Пептиды ledgf и их композиции для лечения дегенеративных заболеваний

Изобретение относится к области биотехнологии, конкретно к получению фрагментов полноразмерного фактора роста эпителия хрусталика глаза (LEDGF), и может быть использовано в медицине. Получают фрагмент LEDGF с SEQ ID NO: 2, который используют в фармацевтических композициях для лечения заболеваний, связанных с агрегацией белка. Изобретение позволяет эффективно лечить заболевания, связанные с агрегацией белка, в частности глазные заболевания. 4 н. и 11 з.п. ф-лы, 31 ил.

 

РОДСТВЕННЫЕ ЗАЯВКИ

[0001] Настоящая заявка испрашивает приоритет согласно предварительной заявке на патент США №61/649,847, поданной 21 мая 2012 г, и международной патентной заявке № PCT/US 2012/065620, поданной 16 ноября 2012 г. Содержание вышеназванных приоритетных заявок полностью включено в настоящую заявку посредством ссылки.

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

[0002] Настоящее изобретение относится к новым пептидам фактора роста, выделяемого из эпителия хрусталика глаза (LEDGF), и их композициям для использования в лечении дегенеративных заболеваний и заболеваний, сопровождающихся различными видами клеточного стресса, в том числе оксидативного стресса и стресса, связанного с агрегацией белков. В частности, настоящее изобретение относится к новым композициям LEDGF1-326, характеризующимся улучшенной стабильностью, непрерывной доставкой, и их использованию в лечении заболеваний, связанных с агрегацией белка, возрастных заболеваний и дегенеративных заболеваний.

ПРЕДПОСЫЛКИ К СОЗДАНИЮ ИЗОБРЕТЕНИЯ

[0003] Заболевания заднего сегмента глаза, к которым относятся возрастная макулярная дегенерация (ВМД) и пигментный ретинит (ПР), являются основными причинами слепоты в США (Джагер и соавт., «МЕДИЦИНСКИЙ ЖУРНАЛ НОВОЙ Англии» (New England Journal of Medicine), 2008. 358(24): 2606-17). В настоящее время в США ВМД страдает свыше 8 миллионов человек. Ожидается, что к 2020 году это число достигнет 12 миллионов (Джагер и соавт.; Фридман и соавт.: журнал «Архивы офтальмологии» (Archives of Ophthalmology), 2004. 122(4): p.564-72). 90% всех случаев ВМД приходится на долю сухой формы ВМД (сухая ВМД), сопровождающейся хроническим оксидативным стрессом и воспалением (Либби и соавт.«Достижения в области эксперементальной медицины и биологии» (Advances in Experimental Medicine and Biology), 2010. 664: p.403-9; Стьэн. «Поколения» (Generations), 2003. 27: p.8-14). С другой стороны, ПР представляет собой наследственное заболевание, причиной которого являются свыше 50 генных мутаций (X. Огуро и соавт., Nihon Ganka Gakkai Zasshi, 2002. 106(8): p.461-73; Дрыджа (Dryja) и соавт., «Природа» (Nature), 1990. 343(6256): p.364-6.). В настоящее время во всем мире ПР страдает примерно 1,5 миллиона человек (Хартонг и соавт., «Ланцет» (Lancet), 2006. 368(9549): р. 1795-809).

[0004] Уникальность анатомии и физиологии глаза является главным препятствием в разработке лекарственного препарата для лечения заболеваний заднего сегмента глаза, в том числе дегенеративных заболеваний сетчатки (Компелла и соавт.«Оказание терапевтической помощи» (Ther Deliv). 1(3): p.435-56). При местном введении лекарственному препарату не удается достигнуть заднего сегмента глаза из-за различных статических (роговица, слизистая оболочка глаза и склера наряду с другими тканями) и динамических барьеров (моргание, слезная пленка, непроизвольное и вызванное слезотечение) (Р. Гаудана и соавт, «Доставка препаратов для офтальмологического лечения» (Ocular drug delivery). Дж. Эпс, 2010. 12(3): р. 348-60; Тримавитана и соавт «Современная разработка новых лекарственных средств» (Drag Discov Today), 2011. 16(5-6): p.270-7). С другой стороны, главными сложностями при внутривенном введении являются гематоретинальный барьер (ГРБ), системная дегенерация, системные побочные эффекты и низкая концентрация лекарственного препарата в мишени. Другие способы введения лекарственных препаратов, такие как введение в передний отдел глаза, периокулярный, субретинальный способы, имеют ряд недостатков, обладающих некоторыми сходствами с топическим и системным способами введения лекарственных препаратов (Бейд и соавт.«Разработка лекарственных препаратов и задняя стенка глаза» (Drug Development and the back of the eye). Изд. Компелла UB. 2010, p.409-448: Springer). При локальной доставке, такой, как интравитреальная инъекция, лекарственный препарат находится в непосредственной близости с сетчаткой глаза (тканью-мишенью, поражаемой при дегенеративных заболеваниях сетчатки), таким образом, именно при таком способе введения лекарственный препарат наиболее эффективно доставляется к сетчатке. Однако частые интравитреальные инъекции лекарственного препарата ведут к различным осложнениям, таким как отслоение сетчатки, ретинальное кровоизлияние, эндофтальмит, увеличение глазного давления, не считая соблюдение пациентом режима и схем лечения и развитие различных инфекций (Пеймен и соавт. «Сетчатка» (Retina), 2009. 29(7): р. 875-912.; By и соавт. "Семинары по офтальмологии» (Semin Ophthalmol), 2009. 24(2): p.100-5). Таким образом, существует потребность в соединениях и системе доставки, которые позволят лекарственным препаратам дольше задерживаться в глазу.

[0005] Новые системы доставки лекарственных препаратов, которые могут пролонгировать или контролировать высвобождение лекарственного средства в течение продолжительного времени, а также увеличить стабильность и биологическую доступность лечебных агентов, таких как белки, гены и низкомолекулярные соединения, привлекли к себе широкое внимание. Рассасывающиеся (полилактид-ко-гликолид, или ПЛГ, и поликапролактон, или ПКЛ) и нерассасывающиеся (например, витразет и ретизерт) имплантаты обеспечивают платформу для длительного высвобождения лекарственного средства в течение промежутка времени от нескольких месяцев до нескольких лет. Однако, использование рассасывающихся имплантатов, характеризующихся неравномерным высвобождением лекарственного вещества, равно как и проведение высокоинвазивной офтальмологической операции, имеет ряд недостатков. Микро- и наночастицы обеспечивают пролонгированное высвобождение инкапсулированных молекул в течение промежутка времени от нескольких недель до нескольких месяцев. Однако использование органических растворителей, таких, как дихлорметан, на подготовительном этапе вызывает денатурирование белков и снижение их эффективности, в результате чего становится неэффективным и все лечение. К прочим проблемам относятся дальнейшее поддержание эффективности инкапсулирования, контроль размеров частиц и стерильность на подготовительном этапе. Также испытаниям подвергались ионтофорез, применение микроигл, доставка лекарственных препаратов к тканям глаза при помощи ультразвука, однако наибольшие успехи были достигнуты при работе с низкомолекулярными лекарственными препаратами. Эти методы до сих пор находятся на этапе исследований и нуждаются в проверке их эффективности и безопасности. Таким образом, для успеха новых лекарственных препаратов против дегенерации сетчатки крайне важной становится безинвазивная или минимально инвазивная, контролируемая и пролонгированная доставка лекарственных препаратов к заднему сегменту глаза.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

[0006] Настоящее изобретение относится к биологически активным LEDGF-пептидам, которые могут быть произведены в большом количестве, с высокими показателями чистоты или с совмещением обоих показателей. К примеру, настоящее изобретение включает LEDGF-пептиды, которые могут быть произведены в количестве, равном или превышающем 20 мг на литр культуры и с чистотой, равной или превышающей 90%, в соответствии с измерениями, полученными при помощи ДСН-ПААГ-электрофореза и эксклюзионной ВЭЖХ. В одном варианте изобретения данный пептид является мономером массой примерно 40 кДа и может существовать в виде димера массой 80 кДа. В другом варианте изобретения данный пептид обладает преимущественно структурой случайной спирали и включает N-терминальный связанный со стрессом домен связывания, а также опционально - домен связывания ТАТ.

[0007] В другом варианте изобретения данный пептид содержит аминокислоты 1-326, входящие в состав LEDGF (LEDGF1-326). В еще одном варианте изобретения, данный пептид содержит аминокислотную последовательность №2. В другом варианте изобретения данный пептид содержит аминокислотную последовательность, которая идентична аминокислотной последовательности №1 по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95%. Кроме того, настоящее изобретение включает нуклеотидные последовательности, кодирующие аминокислотную последовательность №2, или нуклеотидные последовательности, кодирующие аминокислотные последовательности, которые идентичны последовательности №2 по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95%. Также настоящее изобретение включает векторы, содержащие такие нуклеотидные последовательности. В одном из вариантов изобретения таким вектором является вектор рЕТ-28а(+).

[0008] В другом аспекте настоящее изобретение относится к соединениям, в состав которых входит LEDGF-пептид. В одном варианте изобретения данное соединение является LEDGF-пептидом в сочетании с переносчиком лекарственного препарата, разбавителем, вспомогательным веществом или их комбинацией. В другом варианте изобретения данное соединение содержит LEDGF-пептид, ассоциированный или связанный с коллоидными металлическими частицами, такими как цинковые частицы, для образования наноансамблей. В еще одном варианте изобретения данные соединения содержат LEDGF-пептид, инкапсулированный или связанный с внутренней частицей, помещенной в пористую внешнюю частицу. В некоторых вариантах изобретения LEDGF-пептидом, использованным в вышеуказанных соединениях, является LEDGF1-326.

[0009] В другом аспекте настоящее изобретение относится к методам лечения заболеваний, связанных с агрегацией белка, путем назначения вышеуказанных соединений LEDGF-пептида нуждающимся в них пациентам. В некоторых вариантах изобретения заболеваниями, связанными с агрегацией белка, являются дегенеративные заболевания сетчатки. Примеры дегенеративных заболеваний сетчатки включают, но не ограничиваются ими, возрастную макулярную дистрофию (ВМД), пигментный ретинит (ПР) и диабетическую ретинопатию (ДР). В другом варианте изобретения заболеваниями, связанными с агрегацией белка, являются нейродегенеративные заболевания, включающие, но не ограничивающиеся ими, болезнь Альцгеймера (БА), болезнь Паркинсона (БП), болезнь Хантингтона (БХ), боковой амиотрофический склероз или прионную болезнь.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ ОБЪЕКТОВ

[0010] Рисунок 1 - иммуноблот очищенного непроцессированного LEDGF. Из рисунка видно, что попытки очистить непроцессированный LEDGF закончились получением нестабильного и фрагментированного продукта.

[0011] Рисунок 2 - диаграмма, сопоставляющая непроцессированные LEDGF и LEDGF1-326.

[0012] Рисунок 3 - изображение успешного клонирования нуклеотидной последовательности, кодирующей LEDGF1-326, в вектор рЕТ-28 а (+), на агарозном геле. Ген, кодирующий Ledgf1-326, амплифицировали с помощью ПЦР и затем вшили в вектор рЕТ-28 а(+). Ряд 1: Ген Ledgf1-326, амплифицированный с помощью ПЦР, ряд 2: неразрезанный кольцевой вектор рЕТ-28 а(+), ряд 3: линейный ветор рЕТ-28а(+), расщепленный рестриктазой BamHI, ряд 4: неразрезанная кольцевая плазмида pLEDGF1-326 (рЕТ-28 а (+), сшитый с Ledgf1-326), ряд 5: линейная плазмида pLEDGF1-326, расщепленная рестриктазой BamHI, ряд 6: линейная pLEDGF1-326, расщепленная рестриктазой HindIII, ряд 7: плазмида pLEDGF1-326, расщепленная BamHI и HindIII, ряд 8: амплификация гена Ledgf1-326 из плазмиды pLEDGF1-326 методом ПНР.

[0013] Рисунки 4А-С - графики, отображающие успешную экспрессию и очистку LEDGF1-326: А) ДСН-ПААГ - ряд 1: маркер белка производства компании «Ферментас» (Fermentas, г. Глен-Берни, штат Мэриленд, США), ряд 2: неиндуцированный клеточный лизат, ряд 3: клеточный лизат, индуцированный ИПТГ, ряд 4: растворимая фракция лизата, ряд 5: LEDGF1-326, полученный из ЖЭХБ-катионообменной колонки, ряд 6: LEDGF1-326, полученный из ЖЭХБ-гель-фильтрационной колонки; В) ЖЭХБ-катионобменная хроматограмма; С) ЖЭХБ - гель - фильтрационная хроматограмма.

[0014] Рисунки 5A-D - графики, отображающие некоторые физические характеристики LEDGF1-326. А) Эксклюзионная ВЭЖХ: LEDGF1-326 разделили по размеру на коллонке Agilent Bio-SEC с применением 25 мМ буферного рствора трис-HCl, содержащего 1 мМ CaCl2, рН 7.0. LEDGF1-326 элюировали преимущественно на одном пике на 11,5 мин с частицами, чья молекулярная масса была примерно на 5% выше. В) MALDI-TOF: LEDGF1-326 имеет молекулярную массу, равную 40 кДа, и может существовать в форме димера. С) ДРС: размер LEDGF1-326 исследовали в 25 мМ фосфатного буфера, рН 7,0 с применением анализатора Nano ZS. LEDGF1-326 характеризовался монодисперсной популяцией, диаметр примерно 10 нм, агрегация отсутствовала. D) ДСН-ПААГ: LEDGF1-326 разделили по размеру на 4-15% ДСН-ПААГ геле в восстановительных (бета-меркаптоэтанол и кипячение) и невосстановительных (без бета-меркаптоэтанола и без кипячения) условиях. При использовании невосстановительного геля обнаружено присутствие димеров LEDGF1-326.

[0015] Рисунок 6А-В - графики, отображающие дополнительные данные о предсказанных структурных свойствах LEDGF1-326. А) Цифровой дихроизм: Исследовали вторичные структуры 500 мкг/мл LEDGF1-326 в 25 мМ фосфатного буфера рН 7,0 с применением Chirascan. Для α- спирали или β-листов не обнаружили характерных пиков. Далее, наличие сильного отрицательного сигнала при 200 нм указывало на то, что LEDGF1-326 является белком, структура которого образована преимущественно случайной спиралью. В) Трехмерная модель LEDGF1-326: трехмерную модель LEDGF1-326 предсказали с помощью сервера для моделирования структуры белка I-Tasser на основе его аминокислотной последовательности и гомологии с белками, чьи структуры занесены в банк данных белковых структур. В соответствии с трехмерной моделью, LEDGF1-326 является белком, чья структура образована случайной спиралью.

[0016] На рисунке 7A-F представлены дополнительные графики, которые содержат дополнительную информацию о предсказанных структурных свойствах LEDGF1-326. Флуоресцентная спектроскопия при химическом денатурировании: А) Спектры флуоресценции, полученные при инкубировании 300 мкг/мл LEDGF1-326 с 0-6 M мочевины в 25 мМ фосфатного буфера при рН 7,0 регистрировали в диапазоне от 300 до 400 нм при длине волны возбуждения 280 нм. В) Для определения параметров конформационной стабильности построили зависимость интенсивности флуоресценции при 340/356 нм от концентрации мочевины. С) Спектры КД полученные при инкубировании 300 мкг/мл LEDGF1-326 с 0-6 M мочевины в 25 мМ фосфатного буфера при рН 7.0, регистрировали в интервале от 220 до 260 нм. D) Для определения параметров конформационной стабильности построили зависимость сигнала КД при 230 нм от концентрации мочевины. Е) LEDGF1-326 подвергли тепловому денатурированию и зарегистрировали соответствующие изменения сигнала КД в диапазоне от 215 до 250 нм. F) Для определения температуры плавления LEDGF1-326 построили зависимость сигнала КД при 222 нм от температуры.

[0017] Рисунок 8А-В - графики, демонстрирующие способность LEDGF1-326 защищать клетки линии ARPE-19 от стресса, связанного с агрегацией белка. Клетки линии ARPE-19 были обработаны LEDGF1-326 в течение 48 ч в А) отсутствие или В) присутствие агрегационного стресса.

[0018] Рисунки 9А-В - графики, показывающие, что LEDGF1-326 замедляет утрату функциональности фоторецепторов у крыс линии RCS. А) Зарегистрировали скотопическую ЭРГ с применением вспышек интенсивностью 0,4 log кд-сек/м2 и построили зависимость амплитуды скотопической b-волны от возраста крыс. При фотопической ЭРГ перед ее регистрацией крыс адаптировали к свету фоновым освещением яркостью 30 кд/м2 в течение 3 мин. В) Построили зависимость амплитуды фотопической b-волны от возраста крыс. Для каждой крысы получили среднее значение на основании трех ЭРГ, затем внутри каждой группы рассчитали среднюю амплитуду b-волны. Данные представлены как среднее значение ± стандартное отклонение при N=3. *, р<0.05 в сравнении с соответствующей группой, не получавшей лечения.

[0019] Рисунок 10 - графики, показывающие, что наноансабли LEDGF1-326 /цинк остаются стабильными после разведения.

[0020] Рисунок 11А-С - графики, показывающие, изменения третичной структуры, вторичной структуры и размера LEDGF1-326 в отсутствие или присутствие добавок.

[0021] Рисунок 12 - изображение LEDGF1-326 на ДСН-ПААГ геле при восстановительных условиях.

[0022] Рисунки 13А-В - графики, изображающие количественные характеристики растворимых белков и нерастворимых агрегатов LEDGF1-326 в присутствие и отсутствие различных добавок.

[0023] Рисунок 13С - изображение микроцентрифужных пробирок, демонстрирующее отсутствие нерастворимых агрегатов LEDGF1-326 в присутствие различных добавок.

[0024] Рисунок 14 - графики, отображающие иммунореактивность LEDGF1-326 в присутствие и отсутствие различных добавок.

[0025] Рисунок 15А-С - графики, демонстрирующие биофизические параметры структурной целостности и конформационной стабильности LEDGF1-326 в присутствие добавок. А) Зависимость интенсивности флуоресценции LEDGF1-326 на длине волны 342 нм при возбуждении на длине волны 280 нм от времени в присутствие различных. В) Зависимость кругового дихроизма (КД) LEDGF1-326 на длине волны 208 нм от времени и добавок. С) Зависимость гидродинамического размера LEDGF1-326 от времени и добавок.

[0026] Рисунок 16 - изображение ДСН-ПААГ геля, отображающее зависимость молекулярной массы LEDGF1-326 от времени.

[0027] Рисунки 17A-D - графики, демонстрирующие формирование нано-ансаблей LEDGF1-326 в присутствии цинка. А) Динамическое рассеяние света. LEDGF1-326 формирует нано-скопления в присутствие цинка. В) Круговой дихроизм. Вторичная структура LEDGF1-326 изменяется в присутствие цинка. С) Флуоресцентная спектроскопия. Наблюдается тушение флуоресценции LEDGF1-326 в присутствии цинка, что указывает на попдание гидрофобных групп в более полярную среду. D) Ультрафиолетовая спектроскопия: коэффициент поглощения УФ LEDGF1-326 уменьшался в присутствии 0,1 мМ и 1 мМ цинка, но не в присутствии 10 мМ цинка.

[0028] Рисунки 18 - изображения наноансамблей LEDGF1-326 и цинка, полученных с помощью ПЭМ.

[0029] Рисунки 19A-D - графики, демонстрирующие обратимость формирования наноансамблей LEDGF1-326.

[0030] Рисунки 20A-D - графики и изображение ДСР-ПААГ геля, демонстрирующие повышение стабильности наноансамблей LEDGF1-326 с течением времени.

[0031] Рисунок 21 - график, демонстрирующий усиленное поглощение наноансамблей LEDGF1-326 клетками линии ARPE-19.

[0032] Рисунок 22 - график с результатами МТТ-анализа, демонстрирующими способность наноансамблей LEDGF1-326 спасать клетки линии ARPE-19 от сывороточного голодания.

[0033] Рисунки 23A-D - графики, демонстрирующие способность наноансамблей LEDGF1-326 уменьшать дегенерацию сетчатки, что было доказано методом электроретинографии.

[0034] Рисунки 24А-Н - графики, отражающие способность наноансамблей LEDGF1-326 задерживаться в области стекловидного тела не менее чем на 14 дней, что было установлено путем отслеживания флуоресцентного сигнала конъюгата Alexa-LEDGF1-326 у нормальных крыс вида SD. А) Демонстрирует результаты холостого сканирования перед интравитреальной инъекцией в глаз крысы вида SD. В) и С) демонстрируют стандартную кривую для контрольной группы и ансамблей LEDGF1-326, соответственно. D) и Е) демонстрируют флуоресцентный сигнал в различных тканях, включая стекловидное тело, комплекс хороид-ПЭС и водянистую влагу, полученные с помощью сканера Flurotron; F), G) и H) преобразуют флуоресцентный сигнал, измеренный выше, в фактические значения наноансамблей LEDGF1-326 для стекловидного тела, комплекса хороидя-ПЭС и водянистой влаги, соответственно.

[0035] Рисунок 25 - график, демонстрирующий способность наноансамблей сохранять иммунореактивность LEDGF1-326.

[0036] Рисунки 26А-В - это А) изображения, поученные при количественном подсчете клеток линии ARPE-19 с трансфицированными LEDGF1-326 и В) графики, демонстрирующие зависимость количества клеток от времени и концентрации LEDGF1-326.

[0037] Рисунок 27 - график, демонстрирующий увеличение фагоцитарной активности клеток линии ARPE-19 с трансфицированными LEDGF1-326.

[0038] Рисунки 28A-D - изображения и графики, демонстрирующие гистологического исследования глаз крыс вида SD, которым была выполнена инъекция LEDGF1-326. А) графическое изображение вертикального среза глаза и места интравитреальной инъекции. В) изображения поперечных срезов сетчатки, полученных в группах нормальных крыс вида SD; крыс линии RCS, не получавших лечения, и крыс линии RCS, получавших LEDGF1-326. С) и D) графики, отображающие измеренную толщину наружного и внутреннего ядерных слоев сетчатки в контрольной группе и группе, получавшей LEDGF1-326, соответственно.

[0039] Рисунок 29 - иммунофлуоресцентные снимки сетчатки в контрольной группе и группе крыс вида SD, получавших LEDGF1-326.

[0040] Рисунок 30 - график, демонстрирующий кумулятивное высвобождение гис-LEDGF1-326 из приводимых в качестве примера соединений типа «частица-в-частице» (PinP)

[0041] Рисунок 31 - графики, отображающие результаты безинвазивной флуорофотометрии глаза крысы после интравитреальной инъекции А) концентрации Alexa-гастидин-LEDGF1-326 в группах, получавших соединение типа «PinP» и раствор.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ Определения

[0042] Термины «сетчатка» и «ретинальный» используются здесь как для обозначения сетчатки, так и для обозначения всего заднего сегмента глаза, примыкающего к сетчатке.

[0043] Термины «лечебный» или «лечение» используются здесь для обозначения полного инвертирования или устранения основного заболевания, временной или пролонгированной профилактики развития заболевания, временной или пролонгированной ремиссии заболевания и снижения интенсивности одного или нескольких сопутствующих симптомов.

[0044] Термины «пептид», «полипептид» и «белок» используются здесь взаимозаменяемо. Если не указано иное, данные термины обозначают полимер, в состав которого входит не менее двух аминокислот, связанных пептидной связью. Таким образом, данные термины охватывают олигопептиды, фрагменты белков, аналоги, производные, гликозилированные производные, пегилированные производные, гибридные белки и т.п.

[0045] Термины «идентичность / сходство последовательности» используются здесь для обозначения идентичности, сходства двух или более аминокислотных последовательностей. Идентичность последовательности может быть измерена в процентах: чем выше процентная доля, тем более идентичными являются последовательности. Специалистам в данной области хорошо известны методы выравнивания последовательностей и используемые для сравнения последовательности. Различные программы и алгоритмы для выравнивания также описаны (см. Смит и Вотерман, «Достижения в области прикладной математики» (Adv. Appl. Math.) 2:482, 1981; Нидлмен и Вунш, «Журнал молекулярной биологии» (J. Mol. Biol.) 48:443; Пирсон и Липмен, «Труды национальной академии наук США» (Proc. Natl. Acad. Sci. USA) 85:2444, 1988; Хиггинс и Шарп, «Ген» (Gene), 73:237-44, 1988; Хиггинс и Шарп, CABIOS 5:151-3, 1989; Корпет и соавт «Исследование нуклеиновых кислот» (Nuc. Acids. Res.) 16:10881-10, 1990). где содержится подробное рассмотрение методов выравнивания последовательностей и подсчета их гомологичности, доступных на сегодняшний день.

[0046] Доступ к программе поиска локальных выравниваний BLAST, разработанной в Национальном центре биотехнологической информации (НЦБИ - NCBI) (Альтшуле и соавт.. «Журнал молекулярной биологии» (J. Mol. Biol.) 215:403-10, 1990) осуществляется из нескольких мест, включая Национальный центр биотехнологической информации (НЦБИ, Национальная медицинская библиотека, 20894 США, штат Мэриленд, г. Бетесда, строение 38А, зал 8N805) и в сети интернет и позволяет использовать также программы анализа последовательностей blastp, blastn, blastx, tblastn, и tblastx. Программа blastp используется для сравнения аминокислотных последовательностей. Дополнительную информацию можно найти на официальном веб-сайте НЦБИ.

[0047] В целом, при выравнивании количество совпадений определяется путем подсчета количества позиций, в которых идентичный аминокислотный остаток присутствует в обеих последовательностях. Процентная идентичность определяется путем деления количества совпадений либо на общую длину последовательности сравнения, либо на заданную длину (например, 100 последовательных нуклеотидов или аминокислотных остатков в последовательности сравнения), после чего полученный результат умножается на 100.

Применение изобретения

[0048] Непроцессированный белок LEDGF способен предотвращать пагубное воздействие стресса, вызванного скоплением мутантного родопсина Р23Н (Бейд и соавт, PLoS One. 6(9): с. е24616). Тем не менее, трансляция белков на основе информации генов на уровне, при котором белок можно использовать в лекарственных целях, всегда сопровождалась трудностями в связи с тем, что для сохранения своей биологической активности белок должен поддерживать специфическую трехмерную структуру. Кроме того, производство и биосинтез белка зачастую терпят неудачу из-за его нестабильности в процессе биосинтеза и очистки. Далее, чтобы эффективно использовать лекарственных средств на основе белка, зачастую необходимо получить нескольких миллиграммов продукта, чтобы правильно охарактеризовать свойства белка. К примеру, непроцессированный LEDGF дает на выходе только 0,9 мг на 500 мл, при этом для полного описания белка не хватает нескольких десятых миллиграмма, что ведет к получению фрагментированного продукта. Настоящее изобретение предлагает пептиды LEDGF, которые, подобно непроцессированному белку, обеспечивают выживаемость клеток, но при этом могут быть произведены в большом количестве и очищены до высокого уровня чистоты. Кроме того, LEDGF-пептиды настоящего изобретения препятствуют агрегации белков. LEDGF-пептиды настоящего изобретения демонстрируют эффективность при лечении заболеваний, причиной которых является стресс, вызванный агрегацией белков (ПР), оксидативный стресс (сухая форма ВМД), а также при лечении диабетической ретинопатии. Исходя из этого, молекула, подобная предлагаемым LEDGF-пептидам, может представлять собой универсальный лекарственный белок для лечения многочисленных заболеваний, связанных с агрегацией белка, включая прочие дегенеративные заболевания сетчатки и нейродегенеративные заболевания. Далее настоящее изобретение охватывает композиции LEDGF-пептидов с пролонгированным высвобождением, которые найдут применение при лечении вышеупомянутых заболеваний.

LEDGF-пептиды

[0049] Предлагаемые LEDGF-пептиды содержат N-терминальные пептиды непроцессированного LEDGF. В одном варианте изобретения LEDGF-пептид содержит N-терминальный домен связывания LEDGF, связанный со стрессом. Не ограничиваясь следующей теорией, LEDGF-пептид может препятствовать развитию заболеваний, связанных с агрегацией белка, благодаря способности LEDGF выступать в качестве фактора транскрипции и инициировать транскрипцию других генов, ответственных за стрессовый ответ. Другая возможность предусматривает способность LEDGF-пептидов связываться с неправильно уложенными белками либо непосредственно, либо посредством других промежуточных белков и обеспечивать нормальную укладку или убиквитинилирование неправильно уложенных белков для осуществления протеолитического распада. В некоторых вариантах изобретения, LEDGF - пептид может также включать домен связывания ТАТ.

[0050] В одном варианте изобретения, LEDGF-пептидом является LEDGF1-326 (SEQ ID NO: 2). LEDGF1-326 очистили до состояния, близкого к гомогенности. LEDGF1-326 обладает преимущественно структурой случайной спирали, стабилен при комнатной температуре и существует в виде мономера массой 40 кДа и/или димера массой 80 кДа. Как детально описано в разделе «Образцы» ниже, LEDGF1-326 удалось предотвратить развитие агрегационного стресса в клетках линии ARPE-19, вызванного мутантным родопсином Р23Н. Единоразовая интравитреальная инъекция LEDGF1-326 сократила утрату функциональности фоторецепторов подопытных крыс с дегенеративными изменениями сетчатки на срок свыше восьми недель.

[0051] К предлагаемым LEDGF-пептидам относят также LEDGF-пептиды, обладающие по меньшей мере около 70%, по меньшей мере около 75%, по меньшей мере около 80%, по меньшей мере около 85%, по меньшей мере около 90% или по меньшей мере около 95% идентичностью с последовательностью LEDGF1-326. В одном варианте изобретения к LEDGF-пептидам относятся пептиды, включающие N-терминальный, связанный со стрессом домен связывания непроцессированного LEDGF и обладающие по меньшей мере около 70%, по меньшей мере около 75%, по меньшей мере около 80%, по меньшей мере около 85%, по меньшей мере около 90% или по меньшей мере около 95% идентичностью с последовательностью LEDGF1-326. В другом варианте изобретения к LEDGF-пептидам относят пептиды с N-терминальным, связанным со стрессом доменом связывания и доменом связывания ТАТ, обладающие по меньшей мере около 70%, по меньшей мере около 75%, по меньшей мере около 80%, по меньшей мере около 85%, по меньшей мере около 90% или по меньшей мере около 95% идентичностью с последовательностью LEDGF1-326. Кроме того, к предлагаемым LEDGF-пептидам относят пептиды, включающие более 326 аминокислот или менее 326 аминокислот последовательности №2, при этом более крупный или более мелкий размер пептидов не приводит к значительному снижению биологической активности или стабильности LEDGF во время биосинтеза и очистки. Специалист в данной области может определить пригодность того или иного LEDGF-пептида для использования в настоящем изобретении путем оценки сходства параметров предполагаемого пептида с биофизическими и биохимическими характеристиками, а также биологической активностью при помощи тестов, описанных в разделе «Образцы». Специалист в данной области может определить, что LEDGF-пептиды, схожие с LEDGF1-326 в плане биофизических и биохимических характеристик, а также биологической активности, будут обладать схожей полезностью и, соответственно, попадать в поле действия настоящего патента.

[0052] В некоторых вариантах изобретения вышеописанные LEDGF-пептиды созданы искусственно. В некоторых других вариантах изобретения вышеописанные LEDGF-пептиды созданы путем рекомбинации. К клеткам-хозяевам, пригодным для экспрессии LEDGF-пептидов, относят, но не ограничивают ими, Е. coli, Saccharornees, Picchia, Bacillus, клетки линии СНО, ВНК, COS и NSO.

Стандартные фармацевтические композиции

[0053] Описанные в данном изобретении LEDGF-пептиды можно приготовить в виде физиологически допустимых композиций с использованием известных методов. В книге Remingtonʹs Pharmaceutical Sciences, E.B. Мартин, Mack Publishing Co., Easton, PA, издание 19 (1995), описываются композиции, пригодные для фармацевтической доставки указанных здесь LEDGF-пептидов.

[0054] Композиции в соответствии с настоящим изобретением можно назначать в форме таблетки, капсулы, сосательной таблетки, облатки, раствора, суспензии, эмульсии, порошка, аэрозоля, суппозитория, спрея, пастилки, мази, крема, пасты, пены, геля, тампона, пессария, гранулы, болюса, жидкости для полоскания рта, имплантата, в приборе, в виде глазных капель или трансдермального пластыря.

[0055] К данным композициям относят композиции, пригодные для перорального, ректального, назального, ингаляционного, местного (в том числе, накожного, трансдермального, трансбуккального и в форме глазных капель), вагинального, парентерального (в том числе, подкожного, внутримышечного, внутривенного, внутрикожного, внутриглазного, интратрахеального и эпидурального) введения, введения в глаз (периокулярного, интраокулярного, в том числе, супрахориоидального, субретинального и интравитреального) или ингаляционного способа введения. В одном примере изобретения композиции предлагаемых пептидов предполагают транссклеральное, субретинальное или интравитреальное введения. К транссклеральному введению относят субконъюнктивальное, субтеноновое и ретробульбарное транссклеральное введение. Для удобства данные композиции можно представить в стандартной лекарственной форме и изготовить традиционными фармацевтическими методами. В подобных методах присутствует этап связывания активного ингредиента с носителем (-ями) или вспомогательным (-ми) веществом (-ами). В целом, данные композиции изготавливают путем равномерного и тесного связывания активного ингредиента с жидкостным носителем, высокодисперсным твердым носителем или обоими сразу, после чего, при необходимости, происходит формовка продукта.

[0056] Предлагаемые композиции, пригодные для перорального введения, могут быть представлены в виде дискретных единиц, таких как капсулы, облатки или таблетки, каждая из которых содержит заранее определенное количество активного ингредиента; порошка или гранул; раствора или суспензии в водосодержащей или безводной жидкости; жидкой эмульсии типа «масло в воде» или эмульсии типа «вода в масле» и т.д.

[0057] Таблетку могут изготавливать путем прессовки или формовки, в некоторых случаях - с использованием одного или нескольких вспомогательных ингредиентов. Прессованные таблетки могут изготавливать путем прессовки, на пригодном для этого оборудовании, активного ингредиента в сыпучем состоянии, таком как порошок или гранулы, опционально смешанного со связывающим вспомогательным веществом, лубрикантом, инертным разбавителем, консервантом, поверхностно-активным веществом или диспергирующим веществом. Формованные таблетки могут изготавливать путем формовки, на пригодном для этого оборудовании, смеси порошкообразной субстанции, увлажненной инертным жидкостным разбавителем. Таблетки могут опционально покрывать оболочкой и снабжать риской, а также составлять их композицию таким образом, чтобы обеспечить пролонгированное или контролируемое высвобождение их активного ингредиента.

[0058] К композициям, пригодным для местного применения в ротовой полости, относят сосательные таблетки, содержащие ингредиенты в ароматизированной основе, обычно - в сахарозе и аравийской или трагакантовой камеди; пастилки, содержащие данный активный ингредиент в инертной основе, такой как желатин и глицерин или сахароза и аравийская камедь; и жидкости для полоскания рта, содержащие данный активный ингредиент, назначаемый с пригодным жидкостным носителем.

[0059] Композиции для местного нанесения на кожу могут быть представлены в виде мазей, кремов, гелей, паст и глазных капель, содержащих данный активный ингредиент, назначаемый с пригодным носителем.

[0060] Композиции для ректального введения могут быть представлены в виде суппозитория с подходящей основой, содержащей, например, какао-масло или салицилат.

[0061] К композициям для назального введения с твердым носителем относят крупный порошок, например, с размером частиц от 20 до 500 микрон, предназначенный для вдыхания через нос; т.е. введения путем быстрых вдыхательных движений через носовой канал из емкости с порошком, поднесенной близко к носу. К соответствующим композициям с жидкостным носителем, таким как, например, назальный спрей или назальные капли, относят водные или масляные растворы активного ингредиента.

[0062] Композиции, пригодные для вагинального введения, могут быть представлены в виде пессария, тампона, крема, геля, пасты, пены или спрея, содержащих помимо активного ингредиента другие вещества, такие, как носители, приемлемые в данных композициях и известные специалистам.

[0063] Композиции, пригодные для ингаляций, могут быть представлены в виде аэрозоля, миста или спрея, содержащих помимо активного ингредиента другие вещества, такие, как носители, приемлемые в данных композициях и известные специалистам.

[0064] Композиции, пригодные для парентерального введения, включают водные и неводные стерильные растворы для инъекций, которые могут содержать антиоксиданты, буферные вещества, бактериостаты и другие компоненты, которые обеспечивают изотоничность композиции с кровью предполагаемого реципиента; водные и безводные стерильные суспензии, которые могут включать суспендирующие вещества и загустители; гели и имплантаты, вводимые в организм хирургическим путем.

Композиции наноконструкций

[0065] В некоторых вариантах изобретения, предлагаемые LEDGF-пептиды доставляются виде ансамблей наночастиц путем связывания или иного соединения LEDGF-пептидов с коллоидными частицами металла. В настоящем изобретении могут использоваться любые коллоидные металлы. К коллоидным металлам относят любую водонерастворимую металлическую частицу, металлическое соединение, диспергированное в жидкой воде, гидрозоль или золь металла. Коллоидные частицы металла выделяют из металлов групп ΙΑ, IB, IIB и IIIB периодической системы химических элементов, а также из переходных металлов, преимущественно группы VIII. Примерами таких металлов служат цинк, золото, серебро, алюминий, рутений, железо, никель и кальций. К прочим пригодным металлам относят приведенные ниже металлы со всеми возможными степенями окисления: литий, натрий, магний, калий, скандий, титан, ванадий, хром, марганец, кобальт, медь, галлий, стронций, ниобий, молибден, палладий, индий, олово, вольфрам, рений, платина и гадолиний. Металлы предпочтительно получать из подходящего соединения металла в ионной форме, например, Al3+, Ru3+, Zn2+, Fe3+, Ni2+ и Ca2+.

[0066] В одном варианте изобретения наночастицы формируют путем добавления коллоидного металла непосредственно к раствору, содержащему LEDGF-пептиды. Термин «наночастицы» используется здесь в значении одного или более пептидов, связанных или адсорбированных на поверхности одиночной коллоидной частицы металла, или в значении пептида, связанного или адсорбированного множественными коллоидными частицами металла. В качестве примера, наночастицы LEDGF/Zn образуют путем контролируемого добавления 10 мМ Zn(II) при комнатной температуре. Затем в течение свыше 24 часов при 37°С формируют наноансамбли. Условия формирования других наноансамблей с использованием прочих коллоидных металлов могут быть без труда определены специалистом в данной области. Композиции типа "частица в частице"

[0067] В другом варианте изобретения LEDGF-пептиды присутствуют в качестве композиций типа "частица в частице" с пролонгированным высвобождением активного ингредиента. Предлагаемые соединения с пролонгированным высвобождением активного вещества представляют собой внутреннюю частицу, заключенную внутри более крупной пористой внешней частицы, в том числе различные структуры, такие как «наночастица в пористой микрочастице» (NPinPMP), «малая наночастица в пористой крупной наночастице» (SNPinPLNP) и «малая микрочастица в пористой крупной микрочастице» (SMPinPLMP). Внутренняя частица меньше по размеру и относительно не расширяется, по сравнению с более крупной частицей. Внешняя частица может расширяться и образует заметно пористую структуру во время обработки, что позволяет внедрить внутреннюю частицу в пористую структуру внешней частицы.

[0068] В контексте настоящего изобретения считается, что частица расширяется в присутствии сверхкритической жидкости, если первоначальная площадь поверхности частицы увеличивается в пределах от приблизительно 1,25 до приблизительно 100 раз. В некоторых вариантах изобретения считается, что частица расширяется, если первоначальная площадь поверхности частицы увеличивается в пределах от приблизительно 1, 25 до приблизительно 5 раз, от приблизительно 5 до приблизительно 25 раз, от приблизительно 25 до приблизительно 50 раз, от приблизительно 50 до приблизительно 75 раз, от приблизительно 75 до приблизительно 100 раз. Также возможны варианты изобретения, при которых частица считается расширяющейся, если ее первоначальный размер увеличивается по меньшей мере на 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50%.

[0069] Предложенные внутренние частицы изготовлены с использованием полимерных или неполимерных материалов, которые не расширяются в присутствии сверхкритической жидкости. В некоторых вариантах изобретения материалом для получения наночастиц служит полимерный материал, не расширяющийся в присутствии сверхкритической жидкости. В некоторых вариантах изобретения таким полимерным материалом является материал, не расширяющийся в присутствии диоксида углерода в сверхкритическом состоянии. Примерами пригодных полимерных и неполимерных материалов, которые могут использоваться в настоящем изобретении, являются полилактид (ПЛА, или PLA), поли(гликолевая кислота), сополимеры молочной и гликолевой кислоты (ПЛГА, или PLGA), производные целлюлозы, хитозан, полиэтилен (ПЭ, или РЕ), полипропилен, поли(тетрафторэтилен), поли(этилентерефаталат), оксид железа, оксид церия, оксид цинка, золото, серебро, прочие биосовместимые металлы и кристаллы, а также диоксид кремния. Кристаллические материалы или материалы, обладающие обширными кристаллическими областями, менее склонны к расширению во время обработки сверхкритической жидкостью. Внутренние полимерные могут получать с помощью существующих методов испарения легколетучего растворителя в эмульсионной среде или иным похожим методом синтеза. LEDGF-пептиды могут инкапсулировать во внутренние частицы во время формирования внутренних частиц или прикрепляют к их поверхности после формирования.

[0070] Предлагаемые внешние частицы получают с использованием материалов, расширяющихся в присутствии сверхкритической жидкости. В некоторых вариантах изобретения материалом для получения микрочастиц является полимерный материал, расширяющийся в присутствии сверхкритической жидкости. В некоторых вариантах изобретения это материал, расширяющийся в присутствии диоксида углерода в сверхкритическом состоянии. Примерами полимерных материалов, пригодных для использования в настоящем изобретении, являются лактид-ко-гликолид, полиамиды, поликарбонаты, полиалкиленгликоли, полиалкиленоксиды, поливиниловые спирты, поливиниловые простые эфиры, поливиниловые сложные эфиры, поливинилпирролидон, полигликолиды и их сополимеры. Кроме того, к пригодным полимерным материалам относятся алкилцеллюлоза, гидроксиалкилцеллюлозы, простые эфиры целлюлозы, сложные эфиры целлюлозы, нитроцеллюлозы, полимеры сложных эфиров акриловой и метакриловой кислоты, метилцеллюлоза, этиэлцеллюлоза, гидроксипропилцеллюлоза, гидроксипропилметилцеллюлоза, гидроксибутилметилцеллюлоза, ацетат целлюлозы, ацетобутират целлюлозы, ацетатфталат целлюлозы, карбоксилетилцеллюлоза, (поли)метилметакрилат целлюлозы, поли(этилметакрилат), поли(бутиметакрилат), поли(виниловые спирты), поли(винилацетат) и поливинилприрролидон. В целом, для расширения во время обработки сверхкритической жидкостью подходят аморфные материалы или материалы с обширными аморфными областями. Полимерные внешние частицы получают путем традиционного испарения легколетучего растворителя в эмульсионной среде или иным так же пригодным методом синтеза. В некоторых вариантах изобретения LEDGF-пептиды инкапсулируют во внешние частицы во время формирования внешних частиц или прикрепляют к их поверхности после формирования.

[0071] Процесс генерирования различных архитектур частиц достигается путем технологии обработки в сверхкритической жидкости. Полученный в результате привес, не содержащий растворителя, особенно хорошо подходит для использования в лекарственных препаратах, таких как препараты на основе пептидов и нуклеотидов, подверженных агрегации или распаду. Например, LEDGF-пептиды могут вводить на поверхность внутренней частицы, внешней частицы или на поверхности обеих частиц; в матрицу внутренней частицы, внешней частицы или матрицы обеих частиц; в поры внешней частицы; либо возможны комбинации вышеописанных вариантов. В некоторых вариантах изобретения LEDGF-пептиды присутствуют на поверхности внутренней частицы. В других вариантах изобретения LEDGF-пептиды присутствуют на поверхности внутренней и внешней частицы. В следующих вариантах изобретения LEDGF-пептиды присутствуют в матрице внутренней частицы. В других вариантах изобретения LEDGF-пептиды присутствуют как в матрице внутренней, так и в матрице внешней частицы. В других вариантах изобретения лекарственный агент присутствует в порах внешней частицы.

[0072] Внутренние и внешние частицы перемешиваются и обрабатываются сверхкритической жидкостью под высоким давлением. В некоторых вариантах изобретения в роли сверхкритической жидкости выступает диоксид углерода. При воздействии сверхкритической жидкости внешние частицы расширяются, при этом на их внешней поверхности образуются поры. Затем под действием сверхкритической жидкости внутренние частицы нагнетаются во внешние частицы, в результате чего образуются композиции типа «частица в частице» с пролонгированным высвобождением активного ингредиента. В одном варианте изобретения композиции типа «частица в частице» с пролонгированным высвобождением активного вещества образованы путем внедрения внутренних наночастиц диаметром от приблизительно 1 нм до приблизительно 900 нм во внешнюю микрочастицу диаметром от приблизительно 1 мкм до приблизительно 100 мкм. В другом варианте изобретения композиции типа «частица в частице» с пролонгированным высвобождением активного ингредиента образованы путем внедрения внутренней наночастицы диаметром от приблизительно 1 нм до приблизительно 300 нм во внешнюю наночастицу диаметром от приблизительно 10 нм до приблизительно 999 нм. В следующем варианте изобретения композиции типа «частица в частице» с пролонгированным высвобождением активного ингредиента образованы путем внедрения внутренней микрочастицы диаметром от приблизительно 1 мкм до приблизительно 100 мкм во внешнюю микрочастицу диаметром от приблизительно 2 мкм до приблизительно 500 мкм. Отбор внутренней и внешней частиц подходящего размера определяется типом материала, из которого получают частицы, степенью расширения внешней частицы в используемой сверхкритической жидкости и размером внутренних частиц, подлежащих внедрению во внешнюю частицу. Специалист в данной области без труда определит все эти факторы. В целом, соотношение размеров внутренней и внешней частиц может варьироваться в пределах от приблизительно 1:5 до приблизительно 1:100. В одном варианте изобретения соотношение размеров может составлять 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95 или 1:100.

[0073] Формирование структур типа NPinPMPs достигается путем обработки наночастиц и микрочастиц при давлении от приблизительно 1000 до приблизительно 1 400 фунт-сила/кв.дюйм. Время обработки может изменяться, к примеру, от приблизительно 5 мин до приблизительно 2 часов. Температура может варьироваться в пределах от 30°С до 45°С. Выбор приемлемого диапазона давления и температуры определяется, главным образом, температурой и давлением, при которых используемая сверхкритическая жидкость достигает сверхкритической фазы. В соответствии с этим, специалист в данной области сможет подобрать приемлемый диапазон времени, температуры и давления, опираясь на характеристики используемой сверхкритической жидкости, желаемый размер или объем расширения внешней частицы, а также желаемую степень пористости внешней частицы. Например, при обработке в течение более длительного времени и/или при более высоком давлении, после которой происходит резкий сброс давления, получают внешние частицы, характеризующиеся большим расширением и пористостью, по сравнению с частицами, полученными при обработке в течение менее продолжительного времени и/или при меньшем давлении.

[0074] В одном варианте изобретения внутренние и внешние частицы перемешивают в соотношении приблизительно 1:3. В одном варианте изобретения отношение внутренних частиц к внешним составляет приблизительно 1:9. Данные соотношения оказывают влияние на степень внедрения наночастиц и замедленную скорость высвобождения лекарственного вещества. В целом, чем больше количество внутренних частиц относительно количества внешних частиц, тем больше внутренних частиц внедряется во внешние частицы, в результате чего повышается скорость высвобождения и доза лекарственного вещества. Чем меньше количество внутренних частиц относительно количества внешних частиц, тем ниже степень взрывного высвобождения лекарственного вещества.

Заболевания, связанные с агрегацией белка, и способы их лечения

[0075] Предлагаемые LEDGF-композиции могут использоваться при лечении заболеваний, связанных с агрегацией белка. Заболевания, связанные с агрегацией белка и поддающиеся лечению с помощью предлагаемых LEDGF-композиций, включают дегенеративные заболевания сетчатки и нейродегенеративные заболевания. К дегенеративным заболеваниям сетчатки относят возрастную макулярную дистрофию, пигментный ретинит и диабетическую ретинопатию. Нейродегенеративные заболевания включают болезнь Альцгеймера (БА), болезнь Паркинсона (БП), болезнь Хантингтона (БХ), боковой амиотрофический склероз и прионную болезнь.

[0076] В одном варианте изобретения настоящее изобретение охватывает методы лечения дегенеративного заболевания сетчатки с помощью введения пациенту с дегенеративным заболеванием сетчатки лекарственного соединения, содержащего предлагаемый LEDGF-пептид. В некоторых вариантах изобретения таким LEDGF пептидом является последовательность №2. В одном варианте изобретения соединение, содержащее LEDGF-пептид, вводят транссклерально. В другом варианте изобретения соединение, содержащее LEDGF-пептид, применяют местно в форме глазных капель. В другом варианте изобретения соединение, содержащее LEDGF-пептид, имплантируют или систематически применяют в форме композиции с пролонгированным высвобождением активного ингредиента. В одном варианте изобретения композицией с пролонгированным высвобождением активного ингредиента является наноансамбль с пролонгированным высвобождением активного ингредиента, например, наноансамбль LEDGF/цинк. В другом варианте изобретения композицией с пролонгированным высвобождением активного ингредиента является композиция типа "частица в частице", такая как композиция наночастицы в пористой микрочастице (NPinPMP).

[0077] В одном варианте изобретения настоящее изобретение включает методы снижения агрегации белка при дегенеративном заболевании сетчатки с помощью введения пациенту с дегенеративным заболеванием соединения, содержащего предложенный LEDGF-пептид. В некоторых вариантах изобретения таким LEDGF-пептидом является LEDGF1-326. В одном варианте изобретения соединение, содержащее LEDGF-пептид, вводят транссклерально. В другом варианте изобретения соединение, содержащее LEDGF-пептид, применяют местно и вводят в глаз форме глазных капель. В другом варианте изобретения соединение, содержащее LEDGF-пептид, имплантируют или систематически применяют в форме композиции с пролонгированным высвобождением активного ингредиента. В одном варианте изобретения композицией с пролонгированным высвобождением активного ингредиента является предложенная нанокомпозиция с пролонгированным высвобождением активного ингредиента, такая как нанокомпозиция LEDGF/цинк. В другом варианте изобретения композицией с пролонгированным высвобождением активного ингредиента является композиция типа «частица в частице», такая как наночастица в пористой микрочастице (NPinPMP).

[0078] В одном варианте изобретения настоящее изобретение включает методы лечения нейродегенеративных заболеваний с помощью введения пациенту с нейродегенеративным заболеванием соединения, содержащего предлагаемый LEDGF-пептид. В некоторых вариантах изобретения таким LEDGF-пептидом является LEDGF1-326. В одном варианте изобретения соединение, содержащее LEDGF-пептид, вводят интраперитонеально. В другом варианте изобретения LEDGF-соединение применяют перорально. В другом варианте изобретения LEDGF-соединение применяют систематически в форме композиции с пролонгированным высвобождением активного ингредиента. В одном варианте изобретения предложенной композицией с пролонгированным высвобождением активного ингредиента является нанокомпозиция с пролонгированным высвобождением активного ингредиента, такая как нанокомпозиция LEDGF/цинк. В другом варианте изобретения композицией с пролонгированным высвобождением активного ингредиента является композиция типа «частица в частице», такая как наночастица в пористой микрочастице (NPinPMP).

[0079] В другом варианте изобретения настоящее изобретение включает методы снижения агрегации белка при нейродегенеративном заболевании с помощью введения пациенту с нейродегенеративным заболеванием соединения, содержащего предложенный LEDGF-пептид. В некоторых вариантах изобретения таким LEDGF-пептидом является LEDGF1-326. В одном варианте изобретения LEDGF-соединение вводят интраперитонеально. В другом варианте изобретения LEDGF-соединение вводят перорально. В другом варианте изобретения LEDGF-соединение вводят систематически в форме композиции с пролонгированным высвобождением активного ингредиента. В одном варианте изобретения, композицией с пролонгированным высвобождением активного ингредиента является предложенная нанокомпозиция с пролонгированным высвобождением активного ингредиента, такая как нанокомпозиция LEDGF/цинк. В другом варианте изобретения композицией с замедленным высвобождением активного вещества является композиция типа «частица в частице», такая как наночастица в пористой микрочастице (NPinPMP).

[0080] Соединения и методы настоящего изобретения иллюстрируются нижеприведенными неограничивающими примерами, которые не подлежат истолкованию в качестве наложения любого ограничения на объем настоящего изобретения. Напротив, совершенно понятно, что после знакомства с приведенным здесь описанием специалисты в данной области смогут предложить другие варианты, модификации и аналоги данных соединений и методов без отступления от их существа.

ОБРАЗЦЫ

Образец 1

1. Материалы

[0081] Плазмиды pEGFP-LEDGF были переданы д-ром Тосимичи Синохарой (Медицинский центр при Университете в Небраске, г.Омаха, штат Небраска, США). Прямые и обратные праймеры получили в компании «Интегрейтид ДИ-ЭН-ЭЙ текнолоджис» (Integrated DNA Technologies, г. Коралвиль, штат Айова, США). ДНК-полимераза I, Т4 ДНК-лигаза и рестриктазы получили в компании "Нью ингланд биолаб Инк." (New England Biolab Inc., г. Ипсвич, штат Массачуссетс, США). Набор реагентов для выделения ДНК из гелей QIAquick gel extraction kit, набор реагентов для выделения плазмидной ДНК QIAprep spin miniprep kit и набор реагентов для выделения плазмидной ДНК QIAGEN plasmid mini kit были получены в компании «Квиаген» (Qiagen, г. Валенсия, штат Калифорния, США). Хроматографическую колонку ХК 16/20, колонку для гель-фильтрации S-200, гранулированную SP-сефарозу получили в компании «ДЖИ-И лайфсайэнс хелскеа (GE Lifesciences Healthcare, г. Пискатавэй, штат Нью-Джерси, США). Клетки линии ARPE-19 получили из коллекции биоматериалов банка Американской коллекции типовых культур (АТСС, г. Манассас, штат Виргиния, США). Среду для культивирования клеток DMEM/F12, фетальную бычью сыворотку, липофектамин 2000, среду LB и ультрачистую агарозу получили в компании «Инвитроген» (Invitrogen, г. Карлсбад, штат Калифорния, США). Все прочие материалы, если иное не обозначено, получили в компании "Сигма-Алдрич" (Sigma-Aldrich, г. Сент-Луис, штат Миссури, США).

Подготовка конструкции LEDGF1-326 - ДНК

[0082] Ген, кодирующий белок LEDGF1-326, клонировали в вектор рЕТ-28 а (+) (компания «Новаген», Novagen, г. Мэдисон, штат Висконсин, США). Вкратце, ген Ledgf1-326 амплифицировали методом полимеразной цепной реакции (ПЦР) из плазмиды pEGFP-LEDGF с использованием прямого праймера 5ʹAGTAGTGGATCCATGACTCGCGATTTCAAAC3ʹ (последовательность №3), состоящего из сайта рестрикции рестриктазы HindIII, и обратного праймера 5ʹAATAATAAGCTTTCACTGCTCAGTTTCCATTTGTTCʹ3 (последовательность №4), состоящего из сайта рестрикции рестриктазы BamHI. Амплификацию методом ПЦР проводилась с использованием ДНК-полимеразы и включала следующие стадии: денатурацию при температуре 94°С в течение 5 мин, за которой следовали 36 циклов денатурации при температуре 94°С продолжительностью 30 сек, отжиг при температуре 50°С в течение 45 сек, достройка при температуре 72°С в течение 2 мин и финальная стадия достройки при температуре 72°С в течение 5 мин. Амплифицированный ген Ledgf1-326 очистили с помощью набора реагентов QIAquick gel extraction kit в соответствии с инструкцией производителя. Затем очищенную вставку гена Ledgf1-326 и вектор рЕТ-28а(+) последовательно отщепили на 5ʹ и 3ʹ концах с использованием рестриктазы HindIII и BamHI, соответственно. После этого их очистили с использованием набора реагентов QIAprep spin miniprep kit в соответствии с инструкцией производителя. В течение ночи при температуре 4 происходило лигирование липких концов вставки и вектора под действием Т4 ДНК-лигазы. Компетентные клетки Escherichia coli DH5a подвергли трансформации продуктами лигирования с применением теплового шока в соответствии с инструкцией производителя. Отобрали десять колоний, плазмиду амплифицировали, выделили и очистили с помощью набора реагентов QIAGEN plasmid mini kit. Вставку Ledgf1-326 в вектор рЕТ-28а(+) подтвердили тремя различными способами: во-первых, ПЦР-скринингом, во-вторых, анализом рестрикции и, наконец, секвенированием ДНК. Чистоту и размер рекомбинантной ДНК определили с использованием агарозного геля 2. Количественный анализ ДНК производили с использованием спектрофотометра NanoDrop 1000 производства компании «Термосайэнтифик» (Thermo scientific, г. Уилмингтон, штат Делавэр, США). Колонию, в которой был отмечен положительный ПЦР-сигнал и правильная последовательность, культивировали дальше, также произвели консервирование бактерий в глицерине, после чего направили их на хранение при -80°С для всего дальнейшего использования. Биоинформатический анализ

[0083] Последовательность аминокислот LEDGF1-326 передали на портал биоинформационных данных ExPASy и рассчитали молекулярную массу, теоретическую изоэлектрическую точку, аминокислотный состав, атомный состав, коэффициент экстинкции и предположительное время полувыведения LEDGF1-326.

Экспрессия и очистка LEDGF1-326

[0084] С целью белкового биосинтеза плазмиду pLEDGF1-326 амплифицировали и очистили от колонии Escherichia coli DH5a при помощи набора реагентов QIAGEN plasmid mini kit в соответствии с инструкцией производителя. Затем плазмиду трансформировали в штаммах Escherichia coli BL21(DE3) в соответствии и инструкцией производителя. После этого одиночную колонию содержащей плазмиду бактерии посеяли на среду LB (бульон Луриа), содержащую 50 мкг/мл канамицина на ночь. 1% инокулята выросшей за ночь культуры добавили к одному литру среды LB с содержанием 50 мкг/мл канамицина. Культуре позволили расти при 37°С до тех пор, пока оптическая плотность (ОП) культурной среды не достигла 0,6-0,8. Экспрессию белка индукцировали путем добавления ИПТГ (изопропил-β-D-тиогалактозида) до конечной концентрации 200 мкМ. Затем клетки выращивали далее в течение 3 часов при 37°С и собрали методом центрифугирования с ускорением 3000 g в течение 15 мин при 4°С. Собранные клетки смешали с буферным раствором А (25 мМ трис-HCl рН 7,0; 1 мМ ЭДТА; 1 мМ ФМСФ и 5% сахарозы). Клетки облучали пульсирующим ультразвуком с помощью ультразвукового гомогенизатора Sonicator 3000 компании «Месоникс» (Mesonix, Sonicator 3000, г. Фармингдейл, штат Нью-Йорк, США) на мощности 70% (36 Вт) в течение 5 сек, после чего охлаждали в течение 15 сек. всего в течение 30 мин. Лизированные клетки подвергли центрифугированию при 13000 g в течение 20 мин при 4°С для того, чтобы отделить растворимые и нерастворимые фракции лизата. Для определения содержания белка и растворимости/нерастворимости полученного белка растворимые (надосадочные) и нерастворимые (осадочные) фракции проанализировали с помощью ДСР-ПААГ электрофореза.

[0085] Жидкостная экспресс-хроматография белков (ЖЭХБ): LEDGF1-326 была экспрессирована в жидкой фракции согласно ДСН-ПААГ. LEDGF1-326 очистили с применением метода ЖЭХБ в два этапа, первый - на основе заряда (катионный обмен), а второй - на основе размера (гель-фильтрация). Вкратце, катионообменную гранулированную SP-сефарозу пометили в колонку ХК 16/20 и уравновесили с помощью буферного раствора А при скорости потока 2 мл/мин. Затем на колонку при скорости потока 1 мл/мин загрузили растворимую фракцию. Далее колонку промыли пятикратным объемом буферного раствора А при скорости потока 2 мл/мин. Большую часть неспецифически и слабо связанных примесей элюировали с резким градиентом хлорида натрия (проводимость от 0 до 28%). После удаления значительной доли примесей продолжили дальнейшее элюирование LEDGF1-326 с помощью второго градиента NaCl (проводимость от 28 до 40%) в течение 40 мин. За особенностями элюирования белка наблюдали путем измерения поглощения на длине волны 280 нм с помощью встроенного УФ-детектороа. Во время элюирования собрали фракции объемом 2,5 мл, которые были проанализированы с помощью ДСН-ПААГ для определения их чистоты. Фракции с высоким содержанием белка объединили вместе. Объединенные фракции диализировали с помощью диализного буфера (25 мМ трис рН 7,0 и 0,1% сахароза), а затем лиофилизировали 48 часов. Лиофилизированный белок растворили в 2 мл деионизированной воды. На следующей стадии очистки подготовленную колонку для гель-фильтрации S-200 уравновесили с помощью выравнивающего буфера В (25 мМ трис-HCl рН 7,0 и 100 мМ NaCl) при скорости потока 1 мл/мин. Концентрированный раствор LEDGF1-326, полученный после катионного обмена, загрузили на колонку S-200. LEDGF1-326 элюировали при помощи буфера В при скорости потока 1 мл/мин. Примерно на 100 мин получили острый пик, собрали по 1 мл фракций. Собранные фракции проанализировали с помощью ДСН-ПААГ. Фракции, содержащие чистый LEDGF1-326, объединили вместе.. Для удаления избытков соли и прочих примесей очищенный LEDGF1-326 подвергли интенсивному диализу в диализном буфере (25 мМ трис-HCl рН 7,0 и 0,1% сахарозы),в течение 48 часов при 4°С, при этом замена буфера была проведена три раза. Диализированный LEDGF1-326 замораживали и высушивали методом лиофилизации в течение 48 часов при -80°С. Лиофилизированный LEDGF1-326 распределили по аликвотным пробам и отправили на хранение при -80°С для последующего использования.

[0086] УФ-спектроскопия: Двенадцать мг лиофилизированного LEDGF1-326 точно отмерили и растворили в 1 мл деионизированной воды. УФ спектр поглощения регистрировали в пределах от 200 нм до 400 нм с помощью кюветно-планшетного мультидетектора планшетов Spectramax М5 производства фирмы «Молекьюлар дивайсиз» (Molecular Devices, г. Даунингтаун, штат Пенсильвания, США). Образец последовательно разбавляли деионизированной водой до тех пор, пока не получили оптическую плотность менее 1 при длине волны 280 нм. Этот показатель оптической плотности использовали для вычисления количества очищенного белка в образце с учетом молярного коэффициента экстинкции. Исследование физических параметров

[0087] Молекулярную массу и чистоту белка LEDGF1-326 определяли с помощью ДСН-ПААГ электрофореза, эксклюзионной ВЭЖХ и времяпролетной матрично-активированной лазерной десорбции/ионизации MALDI-TOF.

[0088] ДСН-ПААГ электрофорез: Вкратце 5 мкг LEDGF1-326 кипятили в течение 10 мин в ДСН-ПААГ буфере (с содержанием бета-меркаптоэтанола). Белковый образец нанесли на 4 - 15% полиакриламидный гель производства фирмы «Био-рад» (Bio-Rad, г. Геркулис, штат Калифорния, США) и подвергали электрофорезу в течение 90 мин при 30 мА. Затем гель окрасили кумасси ярко-голубым и визуализировали под белым светом с использованием системы гель-документирования GelDoc™ XR фирмы «Биорад» (Biorad, г. Геркулис, штат Калифорния). Для осуществления ДСН-ПААГ электрофореза в нередуцирующих условиях LEDGF 1-326 растворили в невосстановительном буфере (без содержания бета-меркаптоэтанола), кипячение не проводилось.

[0089] Эксклюзионная ВЭЖХ: Лиофилизированный белок растворили в деоинизированной воде до конечной концентрации 500 мкг/мл и отфильтровали с помощью фильтра ПВДФ, 0,22 мкм. Количественная оценка белка проводилась с применением колонки Agilent Bio SEC-3 и 25 мМ трис-буфера, содержащего 1 мМ CaCl2, рН 7,0, при 25°С и (линейной) скорости потока, равной 1 мл/мин. Калибровка колонки была выполнена с помощью молекулярно-массовых эталонов («Инвитроджен»). УФ-поглощение измерили на уровне 214 нм.

[0090] MALDI-TOF: Гомогенность и идентичность подтвердили на времяпролетном масс-спектрометре 4800 Plus MALDITOF/TOF™ производства фирмы «АБ Сайэкс»» (АВ Sciex, г. Фрамингем, штат Массачусетс, США) путем определения молекулярной массы. Образец белка растворили в стандартном растворе MALDI матрицы с синапиновой кислоты, нанесли на металлическую мишень и высушили на ней. Данные собрали в виде общего ионного тока (ОИТ) 1000 лазерных импульсов интенсивностью 5900.

[0091] Метод динамического рассеяния света (ДРС): Гомогенность и размер молекул белка LEDGF1-326 оценили с применением анализатора размера частиц и дзета-потенциала Nano ZS производства фирмы «Малверн» (Malvern, г. Уэстборо, штат Массачусетс, США). Вкратце, образец лиофилизированного белка растворили в деоинизированной воде до конечной концентрации образца белка, равной 2,5 мг/мл. Размер измеряли с учетом средних значений количества, интенсивности и объема методом динамического рассеяния света под углом обратного рассеяния 173°. Использовали средний показатель, полученный на основе 13 сканирований.

Исследование биофизических параметров

[0092] С целью биофизического исследования белок подвергли экстенсивному диализу в 25 мМ фосфатного буфера рН 7.0 для удаления трис-HCl и сахарозы и отфильтровали с помощью шприцевого фильтра ПВДФ, 0,22 мкм. Полученные спектры проанализировали с применением комплектов ПО Origin® 8.5 производства компании «Ориджинлаб корп.» (OriginLab Corp., г. Нортгемптон, штат Массачусетс, США) или SigmaPlot 11.0 производства компании «Систат софтвеа инк.» (Systat Software, Inc, г. Чикаго, штат Иллинойс, США). Данные были описаны уравнениями 1 и 2, сформулированными Шольцем и др., как представлено ниже, для определения ΔG, m-value и [urea]1/2 [62].

где yF° и yU° точки пересечения с осями координат, где yF° и yU° - это отсекаемые отрезки на оси координат, mF и mU - это угловые коэффициенты базовых линий пред- и переходной фазы, a m-value - это угловой коэффициент переходной фазы, ΔG - это изменение свободной энергии при любой частной концентрации мочевины, которое изменяется линейно с концентрацией мочевины и используется для количественной оценки ΔО(Н2О). ΔG(F2O) определяется как конформационная стабильность белка в отсутствие мочевины при 25°С. R - это универсальная газовая постоянная, а Τ - это температура образца, [urea]1/2 - это концентрация мочевины, при которой LEDGF1-326 на 50% свернут и на 50% развернут.

[0093] Круговой диохроизм (КД): Для определения вторичной структуры LEDGF1-326 и параметров ее конформационной стабильности регистрировали спектр КД диализированного белка в дальней УФ области. Вкратце, 500 мкг/мл образца белка поместили в кварцевую кювету с длиной оптического пути 1 мм. Регистрация спектров проводилась при скорости сканирования 0,5 сек за момент времени, с шагом 1 нм и шириной полосы 4 нм от 200 до 280 нм на КД-спектрометре Chirascan® CD производства компании «Эплайд Фотофизике лтд.» (Applied Photophysics Ltd, Великобритания). Все сканирования проводились в трех повторностях. Чтобы определить процентное содержание различных вторичных структур в нативном LEDGF1-326, над полученным спектром нативного LEDGF1-326 провели операцию обратной свертки с помощью ПО CDNN 2.1 (д-р. Геральд Бом, Университет имени Мартина Лютера, Галле-Виттенберг, Германия, Великобритания). Для определения конформационной стабильности белка LEDGF1-326 провели химическую денатурацию в присутствии мочевины разной концентрации. Вкратце, 300 мкг/мл белка инкубировали с 0-6 M мочевины в 25 мМ фосфатного буфера рН 7,0 в течение 24 часов. Сигнал КД регистрировался, как указано выше. Параметры конформационной стабильности LEDGF1-326 определяли путем построения кривой сигнала КД при 230 нм в виде функции концентрации мочевины для получения разности максимальных сигналов КД спектра свернутых и несвернутых белков при данной длине волны. Аналогично для определения температурной стабильности белка LEDGF1-326, 500 мкг/мл LEDGF1-326 подвергли тепловой денатурации в пределах от 25°С до 90°С, плавно изменяя температуру со скоростью 1° С/мин. Для определения точки плавления (Tm) использовали сигнал КД при 222 нм.

[0094] Флуоресцентная спектроскопия: Нарушения третичной структуры белка определяли путем проведения стационарной флуоресцентной спектроскопии. Образец белка (конечная концентрация 300 мкг/мл) инкубировали с раствором мочевины разной концентрации (от 0 до 6 М) в 25 мМ фосфатного буфера рН 7,0 в течение 24 часов. Истинные спектры флуоресценции триптофана регистрировали в пределах от 300 до 400 нм, при длине волны возбуждения 280 нм, с приращением 1 нм, используя кюветно-планшетный мультидетектор Spectramax М5 производства фирмы «Молекьюлар дивайсиз» (Molecular Devices, г. Даунингтаун, штат Пенсильвания). Параметры конформационной стабильности LEDGF1-326 определили путем построения кривой коэффициента интенсивности флуоресценции при 340/356 нм в зависимости от концентрации мочевины. Во все значения интенсивности были внесены поправки на эффекты буфера и внутреннего фильтра. Анализ жизнеспособности клеток

[0095] Для определения клеточной выживаемости LEDGF1-326 в условиях агрегационного стресса использовались клетки линии ARPE-19. Вкратце, клетки линии ARPE-19 содержали, как описывалось ранее (Бейд и соавт.- Baid et al., PLoS One. 6(9): p. e24616). Для анализа жизнеспособности клеток 10000 клеток поместили на планшет с 96 лунками и инкубировали в течение 24 часов. Спустя 24 часа сывороточную среду удалили. В экспериментальные группы (pP23H-Rho+LEDGF1-326) временно трансфицировали плазмиду pP23H-Rho (1 мкг/мл), с применением 1:3 липофектамина 2000 в бессывороточной среде, в соответствии с инструкцией производителя. Спустя шесть часов трансфекции среду удалили и обрабатывали клетки увеличивающимся количеством LEDGF1-326 с интервалом концентрации от 0,001 мкг/мл до 50 мкг/мл в течение 48 часов. Также в качестве контрольных наблюдались следующие группы: клетки отсутствуют (только среда), клетки без липофектамина 2000 и клетки с липофектамином 2000. Спустя 48 часов среду удалили и добавили 200 мкл свежей бессывороточной среды. В каждую лунку добавили 20 мкл МТТ-реагента (3-(4,5-диметилтиазол-2-ил)-2,5-дифенилтетразолия бромид, 5 мг/мл в фосфатно-буферном солевом растворе (ФСБ), рН 7,4), и дальше инкубировали 3 часа при 37°С. Среду с МТТ удалили и растворили образовавшиеся кристаллы формазана в 200 мкл диметилсульфоксида (ДМСО). Полученное поглощение света измерили при 570 нм с применением Spectramax М5. Процентную долю жизнеспособности групп вычислили с учетом показателей контрольной группы, в которой находились клетки без липофектамина 2000. Эксперименты в каждой группе повторялись n=4.

Содержание лабораторных животных

[0100] В виварии медицинского подразделения Университета Колорадо с одобрения Институционального комитета по содержанию и использованию животных содержалась колония крыс линии RCS. Эксперименты проводились в соответствии с положением Ассоциации исследователей в области зрения и офтальмологии об использовании животных в офтальмологических исследованиях.

Электроретинография

[0101] Крыс в возрасте 4 недель адаптировали к темноте 30 мин. Затем животное подготовили к электроретинографии (ЭРГ) под тусклым красным светом. Вкратце, крысе ввели наркоз путем интраперитонеальной инъекции смеси 80 мг/кг кетамина и 12 мг/кг ксилазина. Затем зрачок расширили одной каплей тропиканамида 0,5% производства фирмы «Акорн» (Akorn, г. Лейк-Форест, штат Иллинойс, США) и поддерживали его в увлажненном состоянии с помощью одной капли гипромеллозы 2,5 % (Akorn, г. Лейк-Форест, штат Иллинойс, США). После этого животное поместили на нагретую водяную рубашку с температурой 37°С. В хвост и щеку животного ввели электрод сравнения производства фирмы «ЭЛ-КЕЙ-СИ Текнолоджиз Инк.» (LKC Technologies Inc., г. Гейтерсберг, штат Мэриленд, США) Поперек роговицы каждого глаза разместили электрод DTL plus (LKC Technologies Inc., г. Гейтерсберг, штат Мэриленд, США). Каждое животное подвергли кратким вспышкам света интенсивностью 0,4 log кд-сек/м2 с интервалом 10 сек между каждой вспышкой, при этом регистрировали скотопическую ЭРГ. После этого животное адаптировали к свету 3 мин с фоновым освещением яркостью 30 кд/м2. Фотопическую ЭРГ регистрировали при той же интенсивности вспышки, но уже при наличии фонового освещения. Для каждой крысы определили средние показатели ЭРГ на основе не менее трех процедур ЭРГ. После этого в один глаз интравитреально ввели 2 мкл стерильно отфильтрованного LEDGF1-326 с концентрацией 0,25, 0,5, или 2,5 мг/мл, а в контралатеральный глаз - плацебо. ЭРГ регистрировали каждые 2 недели в течение 8 недель после интравитреальной инъекции, т.е. до достижения крысами 12-недельного возраста.

Статистический анализ

[0102] Данные представлены как среднее ± стандартное отклонение. Для сравнения двух или нескольких экспериментальных групп использовали параметрический t-критерий Стьюдента на независимой выборке или проводили дисперсионный анализ ANO VA, подкрепляя его ретроспективным/ анализом Тьюки, (SPSS, версия11.5, SPSS, г.Чикаго, штат Иллинойс, США), соответственно.. Разницы считались статистически значимыми при p≤0.05.

2. Результаты

Клонирование LEDGF1-326 вектор рЕТ28а(+)

[0103] Фрагмент ДНК, состоящий из примерно 1000 азотистых оснований, получили путем амплификации гена Ledgf1-326 (рис.3, дорожка 1) из плазмиды pEGFP-LEDGF, осуществленной с помощью полимеразной цепной реакции (ПЦР). В неразрезанном векторе рЕТ-28 а (+) (дорожка 2) обнаружилась положительная полоса примерно на отметке 4,5 т.п.н., которая распрямилась и сместилась вверх между маркированными 5 и 6 т.п.н. после разрезания BamHI (дорожка 3). Когда ген Ledgf1-326 вшили в вектор рЕТ-28а (+) (с этого времени и далее плазмиду, полученную таким путем, будем именовать pLEDGF1-326), произошел сдвиг полосы, равный ~1000 пар оснований, что означало успешную вставку гена Ledgf1-326 в вектор рЕТ28а(+) (дорожка 4). Чтобы подтвердить наличие вшивания, плазмиду pLEDGF1-326 однократно разрезали рестриктазами BamHI (дорожка 5) или HindIII (дорожка 6). Плазмида pLEDGF1-326 приобрела линейную форму благодаря двум реакциям рестриктазного расщепления, полоса ДНК достигла уровня примерно 6,4 т.п.н., что на 1000 пар оснований превышало показатель вектора рЕТ28а(+). Плазмиду pLEDGF1-326 дважды разрезали рестриктазами BamHI and HindIII, в результате чего получили два фрагмента: больший фрагмент размером ~5,4 т.п.н. (верхняя полоса, дорожка 8) и меньший фрагмент размером ~1000 т.н. (нижняя полоса, дорожка 7). В результате амплификации гена Ledgf1-326 методом ПЦР из плазмиды pLEDGF1-326 получили пригодную полосу ДНК из примерно 1000 оснований (дорожка 8), что свидетельствовало об успешной вставке гена LEDGF1-326 в вектор рЕТ-28 а (+).

Исследование биофизических параметров LEDGF1-326

[0104] Биоинформатический анализ последовательности LEDGF1-326, проведенный на биоинформационной платформе ExPASy Швейцарского института биоинформатики (Гастайгер и соавт.- Gasteiger et al., «Исследования нуклениновых кислот» - Nucleic Acids Res, 2003. 31(13): p.3784-8) позволил определить ее теоретическую молекулярную массу, равную 36,9 кДа. Рссчитанная изоэлектрическая точка (ИЭТ) LEDGF1-326 составила 9,23, при этом 73 аминокислотных остатка были положительно заряженными (аргинин и лизин), 63 аминокислотных остатка - отрицательно заряженными (аспартовая и глутаминовая кислоты). Теоретический молярный коэффициент поглощения составил 15470 М-1 см-1 при 280 нм в воде. На основе N-концевого метионина предсказали период ее полужизни в клетках млекопитающих, составивший 30 часов.

Очистка LEDGFunee крупном объеме

[0105] В результате экспрессии последовательности LEDGF1-326 в клетки BL21(D3B) в заданных условиях, появилась новая положительная полоса примерно на уровне 40 кДа, что указывало на экспрессию белка LEDGF1-326 (рис. 4А, дорожка 3). Эта полоса появилась в надосадочной фракции после лизиса бактериальных клеток, что указывало на экспрессию LEDGF1-326 в качестве растворимого белка в бактериальной культуре (дорожка 4). LEDGF1-326 очистили от грубого клеточного лизата с помощью системы жидкостной экспресс-хроматографии белков (ЖЭХБ). На первом этапе очистки использовали катионообменную колонку (рисунок 4 В). Несвязанный белок и другие клеточные примеси, включая липиды, вымыли во время фазы промывки колонки (100-280 мл). После этого, прочие клеточные белки, слабо связанные с колонкой, элюировали, когда увеличили проводимость подвижной фазы с 0 до 28%, используя резкий градиент хлорида натрия (NaCl) (280-400 мл). При дальнейшем постепенном повышении градиента NaCl в течение 40 мин до 40%-ной проводимости, произошло вымывание LEDGF1-326 (400-450 мл). Во время анализа собранной фракции методом ДСН-ПААГ электрофореза, наряду с другими низкомолекулярными полосами обнаружили и сильную положительную полосу LEDGF1-326 при молекулярной массе примерно ~40 кДа (рисунок 4А, дорожка 5). При дальнейшей очистке на гель-фильтрационной колконке элюирование LEDGF1-326 произошло в виде первого пика (собранные фракции), далее последовали пики других белков с меньшей молекулярной массой (рисунок 4С). Смешанные фракции из гель-фильтрационных колонок выявили наличие сильной полосы при молекулярной массе ~40 кДа наряду с крайне слабыми полосами, соответствующими низкомолекулярным соединениям, что указывало на почти полную очистку LEDGF1-326 (рис. 4А, дорожка 6). Подсчет белка показал, что на 1 литр культуры во встряхиваемой колбе получили около 20 мг белка.

Очистка LEDGF1-326 до состояния, близкого к гомогенности

[0106] Чистоту белка LEDGF1-326 определяли эксклюзионной хроматографией (эксклюзионной ВЭЖХ) (рисунок 5А). Наблюдались два пика, время удерживания первого пика составляло 10,5 мин, а время удерживания второго пика - около 11,5 мин. Когда проинтегрировали область, находящуюся ниже кривой линии, первый пик составил всего 5%, а второй пик составил 95%. Это говорило о том, что чистота белока LEDGF1-326 равнялась 95%. Молекулярную массу LEDGF1-326 подтвердили матрично-активированной лазерной десорбцией/ионизацией (MALDI-TOF). Основной пик, полученный в спектре MALDI-TOF, был на уровне 40314,32 и 80663,19 m/z (отношение массы к заряду) (рисунок 5 В). С помощью MALDI-TOF было установлено, что молекулярная масса LEDGF1-326 составляет 40 кДа, что равно теоретической молекулярной массе. Также был замечен второй пик на 80663 м/з (отношение массы к заряду), что указало на возможность существования LEDGF1-326 в форме димера. Для исследования существования димеров провели ДСН-ПААГ электрофорез LEDGF1-326 в восстановительных и невосстановительных условиях (рисукнок 5D). В невосстановительных условиях, показатели полосы LEDGF1-326 сместились вверх до размера 95-105 кДа. Это свидетельствовало о возможности существования LEDGF1-326 в форме димера. В восстановительных/денатурирующих условиях димеры распадались на мономеры.

[0107] Для дальнейшего выяснения способности LEDGF1-326 к самоассоциации и образованию более высокомолекулярных олигомеров использовали метод динамического рассеяния света (ДРС) (рисунок 5С). На гомологичной популяции с единичным пиком (100%-ная дистрибуция) исследовали распределение размеров частиц на основе показателей количества, интенсивности или объема. Все три пика произошли в непосредственной близости, что указывало на наличие крайне незначительного диапазона размеров. Отсутствие других пиков, соответствующих более крупным молекулам, говорило об отсутствии каких бы то ни было олигомеров. На основе ДРС получили z-средний диаметр, составивший 11,32 нм, и коэффициент полидисперсности, составивший 0,15.

LEDGF1-326 образован случайными спиралями

[0108] Для исследования вторичной структуры LEDGF1-326, проанализировали спектр кругового дихроизма (КД) нативного LEDGF1-326 в дальней УФ области (рисунок 6А). Сигнал КД оставался негативным в диапазоне от 280 до 200 нм. После 220 нм наблюдалось резкое снижение КД сигнала. Характерные отрицательные полосы отсутствовали при 222 нм и 208 нм, также не было характерной положительной полосы в районе 200 нм, что указывало на отсутствие в LEDGF1-326 α-спирали или β-листов. В целом, крайне низкая эллиптичность в области выше 210 нм и отрицательная полоса в области ниже 200 нм указали на то, что LEDGF1-326 быть образован в основном случайными спиралями.

[0109] Для дальнейшего анализа вторичной структуры LEDGF1-326 провели обратную свертку КД спектра с помощью ПО CDNN 2.1. При допущении, что полученный спектр является линейной комбинацией индивидуального спектра компонентов вторичной структуры и шума, вызванного ароматическими хроматофорами и простетичискими группами, было предсказано, что на долю произвольных спиралей во вторичной структуре LEDGF1-326 должно приходиться 45,1%. β-изгиб составлял примерно 21.2%, также имелось 15% параллельных β-листов и 16% антипараллельных β-листов. Доля α-спирали составляла примерно всего 16%.

[0110] Трехмерную структуру нативного белка LEDGF1-326 предсказали с помощью сервера для моделирования структуры белка I-Tasser (Iterative Threading Assembly Refinement) (рисунок 6B). Предсказанная модель LEDGF1-326 обладала степенью достоверности (C-score), равной -3.18; показателем структурного сходства (ТМ- score), равным 0,36±0,12, а среднеквадратичное отклонение (RMSD) равнялось 14.1±8 Å, что указывало на надежность предсказанной модели. Согласно предсказанной модели, белок LEDGF1-326 преимущественно свернут в произвольные спирали.

LEDGF1-326 обладает конформационной стабильностью

[0111] Для уяснения конформационной стабильности LEDGF1-326 в воде исследовали нарушения третичной структуры, обусловленные химической денатурацией, путем измерения собственной флуоресценции присутствующих в LEDGF1-326 молекул триптофана (рисунок 7А и 7В). Эмиссионный спектр нативного белка LEDGF1-326, в отсутствие мочевины обладал λmax при 340 нм и Δλ1/2 (полуширина Δλ) 56 нм (рисунок 7А). При увеличении концентрации мочевины с 0 до 5 M наблюдалось тушение флуоресцентного сигнала, а также красное смещение (флуоресцентный максимум, сдвигающийся в красную сторону). Сигнал медленно уменьшался до тех пор, пока концентрация мочевины не составила 0,9 М. Затем происходило резкое уменьшение флуоресцентного сигнала до тех пор, пока концентрация мочевины не составила 2,3 М. Свыше этой концентрации уменьшение флуоресцентного сигнала было минимальным. Величина λmax LEDGF1-326 сместилась к 356 нм, а Δλ1/2 составила 71 нм при 5 M мочевины. При построении графика коэффициента флуоресцентного сигнала LEDGF1-326 при 340-356 нм в зависимости от концентрации мочевины получили сигмоидальную кривую (рисунок 7В). Наблюдалось медленное снижение флуоресцентного сигнала с 0-1 M мочевины (предпереходная фаза), затем резкое уменьшение с 1-3 M мочевины (переходная фаза), за которым следовала фаза медленного уменьшения с 3-5 M (постпереходная фаза). С помощью уравнений 1 и 2 (описанных в разделе «Методы»), определили значения ΔG(Н2О) LEDGF1-326 в размере 3,24±0,48 ккал моль-1, m-value в размере 1,70±0,22 ккал моль-1М-1 и [urea]1/2 в размере 1,81±0,02 М, что указывало на стабильность белка LEDGF1-326.

[0112] Для изучения нарушений вторичной структуры LEDGF1-326 в присутствии мочевины провели КД спектроскопию в дальней УФ области (рисунок 7С и 7D). КД сигнал LEDGF1-326 прослеживали относительно длины волны при каждом значении концентрации мочевины (рисунок 7С). КД сигнал непрерывно становился все более отрицательным по мере увеличения концентрации мочевины. При построении графика КД сигнала при 230 нм в зависимости от концентрации мочевины (рисунок 7D) получили сигмовидную кривую. При подстановке данных в уравнения 1 и 2 получили значения ΔG(H2O) LEDGF1-326 в размере 3,28±0,40 ккал моль-1, m-value в размере 1,90±0.19 ккал моль-1М-1 и [urea]1/2 в размере 1,61±0,02 М.

LEDGF1-326 устойчив при нагревании

[0113] Термическую устойчивость LEDGF1-326 определили с помощью КД спектроскопии в дальней УФ области (рисунок 7Е и 7F). КД сигнал измеряли в присутствии нагревания в качестве денатурирующего фактора начиная с 215-250 нм (рисунок 7Е). При повышении температуры раствора LEDGF1-326 наблюдалось увеличение отрицательного провала, полученного примерно при 235 нм. КД сигнал соответствовал схеме химической денатурации, предпереходная фаза между ~30-35°С, затем переходная фаза ~35-55°С и постпереходная фаза с ~55-70°С (рисунок 7F). При обработке этих данных с помощью глобального анализа получили Tm (температура плавления) LEDGF1-326, равную 44,82±0,17°С, что указывало на возможную устойчивость LEDGF1-326 при 25°С (комнатная температура).

LEDGF1-326 защищает клетки линии ARPE-19 от стресса, связанного с агрегацией

[0114] Способность LEDGF1-326 защищать клетки линии ARPE-19 от стресса, связанного с агрегацией белка, измерили с помощью анализа жизнеспособности клеток (рисунок 8). Первоначально исследовали способность LEDGF1-326 увеличивать жизнеспособность клеток линии ARPE-19 в отсутствие стресса (рисунок 8А). Заметная разница между жизнеспособностью необработанных клеток и клеток, обработанных LEDGF1-326 с концентрацией от 0,001 до 50 мкг/мл в течение 48 часов, отсутствовала. При наивысшей дозе LEDGF1-326 (50 мкг/мл) клеточная жизнеспособность составляла 108,14±5,63% (крайний справа столбец) по сравнению с жизнеспособностью необработанных клеток, равной 100±13,19% (крайний слева столбец), что было незначительно. Поведение LEDGF1-326 менялось в клетках линии ARPE-19 с транфицированными pP23H-Rho (рисунок 8 В). В клетках с экспрессией мутантного гена родопсина Р23Н наблюдалось снижение клеточной жизнеспособности до 48,25±5,62% (столбец 2). Данное снижение клеточной жизнеспособности можно объяснить токсическим воздействием склонного к агрегации мутанта родопсина Р23Н в процессе его экспрессии и аккумуляции в клетках. При обработке клеток с экспрессией мутантного гена родопсина Р23Н (столбцы 3-9) возрастающим количеством LEDGF1-326 наблюдалось увеличение жизнеспособности клеток. LEDGF1-326 с самой низкой концентрацией 0,001 мкг/мл повысил жизнеспособность клеток линии ARPE-19 с 48,25±5,62 до 77,02±10,20%. После этой точки жизнеспособность клеток оставалась значительно выше, чем в группе с транфицированной плазмидой pP23H-Rho, не обработанной белком LEDGF1-326 (столбец 2).

LEDGF1-326 замедлят утрату функциональности фоторецепторов

[0115] Эффективность LEDGF1-326 в плане замедления функциональной утраты фоторецепторов изучали на крысах линии RCS (с наследственной дегенерацией сетчатки) путем мониторинга электроретинограмм (ЭРГ). На регистрируемой в условиях темновой адаптации (скотопической) ЭРГ, до введения интравитреальной инъекции, амплитуда b-волны у не получавших и получавших лечение крыс варьировалась в пределах от 180,17±27,42 до 216,60±35.,30 мкВ в возрасте 4 недель (базовая ЭРГ) (рисунок 9А). Спустя две недели после интравитреальной инъекции наблюдалось резкое уменьшение амплитуды b-волны во всех группах, при этом амплитуда варьировалась в пределах от 65,80±15,44 to 91,13±13,94 мкВ. Значительного различия между группой, не получавшей лечение LEDGF1-326, и группами, получавшими такое лечение, не наблюдалось. Спустя еще две недели амплитуда b-волны продолжала уменьшаться во всех группах, тем не менее, уменьшение происходило медленнее в группах, получавших лечение пептидом LEDGF1-326. Спустя восемь недель после интравитреальной инъекции амплитуда b-волны у группы, не получавшей лечение, и групп, получавших лечение 0,5; 1,0 и 5 мкг (белка) LEDGF1-326, составляла 9,40±4,57; 32,43±10,34; 37,93±0,60 и 57,63±8,81 мкВ, соответственно. Амплитуда b-волны в группах, получавших лечение (белком) LEDGF1-326, была значительно (р<0.05) выше, чем в группе, не получавшей лечения. В группах, получавших лечение пептидом LEDGF1-326, прослеживалась зависимость замедления уменьшения амплитуды b-волны от дозы получаемого средства. При увеличении дозы LEDGF1-326 сокращалось уменьшение амплитуды b-волны.

[0116] На регистрируемой в условиях световой адаптации (фотопической) ЭРГ, до введения интравитреальной инъекции крысам в взрасте 4 недель, базовая амплитуда b-волны варьировалась в пределах от 69,83±16,49 до 80,97±8,60 мкВ. Значительное различие между группой, не получавшей лечение LEDGF1-326, и группами, получавшими такое лечение, отсутствовало (рисунки 9 В). Амплитуда b-волны в группе, не получавшей лечение, уменьшилась с 80,97±8,60 до 10,90±5,64 мкВ, в то время как в группах, получавших лечение 0,5; 1,0 и 5,0 мкг пептида LEDGF1-326, амплитуда уменьшилась с 79,63±20,30 до 41,33±9,20; с 69,83±16,49 до 28,00±7,23 и с 68,75±15,93 до 45,78±15,18 мкВ, соответственно. Спустя восемь недель после однократной интравитреальной инъекции LEDGF1-326 амплитуда b-волны в группах, получавших лечение пептидом LEDGF1-326, была значительно (р<0.05) выше, чем в группе, не получавшей лечения, как и в случае скотопической ЭРГ.

Образец 2

1. Материалы и методы

[0117] Материалы- Изопропил-β-D-тио-галактозид (ИПТГ) лимонная кислота, вторичный кислый фосфат натрия (двухосновный), этилендиаминтетрауксусная кислота (ЭДТА), твин 20, сахароза, азид натрия были приобретены в компании «Сигма-Алдрич». Для очистки белка использовали жидкостный хроматограф АКТА FLPC. Все хроматограммы анализировали с помощью ПО UNICORN. Все прочие химические препараты реактивной чистоты или выше, приобрели в компании «Сигма-Алдрич», если иное не оговорено.

[0118] Удаление гистидиновой метки - Ген Ledgf1-326 амплифицировали из плазмиды pLEDGF1-326 с использованием праймеров

содержащих сайты рестрикции рестриктаз NcoI и HindIII, соответственно. Затем ген Ledgf1-326 лигировали в вектор рЕТ-28а(+) после расщепления ферментами NcoI и HindIII. Компетентные клетки Escherichia coli DH5α подвергли трансформации продуктами лигирования. Лигированный продукт трансформировали в компетентные клетки Escherichia coli DH5α cells в соответствии с инструкцией производителя. Вставку гена подтвердили методами ГЩР, рестрикционного расщепления и секвенирования.

[0119] Биосинтез и очистка LEDGF1-326: LEDGF1-326 (без гистидиновой метки) биосинтезировали и очистили, как описывалось ранее (см. JBC). Вкратце, LEDGF1-326 экспрессировали в клетках Escherichia coli BL21 (DE3) с помощью 1 мМ ИПТГ. LEDGF1-326 очистили от клеточного лизата с помощью двухступенчатой жидкостной экспресс-хроматографии белков (ЖЭХБ). Первая стадия была основана на заряде (катионный обмен), а вторая - на размере (гель-фильтрация). Очищенный белок LEDGF1-326 подвергли глубокому диализу в цитрат-фосфатном буфере с рН 7,0, концентрированию и отправили на хранение для дальнейшего использования при -80°С.

[0120] Приготовление композиции: Композицию белка LEDGF1-326 (1 или 0,5 мг/мл) приготовили в цитрат-фосфатном буфере с диапазоном рН от 6 to 7,5. Добавили твин 20, ЭДТА до конечной концентрации 0,1% (весовая доля), 1 мМ, 10% (весовая доля), соответственно. Композицию с содержанием 0,02% азида натрия испытали на предмет деградации, которая могла быть вызвана ростом микроорганизмов. Все приготовленные композиции хранились при 25°С в термостатированном инкубаторе, во избежание испарения были приняты соответствующие меры.

[0121] Флуоресцентная спектроскопия: Для выявления изменений в третичной структуре провели стационарную флуоресцентную спектроскопию. Истинные флуоресцентные спектры триптофана (Трп), содержащегося в композициях, регистрировали в диапазоне длины волн от 300 to 400 нм, с длиной волны возбуждения 280 нм и шагом 1 нм на планшете Spectramax М5 (Molecular Devices, г. Даунингтаун, штат Пенсильвания, США). Чтобы измерить изменения флуоресценции, построили график интенсивности флуоресценции при 342 нм для каждого значения рН и каждого момента времени. Во все значения флуоресценции были внесены поправки на эффекты буфера и внутреннего фильтра.

[0122] Круговой дихроизм (КД): Изменения вторичной структуры LEDGF1-326 определили с помощью спектров КД в дальней УФ-области. Вкратце, композицию поместили в кварцевую кювету с длиной оптического пути 1 мм. Регистрация спектров проводилась при скорости сканирования 0,5 сек за момент времени, с шагом 1 нм и каналом регистрации в 4 нм при длине волны от 200 до 280 нм на КД-спектрометре Chirascan® CD (Photophysics Ltd, Великобритания).

[0123] Динамическое рассеяние света ДРС): Размер белка LEDGF1-326 фиксировали с использованием анализатора Nano ZS (Malvern, г. Уэстборо, штат Массачусетс, США). Вкратце, 100 мкл композиции поместили в малообъемную стеклянную кювету. При помощи динамического рассеяния света собрали данные о рассеянии света частицами LEDGF1-326 под углом обратного рассеяния 173°. Для каждого измерения зарегистрировали средний показатель 13 сканирований.

[0124] Электрофорез в полиакриламидном геле в присутствии додецилсульфата натрия (ДСН-ПААГ): Образцы композиции LEDGF1-326 (10 мкг) кипятили в течение 10 мин при 75°С вместе с 10 мкл буфера для загрузки образцов (2х). Образцы загрузили на 4-15%-процентные гели mini-PROTEAN TGX и разделили белки по размеру. Белки визуализировали с помощью кумасси синего в соответствии с инструкцией производителя.

[0125] Оценка белка: Для оценки белка композицию LEDGF1-326 осадили путем центрифугирования при 10000 g в течение 5 мин и собрали супернатант. Оценку супернатанта на содержание в нем белка осуществили методом с бицинхониновой кислотой с помощью набора реактивов ВСА в соответствии с инструкцией производителя. Для подсчета нерастворимых агрегатов растворимый белок, измеряемый в каждый момент времени, вычли из уровней белка в день 0 соответствующей композиции.

[0126] ИФА: Для определения процентного содержания иммунореактивного LEDGF1-326 в композициях использовали метод непрямого иммуноферментного анализа (ИФА). Вкратце, на планшет с 96 лунками в трех экземплярах наносили либо 100 мкг стандартного LEDGF1-326 (свежеочищенного), либо образцы композиции и оставили на ночь при 4°С. Лунки трижды промывали промывочным буфером (0,1% весовой доли твин 20 в фосфатно-буферном растворе (ФСБ) рН 7,0) после каждого этапа. Места неспецифического связывания блокировали с помощью блокирующего раствора (0,5% альбумина бычьей сыворотки и 0,1% твин 20 в ФСБ рН 7,0) в течение 4 часов. LEDGF1-326 обнаруживали с помощью антител мыши к LEDGF производства фирмы «Би Ди Биосайнсиз» (BD Biosciences, г. Сан-Диего, штат Калифорния, США), а их, в свою очередь, выявляли с помощью противомышиных вторичных антител, конъюгированных с пероксидазой хрена (источник). После тщательной промывки планшета в заключении добавили finally 3,3ʹ,5,5ʹ-тетраметилбензидин (ТМБ). Количественный анализ иммунореактивного LEDGF1-326 произвели с помощью колориметрического поглощения при 650 нм сразу после появления синего цвета.

[0127] Статистический анализ: Все данные представлены как среднее±стандартное отклонение. При сравнении между двумя множественными группами собирали данные для всех вариантов рН, находили среднее значение и сопоставляли с соответствующей композицией, содержащей добавки. Статистические вычисления проводили на основе однофакторного дисперсионного анализа, сопровождавшегося ретроспективным анализом Тьюки, (SPSS, версия11.5, SPSS, г.Чикаго, штат Иллинойс, США). Считалось, что р≤0.05 статистически значимо. 2.

Результаты

Клонирование и очистка LEDGF1-326 без гистидиновой метки

[0128] В результате ПЦР-амплификации была получена полоса из 1000 пар оснований LEDGF1-326. Рестрикционное расщепление, вшивание и последующая ПЦР-амплификация из плазмиды со вставкой гена LEDGF1-326 выявили положительную полосу LEDGF1-326. Очистка белка LEDGF1-326 выявила полосу мономера при 40 кДа наряду с очень слабыми низкомолекулярными полосами, что указывало на возможность некоторой деградации LEDGF1-326 во время процесса очистки.

Добавки повышают стабильность LEDGF1-326

[0129] Воздействие добавок твин 20, ЭДТА и сахарозы на стабильность LEDGF1-326 наблюдали в цитрат-фосфатном буфере между рН 6,0-7,5. Нарушения третичной структуры в LEDGF1-326 отслеживали путем измерения флуоресцентных свойств триптозана (Три) в LEDGF1-326 (рисунок 11А). В композиции LEDGF1-326 (0,5 мг/мл) не обнаруживалась значительная разница в интенсивности флуоресценции при 342 нм относительно рН буфера (рисунок 11A(i)). В 0 день в простых композициях LEDGF1-326 (только с буфером) зафиксировали начальную интенсивность флуоресценции, равную 5163±302 О.Е.Ф. при 342 нм в диапазоне рН 6,0-7,5. В 1 день интенсивность флуоресценции выросла до 6198±102 О.Е.Ф, однако ко дню 3 она значительно понизилась до 3518±305 О.Е.Ф., что сигнализировало о снижении интенсивности сигнала на ~43% по сравнению с 1 днем. К 14 дню интенсивность сигнала была снижена на 87%. Спектры флуоресценции обнаружили красное смещение при максимальной интенсивности флуоресценции в 3 день, 7 день, за пределами спектров активность отсутствовала.

[0130] Внесение добавок не изменило начальную интенсивность флуоресценции LEDGF1-326, и в 0 деньне наблюдалось значительной разницы в интенсивности флуоресценции композиций с добавками или без добавок (рисунок 11 A(ii)). До 60 дня во всем диапазоне рН не наблюдалось ни значительного снижения флуоресцентного сигнала, ни сдвига флуоресцентного максимума.

[0131] Нарушения вторичной структуры LEDGF1-326 отслеживали с помощью КД. На рисунке 11В показана эллиптичность LEDGF1-326 в различных композициях при 208 nm и 6,0-7,5 рН в зависимости от времени. На основании КД установили, что вторичная структура LEDGF1-326 составлена преимущественно случайными спиралями. В 0 день эллиптичность LEDGF1-326 составляла -17.5±0.1 миллиградусов, однако ко дню 3 значительно сократилась до -13.9±0.8 миллиградусов (рисунок 11B(i)). Наблюдался дальнейшее ослабление сигнала, и, начиная с 7 дня, эллиптичность составляла -3.4±2.3. ВО день отсутствовала значительная разница между КД сигналами в композициях с добавками или без них (рисунок 11B(ii)). Во всех композициях с добавками КД сигнал в 0 день и в 60 день составлял -17.9±0.3 и -19.1±1.4 миллиградусов, соответственно, что указывало на отсутствие заметных изменений сигнала.

[0132] Методом ДРС определили, что в 0 день гидродинамический размер (частиц) LEDGF1-326 составлял 7±1 нм во всех композициях с добавками или без них (рисунок 11C(i)). К 3 дню в простых композициях (только с буфером) рН 6-7,5 размер частиц LEDGF1-326 увеличился до 200-700 нм. В 0 день в присутствии добавок установленный размер LEDGF1-326 составлял ~1 нм. Вплоть до дня 60 не было выявлено никаких изменений размеров частиц (рисунок 11C(ii)).

[0133] Методом ДСН-ПААГ электрофореза установили, что LEDGF1-326 является белком с молекулярной массой 40 кДа. В 0 день во всех композициях присутствовали крайне слабые полосы низкомолекулярных белков. В простых композициях (только с буфером) относительно низкомолекулярные фрагменты интенсифицировались уже в 1 день (рисунок 12(i)). Ко дню 3 обнаружили значительное количество видимых относительно низкомолекулярных полос. На 7 день полоса в 40 кДа и прочие фрагменты полностью исчезли. Добавки отсрочили интенсификацию относительно низкомолекулярных полос вплоть до дня 60 дня (рисунок 12(ii)). В композициях, содержащих добавки, вне зависимости от рН буфера на 60 день были различимы относительно низкомолекулярные полосы наряду с полосой в 40 кДа.

Добавки снижают образование нерастворимых агрегатов

[0134] В 0 день содержание растворимого белка в простых композициях LEDGF1-326 (только с буфером), рН 6,0-7,5 составляло 417,8±21,3 мкг/мл (рисунок 13А). На 7 день произошло заметное снижение содержания растворимого белка до t142,5±60,7 мкг/мл. После этого содержание белка в простых композициях (только с раствором) при разном уровне рН значительно менялось, однако закономерность этих изменений определить не удалось. В среднем, на 60 день общее содержание растворимого белка составило 316,2±140,0 мкг/мл. В композициях, содержащих добавки, содержание белка составляло 470,5±17,3 мкг/мл в 0 день и осталось на уровне 469,0±33,4 мкг/мл даже спустя 60 дней.

[0135] Процентную долю агрегатов в композиции высчитали на основе содержания растворимого белка (рисунок 13В). В простых композициях (только с буфером) нерастворимые агрегаты обнаружили уже в 3 день, а к 7 дню доля скоплений составляла 64,6±14,0% (рисунок 13В). После 7 дня содержание агрегатов в композиции менялось непредсказуемым образом, однако их процентная доля оставалась заметно высокой во всем диапазоне рН. В присутствии добавок процентная доля нерастворимых агрегатов оставалась ниже пороговой чувствительности вплоть до 60 дня, за исключением 30 дня, когда их доля составила 22,3±9% (рисунок 13В).

[0136] В простой композиции (только с буфером) были заметны осевшие частицы (рисунок 13С), в то время как композиции, содержащие добавки, оставались прозрачными и чистыми вплоть до 60 дня.

LEDGF1-326 сохраняет иммунореактивность в присутствии добавок

[0137] Иммунореактивность LEDGF1-326 количественно определили с применением метода непрямого ИФА (рисунок 14). В день 0 в простых композициях (только с буфером) рН 6,0-7,5 ИФА выявил 76,9±4.8% иммунореактивных LEDGF1-326. На 14 день при исследовании иммунореактивности обнаружили, что LEDGF1-326 практически утратил иммунореактивность, осталось всего 3,1±2,4%. На 60 день иммунореактивность LEDGF1-326 не поддавалась обнаружению. С другой стороны, в композициях, содержащих добавки выявили 74,8±7,7; 66,2±2,8 и 70,4±24,5% иммунореактивного (белка) LEDGF1-326 в 0 день, 14 день и 60 день, соответственно. Было видно, что иммунореактивность зависит от рН, в то время как при рН, равному 6 и 7,5, выявили 30±4 и 58±1% иммунореактивных LEDGF1-326, при рН 6,5; 6,75; 7,0 и 7,25 выявили 78±15, 78±45, 76±9,и 102±13% иммунореактивных LEDGF1-326 в 60 день.

По отдельности добавки менее эффективно повышают стабильность LEDGF1-326

[0138] Чтобы понять, какое воздействие оказывают добавки на стабильность LEDGF1-326 по отдельности, каждую в отдельности добавку испытывали в композициях LEDGF1-326 (1 мг/мл) при рН 7,0 (рисунок 15 и 16). В простой композиции (только с цитрат-фосфатным буфером) к 30 дню интенсивность флуоресценции LEDGF1-326 при 342 нм снизилась с 8410±116 до 2178±22 О.Е.Ф. (рисунок 15А). В то же время в композиция, содержащих 0,01% твин/твин 0,01% 20, 1 мМ ЭДТА и 10% сахарозы, интенсивность флуоресценции в 30 день составляла 4925±1249, 4056±979 и 6370±592 О.Е.Ф., соответственно. Азид натрия, используемый в качестве контрольного образца для мониторинга/отслеживания содержания микроорганизмов, продемонстрировал интенсивность флуоресценции, равную 9136±241 О.Е.Ф. В отсутствие добавок, флуоресцентный сигнал LEDG1-326 уменьшился на 75% по сравнению с сигналом в 0 день. Твин 20, ЭДТА и сахароза сохранили флуоресцентный сигнал на ~59, 48, and 76%, соответственно. Аналогично флуоресценции сигнал КД также выявил нестабильность LEDGF1-326 (рисунок 15В).

[0139] В 30 день все композиции обнаружили заметную разницу в эллиптичности при 208 нм по сравнению с сигналом в 0 день. Присутствовал значительный фоновый шум, указывавший на наличие неестественных структур.

[0140] В 0 день LEDGF1-326 обнаружил средний гидродинамический размер, равный 7±1 нм, во всех композициях, за исключением содержащей сахарозу (рисунок 15С). В присутствии сахарозы LEDGF1-326 обнаруживал гидродинамический размер, равный 1 нм. К 30 дню размер частиц значительно увеличился до 578±366, 726±444, 490±423 и 1052±125 нм в простой композиции (только буфер) и композициях, содержащих твин 20, ЭДТА, сахарозу, соответственно. В группе с азидом натрия вместо увеличения произошло уменьшение размера с 7 до 4 нм.

[0141] Мономерный нативный LEDGF1-326 наблюдали с помощью ДСН-ПААГ электрофореза (рисунок 16). Первоначально в 0 день выраженность полосы LEDGF1-326 в 40 кДА была одинаковой во всех группах. На 7 день наблюдалось истончение полосы в 40 кДА, что указывало на сокращение мономеров LEDGF1-326. По сравнению с 0 днем в 14 день во всех группах стали более заметны полосы более низкомолекулярные полосы.

Образец 3

1. Материалы и методы

[0142] Клетки линии ARPE-19 получили из коллекции биоматериалов АТСС (АТСС, г. Манассас, штат Виргиния, США). Материалы для культивирования клеточных культур, реагенты и липофектамин 2000 приобрели у компании «Инвитроджин Корпорейшн» (Invitrogen Corporation, г. Карлсбад, штат Калифорния, США). Хромовую кислоту, HCl, NaOH и прочие необходимые для применения кругового дихроизма материалы приобрели в компании «Фишер Сайнтифик» (Fisher Scientific, г. Питтсбург, штат Пенсильвания, США). Трис-основание, ZnCh, ЭДТА (этилендиаминтерауксусная кислота) приобрели в компании «Сигма-Алдрич» (Sigma-Aldrich, г. Сент-Луис, штат Миссури, США). Приготовление наноансамблей

[0143] Лиофилизированный LEDGF1-326 тщательно диализировали в течение ночи при 25 мМ трис-HCl, 100 мМ NaCl, рН 7,4 при 4°С. В том же буфере приготовили маточный раствор ZnCl2 (100 мМ). Для приготовления наноансамблей маточный раствор цинка разбавили до конечной концентрации 0,1 мМ, 1 мМ и 10 мМ с помощью 25 мМ трис-HCl, 100 мМ NaCl, рН 7,4 и добавили в него LEDGF1-326 (конечная концентрация 1 мг/мл), после чего инкубировали при 37°С в течение 24 часов. В качестве контрольной группы использовали LEDGF1-326 без цинка при сходных условиях. Перед приготовлением наноансамблей все растворы отфильтровали с помощью фильтра 0,2 мкм. Нано (хх) ансамбль означает наноансамбль LEDGF1-326, приготовленный с хх мМ Zn(II). Динамическое рассеяние света

[0144] Гомогенность наноансамблей и их дистрибуцию по размерам оценили с помощью анализатора размера частиц и дзета-потенциала Nano ZS производства фирмы «Малверн» (Malvern, г. Уэстборо, штат Массачусетс, США) на основе динамического рассеяния света (ДРС). Вкратце, образец поместили в кварцевую кювету объемом 150 мкп и собрали данные под углом обратного рассеяния 173°. График дистрибуции по размерам был построен на основе усредненных значений, полученных в результате одиннадцати сканирований. Изменение показателей наноансамблей в зависимости от времени и их стабильность отслеживали путем оценки распределения частиц по размерам в зависимости от их числа в разные моменты времени. Флуоресценция

[0145] Изменения третичной структуры LEDGF1-326 определяли путем измерения собственной флуоресценции триптофана в состоянии равновесия. Образец поместили в кварцевую кювету объемом 150 мкл и регистрировали спектры испускания в диапазоне от 300 до 400 нм, при длине волны возбуждения 280 нм и с приращением 1 нм, используя кюветно-планшетный мультидетектор Spectramax М5 производства фирмы «Молекьюлар дивайсиз» (Molecular Devices, г. Даунингтаун, штат Пенсильвания, США). Количество сканирований в момент времени равнялось 6. Круговой дихроизм

[0146] Для определения изменений во вторичной структуре LEDGF1-326, регистрировали спектр КД композиций в дальней УФ области. Вкратце, образец поместили в кварцевую кювету с длиной оптического пути 1 мм и регистрировали спектры при скорости сканирования 0.5 сек в момент времени, с шагом 1 нм мканалом регистрации в 4 нм от 200 до 280 нм на КД-спектрометре Chirascan® CD производства компании «Эплайд Фотофизике Лтд.» (Applied Photophysics Ltd, Великобритания). Каждое сканировали выполняли трижды. Из сканограмм изъяли показатели буфера.

Анализ жизнеспособности клеток

[0147] Для определения клеточной выживаемости LEDGF1-326 в условиях агрегационного стресса использовали клетки линии ARPE-19. Вкратце, клетки линии ARPE-19 содержались, как описывалось ранее (Baid et al., PLoS One. 6(9): p.e24616). Для анализа жизнеспособности клеток 10000 клеток поместили на планшет с 96 лунками, содержащий среду DMEM-F12 с добавлением сыворотки. Спустя 24 часа сывороточную среду удалили и промыли клетки 100 мкл среды без добавления сыворотки. После этого клетки обработывали 200 мкл LEDGF1-326 либо LEDGF1-326 +10 мМ цинковых наноансамблей в течение 48 часов. В качестве контрольных наблюдались следующие группы: клетки отсутствуют (только среда), клетки с 25 мМ трис-буфера (в качестве контрольной группы для клеток, обработанных только LEDGF1-326), и клетки с 25 мМ трис+10 мМ цинка (эквивалентна группе с наибольшим содержанием цинка). Затем среду удалили и добавили 200 мкл свежей среды без сыворотки. В каждую лунку добавили 20 мкл МТТ-реагента (3-(4,5-диметилтиазол-2-ил)-2,5-дифенилтетранатрий бромид, 5 мг/мл в ФСБ, рН 7,4), и дальше инкубировали 3 часа при 37°С. Среду с МТТ удалили и растворили образовавшиеся кристаллы формазана в 200 мкл ДМСО. Достигнутую оптическую плотность измерили при 570 нм с помощью мультиредактора Spectramax М5. Процентный показатель жизнеспособности групп вычислили с учетом показателей контрольной группы клеток без липофектамина 2000. Эксперименты в каждой группе повторялись n=4.

Включение вещества клеткой

[0148] Клетки линии ARPE-19 (50000) посеяли на планшет с 24 лунками в среду DMEM-F12 с добавлением сыворотки. Спустя 24 часа среду удалили и промыли клетки 100 мкл среды без добавления сыворотки. После этого клетки обрабатывали 200 мкл LEDGF1-326 или нано(10) ансамбля в течение 1 и 6 часов. В качестве контрольных наблюдались следующие группы: клетки с 25 тМ трис-буфера (в качестве контрольной группы для клеток, обработанных только LEDGF1-326) и клетки с 25 мМ трис+10 мМ цинка (эквивалентна группе с наибольшим содержанием цинка). Спустя 2 или 6 часов клетки дважды промыли 500 мкл холодного раствора ФСБ рН 7.4, после чего дважды промыли в 500 мкл кислотного ФСБ рН 5. После этого клетки лизировали 1% нейтральным детергентом тритон-х в течение 20 мин при комнатной температуре, выбраковали и собрали. Флуоресценцию измерили при длине волны возбуждения 488 нми эмиссии 519 нм. Хелирование

[0149] Чтобы определить, обратимо ли формирование наноансамблей в присутствии хелирующего агента, наноансамблям позволили формироваться в течение 24 часов при 37°С, как описывалось выше. Приготовили маточный раствор ЭДТА 500 мМ с использованием 25 мМ трис-HCl и 100 мМ NaCl, рН 7,4. ЭДТА добавили до конечной концентрации 50 мМ к LEDGF1-326 или наноансамблю. Инкубировали 4 часа при комнатной температуре, затем провели УФ-исследование, флуоресцентное исследование и исследование КД, как описывалось выше.

2. Результаты

LEDGF1-326 претерпевает структурные и конформационные изменения в присутствии ZnCl2

[0150] Формирование наноансамблей в присутствии Zn(II) отслеживали с помощью динамического рассеяния света (ДРС), собственной флуоресценции триптофана, КД в дальней УФ-области и спектров в УФ- и видимой области (рисунок 17). LEDGF1-326 обнаружил гидродинамический диаметр в размере 9±1 нм, который значительно не изменялся в течение 24 часов, как показали результаты ДРС (рисунок 17А). LEDGF1-326, инкубированный с Zn(II) различной концентрации, претерпел изменения размера, что указывало на формирование наноансамблей. При 0,1 мМ ZnCl2 изменений размера не отмечалось вплоть до 24 часов. В присутствии 1 мМ и 10 мМ Zn(II) LEDGF1-326 обнаружил увеличение размера за 30 мин инкубирования при 37°С.При 24-часовом инкубировании LEDGF1-326 обнаружил размеры 7±1, 22±5, 26 ±5 и 28±5 нм для контрольной группы, нано(0,1), нано(1) и нано(Ю) ансамблей, соответственно.

[0151] Для исследования изменений вторичной структуры LEDGF1-326 в присутствии Zn(II) отслеживали спектры КД LEDGF1-326 в дальней УФ-области с 200-260 нм (рисунок 17В). После 24-часового инкубирования при 37°С, LEDGF1-326 обнаружил отрицательную эллиптичность ниже 200 нм и отрицательный провал при 230 нм. Обратная свертка спектров показала, что LEDGF1-326 преимущественно свернута в случайные спирали. В присутствии Zn(II) обнаружили значительные изменения спектра КД. Отрицательный провал при 230 нм сдвинулся влево (к меньшим длинам волн). Эллиптичность LEDGF1-326 указала на повышенный отрицательный сигнал при повышенной концентрации Zn(II). Изменение КД зависело от концентрации Zn(II): в композициях с 0,1 мМ Zn(II) изменения происходили медленно, а в композициях с 10 мМ Zn(II) - быстрее всего (данные не представлены). При 230 нм наблюдался сдвиг отрицательного прогиба/провала в сторону более нижних/низких длин волн в зависимости от концентрации, что указывало на возможное формирование α-спирали. Однако ниже 200 нм отрицательный сигнал также увеличивался в зависимости от концентрации Zn(II). Обратная свертка спектра КД выявила 2%-ное увеличение α-спирали по сравнению с контрольной группой в нано (10) композиции.

[0152] Спектр собственной флуоресценции триптофана в составе LEDGF1-326 (рисунок 17С) обнаружил в присутствии Zn(II), что интенсивность флуоресцентного сигнала снижалась между 200 - 400 нм в присутствии Zn(II). Примечательно, что флуоресцентный сигнал уменьшался сильнее в композиции с 0.1 мМ Zn(II), по сравнению с композицией с 10 мМ Zn(II).

[0153] LEDGF1-326 продемонстрировал Amax при 276 нм в УФ спектрах поглощения (рисунок 17D). В присутствии Ζn(11) наблюдалось уменьшение УФ сигнала в композициях с 0,1 и 1 мМ Ζn(ΙΙ), однако в композиции с 10 мМ цинка изменение отсутствовало. УФ-сигнал при 276 нм (Amax) составлял 0,47; 0,33; 0,32 и 0,46 для контрольного, нано(0,1), нано(1) и нано(10) ансамблей, соответственно.

LEDGF1-326 формирует наноструктуры

[0154] Как показано на рисунке 18, при изучении нано (10) ансамблей LEDGF1-326 (крайний справа снимок) методом просвечивающей электронной микроскопии (ПЭМ) в них обнаружили наличие свободно сформированных наноструктур, какие встречаются при плотном негативном окрашивании. Одни наноансамбли были сцеплены друг с другом, тогда как другие пребывали в виде одиночных частиц. В отсутствие Zn(II), LEDGF1-326 (средний снимок) не обнаруживал подобных структур.

Наноансамбли стабильны при разведении

[0155] Стабильность наноансамблей при разведении изучали с применением ДРС (рисунок 10). Однажды сформировавшись, нано (10) ансамбли не выказывали признаков изменения размеров при разведении их в 2 и 4 раза. Далее эти разведенные/разбавленные нано (10) ансамбли хранили при 4°С 24 часа, после чего измерили размер, однако изменения размера отсутствовали. Формирование наноансамбля обратимо

[0156] Для изучения характера взаимодействия LEDGF1-326 и цинка наблюдали за воздействием ЭДТА на нано (10) (рисунок 19). При добавлении ЭДТА в контрольную группу LEDGF1-326 не было выявлено значительных изменений размера, размер LEDGF1-326 остался равным ~7-8 nm (рисунок 19А). Размер нано (10) ансамбля, составлявший перед добавлением ЭДТА 25±4, снизился до 9±2 сразу после добавления ЭДТА. Спектр флуоресценции наноансамбля, оказавшийся потушенным в результате формирования наноансамбля, восстановился (рисунок 19 В). После добавления ЭДТА контрольный и нано (10) ансамбли обладали схожим спектром флуоресценции. Все изменения вторичной структуры, как видно по спектру КД, также обратились (рисунок 19С). Спектры в УФ- и видимой области также выявили обращение изменений, произошедших из-за формирования наноансамблей (рисунок190).

Стабильность LEDGF1-326 возрастает в наноансамблях

[0157] За стабильностью LEDGF1-326 в наноансамблях при 25°С наблюали в течение 30 дней с применением ДРС, ДСН-ПААГ электрофореза, КДи флуоресценции (рисунок 20). В 3 день размер LEDGF1-326 в контрольной группе уменьшился с 8±1 до 5±1 нм (рисунок 20А). В нано (1) ансамблях величина размера составляла 27± в 0 день и уменьшилась до 4±3 нм в 7 день. С другой стороны, в нано (10) ансамблях не выявили изменений размеров вплоть до 30 дня. В 30 день зафиксировали изменение размера с 27±1 до 8±2 нм в нано (10) ансамблях.

[0158] В 0 день в контрольной группе LEDGF1-326, нано (1) и нано (10) ансамблях с помощью ДСН-ПААГ электрофореза обнаружили полосу в 40 кДа (рисунок 20 В). К 3 дню эта полоса полностью исчезла в контрольной группе LEDGF1-326. Нано (1) ансамбли утратили эту полосу в 7 день, а нано (10) - в 30 день.

[0159] В спектре КД контрольной группы LEDGF1-326 обнаружили продолжительное уменьшение отрицательной эллиптичности начиная с 1 дня и полную потерю сигнала в 30 день (рисунок 20С). В нано (1) ансамблях обнаружили непрерывное ослабление сигнала КД, начиная с 1 дня; однако вплоть до 30 дня сигнал сохранялся. В нано (10) ансамблях значительного ослабления сигнала не отмечалось вплоть до 14 дня, в 30 день сигнал КД снизился, тем не менее, отрицательный сигнал был по-прежнему отчетливо различим.

[0160] В спектре флуоресценции контрольной группы LEDGF1-326 обнаружили значительное снижение интенсивности флуоресценции в 7 день по сравнению с 0 днем, дальнейшее снижение флуоресценции/интенсивности флуоресценции продолжалось вплоть до 30 дня (рисунок 20D). С другой стороны, в нано (1) ансамблях не обнаруживали снижения флуоресцентных сигналов вплоть до 7 дня по сравнению с 0 днем, тем не менее, начиная с 14 дня наблюдалось снижение сигнала. В наиболее устойчивых нано (10) ансамблях потеря интенсивности по сравнению с 0 днем не наблюдалась вплоть до 14 дня. В 30 день снижение интенсивности в этой группе было гораздо менее значительным по сравнению с другими соответствующими группами. Клетки линии ARPE-19 поглощают большее количество наноансамблей

[0161] Клеточное поглощение LEDGF1-326 исследовали в клетках линии ARPE-19 с применением конъюгата Alexa-LEDGF1-326 (рисунок 21). Поглощение клетками ARPE-19 конъюгированных с краской «Alexa» LEDGF1-326 происходило в зависимости от дозировки. Клетки линии ARPE-19 поглотили 0,5±0,1; 1,0±0,3 и 1,4±0,2 мкг Alexa-LEDGF1-326 (контрольная группа) при инкубировании их в течение 2 часов с 2, 10 и 25 мкг/мл Alexa-LEDGF1-326, соответственно. При увеличении времени инкубирования до 6 часов возросло поглощение Alexa- LEDGF1-326. Поглощение LEDGF1-326 увеличилось до 1,2±0,2; 1,2±0,2 и 1,9±0,2 мкг в течение 6 часов при использовании 2, 10 и 25 мкг/мл Alexa-LEDGF1-326, соответственно.

[0162] Для нано (10) ансамблей, содержащих конъюгат Alexa- LEDGF1-326, было выявлено более высокое поглощение в течение 2 и 6 часов по сравнению с соответствующими контрольными группами. При 2 часах размер поглощения составил 0,7±0,08; 1,0±0,2 и 2,2±0,5 мкг для 2, 10 и 25 мкг/мл нано (10) ансамблей, соответственно. Хотя поглощение наноансамблей было выше по сравнению с контрольными группами, значительная разница отсутствовала. При увеличении времени инкубирования с 2 до 6 часов поглощение нано (10) ансамблей значительно возросло. При 6-часовом инкубировании поглощение составило 2,0±0,09; 2,9±0,5 и 2,9±0,2 мкг при для 2, 10, и 25 мкг/мл нано (10) ассамблей, соответственно. Наноансамбли защищают клетки линии ARPE-19 от сывороточного голодания

[0163] Эффективность наноансамблей в плане защиты клеток линии ARPE-19 от сывороточного голодания оценивали с помощью МТТ- анализа (рисунок 22). По сравнению с необработанной группой (100% выживаемость) в группе, обработанной LEDGF1-326, обнаружили повышение выживаемости в зависимости от дозы. Выживаемость клеток линии ARPE-19 возросла до 124±11, 148±12 и 160±44% при обработке 0,01; 0,1 и 1,0 мкг/мл LEDGF1-326, соответственно. В группе, обработанной нано (10) ансамблями, выявили более высокую выживаемость клеток по сравнению с соответствующими контрольными группами, обработанными LEDGF1-326. Выживаемость клеток линии ARPE-19 возросла до 150±3, 180±22 и 200±8% при обработке 0,01; 0,1 и 1,0 мкг/мл LEDGF1-326, соответственно.

Наноансамбли увеличивают эффективность LEDGFum в плане задержки развития дегенеративных изменений сетчатки

[0164] Эффективность наноансамблей в плане профилактики функциональных нарушений сетчатки исследовали на крысах линии RCS с помощью электроретинографии (ЭРГ) (рисунок 23А). В 4 неделю, до введения крысам интравитреальной инъекции, амплитуда b-волны составляла 313±32 мкВ, значительное различие во всех группах отсутствовало. Спустя последующие 10 недель, т.е в 14 неделю, в группе с буфером и группе, обработанной Zn(II), выявили уменьшение амплитуды b-волны с 307±44 до 17±10 и с 302±37 до 11±7 мкВ, соответственно. Обработка LEDGF1-326 (контрольная группа) замедлила уменьшение амплитуды b-волны, и в 14 неделю амплитуда b-волны уменьшилась 337±30 до 42±15 мкВ. Тем не менее, в 14 неделю значительного различия между амплитудой b-волны в группах с буфером, Zn(II) и контрольной группе не наблюдалось. Выяснили, что нано (10) в значительной мере предохраняли от уменьшения амплитуды b-волны вплоть до 14 недели. В 14 неделю амплитуда b-волны уменьшилась с 305±36 до 65±15 мкВ, что указывало на значительно высокую b-волну по сравнению с соответствующими группами с буфером или Zn(II).

[0165] При фотопической ЭРГ в 4 неделю амплитуда b-волны во всех группах составляла 105±23 (рисунок 23В). Также как и при скотопической ЭРГ было заметно уменьшение амплитуды b-волны. В группе с буфером и группе, обработанной Zn(II), обнаружили уменьшение амплитуды b-волны с 94±26 до 12±7 и с 109±23 до 11±7 мкВ, соответственно. В контрольной группе, обработанной LEDGF1-326, и группе, обработанной нано (10) ансамблями, это уменьшение замедлилось, и амплитуда b-волны уменьшилась с 100±28 до 22±5 и с 113±23 до 40±10 мкВ, соответственно. Нано (10) ансамбли обнаружили значительно более высокую b-волну по сравнению с соответствующей группой с буфером, Zn(II) и контрольной группы, обработанной LEDGF1-326.

[0166] Далее, амплитуда осцилляторного потенциала (ОП) во всех группах составляла 91,8±11,5 мкВ в 4 неделю (рисунок 23С). Во всех группах наблюдалось уменьшение амплитуды ОП. К 14 неделе амплитуда ОП составляла 32±5; 33±8; 36±8 и 36±9 мкВ в группе с буфером, Zn(II), контрольной группе, группе с нано (10) ансамблем, соответственно. Значительной разницы между всеми группами не наблюдалось.

[0167] Также измерили амплитуду вспышек при 30 Гц (рисунок 23D). В 4 неделю амплитуда вспышек составляла в среднем 10±2 мкВ для всех групп. Как и при любой другой ЭРГ во всех группах наблюдалось уменьшение амплитуды вспышек во всех группах; однако в 14 неделю амплитуда колебаний в группе с нано (10) ансамблями была значительно выше, чем в группе/ах с буфером и and Zn(II). Значения амплитуды вспышек в 14 неделю составляли 2±0,4; 3,7±0,4; 2,4±0,6; 5,2±2,2 мкВ для буфера, Zn(II), контрольной группы и нано (10) ансамблей, соответственно.

Наноансамбли увеличивают персистентность LEDGF1-326 в тканях глаза до нескольких дней

[0168] Персистентность LEDGF1-326 в тканях нормальных крыс линии SD измерили с помощью флуоресцентного сигнала Alexa-LEDGF1-326 (рисунок 24). На рисунке 24А показано среднее значение холостого сканирования (n=7) до интравитреальной инъекции в глаз крысы вида SD. Холостое сканирование определило аутофлуоресценцию хороида, хрусталика и роговицы autofluorescence на примерно на 24, 50, and 88 информационной точке, соответственно. На основе холостого сканирования различным тканям глаза присвоили те или иные информационные точки. Такими точками были: хороидая-ПЭС- 24, стекловидное тело ~40, хрусталик ~50 водянистая влага ~70 и роговица ~88. На рисунках 24 В и 32С изображена стандартная кривая для контрольной группы и нано (10) ансамбля. Она использовалась для установления фактической концентрации Alexa-LEDGF1-326 (мкг/мл) на основе флуоресцентного сигнала, полученного через концентрацию (нг/мл) натрия флуоресцеина (NaF) на снимках, сделанных сканером Flurotron, На рисунках 24D и 24Е представлены сканограммы, сделанные с помощью Flurotron (N=4) для контрольной группы и группы нано (10) ансамбля начиная с 2 мин до 14 дней после интравитреальной инъекции. Флуоресцентный сигнал в стекловидном теле, хороиде-ПЭС и водянистой влаге получили на основе сканограммы (данные исследования на сканере) Flurotron (рисунок 24D и 24Е) и использовали для установления фактической концентрации Alexa-LEDGF1-326 (рисунок 24F, 24G и 24Н, соответственно). Высокий пик в стекловидном теле на второй минуте после инъекции (рисунок 24С и 24D свидетельствовал о том, что интравитреальную инъекцию выполнили соответствующим образом.

[0169] В стекловидном теле в соответствии с данными, полученными при холостом исследовании, наблюдался флуоресцентный сигнал, равный 3±0,5 нг/мл NaF (рисунок 24А), что равнялось 0 мкг/мл Alexa-LEDGF1-326 и соответствовало базовой линии. Через 2 мин после интравитреальной инъекции в стекловидном теле контрольной группы зафиксировали пиковое значение Alexa-LEDGF1-326 в размере 292±106 мкг/мл, которое резко упало до 127±74 мкг/мл через 30 мин (рисунок 24F). К 3 дню показатель Alexa-LEDGF1-326 в контрольной группе находился ниже нулевой линии. С другой стороны, в группах нано (10) ансамбля наблюдалась персистентность в течение нескольких дней. Пиковая концентрация Alexa-LEDGF1-326 через 2 мин после инъекции составляла 321±54 мкг/мл, вначале наблюдалось резкое снижение до 100±45 мкг/мл через 30 мин; после этого снижение замедлилось по сравнению с контрольной группой. Персистентность наноансамбля в стекловидном теле наблюдали вплоть до 14 дня. В 14 день концентрация Alexa-LEDGF 1-326 в группе нано (10) ансамбля составляла 0,7±0,1 мкг/мл, что значительно превышало показатель контрольной группы и нулевую линию.

[0170] Также для группы нано (10) ансамбля определяли персистентность Alexa-LEDGF1-326 в хороиде-ПЭС и водянистой влаге. Аутофлуоресценцию хороидеи-ПЭС определили на уровне 10±4 нг/мл NaF, на основе этих данных определили концентрацию Alexa-LEDGF1-326 в размере 0,1 μg/ml. Таким образом, 0,1 мкг/мл Alexa-LEDGF1-326 считали нулевой линией для хороида-ПЭС (рисунок 24G). Вскоре после интравитреальной инъекции в хороида-ПЭС зарегистрировали концентрацию ALexa-LEDGF1-326 в размере 13.2±10.8 мкг/мл, которая увеличилась до 30,0±22,6 мкг/мл через 30 мин в контрольной группе. После этого наблюдалось снижение уровня Alexa-LEDGF1-326, и уже к 1 дню концентрацию Alexa-LEDGF1-326 невозможно было определить. С другой стороны, в группе нано (10) ансамбля наблюдалась концентрация Alexa-LEDGF1-326 в размере 14,3±9,8 мкг/мл через 2 мин. Концентрация увеличилась до 21,5±12,8 мкг/мл через 30 мин. К 1 дню уровень Alexa-LEDGF1-326 упал до 2,0±1,1 мкг/мл, тем не менее, он находился значительно выше базовой линии, по сравнению с контрольной группой. Уровень Alexa-LEDGF1-326 оставался значительно высоким вплоть до 14 дня и составил 0,6±0,2 мкг/мл в 14 день.

[0171] В водянистой влаге нулевая линия, определенная холостым сканированием, соответствовала 0 мкг/мл Alexa-LEDGF1-326 (рисунок 24А). Спустя 2 мин после интравитреальной инъекции, концентрация Alexa-LEDGF 1-326 составляла 3,4±3 и 4,9±2,4 мкг/мл для контрольной группы и группы нано (10) ансамбля (рисунок 24Н). В контрольной группе уровень Alexa-LEDGF 1-326 упал ниже нулевой линии за 6 часов, в то время как в группе нано (10) ансамбля отмечали присутствие Alexa-LEDGF1-326 вплоть до 14, в этот момент времени концентрация Alexa-LEDGF1-326 составляла 0,6±0,1 мкг/мл.

В наноансамбле LEDGF 1-326 дольше сохраняет иммунореактивность in vivo

[0172] Иммунореактивность комплекса Alexa-LEDGF 1-326 исследовали в различных тканях глаза и в крови через 14 дней после однократной интравитреальной инъекции с помощью метода непрямого ИФА (рисунок 25). При изучении тканей глаза холостой группы, в который не производилась инъекция, в роговице, водянистой жидкости, хрусталике, стекловидном теле, сетчатке, хороиде-ПЭС, склере и крови отсутствовал комплекс Alexa-LEDGF1-326 в количествах, поддающихся обнаружению. Этот факт указывал на отсутствие какого-либо определяемого количества эндогенного LEDGF1-326. Примечательно, что конъюгат Alexa-LEDGF1-326 обнаружили в сетчатке как контрольной группы, так и группы с нано (10) ансамблем в размере 0,2±0,2 и 1,3±0,4 мкг/г от массы ткани, соответственно. Между контрольной и холостой группами не было значительного различия, в то время как в группе с нано (10) ансамблями зафиксировали гораздо более высокое количество соединения Alexa-LEDGF1-326 по сравнению с контрольной и холостой группами.

Образец 4

[0173] Количественное определение живых/мертвых клеток- Для количественного определения клеток, 10000 клеток линии ARPE-19 cells поместили на планшет с 96 лунками и инкубировали 24 часа (рисунок 26). Спустя 24 часа сывороточную среду удалили. В тестируемые группы (pP23H-Rho+ LEDGF1-326) временно трансфицировали плазмиду pP23H-Rho (1 мкг/мл), с применением липофектамина 2000, находящегося в отношении 1:3 к среде без сыворотки, в соответствии с инструкцией производителя. Спустя шесть часов трансфекции среду удалили и обработали клетки увеличивающимся количеством LEDGF1-326. Также в качестве контрольных наблюдались следующие группы: клетки отсутствуют (только среда), клетки без липофектамина 2000 и клетки с липофектамином 2000. После того, как закончилась обработка. LEDGF1-326, клетки промыли раствором ФСБ. Клетки пометили комбинацией следующих веществ: проникающего через плазматическую мембрану (Hoechst 33342); не способного проникнуть сквозь клеточную мембрану (BOBO™ 3) и красителя клеточного ядра (4ʹ,6-диамидин-2-фенилиндол, дигидрохлорид; DAPI). Краситель Hoechst 33342 пометил клеточные ядра, a BOBO™ 3 - мертвые или умирающие клетки. Клетки визуализировали с помощью системы одновременного многопараметрического скрининга Operetta®. Количество клеток определили с помощью автоматической программы, входящей в составе ПО системы Operetta®. Число и процентную долю живых клеток вычислили путем вычитания числа мертвых клеток из числа «всех клеток». Как показано на рисунке 26, LEDGF1-326 повышает жизнеспособность клеток линии ARPE-19.

[0174] Иммуноблоттинг: Во время иммуноблоттинга для трансфекции вместо P23H-Rho использовали P23H-Rho, помеченный голубым флуоресцентным белком CFP (pP23H-CFP-Rho). Клетки линии ARPE-19 cells поместили на планшеты 60 мм; трансфекцию и обработку лекарственным препаратом пропорционально увеличили относительно исследования на планшетах с 96 лунками. После обработки LEDGF1-326, клетки промыли один раз в холодном ФСБ и лизировали ультрозвуком в РИПА-буфере, содержащем ингибитор протеазы. Равные количества супернатанта поместили на ДСН-ПААГ гель и подвергли иммуноблоттингу на предмет белков теплового шока Hsp70, Hsp40, Hsp27, флуоресцентного белка CFP (для P23H-CFP-Rho), LEDGF1-326, и β-актина. Полосы белка визуализировали с помощью хемилюминесцентного набора ECL™ detection kit (GE Healthcare, г.Пискатавэй, штат Нью-Джерси, США). Полученные данные свидетельствовали об усвоении LEDGF1-326 клетками.

[0175] Фагоцитарный анализ: Клетки линии ARPE-19 посеяли на планшет с 24 лунками и трансфицировали 20 пМ/мл малой интерферирующей РНК MERTK siRNA производства компании «Санта-Круз биотекнолоджи Инк» (Santa Cruz Biotechnology Inc., г.Даллас, штат Техас, США) с помощью трансфицирующего агента малой интерферирующей РНК («Санта Круз биотекнолоджи Инк. - Santa Cruz Biotechnology Inc., Даллас, штат Техас) в течение 6 часов. Трансфицирующую среду удалили и инкубировали клетки дальше в бессывороточной среде 24 часа. В качестве контрольной группы использовались клетки, трансфицированные лишь средой без применения малой интерферирующей РНК MERTK siRNA. Клетки промыли один раз и обрабатывали 0,05; 0,5 или 5 мкг/мл LEDGF1-326 в течение 24 часов, а затем наблюдали фагоцитоз частиц размером 2 мкм. Вкратце, 100 мкг/мл синих флуоресцирующих микросфер «FluoSpheres» диаметром 2 мкм производства компании «Лайф текнолоджиз»» (Life Technologies, г.Гранд-Айленд, штат Нью-Йорк, США) инкубировали с клетками 3 часа. После этого клетки дважды промыли холодным ФСБ-раствором рН 7,4, а затем - 2 раза холодным ФСБ-раствором рН 5,0, чтобы удалить прилипшие микросферы FluoSpheres. Клетки лизировали с использованием 1% детергента тритон-х и измерили флуоресценцию частиц в клеточном лизате при длине волны возбуждения 350 нм и эмиссии 430 нм. При анализе поглощения частиц в качестве контрольной группы использовались клетки, трансфицированные только трансфицирующим агентом без малой интерферирующей РНК. Клетки, не обработанные частицами, использовались для измерения фоновой флуоресценции. Как показано на рисунке 27, LEDGF1-326 повышает фагоцитарную активность. Снижение фагоцитоза клеток пигментного эпителия сетчатки является характерной чертой нескольких заболеваний сетчатки, в том числе и дегенеративных заболеваний. LEDGF1-326 окажется полезным при лечении заболеваний, сопровождающихся нарушением фагоцитоза.

[0176] Результаты гистологического исследования: в конце исследования, т.е. в 12 неделю, после измерения ЭРГ глаза энуклеировали и фиксировали в фиксаторе Дэвидсона (37-40%-ный формальдегид (2%), этиловый спирт (35%), безводная уксусная кислота (10%) и дистиллированная вода (53%)) в течение 24 часов при комнатной температуре. Затем глаза поместили в этиловый спирт с концентрацией 70% для последующей серии дегидратаций и инфильтраций парафином. Было получено три вертикальных среза толщиной 6 мкм, срезанных начиная с назальной и до височной стороны зрительного нерва (на расстоянии 500 мкм) на стандартном микротоме. Тканевые срезы окрасили гематоксилином-эозином, после чего провели общее исследование морфологии сетчатки с помощью светового микроскопа. Толщину наружного ядерного слоя (НЯС) и внутреннего ядерного слоя (ВЯС) методически измерили с помощью ПО для предоставления изображений Aperio ImageScope вер. 11.1.2.760. Поскольку защита фоторецепторных клеток в сетчатке может осуществляться неравномерно, в каждом образце исследовали каждые 500 мкм начиная с главного края и по направлению к второстепенному. Для каждой точки получили среднюю величину на основании измерений трех срезов. Представленные данные являются усредненными значениями, полученными на основе исследования трех глаз. Как показано на рисунке 28, LEDGF1-326 замедляет утрату фотороцепторов в сетчатке и ядре.

[0177] Иммунофлуоресценция: Для проведения иммунофлуоресценции после удаления парафина срезы глазной ткани претерпели следующие этапы обработки при комнатной температуре, если не указано иное. Антиген удалили путем кипячения срезов при 80°С в течение 15 мин. После предотвращения неспецифического связывания срезы инкубировали с первичным антителом мыши против родопсина (lD4) при 4°С в течение ночи, а затем 30 мин инкубировали с ДАГГИ и антителами осла против IgG мыши, конъюгированными с Alexa Fluor® 594. В заключении, срезы глазной ткани промыли и приготовили для исследования с помощью заливочной среды Supermount H производства компании «Биоджиникс» (Biogenex, г. Сан-Рамон, штат Калифорния, CULASan Ramon, СА) во избежание быстрого уменьшения флуоресценции. Флуоресценцию наблюдали с помощью конфокального микроскопа (Nikon Eclipse Cl) при 20Х увеличении. Длины волн возбуждения-излучения, используемые для ДАЛИ и Alexa Fluor, составляли 408-450/35 и 637-605/75 нм, соответственно. Изображения были получены с помощью ПО Nikon EZ-C1 вер. 3.40. Как показано на рисунке 29, LEDGF1-326 замедляет сокращение палочек во внешнем сегменте сетчатки.

Образец 5

Кумулятивное высвобождение His-LEDGF1-326 in vitro

[0178] Структуры типа «NPinPMP» с инкапсулированным гастидин-LEDGF1-326 оценили на предмет высвобождения in vitro в растворе ФСБ рН 7,4. Частицы (2-3 мг) взвесили и диспергировали в 1 мл раствора рН 7,4, после чего инкубировали при 37°С и перемешивании при 200 об/мин (шейкер-инкубатор (Max Q shaker incubator). В заранее определенные моменты времени взвешенные/суспендированные частицы подвергали центрифугированию при 13000 g в течение 15 мин и собирали супернатант.Частицы, содержащие пеллеты, повторно суспендировали в 1 мл свежего раствора ФСБ рН 7,4 и инкубировали. Содержание гистидин-LED1-326 в образцах определяли с помощью набора micro ВСА assay в соответствии с инструкцией производителя (Pierce Biotechnology, штат Иллинойс, США). Данные, поученные в условиях in vitro, выявили пролонгированное высвобождение гастидин-LEDGF1-326 из структур типа «NPinPMP». Как показано на рисунке 30, к концу 3 месяца наблюдалось 60% кумулятивное высвобождение гистид ин-LEDGF1-326.

Доставка гистидин- LEDGF1-326 in vivo у крыс

[0179] Доставку гистидин-LEDGF1-326 in vivo исследовали после интравитреального введения крысам конъюгата Alexa Fluor 488 и гистидин-LEDGF1-326, инкапсулированного в структуру типа «NPinPMP». В структурах типа « NPinPMP » использовали только меченые LEDGF1-326. В глаза крысы ввели структуру типа «NPinPMP» с инкапсулированным конъюгатом Alexa-гистидин-LEDGF1-326 (6,0 мкг гистидин-LEDGF1-326 /5 мкл), а контрольной группе - конъюгат Alexa-гистидин-LEDGF1-326=эквивалентной концентрации (1,5 мкг меченого белка и 4,5 мкг немеченого белка/5 мкл). Такое соотношение позволило начать исследование с одинаковой интенсивности флуоресценции в обеих группах. Флуоресценцию глаза в результате высвобождения конъюгата Alexa-гистидин-LEDGF1-326 периодически отслеживали с помощью компьютеризированной системы Fluorotron Master™ производства компании «Окуметрикс» (Ocumetrics, Калифорния, США) до тех пор, пока флуоресценция не достигла нижнего предела/порога чувствительности, или базовой линии. Значения флуоресценции глаз на базовой линии отследили до введения композиций. В каждый момент времени проводили три флуориметрических сканирования, использовали их среднее значение. Стандартную кривую для конъюгата Alexa-гистидин- гистидин-LEDGF1-326 при различных концентрациях получили с применением кюветы и глазного флуорофотометра, оснащенного адаптером использованиях на крысах. С помощью стандартной кривой эквивалентные концентрации флуоресцеина, полученные благодаря флуорофотометру, перевели в фактическую концентрацию Alexa-гистидин-LEDGF1-326.

[0180] Выполнили интравитреальные инъекци Alexa-гистидин-LEDGF1-326, инкапсулированного в структуру типа «NPinPMP», и растворимого конъюгата Alexa-гистидин-LEDGF1-326 в виде раствора. После этого косвенно определили распределение концентраций гистидин-LEDGF1-326 вдоль оптической оси глаза путем измерения кривой распределения интенсивности флуоресценции alexa (эквивалент концентрации флуоресцеина натрия) вдоль осевых плоскостей, определенных как экспериментальные точки при направлении от начала к концу. При флуоресцентном сканировании выявили пролонгированную доставку конъюгата Alexa-His-LEDGF1-326 из структур типа «NPinPMP» по сравнению с раствором. Эквивалентные концентрации флуоресцеина, зафиксированные с помощью системы Fluorotron Master, преобразовали в концентрации Alexa- гистидин-LEDGF1-326. Был построен график концентрации конъюгатов Alexa- гистидин-LEDGF1-326 из раствора и из структуры типа «NPinPMP» в витреальной области в различные моменты времени. Приводятся данные только по концентрациям меченого бевацизумаба. Перед интравитреальной инъекцией зафиксировали данные о флуоресценции на базовой линии в здоровых глазах и вычислили, что концентрация, при которой происходит флуоресценция на базовой линии, должна составлять 2,03 мкг/мл. Как показано на рисунке 31, в группе, которой вводили конъюгат Alexa-rac-LEDGF1-326 в виде раствора, концентрация Alexa-гистидин-LEDGF1-326 составила 2,02 мкг/мл в 1 день, что указывает на его быстрое выведение из витреальной области. В группе, которой вводили структуры типа «NPinPMP», начальная концентрация конъюгата Alexa-гистидин-LEDGF1-326 в стекловидном теле составляла 18,23 мкг/мл, кроме того, концентрация Alexa-гистидин-LEDGF1-326 выше базовой линии сохранялась вплоть до 35 дня и достигла уровня базовой линии по прошествии 50 дней. Данные наблюдений показывают, что можно добиться пролонгированного in vivo высвобождения конъюгата Alexa-гистидин-LEDGF1-326 из иллюстративной структуры типа «частица в частице».

1. Пептид, являющийся фрагментом полноразмерного фактора роста эпителия хрусталика глаза (LEDGF) для лечения глазных заболеваний, обусловленных агрегацией белка, характеризующийся тем, что он имеет аминокислотную последовательность SEQ ID NO: 2 или аминокислотную последовательность SEQ ID NO: 2 с дополнительными аминокислотами на концах, такую, что упомянутые дополнительные аминокислоты не уменьшают биологическую активность или стабильность при биосинтезе или при производстве и очистке, по сравнению с полноразмерным LEDGF.

2. Пептид по п. 1, характеризующийся тем, что он представляет собой пептид, имеющий аминокислотную последовательность SEQ ID NO: 2.

3. Пептид по п. 1, характеризующийся тем, что он имеет аминокислотную последовательность SEQ ID NO: 1.

4. Фармацевтическая композиция для лечения глазных заболеваний, связанных с агрегацией белка, характеризующаяся тем, что она содержит в себе эффективное количество пептида по любому из пп. 1-3 и фармацевтически приемлемый носитель, разбавитель, вспомогательное вещество или их комбинацию.

5. Композиция по п. 4, в которой пептид связан с или включен в коллоидную цинковую металлическую наночастицу.

6. Композиция по п. 5, в которой пептид связан с или инкапсулирован во внутреннюю частицу, в которой упомянутая внутренняя частица погружена в пористую внешнюю частицу.

7. Композиция по п. 6, в которой упомянутая внутренняя частица выполнена из не расширяющегося в сверхкритическом диоксиде углерода материала, в частности из материала, выбранного из группы, включающей полимолочную кислоту (PLA), поли(гликолевую кислоту) (PGA), сополимер молочной и гликолевой кислоты (PLGA), производные целлюлозы и хитозан.

8. Способ лечения глазного заболевания, обусловленного агрегацией белка, характеризующийся тем, что в нем нуждающемуся в этом пациенту вводят фармацевтическую композицию по любому из пп. 5-7.

9. Способ по п. 8, характеризующийся тем, что вышеупомянутое заболевание выбрано из группы, включающей дистрофию желтого пятна, обусловленную возрастными изменениями, пигментный ретинит и пигментную дистрофию сетчатки.

10. Способ лечения заболевания, обусловленного агрегацией белка, характеризующийся тем, что в нем нуждающемуся в этом пациенту вводят композицию, содержащую эффективное количество пептида, имеющего аминокислотную последовательность SEQ ID NO: 2.

11. Способ по п. 10, характеризующийся тем, что в нем упомянутое заболевание представляет собой глазное заболевание.

12. Способ по п. 11, характеризующийся тем, что в нем упомянутое глазное заболевание представляет собой дегенерацию сетчатки.

13. Способ по п. 12, характеризующийся тем, что в нем упомянутая дегенерация сетчатки обусловлена возрастной макулярной дегенерацией или пигментным ретинитом.

14. Способ по п. 10, характеризующийся тем, что в нем упомянутое заболевание, обусловленное агрегацией, представляет собой нейродегенеративное заболевание.

15. Способ по п. 14, характеризующийся тем, что в нем упомянутое нейродегенеративное заболевание выбрано из группы, включающей болезнь Альцгеймера, болезнь Паркинсона, болезнь Гентингтона, боковой амиотрофический склероз и прионное заболевание.



 

Похожие патенты:

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к способу получения рекомбинантной фосфатазы бактериальных липополисахаридов.

Настоящее изобретение относится к биотехнологии. Предложен иммуностимулирующий неметилированный CpG-олигодезоксинуклеотид, вектор экспрессии, его содержащий, вакцина для предотвращения или борьбы с инфекционным заболеванием у птиц, содержащая указанные олигодезоксинуклеотид и/или вектор экспрессии и иммунологическое количество антигенного компонента, выделенного из патогенного для птичьих вируса или микроорганизма, а также применение олигодезоксинуклеотида в качестве лекарственного средства и для предотвращения инфекции у птичьих.

Изобретение относится к области биологии, в частности молекулярной биологии и генетической инженерии. В качестве настоящего изобретения предложен фрагмент ДНК, обеспечивающий высокий уровень экспрессии генов в растениях и представляющий собой промотор гена pro-SmAMP2, соединенный с его 5'-нетранслируемой областью, где указанный фрагмент ДНК имеет нуклеотидную последовательность SEC ID NO 5.

Изобретение относится к области биохимии, биотехнологии и генетической инженерии, в частности к лекарственному средству для лечения фиброза печени на основе смеси двух невирусных плазмидных конструкций.

Настоящая группа объектов изобретения относится к области биотехнологии и иммунологии. Предложен биспецифический связывающий белок, который содержит первую полипептидную цепь, включающую два вариабельных домена тяжелой цепи антитела, и вторую полипептидную цепь, включающую два вариабельных домена легкой цепи антитела, (DVD-Ig).

Изобретения относятся к области биотехнологии и касаются способа снижения продукции лактата в клетках млекопитающего, способа сайлесинга или снижения в клетке млекопитающего транскрипции лактатдегидрогеназы (LDH) и киназы пируватдегидрогеназы (PDHK), способа получения клетки млекопитающего, которая проявляет пониженное продуцирование лактата в культуре, вектора, содержащего первую гетерологичную нуклеотидную последовательность, кодирующую малую интерферирующую РНК (миРНК), специфичную для лактатдегидрогеназы, и вторую гетерологичную нуклеотидную последовательность, кодирующую миРНК, специфичную для киназы пируватдегидрогеназы, каждая из которых связана со своим промотором.

Изобретение относится к области биохимии. Заявлено антитело к BLyS.

Изобретение относится к биохимии. Описан способ получения антитела, включающий выделение антитела из среды культивирования эукариотической клетки, содержащей нуклеиновую кислоту, кодирующую антитело, причем нуклеиновую кислоту, кодирующую антитело, получают путем амплификации нуклеиновых кислот, кодирующих родственный вариабельный домен, используя в качестве матрицы в полимеразной цепной реакции (ПЦР) одноцепочечные кДНК, полученные из РНК антитело-секретирующей В-клетки, и вставки нуклеиновых кислот, кодирующих вариабельный домен, в эукариотическую экспрессионную плазмиду путем безлигазного клонирования, в котором для вставки используют пул нуклеиновых кислот, кодирующих вариабельный домен соответственно легкой и тяжелой цепей антитела, где В-клетка является отдельной единичной В-клеткой, и где В-клетка и ее потомство за 7 дней их совместного культивирования с питающими клетками, начиная с одной клетки, производят более 20 нг/мл антител выделения сегментов нуклеиновых кислот, кодирующих вариабельные домены антител, и введение выделенных сегментов нуклеиновых кислот в эукариотические экспрессионные плазмиды осуществляется без промежуточного выделения и анализа клональных промежуточных плазмид.

Изобретение относится к области биотехнологии, конкретно к противоопухолевым вакцинам на основе эпитопных пептидов MPHOSPH1, и может быть использовано в медицине. Получают пептид состоящий из аминокислотной последовательности SEQ ID NO: 120.

Изобретение относится к области биотехнологии и вирусологии. Описано получение оптимизированных полипептидов HA вируса гриппа H1N1, вызывающих иммунный ответ с широким спектром активности в отношении изолятов вируса гриппа H1N1.

Настоящее изобретение относится к области биотехнологии и может быть использовано для повышения мышечной массы сельскохозяйственных животных, птицы и животных семейства псовых.

Изобретение относится к области биохимии. Заявлена кДНК природного гена GDNF, искусственно модифицированная удалением pro-области, которая при попадании в клетки или ткани млекопитающих в составе стандартных векторов продуцирует активный специфический GDNF.

Изобретение относится к области биотехнологии, конкретно к способу увеличения периода времени до рецидива опухоли, и может быть использовано в медицине. Получают антагонисты неурегулина, представляющие собой анти-NRG1 антитело, siPHK или shPHK, нацеленные на NRG1, или иммуноадгезин к NRG1 для введения пациенту, ранее получавшему противораковую терапию, в комбинации с терапевтическим средством, выбранным из паклитаксела, цисплатина или их комбинации для отсрочки времени до рецидива опухоли или предотвращения развития резистентности раковых клеток к лечению терапевтическим агентом.

Изобретение относится к биотехнологии, а именно к способу очистки G-CSF (гранулоцитарный колониестимулирующий фактор) в последовательности очистки, применяющей хроматографию.

Настоящее изобретение относится к области биотехнологии. Предложено терапевтическое антитело и терапевтический фрагмент антитела для повышения продукции тромбоцитов, включающие пептид-миметик тромбопоэтина (ТРО), содержащий последовательность IEGPTLRQWLAARA и встроенный как дополнение к С-концу константной области легкой цепи и/или в положении менее 20 аминокислот ниже С-конца шарнирной области тяжелой цепи.

Настоящее изобретение относится к области биотехнологии, конкретно к созданию лекарственных препаратов с замедленным высвобождением белковых или пептидных лекарственных средств, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, а именно к способу получения очищенного рекомбинантного GDF-5-подобного белка. .

Изобретение относится к области молекулярной биологии, конкретно, к белкам, регулирующим клеточную дифференцировку путем ингибирования белка семейства Wnt, и может быть использовано в медицине для профилактики и лечения связанных с нарушениями активности Wnt сигнального пути заболеваний, например рака толстой кишки, меланомы, карциномы.

Изобретение относится к области биохимии. .

Изобретение относится к области биотехнологии, конкретно к пептиду, который обладает ростостимулирующей активностью фактора роста гепатоцитов HGF. .

Группа изобретений относится к медицине, а именно к офтальмологии, пластической хирургии и косметологии, и может быть использована для устранения ретракции верхнего и нижнего века при эндокринной офтальмомиопатии, развившейся при тиреотоксикозе или болезни Грейвса.

Изобретение относится к области биотехнологии, конкретно к получению фрагментов полноразмерного фактора роста эпителия хрусталика глаза, и может быть использовано в медицине. Получают фрагмент LEDGF с SEQ ID NO: 2, который используют в фармацевтических композициях для лечения заболеваний, связанных с агрегацией белка. Изобретение позволяет эффективно лечить заболевания, связанные с агрегацией белка, в частности глазные заболевания. 4 н. и 11 з.п. ф-лы, 31 ил.

Наверх