Биологический днк-маркер для определения примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки



Биологический днк-маркер для определения примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки
Биологический днк-маркер для определения примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки

 


Владельцы патента RU 2615449:

Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В. Ломоносова" (МГУ) (RU)

Изобретение относится к области биохимии, в частности к биологическому ДНК-маркеру для определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки, а также к способу определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки в исследуемых образцах с его использованием. Изобретение может быть использовано для оценки качества поступающего сырья на мукомольных комбинатах и макаронных фабриках, также для оценки качества продукции из муки твердой пшеницы на протяжении всей производственной цепи, в том числе санитарно-эпидемиологических экспертиз, сертификационных испытаний. 2 н.п. ф-лы, 4 ил., 1 пр.

 

Область техники

Изобретение относится к области биотехнологии и пищевой промышленности и предназначено для обнаружения примеси муки мягкой пшеницы (Т. aestivum) в муке твердой пшеницы (Т. durum) и продуктах ее переработки (макаронных изделиях, крупах и др.).

Изобретение представляет собой биологический ДНК-маркер, включающий высокоспецифичные олигонуклеотидные последовательности, для определения качества муки твердой пшеницы и качества производимых из нее продуктов питания (макаронных изделий, круп) путем проведения анализа методом ПЦР.

Изобретение предназначено для качественного обнаружения ДНК мягкой пшеницы в муке твердой пшеницы и производимых из нее продуктах питания (макаронные изделия, крупа и пр.). Использование биологического ДНК-маркера позволяет определить содержание ДНК твердой и мягкой пшеницы в исследуемом образце и избежать возможности получения ложного результата. Оригинальный подбор олигонуклеодидных последовательностей для качественного определения наличия геномной ДНК мягкой пшеницы в муке твердой пшеницы и производимых из нее продуктах питания обеспечивает высокую специфичность предлагаемого маркера и достоверность получаемых результатов. Благодаря высокой чувствительности метод позволяет детектировать наличие не менее 0,1% примесей ДНК мягкой пшеницы в общей ДНК исследуемого материала.

Изобретение может быть использовано на мукомольных комбинатах и макаронных фабриках для оценки качества поступающего сырья, также для оценки качества готовой продукции из муки твердой пшеницы, в том числе для проведения санитарно-эпидемиологических экспертиз и сертификационных испытаний.

Уровень техники

Согласно стандартам (ГОСТ 52668-2006 - Мука из твердой пшеницы для макаронных изделий. Технические условия и ГОСТ P 31743-2012 - Изделия макаронные. Общие технические условия) сырьем для изготовления макаронных изделий группы A, а также ряда круп (манная крупа, кускус, булгур) является мука твердой пшеницы Т. durum, что связано с особенностями консистенции эндосперма зерен Т. durum, а именно стекловидностью, обусловленной тесной связью белковых веществ с крахмальными зернами. Стекловидное зерно имеет плотную структуру, отличается высокой механической прочностью и имеет высокие технологические качества при переработке, что определяет ее преимущества при производстве макаронных изделий и круп. При специальных сортовых помолах стекловидное зерно твердой пшеницы превращается в макаронную муку высшего сорта или крупку. Использование муки из твердой пшеницы сказывается на физико-механических свойствах макаронного теста. Изделия из него обладают большой прочностью (не крошатся), большой развариваемостью (значительным увеличением объема без потери частиц и ослизнения), хорошим сохранением формы.

Из-за высокой цены на муку твердой пшеницы часто при изготовлении макаронных изделий в исходное сырье могут добавлять муку мягкой пшеницы, что значительно удешевляет конечный продукт и существенно снижает потребительские качества макаронных изделий. Качество макаронных изделий обратно пропорционально количеству примесей муки мягкой пшеницы в исходном сырье.

В настоящее время для обнаружения чужеродных примесей в растительном материале и продуктах на его основе (крупа, экстракты и проч.) используют методы, основанные на качественной идентификации либо чужеродных белков, либо нуклеиновых кислот.

Большинство современных способов дифференциации ДНК мягкой и твердой пшеницы основаны на различиях в их геномном составе. Твердая пшеница Triticum durum является тетраплоидным видом с гаплоидным геномным составом AB, в то время как мягкая пшеница Triticum aestivum - гексаплоидный вид с гаплоидным геномным составом ABD.

Предлагаемое изобретение представляет собой биологический ДНК-маркер для определения примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки. Маркер представляет собой набор из двух синтетических олигонуклеотидов, гомологичных последовательности гена Lr34 пшеницы (фиг. 4). Ортологичные гены Lr34 локализуются как в геноме В (ген Lr34B), так и в геноме D (ген Lr34D) и отличаются своей нуклеотидной последовательностью. Подход основан на различиях в первичных последовательностях Lr34B гена в геноме В твердой пшеницы Т. durum и последовательности гена Lr34D в D геноме Т. aestivum.

При проведении ПЦР реакции в случае присутствия в образце (зерно, мука и продукты переработки) ДНК только твердой пшеницы в результате амплификации будет идентифицирован только один фрагмент гомологичный последовательности гена Lr34B B генома Т. durum длиной 1027 п.н., в случае присутствия в образце только ДНК мягкой пшеницы - фрагмент длиной 622 п.н., гомологичный последовательности гена Lr34D D генома Т. aestivum. В случае наличия примесей ДНК мягкой пшеницы в образце твердой пшеницы будут амплифицированы два фрагмента длиной 1027 п.н. и 622 п.н. Чувствительность предлагаемого способа определения составляет не менее 0,1% примесей ДНК мягкой пшеницы в тотальной ДНК анализируемого образца.

Таким образом, предлагаемый биологический ДНК-маркер для определения присутствия примесей геномной ДНК мягкой пшеницы в муке твердой пшеницы и в продуктах, получаемых на ее основе, позволяет в одной ПЦР реакции детектировать присутствие ДНК как мягкой, так и твердой пшеницы и избежать ложноотрицательных результатов по присутствию примесей мягкой пшеницы.

Возможность детекции в одной реакции ПЦР ДНК как твердой, так и мягкой пшеницы значительно сокращает время проведения диагностики за счет уменьшения числа технологических операций при проведении анализа.

Был проведен патентный поиск, который показал наличие ряда методов определения качества муки твердой пшеницы и продуктов ее переработки, в том числе возможность детекции примесей мягкой пшеницы.

Существует способ определения качества муки твердой пшеницы, который основан на исследовании содержания белка, клейковины, цвета, зольности, крупности помола, активности ряда ферментов и др. [Ирвин Г.Н. Пшеница дурум и макаронные изделия // В кн.: Пшеница и оценка ее качества. - М.: Колос.- 1968. - С. 459-475]. Способ характеризуется высокой трудоемкостью и не позволяет говорить об отсутствии примесей мягкой пшеницы в муке твердой пшеницы.

В настоящее время для обнаружения примесей в муке и продуктах переработки твердой пшеницы (крупа, экстракты и проч.) используют подходы, основанные на качественной идентификации вторичных метаболитов, белков или последовательностей нуклеиновых кислот.

Известен ряд методов, позволяющих определять наличие примесей мягкой пшеницы в продуктах из твердой пшеницы. Большинство из них основаны на детекции продуктов экспрессии генов, представленных в D-геноме мягкой пшеницы и отсутствующих в геноме твердой пшеницы. Подобные методы основаны на детекции наличия в исследуемом материале специфичных альбуминов и глиадинов, характерных для мягкой пшеницы (P. Resmini, Tec Molitona (1968) 19, 145-150, P. Resmini et al. Tec. Molitona 27. 97-109). Также белковые методы могут быть основаны на определении наличия ферментов полифенолоксидаз и эстераз, которые кодируются D-геномом мягкой пшеницы (Feillet. P and Kobrehel, К. (1972) Ann. Technol. Agπc. 21, 17-24, Feillet, P and Kobrehel, K. (1974). Cereal Chem. 51. 203-209) и (Cooke, R.J. Smith, T.M. and Ainsworth, C.C. (1986). Seed Sci Technol. 14, 693-704.). Однако белковые методы достаточно трудоемки и часто не обладают высокой чувствительностью, что связано с возможными различиями в белковой экспрессии при разных условиях выращивания пшеницы. Также методы белковой детекции имеют существенные недостатки, так как в процессе производства макаронных изделий белки в большинстве своем разрушаются из-за использования высокой температуры и быстрого высушивания, что говорит о невозможности установления единого стандарта белковой детекции примесей мягкой пшеницы.

Большая группа методов детекции примесей мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки основана на ПЦР идентификации специфических участков ДНК, характерных для D генома мягкой пшеницы.

Известен способ детекции примесей мягкой пшеницы с использованием ДНК высоко повторяющейся последовательности Dgas44, которая, как принято считать, локализуется исключительно на D геноме гексаплоидной пшеницы (Патент WO 1998004737).

Стоит отметить, что существенным недостатком метода является необходимость использования нескольких праймерных пар для достижения достоверного результата. Кроме того, анализ последовательностей, представленных в геноме во множестве копий, могут приводить к неоднозначным результатам амплификации.

Для более точной детекции ДНК-последовательностей, специфичных для D генома мягкой пшеницы, используются монокопийные ДНК-последовательности (нетранслируемый регион гена WaxyD, гены TaSUT1, CbpIII и Lr1). Однако, разработанная в результате система из множества праймеров достаточно трудоемка и сложна в использовании (Патент EP 1736543).

Наиболее близким аналогом (прототипом) изобретения является способ определения примеси муки мягкой пшеницы в крупке (семолине) твердой пшеницы и в готовой продукции макаронной промышленности, основанный на ПЦР детекции с использованием пары специфичных для D генома мягкой пшеницы олигонуклеотидных праймеров, гомологичных области внешнего транскрибируемого спейсера высокоповторяющихся генов рибосомных РНК локуса NorD3. По факту обнаружения в продуктах ПЦР соответствующей ДНК-последовательности размером 791 п.н. судят о загрязненности ("фальсифицированности") крупки твердой пшеницы мукой из мягкой пшеницы. Недостатком данного метода является возможность получения ложноотрицательного результата, так как отсутствие продуктов реакции может указывать не только на отсутствие D-генома (мягкой пшеницы) в исследуемом образце, но и быть следствием некачественно проведенной ПЦР, что связано с необходимостью проводить отдельно контрольные реакции (патент RU 2249046).

В предлагаемом нами методе исключена возможность подобной ошибки, так как разработанная тест-система на основе последовательности монокопийного гена Lr34 уже несет в себе внутренний контроль, и на элекрофорезе будет визуализирован фрагмент ДНК 1027 п.н. (в случае присутствия ДНК только твердой пшеницы), либо 622 п.н. (в случае присутствия ДНК только мягкой пшеницы), либо оба фрагмента (в случае присутствия ДНК обоих видов пшеницы). Отсутствие амплифицированных фрагментов говорит о неправильно проведенной реакции.

Раскрытие изобретения

Задачей предлагаемого изобретения является создание биологического ДНК-маркера для обнаружения примесей геномной ДНК мягкой пшеницы в муке твердой пшеницы и в продуктах, получаемых на ее основе, а также способа, основанного на использовании маркера.

Поставленная задача решается тем, что создан биологический ДНК-маркер для определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки, представляющий собой олигонуклеотидные праймеры - затравки полимеразной реакции - SEQ ID №1 5'-CCTCAAATGATCAATTATGTGCAAC-3' и SEQ ID №2 5'GTCAGTGTGGACACTTAGTTC -3'.

Также поставленная задача решается способом определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки путем проведения анализа методом ПЦР, включающим выделение ДНК, проведение амплификации с использованием биологического ДНК-маркера по п. 1, и в случае выявления в продуктах ДНК-амплификации исследуемых образцов фрагмента гена ортолога Lr34 длиной 622 п.н. делают вывод о наличии примеси муки мягкой пшеницы.

Технический результат заключается в повышении точности определения присутствия примесей муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки при снижении риска получения ложноотрицательного результата.

Оригинальный подбор олигонуклеотидных последовательностей для качественного определения наличия геномной ДНК мягкой пшеницы в муке твердой пшеницы и производимых из нее продуктах питания обеспечивает высокую специфичность предлагаемого маркера и достоверность получаемых результатов. Благодаря высокой чувствительности метод позволяет детектировать наличие не менее 0,1% примесей ДНК мягкой пшеницы в общей ДНК исследуемого материала.

Предлагаемый нами метод имеет явное преимущество перед имеющимися ранее изобретениями за счет сокращения времени проведении анализа и повышения точности диагностики.

На дату подачи заявки на предлагаемое изобретение в патентной и научно-технической литературе по совокупности признаков не было обнаружено аналогичной, тождественной или эквивалентной заявляемой.

Краткое описание чертежей

На фиг. 1 показаны фрагменты ДНК, выявленные с помощью олигонуклеотидных последовательностей SEQ ID №1 и SEQ ID №2 из образцов ДНК сортов мягкой пшеницы Т.aestivum (1 - Родина, 2 - Чайнинг Спринг, 3 - Чернява, 4 - Марафон, 5 - Галина, 6 - Новосибирская 40, 7 - Памяти Федина, 8 - Заря, 9 - Омская озимая, 10 - Красота, 11 - Жатва Алтая, 12 - Княжна, 13 - Умка) и твердой пшеницы Т.durum (14 - Мироновская 808, 15 - Московская 39, 16 - Алтайская 60, 17 - Альбидум 28, 18 - Башкирская 24, 19 - Новосибирская 29, 20 - Полюшко, 21 - Прикумская 124, 22 - Краснокутка 10, 23 - Дончанка, 24 - Безенчукская степная). М - маркер молекулярных масс (отмечены фрагменты молекулярной массой 1000, 500 п.н.).

На фиг. 2 представлены фрагменты ДНК, выявленные с помощью олигонуклеотидных последовательностей SEQ ID №1 и SEQ ID №2 из макаронных изделий различных производителей: 1. Ambra (Италия)*, 2. Dell Castello (Италия)*, 3. Barilla (Италия)*, 4. La molisana (Италия)*, 5. Лапша Удон (Китай)**, 6. Смак экстра (Россия, группы В)***, 7. Знатные (Россия, группа А)*, 8. Доширак (Россия, группа А)*, 9. Глобус (Россия, группа А)*. М - маркер молекулярных масс (отмечены фрагменты молекулярной массой 1000 и 500 п.н.)

* - на маркировке обозначено «мука из твердой пшеницы высшего сорта»

** - на маркировке обозначено «мука из мягкой пшеницы высшего сорта»

*** - на маркировке обозначено «мука пшеничная хлебопекарная, мука из твердой пшеницы второго сорта»

На фиг. 3 представлены фрагменты ДНК, выявленные с помощью олигонуклеотидных последовательностей SEQ ID №1 и SEQ ID №2 из образцов с различным содержанием примесей муки мягкой пшеницы в муке твердой пшеницы. М - маркер молекулярных масс (отмечены фрагменты молекулярной массой 1000 и 500 п.н.).

Осуществление изобретения

С целью обнаружения примесей мягкой пшеницы в объекте исследования проводится экстракция ДНК из тестируемых продуктов (мука, макаронные изделия, крупы и пр.).

1. Экстракция ДНК из тестируемого объекта.

Выделение ДНК из зерен мягкой и твердой пшеницы и продуктов переработки (мука, макаронные изделия, крупы и пр.)

Объект исследования

В качестве объектов исследования использовали измельченные зерна сортов твердой и мягкой пшеницы, а также продуктов переработки: мука, макаронные изделия, изготовленные различными производителями (Россия, Китай и Италия).

Экстракция ДНК

ДНК выделяли согласно протоколу Булыгина и др., 2009. Образцы при необходимости измельчали в ступке. Небольшое количество образца (75-100 мг) суспендировали в 200 мкл буфера I (50 мМ трис-HCl pH 8.0; 5 мМ ЭДТА; 50 мкг/мл панкреатической РНКазы) с помощью гомогенизатора (Vortex, Германия) в течение 3-5 минут (до получения гомогенной суспензии), после чего к полученной суспензии добавляли 300 мкл лизирующего буфера II (0.2 М NaOH, 1% раствор додецилсульфата натрия, pH 12.0) и тщательно перемешивали путем пипетирования. Затем добавляли 300 мкл нейтрализующего буфера III (2.5 М раствор ацетата калия, pH 4.5) и повторно суспендировали в течение 20 сек. Смесь центрифугировали при 11000g в течение 3 мин. Супернатант подвергали дополнительной очистке с помощью набора реактивов Wizard DNA Preps (Promega, США) согласно рекомендациям производителя.

2. Оценка качества и количества экстрагированной ДНК.

Оценку качества и количества экстрагированной ДНК проводили путем измерения оптической плотности раствора ДНК на спектрофотометре (Bio Photometer, Eppendorf или SmartSpec 3000, Bio-Rad, США, Qubit, Invitrogen) или при помощи аналитического электрофореза.

3. Полимеразная цепная реакция (ПЦР).

Выделенную ДНК использовали в качестве матрицы в реакции амплификации.

Амплификацию ДНК проводили в реакционной смеси объемом 15 мкл, содержащей 10х буфер для соответствующей полимеразы, 0,16 мМ каждого dNTP, 1.2 мМ MgCl2, 0.6 мкМ биологического ДНК-маркера (в эквимолярном соотношении каждого из олигонуклеотидных праймеров), 0.3 ед DreamTaq полимеразы (Fermentas, Литва) и 100 нг геномной ДНК в ДНК-амплификаторе «Applied Biosystems 2700» (США) в режиме: денатурация - 30 с - 94°C; отжиг - 40 с - 59°C; синтез ДНК - 1 мин 20 с - 72°C (35 циклов) с предварительной денатурацией - 5 мин (94°C) и заключительной элонгацией PCR-фрагментов 10 мин - 72°C.

4. Электрофоретическое разделение и визуализация ПЦР-продуктов.

Продукты амплификации анализировали путем проведения аналитического электрофореза в 1% агарозном геле, содержащем бромистый этидий в 1х ТВЕ буфере. В качестве маркеров молекулярного веса использовали Gene Ruler™ DNA Ladder Mix ("Fermentas", Литва). Разделение фрагментов в геле осуществлялось в течение 30-45 минут при 75-100V.

Визуализацию проводили путем окрашивания гелей бромистым этидием согласно инструкции производителя, с последующим фотодокументированием.

Размер амплифицируемых продуктов определяли с помощью маркера молекулярных масс GeneRuler™ DNA Ladder mix ("Fermentas", Литва).

Детекцию для каждого образца осуществляли в трехкратной повторности. В качестве отрицательного контроля использовали ddH2O.

Пример. Способ идентификации примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки

Из зерен 11 сортов твердой пшеницы Triticum durum и 13 сортов мягкой пшеницы Triticum aestivum, а также из 9 образцов макаронных изделий получали ДНК вышеописанным методом. В качестве отрицательного контроля использовали ДНК риса.

В качестве отрицательного контроля может быть взята ДНК растений любого вида (например, овса, ржи, риса) или продуктов их переработки (мука, каши и пр.). Эти виды предположительно несут наиболее схожие гомологичные последовательности гена Lr 34. Таким образом, отсутствие амплификации фрагмента будет подтверждать высокую специфичность проводимой реакции амплификации.

ДНК, выделенную из каждого исследуемого образца, использовали в качестве матрицы для проведения полимеразной цепной реакции при описанных выше условиях с использованием биологического ДНК-маркера, представленного последовательностями SEQ ID №1 и SEQ ID №2.

Полученные продукты амплификации визуализировали путем электрофореза в геле. Размер полученных фрагментов при наличии в образце ДНК твердой пшеницы Triticum durum должен составлять 1027 п.н., при наличии ДНК мягкой пшеницы Triticum aestivum - 622 п.н. (фиг. 1).

В случае примесей ДНК муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки будут присутствовать два фрагмента (фиг. 2, 3). При определении чувствительности метода использовалась искусственная модельная система, в которой при проведении ПЦР реакции к ДНК твердой пшеницы добавлялась ДНК мягкой пшеницы в концентрациях 10%, 1%, 0.1%, 0.01%, 0.001% (фиг. 3).

При проведении анализа коммерческой продукции (фиг. 2) в ряде случаев выявлено несоответствие между указанным на упаковке составом и реальным присутствием примесей мягкой пшеницы в макаронных изделиях.

Таким образом, использование биологического ДНК-маркера приводит к специфической амплификации фрагментов различной длины у образцов муки мягкой и твердой пшеницы, что позволяет однозначно определять наличие примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки по присутствию ДНК-амплификации исследуемых образцов двух фрагментов (1027 и 622 п.н.).

1. Биологический ДНК-маркер для определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки, представляющий собой олигонуклеотидные праймеры - затравки полимеразной реакции - SEQ ID №1 5'-CCTCAAATGATCAATTATGTGCAAC-3' и SEQ ID №2 5'-GTCAGTGTGGACACTTAGTTC-3'.

2. Способ определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки в исследуемых образцах, включающий выделение ДНК, проведение амплификации с использованием биологического ДНК-маркера по п. 1, и в случае выявления в продуктах ДНК-амплификации исследуемых образцов фрагмента гена ортолога Lr34 длиной 622 п.н. делают вывод о наличии примеси муки мягкой пшеницы.



 

Похожие патенты:

Изобретение относится к области медицины и предназначено для прогнозирования устойчивости к инотропной терапии у новорожденных с артериальной гипотензией. Из образцов периферической крови выделяют ДНК.

Изобретение относится к области биохимии. Описано изобретение, включающее способ отбора нуклеиновых кислот по размеру.

Изобретение относится к биохимии. Описан способ определения чувствительности роста опухолевых клеток к ингибированию с помощью ингибитора киназы EGFR, включающий определение статуса метилирования гена ERBB2 в опухолевой клетке образца, причем пониженный уровень метилирования гена ERBB2 означает, что менее чем 50% возможных сайтов метилирования в части гена ERBB2 являются метилированными, и указывает на то, что рост опухолевых клеток чувствителен к ингибированию с помощью ингибитора EGFR.

Изобретение относится к области биохимии, в частности к растению трансгенной кукурузы, которое является устойчивым к гербицидам 2,4-D и хизалофопу, его семени и части.

Настоящее изобретение направлено на методы выявления в образце мутаций в ДНК, где мутантная ДНК присутствует на фоне избытка немутантной ДНК. В некоторых применениях немутантная ДНК присутствует в образце в тысячекратном избытке.

Изобретение относится к области медицины и предназначено для диагностики раннего неонатального сепсиса (РНС) у новорожденных первых суток жизни. В клетках буккального соскоба измеряют уровни экспрессии генов IL12A и CD68 относительно представленности мРНК референсных генов В2М, GUS, ТВР или HPRT.

Группа изобретений относится к области биотехнологии, а именно к способам идентификации модифицированных остатков цитозина в исследуемой нуклеотидной последовательности.

Изобретение относится к области биотехнологии, конкретно к маркерам гипертиреоза, и может быть использовано в медицине для диагностики гипертиреоза у кошки. Способ диагностики гипертиреоза у кошки включает: (a) определение уровня нуклеиновой кислоты, кодирующей пептид натрий-йодного симпортера кошки с SEQ ID NO: 2, в биологическом образце кошки; и (b) сравнение уровня нуклеиновой кислоты с референсным уровнем указанной нуклеиновой кислоты, определенным у контрольных кошек без гипертиреоза, где биологический образец содержит ткань, клетку или биологическую жидкость, содержащую ДНК или РНК.

Изобретение относится к области молекулярной биологии и диагностической медицины. Описан способ определения последовательностей экзонов генов BRCA1 и BRCA2.

Изобретение относится к биотехнологии. Описан способ детектирования и характеризации токсиногенного штамма Clostridium difficile в пробе, в котором выполняют следующие стадии: a.

Настоящее изобретение относится к биотехнологии, конкретно к рекомбинантным модификациям аллергенов группы 6 Poaceae (мятликовых), и может быть использовано в медицине для предупреждения или терапевтического лечения аллергий типа 1, в инициирование которых вовлечены аллергены группы 6 мятликовых.

Изобретение относится к области биохимии, в частности к векторам для экспрессии белков в растениях. Представлены варианты трансгенного растения, предназначенного для экспрессии фермента, деградирующего клеточную стенку.

Изобретение относится к области биохимии, в частности к агенту для придания растению устойчивости к ингибитору 4-HPPD, включающему ДНК, кодирующую белок, обладающий активностью, придающей растению устойчивость к ингибитору 4-HPPD.

Изобретение относится к области биохимии, в частности к гипоаллергенному полипептиду семейства злаковых. Также раскрыты молекула ДНК, кодирующая вышеуказанный гипоаллергенный полипептид, рекомбинантный вектор экспрессии, содержащий указанную молекулу ДНК, и клетка-хозяин, трансформированная посредством указанной молекулы ДНК или указанным вектором, для получения вышеуказанного гипоаллергенного полипептида.

Изобретение относится к области биохимии, в частности к способам получения растения с повышенной устойчивостью к засухе и действию солей по сравнению с диким видом растения путем снижения экспрессии/функции белка-фактора транскрипции у растения.

Изобретение относится к области биохимии, в частности к применению гена, кодирующего белок, который состоит из аминокислотной последовательности, представленной в SEQ ID NO.2, для получения трансгенного риса с длинными, большими и многочисленными зернами и увеличенной урожайностью, увеличенным количеством зерен в метелке и скрученными листьями.

Изобретение относится к области биотехнологии. Представлены: выделенный из томата полинуклеотид, соответствующий SEQ ID NO:1, представленной в описании, или полинуклеотид, который имеет, по меньшей мере, 70% идентичность с нуклеотидной последовательностью SEQ ID NO:1, или их фрагмент, которые кодируют полипептид с активностью фарнезен-синтазы, соответствующий SEQ ID NO:2, представленной в описании, или имеющий, по меньшей мере, 70% идентичность с аминокислотной последовательностью, соответствующей SEQ ID NO:2, или их фрагмент.

Изобретение относится к области биохимии, в частности к композициям для интенсивной продукции целевого белка в эукариотических клетках, включающим ДНК-вектор со вставкой гена целевого белка и агонист клеточных рецепторов.

Изобретение относится к области биохимии, в частности к гену звездчатки Stellaria media, кодирующему антимикробный пептид звездчатки Stellaria media Sm-AMP-Х, обладающему последовательностью SEQ ID №1.

Изобретение относится к области биохимии, в частности к растению, обладающему повышенной устойчивостью к AHAS-ингибирующему гербициду, включающему, по крайней мере, одну Shiloh-8 IMI нуклеиновую кислоту, его части, растительной клетке и семени.

Изобретение относится к области биотехнологии, молекулярной биологии, молекулярно-генетической диагностики вирусных болезней животных. Описан способ выявления ДНК провируса лейкоза и иммунодефицита крупного рогатого скота методом мультиплексной ПЦР. Также описан набор для осуществления этого способа, содержащий две пары прямых и обратных олигонуклеотидных праймеров для выявления провирусов энзоотического лейкоза и иммунодефицита крупного рогатого скота. Предложенная группа изобретений может быть использована в научных исследованиях и ветеринарии. 2 н.п. ф-лы, 5 ил., 3 табл., 2 пр.
Наверх