в таком количестве, которое будет терапевтически эффективным. Подлежащее введению количество зависит от подлежащего лечению субъекта, включая, например, агрессивность заболевания или рака, размер любой опухоли(ей) или поражений, предшествующие или другие курсы лечения. Точные количества активного ингредиента, требующиеся для введения, зависят от заключения лечащего врача. Пригодные схемы для начального введения и последующего введения также являются изменчивыми, но должны быть типизированы путем начального введения с последующими другими введениями. Такое введение может быть системным, в виде однократной дозы, непрерывным в течение периода времени в 10, 20, 30, 40, 50, 60 минут и/или 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или более часов, и/или 1, 2, 3, 4, 5, 6, 7 дней, или более. Более того, введение может быть посредством механизма медленного высвобождения или пролонгированного высвобождения, реализуемого препаратом и/или способом введения.

Другие пригодные системы доставки включают, но без ограничения, системы с замедленным, отсроченным, пролонгированным или контролируемым высвобождением. Такие системы позволяют избежать повторных введений во многих случаях, являясь более удобными для субъекта и лечащего врача. Существует много типов систем доставки, известных специалистам в данной области. Указанные системы включают, например, системы на полимерной основе, такие как полимолочная и/или полигликолевая кислоты, полиангидриды, поликапролактоны, сополиоксалаты, полиэфирамиды, полиортоэфиры, полигидроксимасляная кислота, и/или их комбинации. Микрокапсулы из указанных выше полимеров, содержащие нуклеиновые кислоты, описаны, например, в патенте США №5075109. Другие примеры включают неполимерные системы, которые представляют собой липиды, включающие стерины, такие как холестерин, сложные эфиры холестерина и жирные кислоты или нейтральные жиры, такие как моно-, ди- или триглицериды; гидрогелевые системы; системы на основе липосом; системы на основе фосфолипидов; силастиковые системы; пептидные системы; покрытия из воска; прессованные таблетки, полученные с использованием обычных связывающих веществ и наполнителей; или частично конденсированные имплантаты. Типичные примеры включают, но без ограничения, разрушаемые системы, в которых молекула РНК находится внутри матрицы (например, аналогичные описанным в патентах США №№4452775, 4675189, 5736152, 4667013, 4748034 и 5239660, которые включены в настоящий документ посредством отсылки), или диффузионные системы, в которых активный компонент проникает с регулируемой скоростью из полимера (например, аналогичные описанным в патентах США №№3832253, 3854480, 5133974 и 5407686, которые включены здесь посредством отсылки). Препарат может представлять собой, например, микросферы, гидрогели, полимерные резервуары, холестериновые матрицы или полимерные системы. В отдельных вариантах осуществления система может обеспечивать замедленное или контролируемое высвобождение композиции, например, посредством контроля скорости диффузии или разрушения/разложения препарата, содержащего молекулы РНК. Кроме того, система доставки на основе насосной системы может быть использована для доставки одного или нескольких вариантов осуществления.

Примеры систем, в которых высвобождение возникает импульсами, включают, например, системы, в которых композиция захватывается в липосомы, которые инкапсулированы в полимерной матрице, при этом липосомы являются чувствительными к определенному стимулу, например, температуре, рН, свету или разрушающему ферменту, и системы, в которых композиция инкапсулирована в микрокапсулах с ионным покрытием с разрушающим ядро микрокапсулы ферментом. Примерами систем, в которых высвобождение ингибитора является постепенным и непрерывным, являются, например, эродируемые системы, в которых композиция содержится в форме внутри матрицы, и диффузионные системы, в которых композиция проникает с контролируемой скоростью, например, через полимер. Такие системы с замедленным высвобождением могут быть, например, в форме гранул или капсул.

Композиции и способы могут применяться для усиления доставки молекул РНК (смотри Shim и Kwon (2010), который включен в настоящий документ посредством отсылки для обзора). Композиции и способы для усиленной доставки могут обеспечивать достаточную доставку посредством циркуляции, соответствующего биораспределения, достаточного клеточного транспорта, достаточной внутриклеточной обработки и тому подобного. Препараты и композиции могут включать, но без ограничения, одну или несколько химических модификаций молекул РНК, введение молекулы РНК или предшественников РНК в вирусный или невирусный вектор, направленной доставки молекулы РНК и/или связывание молекул РНК с усилителем клеточной доставки.

В некоторых аспектах химически модифицированные молекулы РНК могут включать, с химическими модификациями, описанными выше, или без них, конъюгирование молекулы РНК с молекулой носителя. В некоторых аспектах молекула носителя представляет собой природный или синтетический полимер. Например, молекула носителя может представлять собой холестерин или аптамер РНК, и тому подобное. Молекула носителя может быть конъюгирована с молекулами РНК на 5'- и/или 3'-конце активной цепи или цепи-«пассажира», или на внутреннем положении нуклеотида. Носитель может быть конъюгирован с любой цепью молекул РНК.

В дополнительном аспекте одна или две цепи молекулы РНК могут быть кодированы или доставлены с помощью вирусного вектора. Различные вирусные векторы, известные в данной области, могут быть модифицированы для того, чтобы экспрессировать или нести молекулу РНК в клетку-мишень, например, вирус простого герпеса 1 типа или лентивирусные векторы использовали для усиления доставки siPHK.

В еще одном аспекте молекула РНК может быть ассоциирована с невирусным вектором. Невирусные векторы могут быть связаны с направляющими или усиливающими доставку фрагментами, такими как антитела, различные полимеры (например, PEG), фузогенные пептиды, линкеры, проникающие в клетку пептиды и тому подобное. Невирусные векторы включают, но без ограничения, липосомы и липоплексы, полимеры и пептиды, синтетические частицы и тому подобное. В некоторых аспектах липосома или липоплекс имеет нейтральный, отрицательный или положительный заряд и может включать кардиолипин, анизамид, конъюгированный с полиэтиленгликолем, диолеоилфосфатидилхолин или различные другие нейтральные, анионные или катионные липиды, или липидные конъюгаты. siPHK могут образовывать комплексы с катионными полимерами (например, полиэтиленимином (PEI)), биоразлагаемым катионным полисахаридом (например, хитозаном) или катионными полипептидами (например, ателоколлагеном, полилизином и протамином).

В некоторых аспектах доставка РНК может быть усилена путем нацеливания РНК на клетку. Нацеливающие фрагменты могут быть конъюгированы с различными доставляющими композициями и обеспечивать селективное или специфическое связывание с клеткой(ами)-мишенью(ями). Нацеливающие фрагменты могут включать, но без ограничения, фрагменты, которые связываются с рецепторами на клеточной поверхности, клеточно-специфическим внеклеточным полипептидом, сахаридами или липидами, и тому подобное. Например, малые молекулы, такие как фолат, пептиды, такие как содержащие RGD пептиды, и антитела, такие как антитела к рецепторам эпидермального фактора роста, могут применяться для нацеливания на специфические типы клеток.

В еще одном аспекте доставка может быть усилена фрагментами, которые взаимодействуют с клеточными механизмами и механизмом, таким как захват и внутриклеточный трафик. В некоторых аспектах проникающие в клетку пептиды (СРР) (например, ТАТ и MPG вируса иммунодефецита человека 1 (HIV-1)), пенетратин, полиаргинин, могут связываться с siPHK или доставляющим вектором для усиления доставки в клетку. Фузогенные пептиды (например, эндодоменные производные оболочки HIV-1 (HGP) или фузогенный пептид вируса гриппа (diINF-7)) также могут применяться для усиления клеточной доставки.

Различные системы доставки, такие как холестерин-siPHK, РНК аптамеры-siPHK, аденовирусный вектор, лентивирусный вектор, стабильные частицы, состоящие из нуклеиновых кислот и липидов (SNALP), липосома на основе аналога кардиолипина, липосома DSPE-полиэтиленгликоль-DOTAP-холестерин, липосома гиалуронан-DPPE, липосома, содержащая нейтральный липид DOPC, ателоколлаген, хитозан, полиэтиленимин, полилизин, протамин, RGD-полиэтиленгликоль-полиэтиленимин, липосома к HER-2 с пептидом гистидин-лизин, антитело к ВИЧ-протамин, аргинин, водорастворимый липополимер, конъюгированный с олигоаргинином (9R) (WSLP), олигоаргинин (15R), ТАТ-РАМАМ, холестерин-MPG-8, DOPE-катионная липосома, пептид GALA-PEG-расщепляемый ММР-2 пептид-DOPE и им подобные использовали для усиления доставки siPHK.

Предполагается, что оптимальный терапевтический диапазон доз для миметиков миРНК у раковых пациентов составляет 0.01-5.0 мг миРНК на кг массы тела пациента (мг/кг). В отдельных вариантах осуществления предполагается, что примерно, не менее чем примерно или не более чем примерно 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7. 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0 мг молекулы РНК, или любой диапазон, который может быть получен на основе указанных значений, может быть формулирован в композицию и/или введен пациенту. В отдельных вариантах осуществления пациенту может быть введено 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7. 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0 мг/кг молекулы РНК, или любой диапазон, который может быть получен на основе указанных значений, на дозу или схему введения, которые можно вводить каждые 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 часа, и/или 1, 2, 3, 4, 5, 6, 7 день(дней), и/или 1, 2, 3, 4 недели, или любой диапазон, который может быть получен на основе указанных значений.

Инъекции могут быть внутривенными (IV), интраперитонеальными (IP), внутримышечными (IM), внутриопухолевыми (IT), внутритрахеальными (для легочной доставки), интравитреальными (для заболеваний глаз) или подкожными, все из которых были определены как эффективные в качестве способа доставки молекул РНК, описанных здесь. Несколько методик доставки особо рассмотрены, включая, но без ограничения, эмульсию нейтрального липида (NLE), ателоколлаген, SNALP, DiLA и циклодекстрин, которые описаны более подробно ниже.

Эмульсии нейтрального липида (NLE) представляют собой коллекцию препаратов, которые объединяют нейтральный липид, масло и эмульгатор с миметиком миРНК для получения комплексов, которые способны доставлять миРНК в опухоли и другие ткани после внутривенной (IV) инъекции. Один такой препарат объединяет 1,2-диолеоил-sn-глицеро-3-фосфохолин (DOPC), сквален, Полисорбат 20 (Твин-20) и аскорбиновую кислоту в соотношении 1:2.6:53.4:0.1 (масса/масса). Компоненты NLE смешивают в растворителе подобном хлороформу, и затем растворитель удаляют с использованием роторного выпаривателя, получая в результате вязкий раствор. Миметик миРНК, растворенный в PBS, добавляют в соотношении 1:2 (масса/масса) в DOPC. В некоторых вариантах осуществления соотношение молекулы РНК к DOPC составляет примерно, не меньше чем примерно, или не больше чем примерно 0.1:1, 0:2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4; 1:0.3, 1:0.2, 1:0.1, или любой диапазон, который может быть получен на основе указанных значений. Обработка ультразвуком позволяет получить частицы + миРНК, которые могут быть инъецированы IV в дозе приблизительно 0.01-1 мг/кг человеку. В некоторых вариантах осуществления указанный препарат обеспечивается пациенту в количествах 0.005, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7. 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0 мг/кг на дозу или схему введения, которые могут вводиться каждые 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 часа, и/или 1, 2, 3, 4, 5, 6, 7 день(дней), и/или 1, 2, 3, 4 недели, или в любом диапазоне, который может быть получен на основе указанных значений.

Комплексы ателоколлаген/миРНК готовят путем смешивания равных объемов ателоколлагена (0.1% в PBS при рН 7.4) (Koken Co., Ltd.; Tokyo, Japan) и раствора миРНК (20 мкМ миРНК) и вращения смесей в течение 1 ч при 4°С. Полученные комплексы миРНК/ателоколлаген разбавляют в PBS до конечной концентрации ателоколлагена 0.05%. В некоторых вариантах осуществления конечная процентная концентрация ателоколлагена составляет примерно, примерно не менее чем, или примерно не более чем 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.11%, 0.10%, 0.11%, 0.12%, 0.13, 0.14%, 0.15%, 0.16%), 0.17%, 0.18%, 0.19%, 0.20%, или любой диапазон, который может быть получен на основе указанных значений.

SNALP разделяет на категории коллекцию препаратов, разработанных Tekmira Pharmaceutical Corp. (Burnaby, ВС, CA) для системной доставки нуклеиновых кислот. Наиболее часто публикуемый препарат содержит липиды 3-N-[(кметоксиполи(этиленгликоль)2000)карбамоил]-1,2-димиристилокси-пропиламин (PEG-C-DMA), 1,2-дилинолилокси-N,N-диметил-3-аминопропан (DLinDMA), 1,2-дистеароил-sn-глицеро-3-фосфохолин (DSPC) и холестерин в молярном процентном соотношении 2:40:10:48. Липидный препарат смешивают с siPHK/miPHK и получают частицы с использованием метода разведения этанолом (Jeffs 2005, который включен в настоящий документ посредством отсылки). В отдельных вариантах осуществления соотношение липида к нуклеиновой кислоте (масса/масса) составляет, составляет не менее чем, или составляет не более чем, примерно 0.001:1, 0.002:1, 0.003:1, 0.004:1, 0.005:1, 0.006:1, 0.007:1, 0.008:1, 0.009:1, 0.01:1, 0.02:1, 0.03:1, 0.04:1, 0.05:1, 0.06:1, 0.07:1, 0.08:1, 0.09:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4; 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1:0.06, 1:0.05, 1:0.04, 1:0.03, 1:0.02, 1:0.01, 1:0.009, 1:0.008, 1:0.007, 1:0.006, 1:0.005, 1:0.004, 1:0.003, 1:0.002, 1:0.001, или любой диапазон, который может быть получен на основе указанных значений.

Tekmira заявляет о достижении более чем 90% эффективности инкапсулирования. Размеры частиц составляют приблизительно 110 нм.

DiLA2 описывает группу различных препаратов, разработанных Marina Biotech Inc. (Bothell, Wash., USA) для системной доставки малых dsPHK. Один препарат объединяет C18:1-norArg-NH3C1-C16, холестерин гемисукцинат (CHEMS, Anatrace, СН210), холестерол (Anatrace СН200) и DMPE-PEG2k (Genzyme) в соотношениях 50:28:20:2 (масс/масса). Малая dsPHK объединена с липидным препаратом в соотношении РНК:липид от 1.7:1 до 5:1 (масса/масса). В отдельных вариантах осуществления соотношение РНК:липид составляет примерно, составляет не менее чем примерно, или не более чем примерно 0.001:1, 0.002:1, 0.003:1, 0.004:1, 0.005:1, 0.006:1, 0.007:1, 0.008:1, 0.009:1, 0.01:1, 0.02:1, 0.03:1, 0.04:1, 0.05:1, 0.06:1, 0.07:1, 0.08:1, 0.09:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4; 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1:0.06, 1:0.05, 1:0.04, 1:0.03, 1:0.02, 1:0.01, 1:0.009, 1:0.008, 1:0.007, 1:0.006, 1:0.005, 1:0.004, 1:0.003, 1:0.002, 1:0.001, или любой диапазон, который может быть получен на основе указанных значений. Два компонента смешивают посредством сталкивающихся потоков и инкубируют в течение 1 часа для получения стабильных частиц с диаметрами приблизительно 125 нм.

Calando Pharmaceuticals, Inc. (Pasadena, CA, USA) разработала доставляющую платформу, называемую RONDEL™, которая представляет собой частицы на основе циклодекстрина. Поликатионы циклодекстрина (CDP) смешивают с конъюгатом адамантан-PEG5000 (AD-PEG) в соотношении 1:1 AD:CDP (моль/моль) (Hu-Lieskovan 2005, который включен в настоящий документ посредством отсылки). Модифицированный трансферрином AD-PEG (AD-PEG-трансферрин) может быть добавлен в соотношении 1:1,000 AD-PEG-трансферрин:AD-PEG (масса/масса) для обеспечения нацеливающего фрагмента для улучшения доставки в раковые клетки с повышенными уровнями трансферрина. Смесь добавляли в равный объем молекулы РНК при соотношении зарядов (положительные заряды CDP к отрицательным зарядам остова миРНК) 3:1 (+/-). В некоторых вариантах осуществления соотношение зарядов между смесью и молекулами РНК составляет примерно, не менее чем примерно, или не более чем примерно 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, или любой диапазон, который может быть получен на основе указанных значений. Равный объем, равный 10% (масса/объем), глюкозы в воде добавляют в полученные полиплексы с получением подходящего для инъекции конечного препарата полиплекса в 5% (масса/объем) глюкозе (D5W).

В отдельных вариантах осуществления частицы применяются для доставки терапевтической нуклеиновой кислоты. В отдельных вариантах осуществления размер частиц составляет примерно, не менее чем примерно, или не более чем примерно 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250 нм, или любой диапазон, который может быть получен на основе указанных значений.

А. Комбинированные терапии

В некоторых вариантах осуществления композиции и способы включают терапевтическую нуклеиновую кислоту. Эти композиции могут применяться в комбинации со второй терапией для усиления эффекта терапии миРНК, или увеличения терапевтического действия другой используемой терапии. Эти композиции будут обеспечены в объединенном количестве, эффективном для достижения требуемого эффекта, такого как уничтожение раковых клеток и/или ингибирования клеточной гиперпролиферации. Этот способ может включать приведение в контакт клеток с терапевтической нуклеиновой кислотой или вторую терапию в одно и то же или разное время. Это может быть достигнуто путем приведения в контакт клетки с одной или несколькими композициями или фармакологическими препаратами, которые включают один или несколько из агентов, или путем приведения в контакт клетки с двумя или более различными композициями или препаратами, при этом одна композиция обеспечивает (1) терапевтическую нуклеиновую кислоту; и/или (2) вторую терапию. Может быть введена вторая композиция или способ, который включает химиотерапию, лучевую терапию, операционную терапию, иммунотерапию или генную терапию.

Предполагается, что пациент может быть обеспечен терапией миРНК и второй терапией в течение примерно 12-24 ч каждой и, более предпочтительно, в течение примерно 6-12 ч каждой. В отдельных ситуациях желательно значительно расширить период времени лечения, однако тогда, когда между соответствующими введениями проходит от нескольких дней (2, 3, 4, 5, 6 или 7) до нескольких недель (1, 2, 3, 4, 5, 6, 7 или 8).

В некоторых вариантах осуществления курс терапии будет продолжаться 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 дней или более. Предполагается, что один агент может быть введен на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 и/или 90 день, любую их комбинацию, или другой агент вводится на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 и/или 90 день, или любую их комбинацию. В течение одного дня (24-часовой период) пациенту можно производить одно или множество введений агента(ов). Более того, после курса терапии предполагается, что существует период времени, в течение которого лечение не проводится. Этот период времени может продолжаться 1, 2, 3, 4, 5, 6, 7 дней и/или 1, 2, 3, 4, 5 недель, и/или 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев, или дольше в зависимости от состояния пациента, например, его прогноза, силы, состояния здоровья и т.д.

Введение любого соединения или терапии по настоящему изобретению пациенту будет следовать общим протоколам введения таких соединений с учетом токсичности, в случае присутствия, вектора или любого белка, или другого агента. Следовательно, в отдельных вариантах осуществления имеется стадия контроля токсичности, которая присуща комбинированной терапии. Ожидается, что циклы терапии будут повторяться при необходимости. Также предполагается, что различные стандартные терапии, а также хирургическое вмешательство, может применяться в комбинации с описанной терапией.

В определенных аспектах предполагается, что вторая терапия, такая как химиотерапия, радиационная терапия, иммунотерапия, операционная терапия или другая генная терапия используется в комбинации с терапией миРНК, как описано в настоящем документе.

Примеры химиотерапевтических агентов включают алкилирующие агенты, такие как тиотепа и циклофосфамид; алкилсульфонаты, такие как бусульфан, импросульфан и пипосульфан; азиридины, такие как бензодопа, карбоквон, метуредопа и уредопа; этиленимины и метиламеламины, включая алтретамин, триэтиленмеламин, триэтиленфосфорамид, триэтиленфосфорамид, триэтилентиофосфорамид и триметилоломеламин; ацетогенины (в частности, буллатацин и буллатацинон); камптотецин (в том числе синтетический аналог топотекан); бриостатин; каллистатин; СС-1065 (в том числе его синтетические аналоги адозелезин, карзелезин и бизелезин); криптофицины (в частности, криптофицин 1 и криптофицин 8); доластатин; дуокармуцин (в том числе синтетические аналоги KW-2189 и СВ1-ТМ1); элеутеробин; панкратистатин; саркодиктиин; спонгистатин; азотные аналоги иприта, такие как хлорамбуцил, хлорнафазин, хлорфосфамид, эстрамустин, ифосфамид, мехлоретамин, гидрохлорид мехлоретаминоксида, мелфалан, новэмбихин, фенестерин, преднимустин, трофосфамид, урамустин; нитрозомочевины, такие как кармустин, хлорозотоцин, фотемустин, ломустин, нимустин и ранимустин; антибиотики, такие как энедииновые антибиотики {например, калихеамицин, в частности калихеамицин-гамма II и калихеамицин омега II; динемицин, в том числе динемицин А; бифосфонаты, такие как клодронат; эсперамицин; а также неокарциностатиновый хромофор и родственные хромофоры хромопротеиновых энедииновых антибиотиков, алкациномизины, актиномицин, аутрамицин, азасерин, блеомицины, кактиномицин, карабицин, карминомицин, карцинофиллин, хромомицины, дактиномицин, даунорубицин, деторубицин, 6-диазо-5-оксо-L-норлейцин, доксорубицин (включая мофолинодоксорубицин, цианоморфолинодоксорубицин, 2-пирролинодоксорубицин и дезоксидоксорубицин), эпирубицин, эзорубицин, идарубицин, марселломицин, митомицины, такие как митомицин С, микофеноловую кислоту, ногаламицин, оливомицины, пепломицин, потфиромицин, пуромицин, квеламицин, родорубицин, стрептонигрин, стрептозоцин, туберцидин, убенимекс, зиностатин, зорубицин; антиметаболиты, такие как метотрексат и 5-фторурацил (5-FU); аналоги фолиевой кислоты, такие как деноптерин, метотрексат, птероптерин, триметотрексат; пуриновые аналоги, такие как флударабин, 6-меркаптопурин, тиамиприн, тиогуанин; пиримидиновые аналоги, такие как анцитабин, азацитидин, 6-азауридин, кармофур, цитарабин, дидезоксиуридин, доксифлуридин, эноцитабин, флоксуридин; андрогены, такие как калустерон, дромостанолона пропионат, эпитиостанол, мепитиостан, тестолактон; антиадреналин, такие как аминоглютетимид, митотан, трилостан; наполнители фолиевой кислоты, такие как фролиновая кислота; ацеглатон; альдофосфамидгликозид; аминолевулиновую кислоту; энилурацил; амсакрин; бестрабуцил; бисантрен; эдатраксат; дефофамин; демеколцин; диазиквон; элформитин; эллиптиния ацетат; эпотилон; этоглуцид; галлия нитрат; гидроксимочевину; лентинан; лонидаинин; майтансиноиды, такие как майтансин и ансамитоцины; митогуазон; митоксантрон; мопиданмол; нитраэрин; пентостатин; фенамет; пирарубицин; лозоксантрон; подофиллиновую кислоту; 2-этилгидразид; прокарбазин; PSK полисахаридный комплекс; разоксан; ризоксин; сизофуран; спирогерманий; тенуазоновую кислоту; триазиквон; 2,2',2"-трихлортриэтиламин; трихотецены (в частности, токсин Т-2, верракурин А, роридин А и ангуидин); уретан; виндесин; дакарбазин; манномустин; митобронитол; митолактол; пипоброман; гацитозин; арабинозид («Ara-С»); циклофосфамид; тиотепа; таксоиды, например, паклитаксел и доксетаксел; хлоранбуцил; гемцитабин; 6-тиогуанин; меркаптопурин; метотрексат; координационные платиновые комплексы, такие как цисплатин, оксаплатин и карбоплатин; винбластин; платину; этопозид (VP-16); ифосфамид; митоксантрон; винкристин; винорелбин; новантрон; тенипозид; эдатрексат; дауномицин; аминоптерин; кселода; ибандронат, иринотекан (например, СРТ-11); ингибитор топоизомеразы RFS 2000; дифторметилорнитин (DMFO); ретиноиды, такие как ретиноевая кислота; капецитабин; и фармацевтически приемлемые соли, кислоты или производные любого из указанных выше.

Лучевая терапия, также называемая как радиотерапия, представляет собой лечение рака и других заболеваний ионизирующим излучением. Ионизирующее излучение выделяет энергию, которая повреждает или разрушает клетки в области, которая подвергается воздействию посредством повреждения их генетического материала, делая невозможным для данных клеток продолжать рост и деление. Несмотря на то, что радиация повреждает как раковые, так и нормальные клетки, последние могут восстановиться самостоятельно и правильно функционировать. Лучевую терапию может использоваться для лечения локализованных солидных опухолей, таких как рак кожи, языка, гортани, мозга, молочной железы или шейки матки. Лучевую терапию также можно использовать для лечения лейкемии и лимфомы (злокачественные заболевания соответственно кроветворных клеток и лимфатической системы).

Лучевая терапия, применяющаяся согласно настоящему изобретению, может включать, но без ограничения, применение гамма-излучения, рентгеновского излучения и/или направленную доставку радиоактивных изотопов к клеткам опухоли. Рассматриваются также другие формы агентов, повреждающих ДНК, такие как микроволны, протонное излучение (патенты США №№5760395 и 4870287) и ультрафиолетовое излучение. Наиболее вероятно, что указанные факторы воздействуют на большой диапазон повреждений ДНК, на предшественники ДНК, на репликацию и восстановление ДНК, а также на сборку и поддержание целостности хромосом. Диапазоны дозирования рентгеновских лучей варьируют от дневных доз до 50-200 рентген в течение длительного периода времени (от 3 до 4 недель) до однократных доз, включающих от 2000 до 6000 рентген. Диапазоны дозирования радиоактивных изотопов широко варьируют и зависят от периода полураспада изотопа, мощности и типа излучения, а также от их поглощения клетками неоплазм. Радиационная терапия может включать использование меченных радиоактивными метками антител для доставки доз излучения непосредственно в участки опухоли (радиоиммунотерапия). После введения в организм антитела активно ищут раковые клетки, которые разрушаются убивающим клетки (цитотоксическим) действием излучения. Этот подход может свести к минимуму риск радиационного повреждения здоровых клеток.

Стереотаксическая радиохирургия (гамма-нож) для мозга и других опухолей не использует нож, но очень точно нацеливает пучки гамма излучения из сотни различных углов. Требуется только один сеанс лучевой терапии, составляющий примерно от четырех до пяти часов. Для этой терапии к голове прикрепляют специально изготовленную металлическую рамку. Затем проводят несколько сканирований и облучений рентгеновскими лучами для нахождения точной области, в которой требуется лечение. Во время лучевой терапии опухолей мозга пациент находится в положении лежа в большом шлеме на голове, в котором имеются сотни отверстий для прохождения через них пучков излучения. Родственные подходы допускают расположение для лечения опухолей в других областях тела.

В контексте лечения рака иммунотерапевтические средства в целом основаны на применении иммунных эффекторных клеток и молекул для нацеливания и разрушения злокачественных клеток. Трастузумаб (Herceptin®) служит таким примером. Иммунным эффектором может быть, например, антитело, специфическое для какого-либо маркера на поверхности опухолевой клетки. Антитело может само служить в качестве эффектора терапии или оно может рекрутировать другие клетки для фактического осуществления лизиса клеток. Антитело может быть также конъюгировано с лекарственным средством или токсином (химиотерапевтическим агентом, радионуклидом, A-цепью рицина, холерным токсином, коклюшным токсином и т.д.) и служит лишь в качестве нацеливающего агента. Альтернативно, эффектором может быть лимфоцит, несущий поверхностную молекулу, которая взаимодействует, прямо или опосредованно с опухолевой клеткой-мишенью. Различные эффекторные клетки включают в себя цитотоксические Т-клетки и NK-клетки. Комбинирование терапевтических способов воздействия, т.е. нацеливание цитотоксической активности и ингибирование или уменьшение ErbB2 будет обеспечивать благоприятный терапевтический эффект в лечении видов рака, сверхэкспрессирующих ErbB2.

В одном аспекте иммунотерапии опухолевая или больная клетка должна нести какой-либо маркер, который доступен для нацеливания, т.е. не присутствует на большинстве других клеток. Существуют многие опухолевые маркеры, и любые из них могут быть пригодными для нацеливания в контексте настоящего изобретения. Чаще всего используемые опухолевые маркеры включают в себя карциноэмбриональный антиген, антиген, специфичный для предстательной железы, антиген, ассоциированный с опухолью мочевого тракта, фетальный антиген, тирозиназу (р97), gp68, TAG-72, HMFG, сиалильный антиген Льюиса, MucA, MucB, PLAP, рецептор эстрогена, рецептор ламинина, erb В и р155. Альтернативным аспектом иммунотерапии является комбинирование противораковых эффектов с иммунными стимуляторными эффектами. Однако существуют также другие иммуностимулирующие молекулы, в том числе: цитокины, такие как IL-2, IL-4, IL-12, GM-CSF, гамма-интерферон (IFN), хемокины, такие как MIP-1, МСР-1, IL-8, и факторы роста, такие как FLT3-лиганд. Было показано, что комбинирование иммуностимулирующих молекул либо в виде белков, либо с использованием доставки генов в комбинации с опухолевым супрессором, таким как MDA-7, усиливает противоопухолевые действия (Ju et al., 2000). Более того, антитела против любого из этих соединений могут быть использованы для нацеливания противораковых агентов, описанных здесь.

Примерами иммунотерапий, применяющихся в настоящее время или находящихся на стадии исследования, являются иммуноадъюванты, например, Mycobacterium bovis, Plasmodium falciparum, динитрохлорбензол и ароматические соединения (патенты США №№5801005 и 5739169; Hui and Hashimoto, 1998; Christodoulides et al., 1998), терапия с использованием цитокинов, например, интерферонов α, β и γ; IL-1, GM-CSF и TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998) генная терапия, например, TNF, IL-1, IL-2, p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998; патенты США №№5830880 и 5846945) и моноклональные антитела, например, анти-ганглиозид GM2, анти-HER-2, анти-р185 (Pietras et al., 1998; Hanibuchi et al., 1998; патент США №5824311). Герцептин (трастузумаб) представляет собой химерное (мышиное-человеческое) моноклональное антитело, которое блокирует HER2-neu-рецептор. Герцептин обладает противоопухолевой активностью и был одобрен для применения в лечении злокачественных опухолей (Dillman, 1999). Неограничивающий перечень некоторых известных противораковых иммунотерапевтических агентов и их мишеней включает (Генерическое наименование/Мишень) Цетуксимаб/EGFR, Панитумумаб/EGFR, Трастузумаб/рецептор erbB2, Бевацизумаб/VEGF, Алемтузумаб/CD52, Гемтузумаб-озогамицин/CD33, Ритуксимаб/CD20, Тозитумомаб/CD20, Матузумаб/EGFR, Ибритумомаб тиуксетан/CD20, Тозитумомаб/CD20, HuPAM4/MUC1, MORAb-009/Мезотелин, G250/углеродная ангидраза IX, mAb 8Н9/8Н9 антиген, M195/CD33, Ипилимумаб/CTLA4, HuLuc63/CS1, Алемтузумаб/CD53, Эпратузумаб/CD22, BC8/CD45, HuJ591/простатспецифический мембранный антиген, hA20/CD20, Лексатумумаб/TRAIL рецептор-2, Пертузумаб/рецептор HER-2, Mik-бета-1/IL-2R, RAV12/RAAG12, SGN-30/CD30, AME-133v/CD20, HeFi-1/CD30, BMS-663513/CD137, Волоциксимаб/анти-интегрин α5β1, GC1008/TGFβ, HCD122/CD40, Сиплизумаб/CD2, MORAb-003/Рецептор фолиевой кислоты альфа, CNTO 328/IL-6, MDX-060/CD30, Офатумумаб/CD20 и SGN-33/CD33. Предполагается, что одна или несколько из этих терапий могут применяться с терапиями миРНК, описанными в настоящем документе.

Существует ряд различных подходов для пассивной иммунотерапии злокачественных опухолей. Указанные подходы могут быть в широком смысле разделены на следующие категории: введение только антител; введение антител, связанных с токсинами или химиотерапевтическими агентами; введение антител, связанных с радиоактивными изотопами; введение антиидиотипических антител; и, наконец, очистка костного мозга от опухолевых клеток.

Приблизительно 60% лиц, имеющих злокачественную опухоль, должны подвергаться хирургическому вмешательству того или иного типа, которое включает в себя превентивное, диагностическое или определяющее стадию, лечебное и паллиативное хирургическое вмешательство. Лечебное хирургическое вмешательство является лечением злокачественных опухолей, которое может быть использовано вместе с другими терапиями, такими как лечение по настоящему изобретению, химиотерапия, лучевая терапия, гормональная терапия, генная терапия, иммунотерапия и/или альтернативные виды терапии.

Лечебное хирургическое вмешательство включает в себя резекцию, в которой физически удаляется, вырезается и/или разрушается вся злокачественная ткань или часть злокачественной ткани. Резекцией опухоли называют физическое удаление по меньшей мере части опухоли. Кроме резекции опухоли, хирургическое лечение включает в себя лазерную хирургию, криохирургию, электрохирургию и контролируемую микроскопически хирургию (хирургию Mohs). Кроме того, ожидается, что настоящее изобретение может применяться в сочетании с удалением поверхностных злокачественных опухолей, предраков или несущественных количеств нормальных тканей.

При вырезании части всех злокачественных клеток, ткани или опухоли в теле может образоваться полость. Лечение может выполняться перфузией, прямой инъекцией или местным применением к этой зоне дополнительной противораковой терапии. Такая обработка может повторяться, например, каждые 1, 2, 3, 4, 5, 6 или 7 дней, или каждые 1, 2, 3, 4 и 5 недель, или каждые 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 или 12 месяцев. Эти обработки могут проводиться также с варьирующимися дозами.

Гормональная терапия может быть также использована с настоящим изобретением или в комбинации с любой другой описанной ранее терапией. Применение гормонов может быть использовано в лечении некоторых злокачественных опухолей, таких как злокачественная опухоль молочной железы, предстательной железы, яичника или шейки матки для понижения уровня или ингибирования действий некоторых гормонов, таких как тестостерон или эстроген. Такой вид лечения часто используют в комбинации по меньшей мере с одной другой терапией рака в качестве необязательного лечения или для уменьшения риска метастазирования.

IV. Примеры

Следующие примеры включены для демонстрации предпочтительных вариантов осуществления изобретения. Специалист в данной области должен принять во внимание, что методики, описанные в следующих примерах, представляют собой методики, открытые автором изобретения с целью хорошего практического осуществления изобретения, и, таким образом, могут рассматриваться как предпочтительные варианты для его осуществления. Тем не менее, специалист в данной области в свете настоящего изобретения должен принимать во внимание, что множество изменений может быть сделано в конкретных описанных вариантах осуществления с получением таких же или сходных результатов без отступления от сущности и объема изобретения.

Пример 1

Влияние модификаций нуклеотидов в цепях-«пассажирах» или активных цепях MIR-34a на антипролиферативную клеточную активность

Активность миРНК зависит как от ее способности взаимодействовать с белками РНК-индуцированного комплекса сайленсинга (RISC), так и от ее способности взаимодействовать с мРНК-мишенью посредством гибридизации. Для определения, какие нуклеотиды в двухцепочечной miR-34a могут быть модифицированы без нарушения активности миРНК в клетках, авторы использовали серии двухцепочечных миметиков miR-34a с 2' кислород-метил (2'O-Ме)-модифицированными нуклеотидами, введенными в два смежных положения на активной цепи или на цепи-«пассажире» двухцепочечной миРНК (Таблица 1). Дополнительно к 2'О-Ме-модификациям, каждая цепь-«пассажир» имела 5'-концевую модификацию, состоящую из 5'-амино С6 нуклеотида (первичная аминогруппа, присоединенная к 6-углеродному спейсеру).

Авторы изучали влияние модификаций олигонуклеотида на активности миметиков miR-34a. Синтетический олигонуклеотид с цепью-«пассажиром», имеющий 5'-амино С6 модификацию и не имеющий 2'О-Ме-модификаций, отжигали с каждым из синтетических модифицированных олигонуклеотидов с активной цепью (Таблица 1). Синтетический немодифицированный олигонуклеотид с активной цепью отжигали с каждым из синтетических модифицированных олинуклеотидов с цепью-пассажиром» (Таблица 1). Клетки рака легких человека линии (Н460) подвергали обратной трансфекции полученными двухцепочечными олигонуклеотидами или отрицательной контрольной миРНК (Life Technologies, Inc./Ambion, Inc; Austin, TX, USA; номер по каталогу AMI7103) при конечных концентрациях 30 нМ. Клеточные линии временно трансфицировали с помощью липофектамина 2000 (Life Technologies, Inc./Invitrogen Corp., Carlsbad, CA, USA) согласно рекомендациям производителя с использованием следующих параметров: 5000 клеток на лунку в 96-луночном планшете, 0.1-0.2 мкл липофектамина 2000 (клеточная линия специально оптимизирована) в общем объеме среды 100 мкл. Анализ жизнеспособности клеток выполняли с использованием реагента AlamarBlue® (Invitrogen Corp.; Carlsbad, С A, USA; номер по каталогу DALI 100) согласно протоколу производителя на 3, 4 и 7 день после трансфекции. Флуоресцентный планшетный ридер использовали для измерения накопления резоруфина (длина волны возбуждения 560 нм, длина волны испускания 590 нм), который представляет собой восстановленный субстрат AlamarBlue®. Накопление резоруфина является показателем числа жизнеспособных клеток на лунку. Относительное число пролиферирующих клеток для каждой клеточной популяции, трансфицированной двухцепочечной miR-34a, имеющей 2'O-Ме-модификации, рассчитывали путем деления флуоресценции клеток, трансфицированных немодифицированными миметиками miR-34a, на флуоресценцию клеток, трансфицированных двухцепочечными 2'О-Ме-модифицированными миметиками miR-34a, и умножения результата на 100. Сравнительные значения антипролиферации показаны в Таблице 2.

Таблица 2.
Влияние 2'-O-Ме-модифицированных нуклеотидов в miR-34a на пролиферацию клеток рака легкого Н460. Антипролиферативная клеточная активность синтетической двухцепочечной miR-34a, не имеющей 2'O-Ме-модификаций, была принята за 100%. Процентные значения антипролиферации клеток больше чем 100 указывают на антипролиферативную активность, которая выше, чем антипролиферативная активность немодифицированного контрольного miR-34a. Указанные модификации были только в цепи-«пассажире» или активной цепи. Все цепи-«пассажиры» имели 5'-амино С6 модификацию. ND - не определен.
Положения 2'О-Ме-модифицированного нуклеотида Процентная антипролиферативная клеточная активность
Модификация в цепи-«пассажире» Модификация в активной цепи
1, 2 126 84
3, 4 113 106
5, 6 89 89
7, 8 96 60
9, 10 115 60
11, 12 109 138
13, 14 134 124
15, 16 74 ПО
16, 17 ND 86
17, 18 108 ND
18, 19 ND 65
19, 20 121 60
21, 22 127 ND
21, 22, 23 ND 88
1, 23 98 ND
1, 2, 22, 23 96 ND
3, 4, 18, 19 ND 58
3, 4, 11, 12, 18, 19 ND 58
3, 4, 11, 12, 15, 16, 18, 19 ND 53
3, 4, 11, 12, 15, 16, 19, 20 ND 57

Как показано в Таблице 2, 2'O-Ме-модификации в цепи-«пассажире» в положениях 1+2; 3+4; 9+10; 11+12; 13+14; 17+18; 19+20; и 21+22, и в активной цепи в положениях 3+4; 11+12; 13+14; и 15+16 приводили к увеличенной антипролиферативной активности выше наблюдаемой для немодифицированного контрольного miR-34а. 2'O-Ме-модификации в положениях 15+16 цепи-«пассажира» и в положениях 7+8; 9+10; 18+19; 19+20; 3+4+18+19; 3+4+11+12+18+19; 3+4+11+12+15+16+18+19; и 3+4+11+12+15+16+19+20 активной цепи приводили к существенно нарушенной антипролиферативной активности при сравнении с миметиком miR-34а, не имеющим 2'-O-Ме-модификаций. Модификации других положений цепи-«пассажира» или активной цепи незначительно влияли на антипролиферативные активности миметиков.

Пример 2

Влияние объединенных модификаций нуклеотидов в цепи-«пассажире» и активной цепи MIR-34а на антипролиферативную клеточную активность

Авторы оценивали антипролиферативную клеточную активность миметиков miR-34а, имеющих модифицированные нуклеотиды в обеих цепях, цепи-«пассажире» и активной цепи. Различные модифицированные олигонуклеотиды с цепью-пассажиром» и активной цепью отжигали для формирования миметиков miR-34а с модификациями на обеих цепях. Клеточные линии рака легкого (Н460), рака предстательной железы (РС3) и рака печени (С3А) подвергали обратной трансфекции различными миметиками, а также отрицательной контрольной миРНК (Ambion, номер по каталогу АМ17103) при конечных концентрациях 30 нМ. Липофектамин 2000 (Invitrogen) применяли согласно рекомендациям производителя с использованием следующих параметров: 5000 клеток на лунку в 96-луночном планшете, 0.1-0.2 мкл липофектамина 2000 (клеточная линия оптимизирована) в общем объеме среды 100 мкл. Анализ с помощью AlamarBlue® (Invitrogen, номер по каталогу dal1100) выполняли на клетках согласно протоколу производителя на шестой день после трансфекции. Флуоресцентный планшетный ридер использовали для измерения накопления резоруфина (длина волны возбуждения 560 нм, длина волны испускания 590 нм), который является восстановленным субстратом AlamarBlue®. Флуоресценция резоруфина коррелирует с числом жизнеспособных клеток на лунку. Относительное число пролиферирующих клеток для каждой трансфицированной клеточной популяции рассчитывали путем деления флуоресценции клеток, трансфицированных немодифицированными миметиками miR-34а, на флуоресценцию клеток, трансфицированных двухцепочечным 2'O-Ме-модифицированным miR-34а, и умножения результата на 100. Результаты показаны в Таблице 3.

Указанные модификации были в цепи-«пассажире», активной цепи или обеих цепях. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.

Таблица 3.
Влияние модификаций нуклеотидов в двухцепочечном миметике miR-34а на антипролиферативную клеточную активность клеток рака легкого (Н460), клеток рака предстательной железы (РС3) и клеток рака печени (С3А). Процентные значения антипролиферативной клеточной активности представляют собой среднее от наблюдаемых для всех трех клеточных линий. Значения больше чем 100 указывают на то, что антипролиферативная активность с модифицированными миметиками miR-34а выше, чем наблюдаемая с немодифицированными miR-34а.
Положения 2'О-Ме-модифицированного нуклеотида в активной цепи Положения 2'О-Ме-модифицированного нуклеотида в цепи-«пассажире» Процент антипролиферативной клеточной активности
Нет Нет 100
Нет 1, 2, 20, 21, 22, 23 131
Нет 1, 2, 3, 4, 22, 23 140
Нет 1, 2, 5, 6, 22, 23 131
Нет 1, 5, 6, 22, 23 133
Нет 1, 2, 19, 20, 22, 23 131
11, 12, 15, 16 Нет 107
11, 12, 15, 16 1, 2, 20, 21, 22, 23 152
11, 12, 15, 16 1, 2, 3, 4, 22, 23 138
11, 12, 15, 16 1, 2, 5, 6, 22, 23 146
11, 12, 15, 16 1, 5, 6, 22, 23 146
11, 12, 15, 16 1, 2, 19, 20, 22, 23 154
1, 2, 11, 12 Нет 99
1, 2, 11, 12 1, 2, 20, 21, 22, 23 80
1, 2, 11, 12 1, 2, 3, 4, 22, 23 85
1, 2, 11, 12 1, 2, 5, 6, 22, 23 66
1, 2, 11, 12 1, 5, 6, 22, 23 63
1, 2, 11, 12 1, 2, 19, 20, 22, 23 75
3, 4, 11, 12 Нет 97
3, 4, 11, 12 1, 2, 20, 21, 22, 23 138
3, 4, 11, 12 1, 2, 3, 4, 22, 23 132
3, 4, 11, 12 1, 2, 5, 6, 22, 23 122
3, 4, 11, 12 1, 5, 6, 22, 23 122
3, 4, 11, 12 1, 2, 19, 20, 22, 23 130
3, 4, 15, 16 Нет 90
3, 4, 15, 16 1, 2, 20, 21, 22, 23 143
3, 4, 15, 16 1, 2, 3, 4, 22, 23 137
3, 4, 15, 16 1, 2, 5, 6, 22, 23 131
3, 4, 15, 16 1, 5, 6, 22, 23 125
3, 4, 15, 16 1, 2, 19, 20, 22, 23 151
11, 12, 13, 14, 15, 16, 17, 18 Нет 109
11, 12, 13, 14, 15, 16, 17, 18 1, 2, 20, 21, 22, 23 159
11, 12, 13, 14, 15, 16, 17, 18 1, 2, 3, 4, 22, 23 138
11, 12, 13, 14, 15, 16, 17, 18 1, 2, 5, 6, 22, 23 132
11, 12, 13, 14, 15, 16, 17, 18 1, 5, 6, 22, 23 139
11, 12, 13, 14, 15, 16, 17, 18 1, 2, 19, 20, 22, 23 159

Как показано в Таблице 3, все протестированные миметики miR-34a, имеющие 2'O-Ме-модификации только в цепи-«пассажире», обладают более высокой антипролиферативной клеточной активностью по сравнению с немодифицированным миметиком miR-34. Некоторые миметики, имеющие модификации в обеих, активной цепи и цепи-«пассажире», обладают антипролиферативными клеточными активностями, которые предполагают синергические эффекты модификаций. Например, миметики, имеющие 2'O-Ме-модифицированную активную цепь в положениях 11, 12, 15, 16, в комбинации с 2'О-Ме-модифицированными цепями-пассажирами» в положениях 1, 2, 20, 21, 22, 23; 1, 2, 3, 4, 22, 23; 1, 2, 5, 6, 22, 23; 1, 5, 6, 22, 23; и 1, 2, 19, 20, 22, 23, являются значительно более антипролиферативными, чем миметики только с одной модифицированной цепью. Миметик miR-34a с 2'О-Ме-модификациями в положениях 3, 4, 11, 12 на активной цепи в комбинации с 2'O-Ме-модификациями в положениях 1, 2, 20, 21, 22, 23; 1, 2, 3, 4, 22, 23; 1, 2, 5, 6, 22, 23; 1, 5, 6, 22, 23; и 1, 2, 19, 20, 22, 23 на цепи-«пассажире» показал большую антипролиферативную активность, чем миметик, имеющий модификацию только активной цепи. Эти данные указывают на то, что 2'O-Ме-модификации не только усиливают антипролиферативные активности миметиков miR-34a, но эти определенные комбинации модификаций могут применяться для значительного усиления активностей миметика miR-34a.

Пример 3

Модификации нуклеотидов в обеих цепях, активной цепи и цепи-«пассажире», способствуют стабильности миметиков миРНК.

Так как 2'OΗ требуется для рибонуклеаз для расщепления молекул РНК, введение 2'-модифицированных нуклеотидов в молекулы РНК может сделать их более устойчивыми к расщеплению нуклеазой. Авторы использовали анализ стабильности in vitro и очищенную RNase A (Ambion, номер по каталогу АМ2270) для сравнения стабильностей модифицированных и немодифицированных миметиков miR-34a.

Миметики miR-34a готовили путем гибридизации комплементарных олигонуклеотидов, имеющих 2'O-Ме-модифицированные нуклеотиды в различных положениях, и инкубации гибридов с RNaseA (20 мкг/мл) при 25°С в течение 60 мин. После инкубации в течение 60 мин добавляли дитиотреитол (DTT) до конечной концентрации 10 мМ, и смесь нагревали при 60°С в течение 10 мин для инактивации активности RNase. РНК обратно транскрибировали при помощи обратной транскриптазы вируса мышиного лейкоза Молони (MMLV-RT) (Invitrogen, номер по каталогу 28025-021) с применением hsa-miR-34a TaqMan® MicroRNA Assay праймера RT (Applied Biosystems Inc.; номер по каталогу 4427975, анализ ID 000425). Количественную ПЦР с обратной транскрипцией (qRT-PCR) проводили на кДНК с использованием TaqMan® MicroRNA Assay с праймером, специфическим для hsa-miR-34а, и Platinum Taq Polymerase (Invitrogen, номер по каталогу 10966-083) на системе ПЦР в реальном времени 7900НТ Fast Real-Time PCR System (Applied Biosystems). Таблица 4 показывает влияние модификаций нуклеотидов на стабильность различных миметиков miR-34a.

Миметик, имеющий комбинацию активной цепи и цепи-«пассажира» А150/Р211 является в 2000 раз более стабильным, чем немодифицированный миметик. Повышенная стабильность миметиков может значительно улучшать фармакодинамические свойства во время терапии с использованием миРНК.

При отсутствии этих данных можно предположить, что миметик с наиболее 2'O-Ме-модифицированными нуклеотидами будет наиболее стабильным, так как он имеет меньше всего чувствительных к нуклеазе участков. Удивительно, в анализе авторов изобретения один из наиболее модифицированных миметиков (А206/Р210) был только немного более стабильным, чем немодифицированный миметик. Эти данные указывают на то, что простой подсчет числа 2'O-Ме-модификаций не является точным отражением или предсказуемым способом определения стабильности модифицированных двухцепочечных миметиков miR-34a.

Пример 4

Модификации нуклеотидов в обеих, активной цепи и цепи-«пассажире», способствуют активности миметиков миРНК

Антипролиферативные активности миметиков miR-34a оценивали и сравнивали с миметиком miR-34a без 2'O-Ме-модификаций. Клетки рака легкого (Н460) подвергали обратной трансфекции четырьмя различными двухцепочечными миметиками miR-34a и отрицательной контрольной миРНК (Ambion, номер по каталогу AMI7103) при конечных концентрациях 1, 3 и 10 нМ. Липофектамин 2000 (Invitrogen) применяли согласно рекомендациям производителя с использованием следующих параметров: 5000 клеток на лунку в 96-луночном планшете, 0.1-0.2 мкл липофектамина 2000 (специально оптимизированная клеточная линия) в общем объеме среды 100 мкл. Анализ с помощью AlamarBlue® (Invitrogen, номер по каталогу DALI 100) выполняли на клетках на 3 день после трансфекции согласно протоколу производителя. Флуоресцентный планшетный ридер использовали для измерения накопления резоруфина (длина волны возбуждения 560 нм, длина волны испускания 590 нм), который является восстановленным субстратом AlamarBlue®. Флуоресценция резоруфина коррелирует с числом жизнеспособных клеток на лунку. Относительный процент жизнеспособных клеток для каждой трансфицированной клеточной популяции рассчитывали путем деления флуоресценции от клеток, трансфицированных заданной концентрацией миметика miR-34a, на флуоресценцию от клеток, трансфицированных такой же концентрацией отрицательной контрольной миРНК, и умножения результата на 100. Значения меньше чем 100% указывают на то, что миметик miR-34a уменьшал число жизнеспособных клеток в популяции по сравнению с клеточными популяциями, которые были трансфицированы отрицательной контрольной миРНК. Результаты показаны в Таблице 5.

Все 2'-O-Ме-модифицированные пары миметиков продемонстрировали повышенную устойчивость к нуклеазам по сравнению с немодифицированным миметиком (Таблица 4), и некоторые из двухцепочечных модифицированных миметиков также проявили повышенную антипролиферативную активность (Таблица 5). Наиболее интересными были двухцепочечные модифицированные миметики mir-34а, которые имели сходные со стандартным миметиком miR-34a антипролиферативные активности при использовании в количестве одной трети дозы, что указывало на то, что модифицированные миметики miR-34a были приблизительно в три раза более активными, чем стандартный миметик miR-34a. В отношении данных по стабильности было невозможно предсказать, какие комбинации модификаций будут обеспечивать наиболее активные миметики миРНК.

Пример 5

Регуляция генов модифицированными миметиками MIR-34a

миРНК функционируют в качестве направляющих последовательностей для регуляции трансляции мРНК РНК-индуцированным комплексом сайленсинга (RISC). После вхождения в RISC, миметик миРНК может изменять профили мРНК трнсфицированных клеток путем: (1) направления RISC для расщепления мРНК, которая присоединена к миРНК, (2) изменения полужизни присоединенной мРНК путем предотвращения ее взаимодействия с рибосомами, и/или (3) вызывания изменений в количествах мРНК, которые регулируются генами, которые сами регулируются миметиком миРНК.

Для рассмотрения, имеют ли модифицированные миметики miR-34a такое же влияние на экспрессию мРНК, какое имеет немодифицированный миметик miR-34a, авторы использовали мРНК-чипы для исследования профилей транскрипции генов в клетках рака легкого Н460, трансфицированных отрицательной контрольной миРНК (Ambion, номер по каталогу AMI7111), немодифицированным миметиком miR-34a (Р140/А150) или пятью различными модифицированными миметиками miR-34a (Р210/А150, Р211/А150, Р215/А150, Р211/А200 и Р211/А206) (Таблица 5). Миметики миРНК при 3 нМ или 10 нМ конъюгировали с 0.2 мкл липофектамина 2000 и добавляли в клетки Н460 в количестве 5000 клеток на лунку в 96-луночном планшете в общем объеме среды RPMI 100 мкл. Клетки отбирали на 3 день после трансфекции, и тотальную РНК экстрагировали с использованием набора mirVana™ PARIS™ Kit (Ambion, номер по каталогу AM 1556) согласно рекомендуемым протоколам производителя.

Анализы методом мРНК-чипов проводились компанией Asuragen, Inc. (Austin, ТХ, USA) согласно стандартным операционным процедурам компании. Входящую тотальную РНК в количестве 200 нг метили биотином с использованием набора MessageAmp™ 11-96 aRNA Amplification Kit (Ambion, номер по каталогу 1819). Выходы кРНК подсчитывали с использованием инструмента капиллярного электрофореза биоанализатора Agilent 2100 Bioanalyzer (Agilent Technologies, Inc.). Меченую мишень гибридизировали с мРНК-чипами Affymetrix (Human HG-U133A 2.0 arrays) с использованием рекомендаций производителя и следующих параметров. Гибридизации проводили при 45°С в течение 16 ч в печи для гибридизации Affymetrix Model 640. Чипы промывали и прокрашивали с помощью Fluidics station FS450 (Affymetrix), запуская скрипт отмывки Midi_euk2v3_450. Чипы сканировали в сканере GeneChip Scanner 3000 (Affymetrix). Сводную информацию по данным сигнала изображения, средним групповым значениям, р-величинам с уровнями значимости, логарифмическим отношениям и аннотациям генов для каждого гена на чипе получали с использованием Affymetrix Statistical Algorithm MAS 5.0 (GCOS vl.3). Представлены данные, содержащие данные Affymetrix и файлы результатов (файловый блок), и содержащие первичное изображение и обработанные клеточные интенсивности чипов (.cel).

Проводили сравнение профилей мРНК-чипов для различных образцов для определения их сходства. Коэффициенты корреляции Пирсона между образцами (полный набор проб) были рассчитаны и показаны в Таблицах 6 и 7. Коэффициенты корреляции для всех образцов составили больше, чем 0.987.

Таблица 6.
Коэффициенты корреляции Пирсона после анализа экспрессии генов методом чипов после трансфекции клеток рака легкого 3 нМ указанного миметика миРНК. Последовательности и 2'-O-Ме-модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 5. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
Р140/А150 Р210/А150 Р211/А150 Р215/А150 Р211/А200 Р211/А206
1.000 0.9974 0.9936 0.9971 0.9966 0.9970 Р140/А150
1.000 0.9936 0.9974 0.9969 0.9966 Р210/А150
1.000 0.9953 0.9937 0.9943 Р211/А150
1.000 0.9968 0.9965 Р215/А15
0
1.000 0.9975 Р211/А200
1.000 Р211/А206

Таблица 7.
Коэффициенты корреляции Пирсона после анализа экспрессии генов методом чипов после трансфекции клеток рака легкого 10 нМ указанного миметика миРНК. Последовательности и 2'-О-Ме-модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 5. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
P140/A150 P210/A150 P211/A150 P215/A150 P211/A200 P211/A206
1.000 0.9959 0.9962 0.9952 0.9932 0.9912 P140/A150
1.000 0.9959 0.9956 0.9915 0.9889 P210/A150
1.000 0.9955 0.9910 0.9885 P211/A150
1.000 0.9906 0.9870 P215/A150
1.000 0.9973 P211/A200
1.000 P211/A206

Ограничиваясь анализом тех мРНК, уровни экспрессии которых изменялись по меньшей мере в два раза при помощи минимум двух миметиков miR-34a, сильная корреляция наблюдалась между клетками, трансфицированными 2'-O-Ме-модифицированными миметиками miR-34a и немодифицированным миметиком miR-34а (Таблица 8). Эти данные показали, что целевые свойства модифицированных миметиков miR-34a сходы с немодифицированным миметиком miR-34a.

Таблица 8.
Коэффициенты корреляции Пирсона после анализа экспрессии генов методом чипов изменялись по меньшей мере в два раза после трансфекции клеток рака легкого 10 нМ или 3 нМ миметика миРНК, не имеющего модифицированных нуклеотидов (Р140/А150), и миметиков miR-34a, содержащих 2'-O-Ме-модификации (Р210/А150, Р211/А150, Р215/А150, Р211/А200, Р211/А206). Последовательности и 2'-О-Ме-модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 5. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
10 нМ
P210/A150 P211/A150 P215/A150 P211/A200 P211/A206
0.9537 0.9543 0.9166 0.9409 0.90880 P140/A150
3 нМ
P210/A150 P211/A150 P215/A150 P211/A200 P211/A206
0.9591 0.9206 0.9592 0.9135 0.9199 P140/A150

Дополнительно к глобальным профилям экспрессии авторы сравнивали активности 2'-O-Ме-модифицированных и немодифицированных миметиков miR-34a на известных генах-мишенях miR-34a. Данные чипов показали, что уровни двух непосредственных мРНК-мишеней miR-34a, МЕТ и SIRT1, были значительно уменьшены во всех клеточных популяциях, обработанных 10 нМ миметиков miR-34a, по сравнению с клетками, трансфицированными отрицательной контрольной миРНК (Таблица 9).

Таблица 9.
Уровни мРНК МЕТ или SIRT1 после трансфекции клеток Н460 указанным миметиком miR-34a при концентрации 3 нМ или 10 нМ. Значения представляют процент экспрессии по сравнению с наблюдаемым после трансфекции клеток отрицательной контрольной миРНК (100%). Последовательности и 2'-O-Ме-модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 5. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
Миметик miR-34а Процент экспрессии по сравнению с отрицательной контрольной миРНК
МЕТ SIRT1
3 нМ 10 нМ 3 нМ 10 нМ
Р140/А150 90.38 76.71 80.20 72.44
Р210/А150 84.17 62.16 66.88 52.76
Р211/А150 105.83 64.36 102.69 51.56
Р215/А150 83.05 69.29 72.91 53.56
Р211/А200 85.54 80.39 81.46 77.03
Р211/А206 93.09 84.75 94.10 84.44

Пример 7

Влияние модификаций нуклеотидов в цепи-«пассажире» или активной цепи miR-34 с на антипролиферативную клеточную активность

Активность миРНК зависит от как ее способности взаимодействовать с белками РНК-индуцированного комплекса сайленсинга (RISC), так и от ее способности взаимодействовать с мРНК-мишенью посредством гибридизации. Для определения, какие нуклеотиды в двухцепочечном миметике mir-34c могут быть модифицированы без нарушения активности миРНК в клетках, авторы использовали серии двухцепочечных миметиков mir-34c с 2'О-Ме-модифицированными нуклеотидами, введенными в два смежных положения на активной цепи или на цепи-«пассажире» двухцепочечной миРНК (Таблица 10). Дополнительно к 2'О-Ме-модификациям каждая цепь-«пассажир» имела 5'-амино С6 модификацию.

Авторы изучали влияние модификаций олигонуклеотидов на активности миметиков mir-34c. Синтетический олигонуклеотид с цепью-«пассажиром», имеющий 5'-амино С6 модификацию и не имеющий 2'O-Ме-модификаций, отжигали с каждым из синтетических модифицированных олигонуклеотидов с активной цепью (Таблицы 10, 11). Синтетический немодифицированный олигонуклеотид с активной цепью отжигали с каждым из синтетических модифицированных олигонуклеотидов с цепью-пассажиром» (Таблицы 10, 11). Клеточную линию рака легкого (Н460) подвергали обратной трансфекции полученными двухцепочечными олигонуклеотидами или отрицательной контрольной миРНК (Life Technologies, Inc./Ambion, Inc; Austin, TX, USA; номер по каталогу AM17103) при конечных концентрациях 30 нМ. Клеточные линии временно трансфицировали с использованием липофектамина 2000 (Life Technologies, Inc./Invitrogen Corp., Carlsbad, CA, USA) согласно рекомендациям производителя с использованием следующих параметров: 5000 клеток на лунку в 96-луночном планшете, 0.1-0.2 мкл липофектамина 2000 (специально оптимизированная клеточная линия) в общем объеме среды 100 мкл. Анализы жизнеспособности клеток выполняли с использованием реагента AlamarBlue® (Invitrogen Corp.; Carlsbad, С A, USA; номер по каталогу DALI 100) согласно протоколу производителя на 3, 4 и 7 день после трансфекции. Флуоресцентный планшетный ридер использовали для измерения накопления резоруфина (длина волны возбуждения 560 нм, длина волны испускания 590 нм), который является восстановленным субстратом AlamarBlue®. Накопление резоруфина является показателем числа жизнеспособных клеток на лунку. Относительное число пролиферирующих клеток для каждой клеточной популяции, трансфицированной двухцепочечным mir-34c, имеющим 2'О-Ме-модификации, рассчитывали путем деления флуоресценции клеток, трансфицированных немодифицированными миметиками mir-34c, на флуоресценцию клеток, трансфицированных 2'О-Ме-модифицированными миметиками mir-34c, и умножения на 100. Сравнительные значения антипролиферации показаны в Таблице 11.

Таблица 11.
Влияние модификаций нуклеотидов в двухцепочечных миметиках miR-34 с на пролиферацию клеток рака легкого (Н460). Процентные значения антипролиферации клеток больше чем 100 указывают на антипролиферативную активность, которая выше, чем активность, наблюдаемая с использованием контрольного miR-34c, не имеющего 2'О-Ме-модификаций в любой цепи. Указанные модификации были только в цепи-«пассажире» или активной цепи. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
Модифицированная цепь-«пассажир»
Положения 2'О-Ме-модифицированных нуклеотидов Процент антипролиферативной клеточной активности
Нет 100
1, 2 136
3, 4 171
5, 6 84
7, 8 127
9, 10 132
11, 12 143
13, 14 ПО
15, 16 69
17, 18 97
19, 20 106
1, 2, 22, 23 143
1, 2, 3, 21, 22, 23 114
Модифицированная активная цепь
Положения 2'О-Ме-модифицированных нуклеотидов Процент антипролиферативной клеточной активности
Нет 100
1, 2 87
3, 4 98
5, 6 99
7, 8 79
9, 10 82
11, 12 132
13, 14 102
15, 16 99
17, 18 99
19, 20 78
1, 2, 22, 23 89
1, 2, 3, 21, 22, 23 75

Как показано в Таблице 11, 2'O-Ме-модификации в цепи-«пассажире» в положениях 1, 2; 3, 4; 5, 6, 7, 8; 9, 10; 11, 12; 13, 14; 17, 18; 19, 20; 1, 2, 22, 23; и 1, 2, 3, 21, 22, 23, и в активной цепи в положениях 1, 2; 3, 4; 5, 6; 9, 10; 11, 12; 13, 14; 15, 16; 17, 18; и 1, 2, 22, 23 вызвали сходную или увеличенную антипролиферативную активность по сравнению с наблюдаемой для немодифицированного контрольного mir-34c. 2'O-Ме-модификации в положениях 15+16 цепи-«пассажира» и в положениях 7, 8; 19, 20; и 1, 2, 3, 21, 22, 23 активной цепи вызвали существенно нарушенную антипролиферативную активность по сравнению с миметиком mir-34c, не имеющим 2'-O-Ме-модификаций.

Пример 8:

Влияние объединенных модификаций нуклеотидов в цепи-«пассажире» и активной цепи miR-34c на антипролиферативную клеточную активность

Авторы оценивали антипролиферативные клеточные активности миметиков mir-34 с, имеющих модифицированные нуклеотиды в обеих, цепи-«пассажире» и активной цепи. Различные модифицированные олигонуклеотиды с цепью-«пассажиром» и активной цепью отжигали для формирования миметиков mir-34c с модификациями на обеих цепях. Клетки рака легкого Н460 подвергали обратной трансфекции различными миметиками или отрицательной контрольной миРНК (Ambion, номер по каталогу AMI 7103) при конечных концентрациях 30 нМ. Липофектамин 2000 (Invitrogen) применяли согласно рекомендациям производителя с использованием следующих параметров: 5000 клеток на лунку в 96-луночном планшете, 0.1-0.2 мкл липофектамина 2000 (оптимизированная клеточная линия) в общем объеме среды 100 мкл. Анализ с использованием AlamarBlue® (Invitrogen, номер по каталогу DALI 100) выполняли на клетках согласно протоколу производителя на шестой день после трансфекции. Флуоресцентный планшетный ридер использовали для измерения накопления резоруфина (длина волны возбуждения 560 нм, длина волны испускания 590 нм), который является восстановленным субстратом AlamarBlue. Флуоресценция резоруфина коррелирует с числом жизнеспособных клеток на лунку. Относительное число пролиферирующих клеток для каждой трансфицированной клеточной популяции рассчитывали путем деления флуоресценции клеток, трансфицированных модифицированными миметиками mir-34c, на флуоресценцию клеток, трансфицированных 2'О-Ме-модифицированными миметиками mir-34c, и умножения на 100. Результаты показаны в Таблице 12.

Таблица 12.
Влияния модификаций нуклеотидов в двухцепочечных миметиках miR-34 с на пролиферацию клеток рака легкого (Н460). Процентные значения клеточной антипролиферации больше, чем 100 указывают на антипролиферативную активность, которая выше, чем наблюдаемая с использованием контрольного miR-34c, не имеющего 2'О-Ме-модификаций в любой цепи. Указанные модификации были только в цепи-«пассажире» или активной цепи. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
Активная цепь
Положения 2'О-Ме-модифицированного нуклеотида
Цепь-«пассажир»
Положения 2'О-Ме-модифицированного нуклеотида
Процент пнтипролиферативной клеточной активности
Нет Нет 100
Нет 17, 18 97
Нет 1, 2, 3, 21, 22, 23 89
Нет 1, 2, 3, 17, 18, 21, 22, 23 86
Нет 1, 2, 3.11.12, 13, 14.17, 18, 21, 22, 23 95
3, 4, 17, 18 Нет 109
3, 4, 17, 18 17, 18 99
3, 4, 17, 18 1, 2, 3, 21, 22, 23 97
3, 4, 17, 18 1, 2, 3, 17, 18, 21, 22, 23 94
3, 4, 17, 18 1, 2, 3, 11, 12, 13, 14, 17, 18, 21, 22, 23 101
11, 12, 17, 18 Нет 138
11, 12, 17, 18 17, 18 157
11, 12, 17, 18 1, 2, 3, 21, 22, 23 142
11, 12, 17, 18 1, 2, 3, 17, 18, 21, 22, 23 135
11, 12, 17, 18 1, 2, 3, 11, 12, 13, 14, 17.18, 21, 22, 23 158
3, 4, 11, 12, 13, 14, 15, 16, 17, 18 Нет 143
3, 4, 11, 12, 13, 14, 15, 16, 17, 18 17, 18 158
3, 4, 11, 12, 13, 14, 15, 16, 17, 18 1, 2, 3, 21, 22, 23 139
3, 4, 11, 12, 13, 14, 15, 16, 17, 18 1, 2, 3, 17, 18, 21, 22, 23 153
3, 4, 11, 12, 13, 14, 15, 16, 17, 18 1, 2, 3, 11, 12, 13, 14, 17, 18, 21, 22, 23 159

Как показано в Таблице 12, все миметики, имеющие 2'О-Ме-модификации в цепи-«пассажире», обладают антипролиферативной клеточной активностью по меньшей мере аналогичной немодифицированному миметику mir-34 с.Некоторые миметики, имеющие модификации в обеих, активной цепи и цепи-«пассажире», обладают антипролиферативными клеточными активностями, которые предполагают синергические эффекты модификаций. Например, миметики, имеющие 2'O-Ме-модифицированную активную цепь в положениях 11, 12, 17, 18, объединенные с 2'O-Ме-модифицированными цепями-«пассажирами» в положениях 17, 18; 1, 2, 3, 21, 22, 23; или 1, 2, 3, 11, 12, 13, 14, 17, 18, 21, 22, 23, являются более антипролиферативными, чем миметики только с одной модифицированной цепью. Эти данные предполагают, что 2'O-Ме-модификации не только усиливают антипролиферативные активности миметиков mir-34 с, но что некоторые комбинации модификаций могут применяться для значительного усиления активностей миметика mir-34c.

Пример 9

Модификации нуклеотидов в обеих, активной цепи и цепи-«пассажире», способствуют стабильности миметиков миРНК

Так как 2'OΗ требуется для рибонуклеаз для расщепления молекул РНК, введение 2'-модифицированных нуклеотидов в молекулы РНК может сделать их более устойчивыми к расщеплению нуклеазой. Авторы использовали анализ стабильности in vitro и очищенную RNase A (Ambion, номер по каталогу АМ2270) для сравнения стабильностей модифицированных и немодифицированных миметиков miR-34c.

Миметики miR-34c готовили путем гибридизации комплементарных олигонуклеотидов, имеющих 2'O-Ме-модифицированные нуклеотиды в различных положениях, и инкубации гибридов с RNaseA (20 мкг/мл) при 25°С в течение 120 мин. После инкубации в течение 120 мин добавляли дитиотреитол (DTT) до конечной концентрации 10 мМ, и смесь нагревали при 60°С в течение 10 мин для инактивации активности RNase. РНК обратно транскрибировали при помощи обратной транскриптазы вируса мышиного лейкоза Молони MMLV-RT (Invitrogen, номер по каталогу 28025-021) с использованием hsa-miR-34c TaqMan® MicroRNA assay праймера RT (Applied Biosystems Inc.; номер по каталогу 4427975, анализ ID 000425). Количественную ПЦР с обратной транскрипцией (qRT-PCR) проводили на кДНК с использованием TaqMan® MicroRNA assay с праймером, специфичным для hsa-miR-34 с, и Platinum Taq Polymerase (Invitrogen, номер по каталогу 10966-083) на системе 7900НТ Fast Real-Time PCR System (Applied Biosystems). Таблица 13 показывает влияние модификаций нуклеотидов на стабильность различных миметиков miR-34c.

Миметики, имеющие комбинацию активной цепи и цепи-«пассажира» А133/Р129, являются более чем в 2700 раз более стабильными, чем немодифицированный миметик. Повышенная стабильность миметиков может значительно улучшить фармакодинамические свойства во время терапии с использованием миРНК.

При отсутствии этих данных можно предположить, что миметик с наиболее 2'O-Ме-модифицированными нуклеотидами будет наиболее стабильным, так как он имеет меньше всего чувствительных к нуклеазе участков. Удивительно, в анализе авторов изобретения не наблюдалось, чтобы комбинация миметика А130/Р126, имеющая десять 2'О-Ме-модифицированных нуклеотидов, была более стабильной, чем миметик А130/Р125, имеющий восемь 2'О-Ме-модифицированных нуклеотидов. Эти данные указывают, что простой подсчет числа 2'О-Ме-модификаций не является точным отражением или предсказуемым способом определения стабильности модифицированных двухцепочечных миметиков miR-34c.

Пример 10

Модификации нуклеотидов в обеих, активной цепи и цепи-«пассажире», способствуют активности миметиков миРНК

Антипролиферативные активности четырех самых устойчивых к нуклеазе миметиков mir-34c оценивали и сравнивали с миметиком mir-34c без 2'O-Ме-модификаций. Клетки рака легкого (Н460) подвергали обратной трансфекции четырьмя различными двухцепочечными миметиками miR-34c и отрицательной контрольной миРНК (Ambion, номер по каталогу АМ17103) при конечных концентрациях 3, 10 и 30 нМ. Липофектамин 2000 (Invitrogen) применяли согласно рекомендациям производителя с использованием следующих параметров: 5000 клеток на лунку в 96-луночном планшете, 0.1-0.2 мкл липофектамина 2000 (специально оптимизированная клеточная линия) в общем объеме среды 100 мкл. Анализ с помощью AlamarBlue® (Invitrogen, номер по каталогу DALI 100) выполняли на клетках на 3 день после трансфекции согласно протоколу производителя. Флуоресцентный планшетный ридер использовали для измерения накопления резоруфина (длина волны возбуждения 560 нм, длина волны испускания 590 нм), который является восстановленным субстратом AlamarBlue®. Флуоресценция резоруфина коррелирует с числом жизнеспособных клеток на лунку. Относительный процент жизнеспособных клеток для каждой трансфицированной клеточной популяции рассчитывали путем деления флуоресценции от клеток, трансфицированных заданной концентрацией миметика miR-34c, на флуоресценцию от клеток, трансфицированных такой же концентрацией отрицательной контрольной миРНК, и умножения результата на 100. Значения меньше, чем 100% указывают, что миметик miR-34c уменьшал число жизнеспособных клеток в популяции по сравнению с клеточными популяциями, которые были трансфицированы отрицательной контрольной миРНК. Результаты показаны в Таблице 14.

Все пары миметиков продемонстрировали повышенную устойчивость к нуклеазе по сравнению с немодифицированным миметиком (Таблица 13), и миметик с 2'О-Ме-модификациями в обеих цепях также проявил увеличенную антипролиферативную активность (Таблица 14). Миметик с модификациями в обеих цепях показал антипролиферативную активность, аналогичную контрольному миметику при использовании в количестве одной десятой дозы.

Пример 11

Регуляция генов модифицированными миметиками MIR-34c

миРНК функционируют в качестве направляющих последовательностей для регуляции трансляции мРНК РНК-индуцированным комплексом сайленсинга (RISC). После вхождения в RISC, миметик миРНК может изменять профили мРНК трансфицированных клеток путем: (1) направления RISC для расщепления мРНК, которая соединена с миРНК, (2) изменения полужизни присоединенной мРНК путем предотвращения ее взаимодействия с рибосомами, и/или (3) вызывания изменений в количествах мРНК, которые регулируются генами, которые сами регулируются миметиком миРНК.

Для рассмотрения, имеют ли модифицированные миметики miR-34c такие же эффекты на экспрессию мРНК, которые имеет немодифицированный миметик miR-34c, авторы использовали мРНК-чипы для исследования профилей транскрипции генов в клетках рака легкого Н460, трансфицированных двумя различными отрицательными контрольными миРНК (Ambion, номер по каталогу AMI7111; Ambion, номер по каталогу АМ17103), немодифицированным миметиком mir-34c (Р121/А130) или четырьмя различными модифицированными миметиками mir-34c (Р125/А130, Р126/А130, Р129/А130 и Р129/А133) (Таблица 14). Миметики миРНК при 3, 10 или 30 нМ конъюгировали с 0.2 мкл липофектамина 2000 и добавляли в клетки Н460 в количестве 5000 клеток на лунку в 96-луночном планшете в общем объеме среды RPMI 100 мкл. Клетки отбирали на 3 день после трансфекции, и тотальную РНК экстрагировали с использованием набора mirVana™ PARIS™ Kit (Ambion, номер по каталогу AMI556) согласно рекомендуемым протоколам производителя.

Анализы методом мРНК-чипов проводились компанией Asuragen, Inc. (Austin, ТХ, USA) согласно стандартным операционным процедурам компании. Входящую тотальную РНК в количестве 200 нг метили биотином с использованием набора MessageAmp™ П-96 aRNA Amplification Kit (Ambion, номер по каталогу 1819). Выходы кРНК подсчитывали с использованием инструмента капиллярного электрофореза биоанализатора Agilent 2100 Bioanalyzer (Agilent Technologies, Inc.). Меченую мишень гибридизировали с мРНК-чипами Affymetrix (Human HG-U133A 2.0 arrays) с использованием рекомендаций производителя и следующих параметров. Гибридизации проводили при 45°С в течение 16 ч в печи для гибридизации Affymetrix Model 640. Чипы промывали и прокрашивали на Fluidics station FS450 (Affymetrix), запуская скрипт отмывки Midi_euk2v3_450. Чипы сканировали на сканере Affymetrix GeneChip Scanner 3000. Сводная информация по данным сигнала изображения, средним групповым значениям, р-величинам с уровнями значимости, логарифмическим отношениям и аннотациям генов для каждого гена на чипе была получена с использованием Affymetrix Statistical Algorithm MAS 5.0 (GCOS vl.3). Представлены данные, содержащие данные Affymetrix и файлы результатов (файловый блок) и содержащие первичное изображение и обработанные клеточные интенсивности чипов (.cel).

Профили мРНК-чипов для различных образцов сравнивали для определения их сходства. Коэффициенты корреляции Пирсона между образцами (полный набор проб) были рассчитаны и показаны в Таблицах 15, 16 и 17. Наблюдалось, что коэффициенты корреляции для всех образцов составляют больше, чем 0.9934.

Таблица 15.
Коэффициенты корреляции Пирсона после анализа экспрессии генов методом чипов после трансфекции клеток рака легкого 3 нМ указанного миметика миРНК. Последовательности и 2'-O-Ме-модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 14. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
Р121/А130 Р125/А130 Р126/А130 Р129/А130 Р129/А133
1.000 0.9984 0.9987 0.9982 0.9968 Р121/А130
1.000 0.9982 0.9979 0.9978 Р125/А130
1.000 0.9986 0.9969 Р126/А130
1.000 0.9969 Р129/А130
1.000 Р129/А133

Таблица 16.
Коэффициенты корреляции Пирсона после анализа экспрессии генов методом чипов после трансфекции клеток рака легкого 10 нМ указанного миметика миРНК. Последовательности и 2'-O-Ме-модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 14. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
Р121/А130 Р125/А130 Р126/А130 Р129/А130 Р129/А133
1.000 0.9972 0.9980 0.9962 0.9968 Р121/А130
1.000 0.9973 0.9952 0.9978 Р125/А130
1.000 0.9968 0.9965 Р126/А130
1.000 0.9934 Р129/А130
1.000 Р129/А133

Таблица 17.
Коэффициенты корреляции Пирсона после анализа экспрессии генов методом чипов после трансфекции клеток рака легкого 30 нМ указанного миметика миРНК. Последовательности и 2'-O-Ме-модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 14. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
Р121/А130 Р125/А130 Р126/А130 Р129/А130 Р129/А133
1.000 0.9961 0.9963 0.9982 0.9955 Р121/А130
1.000 0.9965 0.9962 0.9971 Р125/А130
1.000 0.9973 0.9960 Р126/А130
1.000 0.9956 Р129/А130
1.000 Р129/А133

Ограничиваясь анализом тех мРНК, чьи уровни экспрессии относительно отрицательного контроля изменялись по меньшей мере в два раза с помощью минимум двух миметиков miR-34c, сильная корреляция наблюдалась между клетками, трансфицированными 2'-O-Ме-модифицированными миметиками miR-34c и немодифицированным миметиком miR-34c (Таблица 18). Эти данные показали, что целевые свойства модифицированных миметиков miR-34c сходны с немодифицированным миметиком miR-34c.

Таблица 18.
Коэффициенты корреляции Пирсона после анализа экспрессии генов методом чипов изменились по меньшей мере в два раза после трансфекции клеток рака легкого 30, 10 или 3 нМ миметика mir-34c, не имеющего модифицированных нуклеотидов (Р121/А130), и миметиков mir-34c, содержащих 2'-O-Ме-модификации (Р125/А130, Р126/А130, Р129/А133, Р129/А133). Последовательности и 2'-O-Ме-модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 14. Все цепи-«пассажиры» имели 5'-амино С6 модификацию.
30 нМ
Р125/А130 Р126/А130 Р129/А130 Р129/А133
0.8853 0.9307 0.9562 0.88768 Р121/А130
10 нМ
Р125/А130 Р126/А130 Р129/А130 Р129/А133
0.8828 0.9456 0.8992 0.9008 Р121/А130
3 нМ
Р125/А130 Р126/А130 Р129/А130 Р129/А133
0.9350 0.9459 0.9318 0.8629 Р121/А130

Дополнительно к глобальным профилям экспрессии авторы сравнивали активность 2'О-Ме-модифицированных и немодифицированных миметиков mir-34c на предсказанных генах-мишенях mir-34c. Данные чипов показали, что уровни двух предсказанных мРНК-мишеней mir-34c, NR4A2 и SYT1, были значительно понижены в клеточных популяциях, обработанных mir-34c, по сравнению с клетками, трансфицированными отрицательной контрольной миРНК (Таблица 19).

Таблица 19.
Уровни мРНК NR4A2 или SYT1 после трансфекции клеток Н460 указанным миметиком mir-34c при концентрации 3, 10 или 30 нМ. Значения представляют процент экспрессии по сравнению с наблюдаемой после трансфекции клеток отрицательной контрольной миРНК (100%). Последовательности и 2'O-Ме модификации цепи-«пассажира» (Р) и активной цепи (А) показаны в Таблице 14. Все цепи-"«пассажиры" имели 5'-амино С6 модификацию.
Миметик miR-34c Процент экспрессии в сравнении с отрицательной контрольной миРНК
NR4A2 SYT1
3 нМ 10 нМ 30 нМ 3 нМ 10 нМ 30 нМ
Р121/А130 67% 34% 39% 89% 69% 71%
Р125/А130 48% 28% 19% 86% 54% 52%
Р126/А130 73% 46% 29% 90% 76% 74%
Р129/А130 58% 33% 39% 93% 70% 85%
Р129/А133 13% 17% 30% 56% 36% 42%

1. Двухцепочечная молекула РНК с тупыми концами длиной 23 пары оснований для обеспечения клетки активностью miR-34a, содержащая:

a) активную цепь, имеющую SEQ ID NO: 2 от 5' к 3', и

b) полностью комплементарную цепь-«пассажир», имеющую нуклеотидную последовательность, состоящую из SEQ ID NO: 4, при этом цепь-«пассажир» содержит:

i) 2'-OMe модификации сахара в нуклеотидах в положениях 1 и 2, и 22, и 23 цепи-«пассажира» и

ii) терминальную модификацию нуклеотида на 5'-конце.

2. Двухцепочечная молекула РНК с тупыми концами по п.1, дополнительно содержащая 2'-ОМе модификации сахара в нуклеотидах в положениях 3 и 4 цепи-«пассажира».

3. Двухцепочечная молекула РНК с тупыми концами по п.1, дополнительно содержащая 2'-ОМе модификации сахара в нуклеотидах в положениях 5 и 6 цепи-«пассажира».

4. Двухцепочечная молекула РНК с тупыми концами по п.1, дополнительно содержащая 2'-OMe модификации сахара в нуклеотидах в положениях 19 и 20 цепи-«пассажира».

5. Двухцепочечная молекула РНК с тупыми концами по п.1, дополнительно содержащая 2'-ОМе модификации сахара в нуклеотидах в положениях 20 и 21 цепи-«пассажира».

6. Двухцепочечная молекула РНК с тупыми концами по любому из пп.1-5, в которой активная цепь содержит 2'-ОМе модификации сахара в нуклеотидах в положениях 11, 12, 15 и 16.

7. Двухцепочечная молекула РНК с тупыми концами по любому из пп.1-5, в которой активная цепь содержит 2'-ОМе модификации сахара в нуклеотидах в положениях 3, 4, 11 и 12.

8. Двухцепочечная молекула РНК с тупыми концами по любому из пп.1-5, в которой активная цепь содержит 2'-ОМе модификации сахара в нуклеотидах в положениях 3, 4, 15 и 16.

9. Двухцепочечная молекула РНК с тупыми концами по любому из пп.1-5, в которой активная цепь содержит 2'-ОМе модификации сахара в нуклеотидах в положениях 11, 12, 13, 14, 15, 16, 17 и 18.

10. Двухцепочечная молекула РНК с тупыми концами по п.1, в которой цепь-«пассажира» содержит 2'-ОМе модификации сахара в нуклеотидах в положениях 1, 2, 20, 21, 22 и 23 и активная цепь содержит 2'-ОМе модификации сахара в нуклеотидах в положениях: а) 11, 12, 15 и 16; b) 3, 4, 11 и 12; с) 3, 4, 15 и 16; или d) 11, 12, 13, 14, 15, 16, 17 и 18.

11. Двухцепочечная молекула РНК с тупыми концами по п.1, в которой цепь-«пассажира» содержит 2'-ОМе модификации сахара в нуклеотидах в положениях 1, 2, 3, 4, 22 и 23 и активная цепь содержит 2'-ОМе модификации сахара в нуклеотидах в положениях: а) 11, 12, 15 и 16; b) 3, 4, 11 и 12; с) 3, 4, 15 и 16; или d) 11, 12, 13, 14, 15, 16, 17 и 18.

12. Двухцепочечная молекула РНК с тупыми концами по п.1, в которой цепь-«пассажира» содержит 2'-ОМе модификации сахара в нуклеотидах в положениях 1, 2, 5, 6, 22 и 23 и активная цепь содержит 2'-ОМе модификации сахара в нуклеотидах в положениях: а) 11, 12, 15 и 16; b) 3, 4, 11 и 12; с) 3, 4, 15 и 16; или d) 11, 12, 13, 14, 15, 16, 17 и 18.

13. Двухцепочечная молекула РНК с тупыми концами по п.1, в которой цепь-«пассажира» содержит 2'-ОМе модификации сахара в нуклеотидах в положениях 1, 2, 19, 20, 22 и 23 и активная цепь содержит 2'-ОМе модификации сахара в нуклеотидах в положениях: а) 11, 12, 15 и 16; b) 3, 4, 11 и 12; с) 3, 4, 15 и 16; или d) 11, 12, 13, 14, 15, 16, 17 и 18.

14. Двухцепочечная молекула РНК с тупыми концами по любому из пп.1-13 для применения в качестве лекарственного средства.

15. Двухцепочечная молекула РНК с тупыми концами по любому из пп.1-13 для применения в лечении рака.



 

Похожие патенты:

Изобретение относится к области биотехнологии, а именно к молекулярно-генетическим способам диагностики точечных мутаций в нативной ДНК. Сущность способа заключается в том, что для диагностики точечной мутации (замены, инсерции, делеции) в нативной ДНК проводится аллель-специфичная ПЦР с двумя флуоресцентно меченными прямыми праймерами, комплементарными последовательностям ДНК разных аллелей в области сайта мутации, и обратным общим праймером с последующим добавлением суспензии оксида графена (в качестве селективного наноструктурного тушителя флуоресценции) к продуктам ПЦР и измерением интенсивностей флуоресценции конечного раствора по двум каналам флуоресценции, соответствующим флуоресцентным меткам прямых праймеров.

Изобретение относится к биохимии. Описаны модифицированные олигонуклеотиды длиной от 15 до 30 нуклеотидов, содержащие по меньшей мере одну модификацию, причем указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Изобретение относится к молекулярной биологии и медицине. Способ представлен выявлением и идентификацией наиболее перспективных полиморфизмов генов, определяющих повышенный риск развития ишемического инсульта (РР ИИ).

Изобретение относится к области биотехнологии, конкретно к клеточным технологиям, и может быть использовано в медицине для получения лекарственного средства для лечения рака.

Настоящее изобретение относится к антисмысловым олигонуклеотидам, модулирующим экспрессию гена развития поджелудочной железы, в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами гена развития поджелудочной железы.
Изобретение относится к области клинической лабораторной диагностики. Предложен способ оценки готовности раневой поверхности к пластическому закрытию с использованием метода полимеразной цепной реакции (ПЦР).

Изобретение относится к области генной инженерии, конкретно к наборам синтетических олигонуклеотидов, и может быть использовано для определения уровней экспрессии основных изоформ гена PDLIM4.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Изобретение относится к биохимии. Описаны олигонуклеотиды, повышающие экспрессию гена РНКазы H1 путем нацеленного контакта с природными антисмысловыми полинуклеотидами РНКазы H1.

Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, модулирующие экспрессию связывающего половые гормоны глобулина (ГСПГ), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами связывающего половые гормоны глобулина (ГСПГ).

Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, модулирующие экспрессию ядерного респираторного фактора 1 (NRF1), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами ядерного респираторного фактора 1 (NRF1). При этом антисмысловой олигонуклеотид представляет собой олигонуклеотид длиной от 19 до 30 нуклеотидов, который специфически гибридизуется с природным антисмысловым полинуклеотидом NRF1 и имеет последовательность, по меньшей мере на 90% идентичную последовательности, обратно комплементарной участку в рамках от 1 до 810 нуклеотида последовательности SEQ ID NO: 2, или имеет последовательность, по меньшей мере на 90% идентичную участку последовательности SEQ ID NO: 1, причем указанный олигонуклеотид необязательно содержит одну или более модификаций, выбранных из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций. Изобретение также относится к их применению для лечения заболеваний и расстройств, связанных с экспрессией NRF1. Изобретение позволяет повышать экспрессию гена ядерного респираторного фактора 1. 6 н. и 24 з.п. ф-лы, 1 ил., 2 пр.

Настоящее изобретение относится к биотехнологии. Предложен иммуностимулирующий неметилированный CpG-олигодезоксинуклеотид, вектор экспрессии, его содержащий, вакцина для предотвращения или борьбы с инфекционным заболеванием у птиц, содержащая указанные олигодезоксинуклеотид и/или вектор экспрессии и иммунологическое количество антигенного компонента, выделенного из патогенного для птичьих вируса или микроорганизма, а также применение олигодезоксинуклеотида в качестве лекарственного средства и для предотвращения инфекции у птичьих. Предложенный олигодезоксинуклеотид обладает высоким иммуномодулирующим действием и может быть использован в ветеринарии в качестве эффективного иммуностимулирующего компонента в вакцинах против инфекционных заболеваний птиц совместно с антигенным компонентом, выделенным из вируса или микроорганизма патогенного для птичьих. 5 н. и 24 з.п. ф-лы, 32 ил., 3 табл., 24 пр.

Изобретение относится к области биотехнологии, конкретно к подавлению экспрессии генов цитокинов миРНК, и может быть использовано в медицине. Способ включает интраназальное или ингаляционное введение субъекту эффективного количества средства, содержащего смесь молекул миРНК, подавляющих экспрессию гена IL-13 и IL-4. Изобретение позволяет повысить эффективность лечения аллергической бронхиальной астмы. 1 з.п. ф-лы, 11 ил., 2 табл., 4 пр.
Наверх