Аналоги сплицеостатина

Изобретение относится к новым цитотоксическим соединениям формулы (I), где пунктирная линия означает возможную связь; каждый X1 представляет собой -О-; каждый X2 представляет собой -NR-; R1 выбран из группы, состоящей из -R, -OR, -OCOR13, -OCONR14R15, -OCON(R14)NR(R15), =O (двойная связь с кислородом) и -NR14R15; R2 и R3 независимо представляют собой С1-6алкил; R4 и R5 независимо выбраны из группы, состоящей из водорода и -OR; R6 и R7 независимо выбраны из группы, состоящей из галогена, гидроксила и С1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена, R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 гетероатом кислорода; R8 представляет собой водород, С1-6алкил или -OR; R9 независимо выбран из -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -(C(R)2)m-C(O)-SR и -(C(R)2)m-C(O)NR14N(R)R15; R13 выбран из группы, состоящей из водорода, С1-6алкила, С3-8карбоциклила, С3-8гетероциклила, С1-6алкил-С6-14арила, С1-6алкил-С5-14гетероарила, где R13 возможно замещен группой -NRR или -SO2NRR; каждый R14 и R15 независимо выбран из группы, состоящей из водорода, гидроксила, -NRR, -NRNR2, групп -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -С1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6CH2CH2C(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -С1-6алкил, С6-14арил, -С1-6алкилен-С6-14арил и -С5-14гетероарил; или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10 гетероциклильное кольцо, где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-C1-6алкил-C(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-C1-6алкил-NRR; каждый R независимо выбран из группы, состоящей из водорода и группы -C1-6алкил; и каждый m независимо равен 0, 1, 2 или 3; или их фармацевтически приемлемым солям, изобретение также относится к фармацевтической композиции на основе этих соединений для лечения болезненных состояний, включая рак. 6 н. и 34 з.п. ф-лы, 4 ил., 10 табл., 100 пр.

 

Перекрестная ссылка на родственные заявки

В данной заявке испрашивается приоритет предварительной заявки на патент США No. 61/722769, поданной 5 ноября 2012 года, предварительной заявки на патент США No. 61/723645, поданной 7 ноября 2012 года, и предварительной заявки на патент США No. 61/829409, поданной 31 мая 2013 года, все из которых включены в данное описание посредством ссылки во всей их полноте.

Область изобретения

Настоящее изобретение относится к новым производным природного продукта и/или соединениям на основе сплицеостина, применимых в качестве полезных нагрузок в конъюгатах антитело-лекарственное средство (ADC), и соединениям-конструкциям полезная нагрузка-линкер, применимых в связывании с ADC. Настоящее изобретение дополнительно относится к композициям, включающим вышеупомянутые полезные нагрузки, конструкции полезная нагрузка-линкер и ADC, и способам использования этих полезных нагрузок, конструкций полезная нагрузка-линкер и ADC для лечения патологических состояний, включая рак.

Предшествующий уровень техники

Конъюгирование лекарственных средств с антителами, непосредственно или через линкеры, включает рассмотрение ряда факторов, в том числе идентичность и расположение химической группы для конъюгирования лекарственного средства, механизм высвобождения лекарственного средства, структурные элементы, обеспечивающие высвобождение лекарственного средства, и структурную модификацию для высвобождения свободного лекарственного средства. Кроме того, если лекарственное средство должно высвобождаться после интернализации антитела, механизм высвобождения лекарственного средства должен быть согласованным с внутриклеточным транспортом конъюгата.

Хотя множество различных классов лекарственных средств было исследовано в отношении доставки через антитела, всего лишь несколько классов лекарственных средств проявили эффективность в качестве конъюгатов антитело-лекарственное средство, в то же время проявляя приемлемый профиль токсичности.

Сообщалось, что природные продукты FR 901463, FR 901464 и FR 901465 проявляют ингибирующую активность против клеточных линий рака человека и эффективность в некоторых ксенотрансплантатных опухолевых моделях (Journal of Antibiotics (1996), 49(12), 1204-1211). В последнее время сообщалось, что природный продукт FR 901464 и его метилкеталь, обозначенный как сплицеостатин А, ингибирует сплайсингосому путем взаимодействия с SF3b, который является компонентом эссенциального субкомплекса U2 малой ядерной РНК (snRNA) (Nature Chemical Biology (2007), 3(9), 576-583.; Nature (London, United Kingdom) (2010), 468(7324), 664-668).

Краткое изложение сущности изобретения

Настоящее изобретение относится к соединениям и содержащим их фармацевтическим композициям, к их получению и к применениям для соединений, главным образом, но не исключительно, противораковых агентов.

Согласно одному аспекту, настоящее изобретение относится к соединению или соединениям формулы (I):

где:

пунктирная линия означает возможную связь;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

R1 выбран из группы, состоящей из: -R, -OR, -OCOR13, -OCONR14R15, -OCON(R14)NR(R15), =O (двойная связь с кислородом) и -NR14R15;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют С2-6алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 независимо выбран из водорода, групп -C1-6алкил, -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -(C(R)2)m-NR14R15, -(C(R)2)m-C(O)-SR, -(С(R)2)m-C(O)NR14N(R)R15, -C(R)2)m-NR-C(O)-NR14R15, -(C(R)2)m-N(R)COR13 и -(C(R)2)m-NR14N(R)R15;

R13 выбран из группы, состоящей из водорода, С1-6алкила, С3-8карбоциклила, С3-8гетероциклила, С1-6алкил-С6-14арила, С1-6алкил-С5-14гетероарила, где R13 возможно замещен группой -NRR или -SO2NRR;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, -NRR, -NRNR2, групп -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -С1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6CH2CH2C(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1)-NRR, (2)-C(NRR)(C(O)OR), (3)-S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11)-R, (12)-OR, (13)-N(R)NRR, (14)-C(O)N(R)NRR, -(C(R)2)m-O-NRR и -S-S-C1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -C1-6алкил; и

каждый m независимо равен 0, 1, 2 или 3;

или его фармацевтически приемлемой соли.

Согласно другому аспекту, настоящее изобретение относится к соединению или соединениям формулы (II):

или его фармацевтически приемлемой соли, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р;

Р представляет собой радикал формулы (I):

где:

пунктирная линия означает возможную связь;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если Х" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -R, -OR, -OCOR13, -OCONR14R15, -OCON(R14)NR(R15), =O (двойная связь с кислородом) и -NR14R15;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют C2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 представляет собой -(C(R)2)m-C(O)- или -(C(R)2)m-;

L1 выбран из групп: -галоген, NR2,

;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A, где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -С(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -С1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-С1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(ОСН2СН2)1-6-NRC(O)С1-6алкил-, -C1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-C1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6-алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(O)-,

,

или L3 отсутствует;

R13 выбран из группы, состоящей из водорода, С1-6алкила, С3-8карбоциклила, С3-8гетероциклила, С1-6алкил-С6-14арила, C1-6алкил-C5-14гетероарила, где R13 возможно замещен группой -NRR или -SO2NRR;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -С1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6СН2СН2С(O)ОR -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-C1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -С1-6вал кил; и

каждый m независимо равен 0, 1, 2 или 3.

Согласно еще одному аспекту, настоящее изобретение относится к соединению или соединениям формулы (II'):

или его фармацевтически приемлемой соли, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р';

Р' представляет собой радикал формулы (I'):

где:

пунктирная линия означает возможную связь;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если Х" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -(C(R)2)m-, -OR", -OCOR13', -OC(O)NRR14', -OCON(R)N(R)- и -NR-;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют C2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 независимо выбран из водорода, групп -С1-6алкил, -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -(C(R)2)m-NR14R15, -(C(R)2)m-C(O)-SR, -(C(R)2)m-C(O)NR14N(R)R15, -(C(R)2)m-NR-C(O)-NR14R15, -(C(R)2)m-N(R)COR13 и -(C(R)2)m-NR14N(R)R15;

L1 выбран из групп: -галоген, -NR2

;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A, где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -С(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -C1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-C1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(ОСН2СН2)1-6-NRC(O)С1-6алкил-, -С1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-С1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(O)-,

,

или L3 отсутствует;

R13' выбран из группы, состоящей из связи, групп -C1-6алкилен-, -С3-8карбоциклил-, -С3-8гетероциклил-, -С1-6алкил-С6-14арил-, -С1-6алкил-С5-14гетероарил-;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -С1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6СН2СН2С(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен, С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6Циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-C1-6алкил-NRR;

каждый R14' независимо выбран из группы, состоящей из: связи, -NR-, групп -С3-10карбоциклил-, -С3-10гетероциклил-, -(CH2CH2O)1-6CH2CH2C(O)OR', -(CH2CH2O)1-6CH2CH2NR- и -C1-6алкилен-,

где R14 возможно замещен группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -NRR или -SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)ОR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-C1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -С1-6алкил;

каждый R' независимо выбран из -Н, C18алкила, С18гетероалкила и арила;

каждый R" независимо выбран из группы, состоящей из: связи и группы -C1-6алкилен-; и

каждый m независимо равен 0, 1, 2 или 3.

Согласно еще одному дополнительному аспекту, настоящее изобретение относится к соединению или соединениям формулы (III):

или его фармацевтически приемлемой соли, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р;

Р представляет собой радикал формулы (I):

где:

пунктирная линия означает возможную связь;

АВ представляет собой антитело;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если X" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -R, -OR, -OCOR13, -OCONR14R15, -OCON(R14)NR(R15), =O (двойная связь с кислородом) и -NR14R15;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и С1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют C2-6алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 представляет собой -(C(R)2)m-C(O)- или -(C(R)2)m-;

L1 выбран из: связи с АВ, -NR-(связь с АВ) и ;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -С(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -C1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-C1-6алкил-, -N=СР-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(ОСН2СН2)1-6-NRC(O)С1-6алкил-, -C1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-С1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-C1-l2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(O)-,

, и ,

или L3 отсутствует;

R13 выбран из группы, состоящей из водорода, C1-6алкила, С3-8карбоциклила, С3-8гетероциклила, С1-6алкил-С6-14арила, C1-6алкил-C5-14гетероарила, где R13 возможно замещен группой -NRR или -SO2NRR;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6CH2CH2C(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -С1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-С1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -С1-6алкил;

b равен 1-20; и

каждый m независимо равен 0, 1, 2 или 3.

Согласно еще одному аспекту, настоящее изобретение относится к соединению или соединениям формулы (III'):

или их фармацевтически приемлемой соли, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р';

Р' представляет собой радикал формулы (I'):

где:

пунктирная линия означает возможную связь;

АВ представляет собой антитело;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если X" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -С(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -(C(R)2)m-C(O)-, -(C(R)2)m-, -OR", -OCOR13', -OCONRR14', -OCON(R14)N(R15)- и -NR14-;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют C2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 независимо выбран из водорода, групп -С1-6алкил, -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -(C(R)2)m-NR14R15, -(C(R)2)m-C(O)-SR, -(C(R)2)m-C(O)NR14N(R)R15, -(C(R)2)m-NR-C(O)-NR14R15, -(C(R)2)m-N(R)COR13 и -(C(R)2)m-NR14N(R)R15;

L1 выбран из: связи с АВ, -NR-(связь с АВ) и ;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A, где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -C(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -С1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-C1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(ОСН2СН2)1-6-NRC(O)С1-6алкил-, -С1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-С1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(О)-,

, и ,

или L3 отсутствует;

R13 выбран из группы, состоящей из связи, групп -С1-6алкилен-, -С3-8карбоциклил-, -С3-8гетероциклил-, -С1-6алкил-С6-14арил-, -C1-6алкил-C5-14гетероарил-;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6СН2СН2С(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-С1-6алкил-NRR;

каждый R14' независимо выбран из группы, состоящей из: связи, -NR-, групп -С3-10карбоциклил-, -С3-10гетероциклил-, -(CH2CH2O)1-6CH2CH2C(O)OR', -(CH2CH2O)1-6CH2CH2NR- и -C1-6алкилен-,

где R14' возможно замещен группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -NRR или -SO2NRR, (5) -SO2R, (6) -S-S-C1-6алкил-C(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-С1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -С1-6алкил;

каждый R' независимо выбран из -Н, C18алкила, C18гетероалкила и арила;

каждый R" независимо выбран из группы, состоящей из: связи и группы -C1-6алкилен-;

b равен 1-20;и

каждый m независимо равен 0, 1, 2 или 3.

В другом аспекте настоящее изобретение относится к конъюгату антитело-лекарственное средство соединения формулы III или III', где антитело АВ выбрано из: трастузумаба, мутантов трастузумаба (например, мутантов трастузумаба, раскрытых здесь или в международной заявке PCT/IB 2012/056234), ореговомаба, эдреколомаба, цетуксимаба, гуманизированного моноклонального антитела к рецептору витронектина (αvβ3), алемтузумаба, гуманизированного анти-HLA-DR антитела для лечения неходжкинской лимфомы, 131l Lym-1, мышиного анти-HLA-Dr10 антитела для лечения неходжкинской лимфомы, гуманизированного анти-CD22 mAb для лечения лимфомы Ходжкина и неходжкинской лимфомы, лабетузумаба, бевацизумаба, ибритумомаба тиуксетана, офатумумаба, панитумумаба, ритуксимаба, тозитумомаба, ипилимумаба, гемтузумаба, гуманизированного моноклонального антитела против 5Т4-рецептора онкофетального белка и М1/70 (антитело к CD11b-рецептору) и других антител.

Трастузумаб (МНН (международное непатентованное наименование); товарные знаки Herclon, Herceptin) относится к моноклональному антителу, которое блокирует HER2/neu рецептор.

В другом аспекте настоящее изобретение относится к соединению или соединениям формул II, II', III или III', где L представляет собой один или более независимо выбранных аминокислотных ди-радикалов, предпочтительно один или более независимо выбранных аминокислотных дирадикалов, выбранных из группы, состоящей из валина, цитруллина, фенилаланина, лизина, аланина и глицина.

Согласно другому аспекту, настоящее изобретение относится к соединению или соединениям формул III или III', где L способен отщепляться от Р или радикала, содержащего Р, с помощью внутриклеточной протеазы.

Согласно дополнительному аспекту, настоящее изобретение относится к соединению или соединениям формул III или III', где антитело присоединено к аминокислотному дирадикалу через цистеиновый остаток антитела посредством связи через серу или связи сера-сера, лизиновый остаток антитела через амидную связь или глутаминовый остаток через амидную связь. Предпочтительно, антитело представляет собой моноклональное антитело, химерное антитело, гуманизированное антитело, биспецифическое антитело или фрагмент антитела.

Согласно еще одному дополнительному аспекту, настоящее изобретение относится к фармацевтической композиции соединения или соединений формул I, I', II, II', III или III' и/или их соли или солей, содержащей эффективное количество соединения(й) или соли(ей) и фармацевтически приемлемый разбавитель, носитель или эксципиент. Такие фармацевтические композиции могут дополнительно включать терапевтически эффективное количество химиотерапевтического агента, выбранного из группы, состоящей из тубулин-образующего ингибитора, ингибитора топоизомеразы и ДНК-связывающего агента.

Согласно другому аспекту, настоящее изобретение относится к способу уничтожения или ингибирования пролиферации опухолевых клеток или раковых клеток, включающему обработку опухолевых клеток или раковых клеток у пациента количеством соединения формул I, I', II, II', III или III' и/или их соли или солей, которое эффективно для уничтожения или ингибирования пролиферации опухолевых клеток или раковых клеток.

Еще один аспект изобретения относится к способу использования эффективного количества любого из вышеупомянутых соединений и/или любого из вышеупомянутых конъюгатов антитело-лекарственное средство для лечения рака, включающему введение пациенту, нуждающемуся в этом, эффективного количества указанного соединения и/или конъюгата.

Краткое описание графических материалов

На Фиг. 1 схематически показано представление филогенетической связи, определенной с почти полными 16S rRNA последовательностями FERM ВР-3421, с другими Burkholderia spp.

На Фиг. 2 показан биосинтетический генный кластер для сплицеостатинов и предложенный биосинтетический путь, подчеркивающий стадии гидроксилирования, катализируемого цитохромом Р450 Fr9R и Fe(II)/α-кетоглутарат-зависимой диоксигеназой Fr9P.

На Фиг. 3 представлен график, иллюстрирующий данные по ксенотрансплантатам для ADC 3, 4 и 5.

На Фиг. 4 представлен график, иллюстрирующий данные по ксенотрансплантатам для ADC 14 и 18.

Подробное описание изобретения

Настоящее изобретение относится к цитотоксическим натуральным продуктам, включающим цитотоксичные аналоги сплицеостатина, к конъюгатам антитело-лекарственное средство, содержащим указанные цитотоксические натуральные продукты, включающие цитотоксические аналоги сплицеостатина, и к способам их использования для лечения рака и других патологических состояний. Изобретение также относится к способам использования таких соединений и/или конъюгатов in vitro, in situ и in vivo для обнаружения, диагностики или лечения клеток млекопитающих или ассоциированных патологических состояний.

Определения и сокращения

Если не указано иное, следующие термины и выражения, как их используют в данном описании, имеют следующие значения. Когда в данном описании используют товарные знаки, они включают препарат продукта, непатентованное наименование лекарственного средства и активный(е) фармацевтический(е) ингредиент(ы) указанного под товарным знаком продукта, если по контексту не указано иное.

Термин «антитело» (или «Ab», или «АВ») используют в данном описании в наиболее широком смысле, и он конкретно охватывает интактные моноклональные антитела, поликлональные антитела, моноспецифические антитела, мультиспецифические антитела (например биспецифические антитела) и фрагменты антител, которые проявляют желаемую биологическую активность. Интактное антитело имеет главным образом две области:

вариабельную область и константную область. Вариабельная область связывается и взаимодействует с антигеном-мишенью. Вариабельная область включает гипервариабельный участок (CDR), который распознает и связывается со специфическим сайтом связывания на конкретном антигене. Константная область может распознаваться и взаимодействовать с иммунной системой (см., например, Janeway et al., 2001, Immuno. Biology, 5th Ed., Garland Publishing, New York). Антитело может быть любого типа или класса (например, IgG, IgE, IgM, IgD и IgA) или подкласса (например, lgG1, lgG2, lgG3, lgG4, lgA1 и lgA2). Антитело может иметь происхождение из любого подходящего вида. В некоторых воплощениях антитело имеет человеческое или мышиное происхождение. Антитело может быть, например, человеческим, гуманизированным или химерным.

Термины «специфически связывается» и «специфическое связывание» относятся к связыванию антитела с заранее установленным антигеном. Как правило, антитело связывается с аффинностью по меньшей мере примерно 1×107 М-1 и связывается с заранее установленным антигеном с аффинностью, которая по меньшей мере в два раза больше по сравнению с его аффинностью в отношении связывания с неспецифическим антигеном (например бычьим сывороточным альбумином (BSA), казеином), отличным от заранее установленного антигена или близкородственного антигена.

Термин «моноклональное антитело», как его используют в данном описании, относится к антителу, полученному из популяции по существу гомогенных антител, то есть индивидуальные антитела, составляющие популяцию, идентичны за исключением возможных естественных мутаций, которые могут присутствовать в незначительных количествах. Моноклональные антитела являются высокоспецифичными, будучи направленными против единственного антигенного сайта. Определение «моноклональное» указывает на природу антитела как получаемого из по существу гомогенной популяции антител, и его не следует истолковывать как требующее продуцирование антитела каким-либо конкретным способом.

Термин «моноклональные антитела» специально включает «химерные» антитела, в которых часть тяжелой и/или легкой цепи идентична или гомологична соответствующей последовательности антител, имеющих происхождение из конкретных видов или принадлежащих конкретному классу или подклассу антител, в то время как остальная часть цепи(ей) идентична или гомологична соответствующим последовательностям антител, имеющих происхождение из других видов или принадлежащих другому классу или подклассу антител, а также фрагментов таких антител, при условии, что они проявляют желаемую биологическую активность.

«Интактное антитело» представляет собой антитело, которое содержит антиген-связывающую вариабельную область, а также константный домен легкой цепи (CL) и константные домены тяжелой цепи, СН1, СН2, СН3 и СН4, в зависимости от класса антител. Константные домены могут быть нативными последовательностями константных доменов (например, человеческая нативная последовательность константных доменов) или их вариантами аминокислотных последовательностей.

Интактное антитело может проявлять одну или более «эффекторных функций», которые относятся к тем биологическим активностям, которые приписывают Fc-области (например, нативная последовательность Fc-области или аминокислотный вариант последовательности Fc-области) антитела. Примеры эффекторных функций антитела включают комплемент-зависимую цитотоксичность, антитело-зависимую клеточно-опосредованную цитотоксичность (ADCC) и антитело-зависимый клеточно-опосредованный фагоцитоз.

«Фрагмент антитела» содержит часть интактного антитела, предпочтительно содержащую его антиген-связывающую или вариабельную область. Примеры фрагментов антитела включают фрагменты Fab, Fab', F(ab')2 и Fv, диатела, триатела, тетратела, линейные антитела, одноцепочечные молекулы антитела, scFv, scFv-Fc, мультиспецифичные фрагменты антитела, образованные из фрагмента(ов) антител, фрагмент(ы), продуцируемый(е) Fab экспрессионной библиотекой, или эпитоп-связывающие фрагменты любого из вышеуказанного, которые иммуноспецифично связываются с антигеном-мишенью (например, раковым клеточным антигеном, вирусным антигеном или микробным антигеном).

Термин «вариабельный» в контексте антитела относится к определенным участкам вариабельных доменов антитела, которые сильно отличаются по последовательности и используются в связывании и специфичности каждого конкретного антитела для его конкретного антигена. Эта вариабельность сконцентрирована в трех сегментах, называемых «гипервариабельными участками» в вариабельных доменах легкой и тяжелой цепи. Более высококонсервативные участки вариабельных доменов называют каркасными областями (FR). Вариабельные домены нативных тяжелой и легкой цепей каждый содержит четыре FR, соединенные тремя гипервариабельными участками.

Термин «гипервариабельный участок» при использовании здесь относится к аминокислотным остаткам антитела, которые ответственны за связывание антигена. Гипервариабельный участок в общем содержит аминокислотные остатки из «участка, определяющего комплементарность» или «CDR» (например, остатки 24-34 (L1), 50-56 (L2) и 89-97 (L3) в вариабельном домене легкой цепи и 31-35 (Н1), 50-65 (Н2) и 95-102 (L3) в вариабельном домене тяжелой цепи; Kabat et al. (Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)), и/или те остатки из «гипервариабельной петли» (например, остатки 26-32 (L1), 50-52 (L2) и 91-96 (L3) в вариабельном домене легкой цепи и 26-32 (Н1), 53-55 (142) и 96-101 (Н3) в вариабельном домене тяжелой цепи; Chothia и Lesk, 1987, J. Mol. Biol. 196: 901-917). FR остатки представляют собой остатки вариабельного домена, отличные от остатков гипервариабельной области, как определено в данном описании.

«Одноцепочечное Fv» или «scFv» фрагмент антитела содержит V.sub.H и V.sub.L домены антитела, причем эти домены присутствуют в одной полипептидной цепи. Как правило, Fv полипептид дополнительно содержит полипептидный линкер между V.sub.H и V.sub.L доменами, который дает возможность scFv образовывать желаемую структуру для связывания антигена. Для обзора scFv см. Pluckthun в The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp.269-315 (1994).

Термин «диатело» относится к небольшим фрагментам антитела с двумя антиген-связывающими сайтами, причем фрагменты содержат вариабельный тяжелый домен (VH), соединенный с вариабельным легким доменом (VL) в одной полипептидной цепи. При использовании линкера, который слишком короткий, чтобы обеспечить спаривание между двумя доменами на одной цепи, домены вынуждены спариваться с комплементарными доменами другой цепи и создавать два антиген-связывающих сайта. Диатела описаны более подробно, например, в ЕР 0 404 097; WO 93/11161; и Hollinger et al., 1993, Proc. Natl. Acad. Sci. USA 90: 6444-6448.

«Туманизированные» формы не являющихся человеческими антител (например, грызуна) являются химерные антитела, которые содержат минимальную последовательность, имеющую происхождение из иммуноглобулина, не являющегося человеческим. В большинстве случаев гуманизированные антитела являются человеческими иммуноглобулинами (реципиентное антитело), в которых остатки из гипервариабельного участка реципиента заменены остатками из гипервариабельного участка не являющихся человеческими видов (донорное антитело), таких как мышь, крыса, кролик или не являющийся человеческим примат, имеющих желаемую специфичность, аффинность и емкость. В некоторых случаях остатки каркасной области (FR) человеческого иммуноглобулина заменены соответствующими остатками не являющихся человеческими видов. Кроме того, гуманизированные антитела могут содержать остатки, которые не обнаруживают в реципиентном антителе или в донорном антителе. Эти модификации создают для дополнительного улучшения эффективности антитела. В общем, гуманизированное антитело содержит по существу все из по меньшей мере одного и, как правило, двух вариабельных доменов, в которых все или по существу все из гипервариабельных петель соответствуют петлям из иммуноглобулина, не являющегося человеческим, и все или по существу все из FR являются FR из последовательности человеческого иммуноглобулина. Гуманизированное антитело возможно также содержит по меньшей мере участок константной области иммуноглобулина (Fc), как правило человеческого иммуноглобулина. Для дополнительных деталей см. Jones et al., 1986, Nature 321: 522-525; Riechmann et al., 1988, Nature 332: 323-329; и Presta, 1992, Curr. Op. Struct. Biol. 2: 593-596.

Как используют в данном описании, «выделенное» означает отделенное от других компонентов (а) природного источника, такого как растительная или животная клетка или клеточная культура, или (б) синтетической органической химической реакционной смеси. Как используют в данном описании, «очищенное» означает, что при выделении изолят содержит по меньшей мере 95%, и в другом аспекте по меньшей мере 98%, соединения (например, конъюгата) по массе изолята.

«Выделенное» антитело представляет собой антитело, которое было идентифицировано и отделено и/или выделено из компонента из его естественного окружения. Загрязняющие компоненты из его естественного окружения являются материалами, которые будут препятствовать диагностическому или терапевтическому использованию антитела, и могут включать ферменты, гормоны и другие белковые или небелковые растворенные вещества. В предпочтительных воплощениях антитело очищают (1) до более чем 95% по массе антитела, как определяют методом Лоури, и наиболее предпочтительно более чем 99% по массе, (2) до степени, достаточной для получения по меньшей мере 15 остатков N-концевой или внутренней аминокислотной последовательности, путем использования секвенатора с вращающимся стаканом, или (3) до гомогенности согласно электрофорезу на полиакриламиде с додецилсульфатом натрия (SDS-PAGE) в восстанавливающих или невосстанавливающих условиях с использованием кумасси голубого или, предпочтительно, серебрянки. Выделенное антитело включает антитело in situ в рекомбинантных клетках, в виду того что по меньшей мере один компонент природного окружения антитела не будет присутствовать. Однако, обычно выделенное антитело получают по меньшей мере за одну стадию очистки.

Антитело, которое «индуцирует апоптоз», представляет собой антитело, которое индуцирует программируемую клеточную гибель, как определяют посредством связывания аннексина V, фрагментации ДНК, сжатия клетки, расширения эндоплазматического ретикулума, клеточной фрагментации и/или образования мембранных везикул (называемых апоптотическими тельцами). Клетка представляет собой опухолевую клетку, например, молочной железы, яичника, желудка, эндометрия, слюнной железы, легкого, почки, толстой кишки, щитовидной железы, поджелудочной железы или мочевого пузыря. Разные методы доступны для оценки клеточных событий, ассоциированных с апоптозом. Например, перенос фосфатидилсерина (PS) может быть измерен посредством связывания аннексина; фрагментация ДНК может быть оценена посредством электрофоретического расщепления ДНК; и конденсация ядра/хроматина наряду с фрагментацией ДНК может быть оценена посредством какого-либо увеличения в гиподиплоидных клетках.

Термин «терапевтически эффективное количество» относится к количеству лекарственного средства, эффективному для лечения заболевания или расстройства у млекопитающего. В случае рака терапевтически эффективное количество лекарственного средства может снижать количество раковых клеток; уменьшать размеры опухоли; подавлять (то есть замедлять до некоторой степени и предпочтительно останавливать) инфильтрацию раковой клетки в периферические органы; подавлять (то есть замедлять до некоторой степени и предпочтительно останавливать) метастазы опухоли; ингибировать до некоторой степени рост опухоли; и/или облегчать до некоторой степени один или более симптомов, ассоциированных с раком. До той степени, с которой лекарственное средство может ингибировать рост и/или уничтожать имеющиеся раковые клетки, оно может быть цитостатическим и/или цитотоксическим. Для терапии рака эффективность может, например, быть измерена путем оценки времени до прогрессирования заболевания (ТТР) и/или определения степени ответа (RR).

Термин «существенное количество» относится к большинству, то есть более чем 50% популяции, смеси или образца.

Термин «внутриклеточный метаболит» относится к соединению, полученному в результате метаболического процесса или реакции внутри клетки на конъюгате антитело-лекарственное средство (ADC). Метаболический процесс или реакция может представлять собой ферментативный процесс, такой как протеолитическое расщепление пептидного линкера ADC. Внутриклеточные метаболиты включают, без ограничения, антитела и свободное лекарственное средство, которые могут подвергаться внутриклеточному расщеплению после поглощения, диффузии, захвата или транспорта в клетку.

Термины «внутриклеточно расщепленный» и «внутриклеточное расщепление» относятся к метаболическому процессу или реакции внутри клетки на ADC или подобном ему, посредством которых ковалентная связь, например, линкера между лекарственной группировкой и антителом разрушается с получением свободного лекарственного средства или другого метаболита конъюгата, диссоциированного от антитела внутри клетки. Расщепленные группировки ADC являются, таким образом, внутриклеточными метаболитами.

Термин «биодоступность» относится к системной доступности (то есть уровни в крови/плазме) данного количества лекарственного средства, введенного пациенту. Биодоступность представляет собой абсолютный термин, который указывает меру как времени (скорость), так и общего количества (степень) лекарственного средства, которое достигает общего кровотока из введенной лекарственной формы.

Термин «цитотоксическая активность» относится к уничтожающему клетку, цитостатическому или антипролиферативному эффекту ADC или внутриклеточного метаболита указанного ADC. Цитотоксическая активность может быть выражена в виде значения IC50, которое равно концентрации (молярной или массовой) на единицу объема, при которой выживает половина клеток.

«Расстройство» представляет собой любое состояние, при котором может быть получена польза от лечения лекарственным средством или конъюгатом антитело-лекарственное средство. Оно включает хронические и острые расстройства или заболевания, включая такие патологические состояния, которые приводят млекопитающего к рассматриваемому расстройству. Неограничивающие примеры расстройств, подлежащих лечению по настоящему изобретению, включают доброкачественные и злокачественные новообразования; лейкоз и лимфоидные новообразования, нейрональные, глиальные, астроцитальные, гипоталамические и другие эндокринные, макрофагальные, эпителиальные, стромальные и бластоцельные расстройства; а также воспалительные, ангиогенные и иммунологические расстройства.

Термины «рак» и «раковый» относятся к или описывают физиологическое состояние или расстройство у млекопитающих, которое как правило характеризуется нерегулируемым клеточным ростом. «Опухоль» содержит одну или более раковых клеток.

Примеры «пациента» включают, без ограничения, человека, крысу, мышь, морскую свинку, обезьяну, козу, корову, лошадь, собаку, кошку, птицу и домашнюю птицу. В иллюстративном воплощении пациент представляет собой человека.

Термины «лечить» или «лечение», если иное не следует по контексту, относится к терапевтическому лечению или профилактическим мерам для предотвращения обострения, где задача состоит в том, чтобы подавлять или снижать (уменьшать) нежелаемое физиологическое изменение или расстройство, такое как развитие или распространение рака. Для целей данного изобретения, благоприятные или желаемые клинические результаты включают, без ограничения, облегчение симптомов, минимизацию степени заболевания, стабилизированное (то есть не ухудшающееся) состояние заболевания, задержку или замедление прогрессирования заболевания, улучшение или облегчение болезненного состояния и ремиссию (частичную или полную), неважно может ли это быть обнаружено или нет. «Лечение» может также означать продление выживания по сравнению с ожидаемым выживанием без получения лечения. Субъекты, нуждающиеся в лечении, включают тех, кто уже имеет состояние или расстройство, а также тех, у кого подозревается состояние или расстройство.

В контексте рака термин «лечение» включает любое из или все из ингибирования роста опухолевых клеток, раковых клеток или опухоли;

ингибирования репликации опухолевых клеток или раковых клеток, уменьшения общего очага опухоли или снижения количества раковых клеток и улучшения одного или более симптомов, ассоциированных с заболеванием.

В контексте аутоиммунного заболевания термин «лечение» включает любое из или все из ингибирования репликации клеток, ассоциированных с аутоиммунным болезненным состоянием, включая, без ограничения, клетки, которые продуцируют аутоиммунные антитела, уменьшения очага аутоиммунного антитела и ослабления одного или более симптомов аутоиммунного заболевания.

В контексте инфекционного заболевания термин «лечение» включает любое из или все из: ингибирования роста, размножения или репликации патогена, который вызывает инфекционное заболевание, и ослабления одного или более симптомов инфекционного заболевания.

Термин «вкладыш упаковки» используют для ссылки на инструкции, включенные в коммерческие упаковки терапевтических продуктов, которые содержат информацию о показании(ях), использовании, дозировке, введении, противопоказаниях и/или предосторожностях, касающихся применения таких терапевтических продуктов.

Как используют в данном описании, термины «клетка», «клеточная линия» и «клеточная культура» используют взаимозаменяемо, и все такие обозначения включают потомство. Слова «трансформанты» и «трансформированные клетки» включают первичную клетку-субъект и культуры или потомство, происходящее от них, безотносительно количества переносов. Также следует понимать, что все потомство не может быть точно идентичным по содержанию ДНК из-за преднамеренных или случайных мутаций. Мутантное потомство, которое имеет такую же функцию или биологическую активность, как определено в отношении первоначально трансформированной клетки, также включено. Когда подразумеваются отличные обозначения, это будет ясно из контекста.

Если не указано иное, термин «алкил» сам по себе или как часть другого термина относится к прямоцепочечному или разветвленному насыщенному углеводороду, имеющему указанное количество атомов углерода (например, «С18алкил» относится к алкильной группе, имеющей от 1 до 8 атомов углерода). Если количество атомов углерода не указано, алкильная группа имеет от 1 до 8 атомов углерода. Иллюстративные прямоцепочечные C1-C8-алкилы включают, без ограничения, метил, этил, н-пропил, н-бутил, н пентил, н-гексил, н-гептил и н-октил; в то время как разветвленные С18алкилы включают, без ограничения, изопропил, -втор-бутил, -изобутил, -трет-бутил, -изопентил и -2-метилбутил; ненасыщенные С28алкилы включают, без ограничения, винил, аллил, 1-бутенил, 2-бутенил, изобутиленил, 1-пентенил, 2-пентенил, 3-метил-1-бутенил, 2-метил-2-бутенил, 2,3-диметил-2-бутенил, 1-гексил, 2-гексил, 3-гексил, ацетиленил, пропинил, 1-бутинил, 2-бутинил, 1-пентинил, 2-пентинил и 3-метил-1-бутинил.

Если не указано иное, «алкилен» сам по себе или как часть другого термина относится к насыщенному разветвленному или прямоцепочечному или циклическому углеводородному радикалу с установленным количеством атомов углерода, как правило 1-18 атомов углерода, и имеющему два моновалентных радикальных центра, полученные при удалении двух атомов водорода от одного и того же или двух разных атомов углерода исходного алкана. Типичные алкиленовые радикалы включают, без ограничения: метилен (-СН2-), 1,2-этилен (-CH2CH2-), 1,3-пропилен (-CH2CH2CH2-), 1,4-бутилен (-СН2СН2СН2СН2-) и тому подобное. «C110» прямоцепочечный алкилен представляет собой прямоцепочечную насыщенную углеводородную группу формулы -(СН2)1-10-. Примеры C110алкилена включают метилен, этилен, пропилен, бутилен, пентилен, гексилен, гептилен, октилен, нонилен и декален. В некоторых воплощениях по изобретению алкилены имеют от 1 до 9, от 1 до 8, от 1 до 7 и от 1 до 6 атомов углерода.

Если не указано иное, термин «гетероалкил» сам по себе или в комбинации с другим термином означает, если не указано иное, стабильный прямоцепочечный или разветвленный углеводород или его комбинации, полностью насыщенный или содержащий от 1 до 3 степеней ненасыщенности, состоящий из установленного количества атомов углерода и от одного до трех гетероатомов, выбранных из группы, состоящей из О, N, Si, S и/или Р, и где атомы азота и серы могут возможно быть окисленными и гетероатом азота может быть возможно квартенизированным. Гетероатом(ы) О, N и S могут быть локализованы по любому внутреннему положению гетероалкильной группы. Гетероатом Si может быть локализован по любому положению гетероалкильной группы, включая положение, по которому алькильная группа присоединена к остальной части молекулы. Вплоть до двух гетероатомов могут быть расположены друг за другом.

«Галоген» или «галогено» относится к фтору, хлору, брому и йоду.

«Галоген(С1-6-алкил)» относится к C1-6-алкильным группам, замещенным от 1 до 3 или от 1 до 2 галогеновых групп, где С1-6-алкил и галоген являются такими, как определено в данном описании. Термин включает, например, CF3.

Термин «эпокси», или «эпоксигруппа», или «остаток эпокси» известен специалистам в данной области техники как относящийся к трехчленному кольцу, содержащему атомы углерода и атом кислорода, связанные простыми связями следующим образом:

.

Соответственно, термин «эпоксид» относится к соединению, которое содержит по меньшей мере одну эпоксигруппу, как она определена в данном описании.

Если не указано иное, термин «гетероалкилен» сам по себе или как часть другого заместителя означает двухвалентную группу, полученную из гетероалкила (как обсуждалось выше). Для гетероалкиленовых групп гетероатомы также могут занимать один или оба конца цепи.

Если не указано иное, «арил» сам по себе или как часть другого термина означает замещенный или незамещенный моновалентный ароматический углеводородный радикал из 6-20, предпочтительно 6-14, атомов углерода, полученный при удалении одного атома водорода от одного атома углерода исходной ароматической кольцевой системы. Типичные арильные группы включают, без ограничения, радикалы, полученные из бензола, замещенного бензола, нафталина, антрацена, бифенила и тому подобное. Замещенная ароматическая группа (например, арильная группа) может быть замещена одной или более, предпочтительно от 1 до 5, следующими группами: C18алкил, -O-(С18алкил), -C(O)R', -OC(O)R', -C(O)OR', -C(O)NH2, -C(O)NHR', -C(O)N(R')2, -NHC(O)R', -S(O)2R', -S(O)R', -ОН, галоген, -N3, -NH2, -NH(R'), -N(R')2 и -CN; где каждый R' независимо выбран из -Н, C18алкила, С18гетероалкила и арила, предпочтительно незамещенного арила. В некоторых воплощениях замещенная ароматическая группа может дополнительно включать одно или более из следующего: -NHC(=NH)NH2, -NHCONH2, -S(=O)2R' и -SR'.

Термин «гетероарил», как он использован здесь, относится к ароматическому гетероциклическому 5-14-членному, например 5-6-членному, кольцу, имеющему по меньшей мере один гетероатом, выбранный из азота, кислорода и серы, и содержащему по меньшей мере 1 атом углерода. Гетероарилы могут представлять собой моноциклические, бициклические или трициклические кольцевые системы. Иллюстративные гетероарилы представляют собой триазолил, тетразолил, оксадиазолил, пиридил, фурил, бензофуранил, тиофенил, бензотиофенил, хинолинил, пирролил, индолил, оксазолил, бензоксазолил, имидазолил, бензимидазолил, тиазолил, бензотиазолил, изоксазолил, пиразолил, изотиазолил, пиридазинил, пиримидинил, пиразинил, триазинил, циннолинил, фталазинил, хиназолинил, пиримидил, азепинил, оксепинил и хиноксалинил. Гетероарилы являются возможно замещенными. Типичные заместители включают, без ограничения, -X, -R, -O-, -OR, -SR, -S-, -NR2, -NR3, =NR, -CX3, -CN, -OCN, -SCN, -N=C=O, -NCS, -NO, -NO2, =N2, -N3, -NRC(=O)R, -C(=O)NR2, -SO3-, -SO3H, -S(=O)2R, -OS(=O)2OR, -S(=O)2NR, -S(=O)R, -OP(=O)(OR)2, -P(=O)(OR)2, -РО32-, РО3Н2, -AsO2H2, -C(=O)R, -C(=O)X, -C(=S)R,-CO2R,-CO2-, -C(=S)OR,-C(=O)SR, -C(=S)SR, -C(=O)NR2, -C(=S)NR2, -C(=NR)NR2, С120гетероалкил, С620арил, С38гетероциклил, защитную группу или группировку пролекарства, где каждый Х независимо представляет собой галоген: -F, -Cl, -Br или -l; и каждый R независимо представляет собой -Н или С16алкил.

Термины «арилен», «гетероарилен» относятся к двухвалентным вариантам «арила» и «гетероарила», соответственно, и другим терминам, включающим «арил» и «гетероарил».

«Гидрокси» относится к группе -ОН.

«Замещенный алкил» означает алкил, в котором один или более атомов водорода каждый независимо замещен заместителем. Типичные заместители включают, без ограничения: -X, -R, -O-, -OR, -SR, -S-, -NR2, -NR3, =NR, -СХ3, -CN, -OCN, -SCN, -N=C=O, -NCS, -NO, -NO2, =N2, -N3, -NRC(=O)R, -C(=O)NR2, -SO3-, -SO3H, -S(=O)2R, -OS(=O)2OR, -S(=O)2NR, -S(=O)R, -OP(=O)(OR)2, -P(=O)(OR)2, -РО32-, РО3Н2, -AsO2H2, -C(=O)R, -C(=O)X, -C(=S)R, -CO2R, -CO2-, -C(=S)OR, -C(=O)SR, -C(=S)SR, -C(=O)NR2, -C(=S)NR2, -C(=NR)NR2, C120гетероалкил, С620арил, С38гетероциклил, защитную группу или группировку пролекарства, где каждый Х независимо представляет собой галоген: -F, -Cl, -Br или -I; и каждый R независимо представляет собой -Н или C16алкил. Замещенный алкил, замещенный галогеном, иногда называют здесь галогеналкилом. Арильные, алкиленовые, гетероалкиленовые и другие группы, содержащие или не содержащие алкильную или алкиленовую группировку, как описано выше, могут также быть просто замещенными,

Если не указано иное, «аралкил» сам по себе или как часть другого термина означает алкильную группу, как описано выше, замещенную арильную группу, как определено выше.

Если не указано иное, «С38гетероциклил» сам по себе или как часть другого термина относится к моновалентной или двухвалентной замещенной или незамещенной ароматической или неароматической моноциклической или бициклической кольцевой системе, имеющей от 3 до 8 атомов углерода (также называемых кольцевыми членами) и от одного до четырех гетероатомных кольцевых членов, независимо выбранных из N, О, Р или S, и полученной при удалении одного атома водорода из кольцевого атома исходной кольцевой системы. Аналогично, если не указано иное, «С310гетероциклил» сам по себе или как часть другого термина относится к моновалентной или двухвалентной замещенной или незамещенной ароматической или неароматической моноциклической или бициклической кольцевой системе, имеющей от 3 до 10 атомов углерода (также называемых кольцевыми членами) и от одного до четырех гетероатомных кольцевых членов, независимо выбранных из N, О, Р или S, и полученной при удалении одного атома водорода из кольцевого атома исходной кольцевой системы. Один или более атомов N, С или S в гетероциклиле могут быть окисленными. Гетероциклильные группы с более 10 атомами углерода, например кольца или кольцевые системы с 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 атомами углерода, также возможны и охватываются, наряду с С310гетероциклилами, когда термин «гетероциклил» используют без ссылки на конкретное количество атомов углерода. Подобным образом, гетероциклильные группы с менее 3 атомами углерода, например кольца с 1 или 2 атомами, возможны и охватываются, когда термин «гетероциклил» используют без ссылки на конкретное количество атомов углерода. Термин «гетероциклоалкил» относится к неароматическим гетероциклильным кольцам или кольцевым системам, когда все атомы углерода являются насыщенными (то есть, связаны с водородом или другим заместителем, как отмечено ниже, без двойных или тройных связей). В некоторых воплощениях гетероциклоалкильные группы обычно имеют от 3 до 5 членов и от 1 до 2 гетероатомов. В некоторых воплощениях гетероциклоалкил может представлять собой эпокси.

Если не указано иное, гетероциклил присоединен к его боковой группе по любому гетероатому или атому углерода, приводящему к стабильной структуре. Иллюстративные примеры С38гетероциклила включают, без ограничения, тетрагидрофуранил, оксетанил, пиранил, пирролидинил, пиперидинил, бензофуранил, бензотиофен, индолил, бензопиразолил, пирролил, тиофенил (тиофен), фуранил, тиазолил, имидазолил, пиразолил, триазолил, хинолинил, пиримидинил, пиридинил, пиридонил, пиразинил, пиридазинил, изотиазолил, изоксазолил и тетразолил. С38гетероциклил или С310гетероциклил может быть замещен группами в количестве вплоть до семи, включая, без ограничения, C18алкил, C18гетероалкил, -OR', арил, -C(O)R', -OC(O)R', -C(O)OR', -C(O)NH2, -C(O)NHR', -C(O)N(R')2, -NHC(O)R', -S(=O)2R', -S(O)R', галоген, -N3, -NH2, -NH(R'), -N(R')2 и -CN; где каждый R' независимо выбран из -Н, C18алкила, C18гетероалкила и арила. В некоторых воплощениях замещенный гетероциклил может также включать один или более из следующих: -NHC(=NH)NH2, -NHCONH2, -S(=O)2R' и -SR'.

Если не указано иное, «гетероаралкил» сам по себе или как часть другого термина означает алкильную группу, как определено выше, замещенную ароматической гетероциклильной группой, как определено выше.

Если не указано иное, «С38карбоциклил» сам по себе или как часть другого термина представляет собой 3-, 4-, 5-, 6-, 7- или 8-членное моновалентное или двухвалентное, замещенное или незамещенное, насыщенное или ненасыщенное неароматическое моноциклическое или бициклическое карбоциклическое кольцо, полученное при удалении одного атома водорода из кольцевого атома исходной кольцевой системы. Аналогичным образом, если не указано иное, «С310карбоциклил» сам по себе или как часть другого термина представляет собой 3-, 4-, 5-, 6-, 7-, 8-, 9- или 10-членное моновалентное или двухвалентное, замещенное или незамещенное, насыщенное или ненасыщенное неароматическое моноциклическое или бициклическое карбоциклическое кольцо, полученное при удалении одного атома водорода из кольцевого атома исходной кольцевой системы. Иллюстративные С38карбоциклилы включают, без ограничения, циклопропил, циклобутил, циклопентил, циклопентадиенил, циклогексил, циклогексенил, 1,3-циклогексадиенил, 1,4-циклогексадиенил, циклогептил, 1,3-циклогептадиенил, 1,3,5-циклогептатриенил, циклооктил, циклооктадиенил, бицикло(1.1.1.)пентан, и бицикло(2.2.2.)октан. С38карбоциклильная группа или С310карбоциклильная группа может быть незамещенной или замещенной группами в количестве вплоть до семи, включая, без ограничения, С18алкил, С18гетероалкил, -OR', арил, -C(O)R', -OC(O)R', -C(O)OR', -C(O)NH2, -C(O)NHR', -C(O)N(R')2, -NHC(O)R', -S(=O)2R', -S(=O)R', -ОН, -галоген, -N3, -NH2, -NH(R'), -N(R')2 и -CN; где каждый R' независимо выбран из -Н, С18алкила, C18гетероалкила и арила. Карбоциклильные группы с более чем 10 атомов углерода, например кольцевые системы с 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 атомами угдерода, также возможны и охватываются, среди С310карбоциклилов, когда термин «карбоциклил» используют без ссылки на конкретное количество атомов углерода. Термин «циклоалкил» относится к карбоциклильным кольцам или кольцевым системам, где все атомы углерода являются насыщенными (то есть, связаны с водородом или другим заместителем, как отмечено ниже, без двойных или тройных связей).

Термин «хиральный» относится к молекулам, которые имеют свойство партнера с неналагающимся зеркальным изображением, в то время как термин «ахиральный» относится к молекулам, которые являются партнерами с налагающимся зеркальным изображением.

Термин «стереоизомеры» относится к соединениям, которые имеют идентичный химический состав, но отличаются по расположению атомов или групп в пространстве.

«Диастереомер» относится к стереоизомеру с двумя или более центрами хиральности и молекулы которых не являются зеркальными отражениями друг друга. Диастереомеры имеют различные физические свойства, например, точки плавления, точки кипения, спектральные свойства и реакционноспособность. Смеси диастереомеров могут быть разделены посредством аналитических методик высокого разрешения, таких как электрофорез и хроматография.

Стереохимические определения и условные обозначения, использованные здесь, в общем следуют из S. P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms, McGraw-Hill Book Company, New York (1984); и Eliel and Wilen, Stereochemistry of Organic Compounds, John Wiley & Sons, Inc., New York (1994). Многие органические соединения существуют в оптически активных формах, то есть они имеют способность вращать плоскость плоскополяризованного света. При описании оптически активного соединения префиксы d и I или R и S используют для обозначения абсолютной конфигурации молекулы относительно ее хирального(ых) центра(ов). Префиксы d и I или (+) и (-) используют для обозначения знака вращения плоскополяризованного света соединением, причем (-) или I означает, что соединение является левовращающим, а соединение с префиксом (+) или d является правовращающим. Для данной химической структуры эти стереоизомеры являются идентичными, за исключением того, что они являются зеркальными отображениями друг друга. Конкретный стереоизомер может также называться энантиомером, и смесь таких изомеров часто называют энантиомерной смесью. Смесь 50:50 энантиомеров называют рацемической смесью или рацематом, которые могут существовать, когда в химической реакции или процессе не было никакого стереоразделения или стереоспецифичности. Термины «рацемическая смесь» и «рацемат» относятся к эквимолярной смеси двух энантиомерных видов, лишенной оптической активности.

Аминокислотное «производное» включает аминокислоту, имеющую замены или модификации путем ковалентного присоединения исходной аминокислоты, такие как, например, путем алкилирования, гликозилирования, ацетилирования, фосфорилирования и тому подобное. Дополнительно включены в определение «производное», например, один или более аналогов аминокислот с замещенными связками, а также другие модификации, известные в данной области техники.

«Природная аминокислота» относится к аргинину, глутамину, фенилаланину, тирозину, триптофану, лизину, глицину, аланину, гистидину, серину, пролину, глутаминовой кислоте, аспарагиновой кислоте, треонину, цистеину, метионину, лейцину, аспарагину, изолейцину и валину, если не указано иное по контексту.

Фраза «фармацевтически приемлемая соль», как используют в данном описании, относится к фармацевтически приемлемым органическим или неорганическим солям соединения. Соединение как правило содержит по меньшей мере одну аминогруппу, и соответственно соли присоединения кислоты могут быть образованы с этой аминогруппой. Иллюстративные соли включают, без ограничения, соли сульфат, цитрат, ацетат, оксалат, хлорид, бромид, йодид, нитрат, бисульфат, фосфат, гидрофосфат, изоникотинат, лактат, салицилат, кислый цитрат, тартрат, олеат, таннат, пантотенат, битартрат, аскорбат, сукцинат, малеат, малат, гентизинат, фумарат, глюконат, глюкуронат, сахарат, формиат, бензоат, глутамат, метансульфонат, этансульфонат, бензолсульфонат, пара-толуолсульфонат и памоат (то есть 1,1'-метилен-бис-(2-гидрокси-3-нафтоат)). Фармацевтически приемлемая соль может охватывать включение других молекул, таких как ацетатный ион, сукцинатный ион или другой противоион. Противоион может представлять собой любую органическую или неорганическую группировку, которая стабилизирует заряд исходного соединения. Кроме того, фармацевтически приемлемая соль может иметь более одного заряженного атома в своей структуре. В случае множества заряженных атомов, фармацевтически приемлемая соль может иметь множество противоинов. Поэтому, фармацевтически приемлемая соль может иметь один или более заряженных атомов и/или один или более противоионов.

Термины «нагрузка», или «лекарственная нагрузка», или «полезная нагрузка» представляют собой или означают среднее количество полезных нагрузок («полезная нагрузка» и «полезные нагрузки» используют в данном описании взаимозаменяемо с «лекарственным средством» и «лекарственными средствами») на антитело в ADC молекуле. Лекарственная нагрузка может находиться в диапазоне от 1 до 20 лекарственных средств на антитело. Иногда это выражают как DAR, или соотношение лекарственного средства к антителу. Композиции ADC, описанные здесь, как правило имеют соотношения DAR от 1-20 и в некоторых воплощениях от 1-8, от 2-8, от 2-6, от 2-5 и от 2-4. Типичные значения DAR равны 2, 4, 6 и 8. Среднее количество лекарственных средств на антитело, или значение DAR, может быть определено общепринятыми средствами, такими как спектроскопия в УФ/видимой области, масс-спектроскопия, твердофазный иммуноферментный анализ (ELISA) и высокоэффективная жидкостная хроматография (ВЭЖХ). Количественный показатель DAR также может быть определен. В некоторых случаях разделение, очистка и определение характеристик гомогенных ADC, имеющих конкретное значение DAR, могут быть достигнуты такими средствами, как ВЭЖХ с обращенной фазой или электрофорез. DAR может быть ограничен количеством сайтов присоединения на антитело. Например, когда присоединение представляет собой цистеин-тиол, антитело может иметь только одну или несколько цистеин-тиоловых групп или может иметь только одну или несколько достаточно реакционноспособных тиоловых групп, через которые может быть присоединена единица Линкера. В некоторых воплощениях цистеин-тиол представляет собой тиоловую группу цистеинового остатка, который образует внутрицепочечную дисульфидную связь. В некоторых воплощениях цистеин-тиол представляет собой тиоловую группу цистеинового остатка, который не образует внутрицепочечную дисульфидную связь. Как правило, во время реакции конъюгирования меньше теоретического максимума группировок лекарственного средства конъюгируется с антителом. Антитело может содержать, например, много остатков лизина, которые не взаимодействуют с линкером или промежуточным линкером. Только большинство реакционноспособных групп лизина может взаимодействовать с реакционноспособным линкерным реагентом.

В общем, антитела не содержат много, если вообще содержат, свободных и реакционноспособных цистеин-тиоловых групп, которые могут быть связаны с лекарственных средством через линкер. Большинство цистеин-тиоловых остатков в антителах существуют в виде дисульфидных мостиков и должны быть восстановлены восстановителем, таким как дитиотрейтол (DTT). Антитело может быть подвергнуто денатурирующим условиям с высвобождением реакционноспособных нуклеофильных групп, таких как лизин или цистеин. Полезную нагрузку (соотношение лекарственного средства/антитела) в ADC можно контролировать несколькими разными путями, включая: (1) ограничение молярного избытка конструкции лекарственное средство-линкер относительно антитела, (2) ограничение времени или температуры конъюгирования, и (3) частичные или ограничивающие условия восстановления для модификации цистеин-тиола. Когда более одной нуклеофильной группы взаимодействуют с лекарственным средством-линкером, тогда полученный продукт представляет собой смесь ADC с распределением одной или более группировок лекарственных средств на антитело. Среднее количество лекарственного средства на антитело может быть рассчитано из смеси, например, двойным ELISA-антитело анализом, специфичным для антитела и специфичным для лекарственного средства. Индивидуальные ADC могут быть идентифицированы в смеси посредством масс-спектроскопии и разделены посредством ВЭЖХ, например хроматографии гидрофобного взаимодействия.

Ниже перечислены сокращения и определения, которые не могут быть иным образом определены или описаны в данной заявке: DMSO (относится к диметилсульфоксиду), МСВР (относится к масс-спектрометрии высокого разрешения), ДДМ (относится к детектированию с помощью диодной матрицы), TFA (относится к 2,2,2-трифторуксусной кислоте, или трифторуксусной кислоте), TFF (относится к тангенциальному поточному фильтрованию), ЕЮН (относится к этанолу), MW (относится к молекулярной массе), ВЭЖХ (относится к высокоэффективной жидкостной хроматографии), препаративная ВЭЖХ (относится к препаративной высокоэффективной жидкостной хроматографии), и т.д. (означает и так далее), тритил (означает 1,1',1"-этан-1,1,1-триилтрибензол), THF (относится к тетрагидрофурану), NHS (относится к 1-гидрокси-2,5-пирролидиндиону), Cbz (относится к карбоксибензилу), экв. (относится к эквиваленту), n-BuLi (относится к н-бутиллитию), ОАс (относится к ацетату), МеОН (относится к метанолу), изо-Pr (относится к изопропилу, или пропан-2-илу), NMM (относится к 4-метилморфолину) и «-» (в таблице, означает, что на данный момент времени данные не доступны).

Как используют в данном описании, «Н/С» относится к трастузумабу (товарный знак HERCEPTIN®), который означает моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один из его цистеиновых остатков (с линкером или соединением по изобретению).

Как используют в данном описании, «Н/K» относится к трастузумабу, который означает моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один из его лизиновых остатков (с линкером или соединением по изобретению).

Как используют в данном описании, нумерация аминокислотных остатков (например: аланин в положении 114) основана на EU индексе метода Kabat.

Как используют в данном описании, «H/TG1-(Q)» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один из его природных или сконструированных глутаминовых остатков, который находится в трансглутаминазном пептидном (TG1) субстрате-метке, встроенном в антитело (в линкер или соединение по изобретению).

Как используют в данном описании, «Н-А114С/С114» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один из его сконструированных цистеинов, на который был замещен аланин в положении 114 тяжелой цепи (в линкере или соединении по изобретению).

Как используют в данном описании, «H-K392C+L443C/C392+C443» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один или оба из его сконструированных цистеиновых остатков, на который(е) были замещены лизин в положении 392 тяжелой цепи и лейцин в положении 443 тяжелой цепи (в линкере или соединении по изобретению).

Как используют в данном описании, «H-E388C+N421C/C388+C421» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один или оба из его сконструированных цистеиновых остатков, на который(е) были замещены глутаминовая кислота в положении 388 и аспарагин в положении 421 тяжелой цепи (в линкере или соединении по изобретению).

Как используют в данном описании, «H-Q347C+K392C/C347+C392» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один или оба из его сконструированных цистеиновых остатков, на который(е) были замещены глутамин в положении 347 и лизин в положении 392 тяжелой цепи (в линкере или соединении по изобретению).

Как используют в данном описании, «H-L443C+kK183C/C443+kC183» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один или оба из его сконструированных цистеинов, на который(е) были замещены лейцин в положении 443 тяжелой цепи и лизин в положении 183 легкой (каппа) цепи (в линкере или соединении по изобретению).

Как используют в данном описании, «H-Q347C+L443C/C347+C443» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один или оба из его сконструированных цистеинов, на который(е) были замещены глутамин в положении 347 и лейцин в положении 443 тяжелой цепи (в линкере или соединении по изобретению).

Как используют в данном описании, «Н- RK183C/kC183» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через один из его сконструированных цистеинов, на который был замещен лизин в положении 183 легкой (каппа) цепи (в линкере или соединении по изобретению).

Как используют в данном описании, «H-N421C/C421» относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через его сконструированный цистеин, на который был замещен аспарагин в положении 421 тяжелой цепи (в линкере или соединении по изобретению).

В общем, как используют в данном описании, «Н-(АА1)###(АА2)/(АА2)###» (где (АА1) и (АА2) представляют собой первую и вторую аминокислоты) относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через его сконструированный (АА2), на который был замещен (АА1) в положении ### тяжелой цепи, в соединении по изобретению, где ### представляет собой положение релевантной(ых) аминокислот(ы). Подобное обозначение со ссылкой на «к» или «каппа» будет указывать замещение в легкой цепи.

Подобным образом, как используют в данном описании, «Н-(АА1)###(АА2)+(АА3)####(АА4)/(АА2)###+(АА4)####» (где (АА1), (АА2), (АА3) и (АА4) представляют собой первую, вторую, третью и четвертую аминокислоты) относится к сконструированному трастузумабу, представляющему собой моноклональное антитело, которое блокирует HER2/neu рецептор, связываясь через его сконструированный (АА2), на который был замещен (АА1) в положении ### тяжелой цепи, в соединении по изобретению, где ### представляет собой положение релевантной(ых) аминокислот(ы), и также связывающееся через его сконструированный (АА4), на который был замещен (АА3) в положении #### тяжелой цепи, в соединении по изобретению, где #### представляет собой положение релевантной(ых) аминокислот(ы). Подобное обозначение со ссылкой на «к» или «каппа» будет указывать замещение в легкой цепи.

Как используют в данном описании, «-РАВС-» или «РАВС» относится к структуре:

или ее вариантам.

Как используют в данном описании, «-РАВА-» или «РАВА» относится к структуре:

или ее вариантам.

Соединения и его конъюгаты антитело-лекарственное средство

Один из аспектов изобретения относится к соединению или соединениям формулы (I):

где:

пунктирная линия означает возможную связь;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

R1 выбран из группы, состоящей из: -R, -OR, -OCOR13, -OCONR14R15, -OCON(R14)NR(R15), =O (двойная связь с кислородом) и -NR14R15;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют С2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 независимо выбран из водорода, групп -С1-6алкил, -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -(C(R)2)m-NR14R15, -(C(R)2)m-C(O)-SR, -(C(R)2)m-C(O)NR14N(R)R15, -(C(R)2)m-NR-C(O)-NR14R15, -(C(R)2)m-N(R)COR13 и -(C(R)2)m-NR14N(R)R15;

R13 выбран из группы, состоящей из водорода, С1-6алкила, С3-8карбоциклила, С3-8гетероциклила, С1-6алкил-С6-14арила, С1-6алкил-С5-14гетероарила, где R13 возможно замещен группой -NRR или -SO2NRR;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, -NRR, -NRNR2, групп -С3-10карбоциклил, -С1-6-еалкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6CH2CH2C(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -С1-6алкил, С6-14арил, -С1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-C1-6алкил-C(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, -(C(R)2)m-O-NRR и -S-S-С1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -С1-6алкил; и

каждый m независимо равен 0, 1, 2 или 3;

или их фармацевтически приемлемой соли.

Согласно другому аспекту, настоящее изобретение относится к соединению или соединениям формулы (II):

или их фармацевтически приемлемой соли, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р;

Р представляет собой радикал формулы (I):

где:

пунктирная линия означает возможную связь;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если X" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -R, -OR, -OCOR13, -OCONR14R15, -OCON(R14)NR(R15), =O (двойная связь с кислородом) и -NR14R15;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют С2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 представляет собой -(C(R)2)m-C(O)- или -(C(R)2)m-;

L1 выбран из групп: - галоген, -NR2,

, ,

, , и ;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A, где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -С(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -C1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-C1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(ОСН2СН2)1-6-NRC(O)С1-6алкил-, -C1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-С1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6-алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(O)-,

и ,

или L3 отсутствует;

R13 выбран из группы, состоящей из водорода, С1-6алкила, С3-8карбоциклила, С3-8гетероциклила, С1-6алкил-С6-14арила, С1-6алкил-С5-14 гетероарила, где R13 возможно замещен группой -NRR или -SO2NRR;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6CH2CH2C(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-C1-6алкил-C(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-С1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -C1-6алкил; и

каждый m независимо равен 0, 1, 2 или 3.

Согласно другому аспекту, настоящее изобретение относится к соединению или соединениям формулы (II'):

или их фармацевтически приемлемой соли, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р';

Р' представляет собой радикал формулы (I'):

где:

пунктирная линия означает возможную связь;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если Х" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -(C(R)2)m-, -OR", -OCOR13', -OC(O)NRR14', -OCON(R)N(R)- и -NR-;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и С1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют С2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 независимо выбран из водорода, групп -C1-6алкил, -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -(C(R)2)m-NR14R15, -(C(R)2)m-C(O)-SR, -(C(R)2)m-C(O)NR14N(R)R15, -(C(R)2)m-NR-C(O)-NR14R15, -(C(R)2)m-N(R)COR13 и -(C(R)2)m-NR14N(R)R15;

L1 выбран из групп: - галоген, -NR2,

, ,

, , и ;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2C, где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -С(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -C(O)-C1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -C1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-C1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(ОСН2СН2)1-6-NRC(O)С1-6алкил-, -C1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-С1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из AA0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6-алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(O)-,

, и ,

или L3 отсутствует;

R13 выбран из группы, состоящей из связи, групп -C1-6алкилен-, -С3-8карбоциклил-, -С3-8гетероциклил-, -С1-6алкил-С6-14арил-, -С1-6алкил-С5-14 гетероарил-;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6CH2CH2C(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-С1-6алкил-NRR;

каждый R14' независимо выбран из группы, состоящей из: связи, -NR-, групп -С3-10карбоциклил-, -С3-10гетероциклил-, -(CH2CH2O)1-6CH2CH2C(O)OR', -(CH2CH2O)1-6CH2CH2NR- и -C1-6алкилен-,

где R14' возможно замещен группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -NRR или -SO2NRR, (5) -SO2R, (6) -S-S-C1-6алкил-C(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-С1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -С1-6алкил; и

каждый R' независимо выбран из -Н, С18алкила, C18гетероалкила и арила;

каждый R" независимо выбран из группы, состоящей из: связи и группы -C1-6алкилен-; и

каждый m независимо равен 0, 1, 2 или 3.

Согласно еще одному аспекту, настоящее изобретение относится к соединению или соединениям формулы (III):

или их фармацевтически приемлемой соли, где:

L представляет собой линкерную группировку L1-L-L, где L3 связан с Р;

Р представляет собой радикал формулы (I):

где:

пунктирная линия означает возможную связь;

АВ представляет собой антитело;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если Х" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -R, -OR, -OCOR13, -OCONR14R15, -OCON(R14)NR(R15), =O (двойная связь с кислородом) и -NR14R15;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют С2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 представляет собой -(C(R)2)m-C(O)- или -(C(R)2)m-;

L1 выбран из: связи с АВ, -NR-(связь с АВ) и

;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -С(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -C1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-C1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил- (ОСН2СН2)1-6-NRC(O)С1-6алкил-, -C1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-С1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L20 включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L20 отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(O)-,

, и ,

или L3 отсутствует;

R13 выбран из группы, состоящей из водорода, С1-6алкила, С3-8карбоциклила, С3-8гетероциклила, С1-6алкил-С6-14арила, С1-6алкил-С5-14гетероарила, где R13 возможно замещен группой -NRR или -SO2NRR;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6СН2СН2С(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-C1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -С1-6алкил;

и равен 1-20; и

каждый m независимо равен 0, 1, 2 или 3.

Согласно еще одному аспекту, настоящее изобретение относится к соединению или соединениям формулы (III'):

или их фармацевтически приемлемой соли, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р';

Р' представляет собой радикал формулы (I'):

где:

пунктирная линия означает возможную связь;

АВ представляет собой антитело;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если Х" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -(C(R)2)m-C(O)-, -(C(R)2)m-, -OR", -OCOR13', -OCONRR14', -OCON(R14)N(R15)- и -NR14-;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют С2-6алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, С1-6алкил или -OR;

R9 независимо выбран из водорода, групп -C1-6алкил, -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -(C(R)2)m-NR14R15, -(C(R)2)m-C(O)-SR, -(C(R)2)m-C(O)NR14N(R)R15, -(C(R)2)m-NR-C(O)-NR14R15, -(C(R)2)m-N(R)COR13 и -(C(R)2)m-NR14N(R)R15;

L1 выбран из: связи с АВ, -NR-(связь с АВ) и

;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A, где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -С(O)NPC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -C1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-C1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(ОСН2СН2)1-6-NRC(O)С1-6алкил-, -C1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-C1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2; -NR-С1-6алкил-фенил-С(O)-,

, и ,

или L3 отсутствует;

R13' выбран из группы, состоящей из связи, групп -С1-6алкилен-, -С3-8карбоциклил-, -С3-8гетероциклил-, -С1-6алкил-С6-14арил-, -С1-6алкил-С5-14гетероарил-;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -C1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6СН2СН2С(O)ОR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-8-С1-6алкил-С(O)ОР, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-С1-6алкил-NRR;

каждый R14' независимо выбран из группы, состоящей из: связи, -NR-, групп -С3-10карбоциклил-, -С3-10гетероциклил-, -(CH2CH2O)1-6CH2CH2C(O)OR', -(CH2CH2O)1-6CH2CH2NR- и -C1-6алкилен-,

где R14' возможно замещен группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -NRR или -SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-С1-6алкил-NRR;

каждый R независимо выбран из группы, состоящей из: водорода и группы -C1-6алкил;

каждый R' независимо выбран из -Н, C1-С8алкила, С18гетероалкила и арила;

каждый R" независимо выбран из группы, состоящей из: связи и группы -C1-6алкилен-;

b равен 1-20;и

каждый m независимо равен 0, 1, 2 или 3.

Следует отметить, что двухвалентные переменные, перечисленные выше, предназначены для обозначения, где подходит, расположения таких радикалов в различных ориентациях в пределах молекулы. Так, например, для ссылки, но лишь в качестве примера, L2 группировка «-PABC-Cit-Val-C(O)-C1-6алкил-» между L1 и L3 может быть расположена как L1-PABC-Cit-Val-C(O)-C1-6алкил-L3 или как L1-C1-6алкил-C(O)-Val-Cit-PABC-L3. Подобным образом, L2 определен здесь как представляющий собой L2A-L2B-L2C, причем конструкция может аналогичным образом быть расположена в различных ориентациях.

Так, в некоторых воплощениях предложено ADC формулы III или III' со следующей последовательностью компонентов:

AB-L1-L2-L3-P;

AB-L1-L2-L3-P';

AB-L1-L2A-L2B-L2C-L3-P; или

AB-L1-L2C-L2B-L2A-L3-P.

Некоторые описанные здесь химические группы и группировки предпочтительны в зависимости от условий. Так, в некоторых воплощениях по изобретению, в том числе касающихся различных полезных нагрузок, конструкций линкер-полезная нагрузка и ADC, описанных и заявленных здесь, можно применить одно или более (или все, или ни одно) из следующего:

В некоторых воплощениях по изобретению X1 предпочтительно представляет собой -O-.

В некоторых воплощениях по изобретению X2 предпочтительно представляет собой -NR-.

В некоторых воплощениях по изобретению R1 предпочтительно выбран из группы, состоящей из: -OR, -OCOR13, -OCONR14R15 и -NR14R15.

В некоторых воплощениях по изобретению R2 предпочтительно представляет собой C1-6алкил, и более предпочтительно представляет собой метил.

В некоторых воплощениях по изобретению R3 предпочтительно представляет собой С1-6алкил, и более предпочтительно представляет собой метил.

В некоторых воплощениях по изобретению R4 предпочтительно представляет собой водород или -OR.

В некоторых воплощениях по изобретению R5 предпочтительно представляет собой водород или -OR.

В некоторых воплощениях по изобретению предпочтительно, когда каждый из R6 и R7 независимо выбран из группы, состоящей из: гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из галогена, или R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R.

В некоторых воплощениях по изобретению R8 предпочтительно представляет собой водород или -OR.

В некоторых воплощениях по изобретению R9 независимо выбран из: -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -((R)2)m-NR14R15, -C(R)2)m-C(O)NR14N(R)R15, -(C(R)2)m-NR-C(O)-NR14R15 и -(C(R)2)m-N(R)COR13.

В некоторых воплощениях по изобретению R13 предпочтительно выбран из группы, состоящей из водорода и C1-6алкила.

В некоторых воплощениях по изобретению предпочтительно, когда каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, -NRR, -NRNR2, групп -С3-10карбоциклил, -С3-10гетерециклил, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил; или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо; где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, -(C(R)2)m-O-NRR и -S-S-C1-6алкил-NRR.

В некоторых воплощениях по изобретению предпочтительно, когда m равен 0. В некоторых воплощениях по изобретению предпочтительно, когда m равен 1. В некоторых воплощениях по изобретению предпочтительно, когда m равен 2. В некоторых воплощениях по изобретению предпочтительно, когда m равен 3.

В некоторых воплощениях по изобретению предпочтительно, когда X2 представляет собой -NH-, X1 представляет собой -O-, R1 представляет собой -OCOR13, ОН или -OCONR14R15, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 вместе образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, R13 представляет собой С1-6алкил (более предпочтительно метил), R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо, L1 представляет собой

или ,

и L2A, L2B, L2C и L3 все отсутствуют.

Альтернативно, R6 представляет собой -ОН, и R7 представляет собой C1-6алкил, возможно замещенный 1-3 заместителями, независимо выбранными из галогена, причем хлор является более предпочтительным.

В некоторых воплощениях по изобретению предпочтительно, когда X2 представляет собой -NH-, X1 представляет собой -O-, R1 представляет собой -OCOR13, ОН или -OCONR14R15, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 вместе образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, R13 представляет собой С1-6алкил (более предпочтительно метил), R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо, L1 представляет собой галоген, L3 представляет собой -NR-C1-6алкил-NR, где R более предпочтительно представляет собой водород, и алкильная группа более предпочтительно представляет собой этил, L2A представляет собой -C(O)-C1-6алкил-, и L2A и L2B отсутствуют.

В некоторых воплощениях по изобретению предпочтительно, когда X2 представляет собой -NH-, X1 представляет собой -O-, R1 представляет собой -OCOR13, где R13 более предпочтительно представляет собой водород, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 вместе образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, R13 представляет собой C1-6алкил (более предпочтительно метил), R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо, L1 представляет собой галоген, L3 представляет собой -NR-C1-6алкил-NR, где R более предпочтительно представляет собой водород, и алкильная группа более предпочтительно представляет собой этил, L2A представляет собой -С(O)-С1-6алкил-, и L2B и L2C отсутствуют.

В некоторых воплощениях по изобретению предпочтительно, когда R1 представляет собой -OCOR13 или -OR, где R более предпочтительно представляет собой водород, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, L3 представляет собой -NR-NR-, где каждый R более предпочтительно представляет собой водород или метил, или два R заместителя вместе образуют 6-членное кольцо, L1 представляет собой галоген, -NR2 или

,

L2C представляет собой РАВС, L2B представляет собой -Cit-Val-, и L2A представляет собой -С(O)-С1-6алкил-NRC(O)С1-6алкил-.

В некоторых воплощениях по изобретению предпочтительно, когда R1 представляет собой -OCOR13 или -OR, где R более предпочтительно представляет собой водород, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, L3 представляет собой -NR-NR-, где каждый R более предпочтительно представляет собой водород или метил, или два R заместителя вместе образуют 6-членное кольцо, L1 представляет собой галоген, -NR2 или

,

L2C отсутствует, L2B представляет собой -Ala-Val-, и L2A представляет собой -С(O)-С1-6алкил-NRC(O)С1-6алкил- или -C(O)C1-6алкил-.

В некоторых воплощениях по изобретению предпочтительно, когда L1 выбран из групп: -галоген, -NR2, , , и .

В некоторых воплощениях по изобретению предпочтительно, когда R1 представляет собой -OCOR13, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R9 представляет собой -(C(R)2)m-C(O)NR14R15, где R14 и R15 более предпочтительно представляют собой водород, R13' представляет собой связь, L3 представляет собой

,

где m равен 0, X' представляет собой N, X" представляет собой -N-, и X''' отсутствует, L1 представляет собой галоген, L2C представляет собой РАВС, L2B представляет собой -Cit-Val-, и L2A представляет собой -С(O)-С1-6алкил-NRC(O)С1-6алкил-.

В некоторых воплощениях по изобретению предпочтительно, когда X2 представляет собой -NH-, X1 представляет собой -O-, R1 представляет собой -OCOR13, ОН или -OCONR14R15, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 вместе образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, R13 представляет собой C1-6алкил (более предпочтительно метил), R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо, L1 выбран из: связи с АВ, -NR-(связь с АВ) и

,

и L2A, L2B, L2C и L3 все отсутствуют. Альтернативно, R6 представляет собой -ОН, и R7 представляет собой C1-6алкил, возможно замещенный 1-3 заместителями, независимо выбранными из галогена, причем хлор является более предпочтительным.

В некоторых воплощениях по изобретению предпочтительно, когда X2 представляет собой -NH-, X1 представляет собой -O-, R1 представляет собой -OCOR13, ОН или -OCONR14R15, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 вместе образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, R13 представляет собой С1-6алкил (более предпочтительно метил), R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо, L1 выбран из: связи с AB, -NR-(связь с АВ) и

,

L3 представляет собой -NR-C1-6-алкил-NR, где R более предпочтительно представляет собой водород, и алкильная группа более предпочтительно представляет собой этил, L2A представляет собой -С(O)-С1-6алкил-, и L2B и L2C отсутствуют.

В некоторых воплощениях по изобретению предпочтительно, когда X2 представляет собой -NH-, X1 представляет собой -O-, R1 представляет собой -OCOR13, где R13 более предпочтительно представляет собой водород, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 вместе образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, R13 представляет собой С1-6алкил (более предпочтительно метил), R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо, L1 выбран из: связи с АВ, -NR-(связь с АВ) и

,

L3 представляет собой -NR-C1-6алкил-NR, где R более предпочтительно представляет собой водород, и алкильная группа более предпочтительно представляет собой этил, L2A представляет собой -C(O)-C1-6алкил-, и L2B и L2C отсутствуют.

В некоторых воплощениях по изобретению предпочтительно, когда R1 представляет собой -OCOR13 или -OR, где R более предпочтительно представляет собой водород, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 вместе образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, L3 представляет собой -NR-NR-, где R более предпочтительно представляет собой водород или метил, или два R заместителя вместе образуют 6-членное кольцо, L1 выбран из: связи с АВ, -NR- (связь с АВ) и

,

L2C представляет собой РАВС, L2B представляет собой -Cit-Val-, L2A представляет собой -С(O)-С1-6алкил-NRC(O)С1-6алкил-.

В некоторых воплощениях по изобретению предпочтительно, когда R1 представляет собой -OCOR13 или -OR, где R более предпочтительно представляет собой водород, R2 представляет собой метил, R3 представляет собой метил, R4 представляет собой -ОН, R5 представляет собой водород, R8 представляет собой водород, R6 и R7 вместе образуют эпоксид, R9 представляет собой -(C(R)2)m-C(O)-, L3 представляет собой -NR-NR-, где R более предпочтительно представляет собой водород или метил, или два R заместителя вместе образуют 6-членное кольцо, L1 выбран из: связи с АВ, -NR- (связь с АВ) и

,

L2C отсутствует, L2B представляет собой -Ala-Val-, и L2A представляет собой -С(O)-С1-6алкил-NRC(O)С1-6алкил-.

В некоторых воплощениях по изобретению предпочтительно, когда L1 выбран из: связи с АВ, -NR-(связь с АВ) и

.

В некоторых воплощениях по изобретению предпочтительно, когда антитело выбрано из трастузумаба и мутанта трастузумаба (С392 + L443) и мутанта трастузумаба (С392 + С443).

В некоторых воплощениях по изобретению предпочтительно, когда антитело, связанное через Fc-содержащий или Fab-содержащий полипептид, сконструированный вместе с ацильной донорной глутамин-содержащей меткой (например Gln-содержащими пептидными метками или Q-метками) или эндогенным глутамином, сделано реакционноспособным (а именно, способным образовывать ковалентную связь как ацил-донор в присутствии амина и трансглутаминазы) путем полипептидной инженерии (например, посредством делеции, вставки, замены, мутации аминокислоты или любой их комбинации в полипептиде) в присутствии трансглутаминазы.

В некоторых воплощениях настоящее изобретение относится к любому из вышеупомянутых конъюгатов антитело-лекарственное средство и соответствующих определений, где конъюгат антитело-лекарственное средство содержит 2, 3, 4, 5, 6, 7, 8, 9 или 10 соединений по изобретению.

В некоторых воплощениях настоящее изобретение относится к любому из вышеупомянутых конъюгатов антитело-лекарственное средство и соответствующих определений, где конъюгат антитело-лекарственное средство содержит 3 или 4 соединения по изобретению.

Как правило, карбоксил- и/или амино-содержащие соединения по настоящему изобретению проявляют особые и уникальные преимущества по сравнению с не содержащим карбоксил соединениями. Одно из таких преимуществ заключается в улучшенной водорастворимости. Другое преимущество заключается в улучшенной химической стабильности в воде и в биологических жидкостях, таких как сыворотка, кровь, спинномозговая жидкость, а также в лекарственных препаратах. Еще одно преимущество заключается в способности легкого образования солевых форм карбоксилатных соединений путем объединения их с подходящим анионом, таким как хлорид, ацетат и другой противоион. Кроме того, карбоксилатные соединения по настоящему изобретению могут быть легко использованы для получения амидных и сложноэфирных производных с сильной и улучшенной цитотоксичностью против раковых клеточных линий и злокачественных новообразований. Карбоксилат-содержащие соединения также имеют преимущество в их способности связываться с антителами, например, карбоксильная группа может взаимодействовать с подходящим образом модифицированными линкерными молекулами, несущими аминные, спиртовые и другие группы, с получением конструкции полезная нагрузка-линкеры. Карбоксильные соединения также могут быть непосредственно функционализированы с получением активированных карбоксильных производных, которые затем могут быть конъюгированы с антителами без присоединения дополнительных линкеров. Например, карбоксил-содержащие соединения по изобретению могут быть подвергнуты взаимодействию с N-гидроксисукцинимидом с получением активированных карбоксил-NHS сложных эфиров. Карбоксил-NHS сложные эсриры и конструкции полезная нагрузка-линкеры могут таким образом затем взаимодейстовать с антителами с получением конъюгатов антитело-лекарственное средство.

Антительная единица (Аb или АВ)

Как отмечено выше, термин «антитело» («Ab», или «АВ») использован в данном описании в наиболее широком смысле и конкретно охватывает интактные моноклональные антитела, поликлональные антитела, моноспецифические антитела, мультиспецифические антитела (например биспецифические антитела) и фрагменты антител, которые проявляют желаемую биологическую активность. В дополнение, в то время как некоторые описанные здесь аспекты изобретения относятся к конъюгатам антитело-лекарственное средство, дополнительно предусматривается, что антительная часть конъюгата может быть заменена любым объектом, который специфически связывается или реактивно ассоциирует или образует комплексы с рецептором, антигеном или другой чувствительной группировкой, ассоциированной с данной клеточной популяцией-мишенью. Например, вместо содержания антитела, конъюгаты по изобретению могут содержать нацеливающую молекулу, которая связывается с, образует комплекс с или взаимодействует с рецептором, антигеном или другой чувствительной группировкой данной клеточной популяции для терапевтической или иной биологической модификации. Пример таких молекул включает более низкомолекулярные белки, полипептиды или пептиды, лектины, гликопротеины, не пептиды, витамины, молекулы-переносчики биогенных веществ (такие как, без ограничения, трансферрин) или любые другие молекулы или вещества, связывающиеся с клеткой. В некоторых аспектах антитело или другая такая нацеливающая молекула действует для доставки лекарственного средства к конкретной клеточной популяции-мишени, с которой антитело или другая нацеливающая молекула взаимодействует.

В другом аспекте настоящее изобретение относится к конъюгату антитело-лекарственное средство соединения формул III или III', где антитело АВ выбрано из: трастузумаба, мутантов трастузумаба (например, мутантов трастузумаба, раскрытых здесь или в международной патентной заявке РСТ/IB2012/056234), ореговомаба, эдреколомаба, цетуксимаба, гуманизированного моноклонального антитела к рецептору витронектина (αvβ3), алемтузумаба, анти-HLA-DR антител, включая гуманизированное анти-HLA-DR антитело для лечения неходжкинской лимфомы, 131I Lym-1, анти-HLA-Dr10 антител, включая мышиное анти-HLA-Dr10 антитело для лечения неходжкинской лимфомы, анти-cd33 антител, анти-cd22 антител, включая гуманизированное анти-CD22 mAb для лечения лимфомы Ходжкина или неходжкинской лимфомы, лабетузумаба, бевацизумаба, ибритумомаба тиуксетана, офатумумаба, панитумумаба, ритуксимаба, тозитумомаба, ипилимумаба и гемтузумаба.

Гетероатомы, которые могут присутствовать на антительной единице, включают серу (в одном воплощении из сульфгидрильной группы антитела), кислород (в одном воплощении из карбонильной, карбоксильной или гидроксильной группы антитела) и азот (в одном воплощении из первичной или вторичной аминогруппы антитела). Эти гетероатомы могут присутствовать на антителе в естественном состоянии этого антитела, например существующего в природе антитела, или могут быть введены в антитело посредством химической модификации.

В одном воплощении антительная единица имеет сульфгидрильную группу, и антительная единица связывается через атом серы этой сульфгидрильной группы.

В другом воплощении антитело имеет остатки лизина, которые могут взаимодействовать с активированными сложными эфирами (такие сложные эфиры включают, без ограничения, N-гидроксисукцинимидные, пентафторфенильные и пара-нитрофенильные сложные эфиры) и образовывать таким образом амидную связь, состоящую из атома азота антительной единицы и карбонила.

В еще одном воплощении антительная единица имеет один или более остатков лизина, которые могут быть химически модифицированы для включения одной или более сульфгидрильных групп. Реагенты, которые могут быть использованы для модификации лизинов включают, без ограничения, N-сукцинимидил-S-ацетилтиоацетат (SATA) и гидрохлорид 2-иминотиолана (реагент Трота).

В другом воплощении антительная единица может иметь одну или более углеводных групп, которые могут быть химически модифицированы для получения одной или более сульфгидрильных групп.

В еще одном воплощении антительная единица может иметь одну или более углеводных групп, которые могут быть окислены с получением альдегидной группы (см., например, Laguzza, et al., 1989, J. Med. Chem. 32(3): 548-55). Соответствующий альдегид может образовывать связь с реакционноспособным сайтом, таким как, например, гидразин и гидроксиламин. Другие протоколы для модификации белков для присоединения или ассоциирования лекарственных средств описаны в Coligan et al., Current Протокол s in Protein Science, vol. 2, John Wiley & Sons (2002) (включено в данное описание посредством ссылки).

Когда конъюгаты содержат неиммунореактивный белок, полипептидные или пептидные единицы вместо антитела, полезные неиммунореактивные белковые, полипептидные или пептидные единицы включают, без ограничения, трансферрин, эпидермальные факторы роста («EGF»), бомбезин, гастрин, гастрин-высвобождающий пептид, фактор роста тромбоцитов, интерлейкин-2 (IL-2), IL-6, трансформирующие факторы роста («ТОР»), такие как TGF-α и TGF-β, фактор роста вируса осповакцины («VGF»), инсулин и инсулиноподобные факторы роста I и II, соматостатин, пектины и апопротеин липопротеинов низкой плотности.

Полезные поликлональные антитела представляют собой гетерогенные популяции молекул антител, имеющих происхождение из сыворотки иммунизированных животных. Полезные моноклональные антитела представляют собой гомогенные популяции антител против конкретной антигенной детерминанты (например, антигена раковой клетки, вирусного антигена, микробного антигена, белка, пептида, углевода, химического вещества, нуклеиновой кислоты или их фрагментов). Моноклональное антитело (mAb) против представляющего интерес антигена может быть получено путем использования любых методик, известных в данной области техники, которые обеспечивают продуцирование молекул антител стабильными клеточными линиями в культуре.

Полезные моноклональные антитела включают, без ограничения, человеческие моноклональные антитела, гуманизированные моноклональные антитела, фрагменты антител или химерные моноклональные антитела. Человеческие моноклональные антитела могут быть получены любым разнообразием методов, известных в данной области техники (например, Теng et al, 1983, Proc. Natl. Acad. Sci. USA. 80: 7308-7312; Kozbor et al., 1983, Immunology Today 4: 72-79; и Olsson et al., 1982, Meth. Enzymol. 92: 3-16).

Антитело также может представлять собой биспецифическое антитело. Способы получения биспецифических антител известны в данной области техники и обсуждаются ниже.

Антитело может представлять собой функционально активный фрагмент, производное или аналог антитела, которые иммуноспецифически связываются с клетками-мишенями (например, антигенами раковой клетки, вирусными антигенами или микробными антигенами), или другими антителами, которые связываются с опухолевыми клетками или матриксом. В этом отношении, «функционально активные» означает такие фрагмент, производное или аналог, которые способны индуцировать антитела против антиидиотипических антител, которые распознают тот же самый антиген, который распознает антитело, из которого фрагмент, производное или аналог происходят. Более конкретно, в иллюстративном воплощении антигенность идиотипа молекулы иммуноглобулина может быть усилена путем делеции каркасной области и CDR последовательностей, которые являются С-концевыми к CDR последовательности, которая специфически распознает антиген. Чтобы определить какие из CDR последовательностей связываются с антигеном, синтетические пептиды, содержащие CDR последовательности, могут быть использованы в анализах связывания с антигеном посредством любой методики анализа связывания, известной в данной области техники (например, анализ BIAcore) (в отношении определения положения CDR последовательностей, см., например, Kabat et al., 1991, Sequences of Proteins of Immunological Interest, Fifth Edition, National Institute of Health, Bethesda, Md.; Kabat E et al., 1980, J. Immunology 125(3): 961-969).

Другие полезные антитела включают фрагменты антител, такие как, без ограничения, F(ab')2 фрагменты, Fab фрагменты, Fvs, одноцепочечные антитела, диатела, триатела, тетратела, scFv, scFv-FV или любая другая молекула с такой же специфичностью, как антитело.

Дополнительно, рекомбинантные антитела, такие как химерные и гуманизированные моноклональные антитела, содержащие как человеческие участки, так и участки, не являющиеся человеческими, которые могут быть получены с использованием стандартных методик рекомбинантной ДНК, представляют собой полезные антитела. Химерное антитело представляет собой молекулу, в которой различные участки имеют происхождение из различных видов животных, таких как, например, те, которые имеют вариабельную область, имеющую происхождение из константных областей мышиного моноклонального и человеческого иммуноглобулина (см., например, патент США No. 4816567 и патент США No. 4816397, которые включены в данное описание посредством ссылки во всей их полноте). Гуманизированные антитела представляют собой молекулы антител из видов, не являющихся человеческими, имеющие один или более гипервариабельных участков (CDR) из видов, не являющихся человеческими, и каркасную область из молекулы человеческого иммуноглобулина (см., например, патент США No. 5585089, который включен в данное описание посредством ссылки во всей ее полноте). Такие химерные и гуманизированные моноклональные антитела могут быть получены посредством методик рекомбинантной ДНК, известных в данной области техники, например, с использованием способов, описанных в публикации международной заявки WO 87/02671; публикациях европейских заявок No. 0184187, No. 0171496, No. 0173494; публикации международной заявки WO 86/01533; патенте США No. 4816567; публикации европейской заявки No. 012023; Berter et al., 1988, Science 240: 1041-1043; Liu et al., 1987, Proc. Natl. Acad. Sci. USA 84: 3439-3443; Liu et al., 1987, J. Immunol. 139: 3521-3526; Sun et al., 1987, Proc. Natl. Acad. Sci. USA 84: 214-218; Nishimura et al., 1987, Cancer. Res. 47: 999-1005; Wood et al., 1985, Nature 314: 446-449; и Shaw et al., 1988, J. Natl. Cancer Inst. 80: 1553-1559; Morrison, 1985, Science 229: 1202-1207; Oi et al., 1986, BioTechniques 4: 214; U.S. Pat. No. 5,225,539; Jones et al., 1986, Nature 321: 552-525; Verhoeyan et al., 1988, Science 239: 1534; и Beidler et al., 1988, J. Immunol. 141: 4053-4060; каждая из которых включена в данное описание посредством ссылки во всей их полноте.

Полностью человеческие антитела являются особенно желательными и могут быть получены с использованием трансгенных мышей, которые неспособны к экспрессии генов тяжелых и легких цепей эндогенного иммуноглобулина, но которые могут экспрессировать гены тяжелой и легкой цепей человека. Трансгенных мышей иммунизируют обычным способом с помощью выбранного антигена, например, полноразмерным полипептидом по изобретению или его частью. Моноклональные антитела, направленные против антигена, могут быть получены с использованием традиционной гибридомной технологии. Трансгены человеческого иммуноглобулина, переносимые трансгенными мышами, перегруппировываются во время В-клеточной дифференцировки, и затем подвергаются механизму переключения классов и соматической мутации. Так, с использованием этой технологии возможно продуцирование терапевтически полезных IgG, IgA, IgM и IgE антител. Для обзора этой технологии продуцирования человеческих антител см. Lonberg и Huszar, 1995, Int. Rev. Immunol. 13: 65-93. Для подробного обсуждения этой технологии продуцирования человеческих антител и человеческих моноклональных антител и протоколов продуцирования таких антител, см., например, патенты США №№5625126; 5633425; 5569825; 5661016; 5545806; каждый из которых включен в данное описание посредством ссылки во всей их полноте. Другие человеческие антитела могут быть приобретены у, например, Abgenix, Inc. (в настоящее время Amgen, Freemont, Calif.) и Medarex (Princeton, N.J.).

Полностью человеческие антитела, которые распознают выбранный эпитоп, могут быть генерированы с использованием методики, известной как «управляемая селекция». В таком подходе выбранное моноклональное антитело, не являющееся человеческим, например, мышиное антитело, используют для управления селекцией полностью человеческого антитела, распознающего тот же самый эпитоп (см., например, Jespers et al., 1994, Biotechnology 12: 899-903). Человеческие антитела могут также быть получены с использованием различных методик, известных в данной области техники, включая библиотеки фагового дисплея (см., например, Hoogenboom and Winter, 1991, J. Mol. Biol. 227: 381; Marks et al., 1991, J. Mol. Biol. 222: 581; Quan and Carter, 2002, The rise of monoclonal antibodies as therapeutics, In Anti-IgE and Allergic Disease, Jardieu and Fick, eds., Marcel Dekker, New York, N.Y., Chapter 20, pp. 427-469).

В других воплощениях антитело представляет собой слитый белок антитела или его функционально активного фрагмента, например, в котором антитело подвергнуто слиянию через ковалентную связь (например пептидную связь) по N-концу или С-концу с аминокислотной последовательностью другого белка (или его части, предпочтительно включающей по меньшей мере 10, 20 или 50 аминокислот), который не происходит из антитела. Предпочтительно, антитело или его фрагмент ковалентно присоединены к другому белку по N-концу константной области.

Антитела включают аналоги и производные, которые являются либо модифицированными, а именно путем ковалентного присоединения любого типа молекулы, пока такое ковалентное присоединение дает возможность антителу сохранять его антиген-связывающую иммуноспецифичность. В качестве примера, но без какого-либо ограничения, производные и аналоги антител включают те, которые были дополнительно модифицированы, например, путем гликозилирования, ацетилирования, пегилирования, фосфорилирования, амидирования, дериватизации известными защитными/блокирующими группами, протеолитического расщепления, связывания с клеточной антительной единицей или другим белком, и так далее. Любая из многочисленных химических модификаций может быть осуществлена известными методиками, включая, без ограничения, специфическое химическое расщепление, ацетилирование, формилирование, метаболический синтез в присутствии туникамицина, и так далее. Дополнительно, аналог или производное могут содержать одну или более неприродных аминокислот.

Антитела могут иметь модификации (например, замены, делеции или вставки) в аминокислотных остатках, которые взаимодействуют с Fc-рецепторами. В частности, антитела могут иметь модификации в аминокислотных остатках, идентифицированных как вовлеченные во взаимодействие между анти-Fc доменом и FcRn рецептором (см., например, публикацию международной заявки WO 97/34631, которая включена в данное описание посредством ссылки во всей ее полноте).

Антитела, иммуноспецифичные в отношении антигена раковой клетки, могут быть приобретены или получены любым способом, известным специалисту в данной области техники, таким как, например, химический синтез или технологии рекомбинантной экспрессии. Нуклеотидная последовательность, кодирующая антитела, иммуноспецифичные в отношении антигена раковой клетки, может быть получена, например, из базы данных GenBank или подобной ей базы данных, литературных публикаций, или традиционным клонированием и секвенированием.

В конкретном воплощении могут быть использованы известные антитела для лечения рака. Антитела, иммуноспецифичные в отношении антигена раковой клетки, могут быть приобретены или получены любым способом, известным специалисту в данной области техники, таким как, например, технологии рекомбинантной экспрессии. Нуклеотидная последовательность, кодирующая антитела, иммуноспецифичные в отношении антигена раковой клетки, может быть получена, например, из базы данных GenBank или подобной ей базы данных, литературных публикаций, или традиционным клонированием и секвенированием. Примеры антител, доступных для лечения рака, включают, без ограничения, OVAREX®, представляющее собой мышиное антитело для лечения рака шейки матки; PANOREX® (Glaxo Wellcome, NC), представляющее собой мышиное IgG2a антитело для лечения колоректального рака; цетуксимаб ERBITUX® (Imclone Systems Inc., NY), представляющий собой химерное антитело против EGFR IgG для лечения видов рака, положительных к эпидермальному фактору роста, таких как рак головы и шеи; Vitaxin® (MedImmune, Inc., MD), представляющий собой гуманизированное антитело для лечения саркомы; CAMPATH I/H® (Leukosite, MA), представляющее собой гуманизированное IgG1 антитело для лечения хронического миелоидного лейкоза (CLL); SMART ID10 (Protein Design Labs, Inc., CA), который представляет собой гуманизированное антитело против HLA-DR для лечения неходжкинской лимфомы; ONCOLYM® (Techniclone, Inc., CA), представляющее собой меченное радиоактивным изотопом мышиное антитело против HLA-Dr10 для лечения неходжкинской лимфомы; ALLOMUNE® (BioTransplant, CA), представляющий собой гуманизированное анти-CD2 mAb для лечения лимфомы Ходжкина или неходжкинской лимфомы; CEACIDE® (Immunomedics, NJ), представляющий собой гуманизированное антитело против СЕА для лечения колоректального рака.

В попытках обнаружить эффективные клеточные мишени для диагностики и терапии рака, исследователи пытались идентифицировать трансмембранные и другие опухолеассоциированные полипептиды, которые специфически экспрессируются на поверхности одного или более конкретных видов раковых клеток по сравнению с одной или более нормальными нераковыми клетками. Часто такие опухолеассоциированные полипептиды избыточно эскпрессируются на поверхности раковых клеток по сравнению с поверхностью нераковых клеток. Идентификация таких опухолеассоциированных антигенных полипептидов клеточной поверхности повышает способность специфически нацеливаться на раковые клетки для деструкции посредством терапий на основе антител.

Линкерная единица (L)

Линкер (иногда обозначаемый здесь как «[линкер]») представляет собой бифункциональное соединение, которое может быть использовано для связывания лекарственного средства и антитела с образованием конъюгата антитело-лекарственное средство (ADC). Такие конъюгаты являются полезными, например, в образовании иммуноконъюгатов, направленным против опухолеассоциированных антигенов. Такие конъюгаты обеспечивают избирательную доставку цитотоксических лекарственных средств к опухолевым клеткам.

В ADC линкер служит для присоединения полезной нагрузки к антителу.

В одном аспекте включена вторая часть линкерной единицы, которая имеет второй реакционноспособный сайт, например электрофильную группу, которая является реакционноспособной для нуклеофильной группы, присутствующей на антительной единице (например, антителе). Полезные нуклеофильные группы на антителе включают, без ограничения, сульфгидрил, гидроксил и аминогруппы. Гетероатом нуклеофильной группы антитела является реакционноспособным для электрофильной группы на линкерной единице и образует ковалентную связь с линкерной единицей. Полезные электрофильные группы включают, без ограничения, малеимидные и галогенацетамидные группы. Электрофильная группа обеспечивает подходящий сайт для присоединения антитела.

В другом воплощении линкерная единица имеет реакционноспособный сайт, который имеет нуклеофильную группу, которая является реакционноспособной для электрофильной группы, присутствующей на антителе. Полезные электрофильные группы на антителе включают, без ограничения, альдегидные и кетонные карбонильные группы. Гетероатом нуклеофильной группы линкерной единицы может взаимодействовать с электрофильной группой на антителе и образует ковалентную связь с антителом. Полезные нуклеофильные группы на линкерной единице включают, без ограничения, гидразид, оксим, амино, гидразин, тиосемикарбазон, гидразин карбоксилат и арилгидразид. Электрофильная группа на антителе обеспечивает подходящий сайт для присоединения к линкерной единице.

Аминофункциональные группы также являются полезными реакционноспособными сайтами для линкерной единицы, поскольку они могут взаимодействовать с карбоновой кислотой или активированными сложными эфирами соединения с образованием амидной связки. Как правило, пептидные соединения по изобретению могут быть получены путем образования пептидной связи между двумя или более аминокислотами и/или пептидными фрагментами. Такие пептидные связи могут быть получены, например, согласно методике жидкофазного синтеза (см., например, Schroder и Lubke, «The Peptides», vol. 1, pp 76-136, 1965, Academic Press), который хорошо известен в области пептидной химии.

В контексте изобретения, в частности, но без ограничения, в отношении линкерных компонентов, таких как L1, L2 (включая L2A, L2B и L2C) и L3, выражение «выбранный из одного или более из» или «один или более из» указывает на возможность присутствия нескольких компонентов, которые могут быть одинаковыми или разными, или могут следовать друг за другом. Так, например, L3 может представлять собой -С1-6алкил-, -NR- или другой из индивидуально перечисленных компонентов, но также -С1-6алкил-NR-, или любую другую комбинацию 2 или более перечисленных компонентов.

Синтез соединений и их конъюгатов антитело-лекарственное средство

Соединения и конъюгаты по изобретению могут быть получены с использованием методик синтеза, изложенных ниже в разделе Примеры. Как описано более подробно ниже, соединения и конъюгаты по изобретению могут быть получены с использованием части линкерной единицы, имеющей реакционноспособный сайт для связывания с соединением. В одном аспекте вводят вторую часть линкерной единицы, которая имеет второй реакционноспособный сайт, например электрофильную группу, которая является реакционноспособной для нуклеофильной группы, присутствующей на антительной единице (например, антителе). Полезные нуклеофильные группы на антителе включают, без ограничения, сульфгидрил, гидроксил и аминогруппы. Гетероатом нуклеофильной группы антитела является реакционноспособным для электрофильной группы на линкерной единице и образует ковалентную связь с линкерной единицей. Полезные электрофильные группы включают, без ограничения, малеимидные и галогенацетамидные группы. Электрофильная группа обеспечивает подходящий сайт для присоединения антитела.

В другом воплощении линкерная единица имеет реакционноспособный сайт, который имеет нуклеофильную группу, которая является реакционноспособной для электрофильной группы, присутствующей на антителе. Полезные электрофильные группы на антителе включают, без ограничения, альдегидные и кетонные карбонильные группы. Гетероатом нуклеофильной группы линкерной единицы может взаимодействовать с электрофильной группой на антителе и образует ковалентную связь с антителом. Полезные нуклеофильные группы на линкерной единице включают, без ограничения, гидразид, оксим, амино, гидразин, тиосемикарбазон, гидразин карбоксилат и арилгидразид. Электрофильная группа на антителе обеспечивает подходящий сайт для присоединения к линкерной единице.

Аминофункциональные группы также являются полезными реакционноспособными сайтами для линкерной единицы, поскольку они могут взаимодействовать с карбоновой кислотой или активированными сложными эфирами соединения с образованием амидной связки. Как правило, пептидные соединения по изобретению могут быть получены путем образования пептидной связи между двумя или более аминокислотами и/или пептидными фрагментами. Такие пептидные связи могут быть получены, например, согласно методике жидкофазного синтеза (см., например, Schroder и Lubke, «The Peptides», vol. 1, pp 76-136, 1965, Academic Press), который хорошо известен в области пептидной химии.

Как описано более подробно ниже, конъюгаты могут быть получены с использованием части линкера, имеющей реакционноспособный сайт для связывания с соединением по изобретению, и введением другой части линкерной единицы, имеющей реакционноспособный сайт для антитела. В одном аспекте линкерная единица имеет реакционноспособный сайт, который имеет электрофильную группу, которая является реакционноспособной с нуклеофильной группой, присутствующей на антительной единице, такой как антитело. Электрофильная группа обеспечивает подходящий сайт для присоединения антитела. Полезные нуклеофильные группы на антителе включают, без ограничения, сульфгидрильные, гидроксильные и аминогруппы. Гетероатом нуклеофильной группы антитела является реакционноспособным для электрофильной группы на линкерной единице и образует ковалентную связь с линкерной единицей. Полезные электрофильные группы включают, без ограничения, малеимидные и галогенацетамидные группы.

В другом воплощении линкерная единица имеет реакционноспособный сайт, который имеет нуклеофильную группу, которая является реакционноспособной с электрофильной группой, присутствующей на антительной единице. Электрофильная группа на антителе обеспечивает подходящий сайт для присоединения к линкерной единице. Полезные электрофильные группы на антителе включают, без ограничения, альдегидные и кетонные карбонильные группы. Гетероатом нуклеофильной группы линкерной единицы может взаимодействовать с электрофильной группой на антителе и образует ковалентную связь с антителом. Полезные нуклеофильные группы на линкерной единице включают, без ограничения, гидразид, оксим, амино, гидразин, тиосемикарбазон, гидразин карбоксилат и арилгидразид.

Конъюгирование с трансглутаминазой

В некоторых воплощениях соединение по изобретению может быть ковалентно сшито с Fc-содержащим или Fab-содержащим полипептидом, сконструированным с ацил-донорной глутамин-содержащей меткой (например, Gln-содержащими пептидными метками или Q-метками), либо эндогенный глутамин делают реакционноспособным (то есть, способность образовывать ковалентную связь в качестве ацил-донора в присутствии амина и трансглутаминазы) посредством полипептидной инженерии (например, посредством делеции, вставки, замены, мутации аминокислот или любой их комбинации на полипептиде), в присутствии трансглутаминазы, при условии, что соединение по изобретению содержит аминодонорный агент (например, небольшую молекулу, содержащую или присоединенную к реакционноспособному амину), тем самым образуя стабильную и гомогенную популяцию сконструированного Fc-содержащего полипептидного конъюгата, причем аминодонорный агент сайт-специфическим образом конъюгирован с Fc-содержащим или Fab-содержащим полипептидом через ацил-донорную глутамин-содержащую метку или экспонированный/доступный/реакционноспособный эндогенный глутамин. Например, соединения по изобретению могут быть конъюгированы как описано в публикации международной заявки No. PCT/IB 2011/054899, содержание которой полностью включено в данное описание посредством ссылки. В некоторых воплощениях для облегчения конъюгирования соединения по изобретению с Fc-содержащим или Fab-содержащим полипептидом, сконструированным с ацил-донорной глутамин-содержащей меткой или эндогенным глутамином, сделанным реакционноспособным посредством полипептидной инженерии в присутствии трансглутаминазы, Z представляет собой NH2.

Конъюгирование с константной областью каппа домена легкой цепи человека

В некоторых воплощениях соединение по изобретению может быть ковалентно присоединено к боковой цепи K188 константной области каппа домена легкой цепи человека (CLк) (нумерация полноразмерной легкой цепи согласно Kabat. Например, соединения по изобретению могут быть конъюгированы как описано в заявке на патент США №13/180204, полное содержание которой включено в данное описание посредством ссылки. В некоторых воплощениях, для облегчения конъюгирования с K188 CLк (CLк-K80), Z представляет собой

;

R7 независимо выбран в каждом случае из группы, состоящей из F, Cl, I, Br, NO2, CN и CF3; и h равен 1, 2, 3, 4 или 5.

В некоторых воплощениях изобретения предложена композиция, содержащая соединение по изобретению, ковалентно конъюгированное с антителом (или его антиген-связывающим участком), где по меньшей мере примерно 50%, или по меньшей мере примерно 60%, или по меньшей мере примерно 70%, или по меньшей мере примерно 80%, или по меньшей мере примерно 90% соединения по изобретению в композиции конъюгировано с антителом или его антиген-связывающим участком по K188 CLк.

В некоторых воплощениях соединения по изобретению могут быть конъюгированы с объединенным сайтом каталитического антитела, такого как альдолазные антитела, или его антиген-связывающего участка. Альдолазные антитела содержат участки объединенного сайта, которые, будучи незагруженными (например, конъюгацией), катализируют реакцию альдольного присоединения между алифатическим кетонным донором и альдегидным акцептором. Содержание публикации заявки на патент США No. US 2006/205670 включено в данное описание посредством ссылки, в частности стр. 78-118, описывающие линкеры, и абзацы [0153]-[0233], описывающие антитела, их полезные фрагменты, варианты и модификации, h38C2, объединенные сайты и гипервариабельные участки (CDR), и связанная с ними технология антител. Термин «объединенный сайт» включает CDR и соседние каркасные остатки, которые вовлечены в связывание антигена.

Композиции и способы введения

В других воплощениях еще один аспект изобретения относится к фармацевтической композиции, включающей эффективное количество соединения по изобретению и/или его конъюгата антитело-лекарственное средство и фармацевтически приемлемый носитель или наполнитель. В некоторых воплощениях композиции подходят для ветеринарного введения или введения человеку.

Фармацевтические композиции по настоящему изобретению могут быть представлены в любой форме, которая обеспечивает введение композиции пациенту. Например, композиция может быть представлена в форме твердого вещества или жидкости. Типичные пути введения включают, без ограничения, парентеральное, глазное и внутриопухолевое введение. Парентеральное введение включает подкожные инъекции, внутривенную, внутримышечную или внутригрудную инъекцию или инфузионные техники. В одном аспекте композиции вводят парентерально. В конкретном воплощении композиции вводят внутривенно.

Фармацевтические композиции могут быть изготовлены таким образом, чтобы обеспечить соединению по изобретению и/или его конъюгату антитело-лекарственное средство биодоступность после введения композиции пациенту. Композиции могут принимать форму одной или более стандартных лекарственных форм, где, например, таблетка может представлять собой одноразовую стандартную форму, а контейнер соединения по изобретению и/или его конъюгата антитело-лекарственное средство в жидкой форме может содержать множество единиц дозировки.

Материалы, используемые в изготовлении фармацевтических композиций, могут быть нетоксичными в используемых количествах. Специалистам в данной области техники очевидно, что оптимальная дозировка активного(ых) ингредиента(ов) в фармацевтической композиции зависит от ряда факторов. Релевантные факторы включают, без ограничения, вид животного (например, человек), конкретную форму соединения по изобретению и/или его конъюгата антитело-лекарственное средство, путь введения и используемую композицию.

Фармацевтически приемлемый носитель или наполнитель может представлять собой твердое вещество или частицы, так что композиции находятся, например, в таблетированной или порошкообразной форме. Носитель(и) может(гут) представлять собой жидкость. В дополнение, носитель(и) может(гут) представлять собой частицы.

Композиция может быть представлена в форме жидкости, например, раствора, эмульсии или суспензии. В композиции для введения путем инъекции могут также быть включены один или более поверхностно-активных агентов, консервантов, увлажняющих агентов, диспергирующих агентов, суспендирующих агентов, буферов, стабилизаторов и изотонических агентов.

Жидкие композиции, независимо от того представляют ли они растворы, суспензии или другую подобную форму, могут также включать одно или более из следующего: стерильные разбавители, такие как вода для инъекций, солевой раствор, предпочтительно физиологический солевой раствор, раствор Рингера, изотонический хлорид натрия, жирные масла, такие как синтетические моно- или диглицериды, которые могут служить в качестве растворителя или суспендирующей среды, полиэтиленгликоли, глицерин, циклодекстрин, пропиленгликоль или другие растворители; антибактериальные агенты, такие как бензиловый спирт или метилпарабен; антиоксиданты, такие как аскорбиновая кислота или бисульфит натрия; хелатообразующие агенты, такие как этилендиаминтетрауксусная кислота; буферы, такие как ацетаты, цитраты, фосфаты или аминокислоты и агенты для регулирования тоничности, такие как хлорид натрия или декстроза. Парентеральная композиция может быть заключена в ампулу, одноразовый шприц или многодозовый флакон, изготовленный из стекла, пластика или другого материала. Физиологический солевой раствор является примером адъюванта. Инъецируемая композиция предпочтительно является стерильной.

Количество соединения по изобретению и/или его конъюгата антитело-лекарственное средство, которое является эффективным в лечении конкретного расстройства или состояния, зависит от природы расстройства или состояния, и может быть определено путем стандартных клинических методик. В дополнение, in vitro или in vivo анализы возможно могут быть использованы, чтобы помочь идентифицировать оптимальные диапазоны дозировок. Точная доза, предназначенная для использования в композиции, зависит от пути введения и тяжести заболевания или расстройства, и будет решаться в соответствии с мнением лечащего врача и особенностями каждого пациента.

Композиции содержат эффективное количество соединения по изобретению и/или его конъюгата антитело-лекарственное средство, так чтобы получить подходящую дозировку. Как правило, такое количество составляет по меньшей мере примерно 0,01% соединения по изобретению и/или его конъюгата антитело-лекарственное средство по массе композиции. В иллюстративном воплощении фармацевтическую композицию изготавливают таким образом, чтобы единица парентеральной дозировки содержала от примерно 0,01% до примерно 2% по массе количества соединения по изобретению и/или его конъюгата антитело-лекарственное средство.

Для внутривенного введения композиция может содержать от примерно 0,01 до примерно 100 мг соединения по изобретению и/или его конъюгата антитело-лекарственное средство на кг массы тела пациента. В одном аспекте композиция может включать от примерно 1 до примерно 100 мг соединения по изобретению и/или его конъюгата антитело-лекарственное средство на кг массы тела пациента. В другом аспекте вводимое количество соединения по изобретению и/или его конъюгата антитело-лекарственное средство находится в диапазоне от примерно 0,1 до примерно 25 мг/кг массы тела.

В общем, дозировка соединения по изобретению и/или его конъюгата антитело-лекарственное средство, вводимого пациенту, как правило составляет от примерно 0,01 мг/кг до примерно 20 мг/кг массы тела пациента. В одном аспекте дозировка, вводимая пациенту, составляет от примерно 0,01 мг/кг до примерно 10 мг/кг массы тела пациента. В другом аспекте дозировка, вводимая пациенту, составляет от примерно 0,1 мг/кг до примерно 10 мг/кг массы тела пациента. В еще одном аспекте дозировка, вводимая пациенту, составляет от примерно 0,1 мг/кг до примерно 5 мг/кг массы тела пациента. В еще одном аспекте вводимая дозировка составляет от примерно 0,1 мг/кг до примерно 3 мг/кг массы тела пациента. В еще одном аспекте вводимая дозировка составляет от примерно 1 мг/кг до примерно 3 мг/кг массы тела пациента.

Соединение по изобретению и/или его конъюгат антитело-лекарственное средство могут быть введены любым общепринятым путем, например путем инфузии или болюсной инъекции. Введение может быть системным или местным. Известны различные системы доставки, например, инкапсулирование в липосомы, микрочастицы, микрокапсулы, капсулы и так далее, и они могут быть использованы для введения соединения по изобретению и/или его конъюгата антитело-лекарственное средство. В некоторых воплощениях более одного соединения по изобретению и/или его конъюгата антитело-лекарственное средство вводят пациенту.

В конкретных воплощениях может быть желательно вводить одно или более соединений по изобретению и/или их конъюгатов антитело-лекарственное средство локально в область, нуждающуюся в лечении. Этого можно достичь, в качестве примера и без ограничения, путем локальной инфузии во время хирургического вмешательства; местного нанесения, например, вместе с раневой повязкой после хирургического вмешательства; путем инъекции; посредством катетера; или с помощью имплантата, представляющего собой пористый, непористый или желатинообразный материал, включая мембраны, такие как силиконовые мембраны, или волокна. В одном воплощении введение может быть осуществлено путем прямой инъекции в место (или бывшее место), пораженное раком, опухолью или неопластической или пренеопластической тканью. В другом воплощении введение может быть осуществлено путем прямой инъекции в место (или бывшее место) проявления аутоиммунного заболевания.

В еще одном воплощении соединение по изобретению и/или его конъюгат антитело-лекарственное средство могут быть доставлены в системе контролируемого высвобождения, такой как, без ограничения, помпа, или могут быть использованы различные полимерные материалы. В еще одном воплощении система контролируемого высвобождения может быть помещена вблизи мишени соединения по изобретению и/или его конъюгата антитело-лекарственное средство, например, печени, тем самым требуя только фракцию системной дозы (см., например, Goodson, в Medical Applications of Controlled Release, выше, vol. 2, pp. 115-138 (1984)). Могут быть использованы другие системы контролируемого высвобождения, обсуждаемые в обзоре Langer (Science 249: 1527-1533 (1990)).

Термин «носитель» относится к разбавителю, адъюванту или эксципиенту, с которым вводят соединение или его конъюгат антитело-лекарственное средство. Такие фармацевтические носители могут представлять собой жидкости, такие как вода и масла, в том числе из жидких углеводородов, животного, растительного или синтетического происхождения. Носители могут представлять собой солевой раствор и тому подобное. В дополнение, могут быть использованы вспомогательные, стабилизирующие и другие агенты. В одном воплощении, при введении пациенту, соединение или конъюгат и фармацевтически приемлемые носители являются стерильными. Вода является иллюстративным носителем, когда соединение или конъюгат вводят внутривенно. Солевые растворы и водные растворы декстрозы и глицерина также могут быть использованы в качестве жидких носителей, в частности для инъецируемых растворов. Композиции по настоящему изобретению при желании могут также содержать небольшие количества увлажняющих или эмульгирующих агентов, или забуферивающих рН агентов.

Композиции по настоящему изобретению могут принимать форму растворов, гранул, порошков, препаратов непрерывного высвобождения или любую другую форму, подходящую для применения. Другие примеры подходящих фармацевтических носителей описаны в Е.W. Martin «Remington's Pharmaceutical Sciences».

В одном из воплощений соединение по изобретению и/или его конъюгат антитело-лекарственное средство изготавливают в соответствии с общепринятыми методиками в виде фармацевтической композиции, изготовленной с возможностью внутривенного введения животным, в частности людям. Как правило, носители или наполнители для внутривенного введения представляют собой стерильные изотонические водные буферные растворы. При необходимости композиции также могут включать солюбилизирующий агент. Композиции для внутривенного введения возможно могут содержать местный анестетик, такой как лигнокаин, для облегчения боли в месте инъекции. В общем, ингредиенты поставляют раздельно или в смеси в стандартной лекарственной форме, например, в виде сухого лиофилизированного порошка или обезвоженного концентрата, в герметично закрытом контейнере, таком как ампула, или саше, с указанием количества активного агента. Когда соединение по изобретению и/или его конъюгат антитело-лекарственное средство предназначены для введения посредством инфузии, они могут быть помещены, например, во флакон для инфузии, содержащий стерильную воду фармацевтической степени чистоты или солевой раствор. Когда соединение по изобретению и/или его конъюгат антитело-лекарственное средство вводят путем инъекции, может быть предложена ампула стерильной воды для инъекции или солевого раствора, так чтобы ингредиенты можно было смешать перед введением.

Композиция может включать разные материалы, которые модифицируют физическую форму твердого вещества или жидкую лекарственную форму. Например, композиция может включать материалы, которые образуют покрывающую оболочку, окружающую активные ингредиенты. Материалы, которые образуют покрывающую оболочку, как правило являются инертными и могут быть выбраны из, например, сахара, шеллака и других энетросолюбильных покрывающих агентов. Альтернативно, активные ингредиенты могут быть инкапсулированы в желатиновую капсулу.

Независимо от того является ли форма композиции по настоящему изобретению твердой или жидкой, она может включать фармакологический агент, используемый в лечении рака.

Терапевтические применения соединений и их конъюгатов антитело-лекарственное средство

Другой аспект изобретения относится к способу использования соединений по изобретению и их конъюгатов антитело-лекарственное средство для лечения рака.

Соединения по изобретению и/или их конъюгаты антитело-лекарственное средство полезны для ингибирования размножения опухолевой клетки или раковой клетки, индуцирования апоптоза в опухолевой или раковой клетке или во время лечения рака у пациента. Соединения по изобретению и/или их конъюгаты антитело-лекарственное средство могут быть использованы соответственно во множестве показаний для лечения видов рака у животного. Указанные конъюгаты могут быть использованы для доставки соединения по изобретению к опухолевой клетке или раковой клетке. Не привязываясь к какой-либо теории, в одном воплощении антитело конъюгата связывается или ассоциирует с антигеном, ассоциированным с раковой клеткой или опухолевой клеткой, и конъюгат может быть перенесен (интернализован) внутрь опухолевой клетки или раковой клетки через рецептор-опосредованный эндоцитоз или другой механизм интернализации. Антиген может быть присоединен к опухолевой клетке или раковой клетке или может быть белком внеклеточного матрикса, ассоциированным с опухолевой клеткой или раковой клеткой. В некоторых воплощениях, оказавшись в клетке, одна или более специфических пептидных последовательностей подвергаются ферментативному или гидролитическому расщеплению одной или более протеазами, ассоциированными с опухолевой клеткой или раковой клеткой, приводя к высвобождению соединения по изобретению из конъюгата. Высвобожденное соединение по изобретению затем свободно мигрирует внутри клетки и индуцирует цитотоксические или цитостатические действия. Конъюгат также может расщепляться внутриклеточной протеазой с высвобождением соединения по изобретению. В альтернативном воплощении соединение по изобретению отщепляется от конъюгата снаружи опухолевой клетки или раковой клетки, и соединение по изобретению затем проникает в клетку.

В некоторых воплощениях конъюгаты обеспечивают конъюгат-специфичное нацеливание противоопухолевого или противоракового лекарственного средства, тем самым снижая общую токсичность соединений по изобретению.

В другом воплощении антительная единица связывается с опухолевой клеткой или раковой клеткой.

В еще одном воплощении антительная единица связывается с антигеном опухолевой клетки или раковой клетки, который находится на поверхности опухолевой клетки или раковой клетки.

В еще одном воплощении антительная единица связывается с антигеном опухолевой клетки или раковой клетки, который представляет собой белок внеклеточного матрикса, ассоциированный с опухолевой клеткой или раковой клеткой.

Специфичность антительной единицы в отношении конкретной опухолевой клетки или раковой клетки может быть важна для определения тех опухолей или видов рака, которые лечатся наиболее эффективно.

Конкретные типы рака, которые можно лечить соединением по изобретению и/или его конъюгатом антитело-лекарственное средство, включают, без ограничения, карциномы мочевого пузыря, молочной железы, шейки матки, толстой кишки, эндометрия, почек, легких, пищевода, яичников, предстательной железы, поджелудочной железы, кожи, желудка и яичек, а также злокачественные новообразования крови, включая, без ограничения, лейкозы и лимфомы.

Комплексная терапия рака. Виды рака, включая, без ограничения, опухоль, метастазы, или другое заболевание или расстройство, характеризующееся неконтролируемым клеточным ростом, можно лечить или подавлять путем введения соединения по изобретению и/или его конъюгата антитело-лекарственное средство.

В других воплощениях предложены способы лечения рака, включающие введение пациенту, нуждающемуся в этом, эффективного количества соединения по изобретению и/или его конъюгата антитело-лекарственное средство и химиотерапевтического агента. В одном воплощении химиотерапевтический агент является таким, с которым лечение рака, как обнаружено, не являлось не поддающимся терапии. В другом воплощении химиотерапевтический агент является таким, с которым лечение рака, как обнаружено, не поддавалось терапии. Соединение по изобретению и/или его конъюгат антитело-лекарственное средство может быть введено пациенту, который уже подвергался хирургическому вмешательству в качестве лечения рака.

В некоторых воплощениях пациент также получает дополнительное лечение, такое как лучевая терапия. В конкретном воплощении соединение по изобретению и/или его конъюгат антитело-лекарственное средство вводят одновременно с химиотерапевтическим агентом или с лучевой терапией. В другом конкретном воплощении химиотерапевтический агент вводят или лучевую терапию проводят до или после введения соединения по изобретению и/или его конъюгата антитело-лекарственное средство.

Химиотерапевтический агент может быть введен на протяжении ряда сеансов. Любой один или комбинация химиотерапевтических агентов, например как стандартное лечение химиотерапевтическим(и) агентом(ами), могут быть введены.

Дополнительно предложены способы лечения рака соединением по изобретению и/или его конъюгатом антитело-лекарственное средство в качестве альтернативы химиотерапии или лучевой терапии, когда химиотерапия или лучевая терапия проявляют или могут проявлять слишком сильную токсичность, например, приводят к неприемлемым или непереносимым побочным эффектам, для субъекта, подвергаемого лечению. Пациент, которого лечат, может, возможно, быть подвергнут дополнительному лечению рака, такому как хирургическое вмешательство, лучевая терапия или химиотерапия, в зависимости от того, какое лечение находят приемлемым или переносимым.

Соединения по изобретению и/или его конъюгаты антитело-лекарственное средство могут также быть использованы в in vitro или ex vivo способе, таком как для лечения некоторых видов рака, включая, без ограничения, лейкозы и лимфомы, причем лечение включает аутологические трансплантаты стволовых клеток. Такое лечение может включать многостадийный процесс, при котором аутологические гематопоэтические стволовые клетки животного собирают и очищают от всех раковых клеток, причем остающуюся популяцию клеток костного мозга животного затем устраняют посредством введения высокой дозы соединения по изобретению и/или его конъюгата антитело-лекарственное средство при одновременной высокодозовой лучевой терапии или без нее и трансплантат стволовых клеток внедряют обратно в организм животного. Затем проводят поддерживающую терапию, в то время как функция костного мозга восстанавливается, и пациент выздоравливает.

Изобретение далее описано в следующих примерах, которые не предназначены ограничивать объем изобретения.

Высвобождаемые виды соединений

Дополнительные воплощения по изобретению включают высвобождаемые химические виды соединений, внутри или вблизи раковой клетки или опухолевой клетки, как полагают, посредством ферментативного и/или гидролитического расщепления одной или более протеазой, ассоциированной с раковой клеткой или опухолевой клеткой. Такие соединения включают описанные здесь виды, а также соединения, такие как описано следующей структурой:

Соединение или соединения формулы (II):

или его фармацевтически приемлемая соль, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р;

Р представляет собой радикал формулы (I):

где:

пунктирная линия означает возможную связь;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если X" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -R, -OR, -OCOR13, -OCONR14R15, -OCON(R14)NR(R15), =O (двойная связь с кислородом) и -NR14R15;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют С2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 представляет собой -(С(R)2)m-С(O)- или -(C(R)2)m-;

L1 выбран из групп: -кислота, -NR-кислота и

;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A, где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -C(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -C1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-С1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(OCH2CH2)1-6-NRC(O)C1-6алкил-, -С1-6алкил-, -S-, -С(O)-С1-6алкил-фенил-NR-, -O-С1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(O)-,

,

и ,

или L3 отсутствует;

R13 выбран из группы, состоящей из водорода, C1-6алкила, С3-8карбоциклила, С3-8гетероциклила, С1-6алкил-С6-14арила, С1-6алкил-С5-14гетероарила, где R13 возможно замещен группой -NRR или -SO2NRR;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -С1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(СН2СН2О)1-6СН2СН2С(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -С1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-С1-6алкил-С(O)ОR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-C1-6алкил-NRR;

кислота представляет собой аминокислотный остаток, выбранный из -SCH2CH(COOH)(NH2), -NH(CH2)4CH(COOH)(NH2) и -C(O)(CH2)2CH(COOH)(NH2);

каждый R независимо выбран из группы, состоящей из: водорода и группы -C1-6алкил; и

каждый m независимо равен 0, 1, 2 или 3.

Дополнительно, соединение или соединения формулы (II'):

или их фармацевтически приемлемая соль, где:

L представляет собой линкерную группировку L1-L2-L3, где L3 связан с Р';

Р' представляет собой радикал формулы (I'):

где:

пунктирная линия означает возможную связь;

каждый X1 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X2 независимо выбран из группы, состоящей из: -O-, -S- и -NR-;

каждый X' представляет собой CR или N;

каждый X" представляет собой СН-, CR-(C(R)2)m-NR-, CR-(C(R)2)m-O-; CR-(C(R)2)m-C(O)NR-, CR-(C(R)2)m-C(O)NR-NR-, CR-(C(R)2)m-SO2NR-, CR-(C(R)2)m-NR-NR-, CR-(C(R)2)m-NR-C(O)- или N-, если Х" связан с L2 или дополнительным L3, или иначе представляет собой О, S, CRR, CR-(C(R)2)m-NRR или NRR;

каждый X''' представляет собой -(C(R)2)m-NR- или CR-(C(R)2)m-O-, если X''' связан с L2, или иначе представляет собой R;

Y представляет собой -C(R)2-, -O-, -NR- или -S-;

R1 выбран из группы, состоящей из: -(C(R)2)m-, -OR", -OCOR13', -OC(O)NRR14', -OCON(R)N(R)- и -NR-;

R2 и R3 независимо выбраны из группы, состоящей из: водорода и C1-6алкила;

R4 и R5 независимо выбраны из группы, состоящей из: водорода, -OR, -NR14R15 и оксо;

R6 и R7 независимо выбраны из группы, состоящей из: водорода, галогена, гидроксила и C1-6алкила, возможно замещенного 1-3 заместителями, независимо выбранными из гидроксила и галогена,

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют С2-5алкилиден, возможно замещенный 1-3 заместителями, независимо выбранными из R,

R6 и R7 вместе представляют собой оксо, или

R6 и R7 вместе с атомом углерода, с которым они связаны, образуют 3-5-членную гетероциклоалкильную группировку, содержащую 1 или 2 гетероатома, независимо выбранные из группы, состоящей из кислорода, азота и серы, где указанная гетероциклоалкильная группировка может быть возможно замещена 1-3 заместителями, независимо выбранными из R;

R8 представляет собой водород, C1-6алкил или -OR;

R9 независимо выбран из водорода, групп -C1-6алкил, -(C(R)2)m-C(O)OR, -(C(R)2)m-C(O)NR14R15, -(C(R)2)m-NR14R15, -(C(R)2)m-C(O)-SR, -(C(R)2)m-C(O)NR14N(R)R15, -(C(R)2)m-NR-C(O)-NR14R15, -(C(R)2)m-N(R)COR13 и -(C(R)2)m-R14N(R)R15;

L1 выбран из групп: -кислота, -NR-кислота и

;

L2 представляет собой L2A-L2B-L2C или L2C-L2B-L2A, где:

L2A включает один или более компонентов, выбранных из групп:

-O-, -С(O)-, -C(O)NR-, -С(O)-С1-6алкил-, -С(O)NRC1-6алкил-, -C1-6алкил(ОСН2СН2)1-6-, -С(O)-С1-6алкил-NRC(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-, -С1-6алкил(ОСН2СН2)1-6-С(O)-, -С1-6алкил-S-S-С1-6алкил-NRC(O)СН2-, -С1-6алкил-(OCH2CH2)1-6-NRC(O)CH2-, -С(O)-С1-6алкил-NRC(O)С1-6алкил-, -N=CR-фенил-O-C1-6алкил-, -N=CR-фенил-O-С1-6алкил-С(O)-, -С(O)-С1-6алкил(ОСН2СН2)1-6-NRC(O)-, -С(O)-С1-6алкил-фенил-(NR-С(O)-С1-6алкил)1-4-, -С(O)-С1-6алкил-(ОСН2СН2)1-6-NRC(O)С1-6алкил-, -C1-6алкил-, -S-, -C(O)-C1-6алкил-фенил-NR-, -O-С1-6алкил-S-, -С(O)-O-С1-6алкил-S- и (-CH2-CH2-O-)1-20, или L2A отсутствует;

L2B выбран из АА0-аа, где АА представляет собой природную или неприродную аминокислоту, и аа равен 12; и

L2C включает один или более компонентов, выбранных из групп: -РАВА- и -РАВС-, или L2C отсутствует;

L3 выбран из одной или более из следующих групп: -C1-6алкил-, -NR-С38гетероциклил-NR-, -NR-С38карбоциклил-NR-, -NR-C1-6алкил-NR-, -NR-C1-6-алкил-, -S-, -NR-, -NR-NR- и -NR-C(O)-NR-, где две R группы возможно соединены с образованием 4-10-членного кольца, -NR-С1-6алкил-фенил-NR-, -NR-С1-6алкил-фенил-SO2-NR-, -SO2-, -NR-С1-6алкил-фенил-С(O)-,

, и ,

или L3 отсутствует;

R13' выбран из группы, состоящей из связи, групп -C1-6алкилен-, -С3-8карбоциклил-, -С3-8гетероциклил-, -С1-6алкил-С6-14арил-, -С1-6алкил-С5-14гетероарил-;

каждый R14 и R15 независимо выбран из группы, состоящей из: водорода, гидроксила, групп -NRR, -NRNR2, -С3-10карбоциклил, -С1-6алкилен-С3-10карбоциклил, -С3-10гетероциклил, -C1-6алкилен-С3-10гетероциклил, -(CH2CH2O)1-6CH2CH2C(O)OR, -(CH2CH2O)1-6CH2CH2NRR, -C1-6алкил, С6-14арил, -C1-6алкилен-С6-14арил и -С5-14гетероарил;

или R14 и R15 вместе с атомом или атомами, к которым они присоединены, образуют С3-10гетероциклильное кольцо,

где R14, R15, или оба из них, или кольцо, образованное R14 и R15, возможно замещены группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -(C(R)2)m-NRR или -(C(R)2)m-SO2NRR, (5) -SO2R, (6) -S-S-C1-6алкил-C(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-C1-6алкил-NRR;

каждый R14' независимо выбран из группы, состоящей из: связи, -NR-, групп -С3-10карбоциклил-, -С3-10гетероциклил-, -(CH2CH2O)1-6CH2CH2C(O)OR', -(CH2CH2O)1-6CH2CH2NR- и -C1-6алкилен-,

где R14' возможно замещен группой -(C(R)2)m-R18, где каждый R18 независимо выбран из групп: (1) -NRR, (2) -C(NRR)(C(O)OR), (3) -S-R, (4) арил или гетероарил, возможно замещенный одним или более галогенами, -CF3, -NRR или -SO2NRR, (5) -SO2R, (6) -S-S-C1-6алкил-C(O)OR, (7) -SO2NRR, (8) -C(O)NRR, (9) -C(O)OR, (10) -С4-6циклоалкил, возможно замещенный группами -NRR, -SO2NRR или -NR-C(O)(CH2)0-6NRR, (11) -R, (12) -OR, (13) -N(R)NRR, (14) -C(O)N(R)NRR, (15) -(C(R)2)m-O-NRR и (16) -S-S-C1-6алкил-NRR;

кислота представляет собой аминокислотный остаток, выбранный из -SCH2CH(COOH)(NH2), -NH(CH2)4CH(COOH)(NH2) и -C(O)(CH2)2CH(COOH)(NH2);

каждый R независимо выбран из группы, состоящей из: водорода и группы -С1-6алкил;

каждый R' независимо выбран из -Н, С1-С8алкила, C18гетероалкила и арила;

каждый R" независимо выбран из группы, состоящей из: связи и группы -C1-6алкилен-; и

каждый m независимо равен 0, 1, 2 или 3.

ПРИМЕРЫ

Продуцирование природного продукта

Следующие методики описывают продуцирование «природных продуктов», используемых в качестве полезных нагрузок в настоящем изобретении. Термин «природный продукт» означает, что продукт образуется в результате ферментативного процесса, но утверждается, что эти продукты известны или могут быть обнаружены в природе. Природные продукты обозначены ниже как «NP».

Пример 1

Ферментация, экстракция и выделение: [(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP1); [(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP2); [(2S,5S,6R)-6-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-5-гидрокси-4-метилидентетрагидро-2Н-пиран-2-ил]уксусной кислоты (#NP3); [(2S,6S)-6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-метилидентетрагидро-2Н-пиран-2-ил]уксусной кислоты (#NP4)

Стадия 1: Ферментация с использованием Pseudomonas sp. No. 2663, (штамм FERM BP-3421):

Pseudomonas sp. No. 2663 (штамм FERM BP-3421) получали из Международного патентного депозитария организмов (IPOD) при Национальном институте развития промышленности и технологии (AIST Tsukuba, Central 6, 1-1-1, Higashi, Tsukuba, Ibaraki 305-8566, Япония). Последующие таксономические исследования, проведенные биохимическим анализом (BBL Crystal Kit) и анализом 16S rRNA последовательности, выявили, что FERM BP-3421 представлял собой Burkholderia sp.

Индивидуальные изоляты колоний культивировали путем посева методом разведения замороженной культуры FERM BP-3421 дикого типа на чашки с питательным агаром. Несколько колб Эрленмейера объемом 250 мл, содержащих 50 мл среды для посева (1% полипептона, 0,5% дрожжевого экстракта, 0,5% NaCl), инокулировали выращенной на агаре культурой и инкубировали при 30°С со встряхиванием при 220 об/мин в течение 18-20 часов. Посевную культуру инокулировали в 500 мл производственной питательной среды (1% растворимого крахмала, 1% глицерина, 0,5% глюкозы, 1% соевого пептона HySoy, 0,5% жидкого кукурузного сиропа, 0,2% сульфата аммония, 0,006% сульфата магния .6H2O, 0,2% СаСО3, рН 7,0) на колбу Фернбаха емкостью 2,8 л без дефлекторов при 2,5% (об./об.). Ферментацию осуществляли при 25°С со встряхиванием при 200 об/мин в течение 72 часов.

Стадия 2: Экстракция из ферментативного бульона: в конце ферментации стадии 1 примера 1 к супернатанту производственной ферментации добавляли 50 г/л влажной смолы DIAION HP-20 и смесь встряхивали при 100 об/мин в течение 30 минут. HP-20 собирали центрифугированием и затем экстрагировали этилацетатом при температуре окружающей среды. Более подробно, 13-литровую ферментацию FERM ВР-3421 осуществляли при 25°С в течение 72 часов в соответствии со стадией 1 Примера 1. Цельный бульон центрифугировали при 3800 об/мин в течение 30 минут. Клетки отбрасывали и супернатант смешивали с предварительно промытой влажной НР20 смолой (260 г сухой массы). Полученную суспензию встряхивали на шейкере при температуре окружающей среды в течение 1 часа. НР20 смолу со связавшимся соединением экстрагировали дважды этилацетатом (1 л каждый раз) и этилацетатный раствор фильтровали через целит с последующим упариванием при пониженном давлении с получением светлого неочищенного экстракта (2,4 г).

Стадия 3: Выделение и определение характеристик [(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP1); [(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP2): Неочищенный экстракт со стадии 2 примера 1 растворяли в смеси ацетонитрил/диметилсульфоксид в соотношении 1:1 (14 мл всего). Вязкий раствор фильтровали и затем очищали препаративной ВЭЖХ: (колонка: Waters C18 DELTA РАК (WAT011801), 300×50 мм, 15 мкм, 100 А; подвижная фаза А: 0,02% уксусной кислоты (vv) в смеси ацетонитрил/H2O в соотношении 1:1; подвижная фаза В: 0,02% уксусной кислоты (об./об.) в смеси ацетонитрил/H2O в соотношении 3:1 и подвижная фаза С: 0,02% уксусной кислоты (об./об.) в ацетонитриле. Градиент: 100% в течение 5 мин, от 0% А до 100% за 18 мин, от 100% В до 100% С за 2 мин и 100% С в течение 2 мин. Скорость потока: 50 мл/мин). Фракции со значениями времени удерживания 13,5 и 18,0 мин собирали и подвергали лиофильной сушке с получением #NP1 (172,5 мг) и #NP2 (227,2 мг), соответственно, в виде белых порошков. Фракции со значениями времени удерживания 14,8 мин и 20,5 мин также собирали и подвергали лиофильной сушке с получением двух полуочищенных сероватых порошков I и II.

#NP1: ВЭЖХ (Протокол N): время удерживания 9,36 минут (чистота 92,5%); ИЭР-МСВР (протокол О) m/z 536,2837 [M+H]+; 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 12.20 (br s, D2O заменяемый), 7.80 (d, J=7,9, 1H, D2O заменяемый), 6.35 (dq, J=6,0, 6,0, 1H), 6.32 (br d, J=15,6, 1H), 6.10 (d, J=11,2, 1H), 5.85 (dd, J=11,8, 7.4, 1H), 5.58 (dd, J=15,5, 5,8, 1H), 5.49 (br dd, J=7,0, 7,0, 1H), 4.24 (m, 2H), 3.63 (m, 2H), 3.49 (ddd, J=5,5, 5,5, 2,5, 1H), 3.24 (d, J=6,0, 1H), 2.74 (d, J=3,5, 1H), 2.57 (d, J=3,5, 1H), 2.55 (dd, J=16,4, 8,5, 1H), 2.46 (m, 1H), 2.28 (m, 1H), 2.18 (m, 1H), 1.97 (s, 3H), 1.82 (m, 1H), 1.79 (m, 2H), 1.68 (s, 3H), 1.65 (m, 1H), 1.56 (m), 1.23 (d, J=6,4, 3H), 1.06 (d, J=6,5, 3H), 0.93 (d, J=7,0, 3H). 13C ЯМР (100 МГц, DMSO-d6) δ 172,5, 169,66, 164,55, 142,76, 136,22, 133,88, 128,84, 123,73, 122,83, 79,90, 76,93, 74,88, 70,35, 68,10, 67,93, 57,36, 49,63, 46,39, 39,09, 35,21, 33,91, 31,71, 28,67, 21,02, 19,96, 17,79, 14,22, 12,41.

#NP2: ВЭЖХ (Протокол N): время удерживания 10,93 минут (чистота 90,4%); ИЭР-МСВР (Протокол О) m/z 520,2895 [M+H]+; 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 12.13 (br s, 1H, D2O заменяемый), 7.80 (d, J=7,9, 1H, D2O заменяемый), 6.35 (dq, J=6,0, 6,0, 1H), 6.27 (br d, J=15,8, 1H), 6.10 (d, J=11,2, 1H), 5.85 (dd, J=11,8, 7,3, 1H), 5.57 (dd, J=15,6, 5,8, 1H), 5.50 (br dd, J=7,0, 7,0, 1H), 4.50 (ddd, J=5,5, 5,5, 5,5, 1H), 4.29 (m, 1H), 3.63 (m, 2H), 3.48 (m, 1H), 2.61 (s, 2H), 2.58 (dd, J=16,0, 8,5, 1H), 2.49 (m, 1H), 2.28 (m, 1H), 2.18 (m, 1H), 1.96 (s, 3H), 1.79 (m, 2H), 1.76 (m, 1H), 1.68 (s, 3H), 1.65 (m, 1H), 1.63 (m, 1H), 1.40 (dd, J=11,5, 7,2, 1H), 1.24 (d, J=6,4, 3H), 1.06 (d, J=6,4, 3H), 0.94 (d, J=7,0, 3H). 13C ЯМР (100 МГц, DMSO-d6) δ 172,88, 169,64, 164,56, 142,75, 135,37, 133,74, 128,99, 126,57, 122,84, 79,97, 74,90, 70,36, 68,16, 68,11, 54,71, 52,25, 46,40, 39,08, 37,22, 36,46, 35,23, 31,72, 28,71, 21,01, 19,95, 17,78, 14,23, 12,40.

Стадия 4: Выделение [(2S,5S,6R)-6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-5-гидрокси-4-метилидентетрагидро-2Н-пиран-2-ил]-уксусной кислоты (#NP3)

Полуочищенную массу I, выделенную на стадии 2 примера 1, дополнительно очищали посредством ВЭЖХ с обращенной фазой (колонка: YMC-Pack-ODS-A, 250×30 мм, S-10 мкм, 12 нм: подвижная фаза А: 0,02% уксусной кислоты в воде; подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле: система градиента: от 30% до 100% В за 23 мин и выдерживание при 100% В в течение 1 мин. Скорость потока: 20 мл/мин) с получением #NP3 (7,6 мг) в виде белого порошка.

#NP3: ВЭЖХ (Протокол N): время удерживания 10,9 минут (чистота 94,2%); ИЭР-МСВР (Протокол О) m/z 520,2910 [М+Н]+; 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.76 (d, J=7,9, 1H, D2O заменяемый), 6.35 (dq, J=6,4, 6,4, 1H), 6.22 (br d, J=15,8, 1H), 6.10 (d, J=11,0, 1H), 5.85 (dd, J=11,8, 7,4, 1H), 5.57 (dd, J=15,5, 5,8, 1H), 5.48 (br dd, J=7,0, 7,0, 1H), 5.04 (br s, 1H), 4.80 (br s, 1H), 4.18 (m, 1H), 3.88 (dd, J=5,8, 5,8, 1H), 3.63 (m, 2H), 3.49 (ddd, J=6,0, 6,0, 2,5, 1H), 2.37 (m, 2H), 2.33 (m, 1H), 2.27 (m, 1H), 2.23 (m, 1H), 2.17 (m, 1H), 1.97 (s, 3H), 1.79 (m, 2H), 1.68 (s, 3H), 1.65 (m, 1H), 1.24 (d, J=6,4, 3H), 1.06 (d, J=6,5, 3H), 0.94 (d, J=7,0, 3H). 13C ЯМР (100 МГц, DMSO-d6) δ 172,35, 169,57, 164,50, 144,64, 142,64, 136,08, 133,77, 128,74, 125,24, 122,81, 108,88, 79,95, 76,97, 74,84, 72,37, 69,47, 68,02, 46,34, 38,09, 36,97, 35,17, 31,67, 28,70, 20,95, 19,91, 17,72, 14,20, 12,34.

Стадия 5: Выделение [(2S,6S)-6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-метилидентетрагидро-2Н-пиран-2-ил]уксусной кислоты (#NP4)

Полуочищенный порошок II, выделенный на стадии 2 примера 1, дополнительно очищали посредством ВЭЖХ с обращенной фазой (колонка: YMC-Pack-ODS-A, 250×30 мм, S-10 мкм, 12 нм: подвижная фаза А: 0,02% уксусной кислоты в воде; подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле: система градиента: от 30% до 100% В за 23 мин и выдерживание при 100% В в течение 1 мин. Скорость потока: 20 мл/мин) с получением #NP4 (12,2 мг) в виде белого порошка.

#NP4: ВЭЖХ (Протокол N): время удерживания 12,7 минут (чистота 96,5%); ИЭР-МСВР (Протокол О) m/z 504,2959 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.75 (d, J=7,9, 1H, D2O заменяемый), 6.37 (dq, J=7,5, 6,4, 1H), 6.23 (br d, J=16,0, 1H), 6.10 (d, J=11,8, 1H), 5.85 (dd, J=11,8, 7,5, 1H), 5.53 (dd, J=16,0, 5,6, 1H), 5.51 (dd, J=6,5, 6,5, 1H), 4.80 (br s, 1H), 4.76 (br s, 1H), 4.32 (ddd, J=5,6, 5,5, 5,5, 1H), 4.13 (m, 1H), 3.63 (m, 2H), 3.49 (ddd, J=6,0, 6,0, 2,5, 1H), 2.38 (m, 2H), 2.36 (dd, J=11,5, 5,0, 1H), 2.32 (m, 1H), 2.29 (m, 1H), 2.18 (br dd, J=11,9, 6,5, 1H), 2.13 (dd, J=11,5, 5,9, 1H), 2.00 (dd, J=10,5, 7,0, 1H), 1.97 (s, 3H), 1.79 (m, 2H), 1.67 (s, 3H), 1.65 (m, 1H), 1.24 (d, J=6,4, 3H), 1.05 (d, J=6,3, 3H), 0.94 (d, J=7,0, 3H). 13C ЯМР (100 МГц, DMSO-d6) δ 172,11, 169,61, 164,54, 142,69, 141,40, 135,72, 133,71, 129,01, 126,48, 122,83, 110,53, 79,94, 74,86, 71,99, 68,76, 68,06, 46,37, 38,97, 38,92, 38,70, 35,19, 31,70, 28,71, 20,97, 19,92, 17,74, 14,21, 12,36.

Пример 2

Ферментация, экстракция и выделение аналогов природного продукта: (5R)-5-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,5-ангидро-1-(карбоксиметил)-3-С-(хлорметил)-2-дезоксипентитола (#NP5); (6R)-6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1-дезокси-4-С-(гидроксиметил)гекс-2-улопиранозы (#NP6); (4-[(ацетилокси)метил]-6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-гидрокситетрагидро-2Н-пиран-2-ил)уксусной кислоты (#NP7); [6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-(хлорметил)-4-гидрокситетрагидро-2Н-пиран-2-ил]уксусной кислоты (#NP8); 4-С-[(ацетилокси)метил]-6-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1-дезоксигекс-2-улопиранозы (#NP9); 6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-С-[({[6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-(хлорметил)-4-гидрокситетрагидро-2Н-пиран-2-ил]ацетил}окси)метил]-1-дезоксигекс-2-улопиранозы (#NP10); (2S,3Z)-5-{[(2R,3R,5S,6S)-2,5-диметил-6-{(2Е,4Е)-3-метил-5-[(2S)-4-метил-6-оксо-3,6-дигидро-2Н-пиран-2-ил]пента-2,4-диен-1-ил}тетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#NP11)

Стадия 1: Неочищенный твердый экстракт (3,7 г), полученный как на стадии 2 Примера 1, растворяли в метаноле и фракционировали на колонке Sephadex LH20 с использованием метанола, причем элюаты собирали с 15-минутными интервалами с использованием автоматизированного устройства для отбора фракций в течение периода времени 15,0 часов (всего 65 отобранных фракций). Фракцию-19 из них дополнительно очищали с использованием ВЭЖХ с обращенной фазой (колонка: YMC-Pack-ODS-A, 250×30 мм, S-10 мкм, 12 нм; подвижная фаза А: 0,2% ацетата аммония (масс./об.); подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле; градиент: от 30% В до 60% В за 20 минут, до 100% В за 5 минут, удерживание при 100% В в течение 4 минут и от 100% В до 30% В за 2 минуты; скорость потока: 20 мл/мин) с получением тринадцати фракций: Фракции А (4,3-6,4 мин), В (10,8-11,9 мин), С (12,5-13,5 мин), D (13,5-14,6 мин), Е (15,0-16,1 мин), F (16,5-17,8 мин), G (19,0-19,8 мин), Н (19,8-21,0 мин), I (21,8-23,0 мин), J (23,3-25,4 мин), J1 (25,4-26,2 мин), K (27,9-28,5 мин), L (28,7-29,5 мин).

Стадия 2: Выделение (5R)-5-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,5-ангидро-1-(карбоксиметил)-3-С-(хлорметил)-2-дезоксипентитола (#NP5): (6R)-6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1-дезокси-4-С-(гидроксиметил)гекс-2-улопиранозы (#NP6); (4-[(ацетилокси)метил]-6-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-гидрокситетрагидро-2Н-пиран-2-ил)уксусной кислоты (#NP7)

Фракцию D со стадии 1 Примера 2 дополнительно очищали с использованием ВЭЖХ с обращенной фазой (колонка: C18-Phenomenex; Luna 10 мкМ; 250×10 мм; подвижная фаза А: 0,2% ацетата аммония в воде (масс./об.); подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле; градиент: от 25% В до 35% В за 5 минут, до 45% В за 17 минут, до 70% В за 2 минуты: скорость потока: 2,5 мл/мин), и фракции, элюирующиеся на 13, 14 и 15 минутах, собирали и подвергали лиофильной сушке.

Фракция, элюирующаяся на 13 минуте, дала #NP5: выход: 1,0 мг: ИЭР-МСВР (Протокол О) m/z 572,2614 (М+Н)+, m/z 594,2438 (M+Na)+; 1H ЯМР (500 МГц, DMSO-d6, мульт, J в Гц) δ 7.80 (d, J=8,0, 1H), 6.36 (m, 1H), 6.23 (d, J=15,8, 1H), 6.11 (dd, J=1,3, 11,7, 1H), 5.86 (dd, J=7,5, 11,6, 1H), 5.63 (dd, J=5,6, 15,8, 4H), 5.47 (m, 1H), 4.21 (m, 1H), 4.10 (dd, J=5,6, 8,3, 1H), 3.64 (m, 2H), 3.62 (d, J=10,6, 1H), 3.49 (m, 1H), 3.42 (d, J=10,6, 1H), 3.16 (d, J=8,3, 1H), 2.68 (m, 1H), 2.57 (m, 1H), 2.30 (m, 1H), 2.19 (m, 1H), 1.98 (s, 3H), 1.83 (m, 2H), 1.80 (m, 2H), 1.69 (s, 3H), 1.65 (m, 1H), 1.24 (d, J=6,5, 3H), 1.06 (d, J=6,3, 3H), 0.95 (d, J=7,3, 2H). 13C ЯМР (126 МГц, DMSO-d6) δ 173.3, 170,1, 165,0, 143,1, 135,6, 134,4, 128,5, 126,8, 123,2, 80,2, 75,1, 71,7, 71,3, 70,0, 68,6, 68,2, 50,4, 46,6, 39,9, 35,2, 35,0, 31,9, 29,0, 21,0, 20,1, 17,9, 14,4, 12,5.

Стадия 3: Выделение (6R)-6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1-дезокси-4-С-(гидроксиметил)гекс-2-улопиранозы (#NP6): собранную фракцию с временем удерживания 14,0 минут, указанную выше, со стадии 2 Примера 2, дополнительно очищали с использованием ВЭЖХ с обращенной фазой (колонка: Chromolith: RP 18е, 100-10 мм: подвижная фаза А: 0,2% ацетата аммония в воде (масс./об.); подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле; градиент: от 25% В до 33% В за 20 минут; скорость потока: 2,5 мл/мин) с получением #NP6: выход 4,0 мг, ИЭР-МСВР (Протокол О) m/z 542,2948 (М+Н)+; 1H ЯМР (400 МГц, DMSO-d6, мульт, J в Гц) δ 7.77 (d, J=8,0, 1Н), 6.32 (m, 1H), 6.17 (d, J=15,8, 1H), 6.05 (dd, J=1,3, 11,6, 1H), 5.82 (dd, J=7,5, 11,6, 1H), 5.57 (dd, J=5,9, 15,8, 1H), 5.42 (m, 1H), 4.09 (m, 1H), 3.60 (m, 2H), 3.46 (m, 1H), 3.38 (d, J=10,1, 1H), 3.28 (d, J=10,1, 1H), 3.21 (br s, 1H), 3.17 (br s, 1H), 2.25 (m, 1H), 2.16 (m, 1H), 1.94 (s, 1H), 1.76 (m, 2H), 1.66 (s, 3H), 1.62 (m, 1H), 1.21 (d, J=6,3, 3H), 1.17 (d, J=8,5, 3H), 1.02 (d, J=6,3, 3H), 0.91 (d, J=7,3, 3H). 13C ЯМР (126 МГц, DMSO-d6) δ 174,1, 165,2, 143,5, 135,9, 134,6, 128,9, 127,4, 123,6, 98,8, 80,0, 77,3, 75,5, 69,7, 69,4, 69,2, 68,8, 59,6, 47,0, 35,8, 32,6, 29,5, 26,5, 21,7, 20,7, 18,5, 14,9, 13,1.

Стадия 4: Выделение (4-[(ацетилокси)метил]-6-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-гидрокситетрагидро-2Н-пиран-2-ил)уксусной кислоты (#NP7): собранную фракцию с временем удерживания 15,0 минут, указанную выше, со стадии 2 Примера 2, дополнительно очищали с использованием ВЭЖХ с обращенной фазой (YMC-Pack-ODS-A; 250×10 мм, S-5 мкм, 12 нм. Подвижная фаза А: 0,2% ацетата аммония в воде (масс./об.); подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле; градиент: от 30% В до 50% В за 20 минут, до 95% В за 5 минут: скорость потока: 2,5 мл/мин) с получением #NP7: ИЭР-МСВР (Протокол О) m/z 580,3112 (М+Н)+, m/z 602,2928 (M+Na)+; 1H ЯМР (500 МГц, DMSO-d6, мульт, J в Гц) δ 7.80 (d, J=8,0, 1H), 6.36 (m, 1H), 6.19 (d, J=15,8, 1H), 6.11 (d, J=11,6, 1H), 5.87 (dd, J=7,5, 11,6, 1H), 5.49 (m, 1H), 5.48 (m, 1H), 4.41 (dd, J=7,2, 12,8, 1H), 4.28 (d, J=5,8, 1H), 3.79 (m, 2H), 3.65 (m, 1H), 3.64 (m, 1H), 3.49 (m, 1H), 2.60 (m, 1H), 2.56 (m, 1H), 2.29 (m, 1H), 2.19 (m, 1H), 2.02 (s, 3H), 1.97 (s, 3H), 1.80 (m, 2H), 1.67 (br s, 3H), 1.68-1.65 (br m, 2H), 1.51 (m, 1H), 1.45 (m, 1H), 1.40 (m, 1H), 1.24 (d, J=6,5, 3H), 1.06 (d, J=6,3, 3H), 0.94 (d, J=7,3, 3H). 13С ЯМР (126 МГц, DMSO-d6) δ 173,4, 170,8, 170,1, 165,0, 143,2, 134,4, 134,2, 129,0, 128,9, 123,3, 80,3, 75,1, 68,3, 68,2, 68,0, 66,3, 71,1, 46,5, 39,4, 38,6, 35,4, 35,3, 31,8, 28,9, 21,1, 20,8, 20,0, 17,9, 14,4, 12,5.

Стадия 5: Выделение [6-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-(хлорметил)-4-гидрокситетрагидро-2Н-пиран-2-ил]уксусной кислоты (#NP8), 4-С-[(ацетилокси)метил]-6-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1-дезоксигекс-2-улопиранозы (#NP9) и 6-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)-пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-С-[({[6-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-4-(хлорметил)-4-гидрокситетрагидро-2Н-пиран-2-ил]ацетил}окси)метил]-1-дезоксигекс-2-улопиранозы (#NP10)

Фракцию F со стадии 1 Примера 2 дополнительно очищали с использованием ВЭЖХ с обращенной фазой (C18-Phenomenex; Luna 250×10 мм, 10 мкМ; подвижная фаза А: 0,2% ацетата аммония в воде (масс./об.); подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле; градиент: от 40% В до 45% В за 20 мин, до 95% В за 5 мин; скорость потока: 2,5 мл/мин: фракции, элюирующиеся на 8, 13 и 28 минутах, собирали и подвергали лиофильной сушке с получением:

#NP8 (фракция, элюирующаяся на 8,0 мин): выход: 1,0 мг; ИЭР-МСВР (Протокол О) m/z 556,2671 (М+Н)+, m/z 578,2489 (M+Na)+; 1H ЯМР (500 МГц, DM80-d6, мульт, J в Гц) δ 7.80 (d, J=8,0, 1Н), 6.37 (m, 1H), 6.21 (d, J=15,9, 1H), 6.11 (dd, J=1,3, 11,6, 1H), 5.87 (dd, J=7,5, 11,6, 1H), 5.50 (m, 1H), 5.48 (m, 1H), 4.39 (m, 1H), 4.30 (m, 1H), 3.65 (m, 2H), 3.50 (m, 1H), 3.48 (br s, 2H), 2.91 (dd, J=8,9, 15,0, 1H), 2.60 (dd, J=6,0, 15,0, 1H), 2.30 (m, 1H), 2.19 (m, 1H), 1.98 (s, 3H), 180 (m, 2H), 1.73 (m, 1H), 1.69 (br s, 3H), 1.65 (m, 1H), 1.58 (m, 1H), 1.55 (m, 1H), 1.43 (br dd, J=13,1, 10,4, 1H), 1.25 (d, J=6,5, 3H), 1.07 (d, J=6,3, 3H), 0.95 (d, J=7,3, 3H). 13C ЯМР (126 МГц, DMSO-d6) δ 173,4, 170,1, 165,0, 143,2, 134,5, 134,2, 128,9 (х2), 123,2, 80,2, 75,2, 68,7, 68,5, 68,2, 66,5, 54,6, 46,5, 39,9, 38,7, 35,6, 35,4, 31,9, 28,9, 21,1, 20,1, 17,9, 14,4, 12,5.

#NP9 (фракция, элюирующаяся на 13 минуте): выход: 1,0 мг: ИЭР-МСВР (Протокол О) m/z 584,3066 (М+Н)+, m/z 606,2887 (M+Na)+; 1H ЯМР (500 МГц, DMSO-d6, мульт, J в Гц) δ 7.80 (d, J=7,9, 1H), 6.36 (m, 1H), 6.25 (d, J=15,7, 1H), 6.11 (dd, J=1,0, 11,6, 1H), 5.87 (dd, J=7,5, 11,6, 1H), 5.63 (dd, J=6,1, 15,8, 1H), 5.48 (m, 1H), 4.19 (dd, J=6,1, 9,6, 1H), 3.97 (d, J=10,0, 1H), 3.88 (d, J=10,0, 1H), 3.65 (m, 2H), 3.50 (m, 1H), 3.17 (br s, 1H), 3.15 (br s, 1H), 2.30 (m, 1H), 2.19 (m, 1H), 2.00 (s, 3H), 1.98 (s, 3H), 1.80 (m, 2H), 1.70 (s, 3H), 1.65 (m, 1H), 1.26 (br d, J=1,6, 3H), 1.24 (br s, 3H), 1.06 (d, J=6,2, 3H), 0.96 (d, J=7,3, 3H). 13C ЯМР (126 МГц, DMSO-d6) δ 170,4, 170,1, 165,0, 143,1, 136,1, 134,4, 128,9, 126,4, 123,2, 98,5, 80,4, 75,4, 75,2, 69,2 (x2), 69,0, 68,2, 60,7, 46,5, 35,4, 31,9, 28,9, 25,9, 21,1 (x2), 20,0, 17,9, 14,4, 12,6.

#NP10 (фракция, элюирующаяся на 23 минуте): выход: 1,0 мг, ИЭР-МСВР (Протокол О) m/z 562,2582 (M+2Na)2+, m/z 1101,5263 (M+Na)+; 1H ЯМР (500 МГц, DMSO-d6, мульт, J в Гц) δ 7.79 (d, J=7,9, 2H), 6.37 (m, 2H), 6.27 (d, J=16,2, 1H), 6.21 (d, J=15,6, 1H), 6.12 (d, J=11,6, 1H), 6.11 (d, J=15,3, 1H), 5.88 (dd, J=7,5, 11,6, 2H), 5.64 (dd, J=6,2, 15,8, 1H), 5.54-5.48 (m, 3H), 4.40-4.31 (m, 2H), 4.20 (dd, J=6,2, 9,4, 1H), 4.04 (m, 1H), 3.90 (d, J=10,0 Гц, 1H), 3.69-3.62 (m, 4H), 3.54-3.47 (m, 4H), 3.21-3.13 (m, 2H), 3.06 (dd, J=8,7, 15,6, 1H), 2.73 (dd, J=5,3, 15,7, 1H), 2.31 (m, 2H), 2.20 (m, 2H), 1.99 (s, 6H), 1.84-1.79 (m, 5H), 1.72 (s, 3H), 1.69 (s, 3H), 1.68-1.64 (m, 2H), 1.62 (m, 1H), 1.55 (d, J=13,8 Гц, 1H), 1.44 (m, 1H), 1.27 (brs, 3H), 1.26 (brs, 6H), 1.08 (m, 6H), 0.96 (m, 6H). 13C ЯМР (126 МГц, DMSO-d6) δ 171,3, 170,0 (x2), 165,0 (x2), 143,2 (x2), 136,5, 134,6, 134,7, 134,4, 128,9 (x3), 126,6, 123,3 (x2), 98,4, 80,5 (x2), 75,4, 75,5 (x2), 69,5 (x2), 69,2, 68,6, 68,5 (x3), 66,5, 60,7, 54,8, 46,9 (x2), 40,0, 38,5, 35,9, 35,7 (x2), 32,3 (x2), 29,3, 29,2, 26,2, 21,5 (x2), 20,4 (x2), 18,2 (x2), 14,7 (x2), 12,9 (x2).

Стадия 6: Выделение (2S,3Z)-5-{[(2R,3R,5S,6S)-2,5-диметил-6-{(2Е,4Е)-3-метил-5-[(2S)-4-метил-6-оксо-3,6-дигидро-2Н-пиран-2-ил]пента-2,4-диен-1-ил}-тетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#NP11)

Фракцию К со стадии 1 Примера 2 дополнительно очищали с использованием ВЭЖХ с обращенной фазой (C18-Phenomenex; Luna 250×10 мм, 10 мкМ; Phenomenex; Luna 250×10 мм, 10 мкМ; подвижная фаза А: 0,2% ацетата аммония в воде (масс./об.); подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле; градиент: от 40 до 95% В за 15 мин, скорость потока: 2,5 мл/мин) с получением #NP11. Выход: 2,0 мг. ИЭР-МСВР (Протокол О) m/z 460,2694 (М+Н)+, m/z 482,2514 (M+Na)+; 1H ЯМР (500 МГц, DMSO-d6) δ м.д. 1H ЯМР (500 МГц, DMSO-d6, мульт, J в Гц) δ 7.82 (d, J=6,9 Гц, 1H), 6.37 (m, 1H), 6.38 (m, 1H), 6.13 (dd, J=1,2, 11,6, 1H), 5.88 (dd, J=7,5, 11,6, 1H), 5.78 (s, 1H), 5.68 (dd, J=6,7, 15,8, 1H), 5.62 (t, J=7,0, 1H), 4.97 (m, 1H), 3.67 (m, 1H), 3.66 (m, 1H), 3.52 (m, 1H), 2.47 (m, 1H), 2.44 (m, 1H), 2.33 (m, 1H), 2.23 (m, 1H), 2.00 (s, 3Н), 1.97 (s, 3Н), 1.82 (m, 2H), 1.74 (s, 3Н), 1.67 (m, 1H), 1.26 (d, J=6,5, 3Н), 1.08 (d, J=6,3, 3Н), 0.97 (d, J=7,1, 3Н). 13С ЯМР (126 МГц, DMSO-d6) δ 170,1, 165,0, 164,4, 159,0, 143,1, 137,6, 133,9, 131,2, 124,4, 123,2, 115,6, 80,2, 75,2, 77,2, 68,0, 46,5, 35,3, 34,5, 32,1, 28,9, 22,3, 21,0, 20,1, 17,9, 14,3, 12,4.

Пример 3

Определение молекулярных филогенетических характеристик PERM ВР-3421

Стадия 1: Геномную ДНК выделяли из чистой культуры FERM ВР-3421 и почти полный 16S rRNA ген подвергали ПЦР-амплификации с использованием праймеров 8FPL (5'AGAGTTTGATCCTGGCTCAG3') (SEQ ID NO: 1) и 1492RPL (5'GGTTACCTTGTTACGACTT3') (SEQ ID NO: 2). ПЦР-продукты очищали с использованием набора DNA Clean and Concentrator™-25 (Zymo Research) и непосредственно секвенировали с получением двухцепочечного перекрытия со следующими 16S rRNA праймерами: 8FPL, рС FWD (5'CTACGGGAGGCAGCAGTGGG3') (SEQ ID NO: 3), рС REV (5'CCCACTGCTGCCTCCCGTAG3') (SEQ ID NO: 4), pD FWD (5'CAGCAGCCGCGGTAATAC3') (SEQ ID NO: 5), pD REV (5'GTATTACCGCGGCTGCTG3') (SEQ ID NO: 6), pF FWD (5'CATGGCTGTCGTCAGCTCGT3') (SEQ ID NO: 7), pF REV (5'ACGAGCTGACGACAGCCATG3') (SEQ ID NO: 8) и 1492RPL. Полностью двухцепочечную 16S rRNA последовательность (SEQ ID NO: 1) подвергали поиску по базе данных (National Center for Biotechnology Information) для определения таксономической принадлежности FERM ВР-3421 как Burkholderia sp. Последовательности 16S rRNA наиболее близкородственных типовых штаммов Burkholderia spp. и последовательность Burkholderia sp. NRRL B50319 (штамм А396) (US 20110207604 A1 Asolkar et al., 2011), которая имеет 100%-ную идентичность с FERM ВР-3421, выделяли из GenBank. Множественное выравнивание последовательностей осуществляли с использованием ClustalX (версия 1.81) и филогенетическое положение FERM ВР-3421 относительно других Burkholderia spp. определяли с использованием стандартных методов построения дендрограмм, таких как TREECON (версия 1.3b).

FERM BP-3421 (SEQ ID NO: 9)

На Фиг. 1 проиллюстрирована филогенетическая связь, определенная с использованием почти полных 16S rRNA последовательностей FERM BP-3421, с другими Burkholderia spp. Родственное филогенетическое дерево имеет корни с Burkholderia pickettii и демонстрирует бутстреп-значения (на основании 100 реплицирований и более чем 50%) в их соответствующих узлах. Графический масштаб составляет 0,02 замены на нуклеотид.

Пример 4

Ферментация, экстракция и выделение: [(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP1) и [(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP2) с использованием сконструированного штамма #1 FERM BP-3421

Стадия 1: Исследование генома для биосинтетического генного кластера сплицеостатина:

Геном FERM BP-3421 подвергали секвенированию с использованием технологий нового поколения (454 и Illumina). Биосинтетический генный кластер для сплицеостатинов (Фиг. 2) выводили из последовательности ДНК исследованием генома (для обзора см. Challis GL 2008 J Med Chem 51: 2618-2628), что привело к идентификации гибридного пути транс-ацилтрансферазы (AT) поликетидсинтазы (PKS)/нерибосомальной пептидсинтетазы (NRPS) (для обзора см. J Piel 2010 Nat Prod Rep 27: 996-1047 и указанные там ссылки). Мутанты с выключенными генами PKS и NRPS не продемонстрировали никакого обнаружимого продуцирования сплицеостатина, что подтверждает вовлечение этих генов в биосинтез сплицеостатина. Обнаружения авторов настоящего изобретения согласуются с обнаружениями, о которых сообщалось в Zhang F et al. (2011 J Am Chem Soc 133: 2452-62), и генная терминология, включенная в эту JACS статью, используется здесь ниже.

На Фиг. 2 показан биосинтетический генный кластер для сплицеостатинов и предложенный биосинтетический путь, подчеркивающий стадии гидроксилирования, катализируемого цитохромом Р450 Fr9R и Fe(II)/α-кетоглутарат-зависимой диоксигеназой Fr9P. Стрелки в верхней части представляют кодирующие ДНК-последовательности PKS-NRPS генов; дополнительные гены не показаны.

Стадия 2: Создание мутантного штамма FERM ВР-3421 с выключенным геном диоксигеназы (fr9P) (штамм #1)

Два длинных фрагмента ДНК примерно 700 пар оснований ниже и выше точки замещения гена амплифицировали посредством ПЦР (Pfu Ultra™ Polymerase, Promega) с использованием геномной ДНК FERM ВР-3421 в качестве матрицы и пар праймеров P1_diox (TGG CGA АСА GAT CGA GTT TG) (SEQ ID NO: 10) и P2_diox (CTT GCG GAG AAC TGT GAA TGC GCA ATA GAA GCG CTG TCA TGG AAT G) (SEQ ID NO: 11), и P3_diox (CCG AAA AGT GCC ACC TGA CGT СТА AGA TAA CTC GTG GAT ATT CGG CAA G) (SEQ ID NO: 12) и P4_diox (AGA АТС CCG CGA TCC CAA C) (SEQ ID NO: 13); подчеркнутые основания представляют собой области гомологии с маркером устойчивости к тетрациклину (tet). Tet маркер амплифицировали посредством ПЦР с использованием рЕХ18Тс (Schweizer HP 1998 Gene 212: 77-86) в качестве матрицы и пары праймеров Ptet_f (TTG CGC ATT CAC AGT TCT С) (SEQ ID NO: 14) и Ptet_f (TCT TAG ACG TCA GGT GGC AC) (SEQ ID NO: 15). Три фрагмента подвергали сборке с помощью SOE-PCR (using Pfu Ultra Polymerase, Promega) и лигировали в Smal сайт рЕХ100Т (Schweizer HP & Hoang TT 1995 Gene 158: 15-22) для создания плазмиды pAE-PF12. pAE-PF12 переносили в FERM ВР-3421 путем конъюгации из Е. coli S17.1. Тетрациклин (25 мкг/мл) использовали для селекции мутантов; 5%-ную сахарозу для контрселекции векторной основы и гентамицин (10 мкг/мл) для удаления Е. coli после конъюгации. Мутанты подтверждали в реакциях ПЦР колоний (RED Taq®, Sigma) в трех отдельных реакциях с использованием пар праймеров P1_diox/P4_diox, P1_diox/Ptet_r и ТР1_рЕХ100Т (GGA CGA АТС GAA CTC AGG AAC TTG) (SEQ ID NO: 16)/ТР2_рЕХ100Т (CGA AGA GCG ATT GAG GAA AAG G) (SEQ ID NO: 17) с получением штамма #1.

Стадия 3: Ферментация с использованием сконструированного штамма #1: Сконструированный штамм #1 культивировали в среде для посева (1% полипептона, 0,5% дрожжевого экстракта, 0,5% NaCl), содержащей тетрациклин (25 мг/л) при 30°С и 220 об/мин в течение примерно 24 часов. Вторую посевную культуру генерировали инокуляцией свежей среды для посева, содержащей тетрациклин (25 мг/л), с первой посевной культурой при 10% (об./об.) и инокулировали при 30°С со встряхиванием при 220 об/мин в течение примерно 24 часов. 850 мл посевной культуры использовали для инокуляции 29 л среды для продуцирования (4% глицерина, 2% соевого пептона HySoy, 0,2% сульфата аммония, 0,01% сульфата магния. 6H2O, 0,2% СаСО3), содержащейся в биореакторе емкостью 30 л (BIOSTAT® С plus, Sartorius BBI Systems). Ферментацию осуществляли при 25°С в течение 5 суток. Первоначальное встряхивание осуществляли при 344 об/мин; первоначальный поток воздуха составлял 1,3 стандартных литров в минуту; DO контролировали при 3% с увеличением встряхивания.

Стадия 4: Экстракция из ферментационного бульона: В конце ферментации со стадии 3 примера 4 к цельному бульону добавляли 1,5 кг влажной смолы DIAION HP-20 и смесь встряхивали в течение ночи. HP-20 собирали фильтрованием через 50 мкм-150 мкм клиновидное проволочное сито из нержавеющей стали. НР20 смолу со связавшимся соединением экстрагировали четыре раза этилацетатом (3 л каждый раз при встряхивании в течение 45 мин). Смолу затем промывали (один раз 2 л метанола и 3 раза обогащенной DI водой) и снова использовали для повторного захвата соединения, все еще остающегося в водном фильтрате, с последующей такой же процедурой как описано выше. Растворитель из объединенных этилацетатных экстрактов удаляли выпариванием при пониженном давлении с получением светло-желтого порошка (137 г).

Стадия 5: Выделение [(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP1) и [(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP2): 0,7 г экстракта со стадии 4 Примера 4 растворяли в смешанном растворителе DMF/ACN с соотношением 2:1 (22 мл всего), фильтровали и затем очищали посредством ВЭЖХ с обращенной фазой (Waters ODS-A 50×300 мм, 15 мкм, 120 А, подвижная фаза А: 0,02% АсОН в воде, подвижная фаза В: 0,02% АсОН в ацетонитрильной системе раствориетелей. Градиент: 50% В за 2 мин, до 75% В за 18 мин; 100% В в течение 2 мин. Скорость потока: 50 мл/мин, 5 повторных инжекций). Фракцию с временем удерживания 13,5 мин и 18,0 мин собирали и подвергали лиофильной сушке с получением #NP1 (191 мг) и #NP2 (466 мг), соответственно, в виде белых порошков.

#NP1: ВЭЖХ (Протокол N): время удерживания 9,38 минут (чистота 98,5%);

#NP2: ВЭЖХ (Протокол N): время удерживания 10,97 минут (чистота 96,5%).

Пример 5

Ферментация, экстракция и выделение: [(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP1) с использованием сконструированного штамма #2 Ferm FERM BP-3421

Стадия 1: Конструирование штамма #2: Сначала tet маркер в векторе mini-CTX1 (Hoang TT et al. 2000 Plasmid 43: 59-72) заменяли на neo (устойчивость к канамицину и неомицину) из pCR2.1 (Invitrogen) посредством λ-Red-опосредованной рекомбинации (Datsenko КА & Wanner BL. 2000 Proc Natl Acad Sci USA 97: 6640-5). Используемые праймеры представляли собой P1_neo_pCR2.1 (GTT GGT TTG CGC ATT CAC AGT TCT CCG CAA GAA TTG ATT GCA AGG GCT GCT AAA GGA AG) (SEQ ID NO: 18) и P2_neo_tet_CTX1 _pCR2.1 (TCT TCC GCT TCC TCG CTC ACT GAG TCG CTG CGC TCG GTC ACG GAA ATG TTG AAT ACT CAT ACT C) (SEQ ID NO: 19); подчеркнутые последовательности представляют собой области гомологии для A-Red-опосредованной рекомбинации. Полученному вектору присвоили название pAE-PF24.

PBAD/araC арабиноза-индуцибельную систему амплифицировали посредством ПЦР (Phusion® Hot Start polymerase, Finnzymes) с использованием pKD46 в качестве матрицы и пары праймеров P1_BADp_f (GCT СТА GAC АТС GAT ТТА ТТА TGA CAA CTT GAC, Xbal сайт подчеркнут) (SEQ ID NO: 20) и P2_BADp_r (CCC AAA AAA ACG GGT ATG G) (SEQ ID NO: 21). Ген (включая предполагаемый RBS, но без промотора), кодирующий цитохром Р450 (fr9R), содержащийся в биосинтетическом генном кластере сплицеостатина, амплифицировали посредством ПЦР (Phusion® Hot Start polymerase, Finnzymes) с использованием геномной ДНК из FERM BP-3421 и парой праймеров P3_P450_BAD_f (СТА CTG TTT CTC CAT ACC CGT TTT TTT GGG GGG TTG TTG GTT TTT GAA ATT GC, удлинение для SOE-PCR подчеркнуто) (SEQ ID NO: 22) и P4_P450_r (ATG GTG AAG CTT AAG TCG АСА ACC GGC ATT CC, HindIII сайт подчеркнут) (SEQ ID NO: 23). Два фрагмента, полученные таким образом, подвергали сборке с помощью SOE-PCR (Phusion® Hot Start polymerase, Finnzymes) и затем лигировали в Spel и HindIII сайты pAE-PF24 с получением pAE-PF29. pAE-PF29 переносили в сконструированный штамм #1 посредством конъюгации из E. coli S17.1. Канамицин (500 мкг/мл) использовали для селекции мутантов, а гентамицин (10 мкг/мл) для удаления E. coli после конъюгации. Мутанты подтверждали в реакциях ПЦР двух колоний (RED Taq®, Sigma) с использованием наборов пар праймеров ТР1_СТХ1_маркер (GCA TTC АСА GTT CTC CGC AAG) (SEQ ID NO: 24) и ТР2_СТХ1_маркер (CTC GCT САС TGA CTC GCT G) (SEQ ID NO: 25) и T3_mini-CTX1_f (GCA ATT AAC CCT САС TAA AGG) (SEQ ID NO: 26) и MCS_mini-CTX1_r (СТА TAG GGC GAA TTG GGT AC) (SEQ ID NO: 27) с получением сконструированного штамма #2.

Стадия 2: Ферментация с использованием сконструированного штамма #2: Сконструированный штамм #2 культивировали в среде для посева (1% полипептона, 0,5% дрожжевого экстракта, 0,5% NaCl), содержащей тетрациклин (25 мг/л) при 30°С и 220 об/мин в течение примерно 24 часов. Вторую посевную культуру генерировали инокуляцией свежей среды для посева, содержащей тетрациклин (25 мг/л), с первой посевной культурой при 10% (об./об.) и инокулировали при 30°С со встряхиванием при 220 об/мин в течение примерно 24 часов. Посевную культуру использовали для инокуляции 550 мл среды для продуцирования (4% глицерина, 2% соевого пептона HySoy, 1,5% L-арабинозы, 0,2% сульфата аммония, 0,01% сульфата магния. 6Н2О, 0,2% СаСО3) на колбу Фернбаха объемом 2,8 л без дефлекторов при 2,5% (об./об.). Ферментацию осуществляли при 25°С со встряхиванием при 200 об/мин в течение 4 суток.

Стадия 3: Экстракция из ферментационного бульона: В конце ферментации со стадии 2 примера 5 к примерно 6 л ферментационной продуцированной смеси добавляли 100 г/л влажной смолы DIAION HP-20 и смесь встряхивали в течение 3 часов. HP-20 собирали фильтрованием через 50 мкм-150 мкм клиновидное проволочное сито из нержавеющей стали. НР20 смолу со связавшимся соединением экстрагировали три раза этилацетатом (2 л каждый раз). Более подробно, каждую экстракцию осуществляли переносом смолы в бутыль, добавлением 2 л этилацетата, встряхиванием в течение 1 часа и фильтрованием через 50 мкм-150 мкм клиновидное проволочное сито из нержавеющей стали. Растворитель из объединенных этилацетатных экстрактов удаляли выпариванием при пониженном давлении с получением светло-желтого неочищенного экстракта (17,25 г).

Стадия 4: Выделение [(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP1): 0,12 г экстракта со стадии 3 Примера 5 растворяли в смешанном растворителе DMF/ACN с соотношением 2:1 (22 мл всего), фильтровали и затем очищали посредством ВЭЖХ с обращенной фазой (YMC ODS-A 30×250 мм, 10 мкм, 120 А, подвижная фаза А: 0,02% АсОН в воде, подвижная фаза В: 0,02% АсОН в ацетонитриле. Градиент: 30% В за 2 мин, до 100% В за 18 мин; 100% В в течение 2 мин. Скорость потока: 20 мл/мин). Фракцию с временем удерживания 15,0 мин собирали и подвергали лиофильной сушке с получением #NP1 (73,6 мг) в виде белого порошка.

#NP1: ВЭЖХ (Протокол N): время удерживания 9,36 минут (чистота 92,5%).

Пример 6

Ферментация, экстракция и выделение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3R,5S,7S)-7-гидрокси-7-метил-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#NP12) и [(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP2) с использованием сконструированного штамма #3 PERM BP-3421

Стадия 1: Конструирование штамма #3: Два длинных фрагмента ДНК примерно 700 пар оснований ниже и выше точки замещения гена амплифицировали посредством ПЦР (Pfu Ultra™ Polymerase, Promega) с использованием геномной ДНК FERM ВР-3421 в качестве матрицы и пар праймеров Р1_Р450 (GCA ТСС ААТ САС TTG AAC AGG) (SEQ ID NO: 28) и Р2_Р450 (СТТ GCG GAG AAC TGT GAA TGC GCA AGC CAT CAT TCT CGA CAT TTC C) (SEQ ID NO: 29), и P3_P450 (CCG AAA AGT GCC ACC TGA CGT СТА AGA AGA TTG TGA CGG TAC TGA AGC) (SEQ ID NO: 30) и P4_P450 (AGA GAA CGA TCG CTC САС AG) (SEQ ID NO: 31); подчеркнутые основания представляют собой области гомологии с маркером устойчивости к тетрациклину (tet). Tet маркер амплифицировали посредством ПЦР с использованием рЕХ18Тс (Schweizer HP 1998 Gene 212: 77-86) в качестве матрицы и пары праймеров Ptet_f (TTG CGC АТТ САС AGT TCT С) (SEQ ID NO: 32) и Ptet_r (TCT TAG ACG TCA GGT GGC AC) (SEQ ID NO: 33). Три фрагмента подвергали сборке с помощью SOE-PCR (using Pfu Ultra™ Polymerase, Promega) и лигировали в Smal сайт рЕХ100Т (Schweizer HP & Hoang TT 1995 Gene 158: 15-22) для создания плазмиды pAE-PFU. pAE-PFH переносили в FERM ВР-3421 путем конъюгации из Е. соli S17.1. Тетрациклин (25 мкг/мл) использовали для селекции мутантов; 5%-ную сахарозу для контрселекции векторной основы и гентамицин (10 мкг/мл) для удаления Е. coli после конъюгации. Мутанты подтверждали в реакциях ПЦР двух колоний (RED Taq®, Sigma) с использованием пар праймеров P1_P450/Ptet_r и ТР1_рЕХ100Т (GGA CGA АТС GAA CTC AGG AAC TTG) (SEQ ID NO: 34)/TP2_рЕХ100Т (CGA AGA GCG АТТ GAG GAA AAG G) (SEQ ID NO: 35) с получением штамма #3.

Стадия 2: Ферментация с использованием сконструированного штамма #3: Сконструированный штамм #3 культивировали в среде для посева (1% полипептона, 0,5% дрожжевого экстракта, 0,5% NaCl), содержащей тетрациклин (25 мг/л) при 30°С и 220 об/мин в течение примерно 24 часов. Вторую посевную культуру генерировали инокуляцией свежей среды для посева, содержащей тетрациклин (25 мг/л), с первой посевной культурой при 10% (об./об.) и инокулировали при 30°С со встряхиванием при 220 об/мин в течение примерно 24 часов. Посевную культуру использовали для инокуляции 400 мл среды для продуцирования (4% глицерина, 2% соевого пептона HySoy, 0,2% сульфата аммония, 0,01% сульфата магния. 6H2O, 0,2% СаСО3) при 2,5% (об./об.), содержащихся в колбе Фернбаха объемом 2,8 л без дефлекторов. Ферментацию осуществляли при 25°С со встряхиванием при 200 об/мин в течение 5 суток.

Стадия 3: Экстракция из ферментационного бульона: Культуру-продуцент со стадии 2 примера 6 центрифугировали в течение 30 мин при 4200 об/мин для удаления клеток. К супернатанту добавляли 50 г влажной смолы DIAION HP-20 (12,5% масс./об.) и смесь встряхивали при 200 об/мин в течение 1 ч. НР20 смолу со связавшимся соединением собирали центрифугированием и затем экстрагировали дважды этилацетатом (250 мл на каждую экстракцию). После сушки экстракты объединяли с MgSO4 (который затем удаляли фильтрованием с помощью фильтровальной бумаги Ватман), растворитель удаляли выпариванием при пониженном давлении с получением светлого неочищенного экстракта.

Стадия 4: Выделение [(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP2) и (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3R,5S,7S)-7-гидрокси-7-метил-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#NP12): Половину неочищенного экстракта со стадии 3 Примера 6 очищали препаративной ВЭЖХ с нормальной фазой: (колонка: Princeton SFC 2-этилпиридин, 250×21,2 мм, 5 мкм; подвижная фаза А: гептан; подвижная фаза В: этанол (денатурированный). Градиент: 5% В за 1,5 мин, до 100% В за 8,5 мин, 100% В в течение 2 мин, до 5% В за 0,5 мин и 5% В в течение 2,5 мин. Скорость потока: 27 мл/мин). Фракции с временем удерживания 6,58 мин и 8,18 мин собирали и подвергали лиофильной сушке с получением #NP12 (163 мг, чистота 89%, в виде очень светлого желтоватого порошка) и #NP2 (205 мг, чистота 89% согласно УФ), соответственно.

#NP12: ВЭЖХ (Протокол Р): время удерживания 12,65 мин (чистота 89%); LC/MC: m/z 474,2 [М+Н+-H2O]+ и 514,2 [M+Na+]+

#NP2: ВЭЖХ (Протокол Р): время удерживания 12,46 мин (чистота 89%); LC/MC: m/z 520,2 [M+H+]+

Стадия 5: Выделение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,5S,7S)-7-гидрокси-7-метил-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#NP12): Одну половину 6,58-минутной фракции со стадии 4 примера 6 очищали посредством ВЭЖХ с обращенной фазой: (колонка: Phenomenex Luna С18, 150×21,2 мм, 5 мкм; подвижная фаза А: вода; подвижная фаза В: ацетонитрил. Градиент: 20% В за 1,5 мин, до 70% В за 8,5 мин, до 100% В за 2 мин, до 20% В за 0,5 мин. Скорость потока: 27 мл/мин). Фракцию с временем удерживания 8,25 мин собирали и подвергали лиофильной сушке с получением #NP12 (28 мг) в виде белого порошка. #NP12; ВЭЖХ (Протокол N): время удерживания 12,6 мин (чистота 98,5%); ИЭР-МСВР (протокол О) m/z 492,296 [М+Н]+; 1Н ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.78 (d, J=8,0 Гц, 1Н), 6.35 (m, 1Н), 6.21 (d, J=15,8, 1Н), 6.11 (dd, J=0,9, 11,7, 1Н), 5.85 (dd, J=11,6, 7,5 Гц, 1Н), 5.53 (m, 1Н), 5.49 (m, 1Н), 5.41 (d, J=1,6 Гц, ОН), 4.64 (m, 1Н), 3.65 (m, 1Н), 3.64 (m, 1Н), 3.49 (m, 1Н), 2.45 (m, 2H), 2.30 (m, 1Н), 2.20 (m, 1Н), 1.98 (s, 3H), 1.96 (m, 1Н), 1.81 (m, 3H), 1.69 (s, 3H), 1.65 (m, 1Н), 1.31 (s, 3H), 1.25 (m, 1Н), 1.25 (d, J=6,3 Гц, 3H), 1.14 (m, 1Н), 1.07 (d, J=6,5 Гц, 3H), 0.95 (d, J=7,3 Гц, 3Н). 13C ЯМР (100 МГц, DMSO-d6) δ 169,6, 164,6, 142,1, 134,1, 133,7, 128,2, 127,1, 122,6, 95,3, 79,5, 74,3, 67,6, 66,7, 54,5, 48,4, 46,1, 41,4, 37,5, 35,0, 31,1, 29,6, 28,5,20,8, 19,5, 17,8, 13,9, 12,2.

Пример 7

Ферментация, экстракция и подтверждение продуцирования: [(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP1); [(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#NP2) с использованием Burkholderia sp. MSMB 43

Стадия 1: Ферментация с использованием Burkholderia sp. MSMB 43: Burkholderia sp. (предложенное название «Burkholderia humptydooensis») MSMB 43 получали из Центра профилактики и контроля заболеваемости (CDC) и Школы исследования в области здравоохранения Menzies. MSMB 43 культивировали на чашках с питательным агаром из заморозки и инкубировали при 30°С в течение 48 часов. Выращенную на агаре культуру инокулировали в культуральную колбу 25×150 мм, содержащую 10 мл посевного материала (1% полипептона, 0,5% дрожжевого экстракта, 0,5% NaCl). Посевную культуру инкубировали при 30°С при встряхивании при 220 об/мин в течение 18-20 часов. Посевную культуру инокулировали в 50 мл среды для продуцирования (1% растворимого крахмала, 1% глицерина, 0,5% глюкозы, 1% соевого пептона HySoy, 0,5% кукурузного экстракта, 0,2% сульфата аммония, 0,006% сульфата магния ×6Н2О, 0,2% СаСО3, рН 7,0) на колбу Эрленмейера объемом 250 мл при 2,5% (объем/объем). Ферментационные смеси инкубировали при 25°С при встряхивании при 200 об/мин в течение 72 часов.

Стадия 2: ЖХ-МС анализ ферментации.

Ферментационные смеси центрифугировали для осаждения клеток и супернатанты фильтровали через поливинилиденфторидные мембраны 0,22 мкм. Порцию каждого супернатанта смешивали с диметилсульфоксидом (10:1) и анализировали посредством ЖХ-МС с использованием оборудования Acuity UPLC (Waters): колонка: XBridge C18, 4,6×150 мм, 3,5 мкМ, подвижная фаза А: 0,1% муравьиной кислоты в воде (об./об.); подвижная фаза В: 0,1% муравьиной кислоты в ацетонитриле (об./об.); градиент от 5% до 100% В за 12,0 минут; 100% В в течение 3,0 минут (вводимый объем: 5,0 мкл). На пятые сутки ферментации MSMB43 продуцировал NP1 и NP2 в титрах 150 мг/л и 50 мг/л, соответственно, как наблюдали по времени удерживания и данным масс-спектров.

NP1: m/z: 535,9 (М+Н)+, время удерживания: 13,31 мин.

NP2: m/z: 519,9 (М+Н)+, время удерживания: 14,58 мин.

Экспериментальные методики синтеза

Эксперименты обычно проводили в инертной атмосфере (атмосфере азота или аргона), в частности в тех случаях, когда использовали реагенты или промежуточные соединения, чувствительные к кислороду или влаге. Имеющиеся в продаже растворители и реагенты обычно использовали без дополнительной очистки, в том числе безводные растворители в подходящих случаях (обычно продукты Sure-Seal™ от Aldrich Chemical Company, Milwaukee, Wisconsin). Масс-спектрометрические данные получены на приборе или для жидкостной хроматографии - масс-спектрометрии (ЖХ-МС), или с использованием химической ионизации при атмосферном давлении (ХИАД). Химические сдвиги для ядерного магнитного резонанса (ЯМР) выражены в частях на миллион (м.д., δ) со ссылкой на остаточные пики от использованных дейтерированных растворителей.

Для методик, ссылающихся на синтезы в других Примерах или Методах, можно варьировать реакционный Протокол (продолжительность реакции и температуру). В общем, реакции сопровождала тонкослойная хроматография (ТСХ), ЖХ-МС или ВЭЖХ, и реакционные смеси в подходящих случаях подвергали обработке. Между экспериментами можно варьировать очистку: в общем, растворители и соотношения растворителей, использованные для элюентов/градиентов, выбраны для получения подходящих времен удерживания. Если не указано иное, фракции после ВЭЖХ с обращенной фазой концентрировали путем лиофилизации/сушки вымораживанием. Промежуточные и конечные соединения хранили при 0°С или комнатной температуре в закрытых сосудах или колбах под азотом.

Названия соединений образованы с использованием программного обеспечения ACD Labs.

Условия ВЭЖХ, использованные для анализа

Протокол AA и AB: Колонка: Phenomenex Luna C18 (2), 150×3,0 мм, 5 мкм; Подвижная фаза А: 0,02% трифторуксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% трифторуксусной кислоты в ацетонитриле (об./об.); Градиент: от 5% до 100% В (за 10 минут)A или (за 20 минут)B; Скорость потока: 0,75 мл/минута. Температура: не контролировали; Детектирование: ДДМ 215, 254 нм; Вводимый объем 10 мкл; Прибор: HP 1100.

Протокол В: Колонка: Waters Sunfire C18, 50×4,6 мм, 5 мкм; Подвижная фаза А: 0,05% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,05% муравьиной кислоты в ацетонитриле (об./об.); Градиент: от 5% до 95% В за 4 минуты, удержание при 95% В в течение 1 минуты. Скорость потока: 2,0 мл/минута. Температура: комнатная температура; Детектирование: ДДМ 215 нм; Вводимый объем 4 мкл; Прибор: масс-спектрометр Waters LC and ZQ Mass Spectrometer.

Протокол С: Колонка: Waters Acquity UPLC HSS T3, C18, 2,1×50 мм, 1,7 мкм; Подвижная фаза А: 0,1% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,1% муравьиной кислоты в ацетонитриле (об./об.); Градиент: 5% В за 0,1 минуты, от 5% до 95% В за 2,5 минуты, 95% В за 0,35 минуты; Скорость потока; 1,25 мл/минута. Температура: 60°С; Детектирование: 200-450 нм; МС (+) диапазон: 100-2000 дальтон; Вводимый объем: 5 мкл; Прибор: Waters Acquity.

Протокол D: Колонка: Waters Acquity UPLC HSS Т3, С18, 2,1×50 мм, 1,7 мкм; Подвижная фаза А: 0,1% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,1% муравьиной кислоты в ацетонитриле (об./об.); Градиент: 5% В за 0,1 минуты, от 5% до 95% В за 1,5 минуты, 95% В за 0,35 минуты; Скорость потока: 1,25 мл/минута. Температура: 60°С; Детектирование: 200-450 нм; МС (+) диапазон: 100-2000 дальтон; Вводимый объем: 5 мкл; Прибор: Waters Acquity.

Протокол Е: Колонка: Phenomenex Luna С18 (2), 150×3,0 мм, 5 мкм; Подвижная фаза А: 0,02% трифторуксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% трифторуксусной кислоты в ацетонитриле (об./об.); Градиент: от 0% до 100% В за 23,5 минуты; Скорость потока: 1,5 мл/минута. Температура: не контролировали; Детектирование: ДДМ 210 нм; Вводимый объем: 10 мкл; Прибор: Agilent 1100 HPLC.

Протокол F: Колонка: Phenomenex Luna С18 (2), 150×3,0 мм, 5 мкм; Подвижная фаза А: 0,1% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,1% муравьиной кислоты в ацетонитриле (об./об.); Градиент: 5% В за 1,5 минуты, от 5% до 100% В за 8,5 минут, затем 100% В в течение 1 минуты; Скорость потока: 0,75 мл/минута. Температура: 45°С; Детектирование: ДДМ 215 нм, 254 нм; МС (+) диапазон: 150-2000 дальтон; Вводимый объем: 10 мкл; Прибор: Agilent 1200 LCMS.

Протокол G: Колонка: Atlantis dC18, 50×4,6 мм, 5 мкм; Подвижная фаза А: 0,05% трифторуксусной кислоты в воде (об./об.); Подвижная фаза В: 0,05% трифторуксусной кислоты в ацетонитриле (об./об.); Градиент: от 5% до 95% В за 4,0 минуты, линейный, затем удержание при 95% В в течение 1 минуты. Скорость потока: 2 мл/минута. Температура: комнатная температура; Детектирование: ДДМ 215 нм; МС (+) диапазон: 160-1000 дальтон; Вводимый объем 4 мкл; Прибор: Waters 996 PDA.

Протокол Н: Колонка: Phenomenex Luna С18 (2), 150×3,0 мм, 5 мкм; Подвижная фаза А: вода; Подвижная фаза В: ацетонитрил; Градиент: 5% В за 1,5 минуты, от 5% до 100% В за 8,5 минут, затем 100% В в течение 1 минуты; Скорость потока: 0,75 мл/минута. Температура: 25°С; Детектирование: ДДМ 215 нм, 254 нм; МС (+) диапазон: 150-2000 дальтон; Вводимый объем: 10 мкл; Прибор: Agilent 1200 LCMS.

Протокол I: Колонка: Xtimate C18, 2,1×30 мм, 3 мкм; Подвижная фаза А: 0,1% трифторуксусной кислоты в воде (об./об.); Подвижная фаза В: 0,1% трифторуксусной кислоты в ацетонитриле (об./об.); Градиент от 0% до 60% В за 0,9 минуты, 60% В за 0,6 минуты; 100% В в течение 0,5 минуты; Скорость потока: 1,2 мл/минута. Детектирование: ДДМ 220 нм; Температура: 25°С; Вводимый объем: 1 мкл; Прибор: Agilent.

Протокол J: Колонка: Xtimate C18, 2,1×30 мм, 3 мкм; Подвижная фаза А: 0,1% трифторуксусной кислоты в воде (об./об.); Подвижная фаза В: 0,1% трифторуксусной кислоты в ацетонитриле (об./об.); Градиент: от 10% до 80% В за 0,9 минуты, 80% В за 0,6 минуты; 100% В в течение 0,5 минуты; Скорость потока: 1,2 мл/минута. Детектирование: ДДМ 220 нм; Температура: 25°С; Вводимый объем: 1 мкл; Прибор: Agilent.

Протокол K: Колонка: Phenomenex Luna PFP, 100×3 мм, 5 мкм; Подвижная фаза А: 0,05% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,05% муравьиной кислоты в ацетонитриле (об./об.); Градиент: от 5% до 95% В за 9 минут, удержание при 95% В в течение 1 минуты. Скорость потока: 1,0 мл/минута. Температура: комнатная температура; Детектирование: ДДМ 215 нм; Вводимый объем: 4 мкл; Прибор: масс-спектрометр Waters LC and ZQ Mass Spectrometer.

Протокол L: Колонка: Phenomenex Gemini-NX, C18, 4,6 мм × 50 мм, 110А, 3 мкм, Подвижная фаза А: 0,1% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,1% муравьиной кислоты в ацетонитриле (об./об.); Градиент от 5% до 100% В за 0,0-4,10 минуты; удержание при 100% В в течение 4,10-4,50 минут; Скорость потока: 1,25 мл/минута. Температура: 60°С; Детектирование: 200-450 нм; МС (+) диапазон: 100-2000 дальтон; Вводимый объем: 5 мкл; Прибор: Waters Acquity.

Протокол М: Колонка: Phenomenex Gemini-NX, 4,6 мм × 50 мм, C18, 3 мкм, 110А; Подвижная фаза А: 0,1% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,1% муравьиной кислоты в ацетонитриле (об./об.); Градиент: от 5% до 100% В за 4,10 минуты, удержание при 100% В в течение 0,4 минуты, затем от 100% до 5% В за 0,5 минуты; Скорость потока: 1,5 мл/минута. Температура: 60°С; Детектирование: ДДМ (1315А) в НР1100, сканирование: 200-450 нм; интервал 1 нм; ИЭР-МС (+/-), сканирование: 100-1200 m/z, время сканирования 0,5 сек, Центроидный метод; Вводимый объем: 5 мкл; Оборудование: насос для ВЭЖХ, детектор ДДМ, термостат колонок от Agilent Technologies, Wilmington, DE; автоматический пробоотборник и МС детектор от Waters Corporation, Milford, MA; ELS детектор от Varian medical devices, Palo Alto, CA.

Протокол N: Колонка: YMC ODS-A, 4,6×150 мм, 5 мкм; Подвижная фаза А: 0,01% трифторуксусной кислоты в воде (об./об.); Подвижная фаза В: 0,01% трифторуксусной кислоты в ацетонитриле (об./об.); Градиент: от 10% до 100% В за 15 минут; Скорость потока: 1,0 мл/минута. Температура: не контролировали; Детектирование: ДДМ 230 нм; Вводимый объем: 5 мкл; Прибор: Agilent 1100 HPLC.

Протокол О: масс-спектры высокого разрешения с ионизацией электрораспылением (ИЭР-МСВР) получали с использованием APEXII FTICR масс-спектрометра от Bruker (Billerica, MA), оснащенного сверхпроводящим магнитом 9,4 Тесла с активной защитой (Magnex Scientific Ltd., UK), внешним источником ИЭР Bruker APOLLO и лазером непрерывного излучения Synrad 50W CO2 CW. В масс-спектрометр образец вводили проточной инжекцией с помощью носителя-растворителя, состоящего из смеси 1:1 (об./об.) вода: ацетонитрил (0,25% муравьиной кислоты) при скорости потока 50 мкл/минута. Для сбора и анализа данных использовали программное обеспечение Bruker Xmass. Масс-спектр калибровали внешним образом с использованием смеси HP tuning mix.

Протокол Р: Колонка: YMC ODS-A, 4,6×150 мм, 5 мкм; Подвижная фаза А: 0,01% трифторуксусной кислоты в воде (об./об.); Подвижная фаза В: 0,01% трифторуксусной кислоты в ацетонитриле (об./об.); Градиент: от 10% до 100% В за 19 минут; Скорость потока: 1,0 мл/минута. Температура: не контролировали; Детектирование: ДДМ 230 нм; Вводимый объем: 5 мкл; Прибор: Agilent 1100 HPLC.

Протокол Q: Колонка: Agilent Poroshell 300SB-C8, 75×2,1 мм, 2,6 мкм; Подвижная фаза А: 0,1% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,1% муравьиной кислоты в ацетонитриле (об./об.); Градиент: от 20% В до 45% В за 4 минуты; Скорость потока: 1,0 мл/минута. Температура: 60°С; Детектирование: 220 нм; МС (+) диапазон: 400-2000 Да; Вводимый объем: 10 мкл; Прибор: Agilent 1100 LC, Waters MicromassZQ MS. Деконволюцию осуществляли с использованием MaxEnt1.

Условия ВЭЖХ, использованные для очистки

Метод А: Колонка: Phenomenex Gemini, C18, 30×100 мм, 5 мкм; Подвижная фаза А: 0,02% уксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле (об./об.); Градиент: изменяющийся, возрастающий градиент В в А за 15-20 минут; Скорость потока: 20 мл/минута. Температура: не контролировали; Детектирование: ДДМ 215 нм, 254 нм; Вводимый объем: переменный; Прибор: Gilson.

Метод В*: Колонка: YMC ODS-A, 30×250 мм, 10 мкм; Подвижная фаза А: 0,02% уксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле (об./об.); Градиент: переменный, возрастающий градиент В в А за 15-20 минут; Скорость потока: 20 мл/минута. Температура: не контролировали; Детектирование: ДДМ 230 нм; Вводимый объем: переменный, 0,5-2 мл; Прибор: Varian ProStar Model 330 preparative HPLC (для препаративной ВЭЖХ).

Метод С*: Колонка: Phenomenex Luna C18(2), 150×21,2 мм, 5 мкм; Подвижная фаза А: вода; Подвижная фаза В: ацетонитрил; Градиент: изменяющийся, возрастающий градиент В в А за 10 минут; Скорость потока: 27 мл/минута. Температура: комнатная температура; Детектирование: ДДМ 210-360 нм; МС (+) диапазон: 150-2000 дальтон; Прибор: Waters Fraction Lynx LCMS.

Метод D*: Колонка: Waters Sunfire, C18, 19×100 мм, 5 мкм; Подвижная фаза А: 0,05% муравьиной кислоты в воде (об./об.); Подвижная фаза В: 0,05% муравьиной кислоты в ацетонитриле (об./об.); Градиент: изменяющийся, возрастающий градиент В в А за 10-20 минут; Скорость потока: 25 мл/минута. Детектирование: ДДМ 215 нм; МС (+) диапазон: 160-1000 дальтон; Прибор: Waters FractionLynx.

Метод Е: Колонка: Waters Sunfire, C18, 19×100 мм, 5 мкм; Подвижная фаза А: 0,05% трифторуксусной кислоты в воде (об./об.); Подвижная фаза В: 0,05% трифторуксусной кислоты в ацетонитриле (об./об.); Градиент: от 10 до 50% В за 8,5 минут, от 50 до 100% В за 0,5 минуты, удержание при 100% B в течение 1 минуты. Скорость потока: 25 мл/минута. Детектирование: ДДМ 215 нм; МС (+) диапазон: 160-1000 дальтон; Прибор: Waters FractionLynx.

Метод F*: Колонка: Waters C18 DELTA РАК (WAT011801), 300×50 мм, 15 мкм; Подвижная фаза А: 0,02% уксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле (об./об.); Градиент: изменяющийся, возрастающий градиент B в А за 15-20 минут; Скорость потока: 50 мл/минута. Температура: не контролировали; Детектирование: ДДМ 230 нм; Вводимый объем: переменный, 0,5-5 мл; Прибор: Varian ProStar Model 330 preparative HPLC (для препаративной ВЭЖХ).

Метод G*: Колонка YMC ODS-A, 50×300 мм, 12 мкм, 120 А. Подвижная фаза А: 0,02% уксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле (об./об.); Градиент: 40% B в течение 3 минут, 40-100% В за 20 минут и 100% B в течение 3 минут. Скорость потока; 20 мл/минута. Температура: не контролировали; Детектирование: ДДМ 230 нм; Вводимый объем: переменный, 0,5-5 мл; Прибор: Varian ProStar Model 330 preparative HPLC (для препаративной ВЭЖХ).

Метод Н: Колонка: Cromolith RP-18e 100-10 мм. Подвижная фаза А: 0,02% уксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле (об./об.); Градиент: 20-55% В за 30 минут, 55-100% В за 4 минуты, 100-20% В за 2 минуты и 20% B в течение 2 минут. Скорость потока; 2,5 мл/минута. Температура: не контролировали; Детектирование: ДДМ 230 нм; Вводимый объем: переменный, 0,025-0,1 мл; Прибор: Agilent 1100 analytical HPLC (для аналитической ВЭЖХ).

Метод I: Колонка: C18 semiprep YMC-Pack ODS-A 250×10 мм (S-5 мкм, 12 нм). Подвижная фаза А: 0,02% уксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле (об./об.); Градиент: 18-25% В за 22 минуты, 25-95% В за 1 минуту, 95% B в течение 4 минут, 95-18% В за 1 минуту и 18% B в течение 6 минут. Скорость потока: 2,5 мл/минута. Температура: не контролировали. Детектирование: ДДМ 230 нм. Вводимый объем: переменный, 0,025-0,1 мл. Прибор: Agilent 1200 analytical HPLC (для аналитической ВЭЖХ).

Метод J: Колонка: C18 semiprep YMC-Pack ODS-A 250×10 мм (S-5 мкм, 12 нм). Подвижная фаза А: 0,02% уксусной кислоты в воде (об./об.); Подвижная фаза В: 0,02% уксусной кислоты в ацетонитриле (об./об.); Градиент: 20-30% В за 30 минут, 30-95% В за 1 минуту, 95% B в течение 4 минут, 95-20% В за 2 минуты и 20% B в течение 6 минут. Скорость потока: 2,5 мл/минута. Температура: не контролировали. Детектирование: ДДМ 230 нм. Вводимый объем: переменный, 0,025-0,1 мл. Прибор: Agilent 1200 analytical HPLC (для аналитической ВЭЖХ).

Метод K: Колонка: Cromolith RP-18e 100-10 мм. Подвижная фаза А: вода (об./об.); Подвижная фаза В: ацетонитрил (об./об.); Градиент: 30-65% В за 20 минут, 65-95% В за 1 минуту, 95-30% В за 2 минуты. Скорость потока; 2,5 мл/минута. Температура: не контролировали; Детектирование: ДДМ 230 нм; Вводимый объем: переменный, 0,025-0,1 мл; Прибор: Agilent 1200 analytical HPLC (для аналитической ВЭЖХ).

В некоторых случаях в условия очистки посредством ВЭЖХ были внесены некоторые незначительные изменения, такие как, без ограничения ими, изменение градиента, длительности градиента и скорости потока, что обозначено символом *.

Общие методики

Общая методика А: Получение активированного N-гидрокси-сукцинимидного (NHS) сложного эфира.

К 0,1 М раствору кислоты в тетрагидрофуране при 0°С добавляли N,N'-дициклогексилкарбодиимид (DCC) (2,2 экв.), а затем N-гидроксисукцинимид (2,2 экв.) и реакционную смесь оставляли нагреваться до комнатной температуры и перемешивали. За протеканием реакции следили с помощью ЖХ-МС (или ВЭЖХ, или ТСХ); реакция обычно завершалась в пределах 1-72 часов. Растворители удаляли при пониженном давлении и остаток очищали посредством хроматографии с обращенной фазой с получением целевого N-гидроксисукцинимидного сложного эфира.

Общая методика В: Получение амидов из NHS сложных эфиров.

К 0,1 М N-гидроксисукцинимидному сложному эфиру (1 экв.) в любом из тетрагидрофурана, N,N-диметилформамида (DMF) или N,N-диметилацетамида (DMAc) при 0°С добавляли амин (от 1 до 10 экв.). За протеканием реакции следили с помощью ЖХ-МС (или ВЭЖХ, или ТСХ); реакция обычно завершалась в пределах 1-72 часов. Реакционную смесь концентрировали в вакууме и остаток очищали посредством хроматографии с обращенной фазой с получением целевого амидного продукта.

Общая методика С: Получение пентафторфенилового (PFP) сложного эфира.

К 0,05 М раствору кислоты в тетрагидрофуране при 0°С добавляли DCC (1 экв.), а затем раствор пентафторфенола (от 2 до 4 экв.), растворенного в тетрагидрофуране (0,3 М). Реакционную смесь нагревали до комнатной температуры и перемешивали. За протеканием реакции следили с помощью ЖХ-МС (или ВЭЖХ, или ТСХ); реакция обычно завершалась в пределах 1-48 часов. Реакционную смесь концентрировали при пониженном давлении и остаток очищали посредством хроматографии с обращенной фазой с получением целевого пентафторфенилового (PFP) сложного эфира.

Общая методика D: Библиотечный протокол получения амидов из NHS сложного эфира. Амин (1 экв.) растворяли в тетрагидрофуране (1 мл, 0,04 М) и добавляли N,N-диизопропилэтиламин (5 экв.), а затем метанол (0,2 мл). Затем весь раствор по каплям добавляли к охлажденному раствору (0°С) N-гидроксисукцинимидного сложного эфира (1 экв.), растворенного в тетрагидрофуране (1 мл, 0,04 М). Реакционную смесь перемешивали при 0°С в течение 30 минут и затем оставляли нагреваться до комнатной температуры и перемешивали вплоть до 72 часов. За протеканием реакции следили с помощью ЖХ-МС (или ВЭЖХ, или ТСХ); реакция обычно завершалась в пределах 1-72 часов. Растворители удаляли в вакууме, остаток очищали посредством хроматографии с обращенной фазой и фракции, которые имели отношение к целевому продукту, объединяли и лиофилизировали с получением целевых амидов.

Общая методика Е: Получение амидов через in situ образование NHS сложных эфиров.

К раствору (0,08 М) кислоты (1 экв.) (0°С или комнатная температура) в тетрагидрофуране или N,N-диметилформамиде, или N,N-диметилацетамиде добавляли DCC (2,2 экв.), а затем N-гидроксисукцинимид (2,2 экв.), и реакционную смесь или перемешивали при 0°С, или оставляли нагреваться до комнатной температуры и перемешивали до тех пор, пока анализ методом ЖХ/МС не указал на израсходование большей части исходной кислоты. Реакционную смесь снова охлаждали до 0°С, добавляли амин (от 1 до 20 экв.), нагревали до комнатной температуры и перемешивали. За протеканием реакции следили с помощью ЖХ-МС (или ВЭЖХ, или ТСХ); реакция обычно завершалась в пределах 1-72 часов. Реакционную смесь концентрировали в вакууме и остаток очищали посредством хроматографии с обращенной фазой с получением целевого амида.

Общая методика F: Получение амидов из NHS сложных эфиров. Смесь амина (или кислотной соли амина) (1,0 экв.) и N,N'-диизопропилэтиламина (5 экв.) в метаноле (0,2 мл) перемешивали в течение 15 минут и полученный раствор переносили в раствор NHS сложного эфира (1,0 экв.) в тетрагидрофуране (1,0 мл). Реакционную смесь перемешивали при комнатной температуре с добавлением дополнительного количества амина (1-3 экв.) до тех пор, пока анализ методом ЖХ/МС не указал на израсходование большей части NHS-сложноэфирного исходного материала. Реакционную смесь концентрировали в вакууме и остаток очищали посредством хроматографии с обращенной фазой с получением целевого амидного продукта.

Пример А1

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметил-тетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата #В1.

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата #В1. К охлажденному (0°С) раствору #NP1 (103 мг, 0,192 ммоль, 1 экв.) в тетрагидрофуране (2 мл, 0,096 М) добавляли DCC (87,1 мг, 0,422 ммоль, 2,2 экв.) и реакционную смесь перемешивали в течение 15 минут. Добавляли N-гидроксисукцинимид (48,6 мг, 0,422 ммоль, 2,2 экв.) и реакционную смесь перемешивали при 0°С в течение 15 минут, нагревали до комнатной температуры и перемешивали в течение 72 часов. Реакционную смесь концентрировали в вакууме и остаток очищали посредством хроматографии среднего давления с обращенной фазой С18 (градиент: от 5% до 90% воды в ацетонитриле с 0,02% уксусной кислоты в каждой фазе). Фракции, которые имели отношение к целевому продукту, лиофилизировали с получением #В1 в виде твердого вещества. Выход: 66,6 мг, 0,103 ммоль, 54%. ВЭЖХ (Протокол AA): время удерживания составляет 8,170 минуты (чистота 91%). ЖХ-МС (Протокол D): m/z 633,3 [M+H]+, время удерживания составляет 0,81 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ м.д. 7.78 (d, J=8,02 Гц, 1 Н), 6.37-6.30 (m, 2 H), 6.09 (m, 1 H), 5.85 (dd, J=11,54, 7,43 Гц, 1 Н), 5.59 (dd, J=16,04, 5,28 Гц, 1 H), 5.50 (t, J=7,04 Гц, 1 H), 5.07 (d, J=6,06 Гц, 1 H, D2O заменяемый), 4.34-4.25 (m, 2 H), 3.63 (d, J=5,48 Гц, 2 Н), 3.48 (td, J=7,09, 2,64 Гц, 1 Н), 3.27 (d, J=5,28 Гц, 1 H), 2.97 (d, J=6,85 Гц, 2 H), 2.82-2.77 (m, 4 H), 2.59 (d, J=5,09 Гц, 1 H), 2.33-2.11 (m, 2 H), 1.96 (s, 3 H), 1.92 (d, J=8,22 Гц, 1 H), 1.82-1.77 (m, 2 H), 1.68 (s, 3 H), 1.66-1.6 (br. s, 1 H), 1.59-1.55 (m, 1 H), 1.23 (d, J=6,46 Гц, 3 H), 1.05 (d, J=6,26 Гц, 3 H), 0.93 (d, J=7,24 Гц, 3 H).

Пример А2

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В2).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В2). К охлажденному (0°С) раствору #NP2 (430 мг, 0,828 ммоль, 1 экв.) в тетрагидрофуране (6 мл, 0,13 M) добавляли DCC (376 мг, 1,82 ммоль, 2,2 экв.), а затем N-гидроксисукцинимид (210 мг, 1,82 ммоль, 2,2 экв.). Реакционную смесь оставляли нагреваться до комнатной температуры. Через 18 часов белое твердое вещество отфильтровывали и концентрировали фильтрат до желтого остатка. Остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В2 в виде белого твердого вещества. Выход: 204 мг, 0,331 ммоль, 40%. ВЭЖХ (Протокол AA): время удерживания составляет 9,463 минуты (чистота 77%). ЖХ-МС (Протокол D): m/z 617,3 [М+Н]+, время удерживания составляет 0,91 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ м.д. 7.72 (d, J=7,81 Гц, 1 H), 6.32-6.21 (m, 2 H), 6.04 (m, 1 H), 5.85 (dd, J=11,48, 7,21 Гц, 1 H), 5.57 (dd, J=15,80, 4,90 Гц, 1 H), 5.47 (t, J=7,04 Гц, 1 H), 4.53-4.47 (m, 1 H), 4.32-4.25 (m, 1 H), 3.62-3.55 (m, 2 H), 3.45-3.41 (m, 1 H), 2.95 (d, J=6,60 Гц, 2 H), 2.74 (s, 3 H), 2.59 (dd, J=16,00, 4,68 Гц, 2 H), 2.30-2.07 (m, 2 H), 1.91 (s, 3 H), 1.77-1.65 (m, 4 H), 1.63 (br s, 4 H), 1.61-1.57 (m, 1 H), 1.48 (dd, J=13,27, 7,02 Гц, 1 H), 1.19 (d, J=6,24 Гц, 3 H), 1.050 (d, J=6,24 Гц, 3 H), 0.89 (d, J=7,41 Гц, 3 H).

Пример A3

Синтез пентафторфенил-[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В3).

Стадия 1. Синтез пентафторфенил-[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В3). К раствору #NP1 (25 мг, 0,047 ммоль, 1 экв.) в тетрагидрофуране (0,7 мл, 0,06 М) добавляли DCC (9,7 мг, 0,047 ммоль, 1 экв.), а затем раствор пентафторфенола (17,3 мг, 0,094 ммоль, 2 экв.) в тетрагидрофуране (0,3 мл, 0,3 М). Реакционную смесь перемешивали при комнатной температуре в течение 18 часов, фильтровали и осадок на фильтре ополаскивали ацетонитрилом. Объединенные фильтраты концентрировали в вакууме и неочищенный материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В3 в виде белого твердого вещества. Выход: 21,6 мг, 0,030 ммоль, 65%. ВЭЖХ (Протокол AB): время удерживания составляет 15,617 минуты (чистота 87%). ЖХ-МС (Протокол D): m/z 702,2 [М+Н]+, время удерживания составляет 1,0 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ: 7.79 (d, J=7,8 Гц, 1Н), 6.38 (t, J=6,2 Гц, 1Н), 6.32 (d, J=16,4 Гц, 1Н), 6.12 (dd, J=11,7, 1,2 Гц, 1Н), 5.88 (dd, J=11,5, 7,6 Гц, 1Н), 5.64 (dd, J=16,0, 5,1 Гц, 1Н), 5.45 (t, J=7,0 Гц, 1Н), 5.10 (d, J=6,2 Гц, 1Н), 4.43 (dd, J=7,0, 3,9 Гц, 1Н), 4.32 (t, J=4,7 Гц, 1Н), 3.70-3.60 (m, 1Н), 3.51-3.43 (m, 1Н), 3.12 (d, J=6,6 Гц, 1Н), 2.82 (d, J=5,1 Гц, 1Н), 2.65 (d, J=5,1 Гц, 1Н), 2.36-2.15 (m, 2 H), 2.02-1.91 (m, 3 H), 1.81 (br. s, 1Н), 1.71 (s, 3 H), 1.68-1.59 (m, 4 H), 1.27 (d, J=6,2 Гц, 3 H), 1.06 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 H).

Пример А4

Получение (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В5).

Стадия 1. Синтез [(3R,5S,7R,8R)-8-гидрокси-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В4). К раствору #NP1 (10,2 мг, 0,019 ммоль, 1 экв.), растворенного в смеси 1:1 тетрагидрофуран/вода (1,5 мл, 0,012 М), добавляли гидроксид лития (6 мг, 0,25 ммоль, 13 экв.). Реакционную смесь перемешивали при комнатной температуре в течение 1,5 часов и растворители удаляли в вакууме. Неочищенный остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В4 в виде твердого вещества. Выход: 2 мг, 0,004 ммоль, 20%. ВЭЖХ (Протокол А): время удерживания составляет 7,850 минуты (чистота 93%). ЖХ-МС (Протокол D): m/z 494,1 [М+Н]+, время удерживания составляет 0,68 минуты. 1H ЯМР (400 МГц, CDCl3) δ 6.46 (d, J=8,6 Гц, 1 H), 6.28 (d, J=16 Гц, 1 H), 6.09 (dd, J=11,9 и 5,3 Гц, 1 H), 5.73 (dd, J=12,1 и 1,6 Гц, 1 H), 5.57 (dd, J=15,6 и 5,9 Гц, 1 H), 5.39-5.32 (m, 1 H), 4.75-4.66 (m, 1 H), 4.50-4.41 (m, 1 H), 4.19-4.13 (m, 1H), 3.89-3.82 (m, 1 H), 3.68-3.59 (m, 1 H), 3.52-3.43 (m, 2 H), 2.99 (dd, J=15,2 и 9,4 Гц, 1 H), 2.94 (d, J=4,3 Гц, 1 H), 2.59-2.49 (m, 2 H), 2.36-2.25 (m, 1 H), 2.20-2.09 (m, 2 H), 1.94-1.79 (m, 2 H), 1.76-1.68 (m, 1 H), 1.66 (s, 3 H), 1.63 (d, J=3,9 Гц, 1 H), 1.27 (d, J=6,6 Гц, 3 H), 1.08 (d, J=6,2 Гц, 3 H), 0.93 (d, J=7,4 Гц, 3 Н).

Стадия 2. Синтез (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В5). Получали согласно общей методике синтеза #В1, описанной в Примере А1, за исключением того, что #В4 использовали вместо #NP1. Неочищенную реакционную смесь концентрировали в вакууме и затем очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В5 в виде твердого вещества. Выход: 16,2 мг, 0,027 ммоль, 64%. ЖХ-МС (Протокол D): m/z 591,3 [М+Н]+, время удерживания составляет 0,71 минуты. 1H ЯМР (500 МГц, DMSO-d6, мульт., J в Гц) δ 7.78 (d, J=8,0 Гц, 1 Н), 6.35 (d, J=15,6 Гц, 1 H), 5.97 (dd, J=11,9 и 1,2 Гц, 1 Н), 5.87 (dd, J=11,7 и 7,1 Гц, 1 Н), 5.61 (dd, J=15,6 и 5,1 Гц, 1 Н), 5.55-5.49 (m, 1 Н), 5.22-5.14 (m, 1 Н), 5.11 (d, J=4,7 Гц, 1 Н), 5.08 (d, J=6,0 Гц, 1 Н), 4.36-4.25 (m, 2 Н), 3.69-3.60 (m, 2 Н), 3.53-3.45 (m, 1 Н), 3.31-3.27 (m, 1 Н), 2.99 (d, J=6,7 Гц, 2 Н), 2.84-2.76 (m, 4 Н), 2.61 (d, J=5,0 Гц, 1 Н), 2.34-2.26 (m, 1 Н), 2.24-2.15 (m, 1 Н), 1.95 (dd, J=13,0 и 8,2 Гц, 1 Н), 1.87-1.73 (m, 2 Н), 1.72-1.62 (m, 4 Н), 1.59 (dd, J=13,0 и 3,6 Гц, 1 Н), 1.11 (d, J=6,4 Гц, 3 Н), 1.06 (d, J=6,4 Гц, 3 Н), 0.95 (d, J=7,3 Гц, 3 Н).

Пример А5

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-гидразинил-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В6).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-гидразинил-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В6). Гидразин (0,615 мл 1 М раствора в тетрагидрофуране, 0,615 ммоль, 5 экв.) добавляли к раствору #В1 (78 мг, 0,12 ммоль, 1 экв.), растворенного в дихлорметане (3 мл, 0,04 М), перемешивали при комнатной температуре в течение 1 часа и затем добавляли дополнительное количество гидразина (0,615 мл 1 М раствора в тетрагидрофуране, 0,615 ммоль, 5 экв.). Через 1 час реакционную смесь разбавляли водой и экстрагировали дихлорметаном (3х), органические слои объединяли, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В6 в виде твердого вещества. Выход: 43 мг, 58%. ВЭЖХ (Протокол А): время удерживания составляет 6,870 минуты (чистота составляет 72%). ЖХ-МС (Протокол С): m/z 550,4 [M+H]+, время удерживания составляет 1,15 минуты. 1Н ЯМР (400 МГц, DMSO-d6) δ 8.99 (s, 1 H), 7.78 (d, J=8,2 Гц, 1 H), 6.42-6.25 (m, 2 H), 6.11 (dd, J=11,5 и 1,4 Гц, 1 Н), 5.86 (dd, J=11,7 и 7,4 Гц, 1 H), 5.60 (dd, J=16 и 5,9 Гц, 1 H), 5.55-5.49 (m, 1 H), 5.02 (d, J=5,5 Гц, 1 H), 4.32-4.07 (m, 4 H), 3.70-3.60 (m, 2 H), 3.54-3.45 (m, 1 H), 3.22 (каж. t, J=4,9 Гц, 1 H), 2.74 (d, J=5,1 Гц, 1 H), 2.58 (d, J=5,1 Гц, 1 H), 2.44 (dd, J=14,2 и 8,4 Гц, 1 H), 2.35-2.25 (m, 1 H), 2.24-2.14 (m, 2 H), 1.97 (s, 3 H), 1.91-1.77 (m, 3 H), 1.70-1.60 (m, 4 H), 1.46 (dd, J=12,9 и 3,5 Гц, 1 H), 1.25 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,6 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 H).

Пример А6

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-гидразинил-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В7).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-гидразинил-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В7). К раствору #NP2 (140 мг, 0,269 ммоль, 1 экв.) в тетрагидрофуране (4 мл, 0,07 M) добавляли DCC (122 мг, 0,592 ммоль, 2,2 экв.), а затем N-гидроксисукцинимид (68,1 мг, 0,592 ммоль, 2,2 экв.). Через 18 часов добавляли гидразин (0,576 мл 1 М раствора в тетрагидрофуране, 0,576 ммоль, 2,1 экв.). Через 30 минут добавляли дополнительное количество гидразина (1 мл 1 М раствора в тетрагидрофуране, 1 ммоль, 3,7 экв.). Через 10 минут реакционную смесь концентрировали в вакууме и неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод С*) с получением #В7 в виде твердого вещества. Выход: 78 мг, 0,145 ммоль, 54%. ВЭЖХ (Протокол F): m/z 534,4 [М+Н]+, время удерживания составляет 8,143 минуты (чистота 100%).

Пример А7

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-[(2-гидроксиэтил)амино]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В8), (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В9), (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-оксо-2-[(4-сульфамоилбензил)амино]этил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В10), (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(4-аминобензил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В11), ацетатной соли (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пиперазин-1-ил)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В12), ацетатной соли (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-(4-метилпиперазин-1-ил)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В13) и (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-(гидроксиамино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В14).

Стадия 1а. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-[(2-гидроксиэтил)амино]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В8). Согласно общей методике D из 2-аминоэтанола (2,0 мг, 0,033 ммоль, 1,03 экв.), тетрагидрофурана (1 мл), N,N-диизопропилэтиламина (0,028 мл, 0,160 ммоль, 5 экв.), метанола (0,2 мл) и #В1 (20 мг, 0,032 ммоль, 1 экв.) синтезировали неочищенный целевой материал, который очищали посредством хроматографии с обращенной фазой (Метод D*) с получением #В8 в виде твердого вещества. Выход: 17,6 мг, 0,031 ммоль, 97%. ВЭЖХ (Протокол В): m/z 579,6 [М+Н]+, время удерживания составляет 2,00 минуты (чистота 100%).

Стадия 1b. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В9). К раствору #В1 (15 мг, 0,024 ммоль, 1 экв.), растворенного в тетрагидрофуране (1 мл, 0,024 М), добавляли аммиак (0,069 мл 7 М раствора в метаноле, 0,480 ммоль, 20 экв.) После перемешивания в течение 3,5 часов растворители удаляли в вакууме и неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод С*) с получением #В9 в виде твердого вещества. Выход: 6 мг, 0,012 ммоль, 50%. ВЭЖХ (Протокол F): m/z 535,3 [М+Н]+, время удерживания составляет 7,796 минуты (чистота 100%). 1H ЯМР (400 МГц, DMSO-d6) δ 7.78 (d, J=8,2 Гц, 1 Н), 7.30 (s, 1 H), 6.77 (s, 1 H), 6.40-6.28 (m, 2 H), 6.10 (d, J=11,7 Гц, 1 Н), 5.87 (dd, J=11,5 и 7,6 Гц, 1 Н), 5.61 (dd, J=15,8 и 5,7 Гц, 1 Н), 5.54-5.47 (m, 1 H), 4.99 (d, J=5,9 Гц, 1 Н), 4.29-4.20 (m, 2 H), 3.69-3.61 (m, 2 H), 3.53-3.46 (m, 1 H), 3.23 (каж. t, J=5,1 Гц, 1 H), 2.74 (d, J=5,1 Гц, 1 H), 2.57 (d, J=5,1 Гц, 1 H), 2.48-2.44 (m, 1 H), 2.36-2.25 (m, 1 H), 2.25-2.16 (m, 2 H), 1.97 (s, 3 H), 1.87-1.77 (m, 2 H), 1.69 (s, 3 H), 1.68-1.60 (m, 2 H), 1.49 (dd, J=13,1 и 3,7 Гц, 1 H), 1.25 (d, J=6,6 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 H).

Стадия 1с. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-оксо-2-[(4-сульфамоилбензил)амино]этил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В10). Согласно общей методике D из гидрохлоридной соли 4-(аминометил)бензолсульфонамида (9,2 мг, 0,041 ммоль, 1 экв.), тетрагидрофурана (1 мл), N,N-диизопропилэтиламина (0,035 мл, 0,200 ммоль, 5 экв.), метанола (0,2 мл) и #В1 (25 мг, 0,040 ммоль, 1 экв.) синтезировали неочищенный целевой материал, который очищали посредством хроматографии с обращенной фазой (Метод D*) с получением #В10 в виде твердого вещества. Выход: 15,5 мг, 0,022 ммоль, 55%. ВЭЖХ (Протокол В): m/z 704,4 [М+Н]+, время удерживания составляет 2,36 минуты (чистота 100%). 1Н ЯМР (400 МГц, МЕТАНОЛ-d4) δ: 8.58 (br. s., 1H), 7.80 (d, J=8,2 Гц, 1H), 7.63 (d, J=8,6 Гц, 2 Н), 7.45 (d, J=8,2 Гц, 2Н), 6.42-6.32 (m, 2 H), 6.02-5.90 (m, 2 H), 5.67 (dd, J=15,8, 6,0 Гц, 1H), 5.53 (t, J=7,0 Гц, 1H), 4.62-4.54 (m, 1H), 4.46 (d, J=4,3 Гц, 1H), 4.42-4.32 (m, 2 H), 3.78-3.65 (m, 2 H), 3.58 (t, J=5,8 Гц, 1H), 3.43 (d, J=5,8 Гц, 1H), 2.92-2.81 (m, 2 H), 2.66 (d, J=5,1 Гц, 1H), 2.40 (m, 2 H), 2.24 (m, 1H), 2.02-2.02 (m, 3 H), 1.98 (s, 1H), 1.98-1.67 (m, 2 H), 1.90-1.85 (m, 1 H), 1.83-1.80 (m, 1 H), 1.77 (s, 2 H), 1.41-1.32 (m, 4 H), 1.13-0.98 (m, 3 H).

Стадия 1d. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(4-аминобензил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В11). Согласно общей методике D из 4-(аминометил)анилина (3,9 мг, 0,032 ммоль, 1 экв.), тетрагидрофурана (1 мл), N,N-диизопропилэтиламина (0,011 мл, 0,064 ммоль, 2 экв.), метанола (0,2 мл) и #В1 (20 мг, 0,032 ммоль, 1 экв.) синтезировали неочищенный целевой материал, который очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В11 в виде твердого вещества. Выход: 17,6 мг, 0,027 ммоль, 86%. ВЭЖХ (Протокол AA): время удерживания составляет 6,748 минуты (чистота 91%). 1H ЯМР (400 МГц, DMSO-d6) δ м.д. 8.14 (t, J=5,77 Гц, 1 H), 7.78 (d, J=8,02 Гц, 1 H), 6.90-6.84 (m, 2 H), 6.48-6.43 (m, 2 H), 6.39-6.30 (m, 1 H), 6.27 (s, 1 H), 6.09 (m, 1 H), 5.88-5.80 (m, 1 H), 5.59 (dd, J=15,85, 5,48 Гц, 1 H), 5.51 (t, J=6,94 Гц, 1 H), 5.01 (d, J=5,28 Гц, 1 H), 4.89 (s, 2 H), 4.30-4.22 (m, 1 H), 4.12-3.99 (m, 1 H), 3.63 (d, J=5,87 Гц, 2 H), 3.49 (td, J=7,04, 2,54 Гц, 1 H), 3.22 (t, J=4,40 Гц, 1 H), 2.73 (d, J=5,09 Гц, 1 H), 2.59-2.50 (m, 2 H), 2.35-2.13 (m, 3 H), 1.96 (s, 3 H), 1.88-1.75 (m, 3 H), 1.69 (s, 3 H), 1.64 (td, J=4,89, 2,54 Гц, 1 H), 1.44 (dd, J=12,81, 3,62 Гц, 1 H), 1.23 (d, J=6,46 Гц, 3 H), 1.04 (d, J=6,46 Гц, 3 H), 0.93 (d, J=7,43 Гц, 3 H).

Стадия 1е. Синтез ацетатной соли (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пиперазин-1-ил)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В12). К раствору #В1 (15,5 мг, 0,024 ммоль, 1 экв.), растворенного в тетрагидрофуране (0,24 мл, 0,048 M), добавляли пиперазин (2,5 мг, 0,029 ммоль, 1,2 экв.) После перемешивания в течение 30 минут реакционную смесь разбавляли водой, экстрагировали дихлорметаном, объединенные органические вещества сушили над сульфатом натрия, фильтровали и растворители удаляли в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В12 в виде белого твердого вещества. Выход: 8,2 мг, 0,012 ммоль, 52%. ВЭЖХ (Протокол AA): время удерживания составляет 6,795 минуты (чистота 80%). ЖХ-МС (Протокол С): m/z 604,3 [М+Н]+, время удерживания составляет 1,01 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.79 (d, J=8,2 Гц, 1 H), 6.41-6.28 (m, 2 H), 6.11 (d, J=10,5 Гц, 1 H), 5.87 (dd, J=11,5 и 7,6 Гц, 1 H), 5.60 (dd, J=16 и 5,1 Гц, 1 H), 5.55-5.48 (m, 1 H), 4.97 (d, J=5,9 Гц, 1 H), 4.31-4.20 (m, 2 H), 3.70-3.60 (m, 2 H), 3.55-3.35 (m, 6 H), 3.27-3.22 (m, 1 H), 2.75 (d, J=5,1 Гц, 1 H), 2.69-2.54 (m, 5 H), 2.36-2.13 (m, 4 H), 1.98 (s, 3 H), 1.88-1.76 (m, 3 H), 1.72-1.61 (m, 4 H), 1.58-1.51 (m, 1 H), 1.25 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 H).

Стадия 1f. Синтез ацетатной соли (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-(4-метилпиперазин-1-ил)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В13). К раствору #В1 (18,8 мг, 0,03 ммоль, 1 экв.), растворенного в тетрагидрофуране (0,500 мл, 0,06 M), добавляли 1-метилпиперазин (3,6 мг, 0,036 ммоль, 1,2 экв.) После перемешивания в течение 30 минут реакционную смесь разбавляли водой, экстрагировали дихлорметаном, объединенные органические вещества сушили над сульфатом натрия, фильтровали и растворители удаляли в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В13 в виде белого твердого вещества. Выход: 11,6 мг, 0,017 ммоль, 57%. ВЭЖХ (Протокол AA): время удерживания составляет 6,422 минуты (чистота 94%). ЖХ-МС (Протокол С): m/z 618,4 [М+Н]+, время удерживания составляет 0,97 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.79 (d, J=7,8 Гц, 1 H), 6.42-6.27 (m, 2 H), 6.11 (d, J=10,5 Гц, 1 H), 5.87 (dd, J=11,3 и 7,4 Гц, 1 H), 5.60 (dd, J=15,8 и 5,3 Гц, 1 H), 5.55-5.48 (m, 1 H), 4.97 (d, J=6,2 Гц, 1 H), 4.30-4.21 (m, 2 H), 3.70-3.61 (m, 2 H), 3.56-3.33 (m, 5 H), 3.25 (каж. t, J=5,5 Гц, 1 H), 2.79-2.65 (m, 2 H), 2.60-2.53 (m, 2 H), 2.35-2.12 (m, 9 H), 1.98 (s, 3 H), 1.88-1.78 (m, 3 H), 1.72-1.61 (m, 4 H), 1.56 (dd, J=12,9 и 3,5 Гц, 1 H), 1.25 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 H).

Стадия 1g. (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-(гидроксиамино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В14). К раствору #В1 (30,7 мг, 0,049 ммоль, 1 экв.), растворенного в тетрагидрофуране (0,450 мл) и N,N-диметилформамиде (0,175 мл), добавляли N,N-диизопропилэтиламин (32 мг, 0,245 ммоль, 5 экв.) и гидрохлорид гидроксиламина (10,6 мг, 0,152 ммоль, 3 экв.) После перемешивания в течение 30 минут реакционную смесь разбавляли водой, экстрагировали этилацетатом (3x), объединенные органические слои опять промывали водой, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В14 в виде белого твердого вещества. Выход: 11,8 мг, 0,021 ммоль, 43%. ВЭЖХ (Протокол AA): время удерживания составляет 7,189 минуты (чистота 96%). ЖХ-МС (Протокол С): m/z 551,2 [М+Н]+, время удерживания составляет 1,18 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 10.42 (s, 1 H), 8.74 (s, 1 H), 7.80 (d, J=7,8 Гц, 1 H), 6.43-6.29 (m, 2 H), 6.16-6.10 (m, 1 H), 5.88 (dd, J=11,7 и 7,4 Гц, 1 H), 5.61 (dd, J=16 и 5,5 Гц, 1 H), 5.57-5.51 (m, 1 H), 5.04 (d, J=5,5 Гц, 1 H), 4.32-4.23 (m, 2 H), 3.72-3.62 (m, 2 H), 3.57-3.48 (m, 1 H), 3.27-3.21 (m, 1 H), 2.76 (d, J=5,1 Гц, 1 H), 2.60 (d, J=5,1 Гц, 1 H), 2.44-2.27 (m, 2 H), 2.26-2.11 (m, 2 H), 2.00 (s, 3 H), 1.92-1.80 (m, 3 H), 1.74-1.63 (m, 4 H), 1.49 (dd, J=12,7 и 3,3 Гц, 1 H), 1.27 (d, J=6,6 Гц, 3 H), 1.09 (d, J=6,2 Гц, 3 H), 0.97 (d, J=7,4 Гц, 3 H).

Пример А8

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В15).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В15). К раствору #В2 (108 мг, 0,175 ммоль, 1 экв.), растворенного в тетрагидрофуране (3 мл, 0,06 M), добавляли аммиак (0,500 мл 7 М раствора в метаноле, 3,5 ммоль, 20 экв.) После перемешивания в течение 1 часа растворители удаляли в вакууме и неочищенный целевой материал очищали посредством хроматографии среднего давления с обращенной фазой С18 (градиент: от 0% до 90% воды в ацетонитриле с 0,02% уксусной кислоты в каждой фазе) с получением #В15 в виде твердого вещества. Выход: 23,9 мг, 0,045 ммоль, 26%. ВЭЖХ (Протокол AA): время удерживания составляет 8,231 минуты (чистота 89%). ЖХ-МС (Протокол С): m/z 519,3 [M+H]+, время удерживания составляет 1,41 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.80 (d, J=7,8 Гц, 1 H), 7.33 (s, 1 H), 6.78 (s, 1 H), 6.42-6.33 (m, 1 H), 6.28 (d, J=16 Гц, 1 H), 6.16-6.10 (m, 1 H), 5.88 (dd, J=11,7 и 7,4 Гц, 1 H), 5.61 (dd, J=15,8 и 5,7 Гц, 1 H), 5.56-5.50 (m, 1 H), 4.60-4.51 (m, 1 H), 4.38-4.27 (m, 1 H), 3.72-3.62 (m, 2 H), 3.56-3.48 (m, 1 H), 2.71-2.54 (m, 4 H), 2.38-2.27 (m, 1 H), 2.26-2.16 (m, 2 H), 2.00 (s, 3 H), 1.89-1.74 (m, 3 H), 1.71 (s, 3 H), 1.69-1.61 (m, 2 H), 1.39 (dd, J=13,5 и 6,4 Гц, 1 H), 1.27 (d, J=6,2 Гц, 3 H), 1.09 (d, J=6,6 Гц, 3 H), 0.97 (d, J=7,4 Гц, 3 H).

Пример А9

Получение [(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В16) и (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В17).

Стадия 1. Синтез [(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В16). К раствору #NP2 (25 мг, 0,048 ммоль, 1 экв.), растворенного в смеси 1:1 тетра гидрофура н/вода (3 мл, 0,016 М), добавляли гидроксид лития (15 мг, 0,63 ммоль, 13 экв.). Реакционную смесь перемешивали при комнатной температуре в течение 1 часа и растворители удаляли в вакууме. Неочищенный остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В16 в виде твердого вещества. Выход: 17 мг, 0,035 ммоль, 74%. ЖХ-МС (Протокол D): m/z 478,1 [М+Н]+, время удерживания составляет 0,75 минуты. 1H ЯМР (400 МГц, CDCl3-d) δ 6.27 (d, J=8,98 Гц, 1 Н), 6.09 (d, J=15,61 Гц, 1 Н), 6.00 (dd, J=12,10, 5,46 Гц, 1 Н), 5.62 (dd, J=12,10, 1,17 Гц, 1 Н), 5.40 (dd, J=15,61, 5,85 Гц, 2Н), 5.25 (t, J=6,63 Гц, 1 Н), 4.61 (t, J=6,63 Гц, 1 Н), 4.48-4.32 (m, 2 Н), 3.79-3.73 (m, 1 Н), 3.57-3.48 (m, 2 Н), 3.42-3.33 (m, 2 Н), 2.85 (dd, J=15,22, 8,98 Гц, 2 Н), 2.52-2.44 (m, 2 Н), 2.42 (d, J=5,07 Гц, 1 Н), 2.25-2.00 (m, 1 Н), 1.94-1.87 (m, 2 Н), 1.80-1.74 (m, 2 Н), 1.68-1.59 (m, 2 Н), 1.55 (s, 3 Н), 1.46 (dd, J=13,46, 3,71 Гц, 1 Н), 1.27 (dd, J=13,66, 4,29 Гц, 1 Н), 1.17 (d, J=6,63 Гц, 3 Н), 0.98 (d, J=6,24 Гц, 2Н), 0.83 (d, J=7,02 Гц, 3 Н).

Стадия 2. Синтез (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В17). Получали согласно общей методике синтеза #В1, описанной в Примере А1, за исключением того, что #В16 использовали вместо #NP1. Неочищенную реакционную смесь концентрировали в вакууме и затем очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В17 в виде твердого вещества. Выход: 28 мг, 0,043 ммоль, 43%. ЖХ-МС (Протокол D): m/z 575,1 [М+Н]+, время удерживания составляет 0,82 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.76 (d, J=7,8 Гц, 1 Н), 6.30 (d, J=16 Гц, 1 Н), 5.97 (d, J=12,1 Гц, 1 Н), 5.86 (dd, J=11,7 и 7,0 Гц, 1 Н), 5.63 (dd, J=16 и 5,1 Гц, 1 Н), 5.56-5.48 (m, 1H), 5.22-5.06 (m, 2 Н), 4.60-4.53 (m, 1 Н), 4.39-4.30 (m, 1 Н), 3.70-3.60 (m, 2Н), 3.54-3.45 (m, 1 Н), 3.03-2.98 (m, 2 Н), 2.80 (s, 4 Н), 2.70-2.60 (m, 2 Н), 2.59 (s, 1 Н), 2.37-2.13 (m, 3 Н), 1.87-1.60 (m, 7 Н), 1.54 (dd, J=13,3 и 7 Гц, 1 Н), 1.11 (d, J=6,2 Гц, 3 Н), 1.06 (d, J=6,2 Гц, 3 Н), 0.95 (d, J=7,4 Гц, 3 Н).

Пример А10

Получение 4-{4-[(1Е)-1-(2-{[(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1 -ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинилиден)этил]фенокси}бутановой кислоты (#В18) и (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-{(2E)-2-[1-(4-{4-[(2,5-диоксопирролидин-1-ил)окси]-4-оксобутокси}фенил)этилиден]-гидразинил}-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В19).

Стадия 1. Синтез 4-{4-[(1E)-1-(2-{[(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинилиден)этил]фенокси}бутановой кислоты (#В18). К раствору #В7 (35 мг, 0,066 ммоль, 1 экв.) в этаноле (1 мл, 0,06 М) добавляли 4-(4-ацетилфенокси)бута новую кислоту (73,3 мг, 0,330 ммоль, 5 экв.), затем ледяную уксусную кислоту (0,250 мл) и реакционную смесь нагревали до 37°С. Через 3,5 часа реакционную смесь фильтровали и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В18 в виде белого твердого вещества. Выход: 25,5 мг, 0,034 ммоль, 52%. ЖХ-МС (Протокол D): m/z 737,38 [М+Н]+, время удерживания составляет 0,88 минуты.

Стадия 2. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-{(2Е)-2-[1-(4-{4-[(2,5-диоксопирролидин-1-ил)окси]-4-оксобутокси}фенил)-этилиден]гидразинил}-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В19). К раствору #В18 (25 мг, 0,034 ммоль, 1 экв.), растворенного в тетрагидрофуране (0,7 мл, 0,049 М), добавляли DCC (15,5 мг, 0,075 ммоль, 2,2 экв.), а затем N-гидроксисукцинимид (8,60 мг, 0,075 ммоль, 2,2 экв.). Реакционную смесь перемешивали в течение 4 часов. Растворители удаляли в вакууме и остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В19 в виде белого твердого вещества. Выход: 13 мг, 0,015 ммоль, 46%. ЖХ-МС (Протокол D): m/z 835,8 [М+Н]+, время удерживания составляет 0,92 минуты.

Пример А11

Получение 4-{4-[(1Е)-1-(2-{[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинилиден)этил]фенокси}-бутановой кислоты (#В20) и (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-{(2Е)-2-[1-(4-{4-[(2,5-диоксопирролидин-1-ил)окси]-4-оксобутокси}фенил)этилиден]гидразинил}-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В21).

Стадия 1. Синтез 4-{4-[(1E)-1-(2-{[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинилиден)этил]фенокси}бутановой кислоты (#В20). К раствору #В6 (18,1 мг, 0,033 ммоль, 1 экв.) в этаноле (0,500 мл, 0,06 М) добавляли 4-(4-ацетилфенокси)бутановую кислоту (36,7 мг, 0,165 ммоль, 5 экв.), затем ледяную уксусную кислоту (0,125 мл) и реакционную смесь нагревали до 37°С. Через 1 час реакционную смесь фильтровали и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В20 в виде белого твердого вещества. Выход: 24,9 мг, 0,028 ммоль, 85%. ЖХ-МС (Протокол С): m/z 754,5 [М+Н]+, время удерживания составляет 1,47 минуты.

Стадия 2. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-{(2Е)-2-[1-(4-{4-[(2,5-диоксопирролидин-1-ил)окси]-4-оксобутокси}фенил)-этилиден]гидразинил}-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В21). К раствору #В20 (21,3 мг, 0,028 ммоль, 1 экв.), растворенного в тетрагидрофуране (0,550 мл, 0,05 М), добавляли DCC (13,5 мг, 0,062 ммоль, 2,2 экв.), а затем N-гидроксисукцинимид (7,3 мг, 0,062 ммоль, 2,2 экв.). Реакционную смесь перемешивали в течение 5 часов и добавляли дополнительное количество DCC (5 мг, 0,022 ммоль, 0,8 экв.), а затем N-гидроксисукцинимид (5 мг, 0,042 ммоль, 1,5 экв.). Через 18 часов растворители удаляли в вакууме и остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В21 в виде белого твердого вещества. Выход: 11 мг, 0,013 ммоль, 47%. ВЭЖХ (Протокол Н): m/z 851,3 [М+Н]+, время удерживания составляет 9,074 минуты (чистота 88%). ЖХ-МС (Протокол С): m/z 851,5 [М+H]+, время удерживания составляет 1,58 минуты. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 10.42-10.25 (m, 1 Н), 7.83-7.66 (m, 3 Н), 7.02-6.92 (m, 2 Н), 6.43-6.22 (m, 2 Н), 6.1-6.05 (m, 1 Н), 5.93-5.81 (m, 1 Н), 5.68-5.37 (m, 2 Н), 5.08-4.90 (m, 1 Н), 4.52-4.25 (m, 3 Н), 4.13-4.04 (m, 2 Н), 3.71-3.55 (m, 2 Н), 3.52-3.40 (m, 1 Н), 2.94-2.55 (m, 9 Н), 2.35-2.03 (m, 7 Н), 1.98 (s, 3 Н), 1.95-1.85 (m, 1 Н), 1.84-1.73 (m, 2 Н), 1.72-1.54 (m, 5 Н), 1.30-1.20 (m, 3 Н), 1.12-1.00 (m, 3 Н), 0.98-0.87 (m, 3 Н).

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3S,5S,7S)-7-[2-(гидроксиамино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-Диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В22).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3S,5S,7S)-7-[2-(гидроксиамино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В22). К раствору #В2 (100,8 мг, 0,175 ммоль, 1 экв.), растворенного в тетрагидрофуране (1,8 мл) и N,N-диметилформамиде (0,600 мл), добавляли N,N-диизопропилэтиламин (114 мг, 0,875 ммоль, 5 экв.) и гидрохлорид гидроксиламина (10,6 мг, 0,152 ммоль, 3 экв.) После перемешивания в течение 1 часа реакционную смесь разбавляли водой, экстрагировали этилацетатом (3x), объединенные органические слои опять промывали водой, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии среднего давления с обращенной фазой С18 (градиент: от 10% до 100% воды в ацетонитриле с 0,02% уксусной кислоты в каждой фазе) с получением #В22 в виде белого твердого вещества. Выход: 68 мг, 0,127 ммоль, 73%. ЖХ-МС (Протокол С): m/z 535,4 [М+Н]+, время удерживания составляет 1,36 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 10.40 (s, 1H), 8.73 (d, J=2 Гц, 1 Н), 7.79 (d, J=8,2 Гц, 1 Н), 6.41-6.32 (m, 1 Н), 6.26 (d, J=15,6 Гц, 1 Н), 6.12 (d, J=11,3 Гц, 1 Н), 5.87 (dd, J=11,5 и 7,6 Гц, 1 Н), 5.59 (dd, J=16 и 5,5 Гц, 1 Н), 5.55-5.49 (m, 1 Н), 4.56-4.49 (m, 1 Н), 4.36-4.27 (m, 1 Н), 3.70-3.61 (m, 2 Н), 3.54-3.47 (m, 1 Н), 2.65-2.60 (m, 2 Н), 2.48-2.41 (m, 1 Н), 2.36-2.17 (m, 2 Н), 2.16-2.09 (m, 1 Н), 1.98 (s, 3 Н), 1.85-1.72 (m, 3 Н), 1.72-1.61 (m, 6 Н), 1.43-1.35 (m, 1 Н), 1.25 (d, J=6,6 Гц, 3 Н), 1.07 (d, J=6,2 Гц, 3 Н), 0.95 (d, J=7,4 Гц, 3 Н).

Пример А12

Получение N-[3-(2-{2-[(бромацетил)амино]этокси}этокси)пропаноил]-D-валил-N-(4-{[({4-[({[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]фенил}карбамоил)окси]метил}фенил)-N~5~-карбамоил-D-орнитинамида (#В27).

Стадия 1. Синтез N-[(9Н-флуорен-9-илметокси)карбонил]-L-валил-N-[4-({[(4-{[(трет-бутоксикарбонил)амино]метил}фенил)карбамоил]окси}метил)-фенил]-N~5~-карбамоил-L-орнитинамида (#В23). К раствору трет-бутил-(4-аминобензил)карбамата (75,4 мг, 0,339 ммоль, 1,3 экв.) в N,N-диметилформамиде (2 мл, 0,16 М) добавляли 2,6-диметилпиридин (140 мг, 1,3 ммоль, 5 экв.), N,N-диизопропилэтиламин (169 мг, 1,3 ммоль, 5 экв.) и 3Н-[1,2,3]триазоло[4,5-b]пиридин-3-ол (HOAt, 71,1 мг, 0,522 ммоль, 2 экв.) и перемешивали в течение 5 минут. Реакционную смесь полностью добавляли к раствору N-[(9Н-флуорен-9-илметокси)карбонил]-L-валил-N~5~-карбамоил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-L-орнитинамида (200 мг, 0,261 ммоль, 1 экв.) в N,N-диметилформамиде (2 мл, 0,13М) и реакционную смесь нагревали до 50°С в течение 5 часов и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии среднего давления с обращенной фазой С18 (градиент: от 10% до 100% воды в ацетонитриле с 0,02% трифторуксусной кислоты в каждой фазе) с получением #В23 в виде твердого вещества. Выход: 40 мг, 0,047 ммоль, 18%.

Стадия 2. Синтез бисоли трифторуксусной кислоты и N-[(9Н-флуорен-9-илметокси)карбонил]-L-валил-N-{4-[({[4-(аминометил)фенил]карбамоил}окси)-метил]фенил}-N~5~-карбамоил-L-орнитинамида (#В24). К суспензии #В23 (40 мг, 0,047 ммоль, 1 экв.) в дихлорметане (2 мл, 0,023 М) добавляли раствор 1:1 дихлорметан/трифторуксусная кислота (2 мл). Через 45 минут реакционную смесь концентрировали в вакууме до оранжевой смолы #В24, которую использовали без последующей очистки. Выход: 46 мг (предполагался количественный выход), ЖХ-МС (Протокол D): m/z 750,4 [М+Н]+, время удерживания составляет 0,73 минуты.

Стадия 3. Синтез N-[(9Н-флуорен-9-илметокси)карбонил]-D-валил-N-(4-{[({4-[({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]фенил}-карбамоил)окси]метил}фенил)-N~5-карбамоил-D-орнитинамида (#В25). К раствору #В24 (46 мг, 0,047 ммоль, 1 экв.) в тетрагидрофуране (1 мл, 0,047 М) добавляли N,N-диизопропилэтиламин (12,8 мг, 0,017 ммоль, 2,1 экв.). Затем всю смесь по каплям добавляли к раствору #В1 (29,7 мг, 0,047 ммоль, 1 экв.) в тетрагидрофуране (1 мл). Через 18 часов добавляли метанол (0,4 мл). Через 48 часов реакционную смесь концентрировали в вакууме и неочищенный продукт очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В25 в виде белого твердого вещества. Выход: 12,2 мг, 0,009 ммоль, 20%. ВЭЖХ (Протокол AA): время удерживания составляет 9,140 (чистота составляет 89%). ЖХ-МС (Протокол D): m/z 1268,7 [М+Н]+, время удерживания составляет 0,92 минуты.

Стадия 4. Синтез D-валил-N-(4-{[({4-[({[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]фенил}карбамоил)окси]метил}-фенил)-N~5~-карбамоил-D-орнитинамида (#В26). К раствору #В25 (12 мг, 0,009 ммоль, 1 экв.) в N,N-диметилформамиде (0,3 мл, 0,3 М) добавляли пиперидин (0,2 мл от исходного раствора 0,050 мл в 1 мл N,N-диметилформамида). Через 30 минут реакционную смесь концентрировали в вакууме, очищали посредством хроматографии с обращенной фазой (Метод А) и фракции, которые имели отношение к целевому продукту, лиофилизировали с получением #В26 в виде твердого вещества. Выход: 6,6 мг, 0,006 ммоль, 70%. ВЭЖХ (Протокол AA): время удерживания составляет 6,957 (чистота составляет 89%). ЖХ-МС (Протокол D): m/z 1045,8 [М+Н]+, время удерживания составляет 0,69 минуты.

Стадия 5. Синтез N-[3-(2-{2-[(бромацетил)амино]этокси}этокси)-пропаноил]-D-валил-N-(4-{[({4-[({[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]фенил}карбамоил)окси]метил}фенил)-N~5~-карбамоил-D-орнитинамида (#В27). К раствору #В26 (6 мг, 0,006 ммоль, 1 экв.) в тетрагидрофуране (0,6 мл, 0,01 М) добавляли N,N-диизопропилэтиламин (0,25 мл от исходного раствора [полученного путем растворения 0,01 мл N,N-диизопропилэтиламина в 1 мл тетрагидрофурана], 0,012 ммоль, 2 экв.) и перемешивали при комнатной температуре в течение 5 минут. Всю смесь по каплям добавляли к охлажденному (0°С) раствору 2-бром-N-[2-(2-{3-[(2,5-диоксопирролидин-1-ил)окси]-3-оксопропокси}этокси)этил]ацетамида (2,4 мг, 0,006 ммоль, 1 экв.). Реакционную смесь перемешивали при 0°С в течение 5 минут и затем оставляли нагреваться до комнатной температуры. Через 16 часов реакционную смесь концентрировали в вакууме и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В27 в виде белого твердого вещества. Выход: 1,4 мг, 0,001 ммоль, 20%. ЖХ-МС (Протокол D): m/z 1348,7 [М+Na]+, время удерживания составляет 0,77 минуты.

Пример А13

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[2-({4-[(3-{2-[(N-{6-[(бромацетил)амино]гексаноил}глицил)амино]фенил}-пропаноил)сульфамоил]бензил}амино)-2-оксоэтил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В37).

Стадия 1. Синтез метил-(2Е)-3-(2-{[N-(трет-бутоксикарбонил)глицил]-амино}фенил)проп-2-еноата (#В28). К раствору N-(трет-бутоксикарбонил)-глицина (13,4 г, 77,1 ммоль, 1 экв.), гидрохлорида 1-[3-(диметиламино)пропил]-3-этилкарбодиимида (22,1 г, 115,7 ммоль, 1,5 экв.), 1-гидроксибензотриазола (HOBt) (11,4 г, 84,8 ммоль, 1,1 экв.), 4-(диметиламино)пиридина (DMAP) (0,9 г, 7,4 ммоль, 0,10 экв.) в N,N-диметилформамиде (350 мл) при комнатной температуре добавляли метил-(2Е)-3-(2-аминофенил)проп-2-еноат (15 г, 84,7 ммоль, 1,1 экв.). Реакционную смесь нагревали до 50°С, перемешивали в течение 18 часов. Реакционную смесь разбавляли водой (400 мл), промывали лимонной кислотой (200 мл), экстрагировали этилацетатом (300 мл × 3). Органический слой промывали рассолом (150 мл), сушили над сульфатом натрия, фильтровали и фильтрат концентрировали в вакууме. Неочищенный продукт очищали посредством хроматографии на силикагеле, элюируя смесью петролейный эфир: этилацетат (от 8:1 до 1:1) с получением соединения #В28 (20 г, 71%) в виде твердого вещества. 1H ЯМР (400 МГц, CDCl3): δ 8.29 (br, 1H), 7.84 (d, 2H), 7.55 (t, 1H), 7.40 (t, 1H), 7.22 (t, 1H), 6.41 (d, 2H), 5.37 (br, 1H), 4.00 (d, 2H), 3.79 (s, 3H), 1.46 (s, 9H).

Стадия 2. Синтез метил-3-(2-{[N-(трет-бутоксикарбонил)глицил]амино}-фенил)пропаноата (#В29). Суспензию соединения #В28 (20 г, 59,8 ммоль, 1 экв.) и Pd/C (2,0 г) в этилацетате (350 мл) и метаноле (300 мл) дегазировали под вакуумом и продували водородом (H2) несколько раз. Реакционную смесь перемешивали при комнатной температуре под Н2 (30 фунт-сила на кв. дюйм) в течение 9 часов. Реакционную смесь фильтровали и осадок на фильтре промывали этилацетатом (100 мл). Фильтрат упаривали досуха с получением соединения #В29 в виде масла, которое использовали на следующей стадии без дополнительной очистки: Выход (20,75 г, предполагался количественный выход). 1H ЯМР (400 МГц, CDCl3): δ 9.13 (br, 1H), 7.75 (d, 1H), 7.22 (d, 1H), 7.17 (m, 2H), 5.34 (br, 1H), 4.04 (d, 2H), 3.64 (s, 3H), 2.95 (t, 2H), 2.72 (t, 2H), 1.46 (s, 9H).

Стадия 3. Синтез 3-(2-{[N-(трет-бутоксикарбонил)глицил]амино}-фенил)пропановой кислоты (#В30). К раствору #В29 (20,75 г, 59,8 ммоль, 1 экв.) в тетрагидрофуране (200 мл) добавляли раствор гидроксида натрия (12,24 г, 0,306 ммоль) в воде (155 мл). Реакционную смесь перемешивали при комнатной температуре в течение 3 часов. С помощью лимонной кислоты устанавливали pH реакционной смеси pH 5~6 и смесь экстрагировали этилацетатом (400 мл × 2). Органический слой промывали рассолом (150 мл × 2), сушили над сульфатом натрия, концентрировали досуха с получением #В30 в виде твердого вещества, которое использовали на следующей стадии без дополнительной очистки. Выход: 21,5 г (предполагался количественный выход). 1H ЯМР (400 МГц, CD3OD) δ 7.29 (m, 1H), 7.23 (m, 3H), 3.90 (s, 2H), 2.91 (m, 2H), 2.66 (m, 2H), 1.49 (m, 9H). ЖХ-МС (Протокол I): m/z 345 [M+Na]+, время удерживания составляет 1,034 минуты.

Стадия 4. Синтез 3-[2-(глициламино)фенил]пропановой кислоты (#В31). К раствору #В30 (10 г, 31,1 ммоль, 1 экв.) в этилацетате (100 мл) добавляли HCl/диоксан (70 мл). Реакционную смесь перемешивали при комнатной температуре в течение 3 часов и затем концентрировали досуха. Остаток перекристаллизовывали из трет-бутилметилового эфира (50 мл) с получением #В31 в виде твердого вещества (5,9 г, 26,5 ммоль, 85,5% за три стадии). 1Н ЯМР (400 МГц, DMSO-d6): δ 10.06 (br, 1H), 8.31 (br, 3H), 7.41 (d, 1H), 7.28 (m, 3H), 3.84 (s, 2H), 2.88 (m, 2H), 2.52 (m, 2H).

Стадия 5. Синтез 3-(2-{[N-(6-{[(9Н-флуорен-9-илметокси)карбонил]-амино}гексаноил)глицил]амино}фенил)пропановой кислоты (#В32). К раствору #В31 (1,11 г, 4,98 ммоль, 1 экв.) и бикарбоната натрия (528 мг, 7,47 ммоль, 1,5 экв.) в тетрагидрофуране (25 мл) и воде (10 мл) по каплям добавляли раствор 9Н-флуорен-9-илметил-{6-[(2,5-диоксопирролидин-1-ил)окси]-6-оксогексил}-карбамата (2,7 г, 5,98 ммоль, 1,2 экв.) в тетрагидрофуране (45 мл) и 1,2-диметоксиэтане (DME) (10 мл). Реакционную смесь перемешивали при комнатной температуре в течение 16 часов. С помощью лимонной кислоты устанавливали pH реакционной смеси pH 5~6 и смесь экстрагировали дихлорметаном (100 мл × 2). Органический слой промывали рассолом (100 мл), сушили над сульфатом натрия, концентрировали досуха. Неочищенный продукт очищали посредством хроматографии на силикагеле, элюируя смесью дихлорметан: метанол (от 100:1 до 10:1) с получением #В32 (1,1 г, 1,97 ммоль, 39,7%) в виде твердого вещества. 1H ЯМР (400 МГц, DMSO-d6): δ 9.31 (s, 1H), 8.18 (s, 1H), 7.89 (d, 2H), 7.70 (d, 2H), 7.40 (m, 6H), 7.13 (m, 5H), 4.30 (m, 2H), 4.21 (m, 1H), 3.90 (m, 2H), 2.98 (m, 2H), 2.80 (m, 2H), 2.77 (m, 1H), 2.48 (m, 1H), 2.20 (m, 2H), 1.54 (m, 2H), 1.42 (m, 2H), 1.25 (m, 2H). ЖХ-МС (Протокол I): m/z 580,1 [M+Na]+, время удерживания составляет 1,315 минуты.

Стадия 6. Синтез 9Н-флуорен-9-илметил-{6-[(2-{[2-(3-{[(4-{[(трет-бутоксикарбонил)амино]метил}фенил)сульфонил]амино}-3-оксопропил)фенил-]амино}-2-оксоэтил)амино]-6-оксогексил}карбамата (#В33). Смесь #В32 (900 мг, 1,62 ммоль, 1 экв.) и трет-бутил-(4-сульфамоилбензил)карбамата (787 мг, 2,59 ммоль, 1,6 экв.), 4-(диметиламино)пиридина (198 мг, 1,62 ммоль, 1 экв.), гидрохлорида 1-[3-(диметиламино)пропил]-3-этилкарбодиимида (369 мг, 1,2 ммоль, 0,7 экв.) в дихлорметане (DCM) (30 мл) перемешивали при комнатной температуре в течение 3,5 часов. С помощью лимонной кислоты устанавливали pH реакционной смеси pH 5~6 и смесь экстрагировали дихлорметаном (30 мл × 2). Органический слой промывали рассолом (100 мл), сушили над сульфатом натрия, концентрировали досуха. Неочищенный продукт очищали посредством хроматографии на силикагеле, элюируя смесью дихлорметан: метанол (от 100:1 до 20:1) с получением #В33 в виде твердого вещества (800 мг, 0,972 ммоль, 60,0%). 1H ЯМР (400 МГц, DMSO-d6): δ 12.09 (br, 1H), 9.30 (s, 1H), 8.19 (m, 1H), 7.89 (m, 4H), 7.70 (m, 2H), 7.46 (m, 1H), 7.44 (m, 4H), 7.42 (m, 3Н), 7.35 (m, 1H), 7.16 (m, 1H), 7.08 (m, 2H), 4.23 (m, 2H), 3.88 (m, 3Н), 3.87 (m, 2H), 2.70 (m, 2H), 2.68 (m, 2H), 2.50 (m 2H), 2.17 (m, 2H), 1.53 (m, 2H), 1.51 (s, 9H), 1.25 (m, 4H). ЖХ-МС (Протокол J): m/z 726,1 [М-Boc]+, время удерживания составляет 1,211 минуты.

Стадия 7. Синтез 9Н-флуорен-9-илметил-(6-{[2-({2-[3-({[4-(аминометил)фенил]сульфонил}амино)-3-оксопропил]фенил}амино)-2-оксоэтил]амино}-6-оксогексил)карбамата (#В34). К суспензии (#В33) (52,6 мг, 0,063 ммоль, 1 экв.) в дихлорметане (3 мл, 0,02 M) добавляли трифторуксусную кислоту (0,6 мл) и перемешивали в течение 2 часов, а затем концентрировали в вакууме. Остаток подвергали азеотропной перегонке с ацетонитрилом (3х) с получением #В34 (45,7 мг, 0,063 ммоль, предполагался количественный выход), который использовали как он был на следующей стадии без дополнительной очистки. ЖХ-МС (Протокол D): m/z 726,3 [М+Н]+, время удерживания составляет 0,73 минуты.

Стадия 8. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(4-{[3-(2-{[N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}гексаноил)-глицил]амино}фенил)пропаноил]сульфамоил}бензил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В35). К раствору #В34 (45,7 мг, 0,063 ммоль, 1 экв.) в тетрагидрофуране (0,5 мл, 0,12М) добавляли N,N-диизопропилэтиламин (24,4 мг, 0,189 ммоль, 3 экв.). Реакционную смесь полностью добавляли к охлажденному (0°С) раствору #В1 (40 мг, 0,063 ммоль, 1 экв.) в тетрагидрофуране (0,5 мл) и реакционную смесь оставляли нагреваться до комнатной температуры. Через один час реакционную смесь концентрировали в вакууме с получением #В35 (55 мг, 0,053 ммоль, 70%), который использовали как он был на следующей стадии без дополнительной очистки. ЖХ-МС (Протокол D): m/z 1243,6 [М+Н]+, время удерживания составляет 0,95 минуты.

Стадия 9. Синтез формиатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(4-{[3-(2-{[N-(6-аминогексаноил)глицил]амино}фенил)-пропаноил]-сульфамоил}бензил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В36). К раствору #В35 (55 мг, 0,053 ммоль, 1 экв.) в N,N-диметилформамиде добавляли пиперидин (0,2 мл исходного раствора [полученного путем растворения 0,05 мл в 1 мл N,N-диметилформамида], 0,106 ммоль, 2 экв.). Через 30 минут реакционную смесь концентрировали в вакууме и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В36 в виде белого твердого вещества. Выход: 30 мг, 0,027 ммоль, 52%. ВЭЖХ (Протокол AA): время удерживания составляет 7,143 минуты (чистота составляет 92%). ЖХ-МС (Протокол D): m/z 1021,4 [М+Н]+, время удерживания составляет 0,67 минуты. 1H ЯМР (DMSO-d6) δ: 10.23-10.21 (b.s., 1 H D2O заменяемый), 8.36-8.31 (m, 1H), 8.25-8.20 (m, 1H), 7.76-7.68 (m, 1H), 7.53-7.42 (m, 3Н), 7.14-7.02 (m, 3Н), 6.99-6.93 (m, 1H), 6.35-6.21 (m, 2H), 6.08-6.01 (m, 1H), 5.82-5.76 (m, 1H), 5.61-5.52 (m, 1H), 5.50-5.42 (m, 1H), 4.28-4.16 (m, 4H), 3.82 (d, J=5,9 Гц, 2H), 3.57 (d, J=6,2 Гц, 2Н), 3.49-3.42 (m, 1H), 3.21-3.18 (m, 1H), 2.74-2.66 (m, 3Н), 2.62-2.49 (m, 3Н), 2.31-2.11 (m, 6H), 1.91 (s, 3Н), 1.84-1.69 (m, 3Н), 1.64 (s, 3Н), 1.60-1.41 (m, 6H), 1.32-1.22 (m., 2H), 1.18 (d, J=6,6 Гц, 3Н), 0.99 (d, J=6,21 Гц, 3Н), -0.88 (d, J=6,21 Гц, 3Н).

Стадия 10. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[2-({4-[(3-{2-[(N-{6-[(бромацетил)амино]гексаноил}глицил)амино]фенил}-пропаноил)сульфамоил]бензил}амино)-2-оксоэтил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В37). К раствору #В36 (20 мг, 0,018 ммоль, 1 экв.) в тетрагидрофуране добавляли N,N-диизопропилэтиламин (9,8 мг, 0,076 ммоль, 4,2 экв.) и метанол (0,1 мл). Смесь полностью добавляли к охлажденному (0°С) раствору 1-[(бромацетил)окси]пирролидин-2,5-диона (4,2 мг, 0,018 ммоль, 1 экв.) и перемешивали при 0°С в течение 5 минут, а затем оставляли нагреваться до комнатной температуры. Через 18 часов реакционную смесь концентрировали в вакууме и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В37 в виде белого твердого вещества. Выход: 3,8 мг, 0,003 ммоль, 18%. ВЭЖХ (Протокол AA): время удерживания составляет 7,554 и 7,77 минуты (чистота 91%). ЖХ-МС (Протокол D): m/z 1141,4 [М+Н]+, время удерживания составляет 0,8 минуты. 1H ЯМР (400 МГц, МЕТАНОЛ-d4): 7.66 (d, J=8,2 Гц, 2Н), 7.56-7.49 (m, 1Н), 7.33-7.26 (m, 2 H), 7.03 (m, 3 H), 6.32-6.23 (m, 1H), 5.94-5.81 (m, 2Н), 5.58 (dd, J=16,0, 8,0 Гц, 1 H), 5.47-5.39 (m, 1Н), 4.46 (s, 2Н), 4.43-4.34 (m, 1Н), 4.3 (m, 2 H), 3.88 (s, 2 H), 3.68 (s, 2Н), 3.67-3.62 (m, 2 H), 3.61-3.55 (m, 1Н), 3.52-3.44 (m, 1Н), 3.36-3.32 (m, 1 H), 3.11 (t, J=16 Гц, 1 H), 2.8 (d, J=8,0, 1Н), 2.78-2.72 (m, 2Н), 2.68 (t, J=8,0, 2 H), 2.57 (d, J=4,0 Гц, 1 H), 2.45-2.39 (m, 2 H), 2.36 (dd, J=16,0, 8,0 Гц, 1 H), 2.30 (d, J=8,0 Гц, 1 H), 2.25 (t, J=8,0 Гц, 2 H), 2.20-2.09 (m, 1 H), 1.9 (s, 1Н), 1.85-1.78 (m, 2 H), 1.75-1.71 (m, 1Н), 1.68 (s, 3 H), 1.64-1.54 (m, 3 H), 1.50-1.43 (m, 2 H), 1.27-1.35 (m, 2 H), 1.25 (d, J=8,0 Гц, 3 H), 1.00 (d, J=8,0 Гц, 3 H), 1.05-0.87 (d, J=8,0 Гц, 3 H).

Пример А14

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В40).

Стадия 1. Синтез (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В39). К раствору #В15 (38 мг, 0,075 ммоль, 1 экв.) в смеси 4:1 тетрагидрофуран: вода (2,2 мл) добавляли гидроксид лития (15,6 мг, 0,652 ммоль, 8,7 экв.) и смесь перемешивали при комнатной температуре в течение 12 часов. Реакционную смесь разбавляли этилацетатом и промывали водой. Водный слой экстрагировали этилацетатом (3х) и объединенные органические слои сушили над безводным сульфатом натрия и концентрировали в вакууме. После очистки посредством хроматографии с обращенной фазой (Метод А) получали #В39 в виде твердого вещества. Выход: 16,7 мг, 0,035 моль, 47%. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.76 (d, J=8,2 Гц, 1 Н), 7.31 (s, 1 H), 6.77 (s, 1 H), 6.27 (d, J=16,0 Гц, 1 H), 5.97 (d, J=11 Гц, 1 H), 5.86 (dd, J=11,7 и 7,0 Гц, 1 H), 5.59 (dd, J=16,0 и 5,5 Гц, 1 H), 5.54-5.47 (m, 1 H), 5.22-5.12 (m, 1 H), 5.10 (d, J=4,7 Гц, 1 H), 4.58-4.48 (m, 1 H), 4.35-4.25 (m, 1 H), 3.69-3.59 (m, 2 H), 3.54-3.46 (m, 1 H), 2.64-2.52 (m, 3 H), 2.37-2.14 (m, 3 H), 1.87-1.73 (m, 3 H), 1.72-1.60 (m, 6 H), 1.37 (dd, J=13,3 и 6,2 Гц, 1 H), 1.11 (d, J=6,2 Гц, 3 H), 1.06 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 Н). ВЭЖХ (Протокол AA): время удерживания составляет 7,15 минуты (чистота составляет 100%). ЖХ-МС (Протокол С): m/z 499,3 [М+Na]+, время удерживания составляет 1,18 минуты.

Стадия 2. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата #В40. К раствору #В39 (106 мг, 0,222 ммоль, 1 экв.) в дихлорметане (3 мл) добавляли триэтиламин (TEA) (79 мг, 0,777 ммоль, 3,5 экв.), 4-N,N'-диметиламинопиридин (18,9 мг, 0,155 ммоль, 0,7 экв.) и бис(4-нитрофенил)карбонат (207 мг, 0,666 ммоль, 3 экв.) и реакционную смесь перемешивали при комнатной температуре в течение 2 часов. К 1/5 этой смеси добавляли пиперидин (18,9 мг, 0,222 ммоль, 1 экв.) и смесь перемешивали при комнатной температуре в течение 3,5 часов, концентрировали в вакууме и остаток очищали посредством хроматографии с обращенной фазой (Метод D*) с получением #В40. Выход 2,7 мг, 0,021 ммоль, 9,5%. ВЭЖХ (Протокол В): m/z 588,4 [М+Н]+, время удерживания составляет 2,82 минуты (чистота составляет 100%).

Пример А15

Получение N-[3-(2-{2-[(бромацетил)амино]этокси}этокси)пропаноил]-L-валил-N-[4-({[(2-{[(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В43).

Стадия 1. Синтез N-[(9Н-флуорен-9-илметокси)карбонил]-L-валил-N-[4-({[(2-{[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)-фенил]-N~5~-карбамоил-L-орнитинамида (#В41). К раствору #В7 (56 мг, 0,1 ммоль, 1 экв.) в N,N-диметилформамиде (2,6 мл) добавляли N-[(9Н-флуорен-9-илметокси)карбонил]-L-валил-N~5~-карбамоил-N-[4-({[(4-нитрофенокси)-карбонил]окси}метил)фенил]-L-орнитинамид (FMocValCitPABC-PNP, WO 04010957, 121 мг, 0,15 ммоль, 1,5 экв.), N,N'-диизопропилэтиламин (56 мг, 0,4 ммоль, 4,0 экв.), 2,6-диметилпиридин (45 мг, 0,4 ммоль, 4,0 экв.) и 3Н-[1,2,3]триазоло[4,5-b]пиридин-3-ол (14,3 мг, 0,105 ммоль, 1,05 экв.). После перемешивания при 50°С в течение 1,5 часов реакционную смесь концентрировали в вакууме и неочищенный материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В41 в виде твердого вещества. Выход: 72 мг, 0,06 ммоль, 59%. ЖХ-МС (Протокол D): m/z 1183,5 [M+Na]+, время удерживания составляет 0,95 минуты.

Стадия 2. Синтез L-валил-N-[4-({[(2-{[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамид (#В42). К раствору #В41 (50 мг, 0,043 ммоль, 1 экв.) в N,N-диметилформамиде (0,7 мл) добавляли пиперидин (66 мг, 0,78 ммоль, 20 экв.) и смесь перемешивали в течение 20 минут. Реакционную смесь концентрировали в вакууме и неочищенный материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В42. Выход: 31 мг, 0,033 ммоль, 76%. ЖХ-МС (Протокол D): m/z 939,3 [М+Н]+, время удерживания составляет 0,66 минуты.

Стадия 3. Синтез N-[3-(2-{2-[(бромацетил)амино]этокси}этокси)-пропаноил]-L-валил-N-[4-({[(2-{[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В43). К раствору #В42 (10 мг, 0,011 ммоль, 1 экв.) в N,N-диметилформамиде (0,2 мл) добавляли 2-бром-N-[2-(2-{3-[(2,5-диоксопирролидин-1-ил)окси]-3-оксопропокси}этокси)этил]ацетамид (4,3 мг, 0,011 ммоль, 1 экв.) и смесь перемешивали при комнатной температуре в течение 30 минут. Реакционную смесь разбавляли диметилсульфоксидом (0,2 мл) и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В43 в виде твердого вещества. Выход: 8,8 мг, 0,007 ммоль, 66%. ВЭЖХ (Протокол AA): время удерживания составляет 7,69 минуты (чистота составляет 71%). ЖХ-МС (Протокол А): m/z 1220,4 [М+Н]+, время удерживания составляет 0,77 минуты.

Пример А16

Получение N-(6-аминогексаноил)-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}-метил)фенил]-N~5~-карбамоил-L--орнитинамида (#В47).

Стадия 1. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N~5~-карбамоил-N-[4-(гидроксиметил)фенил]-L-орнитинамида (#В44). N,N-диизопропилэтиламин (3,8 мл, 22,12 ммоль, 1,9 экв.) добавляли к раствору 6-{[(9Н-флуорен-9-илметокси)карбонил]амино}гексановой кислоты (4,2 г, 11,80 ммоль, 1 экв.) и гексафторфосфата N,N,N',N'-тетраметил-O-(7-азабензотриазол-1-ил)урония (HATU, 5,6 г, 14,75 ммоль, 1,25 экв.) в N,N-диметилформамиде (50 мл, 0,24 М) при комнатной температуре и перемешивали в течение десяти минут. Затем к смеси добавляли L-валил-N~5~-карбамоил-N-[4-(гидроксиметил)фенил]-L-орнитинамид (из WO 04010957, 5,6 г, 14,75 ммоль, 1,25 экв.). Через 15 часов к реакционной смеси добавляли дихлорметан, что приводило к выпадению осадка, и смесь фильтровали с получением #В44 в виде не совсем белого твердого вещества. Выход: 6,9 г, 9,6 ммоль, 82%. ЖХ-МС 715,6 (М+Н)+.

Стадия 2. Синтез 4-[(N~5~-карбамоил-N~2~-{(3S)-3-[(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}гексаноил)амино]-4-метилпент-1-ен-2-ил}-L-орнитил)амино]бензил-4-нитрофенилкарбоната (#В45). Раствор #В44 (500 мг, 0,7 ммоль, 1 экв.) и 4-нитрофенилкарбоната (638 мг, 2,1 ммоль, 3 экв.) в N,N-диметилформамиде (3 мл, 0,2 М) обрабатывали N,N-диизопропилэтиламином (365 мкл, 2,1 ммоль, 3 экв.). Реакционную смесь перемешивали при комнатной температуре в течение ночи. Реакционную смесь концентрировали в вакууме, адсорбировали на SiO2 и очищали посредством хроматографии на силикагеле (градиент: от 0 до 25% метанола в дихлорметане) с получением #В45 в виде твердого вещества. Выход: 402 мг, 0,476 ммоль, 68%. ЖХ-МС (Протокол L): m/z 880,7 [М+Н]+, время удерживания составляет 3,39.

Стадия 3. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В46). Указанное в заголовке соединение получали с 10%-ным выходом из 71 мг (0,13 ммоль) #В6 и 171 мг (0,194 ммоль) #В45, используя методику, описанную для получения соединения #В41. ЖХ-МС (Протокол D): m/z 1290,5 [М+Н]+, время удерживания составляет 0,91 минуты.

Стадия 4. Синтез N-(6-аминогексаноил)-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}-метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В47). К раствору #В46 (19 мг, 0,015 ммоль, 1 экв.) в N,N-диметилформамиде (0,35 мл) добавляли пиперидин (25 мг, 0,3 ммоль, 20 экв.) и смесь перемешивали при комнатной температуре в течение 30 минут. Реакционную смесь разбавляли диметилсульфоксидом (0,7 мл) и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В47 в виде твердого вещества. Выход: 3 мг, 0,0028 ммоль, 18%. ВЭЖХ (Протокол AA): время удерживания составляет 6,65, 6,69 минуты (чистота составляет 91%). ЖХ-МС (Протокол D): m/z 1069,9 [М+Н]+, время удерживания составляет 0,61 минуты.

Пример А17

Получение N-(6-аминогексаноил)-L-валил-N-[4-({[(2-{[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-ди метилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)-фенил]-N~5~-карбамоил-L-орнитинамида (#В48).

Стадия 1. Соединение #В9 (113 мг, 0,217 ммоль) превращали в неочищенное #В7 как описано в общей методике Е. ЖХ-МС (протокол D): m/z 534,1 [М+Н]+, время удерживания составляет 0,77 минуты. Неочищенный материал использовали на следующей стадии без дополнительной очистки.

Стадия 2. Синтез N-(6-аминогексаноил)-L-валил-N-[4-({[(2-{[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В48). К раствору неочищенного #В7 (60 мг, 0,11 ммоль, 1 экв.) в N,N-диметилформамиде (2,8 мл) добавляли 2,6-диметилпиридин (48 мг, 0,448 ммоль, 4 экв.), N,N'-диизопропилэтиламин (57,9 мг, 0,448 ммоль, 4 экв.) и HOAt (15,2 мг, 0,112 ммоль, 1 экв.). Реакционную смесь нагревали до 50°С и перемешивали в течение 1,5 часов. Реакционную смесь охлаждали до комнатной температуры, медленно добавляли пиперидин (191 мг, 2,24 ммоль, 20 экв.) и перемешивали в течение 2,0 часов. Реакционную смесь концентрировали в вакууме и очищали посредством хроматографии с обращенной фазой (Метод С*) с получением #В48 в виде твердого вещества. Выход 6,4 мг, 0,005 ммоль, 5,2%. ВЭЖХ (Протокол F): m/z 1052,6 [М+Н]+, время удерживания составляет 7,114 минуты (чистота 100%).

Пример А18

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(3Н-[1,2,3]триазоло[4,5-b]пиридин-3-илокси)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В49).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(3Н-[1,2,3]триазоло[4,5-b]пиридин-3-илокси)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В49). Смесь #NP1 (1,5 г, чистота примерно 50%, 2,8 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 1,07 г, 4,5 ммоль, 1,6 экв.) и N,N'-диизопропилэтиламина (основание Хюнига, 1,0 мл) в N,N-диметилформамиде (7,0 мл) перемешивали при температуре окружающей среды в течение 40 минут. Реакционную смесь фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод F*) с получением #В49 в виде белого порошка. Выход: 730,7 мг, 80%. ВЭЖХ (Протокол N): время удерживания составляет 11,15 минуты (чистота 92%). ИЭР-МСВР (Протокол О): m/z 654,313 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 8.84 (dd, J=4,4, 1,2, 1H), 8.74 (dd, J=8,3, 1,2, 1H), 7.77 (d, J=8,2, 1H, D2O заменяемый), 7.66 (dd, J=8,3, 4,4, 1H), 6.45 (br d, J=15,8, 1H), 6.36 (ddq, J=1,5, 6,5, 6,5, 1H), 6.09 (dd, J=1,3, 11,7, 1H), 5.86 (dd, J=11,7, 7,4, 1H), 5.62 (dd, J=16,0, 5,0, 1H), 5.38 (br dd, J=7,4, 7,4, 1H), 5.18 (d, J=6,0, D2O заменяемый), 4.48 (m, 1H), 4.37 (dd, J=4,0, 4,0, 1H), 3.61 (m, 1H), 3.54 (dq, 2,1, 6,5, 1H), 3.37 (ddd, J=6,9, 6,9, 3,1, 1H), 3.34 (m, 2H), 3.26 (dd, J=16,0, 9,7, 1H), 2.21 (m, 1H), 2.14 (m, 1H), 2.10 (dd, J=12,7, 8,9, 1H), 1.99 (s, 3H), 1.74 (m, 2H), 1.68 (s, 3H), 1.59 (dd, J=13,0, 3,3, 1H), 1.50 (m, 1H), 1.25 (d, J=6,4, 3H), 0.95 (d, J=6,5, 3H), 0.86 (d, J=7,0, 3H).

Пример А19

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-2,5-диметил-6-[(2Е,4Е)-3-метил-5-{(3S,5S,7S)-7-[2-оксо-2-(3Н-[1,2,3]триазоло[4,5-b]пиридин-3-илокси)этил]-1,6-диоксаспиро[2.5]окт-5-ил}пента-2,4-диен-1-ил]тетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В50).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-2,5-диметил-6-[(2Е,4Е)-3-метил-5-{(3S,5S,7S)-7-[2-оксо-2-(3Н-[1,2,3]триазоло[4,5-b]пиридин-3-илокси)этил]-1,6-диоксаспиро[2.5]окт-5-ил}пента-2,4-диен-1-ил]тетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В50). Смесь #NP2 (284 мг, чистота 92%, 0,47 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 220 мг, 0,58 ммоль, 1,2 экв.) и N,N'-диизопропилэтиламина (основание Хюнига, 0,1 мл) в N,N-диметилформамиде (2 мл) перемешивали при температуре окружающей среды в течение 60 минут. Реакционную смесь фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод F*) с получением #В50 в виде белого порошка. Выход: 307,0 мг, 88%. ВЭЖХ (Протокол N): время удерживания составляет 13,12 минуты (чистота 94%). ИЭР-МСВР (Протокол О): m/z 638,320 [М+Н]+. 1Н ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 8.83 (dd, J=4,4, 1,2, 1H), 8.73 (dd, J=8,5, 1,2, 1H), 7.76 (d, J=8,1, 1H, D2O заменяемый), 7.66 (dd, J=8,5, 4,4, 1H), 6.39 (br d, J=15,8, 1H), 6.36 (ddq, J=1,5, 6,5, 6,5, 1H), 6.09 (dd, J=1,5, 11,7, 1H), 5.87 (dd, J=11,7, 7,5, 1H), 5.66 (dd, J=16,1, 4,9, 1H), 5.44 (br dd, J=7,1, 7,1, 1H), 4.71 (ddd, J=4,4, 4,4, 4,4, 1H), 4.51 (m, 1H), 3.63 (m, 1H), 3.57 (dq, J=2,3, 6,6, 1H), 3.41 (ddd, J=6,9, 6,9, 3,1, 1H), 3.36 (dd, J=16,0, 4,1, 1H), 3.33 (dd, J=16,1, 10,0, 1H), 2.74 (d, J=4,8, 1H), 2.70 (d, J=4,8, 1H), 2.24 (m, 1H), 2.15 (m, 1H), 1.98 (s, 3H), 1.85 (m, 1H), 1.83 (m, 1H), 1.70 (dd, J=13,0, 7,5, 1H), 1.66 (dd, J=13,5, 7,9, 1H), 1.52 (m, 1H), 1.25 (d, J=6,8, 3H), 1.00 (d, J=6,5, 3H), 0.89 (d, J=7,5, 3H).

Пример А20

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({2-[(йодацетил)амино]этил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В52).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2-аминоэтил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В51). К раствору #В49 (50,5 мг, чистота 92%, 0,08 ммоль, 1,0 экв.) и 9Н-флуорен-9-илметил-(2-аминоэтил)карбамата (32,1 мг, 0,11 ммоль, 1,4 экв.) в N,N-диметилформамиде (1,0 мл) при перемешивании добавляли N,N'-диизопропилэтиламин (основание Хюнига, 20 мкл). Затем полученную смесь перемешивали при комнатной температуре в течение 10 минут. К реакционному раствору медленно добавляли пиперидин (30 мкл, 0,35 ммоль, 4,4 экв.) и раствор перемешивали при температуре окружающей среды в течение 1 часа. Затем реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В51 в виде белого порошка. Выход: 38,8 мг, 86%. ВЭЖХ (Протокол N): время удерживания составляет 6,61 минуты (чистота 97%). ЖХ-МС (Протокол М): m/z 578,8 [М+Н]+.

Стадия 2. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({2-[(йодацетил)амино]этил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В52). Раствор йодуксусной кислоты (40,3 мг, 0,22 ммоль, 7,3 экв.) и N,N'-дициклогексилкарбодиимида (DCC, 61,6 мг, 0,3 ммоль, 10,0 экв.) в N,N-диметилформамиде (2,5 мл) перемешивали при комнатной температуре в течение 10 минут и светло-желтый раствор добавляли к #В51 (21,1 мг, чистота 85,0%, 0,031 ммоль, 1,0 экв.) в N,N-диметилформамиде (0,2 мл). Полученный раствор перемешивали при комнатной температуре в течение 20 минут. Затем реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В52 в виде белого порошка. Выход: 10,3 мг, 37%. ВЭЖХ (Протокол N): время удерживания составляет 8,96 минуты (чистота 37%). ЖХ-МС (Протокол М): m/z 746,3 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 8.22 (m, 1H, D2O заменяемый), 7.91 (m, 1H, D2O заменяемый), 7.80 (d, J=7,8, 1H, D2O заменяемый), 6.36 (dq, J=6,0, 6,0, 1H), 6.29 (br d, J=16,0, 1H), 6.11 (d, J=11,7, 1H), 5.86 (dd, J=11,7, 7,8, 1H), 5.60 (dd, J=16,0, 5,5, 1H), 5.51 (br dd, J=6,6, 6,6, 1H), 5.02 (d, J=5,0, D2O заменяемый, 1H), 4.26 (m, 2H), 3.65 (m, 2H), 3.60 (s, 2H), 3.51 (br dd, J=6,2, 6,2, 1H), 3.24 (m, 1H), 3.08 (br s, 4H), 2.76 (d, J=5,1, 1H), 2.60 (d, J=5,1, 1H), 2.51 (m, 1H), 2.47 (m, 1H), 2.28 (m, 1H), 2.18 (m, 1H), 1.98 (s, 3H), 1.86 (m, 1H), 1.80 (m, 2H), 1.70 (s, 3H), 1.65 (m, 1H), 1.49 (dd, J=12,5, 2,7, 1H), 1.25 (d, J=6,6, 3H), 1.07 (d, J=6,5, 3H), 0.95 (d, J=7,0, 3H).

Пример А21

Получение (2Z,4S)-4-гидрокси-N-{(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({2-[(йодацетил)амино]этил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}пент-2-енамида (#В54).

Стадия 1. Синтез [(3R,5S,7R,8R)-8-гидрокси-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В4). Смесь #NP1 (192 мг, чистота примерно 50%, 0,18 ммоль, 1,0 экв.), карбоната калия (300 мг, 2,4 ммоль, 13,5 экв.) и метанола (5 мл) перемешивали при комнатной температуре в течение 2 часов. Реакционную смесь нейтрализовали уксусной кислотой, фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод G) с получением #В4 в виде белого порошка. Выход: 50,2 мг. ВЭЖХ (Протокол N): время удерживания составляет 7,39 минуты (чистота 96%). ЖХ-МС (Протокол М): m/z 494,3 [М+Н]+.

Стадия 2. Синтез (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2-аминоэтил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В53). Раствор #В4 (23,4 мг, 0,047 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 34,0 мг, 0,09 ммоль, 2,0 экв.) и N,N'-диизопропилэтиламина (20,0 мкл) в N,N-диметилформамиде (1,0 мл) перемешивали при комнатной температуре в течение 30 минут. К этому раствору добавляли этан-1,2-диамин (80 мкл, 1,3 ммоль, примерно 30 экв.) и полученный раствор перемешивали в течение 1 часа. Реакционную смесь фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В53 в виде белого порошка. Выход: 31 мг. ВЭЖХ (Протокол N): время удерживания составляет 5,58 минуты (чистота 50%). ЖХ-МС (Протокол М): m/z 536,4 [М+Н]+.

Стадия 3. Синтез (2Z,4S)-4-гидрокси-N-{(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({2-[(йодацетил)амино]этил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}пент-2-енамида (#В54). Раствор йодуксусной кислоты (35 мг, 0,18 ммоль, 6 экв.) и N,N'-дициклогексилкарбодиимида (DCC, 49,8 мг, 0,24 ммоль, 8 экв.) в N,N-диметилформамиде (2 мл) перемешивали при комнатной температуре в течение 10 минут и затем добавляли к #В53 (31,0 мг, чистота примерно 50%, примерно 0,03 ммоль, 1,0 экв.) в N,N-диметилформамиде (0,2 мл). Полученный раствор перемешивали при комнатной температуре в течение 0,5 часа. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением неочищенного #В54 в виде белого порошка (23,0 мг). Полученный материал повторно очищали с другой градиентной системой, что привело к получению #В54 в виде белого порошка. Выход: 15,9 мг, 27% за три стадии, ВЭЖХ (Протокол N): время удерживания составляет 7,10 минуты (чистота 92%). ЖХ-МС (Протокол М): m/z 704,2 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 8.22 (m, 1Н, D2O заменяемый), 7.91 (m, 1Н, D2O заменяемый), 7.77 (d, J=7,8, 1Н, D2O заменяемый), 6.28 (br d, J=16,0, 1H), 5.98 (d, J=11,7, 1H), 5.86 (dd, J=11,7, 7,0, 1H), 5.60 (dd, J=16,0, 5,5, 1H), 5.51 (br dd, J=6,6, 6,6, 1H), 5.16 (dq, J=6,2, 6,2, 1H), 5.11 (d, J=3,9, 1H, D2O заменяемый), 5.03 (d, J=4,5, D2O заменяемый, 1H), 4.26 (m, 2H), 3.65 (m, 2H), 3.60 (s, 2H), 3.51 (br dd, J=6,5, 6,5, 1H), 3.25 (m, 1H), 3.08 (br s, 4H), 2.75 (d, J=4,7, 1H), 2.60 (d, J=4,7, 1H), 2.51 (m, 1H), 2.47 (m, 1H), 2.27 (m, 1H), 2.22 (m, 1H), 1.86 (m, 1H), 1.80 (m, 2H), 1.70 (s, 3H), 1.65 (m, 1H), 1.49 (dd, J=12,5, 2,3, 1H), 1.11 (d, J=6,6, 3H), 1.07 (d, J=6,0, 3H), 0.95 (d, J=7,4, 3H).

Пример А22

Получение метил-[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В55).

Стадия 1. Синтез метил-[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В55). Смесь #NP1 (9,9 мг, чистота 92%, 0,018 ммоль, 1,0 экв.), карбоната калия (40 мг, 0,33 ммоль, 18 экв.) и йодметана (30 мкл, 0,31 ммоль, 17 экв.) в N,N-диметилформамиде (500 мкл) перемешивали при комнатной температуре в течение 2 часов. Реакционную смесь нейтрализовали уксусной кислотой, фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В55 в виде белого порошка. Выход: 7,8 мг, 77%. ВЭЖХ (Протокол N): время удерживания составляет 10,7 минуты (чистота 94%). ЖХ-МС (Протокол M): m/z 550,5 [M+H]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.80 (d, J=8,1, 1H, D2O заменяемый), 6.36 (ddq, J=1,2, 6,8, 6,8, 1H), 6.28 (br d, J=15,9, 1H), 6.11 (dd, J=1,2, 11,7, 1H), 5.87 (dd, J=11,7, 7,7, 1H), 5.58 (dd, J=16,1, 5,0, 1H), 5.52 (br dd, J=7,4, 7,4, 1H), 5.02 (d, J=5,8, D2O заменяемый), 4.29 (m, 1H), 4.27 (dd, J=5,3, 5,3, 1H), 3.65 (m, 2H), 3.60 (s, 3H), 3.51 (ddd, J=7,0, 7,0, 2,5, 1H), 3.25 (dd, J=5,8, 5,3, 1H), 2.76 (d, J=5,0, 1H), 2.65 (dd, 15,4, 8,7, 1H), 2.58 (d, J=5,0, 1H), 2.57 (dd, J=15,4, 5,0), 2.30 (m, 1H), 2.21 (m, 1H), 1.98 (s, 3H), 1.86 (dd, J=13,2, 7,6, 1H), 1.69 (s, 3H), 1.66 (m, 1H), 1.53 (dd, 13,2, 3,9, 1H), 1.25 (d, J=6,1, 3H), 1.07 (d, J=6,4, 3H), 0.95 (d, J=7,4, 3H).

Пример А23

Получение [(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-3,6-диметил-5-({(2Z,4S)-4-[(пиперидин-1-илкарбонил)окси]пент-2-еноил}амино)-тетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В60) и (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({2-[(йодацетил)амино]этил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В62).

Стадия 1. Синтез метил-[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-(1-этоксиэтокси)-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В56). К смеси #NP1 (195 мг, чистота примерно 50%, 0,18 ммоль, 1,0 экв.) и карбоната калия (200 мг, 1,6 ммоль, 9 экв.) в N,N-диметилформамиде (4,0 мл) добавляли йодметан (500 мкл, 18 экв.). Полученный раствор перемешивали в течение 120 минут. Реакционную смесь фильтровали и фильтрат распределяли между водой и этилацетатом (по 10 мл в каждой фазе). Органический слой сушили над безводным сульфатом магния и упаривали при пониженном давлении с получением #В55 в виде пленки (191,2 мг, чистота примерно 50%). Затем неочищенный #В55 (191,0 мг, 0,18 ммоль, 1,0 экв.) смешивали с п-толуолсульфонатом пиридиния (PPTS, 56,1 мг, 0,22 ммоль, 1,2 экв.) и этилвиниловым эфиром (2,5 мл, 43 ммоль) в безводном дихлорметане (2,0 мл) и перемешивали при комнатной температуре в течение 1 часа. Реакционную смесь частично упаривали при пониженном давлении и затем распределяли между этилацетатом (10 мл) / водным раствором бикарбоната натрия (насыщенным, 10 мл). Органический слой сушили над безводным сульфатом магния и затем упаривали при пониженном давлении с получением #В56 (187,1 мг), ВЭЖХ (Протокол N): время удерживания составляет 13,2 минуты (чистота 50%), ЖХ-МС (Протокол М): m/z 549,5 [М+Н-СНСН3ОСН2СН3]+, который в следующей реакции использовали как он был.

Стадия 2. Синтез метил-[(3R,5S,7R,8R)-8-(1-этоксиэтокси)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В57). Суспензию #В56 (187,1 мг, чистота примерно 50%, 0,15 ммоль, 1,0 экв.), карбоната калия (120 мг, 0,98 ммоль, 6,5 экв.) в метаноле (4 мл) перемешивали при комнатной температуре в течение 1 часа. Затем реакционную смесь фильтровали и упаривали досуха при пониженном давлении с получением #В57 (171,5 мг), который в следующей реакции использовали как он был. ВЭЖХ (Протокол N): время удерживания составляет 9,9 минуты (чистота 50%). ЖХ-МС (Протокол М): m/z 507,5 [М+Н-СНСН3ОСН2СН3]+.

Стадия 3. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-(1-этоксиэтокси)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В58). Раствор #В57 (171 мг, чистота 50%, 0,15 ммоль, 1,0 экв.), бис(п-нитрофенил)карбоната (320,1 мг, 1,0 ммоль, 7 экв.), 4-(диметиламино)пиридина (9,8 мг, 0,08 ммоль, 0,5 экв.) и N,N'-диизопропилэтиламина (основание Хюнига, 150 мкл) в дихлорметане (4,0 мл) перемешивали при комнатной температуре в течение 6 часов. К реакционному раствору медленно добавляли пиперидин (500 мкл, 5,8 ммоль, 38 экв.) и полученный желтый раствор перемешивали при комнатной температуре в течение 15 минут. Добавляли ледяную воду (20 мл) и путем выпаривания при пониженном давлении удаляли органический растворитель. Образовавшийся таким образом осадок собирали фильтрованием и затем сушили под вакуумом с получением #В58 (347,0 мг), который в следующей реакции использовали как он был. ВЭЖХ (Протокол N): время удерживания составляет 13,20 минуты (чистота 25%). ЖХ-МС (Протокол М): m/z 691,7 [M+H]+.

Стадия 4. Синтез [(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-3,6-диметил-5-({(2Z,4S)-4-[(пиперидин-1-илкарбонил)окси]пент-2-еноил}амино)тетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-(1-этоксиэтокси)-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В59). К раствору #В58 (347 мг, чистота примерно 25%, 0,13 ммоль, 1,0 экв.) в ацетонитриле (10 мл) добавляли 1 М гидроксид лития (1 мл) и воду (1 мл). Полученный мутный раствор перемешивали при комнатной температуре в течение 1 часа, и он постепенно становился прозрачным. Добавляли дополнительное количество 1 М гидроксида лития (1,0 мл) и раствор далее перемешивали в течение 2 часов. Реакционную смесь распределяли между н-бутанолом (30 мл) и водой (30 мл). Верхний слой промывали H2O (20 мл) и затем упаривали досуха при пониженном давлении с получением #В59 (280,2 мг), который в следующей реакции использовали как он был. ВЭЖХ (Протокол N): время удерживания составляет 7,43 минуты (чистота 30%). ЖХ-МС (Протокол М): m/z 677,4 [M+H]+.

Стадия 5. Синтез [(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-3,6-диметил-5-({(2Z,4S)-4-[(пиперидин-1-илкарбонил)окси]пент-2-еноил}амино)-тетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В60) Раствор #В59 (280,2 мг, чистота примерно 30%, 0,12 ммоль, 1,0 экв.) и п-толуолсульфоната пиридиния (PPTS, 250,4 мг, 1 ммоль, 8,0 экв.) в метаноле (5 мл) перемешивали при комнатной температуре в течение 4 часов и затем оставляли стоять при 4°С в течение 18 часов. Потом реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В60 в виде белого порошка. Выход: 78,4 мг (40% после стадий 1-5). ВЭЖХ (Протокол N): время удерживания составляет 10,84 минуты (чистота 96,7%). ЖХ-МС (Протокол М): m/z 605,4 [М+Н]+.

Стадия 6. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2-аминоэтил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В61). Раствор #В60 (38,2 мг, 0,06 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 40,1 мг, 0,1 ммоль, 1,7 экв.) и N,N'-диизопропилэтиламина (основание Хюнига, 20,0 мкл) в N,N-диметилформамиде (1,0 мл) перемешивали при комнатной температуре в течение 20 минут. К этому раствору добавляли 1,2-этилендиамин (120 мкл, 2 ммоль, 33 экв.) и полученный раствор перемешивали в течение 20 минут. Реакционную смесь фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В61 в виде белого порошка. Выход: 14,2 мг, хх%. ВЭЖХ (Протокол N): время удерживания составляет 7,86 минуты (чистота 70%). ЖХ-МС (Протокол М): m/z 647,8 [М+Н]+.

Стадия 7. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({2-[(йодацетил)амино]этил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В62). Раствор йодуксусной кислоты (20,3 мг, 0,1 ммоль, 7 экв.) и N,N'-дициклогексилкарбодиимида (DCC, 31,6 мг, 0,15 ммоль, 10 экв.) в N,N-диметилформамиде (2 мл) перемешивали при комнатной температуре в течение 10 минут и затем добавляли в сосуд, содержащий #В61 (14,0 мг, чистота примерно 70%, 0,015 ммоль, 1,0 экв.) в N,N-диметилформамиде (0,2 мл). Полученный раствор перемешивали при комнатной температуре в течение 30 минут. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В62 в виде белого порошка. Выход: 3,7 мг (11%, за стадии 6-7). ВЭЖХ (Протокол N): время удерживания составляет 10,48 минуты (чистота 94%). ЖХ-МС (Протокол М): m/z 815,4 [М+Н]+, 837,4 [M+Na]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) 8.22 (m, 1H, D2O заменяемый), 7.91 (m, 1H, D2O заменяемый), 7.78 (d, J=7,8, 1H, D2O заменяемый), 6.29 (br d, J=16,1, 1H), 6.22 (dq, J=7,0, 7,0, 1H), 6.09 (d, J=11,7, 1H), 5.89 (dd, J=11,3, 7,4, 1H), 5.61 (dd, J=16,0, 5,1, 1H), 5.51 (br dd, J=6,2, 6,2, 1Н), 5.03 (d, J=5,5, D2O заменяемый), 4.26 (m, 2H), 3.65 (m, 2H), 3.60 (s, 2H), 3.51 (br dd, J=6,2, 6,2, 1Н), 3.30 (m, 4H), 3.24 (dd, J=5,0, 5,0, 1Н), 3.12-3.08 (m, 4H), 3.00 (d, 1Н), 2.80 (s, 4H), 2.75 (d, J=5,1, 1Н), 2.60 (d, J=5,1, 1Н), 2.49 (m, 2H), 2.28 (m, 1H), 2.21 (m, 1H), 1.89 (dd, J=13,2, 8,6, 1H), 1.80 (m, 2H), 1.70 (s, 3H), 1.64 (m, 1Н), 1.50 (dq, J=13,2, 3,1, 1Н), 1.52 (m, 2H), 1.42 (m, 4H), 1.25 (d, J=6,2, 3H), 1.07 (d, J=6,0, 3H), 0.95 (d, J=7,4, 3H).

Пример А24

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В63).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В63). К раствору #В49 (43,2 мг, чистота 92,1%, 0,065 ммоль, 1,0 экв.) в N,N-диметилформамиде (1,0 мл) добавляли чистый пропиламин (30 мкл, 0,5 ммоль, 7,0 экв.). Полученный раствор перемешивали в течение 10 минут. Реакционную смесь распределяли между H2O и этилацетатом (по 10 мл в каждой фазе). Органический слой сушили над безводным сульфатом магния и упаривали при пониженном давлении с получением #В63 Выход: 40,4 мг, 100%. ВЭЖХ (Протокол N): время удерживания составляет 9,73 минуты (чистота 89%). ИЭР-МСВР (Протокол О): m/z 577,3478 [M+H]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.83 (t, J=6,0, 1Н, D2O заменяемый), 7.81 (d, J=8,1, 1Н, D2O заменяемый), 6.36 (ddq, J=1,4, 6,5, 6,5, 1Н), 6.28 (br d, J=15,9, 1Н), 6.11 (dd, J=1,4, 11,7, 1Н), 5.87 (dd, J=11,7, 7,5, 1Н), 5.59 (dd, J=15,9, 5,4, 1Н), 5.51 (br dd, J=7,1, 7,1, 1Н), 5.02 (d, J=5,4, D2O заменяемый), 4.26 (dd, J=5,0, 5,0, 1Н), 4.24 (m, 1Н), 3.65 (m, 1Н), 3.64 (m, 1Н), 3.49 (ddd, J=7,0, 7,0, 2,6, 1Н), 3.24 (dd, J=5,0, 5,0, 1Н), 3.01 (m, 1Н), 2.96 (m, 1Н), 2.75 (d, J=5,2, 1Н), 2.58 (d, J=5,2, 1Н), 2.52 (m, 1Н), 2.29 (ddd, J=15,5, 7,1, 7,1, 1Н), 2.21 (m, 1H), 2.20 (dd, J=14,0, 4,8, 1H), 1.98 (s, 3Н), 1.83 (dd, J=13,4, 5,0, 1H), 1.80 (m, 2H), 1.69 (s, 3Н), 1.65 (m, 1Н), 1.48 (dd, 12,7, 3,9, 1Н), 1.38 (dq, J=7,5, 7,5, 2H), 1.25 (d, J=6,6, 3Н), 1.07 (d, J=6,8, 3Н), 0.95 (d, J=7,5, 3Н), 0.82 (t, J=7,5, 3Н).

Пример А25

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-2,5-диметил-6-[(2Е,4Е)-3-метил-5-{(3S,5S,7S)-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}пента-2,4-диен-1-ил]тетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В64).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-2,5-диметил-6-[(2Е,4Е)-3-метил-5-{(3S,5S,7S)-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}пента-2,4-диен-1-ил]тетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В64). Раствор #NP2 (28,7 мг, чистота 91%, 0,055 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 24,8 мг, 0,065 ммоль, 1,2 экв.) и N,N'-диизопропилэтиламина (основание Хюнига, 30 мкл) в N,N-диметилформамиде (0,5 мл) перемешивали при комнатной температуре в течение 30 минут. К этому раствору добавляли чистый пропиламин (30 мкл, 0,5 ммоль, 7,0 экв.) и полученную реакционную смесь перемешивали при комнатной температуре в течение 1 часа. Реакционную смесь фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В64 в виде белого порошка. Выход: 34,1 мг, 86%. ВЭЖХ (Протокол N): время удерживания составляет 13,11 минуты (чистота 100%). ЖХ-МС (Протокол M): m/z 561,6 [M+H]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.83 (t, J=6,0, 1H, D2O заменяемый), 7.81 (d, J=8,0, 1H, D2O заменяемый), 6.36 (ddq, J=1,6, 7,4, 6,6, 1H), 6.24 (br d, J=16,0, 1H), 6.10 (dd, J=1,6, 12,0, 1H), 5.87 (dd, J=11,8, 7,6, 1H), 5.58 (dd, J=15,9, 5,4, 1H), 5.50 (br dd, J=7,3, 7,3, 1H), 4.55 (ddd, J=5,3, 5,3, 5,3, 1H), 4.29 (dddd, J=9,5, 5,3, 5,3, 5,3, 1H), 3.65 (m, 1H), 3.64 (m, 1H), 3.48 (ddd, J=7,1, 7,1, 2,6, 1H), 3.01 (m, 1H), 2.96 (m, 1H), 2.63 (d, J=5,0, 1H), 2.61 (d, J=5,0, 1H), 2.59 (dd, J=14,2, 8,8, 1H), 2.31 (ddd, J=16,1, 7,5, 7,0, 1H), 2.21 (dd, J=I4,1, 5,0, 1H), 2.19 (m, 1H), 1.96 (s, 3Н), 1.81 (m, 1H), 1.79 (m, 1H), 1.77 (dd, J=13,0, 4,0, 1Н), 1.69 (s, 3Н), 1.66 (m, 2H), 1.37 (dq, J=7,5, 7,5, 2H), 1.36 (m, 1H), 1.25 (d, J=6,6, 3Н), 1.07 (d, J=6,8, 3Н), 0.95 (d, J=7,5, 3Н), 0.82 (t, J=7,5, 3Н).

Пример А26

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В66).

Стадия 1. Синтез (3R,4R,5R,7S)-5-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-4-илацетата (#В64а). К раствору #В63 (44,0 мг, чистота примерно 90%, 0,076 ммоль, 1,0 экв.) в пиридине (0,5 мл) добавляли уксусный ангидрид (150 мкл, 1,6 ммоль, 21,0 экв.). Полученную смесь затем перемешивали при комнатной температуре в течение 3 часов. Реакционную смесь переносили в ледяную воду (10 мл), перемешивали в течение 20 минут и затем распределяли между этилацетатом (30 мл) и водой (30 мл). Органический слой промывали водой (3×20 мл) и упаривали досуха. Остаток растворяли в диметилсульфоксиде (150 мкл) и раствор медленно добавляли к 1 М Трис (трис(гидроксиметил)аминометан) буферу с pH 7,0, который содержал эстеразу, продуцируемую Bucillus stearothermorphillus (Sigma 69509, 0,5 мг/мл, всего 15 мл). Реакционную смесь перемешивали в течение одного часа и затем распределяли между этилацетатом (2×20 мл) и водой (20 мл). Объединенные органические слои промывали водой (2×20 мл) и затем упаривали при пониженном давлении с получением #В64а в виде не совсем белого порошка. Выход: 44,9 мг (предполагался количественный выход). ВЭЖХ (Протокол N): время удерживания составляет 9,51 минуты (чистота 88%). ЖХ-МС (Протокол M): m/z 577,G [М+Н]+.

Стадия 2. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-(ацетилокси)-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В65). Раствор #В64а (14,7 мг, 0,025 ммоль, 1,0 экв.), бис(п-нитрофенил)карбоната (38,4 мг, 0,13 ммоль, 5 экв.), п-диметиламинопиридина (1,6 мг, 0,013 ммоль, 0,5 экв.) и N,N'-диизопропилэтиламина (основание Хюнига, 30 мкл) в дихлорметане (1 мл) перемешивали при комнатной температуре в течение 16 часов. К реакционному раствору медленно добавляли пиперидин (60 мкл, 0,7 ммоль, 28 экв.) и раствор перемешивали при комнатной температуре в течение 15 минут. Добавляли ледяную воду (10 мл) и путем выпаривания при пониженном давлении удаляли органический растворитель. Осадок собирали фильтрованием, промывали водой и затем упаривали при пониженном давлении с получением #В65. Выход 26,2 мг (предполагался количественный выход). ВЭЖХ (Протокол N): время удерживания составляет 13,1 минуты (чистота 45%). ЖХ-МС (Протокол М): m/z 688,5 [М+Н]+.

Стадия 3. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В66). Раствор #В65 (26,1 мг, чистота примерно 45%, 0,017 ммоль, 1,0 экв.), карбоната калия (51 мг, 0,41 ммоль, 24 экв.) в метаноле (1,5 мл) перемешивали при комнатной температуре в течение 1 часа. Реакционную смесь фильтровали и фильтрат распределяли между этилацетатом и водой (по 10 мл в каждой фазе). Органический слой сушили над безводным сульфатом магния и упаривали при пониженном давлении досуха, затем очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В66 в виде белого порошка. Выход: 7,3 мг (44% после стадий 1-3). ВЭЖХ (Протокол N): время удерживания составляет 11,44 минуты (чистота 96,7%). ЖХ-МС (Протокол М): m/z 646,4 [M+H]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.83 (t, J=5,6, 1H, D2O заменяемый), 7.79 (d, J=8,0, 1H, D2O заменяемый), 6.28 (br d, J=16,1, 1H), 6.22 (ddq, J=1,4, 6,8, 6,8, 1H), 6.08 (dd, J=1,4, 11,8, 1H), 5.88 (dd, J=11,7, 7,4, 1H), 5.59 (dd, J=15,7, 5,3, 1H), 5.51 (br dd, J=7,0, 7,0, 1H), 5.02 (d, J=5,3, D2O заменяемый), 4.27 (dd, J=5,0, 5,0, 1H), 4.23 (m, 1H), 3.65 (m, 1H), 3.64 (m, 1H), 3.49 (ddd, J=7,0, 7,0, 2,6, 1H), 3.30 (m, 4H), 3.24 (dd, J=5,0, 5,0, 1H), 3.01 (m, 1H), 2.96 (m, 1H), 2.75 (d, J=5,2, 1H), 2.58 (d, J=5,2, 1H), 2.51 (m, 1H), 2.29 (m, 1H), 2.22 (m, 1H), 2.20 (dd, J=14,0, 4,8, 1H), 1.82 (dd, J=13,3, 8,2, 1H), 1.79 (m, 2H), 1.69 (s, 3H), 1.65 (m, 1H), 1.51 (m, 2H), 1.49 (dd, 13,3, 5,0, 1H), 1.42 (m, 4H), 1.38 (dq, J=7,5, 7,5, 2H), 1.25 (d, J=6,5, 3H), 1.07 (d, J=6,4, 3H), 0.95 (d, J=7,4, 3H), 0.82 (t, J=7,5, 3H).

Пример А27

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-ди метилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В67) и (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В67).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2,5-диоксопирролидин-1-ил)окси]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В67). Смесь #В60 (Пример А23, 23,0 мг, чистота 96,7%, 0,038 ммоль, 1,0 экв.) и N,N'-дициклогексилкарбодиимида (DCC, 13,1 мг, 0,06 ммоль, 1,7 экв.) в N,N-диметилформамиде (0,8 мл) перемешивали при комнатной температуре в течение 20 минут. К этому раствору добавляли N-гидроксил-сукцинимид (34,5 мг, 0,3 ммоль, 7,7 экв.) в N,N-диметилформамиде (0,2 мл). Полученный раствор перемешивали при комнатной температуре в течение 16 часов. Реакционную смесь фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В67 в виде белого порошка. Выход: 9,4 мг, 39%. ВЭЖХ (Протокол N): время удерживания составляет 11,04 минуты (чистота 100%). 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) 7.78 (d, J=8,0, 1H, D2O заменяемый), 6.35 (br d, J=16,1, 1H), 6.22 (dq, J=7,0, 7,0, 1H), 6.08 (d, J=11,7, 1H), 5.89 (dd, J=11,7, 7,4, 1H), 5.60 (dd, J=16,0, 5,1, 1H), 5.52 (br dd, J=7,0, 7,0, 1H), 5.08 (d, J=6,2, D2O заменяемый), 4.29 (m, 2H), 3.65 (m, 2H), 3.49 (br dd, J=7,0, 7,0, 1H), 3.29 (m, 5H), 3.00 (d, J=6,6, 2H), 2.80 (s, 4H), 2.79 (d, J=5,2, 1H), 2.60 (d, J=5,2, 1H), 2.28 (m, 1H), 2.21 (m, 1H), 1.95 (dd, J=13,2, 8,6, 1H), 1.81 (m, 2H), 1.69(s, 3H), 1.64 (m, 1H), 1.58 (dq, J=13,2, 3,1, 1H), 1.52 (m, 2H), 1.43 (m, 4H), 1.25 (d, J=6,2, 3H), 1.07 (d, J=6,2, 3H), 0.95 (d, J=7,0, 3H).

Пример А28

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-ил-2-метилпропаноата (#В71).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-(1-этоксиэтокси)-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В68). Раствор #В63 (Пример А24, 35,0 мг, чистота 92%, 0,06 ммоль, 1,0 экв.), п-толуолсульфоната пиридиния (PPTS, 7,1 мг, 0,028 ммоль, 0,4 экв.) и этилвинилового эфира (0,5 мл, 8,6 ммоль, большое избыточное количество) в безводном дихлорметане (1,0 мл) перемешивали при комнатной температуре в течение 2 часов. Реакционную смесь распределяли между дихлорметаном (10 мл) и водой (10 мл). Органический слой сушили над безводным сульфатом магния и затем упаривали при пониженном давлении с получением #В68. Выход: 36,1 мг. ВЭЖХ (Протокол N): время удерживания составляет 12,33 минуты (чистота 90%). ЖХ-МС (Протокол М): m/z 577,6 [М+Н-СНСН3ОСН2СН3]+.

Стадия 2. Синтез (2Z,4S)-N-{(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-(1-этоксиэтокси)-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}-4-гидроксипент-2-енамида (#В69). Суспензию #В68 (36,1 мг, 0,05 ммоль, 1,0 экв.) и карбоната калия (50 мг, 0,4 ммоль, 8 экв.) в метаноле (1,0 мл) перемешивали при комнатной температуре в течение 1 часа. Затем реакционную смесь фильтровали и упаривали досуха при пониженном давлении с получением #В69. Выход: 33,4 мг. ВЭЖХ (Протокол N): время удерживания составляет 10,458 и 10,459 минуты (чистота 87,6%). ЖХ-МС (Протокол М): m/z 535,5 [М+Н-СНСН3ОСН2СН3]+.

Стадия 3. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-(1-этоксиэтокси)-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-ил-2-метилпропаноата (#В70). Раствор #В69 (33,0 мг, 0,049 ммоль, 1,0 экв.) и изомасляного ангидрида (100 мкл, 0,75 ммоль, 15 экв.) в пиридине (500 мкл) перемешивали при 35°С в течение 24 часов. Затем реакционную смесь упаривали при пониженном давлении с получением #В70. Выход: 37,3 мг. ВЭЖХ (Протокол N): время удерживания составляет 14,06 (чистота 88,3%). ЖХ-МС (Протокол М): m/z 605,6 [М+Н-СНСН3ОСН2СН3]+.

Стадия 4. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пропиламино)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-ил-2-метилпропаноата (#В71). Раствор #В70 (17,8 мг, 0,023 ммоль, 1,0 экв.), п-толуолсульфоната пиридиния (60 мг, 0,24 ммоль, 10 экв.) в безводном метаноле (2,0 мл) перемешивали при комнатной температуре в течение 60 минут. Затем реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В71 в виде белого порошка. Выход: 8 мг (50% после стадий 1-4). ВЭЖХ (Протокол N): время удерживания составляет 11,50 минуты (чистота 100%). ИЭР-МСВР (Протокол О): m/z 605,3798 (М+Н)+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.83 (t, J=6,0, 1H, D2O заменяемый), 7.81 (d, J=8,1, 1H, D2O заменяемый), 6.35 (ddq, J=1,3, 6,5, 6,5, 1H), 6.28 (br d, J=15,9, 1H), 6.12 (dd, J=1,3, 11,7, 1H), 5.86 (dd, J=11,7, 7,5, 1H), 5.59 (dd, J=15,9, 5,4, 1H),5.51 (br dd, J=7,1, 7,1, 1H),5.02 (d, J=5,4, D2O заменяемый), 4.26 (dd, J=5,0, 5,0, 1H), 4.24 (m, 1H), 3.65 (m, 1H), 3.64 (m, 1H), 3.49 (ddd, J=7,0, 7,0, 2,6, 1H), 3.24 (dd, J=5,0, 5,0, 1H), 3.01 (m, 1H), 2.96 (m, 1H), 2.75 (d, J=5,2, 1H), 2.58 (d, J=5,2, 1H), 2.52 (m, 1H), 2.48 (sept, J=6,5, 1H), 2.29 (ddd, J=15,5, 7,1, 7,1, 1H), 2.21 (m, 1H), 2.20 (dd, J=14,0, 4,8, 1H), 1.83 (dd, J=13,4, 5,0, 1H), 1.80 (m, 2H), 1.69 (s, 3H), 1.65 (m, 1H), 1.48 (dd, 12,7, 3,9, 1H), 1.38 (dq, J=7,5, 7,5, 2H), 1.25 (d, J=6,6, 3H), 1.07 (d, J=6,8, 9H), 0.95 (d, J=7,5, 3H), 0.82 (t, J=7,5, 3H).

Пример А29

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пиперидин-1-ил)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В72).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(пиперидин-1-ил)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В72). Смесь #NP1 (163,0 мг, чистота 92%, 0,27 ммоль, 1,0 экв.), гидрата 1-гидроксибензотриазола (НОВТ, 160,0 мг, 1 ммоль, 4 экв.) и 1-этил-3-(3-диметиламинопропил)карбодиимида-HCl (EDC, 195,0 мг, 1 моль, 4 экв.) в N,N-диметилформамиде (4,0 мл) перемешивали при 0°С в течение 30 минут. Затем к этому раствору добавляли триэтиламин (50 мкл) и пиперидин (180 мкл, 2,1 ммоль, 7,5 экв.) при 0°С. Полученную реакционную смесь перемешивали при комнатной температуре в течение 3 часов и при 0°С в течение 16 часов. Затем реакционную смесь распределяли между этилацетатом (2×20 мл) и водой (20 мл). Объединенный органический слой промывали водой (2×10 мл), сушили над безводным сульфатом магния и затем упаривали при пониженном давлении с получением неочищенного #В72 в виде не совсем белого стекла (223,5 мг, чистота 79,5%). Часть этого материала (33,1 мг) очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В72 в виде белого порошка. Выход: 27,4 мг, 100%. ВЭЖХ (Протокол N): время удерживания составляет 10,58 минуты (чистота 98%). ЖХ-МС (Протокол М): m/z 603,7 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.80 (d, J=7,8, 1H, D2O заменяемый), 6.36 (dq, J=6,0, 6,0, 1H), 6.31 (br d, J=16,0, 1H), 6.11 (d, J=11,7, 1H), 5.87 (dd, J=11,7, 7,8, 1H), 5.60 (dd, J=16,0, 5,5, 1H), 5.52 (br dd, J=7,0, 7,0, 1H), 4.98 (d, J=5,8, 1H, D2O заменяемый), 4.25 (m, 2H), 3.65 (m, 2H), 3.49 (br dd, J=6,2, 6,2, 1H), 3.40 (m, 4H), 3.25 (dd, 5,8, 5,1, 1H), 3.08 (br s, 4H), 2.76 (d, J=5,1, 1H), 2.68 (dd, J=15,2, 7,0, 1H), 2.58 (d, J=5,1, 1H), 2.50 (m, 1H), 2.29 (m, 1H), 2.20 (m, 1H), 1.98 (s, 3H), 1.86 (m, 1H), 1.80 (m, 2H), 1.70 (s, 3H), 1.65 (m, 1H), 1.56 (m, 3H), 1.48 (m, 2H), 1.40 (m, 2H), 1.25 (d, J=6,2, 3H), 1.07 (d, J=6,2, 3H), 0.95 (d, J=7,0, 3H).

Пример А30

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(транс-3-аминоциклобутил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В73).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(транс-3-аминоциклобутил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В73). Смесь #NP1 (50,2 мг, чистота 94%, 0,09 ммоль, 1,0 экв.), гидрата 1-гидроксибензотриазола (НОВТ, 65,5 мг, 0,43 ммоль, 4,7 экв.), 1-этил-3-(3-диметиламинопропил)карбодиимида-HCl (EDC, 70 мг, 0,37 ммоль, 4 экв.) в N,N-диметилформамиде (3,0 мл) перемешивали при 0°С в течение 30 минут. Затем к этому раствору добавляли транс-1,3-диаминоциклобутан (112 мг, 1,3 ммоль, 14 экв.) в N,N-диметилформамиде (1,0 мл) и триэтиламин (200 мкл) при 0°С. Полученную реакционную смесь перемешивали при комнатной температуре в течение 15 минут. Реакционную смесь нейтрализовали уксусной кислотой, фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В73 в виде бесцветного стекла. Выход: 64,3 мг, 100%. ВЭЖХ (Протокол N): время удерживания составляет 6,66 минуты (чистота 85,2%). ЖХ-МС (Протокол М): m/z 604,6 [M+H]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 8.26 (d, J=7,0, 1H, D2O заменяемый), 7.80 (d, J=7,9, 1H, D2O заменяемый), 6.36 (dq, J=6,0, 6,0, 1H), 6.28 (br d, J=16,0, 1H), 6.11 (d, J=11,3, 1H), 5.88 (dd, J=11,7, 7,8, 1H), 5.60 (dd, J=16,0, 5,8, 1H), 5.49 (br dd, J=6,6, 6,6, 1H), 5.04 (m, 1H, D2O заменяемый), 4.37 (m, 1H), 4.27-4.21 (m, 2H), 3.65 (m, 3H), 3.50 (br dd, J=5,5, 5,5, 1H), 3.26 (d, J=4,3, 1H), 2.76 (d, J=4,7, 1H), 2.58 (d, J=4,7, 1H), 2.48 (m, 1H), 2.29 (m, 1H), 2.22-2.11 (m, 6H), 1.98 (s, 3H), 1.82 (m, 1H), 1.80 (m, 2H), 1.70 (s, 3H), 1.65 (m, 1H), 1.49 (dd, J=12,5, 2,7, 1H), 1.25 (d, J=6,2, 3H), 1.07 (d, J=6,0, 3H), 0.95 (d, J=7,4, 3H).

Пример А31

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({транс-3-[(йодацетил)амино]циклобутил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В74).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({транс-3-[(йодацетил)амино]циклобутил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В74). Раствор йодуксусной кислоты (38,6 мг, 0,21 ммоль, 5,9 экв.) и N,N'-дициклогексилкарбодиимида (DCC, 64,2 мг, 0,31 ммоль, 9 экв.) в безводном N,N-диметилформамиде (2,0 мл) перемешивали при комнатной температуре в течение 10 минут. Полученный светло-желтый раствор медленно добавляли к #В73 (Пример А30, 27,1 мг, 0,035 ммоль, 1,0 экв.) в N,N-диметилформамиде (0,5 мл) и затем перемешивали при комнатной температуре в течение 15 минут. Продукт очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В74 в виде белого порошка. Выход: 14,2 мг, 41%. ВЭЖХ (Протокол N): время удерживания составляет 9,61 минуты (чистота 100%). ЖХ-МС (Протокол М): m/z 772,4 [M+H]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 8.60 (d, J=7,0, D2O заменяемый), 8.28 (d, J=7,0, 1H, D2O заменяемый), 7.80 (d, J=7,9, 1H, D2O заменяемый), 6.36 (dq, J=6,0, 6,0, 1H), 6.29 (brd, J=16,0, 1H), 6.11 (d, J=11,7, 1H), 5.87 (dd, J=11,7, 7,8, 1H), 5.60 (dd, J=16,0, 5,8, 1H), 5.49 (br dd, J=7,0, 7,0, 1H), 5.01 (d, J=5,4, 1H, D2O заменяемый), 4.27-4.23 (m, 3H), 4.19 (m, 1H), 3.65 (m, 2H), 3.59 (s, 2H), 3.49 (br dd, J=6,0, 6,0, 1H), 3.26 (dd, J=5,1, 5,1, 1H), 2.76 (d, J=5,1, 1H), 2.58 (d, J=5,1, 1H), 2.53 (m, 1H), 2.32 (m, 1H), 2.22-2.11 (m, 6H), 1.98 (s, 3H), 1.82 (m, 1H), 1.80 (m, 2H), 1.69 (s, 3H), 1.65 (m, 1H), 1.52 (dd, J=14,8, 2,7, 1H), 1.25 (d, J=6,2, 3H), 1.07 (d, J=6,0, 3H), 0.95 (d, J=7,0, 3H).

Пример А32

Получение N-[6-(2,5-диоксо-2,5-дигидро-1Н-пиррол-1-ил)гексаноил]-L-валил-N-{4-[({[транс-3-({[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)циклобутил]карбамоил}окси)-метил]фенил}-N5-карбамоил-L-орнитинамида (#В75).

Стадия 1. Синтез N-[6-(2,5-диоксо-2,5-дигидро-1Н-пиррол-1-ил)гексаноил]-L-валил-N-{4-[({[транс-3-({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)циклобутил]карбамоил}окси)метил]-фенил}-N5-карбамоил-L-орнитинамида (#В75). К раствору N-[6-(2,5-диоксо-2,5-дигидро-1Н-пиррол-1-ил)гексаноил]-L-валил-N~5~-карбамоил-N-{4-[({[(4-нитробензил)окси]карбонил}окси)метил]фенил}-L-орнитинамида (MalCValCitPABA-PNP, Eur. Pat. Appl. (1994), EP624377, 23,1 мг, 0,03 ммоль, 1,3 экв.) и #В73 (15,5 мг, чистота 85%, 0,022 ммоль, 1,0 экв.) в безводном N,N-диметилформамиде (0,6 мл) добавляли N,N-диизопропилэтиламин (основание Хюнига, 30 мкл). Полученную смесь перемешивали при комнатной температуре в течение 1 часа. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В75 в виде белого порошка. Выход: 12,6 мг, 28%. ВЭЖХ (Протокол N): время удерживания составляет 9,3 минуты (чистота 91%). ЖХ-МС (Протокол М): m/z 1202,5 [М+Н]+.

Пример А33

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(транс-4-аминоциклогексил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В76).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(транс-4-аминоциклогексил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В76). Раствор #NP1 (40,2 мг, чистота 92%, 0,07 ммоль, 1,0 экв.), гидрата 1-гидроксибензотриазола (НОВТ, 62,5 мг, 0,4 ммоль, 5,8 экв.), 1-этил-3-(3-диметиламинопропил)карбодиимида-HCl (EDC, 72,2 мг, 0,38 ммоль, 5 экв.) в N,N-диметилформамиде (3,0 мл) перемешивали при 0°С в течение 30 минут. Затем к этому раствору добавляли транс-1,4-диаминоциклогексан (290,0 мг, 2,5 ммоль, 30 экв.) в N,N-диметилформамиде (1,5 мл) и триэтиламин (50 мкл) при 0°С. Затем полученную смесь перемешивали при комнатной температуре в течение 0,5 часа и при 0°С в течение 16 часов. Реакционную смесь нейтрализовали уксусной кислотой, фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В76 в виде белого порошка. Выход: 48,2 мг, 100%. ВЭЖХ (Протокол N): время удерживания составляет 7,16 минуты (чистота 87,5%). ЖХ-МС (Протокол М): m/z 632,2 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.81 (d, J=7,8, 1H, D2O заменяемый), 7.72 (d, J=7,8, 1H, D2O заменяемый), 6.36 (dq, J=6,0, 6,0, 1H), 6.28 (br d, J=15,6, 1H), 6.11 (d, J=11,7, 1H), 5.87 (dd, J=11,7, 7,8, 1H), 5.59 (dd, J=16,0, 5,5, 1H), 5.49 (br dd, J=6,6, 6,6, 1H), 5.02 (m, 1H, D2O заменяемый), 4.26 (m, 1H), 4.22 (m, H), 3.65 (m, 2H), 3.49 (br dd, J=6,2, 6,2, 1H), 3.45-3.32 (m, 2H), 3.26 (d, J=3,9, 1H), 2.75 (d, J=5,1, 1H), 2.58 (d, J=5,1, 1H), 2.46 (m, 1H), 2.29 (m, 1H), 2.22 (m, 1H), 2.16 (dd, J=14,0, 4,7, 1H), 1.98 (s, 3Н), 1.83 (m, 1H), 1.81 (m, 2H), 1.79-1.72 (m, 4H), 1.70 (s, 3H), 1.65 (m, 1H), 1.46 (dd, J=12,5, 3,0, 1H), 1.25 (d, J=6,2, ЗН), 1.16-1.10 (m, 4H), 1.07 (d, J=6,0, ЗН), 0.95 (d, J=7,0, 3H).

Пример А34

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(5-аминопентил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата(#В77).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(5-аминопентил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В77). Раствор #NP1 (30,5 мг, чистота 92%, 0,056 ммоль, 1,0 экв.), гидрата 1-гидроксибензотриазола (НОВТ, 38,0 мг, 0,24 ммоль, 4,4 экв.), 1-этил-3-(3-диметиламинопропил)карбодиимида-HCl (EDC, 54,0 мг, 0,28 ммоль, 5 экв.) в N,N-диметилформамиде (3,0 мл) перемешивали при 0°С в течение 30 минут. Затем к этому раствору добавляли триэтиламин (50 мкл) и 1,5-пентандиамин (50 мкл, 0,5 ммоль, 9 экв.) при 0°С. Полученную смесь перемешивали при комнатной температуре в течение 1 часа. Реакционную смесь нейтрализовали уксусной кислотой, фильтровали и затем очищали посредством хроматографии с обращенной фазой (Метод В*). Фракцию с пиком со временем удерживания 22,0 минуты собирали, нейтрализовали NH4OH и сушили вымораживанием с получением #В77 в виде белого порошка. Выход 23,1 мг, 68%. ВЭЖХ (Протокол N): время удерживания составляет 7,67 минуты (чистота 91%). ЖХ-МС (Протокол М): m/z 620,6 [М+Н]+.

Пример А35

Получение N-{[(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-2-метилаланина (#В79).

Стадия 1. Синтез N-{[(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-2-метилаланина (#В78). Смесь #NP2 (118,3 мг, чистота 94,0%, 0,2 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 31,7 мг, 0,083 ммоль, 0,4 экв.) и N,N-диизопропилэтиламина (основание Хюнига, 10 мкл) в N,N-диметилформамиде (2,0 мл) перемешивали при температуре окружающей среды в течение 30 минут. Затем к этому раствору добавляли триэтиламин (100 мкл) и 2-метилаланин (32,5 мг, 0,3 ммоль, 1,3 экв.) в смеси 1:1 пиридин/диметилсульфоксид (1,0 мл). Полученную суспензию перемешивали при температуре окружающей среды в течение 2,0 часов. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В78 в виде белого порошка. Выход: 54,3 мг, 45%. ВЭЖХ (Протокол N): время удерживания составляет 11,29 минуты (чистота 94,1%). ЖХ-МС (Протокол М): m/z 605,6 [М+Н]+.

Стадия 2. Синтез N-{[(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-2-метилаланина (#В79). Раствор #В78 (6,6 мг, 0,011 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 6,0 мг, 0,016 ммоль, 1,5 экв.) и N,N-диизопропилэтиламина (основание Хюнига, 3,0 мкл) в N,N-диметилформамиде (200 мкл) перемешивали при температуре окружающей среды в течение 30 минут. К этому раствору добавляли пропиламин (3,6 мкл, 0,06 ммоль, 5 экв.) и полученный раствор перемешивали в течение 1 часа. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В79 в виде белого порошка. Выход: 4,9 мг, 70%. ВЭЖХ (Протокол N): время удерживания составляет 12,31 минуты (чистота 100%). ЖХ-МС (Протокол М): m/z 646,7 [М+Н]+; 668,7 [M+Na]+.

Пример А36

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-(2-{[2-метил-1-оксо-1-(пропиламино)пропан-2-ил]амино}-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В81).

Стадия 1. Синтез N-{[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-2-метилаланина (#В80). Смесь #NP1 (122,4 мг, чистота 92,0%, 0,22 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 33,2 мг, 0,087 ммоль, 0,4 экв.) и N,N-диизопропилэтиламина (основание Хюнига, 10 мкл) в N,N-диметилформамиде (2,0 мл) перемешивали при температуре окружающей среды в течение 30 минут. Затем к этому раствору добавляли триэтиламин (100 мкл) и 2-метилаланин (36,4 мг, 0,35 ммоль, 1,2 экв.) в смеси 1:1 пиридин/диметилсульфоксид (1,0 мл). Полученную суспензию перемешивали при температуре окружающей среды в течение 2,0 часов. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В80 в виде белого порошка. Выход: 52,7 мг, 42%. ВЭЖХ (Протокол N): время удерживания составляет 9,28 минуты (чистота 90%). ЖХ-МС (Протокол М): m/z 621,6 [М+Н]+.

Стадия 2. Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-(2-{[2-метил-1-оксо-1-(пропиламино)пропан-2-ил]амино}-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В81). Раствор #В80 (6,0 мг, чистота 90%, 0,01 ммоль, 1,0 экв.), гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 5,1 мг, 0,013 ммоль, 1,3 экв.) и N,N-диизопропилэтиламина (основание Хюнига, 3,0 мкл) в N,N-диметилформамиде (200 мкл) перемешивали при температуре окружающей среды в течение 30 минут. К этому раствору добавляли пропиламин (3,6 мкл, 0,06 ммоль, 6 экв.) и полученный раствор перемешивали в течение 1 часа. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В81 в виде белого порошка. Выход: 4,7 мг, 87%. ВЭЖХ (Протокол N): время удерживания составляет 10,95 минуты (чистота 99%). ЖХ-МС (Протокол М): m/z 662,7 [М+Н]+.

Пример А37

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3R,4R,5R,7S)-7-{2-[(4-{[({4-[(N-{6-[(бромацетил)амино]гексаноил}глицил)амино]бензил}окси)-карбонил]амино}бензил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В123).

Стадия 1. Синтез 9Н-флуорен-9-илметил-{2-[(4-{[(трет-бутоксикарбонил)амино]метил}фенил)амино]-2-оксоэтил}карбамата (#В118). К раствору Fmoc-глицина (16 г, 54 ммоль, 1,0 экв.) в сухом DMF (160 мл) при 0°С добавляли N,N-диизопропилэтиламин (DIPEA) (14 г, 108 ммоль, 2,0 экв.) и тетрафторборат N,N,N',N'-тетраметил-O-(бензотриазол-1-ил)урония (TBTU) (16 г, 54 ммоль, 1,0 экв.). Смесь перемешивали при 0°С в течение 30 минут и добавляли раствор трет-бутил-[4-(глициламино)бензил]карбамата (12 г, 54 ммоль, 1,0 экв.) в сухом DMF (50 мл). Смесь перемешивали при комнатной температуре в течение ночи, вливали в ледяную воду (400 мл) и экстрагировали EtOAc (400 мл × 2). Органический слой промывали рассолом (200 мл × 2), сушили над Na2SO4 и концентрировали в вакууме. Остаток перекристаллизовывали из EtOAc (200 мл) и петролейного эфира (400 мл) с получением #В118 (18 г, 66,6%) в виде белого твердого вещества. 1Н ЯМР (400 Гц, DMSO-d6): δ 9.93 (s, 1Н), 7.91 (d, 2H), 7.75 (d, 2H), 7.61 (m, 1 H), 7.52 (d, 2H), 7.43 (m, 2H), 7.36 (m, 3Н), 7.18 (d, 3 H), 4.32 (d, 2H), 4.26 (m, 1 H), 4.07 (d, 2H), 3.80 (d, 2H), 1.39 (s, 9H).

Стадия 2. Синтез трет-бутил-[4-(глициламино)бензил]карбамата (#В119). К раствору #В118 (7,0 г, 14,0 ммоль, 1,0 экв.) в DMF (70 мл) добавляли пиперидин (4,7 мл, 47,5 ммоль, 3,4 экв.) при комнатной температуре. Смесь перемешивали при комнатной температуре в течение 30 минут, упаривали в вакууме. Остаток промывали петролейным эфиром (100 мл × 2) и перекристаллизовывали из EtOAc (50 мл) и петролейного эфира (200 мл) с получением #В119 (3,3 г, 84,6%) в виде белого твердого вещества. 1H ЯМР (400 Гц, CDCl3): δ 9.37 (s, 1Н), 7.57 (d, 2Н), 7.25 (d, 2H), 4.80 (br, 1H), 4.27 (d, 2H), 3.47 (s, 2H), 1.45 (s, 9H).

Стадия 3. Синтез 9Н-флуорен-9-илметил-[6-({2-[(4-{[(трет-бутоксикарбонил)амино]метил}фенил)амино]-2-оксоэтил}амино)-6-оксогексил]-карбамата (#В120). К раствору 6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексановой кислоты (2,66 г, 7,53 ммоль, 1,0 экв.) в сухом DCM (50 мл) при 0°С добавляли N,N-диизопропилэтиламин (1,93 г, 15,1 ммоль, 2,0 экв.) и гексафторфосфат O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 2,86 г, 7,53 ммоль, 1,0 экв.). Смесь перемешивали при 0°С в течение 30 минут и одной порцией добавляли #В119 (2,1 г, 7,53 ммоль, 1,0 экв.). Смесь перемешивали при комнатной температуре в течение ночи. Смесь фильтровали и твердое вещество промывали DCM и сушили в вакууме с получением #В120 (4 г, 86,4%) в виде белого твердого вещества. 1H ЯМР (400 Гц, DMSO-d6): δ 9.91 (s, 1H), 8.11 (br, 1H), 7.90 (d, 2H), 7.69 (d, 2H), 7.51 (d, 2H), 7.41 (m, 2H), 7.33 (m, 3Н), 7.17 (d, 2H), 4.28 (m, 3H), 4.06 (d, 2H), 3.86 (br, 2H), 2.97 (m, 2H), 2.15 (m, 2H), 1.51 (m, 2H), 1.38 (m, 12H); ЖХ-МС (Протокол I): m/z 637,1 (М+Na]+, время удерживания составляет 1,18 минуты.

Стадия 4. Синтез трифторацетатной соли 9Н-флуорен-9-илметил-{6-[(2-{[4-(аминометил)фенил]амино}-2-оксоэтил)амино]-6-оксогексил}карбамата (#В121). К суспензии #В120 (1 г, 1,63 ммоль, 1,0 экв.) в сухом DCM (20 мл) при 0°С добавляли трифторуксусную кислоту (6 мл, большой избыток). Смесь перемешивали при комнатной температуре в течение 2 часов и концентрировали в вакууме. Остаток суспендировали в воде (30 мл) и лиофилизировали с получением #В121 (1,2 г, 100%) в виде слегка желтого твердого вещества. 1H ЯМР (400 Гц, DMSO-d6): δ 10.08 (s, 1H), 8.15 (br, 4H), 7.90 (d, 2H), 7.69 (d, 2H), 7.63 (d, 2H), 7.41 (m, 8H), 4.30 (m, 3Н), 3.98 (m, 3H), 3.87 (d, 2H), 2.97 (m, 2H), 2.17 (m, 2H), 1.51 (m, 2H), 1.40 (m, 2H), 1.26 (m, 2H). ЖХ-МС (Протокол I): m/z 537,1 (М+Na]+, время удерживания составляет 1,10 минуты.

Стадия 5. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(4-{[N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}гексаноил)глицил]-амино}бензил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В122). К раствору #В121 (32,7 мг, 0,044 ммоль, 1 экв.) в тетрагидрофуране (1,0 мл) и метаноле (0,1 мл) добавляли N,N-диизопропилэтиламин (26,0 мг, 0,2 ммоль, 4,5 экв.). Реакционную смесь полностью добавляли к охлажденному (0°С) раствору #В1 (28 мг, 0,044 ммоль, 1 экв.) в тетрагидрофуране (1,0 мл) и реакционную смесь оставляли нагреваться до комнатной температуры. Через один час реакционную смесь концентрировали в вакууме и остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В122 (12,4 мг, 0,011 ммоль, 27%). ЖХ-МС (Протокол D): m/z 1032,6 [М+Н]+, время удерживания составляет 0,92 минуты.

Стадия 6. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3R,4R,5R,7S)-7-{2-[(4-{[({4-[(N-{6-[(бромацетил)амино]гексаноил}глицил)амино]бензил}окси)-карбонил]амино}бензил)амино]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В123). К раствору #В122 (12,4 мг, 0,012 ммоль, 1 экв.) в диметилформамиде (0,7 мл, 0,01 М) добавляли пиперидин (11 мкл исходного раствора [полученного путем растворения 100 мкл пиперидина в 1 мл DMF], 0,013 ммоль, 1,1 экв.). Реакционную смесь перемешивали в течение 16 часов, затем по каплям добавляли раствор N-гидроксисукцинимидного сложного эфира бромуксусной кислоты (2,8 мг, 0,012 ммоль, 1 экв.) в тетрагидрофуране (0,5 мл). Реакционную смесь перемешивали в течение 16 часов, концентрировали в вакууме и остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В123 в виде твердого вещества. Выход: 2,5 мг, 0,027 ммоль, 22%. ЖХ-МС (Протокол D): m/z 932,2 [М+Н]+, время удерживания составляет 0,76 минуты.

Пример А38

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-карбамимидамидо-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В124) и (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[2-(N'-{[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}карбамимидамидо)-2-оксоэтил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В125).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-карбамимидамидо-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В124) и (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[2-(N'-{[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-карбамимидамидо)-2-оксоэтил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В125). К смеси #NP1 (135 мг, чистота примерно 60%, примерно 0,15 ммоль) и гексафторфосфата O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (HATU, 72 мг, 0,19 ммоль, 1,2 экв.) в N,N-диметилформамиде (DMF, 1,0 мл) при 0°С добавляли N,N'-диизопропилэтиламин (30 мкл, #экв.). После перемешивания при температуре окружающей среды в течение 10 минут смесь переносили в раствор гидрохлорида гуанидина (400 мг, 4,1 ммоль, 28 экв.) и N,N'-диизопропилэтиламина (100 мкл) в смеси 1:1 метилсульфоксид/вода (3,0 мл). Полученный раствор перемешивали в течение 20 минут и очищали посредством хроматографии с обращенной фазой (Метод В*) с получением (#В124) и (#В125) в виде белых порошков.

#В124: Выход: 55,6 мг, 38%. ВЭЖХ (Протокол N): время удерживания составляет 8,01 минуты (чистота 87%). ЖХ-МС (Протокол М): m/z 577,44 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.80 (d, J=7,9, 1H, D2O заменяемый), 6.36 (dq, J=6,0, 6,0, 1H), 6.27 (br d, J=16,0, 1H), 6.11 (d, J=11,3, 1H), 5.87 (dd, J=11,3, 7,4, 1H), 5.60 (dd, J=15,6, 5,5, 1H), 5.51 (br dd, J=7,4, 7,4, 1H), 4.93 (d, J=5,8, 1H, D2O заменяемый), 4.29 (m, 1H), 4.22 (m, 1H), 3.65 (m, 2H), 3.50 (br dd, J=6,0, 6,0, 1H), 3.22 (dd, J=4,7, 4,7, 1H), 2.73 (d, J=5,1, 1H), 2.56 (d, J=5,1, 1H), 2.46 (m, 1H), 2.32 (m, 2H), 2.20 (m, 1H), 1.98 (s, 3H), 1.82 (m, 1H), 1.80 (m, 2H), 1.69 (s, 3H), 1.65 (m, 1H), 1.52 (dd, J=13,2, 3,5, 1H), 1.25 (d, J=6,2, 3H), 1.07 (d, J=6,0, 3H), 0.95 (d, J=7,4, 3H).

#B125: Выход: 49,0 мг, 36%. ВЭЖХ (Протокол N): время удерживания составляет 10,14 минуты (чистота 90%). ЖХ-МС (Протокол М): m/z 1094,76 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.78 (d, J=7,9, 2H, D2O заменяемый), 6.36 (dq, J=6,0, 6,0, 2H), 6.27 (br d, J=16,0, 2H), 6.11 (d, J=11,7, 2H), 5.87 (dd, J=11,7, 7,8, 2H), 5.60 (dd, J=16,0, 5,0, 2H), 5.49 (br dd, J=6,7, 6,7, 2H), 5.01 (br s, 2H, D2O заменяемый), 4.32 (m, 2H), 4.25 (m, 2H), 3.65 (m, 4H), 3.49 (br dd, J=6,6, 6,6, 2H), 3.28 (d, J=4,3, 2H), 2.76 (d, J=4,7, 2H), 2.59 (d, J=4,7, 2H), 2.54 (m, 2H), 2.30 (m, 2H), 2.28 (m, 2H), 2.21 (m, 2H), 1.98 (s, 6H), 1.83 (m, 2H), 1.80 (m, 4H), 1.69 (s, 6H), 1.65 (m, 2H), 1.52 (br d, J=12,8, 2H), 1.25 (d, J=6,2, 6H), 1.06 (d, J=6,2, 6H), 0.94 (d, J=7,0, 6H).

Димерные соединения, аналогичные раскрытым выше, также включены в объем настоящего изобретения, например димерные соединения с заменами, описанными во всей этой заявке.

Пример А39

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[N'-(бромацетил)карбамимидамидо]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В126).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[N'-(бромацетил)карбамимидамидо]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В126). К раствору #В124 (24,0 мг, 0,042 ммоль, 1,0 экв.) и N-гидроксисукцинимидного сложного эфира бромуксусной кислоты (24,1 мг, 0,092 ммоль, 2,0 экв.) в N,N-диметилформамиде (1 мл) добавляли N,N'-диизопропилэтиламин (10 мкл). Полученный раствор перемешивали при температуре окружающей среды в течение 30 минут и очищали посредством хроматографии с обращенной фазой (Метод В*) с получением #В126 в виде белого порошка. Выход: 5,7 мг, 20%. ВЭЖХ (Протокол N): время удерживания составляет 10,01 минуты (чистота 99%). ЖХ-МС (Протокол М): m/z 697,35, 699,35 (1:1) [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 9.57 (br s, 1H, D2O заменяемый), 9.41 (br s, 1H, D2O заменяемый), 9.24 (br s, 1H, D2O заменяемый), 9.08 (br s, 1H, D2O заменяемый), 7.79 (d, J=7,5, 1H, D2O заменяемый), 6.36 (dq, J=6,0, 6,0, 1H), 6.26 (br d, J=16,0, 1H), 6.11 (d, J=11,7, 1H), 5.87 (dd, J=11,3, 7,4, 1H), 5.60 (m, 1H), 5.49 (m, 1H), 4.35-4.28 (m, 2H), 3.65 (m, 2H), 3.50 (br dd, J=6,0, 6,0, 1H), 3.41 (s, 2H), 3.26 (d, J=4,7, 1H), 2.78 (d, J=4,3, 1H), 2.61 (d, J=4,3, 1H), 2.55 (m, 1H), 2.32 (m, 2H), 2.20 (m, 1H), 1.98 (s, 3H), 1.85 (m, 1H), 1.80 (m, 2H), 1.69 (s, 3H), 1.65 (m, 1H), 1.53 (dd, J=13,2, 3,5, 1H), 1.25 (d, J=6,2, 3H), 1.07 (d, J=6,2, 3H), 0.95 (d, J=6,6, 3H).

Пример А40

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-[{2-[(йодацетил)(метил)амино]этил}(метил)амино]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В128).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(метил(2-(метиламино)этил)амино)]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В127). К раствору #В49 (54,5 мг, 0,084 ммоль, 1,0 экв.) в N,N-диметилформамиде (2,0 мл) добавляли N,N'-диметил-1,2-этилендиамин (120 мкл, 1,1 ммоль, 12 экв.). Реакционную смесь перемешивали при температуре окружающей среды в течение 5 минут и продукт очищали посредством хроматографии с обращенной фазой (Метод В*) с получением (#В127). Выход: 29,1 мг, 57%, ВЭЖХ (Протокол N): время удерживания составляет 6,92 минуты (чистота 76%). ЖХ-МС (Протокол М): m/z 606,3 [М+Н]+.

Стадия 2. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-[{2-[(йодацетил)(метил)амино]этил}(метил)амино]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В128). Раствор йодуксусной кислоты (43,1 мг, 0,23 ммоль, 4,8 экв.) и N,N'-дициклогексилкарбодиимида (DCC, 64,10 мг, 0,3 ммоль, 6,3 экв.) в N,N-диметилформамиде (2,0 мл) перемешивали при температуре окружающей среды в течение 10 минут и затем переносили в раствор (#В127) (29,1 мг, чистота 76,0%, 0,048 ммоль, 1 экв.) в N,N-диметилформамиде (0,2 мл). Реакционную смесь перемешивали в течение 20 минут и очищали посредством хроматографии с обращенной фазой с получением (#В128) в виде белого порошка. Выход: 12,2 мг, 54%. ВЭЖХ анализ (Протокол N): время удерживания составляет 9,57 минуты (чистота 95,2%). ЖХ-МС (Протокол М): m/z 774,2 [М+Н]+. 1H ЯМР (400 МГц, DMSO-d6, мульт, J в Гц) δ 7.80 (d, J=7,4, 1H, D2O заменяемый), 6.36 (dq, J=6,2, 6,2, 1H), 6.33 (br d, J=15,5, 1H), 6.11 (d, J=11,3, 1Н), 5.86 (dd, J=11,7, 7,8, 1H), 5.60 (dd, J=16,0, 4,7, 1H), 5.52 (br dd, J=6,6, 6,6, 1H), 4.98 (m, 1H, D2O заменяемый), 4.26 (m, 2H), 3.65 (m, 2H), 3.51 (br dd, J=6,2, 6,2, 1H), 3.46-3.35 (m, 6H), 3.24 (m, 1H), 3.02 (s, 1,5H), 2.97 (s, 1,5H), 2.95 (s, 1,5H), 2.82 (s, 1,5H), 2.76 (m, 1H), 2.65 (m, 1H), 2.59 (m, 1H), 2.55 (m, 1H), 2.30 (m, 1H), 2.22 (m, 1H), 1.98 (s, 3H), 1.86 (m, 1H), 1.80 (m, 2H), 1.70 (s, 3Н), 1.65 (m, 1H), 1.49 (dd, J=12,5, 2,7, 1H), 1.25 (d, J=6,2, 3Н), 1.07 (d, J=6,2, 3H), 0.95 (d, J=7,0, 3Н).

Пример А41

Получение (2Z)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-оксопент-2-енамида (#В129).

Стадия 1. Синтез (2Z)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-оксопент-2-енамида (#В129). К раствору #В39 (60 мг, 0,13 ммоль, 1 экв.) в дихлорметане (2 мл) при 0°С добавляли перйодинан Десс-Мартина (DMP) (119 мг, 0,27 ммоль, 2 экв.) и удаляли ледяную баню. Через 35 минут добавляли насыщенный бикарбонат натрия и дихлорметан, и водный слой экстрагировали дихлорметаном. Объединенные органические экстракты сушили над сульфатом натрия и фильтровали, и растворители удаляли в вакууме. Неочищенный материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В129 в виде белого твердого вещества. Выход: 19,04 мг, 0,04 ммоль, 32%. ЖХ-МС (Протокол D): m/z 475,3 [М+Н]+, время удерживания составляет 0,70 минуты. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ d, J=8,0 Гц, 1 Н), 7.32 (s, 1 H), 6.77 (s, 1 H), 6.32 (s, 2 H), 6.27 (d, J=16,0 Гц, 1 Н), 5.60 (dd, J=16,0 и 5,5 Гц, 1 Н), 5.55-5.47 (m, 1 H), 4.58-4.50 (m, 1 H), 4.35-4.26 (m, 1 H), 3.69-3.59 (m, 2 H), 3.54-3.48 (m, 1 H), 2.65-2.51 (m, 3 H), 2.36-2.15 (m, 6 H), 1.88-1.73 (m, 3 H), 1.72-1.60 (m, 6 H), 1.37 (dd, J=13,3 и 6,2 Гц, 1 H), 1.08 (d, J=6,6 Гц, 3 H), 0.96 (d, J=7,4 Гц, 3 H).

Пример А42

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-метил[2-(метилсульфанил)этил]карбамата (#В130).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-{[трет-бутил(диметил)силил]окси}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В131). К раствору #В9 (119 мг, 0,22 ммоль, 1 экв.) в дихлорметане (3 мл) при 0°С добавляли 2,6-лутидин (104 мкл, 0,89 ммоль, 4 экв.), а затем по каплям трет-бутил-диметилсилил-трифторметансульфонат (160 мкл, 0,67 ммоль, 3 экв.). Через 70 минут реакционную смесь разбавляли насыщенным бикарбонатом натрия и дихлорметаном, экстрагировали, фильтровали через трубку для отделения растворителя и растворители удаляли в вакууме. Неочищенный целевой материал очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 5% до 100%) с получением #В131 в виде белого твердого вещества. Выход: 34 мг, 0,05 ммоль, 23%. ЖХ-МС (Протокол С): m/z 671,3 [М+Na]+, время удерживания составляет 2,08 минуты.

Стадия 2. Синтез (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-{[трет-бутил(диметил)силил]окси}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В132). К раствору #В131 (32 мг, 0,049 ммоль, 1 экв.) в смеси 4:1 тетрагидрофуран: вода (1 мл) добавляли гидроксид лития (11,7 мг, 0,49 ммоль, 10 экв.) и смесь перемешивали при комнатной температуре в течение 21 часа. Реакционную смесь концентрировали в вакууме и остаток переносили в этилацетат и воду. Водный слой экстрагировали этилацетатом (3х) и объединенные органические слои сушили над безводным сульфатом натрия и концентрировали в вакууме. После очистки посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 100%) получали #В132 в виде белого твердого вещества. Выход: 11,3 мг, 0,019 моль, 38%. ЖХ-МС (Протокол D): m/z 629,3 [М+Na]+, время удерживания составляет 0,98 минуты.

Стадия 3. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-{[трет-бутил(диметил)силил]окси}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-метил[2-(метилсульфанил)этил]карбамата (#В133). К раствору #В132 (63,2 мг, 0,104 ммоль, 1 экв.) в дихлорметане (1,8 мл) добавляли триэтиламин (73 мкл, 0,520 ммоль, 5 экв.), 4-N,N-диметиламинопиридин (8,9 мг, 0,073 ммоль, 0,7 экв.) и бис-(4-нитрофенил)-карбонат (106 мг, 0,343 ммоль, 3,3 экв.) и реакционную смесь перемешивали при комнатной температуре в течение 2,5 часов. К 1/3 этой смеси добавляли гидрохлорид N-метил-2-(метилсульфанил)этанамина (24,6 мг, 0,174 ммоль, 1,67 экв.) и смесь перемешивали при комнатной температуре в течение 1 часа. Реакционную смесь разбавляли водой, экстрагировали дихлорметаном, фильтровали через трубку для отделения растворителя, разбавляли диметилсульфоксидом (1 мл) и концентрировали в вакууме. Остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В133. Выход: 15,2 мг, 0,021 ммоль, 20%. ЖХ-МС (Протокол С): m/z 760,76 [М+Na]+, время удерживания составляет 2,19 минуты.

Стадия 4. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-метил[2-(метилсульфанил)этил]карбамата (#В130). К раствору #В133 (15,2 мг, 0,021 ммоль, 1 экв.) в тетрагидрофуране (0,4 мл), охлажденному до 0°С, добавляли фторид тетрабутиламмония (TBAF) (1 М в тетрагидрофуране, 53 мкл, 0,053 ммоль, 2,5 экв.) и реакционную смесь через 10 минут нагревали до комнатной температуры (КГ). Через 1,5 часа реакционную смесь концентрировали в вакууме и остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В130. Выход: 8,5 мг, 0,014 ммоль, 65%. ЖХ-МС (Протокол D): m/z 646,3 [М+Na]+, время удерживания составляет 0,79 минуты. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.77 (d, J=8,2 Гц, 1 Н), 7.31 (s, 1 Н), 6.77 (s, 1 Н), 6.32 (d, J=16,0 Гц, 1 Н), 6.26-6.18 (m, 1 Н), 6.09 (d, J=11,5 Гц, 1 Н), 5.89 (dd, J=11,5 и 7,0 Гц, 1 Н), 5.60 (dd, J=16,0 и 5,5 Гц, 1 Н), 5.54-5.47 (m, 1 Н), 5.00 (d, J=5,5 Гц, 1 Н), 4.29-4.21 (m, 2 Н), 3.69-3.61 (m, 2 Н), 3.54-3.47 (m, 1 Н), 3.42-3.33 (m, 2 Н), 3.26-3.21 (m, 1 Н), 2.89-2.78 (m, 3 Н), 2.74 (d, J=5,1 Гц, 1 Н), 2.64-2.56 (m, 3 Н), 2.36-2.17 (m, 4 Н), 2.07 (s, 3 Н), 1.90-1.78 (m, 3 Н), 1.72-1.61 (m, 4 Н), 1.54-1.46 (m, 1 Н), 1.26 (d, J=6,6 Гц, 3 Н), 1.07 (d, J=6,2 Гц, 3 Н), 0.96 (d, J=7,0 Гц, 3 Н).

Пример А43

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В134).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-{[трет-бутил(диметил)силил]окси}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В135). Используя методику, описанную на стадии 3 примера А42, указанное в заголовке соединение получали с 18%-ным выходом из 63,2 мг (0,104 ммоль, 1,0 экв.) #В132, триэтиламина (73 мкл, 0,520 ммоль, 5 экв.), 4-N,N-диметиламинопиридина (8,9 мг, 0,073 ммоль, 0,7 экв.), бис-(4-нитрофенил)-карбоната (106 мг, 0,343 ммоль, 3,3 экв.) и пиперидина (14,8 мг, 0,174 ммоль, 1,7 экв.), используя методику, описанную для получения соединения #В133. ЖХ-МС (Протокол D): m/z 740,5 [M+Na]+, время удерживания составляет 1,13 минуты.

Стадия 2. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-амино-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперидин-1-карбоксилата (#В134). Указанное в заголовке соединение получали с 76%-ным выходом из 13,5 мг (0,019 ммоль) #В135 и 12,8 мг (53 мкл 1 М раствора в тетрагидрофуране, 0,053 ммоль, 2,5 экв.) фторида тетрабутиламмония, используя методику, описанную для соединения #В130. ЖХ-МС (Протокол D): m/z 626,60 [М+Na]+, время удерживания составляет 0,81 минуты. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.77 (d, J=7,80 Гц, 1 Н), 7.31 (s, 1 Н), 6.77 (s, 1 Н), 6.32 (d, J=15,6 Гц, 1 Н), 6.26-6.17 (m, 1 Н), 6.09 (d, J=11,7 Гц, 1 Н), 5.89 (dd, J=11,7 и 7,4 Гц, 1 Н), 5.60 (dd, J=16,0 и 5,5 Гц, 1 Н), 5.54-5.47 (m, 1 Н), 5.00 (d, J=5,5 Гц, 1 Н), 4.29-4.20 (m, 2 Н), 3.69-3.61 (m, 2 Н), 3.54-3.47 (m, 1 Н), 3.27-3.21 (m, 1 Н), 2.75 (d, J=5,1 Гц, 1 Н), 2.58 (d, J=5,1 Гц, 1 Н), 2.36-2.16 (m, 4 Н), 1.88-1.78 (m, 3 Н), 1.73-1.61 (m, 4 Н), 1.57-1.38 (m, 7 Н), 1.25 (d, J=6,2 Гц, 3 Н), 1.07 (d, J=6,2 Гц, 3 Н), 0.96 (d, J=7,4 Гц, 3 Н).

Пример А44

Получение ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперазин-1-карбоксилата (#В136).

Стадия 1. Синтез ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илпиперазин-1-карбоксилата (#В136). Указанное в заголовке соединение получали с 27%-ным выходом из 37 мг (0,078 ммоль) триэтиламина (39,7 мг, 0,39 ммоль, 5 экв.), 4-N,N-диметиламинопиридина (6,7 мг, 0,055 ммоль, 0,7 экв.), бис-(4-нитрофенил)-карбоната (84,7 мг, 0,273 ммоль, 3,5 экв.) и пиперазина (16,8 мг, 0,195 ммоль, 2,5 экв.), используя методику, описанную для получения соединения #В133. ВЭЖХ (Протокол AA): время удерживания составляет 6,318 минуты (чистота 95%). ЖХ-МС (Протокол С): m/z 589,4 [M+H]+, время удерживания составляет 0,97 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.77 (d, J=8,20 Гц, 1 H), 7.31 (s, 1 H), 6.77 (s, 1 H), 6.31-6.17 (m, 2 H), 6.09 (d, J=11,7 Гц, 1 H), 5.89 (dd, J=11,7 и 7,4 Гц, 1 H), 5.60 (dd, J=15,6 и 5,5 Гц, 1 H), 5.55-5.45 (m, 1 H), 4.57-4.50 (m, 1 H), 4.35-4.25 (m, 1 H), 3.69-3.60 (m, 2 H), 3.54-3.46 (m, 2 H), 2.65-2.53 (m, 4 H), 2.36-2.14 (m, 4 H), 1.88 (s, 3 H), 1.85-1.73 (m, 3 H), 1.72-1.61 (m, 5 H), 1.41-1.33 (m, 1 H), 1.25 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,0 Гц, 3 H).

Пример А45

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-4-метилпиперазин-1-карбоксилата (#В137).

Стадия 1. Синтез ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-4-метилпиперазин-1-карбоксилата (#В137). Указанное в заголовке соединение получали с 27%-ным выходом из 37 мг (0,078 ммоль) триэтиламина (39,7 мг, 0,39 ммоль, 5 экв.), 4-N,N-диметиламинопиридина (6,7 мг, 0,055 ммоль, 0,7 экв.), бис-(4-нитрофенил)-карбоната (84,7 мг, 0,273 ммоль, 3,5 экв.) и 1-Ме-пиперазина (19,5 мг, 0,195 ммоль, 2,5 экв.), используя методику, описанную для получения соединения #В133. ЖХ-МС (Протокол С): m/z 603,4 [М+Н]+, время удерживания составляет 1,29 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.77 (d, J=7,8 Гц, 1 H), 7.32 (s, 1 H), 6.77 (s, 1 H), 6.32-6.19 (m, 2 H), 6.10 (d, J=11,7 Гц, 1 H), 5.89 (dd, J=11,7 и 7,4 Гц, 1 H), 5.60 (dd, J=16,0 и 5,9 Гц, 1 H), 5.55-5.47 (m, 1 H), 4.58-4.50 (m, 1 H), 4.35-4.26 (m, 1 H), 3.71-3.61 (m, 2 H), 3.55-3.47 (m, 2 H), 2.65-2.53 (m, 3 H), 2.36-2.14 (m, 8 H), 1.89 (s, 3 H), 1.85-1.74 (m, 3 H), 1.72-1.61 (m, 5 H), 1.42-1.33 (m, 1 H), 1.26 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.96 (d, J=7,4 Гц, 3 H).

Пример А46

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,5S,7S)-7-{[(1H-имидазол-1-илкарбонил)амино]метил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В138), ацетатной соли (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3R,5S,7S)-7-(аминометил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В139) и ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3R,5S,7S)-7-(аминометил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В140).

Стадия 1а. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,5S,7S)-7-{[(1Н-имидазол-1-илкарбонил)амино]метил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В138). К раствору #В22 (15,9 мг, 0,030 ммоль, 1 экв.) в ацетонитриле (0,6 мл) при КТ добавляли карбонилдиимидазол (CDI) (7,4 мг, 0,045 ммоль, 1,5 экв.) и реакционную смесь оставляли перемешиваться в течение 10 минут. Затем реакционную смесь нагревали до 60°С в течение 5,5 часов и охлаждали до КТ. Добавляли воду и дихлорметан, и водный слой экстрагировали. Объединенные органические экстракты сушили над сульфатом натрия и фильтровали, и растворители удаляли в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В138 в виде белого твердого вещества. Выход: 3,4 мг, 0,0059 ммоль, 20%. ЖХ-МС (Протокол С): m/z 585,4 [M+H]+, время удерживания составляет 1,40 минуты. ВЭЖХ (Протокол AA): время удерживания составляет 7,426 минуты (чистота 83%).

Стадия 1b. Синтез ацетатной соли (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,5S,7S)-7-(аминометил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В139). К раствору #В22 (35,2 мг, 0,066 ммоль, 1 экв.) в ацетонитриле (2,2 мл) при КТ добавляли карбонилдиимидазол (16,2 мг, 0,099 ммоль, 1,5 экв.) и реакционную смесь оставляли перемешиваться в течение 30 минут. Затем реакционную смесь нагревали до 60°С в течение 5 часов. Реакционную смесь охлаждали до КТ, добавляли к раствору ацетонитрила (33 мл), воды (17 мл) и 1 н. NaOH (17 мл) и оставляли перемешиваться при КТ в течение 15 минут. Реакционную смесь разбавляли водой и ацетонитрил удаляли в вакууме. Водный раствор экстрагировали дихлорметаном, нейтрализовали уксусной кислотой (0,5 мл) и концентрировали в вакууме. Остаток переносили в ацетонитрил, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В139 в виде белого твердого вещества. Выход: 7,7 мг, 0,015 ммоль, 23%. ЖХ-МС (Протокол С): m/z 449,3 [М+Н]+, время удерживания составляет 0,93 минуты. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.76 (d, J=8,2 Гц, 1 Н), 6.26 (d, J=15,6 Гц, 1 Н), 5.97 (d, J=11,7 Гц, 1 Н), 5.86 (dd, J=11,7 и 7,0 Гц, 1 Н), 5.67 (dd, J=15,6 и 5,8 Гц, 1 Н), 5.56-5.49 (m, 1 Н), 5.21-5.13 (m, 1 Н), 4.54-4.46 (m, 1 Н), 3.79-3.71 (m, 1 Н), 3.70-3.60 (m, 2 Н), 3.54-3.46 (m, 1 Н), 2.80 (dd, J=12,9 и 7,4 Гц, 1 Н), 2.62 (s, 2 Н), 2.58-2.53 (m, 1 H), 2.37-2.14 (m, 2 H), 1.89-1.56 (m, 11 H), 1.44 (dd, J=13,3 и 7,4 Гц, 1 H), 1.11 (d, J=6,6 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.96 (d, J=7,4 Гц, 3 H).

Стадия 1с. Синтез ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,5S,7S)-7-(аминометил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В140). К раствору #В22 (50,8 мг, 0,095 ммоль, 1 экв.) в ацетонитриле (3,1 мл) при КТ добавляли карбонилдиимидазол (23,4 мг, 0,143 ммоль, 1,5 экв.) и реакционную смесь оставляли перемешиваться в течение 30 минут. Затем реакционную смесь нагревали до 65°С в течение 4 часов. Реакционную смесь охлаждали до КТ, добавляли к раствору ацетонитрила (83 мл), воды (6 мл) и 1 н. NaOH (6 мл) и оставляли перемешиваться при КТ в течение 35 минут. Реакционную смесь нейтрализовали уксусной кислотой (0,35 мл) и концентрировали в вакууме. Остаток переносили в ацетонитрил, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В140. Выход: 15 мг, 0,030 ммоль, 32%. ЖХ-МС (Протокол С): m/z 491,3 [М+Н]+, время удерживания составляет 1,13 минуты. ВЭЖХ (Протокол AA): время удерживания составляет 6,969 минуты (чистота 87%). 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 7.78 (d, J=7,8 Гц, 1 H), 6.42-6.30 (m, 1 H), 6.26 (d, J=16,0 Гц, 1 H), 6.11 (d, J=11,5 Гц, 1 H), 5.87 (dd, J=11,5 и 7,4 Гц, 1 H), 5.67 (dd, J=16,0 и 5,8 Гц, 1 H), 5.56-5.49 (m, 1 H), 4.54-4.46 (m, 1 H), 3.81-3.73 (m, 1 H), 3.69-3.61 (m, 2 H), 3.54-3.46 (m, 1 H), 2.80 (dd, J=12,9 и 7,4 Гц, 1 H), 2.63 (s, 2 H), 2.58-2.53 (m, 1 H), 2.37-2.14 (m, 2 H), 1.98 (s, 3 H), 1.84-1.56 (m, 8 H), 1.44 (dd, J=13,3 и 7,4 Гц, 1 H), 1.25 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,6 Гц, 3 H), 0.96 (d, J=7,0 Гц, 3 H).

Пример А47

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-[(транс-4-гидроксициклогексил)амино]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В141), (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-[(цис-3-гидроксициклобутил)амино]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В142), (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-(2-метилгидразинил)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В143), (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-(3R,4R,5R,7S)-4-гидрокси-7-[2-(1-метилгидразинил)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В144) и (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[2-(1,2-диметилгидразинил)-2-оксоэтил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В145).

Стадия 1а. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-[(транс-4-гидроксициклогексил)амино]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В141). К раствору #В1 (19,7 мг, 0,031 ммоль, 1 экв.), растворенного в тетрагидрофуране (0,5 мл), добавляли транс-4-аминоциклогексанол (5,7 мг, 0,049 ммоль, 1,6 экв.). После перемешивания в течение 1,5 часов реакционную смесь разбавляли водой, экстрагировали дихлорметаном и объединенные органические вещества сушили над сульфатом натрия и фильтровали. Растворители удаляли в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В141 в виде белого твердого вещества. Выход: 11,8 мг, 0,019 ммоль, 60%. ВЭЖХ (Протокол AA): время удерживания составляет 7,408 минуты (чистота 94%). ЖХ-МС (Протокол D): m/z 633,3 [М+Н]+, время удерживания составляет 0,73 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.79 (d, J=8,2 Гц, 1 Н), 7.68 (d, J=7,8 Гц, 1 Н), 6.42-6.32 (m, 1 Н), 6.28 (d, J=16,0 Гц, 1 Н), 6.11 (d, J=11,5 Гц, 1 Н), 5.87 (dd, J=11,5 и 7,4 Гц, 1 Н), 5.59 (dd, J=16,0 и 5,5 Гц, 1 Н), 5.54-5.45 (m, 1 Н), 5.00 (d, J=5,1 Гц, 1 Н), 4.49 (d, J=4,3 Гц, 1 Н), 4.30-4.15 (m, 2 Н), 3.70-3.60 (m, 2 Н), 3.54-3.39 (m, 2 Н), 3.26-3.20 (m, 1 Н), 2.74 (d, J=5,1 Гц, 1 Н), 2.58 (d, J=5,1 Гц, 1 Н), 2.37-2.10 (m, 3 Н), 1.98 (s, 3 Н), 1.89-1.59 (m, 10 Н), 1.51-1.41 (m, 1 Н), 1.25 (d, J=6,6 Гц, 3 Н), 1.20-1.10 (m, 4 Н), 1.07 (d, J=6,2 Гц, 3 Н), 0.95 (d, J=7,4 Гц, 3 Н).

Стадия 1b. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{2-[(цис-3-гидроксициклобутил)амино]-2-оксоэтил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В142). К раствору #В1 (16,2 мг, 0,026 ммоль, 1 экв.) в смеси тетрагидрофуран/N,N-диметилформамид (5:1, 0,6 мл) при КТ добавляли N,N-диизопропилэтиламин (13,7 мкл, 0,078 ммоль, 3 экв.) и гидрохлорид транс-3-аминоциклобутанола (4,8 мг, 0,039 ммоль, 1,5 экв.) (время после полудня 12:48) и реакционную смесь перемешивали в течение 2 часов. Добавляли дополнительные количества N,N-диметилформамида (100 мкл), N,N-диизопропилэтиламина (13 мкл, 0,078 ммоль, 3 экв.) и гидрохлорида транс-3-аминоциклобутанола (3 мг, 0,024 ммоль, 0,9 экв.) и реакционную смесь перемешивали в течение дополнительных 30 минут. Реакционную смесь разбавляли диметилсульфоксидом и концентрировали в вакууме для удаления тетрагидрофурана. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В142 в виде белого твердого вещества. Выход: 9,5 мг, 0,016 ммоль, 61%. ВЭЖХ (Протокол AA): время удерживания составляет 7,057 минуты (чистота 91%). ЖХ-МС (Протокол D): m/z 627,1 [М+Na]+, время удерживания составляет 0,72 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 8.03 (d, J=7,8 Гц, 1 Н), 7.79 (d, J=8,2 Гц, 1 Н), 6.42-6.32 (m, 1 H), 6.28 (d, J=16,0 Гц, 1 Н), 6.11 (d, J=11,7 Гц, 1 Н), 5.87 (dd, J=11,7 и 7,4 Гц, 1 Н), 5.59 (dd, J=16,0 и 5,5 Гц, 1 Н), 5.55-5.48 (m, 1 Н), 5.07-4.97 (m, 2 Н), 4.30-4.17 (m, 2 Н), 3.81-3.71 (m, 1 Н), 3.70-3.59 (m, 3 Н), 3.54-3.46 (m, 1 Н), 3.27-3.20 (m, 1 Н), 2.75 (d, J=4,9 Гц, 1 Н), 2.58 (d, J=4,9 Гц, 1 Н), 2.48-2.39 (m, 2 Н), 2.36-2.13 (m, 3 Н), 1.98 (s, 3 Н), 1.89-1.61 (m, 9 H), 1.49-1.41 (m, 1 H), 1.25 (d, J=6,6 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 H).

Стадия 1с. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-(2-метилгидразинил)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В143) и (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-(1-метилгидразинил)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В144). К раствору #В1 (32,4 мг, 0,051 ммоль, 1 экв.) в смеси тетрагидрофуран/N,N-диметилформамид (2:1, 0,75 мл) добавляли при КТ добавляли N,N-диизопропилэтиламин (71,8 мкл, 0,408 ммоль, 8 экв.) и N-метилгидразинсульфат (22,1 мг, 0,15 ммоль, 3 экв.) и реакционную смесь перемешивали в течение 20 минут Добавляли дополнительное количество N,N-диметилформамида (250 мкл). Через еще 30 минут добавляли дополнительные количества N,N-диизопропилэтиламина (35 мкл, 0,20 ммоль, 4 экв.) и N-метилгидразинсульфата (15 мг, 0,10 ммоль, 2 экв.) и реакционную смесь перемешивали в течение 45 минут. Реакционную смесь разбавляли водой и этилацетатом и водный слой экстрагировали. Объединенные органические слои промывали рассолом, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В143 и #В144 в виде белых твердых веществ.

#В143 Выход: 1,9 мг, 0,0034 ммоль, 7%. ЖХ-МС (Протокол D): m/z 564,2 [М+Н]+, время удерживания составляет 0,73 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 9.31 (d, J=5,9 Гц, 1 Н), 7.81 (d, J=8,1 Гц, 1 Н), 6.41-6.32 (m, 1 Н), 6.29 (d, J=16,0 Гц, 1 Н), 6.11 (d, J=11,6 Гц, 1 Н), 5.87 (dd, J=11,6 и 7,6 Гц, 1 Н), 5.59 (dd, J=16,0 и 5,6 Гц, 1 Н), 5.54-5.48 (m, 1 H), 5.04 (d, J=5,4 Гц, 1 H), 4.80-4.72 (m, 1 H), 4.29-4.20 (m, 2 H), 3.69-3.61 (m, 2 H), 3.53-3.46 (m, 1 H), 3.27-3.21 (m, 1 H), 2.75 (d, J=5,1 Гц, 1 H), 2.58 (d, J=5,1 Гц, 1 H), 2.45-2.13 (m, 7 H), 1.98 (s, 3 H), 1.89-1.74 (m, 3 H), 1.72-1.58 (m, 4 H), 1.53-1.45 (m, 1 H), 1.25 (d, J=6,6 Гц, 3 H), 1.07 (d, J=6,4 Гц, 3 H), 0.95 (d, J=7,3 Гц, 3 H).

#В144 Выход: 2,3 мг, 0,0040 ммоль, 8%. ЖХ-МС (Протокол D): m/z 564,2 [М+Н]+, время удерживания составляет 0,76 минуты. 1Н ЯМР (500 МГц, DMSO-d6) δ 7.81 (d, J=7,8 Гц, 1 H), 6.41-6.27 (m, 2 H), 6.11 (d, J=11,5 Гц, 1 H), 5.87 (dd, J=11,5 и 7,3 Гц, 1 H), 5.60 (dd, J=16,1 и 5,9 Гц, 1 H), 5.56-5.48 (m, 1 H), 4.94 (d, J=6,4 Гц, 1 H), 4.67 (s, 1 H), 4.32-4.20 (m, 2 H), 3.69-3.62 (m, 2 H), 3.53-3.47 (m, 1 H), 3.26-3.21 (m, 1 H), 3.06 (dd, J=154 и 7,3 Гц, 1 H), 2.98 (s, 2 H), 2.75 (d, J=4,9 Гц, 1 H), 2.62-2.53 (m, 2 H), 2.35-2.13 (m, 3 H), 1.98 (s, 3 H), 1.89-1.74 (m, 3 H), 1.72-1.58 (m, 5 H), 1.25 (d, J=6,4 Гц, 3 H), 1.07 (d, J=6,4 Гц, 3 H), 0.95 (d, J=7,3 Гц, 3 Н).

Стадия 1d. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[2-(1,2-диметилгидразинил)-2-оксоэтил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В145). К раствору #В1 (29,7 мг, 0,047 ммоль, 1 экв.) в смеси тетрагидрофуран/N,N-диметилформамид (1:1, 1 мл) при КТ добавляли N,N-диизопропилэтиламин (116 мкл, 0,658 ммоль, 14 экв.), а затем дигидрохлорид N,N'-диметилгидразина (31,3 мг, 0,235 ммоль, 5 экв.) и реакционную смесь перемешивали в течение 30 минут. Реакционную смесь разбавляли водой и этилацетатом и водный слой экстрагировали. Объединенные органические слои промывали рассолом, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В145 в виде белого твердого вещества. Выход: 2,2 мг, 0,0038 ммоль, 8%. ЖХ-МС (Протокол D): m/z 578,2 [М+Н]+, время удерживания составляет 0,82 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 7.81 (d, J=8,1 Гц, 1 H), 6.41-6.27 (m, 2 H), 6.11 (d, J=11,7 Гц, 1 H), 5.87 (dd, J=11,7 и 7,6 Гц, 1 H), 5.60 (dd, J=15,9 и 5,4 Гц, 1 H), 5.56-5.48 (m, 1 H), 4.94 (d, J=6,6 Гц, 1 H), 4.79 (q, J=5,7 Гц, 1 H), 4.32-4.19 (m, 2 H), 3.68-3.61 (m, 2 H), 3.53-3.47 (m, 1 H), 3.26-3.21 (m, 1 H), 3.01 (d, J=15.2 и 7,3 Гц, 1 H), 2.93 (s, 3 H), 2.76-2.73 (m, 1 H), 2.60-2.53 (m, 2 Н), 2.44 (d, J=5,7 Гц, 3 Н), 2.35-2.15 (m, 3 H), 1.98 (s, 3 H), 1.87-1.75 (m, 3 H), 1.72-1.56 (m, 5 H), 1.25 (d, J=6,4 Гц, 3 Н), 1.07 (d, J=6,4 Гц, 3 Н), 0.95 (d, J=7,3 Гц, 3 Н).

Пример А48

Получение N-{6-[(бромацетил)амино]гексаноил}-D-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)-карбонил]окси}метил)фенил]-N~5~-карбамоил-1--орнитинамида (#В146).

Стадия 1. Синтез N-{6-[(бромацетил)амино]гексаноил}-D-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}-метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В146). К раствору #В47 (10,4 мг, 0,009 ммоль, 1 экв.) в N,N-диметилформамиде (0,3 мл) при КТ добавляли N,N-диизопропилэтиламин (6,3 мкл, 0,036 ммоль, 4 экв.), потом 1-[(бромацетил)окси]пирролидин-2,5-дион (4,2 мг, 0,017 ммоль, 1,9 экв.), перемешивали в течение 15 минут и затем очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В146 в виде белого твердого вещества. Выход: 4,6 мг, 0,004 ммоль, 43%. ВЭЖХ (Протокол AA): время удерживания составляет 7,597 минуты (чистота 87%). ЖХ-МС (Протокол С): m/z 1188,6 [М+Н]+ время удерживания составляет 1,37 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 9.99 (s, 1 H), 9.68 (s, 1 H), 9.12 (s, 1 H), 8.26-8.18 (m, 1 H), 8.11-8.04 (m, 1 H), 7.84-7.74 (m, 2 H), 7.64-7.54 (m, 2 H), 7.34-7.21 (m, 2 H), 6.41-6.27 (m, 2 H), 6.11 (d, J=11,7 Гц, 1 Н), 6.00-5.93 (m, 1 H), 5.87 (dd, J=11,7 и 7,4 Гц, 1 H), 5.65-5.47 (m, 2 H), 5.40 (s, 2 H), 5.04 (d, J=5,5 Гц, 1 H), 5.02-4.96 (m, 2 H), 4.43-4.34 (m, 1 H), 4.30-4.16 (m, 3 H), 3.81 (s, 2 H), 3.69-3.60 (m, 2 H), 3.54-3.45 (m, 1 H), 3.26-3.20 (m, 1 H), 3.09-2.88 (m, 4 H), 2.77-2.73 (m, 1 H), 2.62-2.55 (m, 1 H), 2.36-2.07 (m, 5 H), 1.98 (s, 3 H), 1.84-1.76 (m, 1 H), 1.73-1.61 (m, 5 H), 1.54-1.33 (m, 5 H), 1.29-1.21 (m, 5 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 H), 0.84 (dd, J=11,3 и 6,6 Гц, 6 H).

Пример А49

Получение ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(аминометил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В147).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(аминометил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В147). К раствору #В14 (40 мг, 0,073 ммоль, 1 экв.) в ацетонитриле (2,3 мл) добавляли CDI (29,8 мг, 0,182 ммоль, 2,5 экв.) при КТ и реакционную смесь перемешивали в течение 40 минут Затем реакционную смесь нагревали до 65°С в течение 4 часов. После охлаждения до КТ реакционную смесь добавляли к раствору ацетонитрила (63 мл), воды (4,5 мл) и 1 н. NaOH (4,5 мл) и перемешивали в течение 30 минут Добавляли уксусную кислоту (270 мкл) и смесь концентрировали в вакууме. Полученный остаток переносили в ацетонитрил, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В147 в виде белого твердого вещества. Выход: 5,1 мг, 0,0088 ммоль, 12%. ВЭЖХ (Протокол AA): время удерживания составляет 6,778 минуты (чистота 89%). ЖХ-МС (Протокол С): m/z 507,2 [М+Н]+, время удерживания составляет 0,98 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.77 (d, J=7,4 Гц, 1 H), 6.41-6.24 (m, 2 H), 6.11 (d, J=11,7 Гц, 1 H), 5.87 (dd, J=11,7 и 7,4 Гц, 1 H), 5.65 (dd, J=16,0 и 6,2 Гц, 1 H), 5.56-5.48 (m, 1 H), 5.00-4.91 (m, 1 H), 4.27-4.20 (m, 1 H), 3.78-3.60 (m, 3 H), 3.55-3.46 (m, 1 H), 3.22-3.18 (m, 1 H), 2.80-2.71 (m, 2 H), 2.62-2.53 (m, 2 H), 2.33-2.15 (m, 3 H), 1.98 (s, 3 H), 1.89-1.77 (m, 5 H), 1.73-1.61 (m, 4 H), 1.48-1.41 (m, 1 H), 1.25 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,0 Гц, 3 H).

Пример А50

Получение метил-[(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В148).

Стадия 1. Синтез метил-[(3S,5S,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В148). К раствору #NP2 (204 мг, 0,393 ммоль, 1 экв.) в N,N-диметилформамиде (4,5 мл) при КТ добавляли карбонат калия (272 мг, 1,96 ммоль, 5 экв.) и йодметан (740 мкл, 11,8 ммоль, 30 экв.) и реакционную смесь перемешивали в течение 1,5 часов. Реакционную смесь фильтровали, промывали водой (3х), сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. ЖХ-МС (протокол D): m/z 534,42 [М+Н]+, время удерживания составляет 0,89 минуты. Неочищенный материал использовали на следующей стадии без дополнительной очистки.

Стадия 2. Синтез метил-[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В148). К раствору неочищенного материала со Стадии 1 примера А#50 в метаноле (3,5 мл) при КТ добавляли карбонат калия (136 мг, 0,056 ммоль, 2,5 экв.) и реакционную смесь перемешивали в течение 2 часов. Реакционную смесь фильтровали с метанолом, разбавляли диметилсульфоксидом (2 мл) и концентрировали в вакууме. После очистки посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 90%) получали #В148 в виде белого твердого вещества. Выход: 91,6 мг, 0,18 ммоль, 48%. ЖХ-МС (Протокол D): m/z 492,47 [М+Н]+, время удерживания составляет 0,80 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.76 (d, J=7,8 Гц, 1 H), 6.25 (d, J=16,0 Гц, 1 H), 5.97 (d, J=11,9 Гц, 1 H), 5.87 (d, J=11,9 и 7,0 Гц, 1 H), 5.65-5.48 (m, 2 H), 5.22-5.13 (m, 1 H), 5.10 (d, J=4,7 Гц, 1 H), 4.56-4.48 (m, 1 H), 4.36-4.25 (m, 1 H), 3.69-3.61 (m, 2 H), 3.60 (s, 3 H), 3.55-3.46 (m, 1 H), 2.74-2.56 (m, 4 H), 2.38-2.13 (m, 2 H), 1.90-1.60 (m, 9 H), 1.44 (dd, J=13,2 и 7,0 Гц, 1 H), 1.11 (d, J=6,2 Гц, 3 H), 1.06 (d, J=6,2 Гц, 3 H), 0.96 (d, J=7,0 Гц, 3Н).

Пример А51

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-4-(метилсульфанил)бутаноата (#В149).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-4-(метилсульфанил)бутаноата (#В149). К раствору #В148 (12 мг, 0,024 ммоль, 1 экв.) в дихлорметане (0,5 мл) добавляли 4-(метилтио)бутановую кислоту (32,2 мг, 0,24 ммоль, 10 экв.), 4-N,N-диметиламинопиридин (2,9 мг, 0,023 ммоль, 1 экв.) и DIC (41,3 мкл, 0,264 ммоль, 11 экв.) и реакционную смесь оставляли перемешиваться в течение 1 часа. Реакционную смесь разбавляли диметилсульфоксидом (0,8 мл) и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В149 в виде смолы. Выход: 9,7 мг, 0,016 ммоль, 66%. ЖХ-МС (Протокол D): m/z 608,2 [М+Н]+, время удерживания составляет 1,05 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.79 (d, J=7,8 Гц, 1 H), 6.44-6.32 (m, 1 H), 6.25 (d, J=16,0 Гц, 1 H), 6.12 (d, J=11,7 Гц, 1 H), 5.87 (dd, J=11,7 и 7,4 Гц, 1 H), 5.62-5.50 (m, 2 H), 4.57-4.48 (m, 1 H), 4.36-4.25 (m, 1 H), 3.70-3.62 (m, 2 H), 3.60 (s, 3 H), 3.55-3.47 (m, 1 H), 2.74-2.56 (m, 4 H), 2.48-2.43 (m, 2 H), 2.41-2.15 (m, 4 H), 2.02 (s, 3 H), 1.88-1.60 (m, 11 H), 1.44 (dd, J=12,9 и 6,6 Гц, 1 H), 1.26 (d, J=6,6 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.96 (d, J=7,4 Гц, 3Н).

Пример А52

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{[(бромацетил)амино]метил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В150).

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{[(бромацетил)амино]метил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В150). К раствору #В147 (7 мг, 0,01 ммоль, 1 экв.) в N,N-диметилформамиде (0,4 мл) при КТ добавляли N,N-диизопропилэтиламин (8,5 мкл, 0,048 ммоль, 4 экв.) и 1-[(бромацетил)окси]пирролидин-2,5-дион (4,2 мг, 0,018 ммоль, 1,5 экв.) и реакционную смесь перемешивали в течение 10 минут Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В150 в виде белого твердого вещества. Выход: 2,9 мг, 0,005 ммоль, 40%. ЖХ-МС (Протокол D): m/z 649,2 [M+Na]+, время удерживания составляет 0,81 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 8.42-8.32 (m, 1 H), δ 7.79 (d, J=7,8 Гц, 1 H), 6.44-6.32 (m, 1 H), 6.28 (d, J=16,0 Гц, 1 H), 6.11 (d, J=11,3 Гц, 1 H), 5.87 (dd, J=11,3 и 7,4 Гц, 1 H), 5.61 (dd, J=16,0 и 5,5 Гц, 1 H), 5.56-5.49 (m, 1 H), 5.02 (d, J=5,9 Гц, 1 H), 4.33-4.26 (m, 1 H), 3.95-3.83 (m, 3 H), 3.72-3.59 (m, 2 H), 3.55-3.45 (m, 1 H), 3.40-3.32 (m, 1 H), 3.28-3.14 (m, 2 H), 2.77 (d, J=5,1 Гц, 1 H), 2.61 (d, J=5,1 Гц, 1 H), 2.31-2.12 (m, 2 H), 1.98 (s, 3 H), 1.88-1.75 (m, 3 H), 1.73-1.61 (m, 4 H), 1.51-1.41 (m, 1 H), 1.25 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,0 Гц, 3 H).

Пример А53

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-(4-{[({[(3R,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]метил}карбамоил)окси]метил}-фенил)-N~5~-карбамоил-L-орнитинамида (#В151).

Стадия 1. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N-(4-{[({[(3R,5S,7S)-7-(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]метил}карбамоил)окси]-метил}фенил)-N~5~-карбамоил-L-орнитинамида (#В152). К раствору #В140 (10,7 мг, 0,022 ммоль, 1 экв.) в N,N-диметилформамиде при КТ добавляли 2,6-лутидин (10,2 мкл, 0,088 ммоль, 4 экв.), N,N-диизопропилэтиламин (15,5 мкл, 0,088 ммоль, 4 экв.), 4-N,N-диметиламинопиридин (2,7 мг, 0,022 ммоль, 1 экв.) и #В45 (22,9 мг, 0,026 ммоль, 1,2 экв.) и реакционную смесь перемешивали в течение 40 минут Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В152 в виде белого твердого вещества. Выход: 14,9 мг, 0,012 ммоль, 55%. ЖХ-МС (Протокол С): m/z 1231,6 [M+H]+, время удерживания составляет 1,97 минуты.

Стадия 2. Синтез ацетатной соли N-(6-аминогексаноил)-L-валил-N-(4-{[({[(3R,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]метил}карбамоил)окси]метил}фенил)-N~5~-карбамоил-L-орнитинамида (#В153). Указанное в заголовке соединение получали с 86%-ным выходом из 14,9 мг (0,012 ммоль, 1,0 экв.) #В152 и 20,4 мг (0,24 ммоль, 20,0 экв.) пиперидина, используя методику, описанную для получения соединения #В47. ЖХ-МС (Протокол С): m/z 1009,83 [М+Н]+, время удерживания составляет 1,35 минуты.

Стадия 3. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-(4-{[({[(3R,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]метил}карбамоил)окси]метил}фенил)-N~5~-карбамоил-L-орнитинамида (#В151). Указанное в заголовке соединение получали с 70%-ным выходом из 11 мг (0,01 ммоль, 1,0 экв.) #В153 и 3,5 мг (0,015 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 5,2 мг (0,04 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя методику, описанную для получения соединения #В150. ВЭЖХ (Протокол AA): время удерживания составляет 8,413 минуты (чистота 87%). ЖХ-МС (Протокол С): m/z 1151,5 [M+Na]+, время удерживания составляет 1,61 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 9.96 (s, 1 H), 8.25-8.18 (m 1 H), 8.06 (d, J=7,4 Гц, 1 H), 7.83-7.74 (m, 2 H), 7.62-7.54 (m, 2 H), 7.31-7.20 (m, 3 H), 6.41-6.31 (m, 1 H), 6.25 (d, J=15,8 Гц, 1 H), 6.11 (d, J=11,7 Гц, 1 H), 6.00-5.92 (m, 1 H), 5.87 (dd, J=11,7 и 7,4 Гц, 1 H), 5.61 (dd, J=15,8 и 5,9 Гц, 1 H), 5.55-5.47 (m, 1 H), 5.39 (s, 2 H), 5.00-4.88 (m, 2 H), 4.59-4.49 (m, 1 H), 4.43-4.34 (m, 1 H), 4.24-4.15 (m, 2 H), 3.99-3.88 (m, 1 H), 3.81 (s, 2 H), 3.69-3.58 (m, 2 H), 3.53-3.36 (m, 2 H), 3.10-2.88 (m, 5 H), 2.63 (s, 2 H), 2.31-2.08 (m, 4 H), 2.02-1.92 (m, 4 H), 1.83-1.56 (m, 10 H), 1.55-1.29 (m, 7 H), 1.28-1.20 (m, 5 H), 1.05 (d, J=6,6 Гц, 3 H), 0.94 (d, J=7,4 Гц, 3 H), 0.85 (dd, J=11,3 и 6,6 Гц, 6 H).

Пример А54

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-(4-{[({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]метил}карбамоил)-окси]метил}фенил)-N~5~-карбамоил-L-орнитинамида (#В154).

Стадия 1. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N-(4-{[({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]метил}карбамоил)окси]метил}фенил)-N~5~-карбамоил-L-орнитинамида (#В155). Указанное в заголовке соединение получали с 41%-ным выходом из 13 мг (0,023 ммоль) #В147, 9,9 мг (0,092 ммоль, 4 экв.) 2,6-лутидина, 12,0 мг (0,092 ммоль, 4 экв.) N,N-диизопропилэтиламина, 2,8 мг (0,023 ммоль, 1 экв.) 4-N,N-диметиламинопиридина и 24,6 мг (0,028 ммоль, 4 экв.) #В45 (22,9 мг, 0,026 ммоль, 1,2 экв.), используя методику, описанную для получения соединения #В152. ЖХ-МС (Протокол D): m/z 1247,93 [M+H]+, время удерживания составляет 0,91 минуты.

Стадия 2. Синтез ацетатной соли N-(6-аминогексаноил)-L-валил-N-(4-{[({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]метил}карбамоил)окси]метил}-фенил)-N~5~-карбамоил-L-орнитинамида (#В156). Указанное в заголовке соединение получали с 66%-ным выходом из 11,9 мг (0,01 ммоль, 1,0 экв.) #В155 и 17,0 мг (0,2 ммоль, 20,0 экв.) пиперидина, используя методику, описанную для получения соединения #В153. ВЭЖХ (Протокол AA): время удерживания составляет 7,001 минуты (чистота 82%). ЖХ-МС (Протокол D): m/z 1025,4 [М+Н]+, время удерживания составляет 0,69 минуты.

Стадия 3. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-(4-{[({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]метил}карбамоил)окси]метил}-фенил)-N~5~-карбамоил-L-орнитинамида (#В154). Указанное в заголовке соединение получали с 46%-ным выходом из 6,1 мг (0,006 ммоль, 1,0 экв.) #В156, 5,0 мг (0,015 ммоль, 7,0 экв.) N,N-диизопропилэтиламина и 3,5 мг (0,015 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона, используя методику, описанную для получения соединения #В150. ВЭЖХ (Протокол AA): время удерживания составляет 7,669 минуты (чистота 84%). ЖХ-МС (Протокол D): m/z 1151,5 [M+Na]+, время удерживания составляет 0,79 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 9.99 (s, 1 H), 8.27-8.19 (m 1 H), 8.16-8.06 (m, 1 H), 7.89-7.73 (m, 2 H), 7.62-7.54 (m, 2 H), 7.31-7.20 (m, 3 H), 6.41-6.31 (m, 1 H), 6.27 (d, J=16,4 Гц, 1 H), 6.11 (d, J=10,9 Гц, 1 H), 6.05-5.94 (m, 1 H), 5.86 (dd, J=10,9 и 7,0 Гц, 1 H), 5.67-5.56 (m, 1 H), 5.55-5.47 (m, 1 H), 5.40 (s, 2 H), 5.02-4.88 (m, 3 H), 4.44-4.33 (m, 2 H), 4.30-4.23 (m, 1 H), 4.22-4.15 (m, 2 H), 3.96-3.84 (m, 1 H), 3.81 (s, 2 H), 3.69-3.58 (m, 2 H), 3.53-3.43 (m, 2 H), 3.10-2.89 (m, 5 H), 2.79-2.71 (m, 1 H), 2.61-2.56 (m, 1 H), 2.31-2.10 (m, 4 H), 2.04-1.91 (m, 4 H), 1.84-1.32 (m, 15 H), 1.30-1.18 (m, 4 H), 1.06 (d, J=6,2 Гц, 3 H), 0.94 (d, J=7,4 Гц, 3 H), 0.84 (dd, J=10,9 и 6,6 Гц, 6 H).

Пример А55

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2Е)-2-{1-[4-({5-[(бромацетил)амино]пентил}окси)фенил]этилиден}-гидразинил]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В157).

Стадия 1. Синтез 9Н-флуорен-9-илметил-[5-(4-ацетилфенокси)пентил]карбамата (#В158). К раствору (9Н-флуорен-9-ил)метил-5-гидроксипентилкарбамата (5 г, 15,4 ммоль, 1 экв.), 1-(4-гидроксифенил)этанона (2,1 г, 15,4 ммоль, 1 экв.) и трифенилфосфина (4,53 г, 16,9 ммоль, 1,1 экв.) в толуоле (50 мл) по каплям при 0-10°С добавляли DIAD (3,43 г, 16,9 ммоль, 1,1 экв.). Раствор перемешивали при КТ в течение 1 часа, разбавляли этилацетатом и промывали водным насыщенным хлоридом аммония и рассолом. Органические слои сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Остаток очищали посредством хроматографии на силикагеле с элюированием смесью петролейный эфир: этилацетат (от 10:1 до 7:1) и дополнительно очищали посредством хроматографии с обращенной фазой с получением #В158 (3,6 г, 53%) в виде белого твердого вещества. 1H ЯМР (400 МГц, CDCl3): δ 7.93 (d, 2 Н), 7.76 (d, 2 H), 7.59 (d, 2 Н), 7.42 (m, 2 Н), 7,33 (m, 2 Н), 6.92 (d, 2 Н), 4.79 (m, 1 Н), 4.43 (m, 2 Н), 4.23 (m, 1 Н), 4.04 (m, 2 Н), 3.25 (m, 2 Н), 2.55 (s, 3 Н), 1.84 (m, 2 Н), 1.58-1.52 (m, 4 H).

Стадия 2. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2Е)-2-(1-{4-[(5-{[(9Н-флуорен-9-илметокси)карбонил]амино}пентил)окси]-фенил}этилиден)гидразинил]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В159). Указанное в заголовке соединение получали с 33%-ным выходом из 30,8 мг (0,056 ммоль, 1,0 экв.) #В6 и 124,0 мг (0,28 ммоль, 5,0 экв.) #В158, используя методику, описанную для получения соединения #В20. ЖХ-МС (Протокол D): m/z 975,4 [M+H]+, время удерживания составляет 1,05 минуты.

Стадия 3. Синтез ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2Е)-2-(1-{4-[(5-аминопентил)окси]фенил}этилиден)-гидразинил]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В160). Указанное в заголовке соединение получали с 64%-ным выходом из 17,8 мг (0,018 ммоль, 1,0 экв.) #В159 и 30,7 мг (0,36 ммоль, 20,0 экв.) пиперидина, используя методику, описанную для получения соединения #В47. ЖХ-МС (Протокол D): m/z 753,62 [М+Н]+, время удерживания составляет 0,66 минуты.

Стадия 4. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-{2-[(2Е)-2-{1-[4-({5-[(бромацетил)амино]пентил}окси)фенил]этилиден}-гидразинил]-2-оксоэтил}-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В157). Указанное в заголовке соединение получали с 46%-ным выходом из 6,2 мг (0,008 ммоль, 1,0 экв.) #В160 и 2,8 мг (0,012 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 4,2 мг (0,032 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя методику, описанную для получения соединения #В150. ВЭЖХ (Протокол AA): время удерживания составляет 8,668 минуты (чистота 53%). ЖХ-МС (Протокол D): m/z 873,3 [М+Н]+, время удерживания составляет 0,88 минуты. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 10.39-10.25 (m, 1 H), 8.30-8.20 (m, 1 H), 7.82-7.66 (m, 3 H), 6.99-6.90 (m, 2 H), 6.42-6.22 (m, 2 H), 6.16-6.06 (m, 1 H), 5.92-5.81 (m, 1 H), 5.68-5.34 (m, 3 H), 5.09-4.92 (m, 1 H), 4.51-4.25 (m, 3 H), 4.03-3.94 (m, 2 H), 3.82 (s, 2 H), 3.70-3.55 (m, 2 H), 3.50-3.40 (m, 1 H), 3.15-3.05 (m, 2 H), 2.90-2.71 (m, 2 H), 2.64-2.56 (m, 2 H), 2.30-2.10 (m, 5 H), 1.98 (s, 3 H), 1.94-1.84 (m, 1 H), 1.83-1.55 (m, 8 H), 1.53-1.33 (m, 4 H), 1.29-1.20 (m, 3 H), 1.12-1.00 (m, 3 H), 0.98-0.88 (m, 3 H).

Пример А56

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-({[N-(бромацетил)-бета-аланил]амино}метил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В161).

Стадия 1. Синтез 2,5-диоксопирролидин-1-ил-N-[(9Н-флуорен-9-илметокси)карбонил]-бета-аланината (#В162). К раствору N-[(9Н-флуорен-9-илметокси)карбонил]-β-аланина (297 мг, 0,95 ммоль, 1 экв.) в тетрагидрофуране (3,5 мл) при КТ добавляли N-гидроксисукцинимид (112 мг, 0,954 ммоль, 1 экв.) и N,N'-дициклогексилкарбодиимид (228 мг, 1,05 ммоль, 1,1 экв.) и реакционную смесь оставляли перемешиваться в течение 4 часов. Реакционную смесь фильтровали с промыванием этилацетатом и концентрировали в вакууме. Неочищенный целевой материал очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 95%) с получением #В162 в виде белого твердого вещества. Выход: 320 мг, 0,78 ммоль, 82%. ЖХ-МС (Протокол D): m/z 431,0 [М+Na]+, время удерживания составляет 0,91 минуты.

Стадия 2. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[({N-[(9Н-флуорен-9-илметокси)карбонил]-бета-аланил}амино)метил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В163). К раствору #В147 (15,1 мг, 0,027 ммоль, 1 экв.) в N,N-диметилформамиде (0,5 мл) добавляли N,N-диизопропилэтиламин (14,3 мкл, 0,081 ммоль, 3 экв.) и #В162 (22,1 мг, 0,054 ммоль, 2 экв.) и реакционную смесь оставляли перемешиваться в течение 30 минут. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением смеси целевого #В163 и непрореагировавшего #В162. ЖХ-МС (Протокол D): m/z 800,4 [М+Н]+, время удерживания составляет 0,97 минуты. Этот материал использовали на следующей стадии без дополнительной очистки.

Стадия 3. Синтез ацетатной соли (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[(бета-аланиламино)метил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В164). Указанное в заголовке соединение получали с 63%-ным выходом из 15,7 мг (0,02 ммоль, 1,0 экв.) #В163 и 34,1 мг (0,4 ммоль, 20,0 экв.) пиперидина, используя методику, описанную для получения соединения #В47. ЖХ-МС (Протокол D): m/z 578,41 [М+Н]+, время удерживания составляет 0,62 минуты.

Стадия 4. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-({[N-(бромацетил)-бета-аланил]амино}метил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В161). Указанное в заголовке соединение получали с 43%-ным выходом из 7,3 мг (0,013 ммоль, 1,0 экв.) #В164 и 4,5 мг (0,019 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 6,8 мг (0,052 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя методику, описанную для получения соединения #В150. ВЭЖХ (Протокол AA): время удерживания составляет 6,564 минуты (чистота 72%). ЖХ-МС (Протокол D): m/z 698,1 [М+Н]+, время удерживания составляет 0,79 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 8.31-8.23 (m, 1 H), 8.02-7.93 (m, 1 H), δ 7.78 (d, J=7,8 Гц, 1 Н), 6.41-6.32 (m, 1 H), 6.28 (d, J=15,8 Гц, 1 H), 6.11 (d, J=11,7 Гц, 1 H), 5.87 (dd, J=11,7 и 7,4 Гц, 1 H), 5.61 (dd, J=15,8 и 5,5 Гц, 1 H), 5.56-5.45 (m, 1 H), 5.00 (d, J=6,2 Гц, 1 H), 4.31-4.24 (m, 1 H), 3.93-3.79 (m, 3 H), 3.72-3.59 (m, 2 H), 3.55-3.45 (m, 1 H), 3.27-3.08 (m, 3 H), 3.28-3.14 (m, 2 H), 2.77 (d, J=5,1 Гц, 1 H), 2.61 (d, J=5,1 Гц, 1 H), 2.36-2.14 (m, 4 H), 1.98 (s, 3 H), 1.88-1.75 (m, 3 H), 1.73-1.61 (m, 4 Н), 1.51-1.41 (m, 1 H), 1.25 (d, J=6,6 Гц, 3 Н), 1.07 (d, J=6,2 Гц, 3 Н), 0.95 (d, J=7,0 Гц, 3 Н).

Пример А57

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-{4-[({[4-({[(2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил]окси}карбонил)пиперазин-1-ил]карбонил}окси)метил]фенил}-N~5~-карбамоил-L-орнитинамида (#В165).

Стадия 1. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N-{4-[({[4-(трет-бутоксикарбонил)пиперазин-1-ил]карбонил}окси)метил]фенил}-N~5~-карбамоил-L-орнитинамида (#В166). К раствору трет-бутил-пиперазин-1-карбоксилата (32 мг, 0,17 ммоль, 1 экв.) в N,N-диметилформамиде (0,9 мл) добавляли N,N-диизопропилэтиламин (90,8 мкл, 0,52 ммоль, 3 экв.) и 4-N,N-диметиламинопиридин (4,2 мг, 0,034 ммоль, 0,2 экв.), а затем #В45 (151 мг, 0,17 ммоль, 1 экв.) и реакционную смесь перемешивали в течение 30 минут. Реакционную смесь разбавляли DMSO (2,5 мл) и очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 95%) с получением #В166 в виде белого твердого вещества. Выход: 114 мг, 0,12 ммоль, 71%. ЖХ-МС (Протокол С): m/z 927,5 [М+Н]+, время удерживания составляет 1,89 минуты.

Стадия 2. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N~5~-карбамоил-N-(4-{[(пиперазин-1-илкарбонил)окси]-метил}фенил)-L-орнитинамида (#В167). К суспензии #В166 (всего 106 мг, 0,11 ммоль, 1 экв.) в ацетонитриле (6 мл) в двух раздельных сосудах при КТ добавляли TFA (800 мкл) и реакционные смеси перемешивали в течение 1,5-2 часов. Реакционные смеси концентрировали в вакууме, повторно разбавляли ацетонитрилом и концентрировали (3х) в вакууме. Неочищенный целевой материал очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 100%) с получением #В167 в виде белого твердого вещества. Выход: 62 мг, 0,066 ммоль, 57%. ЖХ-МС (Протокол D): m/z 827,4 [М+Н]+, время удерживания составляет 0,72 минуты.

Стадия 3. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N-{4-[({[4-({[(2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил]окси}карбонил)пиперазин-1-ил]карбонил}окси)метил]фенил}-N~5~-карбамоил-L-орнитинамида (#В168). К раствору #В39 (13,5 мг, 0,028 ммоль, 1 экв.) в дихлорметане (0,4 мл) при КТ добавляли 4-N,N-диметиламинопиридин (3,4 мг, 0,028 ммоль, 1 экв.), N,N-диизопропилэтиламин (24,7 мкл, 0,14 ммоль, 5 экв.) и бис(4-нитрофенил)карбонат (10,6 мг, 0,034 ммоль, 1,2 экв.) и реакционную смесь оставляли перемешиваться в течение 6 часов. Добавляли раствор #В167 (34,5 мг, 0,037 ммоль, 1,3 экв.) и N,N-диизопропилэтиламина (12 мкл, 0,07 ммоль, 2,5 экв.) в N,N-диметилформамиде (500 мкл) и реакционную смесь оставляли перемешиваться в течение 1 часа. Реакционную смесь разбавляли DMSO (500 мкл) и дихлорметан удаляли в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В168 в виде белого твердого вещества. Выход: 13 мг, 0,01 ммоль, 35%. ЖХ-МС (Протокол С): m/z 1329,6 [М+Н]+, время удерживания составляет 1,81 минуты.

Стадия 4. Синтез ацетатной соли N-(6-аминогексаноил)-L-валил-N-{4-[({[4-({[(2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил]окси}карбонил)пиперазин-1-ил]карбонил}окси)метил]фенил}-N~5~-карбамоил-L-орнитинамида (#В169). Указанное в заголовке соединение получали с 80%-ным выходом из 13 мг (0,01 ммоль, 1,0 экв.) #В168 и 17,0 мг (0,2 ммоль, 20,0 экв.) пиперидина, используя методику, описанную для получения соединения #В47. ЖХ-МС (Протокол D): m/z 1107,5 [М+Н]+, время удерживания составляет 0,69 минуты.

Стадия 5. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-{4-[({[4-({[(2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил]окси}карбонил)пиперазин-1-ил]карбонил}окси)метил]фенил}-N~5~-карбамоил-L-орнитинамида (#В165). Указанное в заголовке соединение получали с 69%-ным выходом из 9,4 мг (0,008 ммоль, 1,0 экв.) #В169, 2,8 мг (0,012 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 4,2 мг (0,032 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя методику, описанную для получения соединения #В150. ВЭЖХ (Протокол AA): время удерживания составляет 7,741 минуты (чистота 91%). ЖХ-МС (Протокол С): m/z 1229,4 [М+Н]+, время удерживания составляет 1,48 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 9.99 (s, 1 H), 8.27-8.19 (m 1 H), 8.13-8.04 (m, 1 H), 7.85-7.73 (m, 2 H), 7.64-7.55 (m, 2 H), 7.35-7.26 (m, 3 H), 6.77 (s, 1 H), 6.32-6.21 (m, 2 H), 6.10 (d, J=12,1 Гц, 1 H), 6.01-5.85 (m, 2 H), 5.59 (dd, J=16,0 и 5,5 Гц, 1 H), 5.55-5.47 (m, 1 H), 5.40 (s, 2 H), 5.02 (s, 2 H), 4.58-4.49 (m, 1 H), 4.45-4.25 (m, 2 H), 4.24-4.14 (m, 2 H), 3.81 (s, 2 H), 3.69-3.60 (m, 2 H), 3.53-3.45 (m, 2 H), 3.43-3.33 (m, 6 H), 3.10-2.89 (m, 4 H), 2.64-2.53 (m, 2 H), 2.38-2.09 (m, 5 H), 2.03-1.92 (m, 1 H), 1.87-1.56 (m, 11 H), 1.55-1.31 (m, 7 H), 1.30-1.19 (m, 5 H), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,0 Гц, 3 H), 0.84 (dd, J=10,9 и 6,6 Гц, 6 H).

Пример А58

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-[4-({[(4-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}пиперазин-1-ил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамида(#В170).

Стадия 1. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N-[4-({[(4-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}пиперазин-1-ил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В171). К раствору #В1 (15 мг, 0,024 ммоль, 1 экв.) в N,N-диметилформамиде (0,1 мл) при КТ добавляли раствор #В167 (28,2 мг, 0,03 моль, 1,25 экв.) и N,N-диизопропилэтиламина (16,8 мкл, 0,096 ммоль, 4 экв.) в N,N-диметилформамиде (0,6 мл) и реакционную смесь перемешивали в течение 1,5 часов. Реакционную смесь разбавляли диметилсульфоксидом и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В171 в виде белого твердого вещества. Выход: 17,8 мг, 0,013 ммоль, 55%. ЖХ-МС (Протокол D): m/z 1345,8 [М+Н]+, время удерживания составляет 0,92 минуты.

Стадия 2. Синтез N-(6-аминогексаноил)-L-валил-N-[4-({[(4-{[(3R,5S,7R,8R)-7-{(1Е,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}пиперазин-1-ил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В172). Указанное в заголовке соединение получали с 79%-ным выходом из 17,8 мг (0,013 ммоль) #В171 и 22,1 мг (0,26 ммоль, 20,0 экв.) пиперидина, используя методику, описанную для получения соединения #В47. ЖХ-МС (Протокол С): m/z 1122,6 [М+Н]+, время удерживания составляет 1,23 минуты.

Стадия 3. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-[4-({[(4-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}пиперазин-1-ил)карбонил]окси}метил)фенил]-N~5~-карбамоил-L-орнитинамида (#В170). Указанное в заголовке соединение получали с 57%-ным выходом из 12,1 мг (0,01 ммоль) #В172, 3,5 мг (0,015 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 5,2 мг (0,04 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя методику, описанную для получения соединения #В150. ВЭЖХ (Протокол AA): время удерживания составляет 7,925 минуты (чистота 81%). ЖХ-МС (Протокол С): m/z 1244,4 [М+Н]+, время удерживания составляет 1,45 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 9.99 (s, 1 H), 8.27-8.19 (m 1 H), 8.13-8.04 (m, 1 H), 7.85-7.73 (m, 2 H), 7.64-7.55 (m, 2 H), 7.35-7.26 (m, 2 H), 6.44-6.24 (m, 2 H), 6.10 (d, J=11,7 Гц, 1 H), 6.03-5.93 (m, 1 H), 5.87 (dd, J=11,7 и 7,4 Гц, 1 H), 5.61 (dd, J=15,6 и 5,5 Гц, 1 H), 5.55-5.47 (m, 1 H), 5.40 (s, 2 H), 5.02 (s, 2 H), 4.98 (d, J=5,9 Гц, 1 H), 4.43-4.33 (m, 2 H), 4.30-4.16 (m, 3 H), 3.81 (s, 2 H), 3.69-3.60 (m, 2 H), 3.55-3.34 (m, 6 H), 3.26-3.22 (m, 1 H), 3.09-2.89 (m, 4 H), 2.75 (d, J=5,1 Гц, 1 H), 2.63-2.55 (m, 2 H), 2.31-2.09 (m, 4 H), 1.98 (s, 3H), 1.92-1.78 (m, 3 H), 1.73-1.31 (m, 12 H), 1.30-1.19 (m, 5 H), 1.07 (d, J=6,6 Гц, 3 H), 0.95 (d, J=7,4 Гц, 3 H), 0.84 (dd, J=10,9 и 6,6 Гц, 6 H).

Пример А59

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,5S,7S)-7-[(бутаноиламино)метил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В173).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,5S,7S)-7-[(бутаноиламино)метил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В173). К раствору #В140 (6,7 мг, 0,014 ммоль, 1 экв.) в дихлорметане (0,4 мл) при 0°С добавляли 4-N,N-диметиламинопиридин (0,4 мг, 0,003 ммоль, 0,2 экв.), N,N-диизопропилэтиламин (12,3 мкл, 0,07 ммоль, 5 экв.) и масляную кислоту (6,8 мкл, 0,074 ммоль, 5,3 экв.) и реакционную смесь оставляли перемешиваться в течение 2 часов при КТ. К реакционной смеси добавляли DCC (8 мг, 0,042 ммоль, 3 экв.) и реакционную смесь перемешивали в течение 45 минут. Реакционную смесь разбавляли этилацетатом и насыщенным бикарбонатом натрия, экстрагировали, промывали рассолом, сушили над сульфатом натрия, фильтровали и концентрировали в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В173 в виде белого твердого вещества. Выход: 3,4 мг, 0,006 ммоль, 43%. ВЭЖХ (Протокол AA): время удерживания составляет 8,927 минуты (чистота 87%). ЖХ-МС (Протокол D): m/z 583,2 [M+Na]+, время удерживания составляет 0,88 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.84-7.75 (m, 2 H), 6.42-6.32 (m, 1 H), 6.23 (d, J=16,0 Гц, 1 Н), 6.11 (d, J=11,5 Гц, 1 Н), 5.87 (dd, J=11,5 и 7,4 Гц, 1 Н), 5.65-5.45 (m, 3 H), 4.60-4.51 (m, 1 H), 3.96-3.85 (m, 1 H), 3.70-3.60 (m, 2 H), 3.54-3.46 (m, 1 H), 3.12-3.01 (m, 1 H), 2.63 (s, 2 H), 2.32-2.12 (m, 2 H), 2.09-2.01 (m, 2 H), 1.98 (s, 3 H), 1.75-1.56 (m, 7 H), 1.55-1.45 (m, 2 H), 1.41-1.33 (m, 1 H), 1.25 (d, J=6,6 Гц, 3 Н), 1.07 (d, J=6,6 Гц, 3 Н), 0.95 (d, J=7,4 Гц, 3 Н), 0.88-0.80 (m, 3 H).

Пример А60

Получение [(3R,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-5-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В174) путем биокатализа с рекомбинантным Fr9P

Стадия 1. Получение рекомбинатного фермента Fr9P в Escherichia coli и очистка из Escherichia coli. Кодон-оптимизированный ген Fr9P (как описано на стадии 1 примера 4) синтезировали и лигировали по Ncol-Hindlll сайтам pGS-21a (GenScript) с получением pAE-PF16. Рекомбинатный белок Fr9P, меченый HiS6-GST, получали в Е. coli BL21(DE3) и очищали из E. coli BL21(DE3) после трансформации плазмидой pAE-PF16. Каждую из двух колб Фернбаха объемом 2,8 л, содержащих 0,5 л среды (Terrific broth с 100 мг/л ампицилина), инокулировали 20 мл ночной культуры в LB среде и инкубировали при 200 об/мин и 25°С. Когда значение OD600 (оптическая плотность при 600 нм) достигало примерно 0,9, клетки индуцировали 0,2 мМ IPTG (изопропилтиогалактозид) и инкубирование возобновляли при 25°С и 200 об/мин. Через 18-20 ч клетки собирали центрифугированием и замораживали при -80°С. Клеточный осадок ресуспендировали в примерно 50 мл ледяного лизирующего буфера [10 мМ фосфатного буфера с pH 7,4; 500 мМ NaCl; 20 мМ имидазола; 10% глицерина; лизоцим 1 мг/мл; 0,5% (об./об.) Tween 20; 20 мМ β-меркаптоэтанола] и инкубировали на льду в течение 30 минут. После обработки ультразвуком на льду, клеточный лизат центрифугировали при 14000 об/мин и 4°С в течение 45 минут. Супернатант переносили в новую пробирку и снова центрифугировали при 14000 об/мин и 4°С в течение 30 минут. К супернатантной фракции (чистому лизату), содержащейся в небольшом стакане во льде добавляли 5 мл суспензии Ni-NTA смолы (Qiagen) и осторожно перемешивали в течение 1 часа. Суспензию переносили в пробирку фирмы Falcon и центрифугировали при 3000 об/мин и 4°С в течение 10 минут. Супернатант выбрасывали и смолу промывали три раза, каждый раз 30 мл ледяного промывочного буфера [10 мМ фосфатного буфера с pH 7,4; 500 мМ NaCl; 40 мМ имидазола; 10% глицерина; 20 мМ β-МЕ (β-меркаптоэтанол)] с последующим центрифугированием при 3000 об/мин и 4°С в течение 10 минут. Смолу переносили в одноразовую колонку и промывали еще три раза, каждый раз 2,5 мл промывочного буфера. Фермент элюировали элюирующим буфером (3×2,5 мл) [10 мМ фосфатного буфера с pH 7,4; 500 мМ NaCl; 250 мМ имидазола; 10% глицерина; 20 мМ β-МЕ]. Производили замену буфера на 50 мМ MOPS с pH 7,5, используя колонку PD-10, и раствор концентрировали с использованием колонки Vivaspin с отсечением по молекулярной массе 30 кДа. Буфер для хранения содержал 50 мМ MOPS с pH 7,5, 2 мМ DTT и 10% глицерина (для хранения при -80°С) или 50% глицерина (для хранения при -20°С). Выход очищенного фермента составил примерно 25 мг на 1 л культуры.

Стадия 2. Синтез [(3R,7S)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-5-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]уксусной кислоты (#В174) с использованием рекомбинантного Fr9P. К водному раствору #NP2 (1 мг, 0,4 мМ, 1 экв.) в 50 мМ буфере MOPS с pH 7,5 добавляли α-кетоглутарат (конечная концентрация 0,8 мМ, 2 экв.), аскорбат натрия (0,08 мМ, 0,2 экв.), NH4Fe(II)SO4 (0,04 мМ, 0,1 экв.) и рекомбинантный Fr9P со стадии 1 примера #А60 (1,2 мкМ, 0,003 экв.). После инкубирования при комнатной температуре в течение 2 часов реакционную смесь подкисляли уксусной кислотой до pH примерно 4-5 и экстрагировали три раза равным объемом этилацетата. Растворитель выпаривали при пониженном давлении, остаток ресуспендировали в 0,25 мл ацетонитрила, фильтровали и очищали посредством хроматографии с обращенной фазой (Метод Н). Фракцию с временем удерживания 18,5 минут собирали и нейтрализовали гидроксидом аммония, после чего ее концентрировали при пониженном давлении. Водный концентрат подкисляли уксусной кислотой до pH примерно 4 и экстрагировали дважды равным объемом этилацетата. Растворитель удаляли при пониженном давлении с получением #В174 в виде белого твердого вещества. Выход: 0,2 мг. ВЭЖХ (Протокол Р): время удерживания составляет 10,39 минуты. ИЭР-МСВР m/z 536,286 [M+H]+; 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) δ 12.24 (brs, ОН), 8.00 (d, J=8,0 Гц, 1H), 6.37 (m, 1H), 6.23 (d, J=15,9, 1H), 6.12 (dd, J=0,7, 11,5, 1H), 5.88 (dd, J=11,6, 7,5 Гц, 1Н), 5.54 (m, 1Н), 5.50 (m, 1Н), 4.67 (m, 1Н), 3.66 (m, 2H), 3.51 (m, 1H), 2.60 (m, 1H), 2.53 (m, 1H), 2.33 (m, 1H), 2.31 (m, 1H), 2.20 (m, 1H), 2.00 (s, 3Н), 1.84 (m, 1H), 1.81 (m, 2H), 1.70 (s, 3H), 1.67 (m, 1H), 1.39 (m, 1H), 1.26 (d, J=6,6 Гц, 3Н), 1.16 (m, 1H), 1.08 (d, J=6,4 Гц, 3Н), 0.96 (d, J=7,2 Гц, 3Н). 13C ЯМР (100 МГц, DMSO-d6) δ 171.7, 170.5, 165.0, 142.7, 134.4, 133.3, 128.5, 127.3, 122.6, 95.3, 79.9, 74.8, 67.9, 67.2, 46.7, 46.1, 38.9, 37.7, 35.0, 31.5, 28.7, 20.8, 19.7, 17.6, 14.2, 12.2.

Пример А61

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-метил[2-(пиридин-2-илдисульфанил)этил]карбамата (#В175).

Стадия 1. Синтез трифторацетатной соли N-метил-2-(пиридин-2-илдисульфанил)этанамина (#В176). К раствору трет-бутил-метил[2-(пиридин-2-илдисульфанил)этил]карбамата (Angew. Chem. Int. Ed. 2007, 46, 6469) (90 мг, 0,3 ммоль, 1 экв.) в дихлорметане (1 мл) при КТ добавляли TFA (1 мл) и реакционную смесь перемешивали в течение 1 часа. Реакционную смесь концентрировали в вакууме и подвергали азеотропной перегонке с ацетонитрилом (3х) с получением #В176 в виде масла. ЖХ-МС (протокол D): m/z 201,1 [М+Н]+, время удерживания составляет 0,43 минуты. Неочищенный материал использовали на следующей стадии без дополнительной очистки.

Стадия 2. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-амино-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-метил[2-(пиридин-2-илдисульфанил)этил]карбамата (#В175). К раствору #В39 (19,5 мг, 0,041 ммоль, 1 экв.) в дихлорметане (0,5 мл) при КТ добавляли 4-N,N-диметиламинопиридин (5 мг, 0,041 ммоль, 1 экв.), N,N-диизопропилэтиламин (21,7 мкл, 0,123 ммоль, 3 экв.) и бис(4-нитрофенил)карбонат (18,9 мг, 0,62 ммоль, 1,5 экв.) и реакционную смесь оставляли перемешиваться в течение 2,5 часов. Добавляли дополнительное количество бис(4-нитрофенил)карбоната (3,1 мг, 0,008 ммоль, 0,2 экв.) и реакционную смесь перемешивали в течение еще 1,5 часов. Добавляли раствор #В176 (44,1 мг, 0,103 ммоль, 2,5 экв.) и N,N-диизопропилэтиламина (54 мкл, 0,31 ммоль, 7,5 экв.) в дихлорметане (0,4 мл), и реакционную смесь перемешивали в течение 1 часа. Добавляли дополнительное количество раствора #В176 (17 мг, 0,04 ммоль, 1 экв.) и N,N-диизопропилэтиламина (44 мкл, 0,25 ммоль, 6 экв.) в дихлорметане (0,2 мл) и реакционную смесь перемешивали в течение еще 15 минут. Реакционную смесь разбавляли DMSO (1 мл) и дихлорметан удаляли в вакууме. Неочищенный целевой материал очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 100%) с получением #В175 в виде белого твердого вещества. Выход: 7,6 мг, 0,011 ммоль, 26%. ЖХ-МС (Протокол D): m/z 703,6 [М+Н]+, время удерживания составляет 0,91 минуты. 1H ЯМР (400 МГц, DMSO-d6, мульт., J в Гц) 8.49-8.43 (m, 1 Н), 7.87-7373 (m, 2 H), 7.32 (s, 1 H), 7.28-7.21 (m, 1 H), 6.78 (s, 1 H), 6.32 (d, J=16,0 Гц, 1 H), 6.26 (d, J=16,4 Гц, 1 H), 6.23-6.13 (m, 1 H), 6.11-5.98 (m, 1 H), 5.93-5.84 (m, 1 H), 5.76-5.67 (m, 1 H), 5.59 (dd, J=15,9 и 5,6 Гц, 1 H).

Пример А#62

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-7-[2-(2,2-диметилгидразинил)-2-оксоэтил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В177).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[2-(2,2-диметилгидразинил)-2-оксоэтил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В177). К раствору #В1 (26,8 мг, 0,042 ммоль, 1 экв.), растворенного в тетрагидрофуране (1 мл), при КТ добавляли N,N-диметилгидразин (16 мк, 0,21 ммоль, 5 экв.) После перемешивания в течение 40 минут добавляли дополнительное количество N,N-диметилгидразина (6,4 мкл, 0,084 ммоль, 2 экв.) и реакционную смесь перемешивали в течение 5 минут. Реакционную смесь разбавляли водой, экстрагировали этилацетатом и объединенные органические вещества сушили над сульфатом натрия и фильтровали. Растворители удаляли в вакууме. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В177 в виде белого твердого вещества. Выход: 14,5 мг, 0,025 ммоль, 60%. ЖХ-МС (Протокол D): m/z 578,5 [М+Н]+, время удерживания составляет 0,72 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 8.85 (s, 0,6 H), 8.33 (s, 0,4 H), 7.93-7.84 (m, 1 H), 6.40-6.27 (m, 2 H), 6.10 (d, J=11,6 Гц, 1 H), 5.87 (dd, J=11,6 и 7,6 Гц, 1 H), 5.63-5.54 (m, 1 H), 5.53-5.46 (m, 1 H), 5.09 (d, J=5,1 Гц, 0,6 H), 5.01 (d, J=6,6 Гц, 0,4 H), 4.35-4.16 (m, 2 H), 3.68-3.60 (m, 2 H), 3.53-3.46 (m, 1 H), 3.27-3.21 (m, 1 H), 2.99-2.90 (m, 0,6 H), 2.76 (d, J=5,4 Гц, 1 H), 2.60-2.53 (m, 1 H), 2.47-2.38 (m, 6,4 H), 2.34-2.26 (m, 1 H), 2.25-2.15 (m, 1 H), 2.06 (dd, J=14,2 и 4,9 Гц, 1 H), 1.98 (s, 3 H), 1.87-1.72 (m, 3 H), 1.71-1.58 (m, 4 H), 1.51-1.43 (m, 1 H), 1.24 (d, J=6,4 Гц, 3 H), 1.07 (d, J=6,4 Гц, 3 H), 0.94 (d, J=7,3 Гц, 3 H).

Пример А#63

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4Е)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({транс-3-[(1Н-имидазол-1-илкарбонил)амино]циклобутил}-амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В178).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-({транс-3-[(1H-имидазол-1-илкарбонил)амино]циклобутил}амино)-2-оксоэтил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2H-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В178). К раствору #В73 (15,3 мг, 0,025 ммоль, 1 экв.) в дихлорметане (0,5 мл) при КТ добавляли N,N-диизопропилэтиламин (8,8 мкл, 0,05 ммоль, 2 экв.) и карбонилдиимидазол (4,9 мг, 0,03 ммоль, 1,2 экв.) и реакционную смесь перемешивали в течение 25 минут. Реакционную смесь разбавляли дихлорметаном, промывали водой, сушили над сульфатом натрия, фильтровали, разбавляли DMSO (0,8 мл) и концентрировали для удаления дихлорметана. Неочищенный целевой материал очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В178 в виде белого твердого вещества. Выход: 3,2 мг, 0,0045 ммоль, 18%. ЖХ-МС (Протокол D): m/z 698,6 [М+Н]+, время удерживания составляет 0,68 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 8.67 (d, J=6,9 Гц, 1 H), 8.37 (d, J=7,1 Гц, 1 H), 8.24 (s, 1 H), 7.78 (d, J=8,1 Гц, 1 H), 7.70-7.67 (m, 1 H), 7.02 (s, 1 H), 6.40-6.27 (m, 2 H), 6.10 (dd, 11,6 и 1,5 Гц, 1 H), 5.87 (dd, J=11,6 и 7,3 Гц, 1 H), 5.60 (dd, J=15,7 и 5,6 Гц, 1 H), 5.52-5.45 (m, 1 H), 5.01 (d, J=5,4 Гц, 1 H), 4.43-4.34 (m, 1 H), 4.33-4.21 (m, 2 H), 3.67-3.54 (m, 2 H), 3.48-3.43 (m, 1 H), 3.30-3.26 (m, 1 H), 2.78 (d, J=5,1 Гц, 1 H), 2.60-2.54 (m, 2 H), 2.39-2.13 (m, 7 H), 1.98 (s, 3 H), 1.83-1.74 (m, 3 H), 1.69 (s, 3 H), 1.65-1.53 (m, 3 H), 1.25 (d, J=6,4 Гц, 3 H), 1.04 (d, J=6,4 Гц, 3 H), 0.93 (d, J=7,3 Гц, 3 H).

Пример А#64

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(тетрагидропиридазин-1(2Н)-ил)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2H-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В179).

Стадия 1. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-4-гидрокси-7-[2-оксо-2-(тетрагидропиридазин-1(2H)-ил)этил]-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2H-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В179). К раствору #В1 (18,1 мг, 0,029 ммоль, 1 экв.) в N,N-диметилформамиде (0,6 мл) при КТ добавляли N,N-диизопропилэтиламин (51,1 мкл, 0,29 ммоль, 10 экв.) и дигидрохлорид гексагидропиридазина (18,5 мг, 0,12 ммоль, 4 экв.) и реакционную смесь перемешивали в течение 30 минут. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В179 в виде белого твердого вещества. Выход: 10,7 мг, 0,018 ммоль, 61%. ЖХ-МС (Протокол D): m/z 604,6 [М+Н]+, время удерживания составляет 0,80 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.79 (d, J=8,2 Гц, 1 Н), 6.42-6.27 (m, 2 Н), 6.11 (d, J=11,7 Гц, 1 Н), 5.87 (dd, J=11,7 и 7,4 Гц, 1 Н), 5.61 (dd, J=16,0 и 5,9 Гц, 1 Н), 5.55-5.47 (m, 1 Н), 4.92 (d, J=6,2 Гц, 1 Н), 4.76 (каж. t, J=7,0 Гц, 1 Н), 4.34-4.18 (m, 2 Н), 3.70-3.60 (m, 2 Н), 3.54-3.40 (m, 3 Н), 3.27-3.21 (m, 1 Н), 3.03 (dd, J=15,2 и 7,4 Гц, 1 Н), 2.81-2.70 (m, 3 Н), 2.55 (d, J=5,5 Гц, 1 Н), 2.33-2.15 (m, 2 Н), 1.98 (s, 3 Н), 1.85-1.74 (m, 3 Н), 1.71-1.56 (m, 5 Н), 1.55-1.48 (m, 4 Н), 1.25 (d, J=6,2 Гц, 3 Н), 1.07 (d, J=6,2 Гц, 3 Н), 0.95 (d, J=7,4 Гц, 3 Н).

Пример А#65

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-{4-[({[({[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]карбамоил}-окси)метил]фенил}-N-5-карбамоил-L-орнитинамид (#В180).

Стадия 1. Синтез N-(6-{[(9H-флуорен-9-илметокси)карбонил]амино}гексаноил)-L-валил-N5-карбамоил-N-[4-(9,9-диметил-3,7-диоксо-2,8-диокса-4,6-диазадец-1-ил)фенил]-L-орнитинамида (#В181). Раствор гидрохлорида трет-бутил-аминометилкарбамата (J. Org. Chem., 1980, 45, 1703, 32,9 мг, 0,18 ммоль, 1 экв.) и N,N-диизопропилэтиламина (47 мкл, 0,27 ммоль, 3 экв.) в N,N-диметилформамиде (1 мл) при 0°C добавляли по каплям к раствору #В45 (161,5 мг, 0,18 ммоль, 1 экв.) в N,N-диметилформамиде (2 мл). Добавляли 4-N,N-диметиламинопиридин (2 мг, 0,016 ммоль, 0,1 экв.) и полученный раствор перемешивали при комнатной температуре в течение одного часа. Реакционную смесь разбавляли трет-бутил-метиловым эфиром и фильтровали. Осадок на фильтре очищали посредством преп. ВЭЖХ с получением #В181 в виде белого твердого вещества. Выход: 20 мг, 0,00023 ммоль, 13%. 1H ЯМР (400 МГц, MeOD-d4) δ 7.82 (d, 2 H), 7.67 (d, 2H), 7.58 (d, 2 H), 7.42 (m, 6 H), 5.04 (br, 3 H), 4.63 (s, 4 H), 4.52 (m, 5 H), 4.36 (m, 2 H), 3.20 (m, 4 H), 2.32 (m, 2 H), 2.10 (m, 1H), 1.90 (m, 1 H), 1.77 (m, 1 H), 1.65 (m, 4 H), 1.44 (m, 7 H), 1.35 (m, 3 H), 0.98 (m, 6 H).

Стадия 2. Синтез трифторацетатной соли N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}гексаноил)-L-валил-N-[4-({[(аминометил)карбамоил]-окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В182). К #В181 (20 мг, 0,00023 ммоль) при 0°С добавляли предварительно охлажденную трифторуксусную кислоту (1,3 мл) и реакционную смесь оставляли перемешиваться в течение 10 мин. Реакционную смесь концентрировали, переносили в ацетонитрил и концентрировали три раза с получением #В182 в виде смолы, которую использовали на следующей стадии без дополнительной очистки. Выход: 25 мг, 0,028 ммоль, 100%. ЖХ-МС (Протокол D): m/z 787,6 [M+H]+, время удерживания составляет 0,75 минут.

Стадия 3. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]-амино}гексаноил)-L-валил-N-{4-[({[({[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)-метил]карбамоил}окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В183). К раствору #NP2 (14,5 мг, 0,028 ммоль, 1 экв.) в N,N-диметилформамиде (0,4 мл) при КТ добавляли N,N-диизопропилэтиламин (19,7 мкл, 0,11 ммоль, 4 экв.) и гексафторфосфат O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (12 мг, 0,031 ммоль, 1,1 экв.). Добавляли #В182 (25,2 мг, 0,028 ммоль, 1 экв.) в DMF (0,6 мл) и реакционную смесь оставляли перемешиваться в течение 45 мин. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В183 в виде белого твердого вещества. Выход: 9,8 мг, 0,0076 ммоль, 27%. ЖХ-МС (Протокол D): m/z 1288,94 [М+Н]+, время удерживания составляет 0,94 минуты.

Стадия 4. Синтез ацетатной соли N-(6-аминогексаноил)-L-валил-N-{4-[({[({[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]карбамоил}окси)метил]-фенил}-N5-карбамоил-L-орнитинамида (#В184). Указанное в заголовке соединение получали с 75%-ным выходом из 11,9 мг (0,009 ммоль, 1,0 экв.) #В183 и 15,3 мг (0,18 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединения #В47. ЖХ-МС (Протокол D): m/z 1066,8 [М+Н]+, время удерживания составляет 0,73 минуты.

Стадия 5. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-{4-[({[({[(3S,5S,7S)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]карбамоил}окси)метил]-фенил}-N-5-карбамоил-L-орнитинамида (#В180). Указанное в заголовке соединение получали с 61%-ным выходом из 7,6 мг (0,01 ммоль) #В184 и 2,6 мг (0,011 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 3,7 мг (0,028 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя процедуру, раскрытую для получения соединения #В150. ЖХ-МС (Протокол D): m/z 1188,8 [М+Н]+, время удерживания составляет 0,81 минуты. 1Н ЯМР (500 МГц, DMSO-d6) δ 9.98 (s, 1 Н), 8.45-8.37 (m, 1 H), 8.27-8.20 (m, 1 H), 8.14-8.05 (m, 1 H), 7.85-7.73 (m, 2 H), 7.61-7.55 (m, 2 H), 7.30-7.24 (m, 2 H), 6.40-6.32 (m, 1 H), 6.25 (d, J=16,1 Гц, 1 H), 6.10 (dd, J=11,5 и 1,2 Гц, 1 H), 6.01-5.93 (m, 1 H), 5.87 (dd, J=11,7 и 7,6 Гц, 1 H), 5.60 (dd, J=15,6 и 5,4 Гц, 1 H), 5.56-5.49 (m, 1 H), 5.41 (s, 2 H), 5.02 (s, 2 H), 4.56-4.50 (m, 1 H), 4.42-4.23 (m, 3 H), 4.22-4.16 (m, 1 H), 3.81 (s, 2 H), 3.69-3.60 (m, 3 H), 3.52-3.45 (m, 2 H), 3.09-2.89 (m, 5 H), 2.66-2.53 (m, 3 H), 2.34-2.09 (m, 6 H), 2.01-1.92 (m, 4 H), 1.85-1.55 (m, 10 H), 1.54-1.31 (m, 7 H), 1.27-1.20 (m, 4 H), 1.06 (d, J=6,4 Гц, 3 H), 0.94 (d, J=7,3 Гц, 3 H), 0.86 (d, J=6,9 Гц, 3 H), 0.83 (d, J=6,9 Гц, 3 H).

Пример А#66

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-2-метил-гидразинил)карбонил]окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В185)

Стадия 1. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]амино}гексаноил)-L-валил-N-{4-[({[2-(трет-бутокси-карбонил)-2-метилгидразинил]карбонил}окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В186). К раствору трет-бутил-1-метилгидразинкарбоксилата (34,8 мг, 0,24 ммоль, 1,3 экв.) в N,N-диметилформамиде (1 мл) при КТ добавляли N,N-диизопропилэтиламин (64,4 мкл, 0,37 ммоль, 2 экв.) и 4-N,N-диметиламинопиридин (11,1 мг, 0,091 ммоль, 0,5 экв.), а затем #В45 (161 мг, 0,18 ммоль, 1 экв.), и реакционную смесь оставляли перемешиваться. Через 4 ч добавляли дополнительное количество трет-бутил-1-метилгидразин-карбоксилата (14 мг, 0,096 ммоль, 0,5 экв.) в N,N-диметилформамиде (0,2 мл) и реакционную смесь перемешивали в течение 1,5 ч. Реакционную смесь разбавляли DMSO (1 мл) и очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 100%) с получением #В186 в виде белого твердого вещества. Выход: 26,1 мг, 0,029 ммоль, 16%. ЖХ-МС (Протокол D): m/z 887,6 [М+Н]+, время удерживания составляет 0,92 минуты.

Стадия 2. Синтез трифторацетатной соли N-(6-{[(9H-флуорен-9-илметокси)карбонил]амино}гексаноил)-L-валил-N5-карбамоил-N-[4-({[(2-метил-гидразинил)карбонил]окси}-метил)фенил]-L-орнитинамида (#В187). К #В186 (16,5 мг, 0,019 ммоль, 1 экв.) при КТ добавляли трифторуксусную кислоту (1 мл) и реакционную смесь оставляли перемешиваться в течение 20 мин. Реакционную смесь концентрировали, переносили в ацетонитрил и концентрировали три раза с получением #В187 в виде смолы, которую использовали на следующей стадии без дополнительной очистки. ЖХ-МС (Протокол D): m/z 809,6 [М+Na]+, время удерживания составляет 0,80 минуты.

Стадия 3. Синтез N-(6-{[(9H-флуорен-9-илметокси)карбонил]амино}-гексаноил)-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-ацетил}-2-метилгидразинил)карбонил]окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В188). К раствору #NP1 (8,7 мг, 0,016 ммоль, 1 экв.) в N,N-диметилформамиде (0,2 мл) при КТ добавляли N,N-диизопропилэтиламин (11,3 мкл, 0,064 ммоль, 4 экв.) и гексафторфосфат O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (7,4 мг, 0,019 ммоль, 1,2 экв.), а затем раствор #В187 (17,1 мг, 0,019 ммоль, 1,2 экв.) и N,N-диизопропилэтиламина (5,7 мкл, 0,032 ммоль, 2 экв.) в N,N-диметилформамиде (0,4 мл) и реакционную смесь оставляли перемешиваться в течение 30 мин. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В188 в виде белого твердого вещества. Выход: 8,3 мг, 0,0064 ммоль, 40%. ЖХ-МС (Протокол D): m/z 1304,9 [М+Н]+, время удерживания составляет 0,93 минуты.

Стадия 4. Синтез ацетатной соли N-(6-аминогексаноил)-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-2-метилгидразинил)-карбонил]окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В189). Указанное в заголовке соединение получали с 80%-ным выходом из 8,3 мг (0,006 ммоль, 1,0 экв.) #В188 и 10,2 мг (0,12 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединения #В47. ЖХ-МС (Протокол D): m/z 1082,81 [М+Н]+, время удерживания составляет 0,66 минуты.

Стадия 5. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-2-метилгидразинил)-карбонил]окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В185). Указанное в заголовке соединение получали с 63%-ным выходом из 5,5 мг (0,005 ммоль, 1 экв.) #В189, 1,7 мг (0,011 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 2,6 мг (0,02 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя процедуру, раскрытую для получения соединения #В150. ЖХ-МС (Протокол D): m/z 1204,86 [М+Н]+, время удерживания составляет 0,77 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 10.01 (s, 1 H), 9.94-9.81 (m, 1 H), 8.28-8.20 (m, 1 H), 8.13-8.05 (m, 1 H), 7.86-7.76 (m, 2 H), 7.66-7.55 (m, 2 H), 7.37-7.25 (m, 2 H), 6.59-6.46 (m, 1 Н), 6.40-6.29 (m, 2 Н), 6.10 (dd, J=11,6 и 1,5 Гц, 1 H), 6.01-5.95 (m, 1 H), 5.87 (dd, J=11,6 и 7,6 Гц, 1 H), 5.65-5.57 (m, 1 H), 5.56-5.50 (m, 1 H), 5.41 (m, 2 H), 5.12-4.96 (m, 4 H), 4.42-4.33 (m, 1 H), 4.32-4.24 (m, 1 H), 4.23-4.16 (m, 2 H), 3.81 (s, 2 H), 3.69-3.60 (m, 2 H), 3.52-3.47 (m, 1 H), 3.07-2.89 (m, 5 H), 2.77-2.73 (m, 1 H), 2.60-2.54 (m, 1 H), 2.34-2.08 (m, 4 H), 2.01-1.92 (m, 4 H), 1.86-1.31 (m, 14 H), 1.27-1.20 (m, 4 H), 1.06 (d, J=6,1 Гц, 3 H), 0.94 (d, J=7,3 Гц, 3 H), 0.86 (d, J=6,9 Гц, 3 H), 0.83 (d, J=6,6 Гц, 3 H).

Пример А#67

Получение N-{7-[(2,5-диоксопирролидин-1-ил)окси]-7-оксогептаноил}-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]-окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В190)

Стадия 1. Синтез N-[(9Н-флуорен-9-илметокси)карбонил]-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]-окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В191). К раствору #В6 (19,4 мг, 0,035 ммоль, 1 экв.) в N,N-диметилформамиде (0,5 мл) при КТ добавляли N,N-диизопропилэтиламин (24,7 мкл, 0,14 ммоль, 4 экв.), 2,6-лутидин (16,3 мкл, 0,14 ммоль, 4 экв.), 4-N,N-диметиламинопиридин (4,3 мг, 0,035 ммоль, 1 экв.) и N-[(9H-флуорен-9-илметокси)карбонил]-L-валил-N5-карбамоил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)фенил]-1-орнитинамид (40,6 мг, 0,053 ммоль, 1,5 экв.) и реакционную смесь перемешивали в течение 2,5 ч. Добавляли дополнительное количество N-[(9Н-флуорен-9-илметокси)карбонил]-L-валил-N5-карбамоил-N-[4-({[(4-нитрофенокси)карбонил]-окси}метил)фенил]-L-орнитинамида (13,5 мг, 0,018 ммоль, 0,5 экв.) и реакционную смесь перемешивали в течение еще 1 ч. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В191 в виде белого твердого вещества. Выход: 9,4 мг, 0,0081 ммоль, 23%. ЖХ-МС (Протокол D): m/z 1177,8 [М+Н]+, время удерживания составляет 0,90 минуты.

Стадия 2. Синтез ацетатной соли L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В192). Указанное в заголовке соединение получали с 56%-ным выходом из 9,4 мг (0,008 ммоль, 1,0 экв.) #В191 и 13,6 мг (0,16 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединение #В47. ЖХ-МС (Протокол D): m/z 955,8 [М+Н]+, время удерживания составляет 0,65 минуты.

Стадия 3. Синтез N-{7-[(2,5-диоксопирролидин-1-ил)окси]-7-оксогептаноил}-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-ацетил}гидразинил)карбонил]окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В190). К раствору #В192 (4,5 мг, 0,004 ммоль, 1 экв.) в N,N-диметилформамиде (0,3 мл) при КТ добавляли N,N-диизопропилэтиламин (3,5 мкл, 0,02 ммоль, 5 экв.), а затем 1,1'-[(1,7-диоксогептан-1,7-диил)бис(окси)]дипирролидин-2,5-дион (получен, как в J. Am. Chem. Soc. 2006, 128, 2802, 8,9 мг, 0,025 ммоль, 6,2 экв.) и реакционную смесь оставляли перемешиваться в течение 35 мин. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В190 в виде белого твердого вещества. Выход: 1,65 мг, 0,0014 ммоль, 34%. ЖХ-МС (Протокол D): m/z 1194,80 [М+Н]+, время удерживания составляет 0,75 минуты. 1H ЯМР (500 МГц, CD3CN) δ 9.06 (s, 1 H), 8.17 (s, 1 H), 7.71-7.63 (m, 2 H), 7.35-7.25 (m, 2 H), 7.19 (d, J=7,6 Гц, 1 H), 6.73 (d, J=6,6 Гц, 1 H), 6.47 (d, J=8,8 Гц, 1 H), 6.41-6.30 (m, 2 H), 5.96-5.85 (m, 2 H), 5.67-5.50 (m, 2 H), 5.33-5.24 (m, 1 H), 5.08-4.99 (m, 2 H), 4.74 (s, 1 H), 4.57-4.48 (m, 1 H), 4.39-4.25 (m, 2 H), 4.15-4.08 (m, 1 H), 3.82-3.75 (m, 1 H), 3.67-3.59 (m, 1 H), 3.55-3.47 (m, 1 H), 3.35-3.20 (m, 2 H), 3.12-2.99 (m, 2 H), 2.82-2.73 (m, 5 H), 2.66-2.52 (m, 6 Н), 2.46-2.38 (m, 2 H), 2.36-2.20 (m, 4 H), 1.98 (s, 3 H), 1.77-1.57 (m, 11 H), 1.53-1.36 (m, 6 H), 1.30 (d, J=6,6 Гц, 3 H), 1.06 (d, J=6,6 Гц, 3 H), 1.00-0.91 (m, 9 H).

Пример А#68

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-[2-(3-{[(2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3S,5S,7S)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил]окси}-3-оксопропил)фенил]-L-аланинамида (#В193)

Стадия 1. Синтез 6-[(бромацетил)амино]гексановой кислоты (#В194). 6-аминогексановую кислоту (14,2 г, 0,11 моль, 1 экв.)) при 0°С добавляли к KOH (6,2 г, 0,11 моль, 1 экв.) в воде (30 мл). По каплям добавляли бромацетилбромид (26,1 г, 0,13 моль, 1,2 экв.) при добавлении по каплям раствора карбоната калия (2,8 н.) для доведения pH до величины выше 7,8. После завершения добавления раствор перемешивали при 0°С в течение одного часа. Реакционную смесь подкисляли 0,5 М HCl для доведения величины pH до 1 и экстрагировали этилацетатом. Органическую фазу сушили над сульфатом натрия и концентрировали в вакууме. Остаток очищали колоночной хроматографией на диоксиде кремния, элюировали смесью дихлорметан: метанол 50:1 с получением #В194 (10,2 г, 38%) в виде белого твердого вещества.

Стадия 2. Синтез пентафторфенил-6-[(бромацетил)амино]гексаноата (#В195). К раствору #В194 (8 г, 31,7 ммоль, 1 экв.) в дихлорметане (400 мл) при 0°С добавляли пентафторфенилтрифторацетат (13,3 г, 45, ммоль, 1,45 экв.) и пиридин (10 г, 127 ммоль, 4 экв.). Реакционную смесь перемешивали при 0°С в течение 10 минут. Реакционную смесь промывали 0,5 М HCl и концентрировали в вакууме. Остаток очищали посредством флэш-хроматографии с элюированием этилацетатом (49,2% в РЕ (петролейный эфир)) с получением #В195 (9,5 г, 71,7%) в виде белого твердого вещества. 1H ЯМР (400 МГц, CDCl3) δ 6.53 (br, 1 H), 3.89 (s, 2 H), 3.35 (m, 2 H), 2.70 (m, 2 H), 1.83 (m, 2 H), 1.64 (m, 2 H), 1.48 (m, 2 H).

Стадия 3. Синтез метил-(2Е)-3-(2-{[N-(трет-бутоксикарбонил)-L-аланил]амино}фенил)проп-2-еноата (#В196). Смесь метил-(2Е)-3-(2-аминофенил)проп-2-еноата (14 г, 79,1 ммоль, 1 экв.), N-(трет-бутоксикарбонил)-L-аланина (22,4 г, 119 ммоль, 1,5 экв.), 1-гидроксибензотриазола (16,1 г, 119 ммоль, 1,5 экв.), гидрохлорида 1-[3-(диметиламино)пропил]-3-этилкарбодиимида (22,8 г, 119 ммоль, 1,5 экв.) и 4-N,N-диметиламинопиридина (1,93 г, 15,8 ммоль, 0,2 экв.) в N,N-диметилформамиде (600 мл) перемешивали при 50°С в течение 3 суток. Реакционную смесь разбавляли этилацетатом (1500 мл) и водой (500 мл). Органический слой отделяли и промывали водой (300 мл × 2), сушили над сульфатом натрия и концентрировали досуха. Остаток очищали посредством колоночной хроматографии на диоксиде кремния с элюированием смесью петролейный эфир: этилацетат от 20:1 до 5:1 с получением неочищенного #В196 (21 г, 76,4%) в виде желтого масла, которое использовали без дополнительной очистки.

Стадия 4. Синтез метил-3-(2-{[N-(трет-бутоксикарбонил)-L-аланил]амино}фенил)пропаноата (#В197). К раствору неочищенного #В196 (21 г, 60,3 ммоль, 1 экв.) в метаноле (1 л) при 20°С добавляли Pd/C (4 г) и реакционную смесь перемешивали при КТ под водородом (35 фунт-сила на кв. дюйм) в течение 12 ч. Реакционную смесь фильтровали и концентрировали досуха с получением неочищенного #В197 (19 г, 90,5%) в виде желтого масла, которое использовали без дополнительной очистки.

Стадия 5. Синтез 3-(2-{[N-(трет-бутоксикарбонил)-L-аланил]амино}фенил)пропановой кислоты (#В198). К раствору неочищенного #В197 (19 г, 54,2 ммоль, 1 экв.) в тетрагидрофуране (150 мл) при 0°С добавляли гидроксид натрия (110 мл, 2 М) и реакционную смесь перемешивали при 50°С в течение 3 ч. Тетрагидрофуран удаляли в вакууме и полученный раствор доводили до pH, равного 3-4, с помощью 1 М HCl и экстрагировали этилацетатом (100 мл × 3). Экстракт промывали рассолом (20 мл × 1), сушили над сульфатом натрия и концентрировали досуха с получением неочищенного #В198 (16 г, 88,9%) в виде коричневого масла.

Стадия 3. Синтез трифторацетатной соли 3-[2-(L-аланиламино)-фенил]пропановой кислоты (#В199). К раствору #В198 (16 г, 47,5 ммоль, 1 экв.) в дихлорметане (150 мл) при 0°С добавляли TFA (100 мл) и реакционную смесь перемешивали при 25°С в течение 12 ч. Реакционную смесь концентрировали досуха и остаток использовали непосредственно на следующей стадии без дополнительной очистки.

Стадия 4. Синтез 3-[2-({N-[(9Н-флуорен-9-илметокси)карбонил]-L-аланил}амино)фенил]пропановой кислоты (#В200). К раствору #В199 (5 г, 21,1 ммоль, 1 экв.) в ацетоне (50 мл) и воде (100 мл) при 0°С добавляли бикарбонат натрия (5,30 г, 63,4 ммоль, 3 экв.). Затем по каплям при 0°С добавляли 9Н-флуорен-9-илметилкарбонохлоридат (4,94 г, 19,1 ммоль, 0,9 экв.) в ацетоне (50 мл). Реакционную смесь доводили до pH, равного 3-4, с помощью 1 М HCl и водную фазу экстрагировали этилацетатом. Объединенные органические слои сушили над сульфатом натрия, концентрировали в вакууме и остаток очищали посредством колоночной хроматографии на диоксиде кремния с элюированием смесью метанол: дихлорметан (от 1,5% до приблизительно 2%) с получением неочищенного продукта, который дополнительно очищали посредством преп. ВЭЖХ с получением белого твердого вещества, которое дополнительно очищали посредством СФХ (сверхкритическая флюидная хроматография)-разделения с получением #В200 (560 мг, 5,8%) в виде белого твердого вещества. 1H ЯМР (400 Гц, DMSO-d6): δ 9.65 (s, 1H), 7.92 (d, 2H), 7.76 (m, 3H), 7.43-7.14 (m, 8H), 4.32 (m, 4H), 2.80 (m, 2H), 2.50 (m, 2H), 1.37 (m, 3H).

Стадия 5. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2H-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-3-[2-({N-[(9H-флуорен-9-илметокси)карбонил]-L-аланил}амино)фенил]пропаноата (#В201). К раствору #В148 (21,2 мг, 0,043 ммоль, 1 экв.) в дихлорметане (0,5 мл) при КТ добавляли 4-N,N-диметиламинопиридин (3,5 мг, 0,029 ммоль, 0,67 экв.), раствор #В200 (39,4 мг, 0,086 ммоль, 2 экв.) в N,N-диметилформамиде (0,3 мл) и N,N'-дициклогексилкарбодиимид (DCC) (23,2 мг, 0,107 ммоль, 2,5 экв.) и реакционную смесь оставляли перемешиваться в течение 2,5 ч. Добавляли дополнительное количество DCC (23 мг, 0,107 ммоль, 2,5 экв.) и реакционную смесь оставляли перемешиваться в течение дополнительных 2 ч. Реакционную смесь разбавляли DMSO (0,7 мл) и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В201 в виде белого твердого вещества. Выход: 8,6 мг, 0,009 ммоль, 21%. ЖХ-МС (Протокол D): m/z 954,57 [M+Na]+, время удерживания составляет 1,10 минуты.

Стадия 6. Синтез ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3S,5S,7S)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2H-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-3-[2-(L-аланиламино)фенил]пропаноата (#В202). Указанное в заголовке соединение получали с 70%-ным выходом из 15,1 мг (0,016 ммоль, 1,0 экв.) #В201 и 27,2 мг (0,32 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединения #В47. ЖХ-МС (Протокол D): m/z 955,8 [М+Н]+, время удерживания составляет 0,65 минуты.

Стадия 7. Синтез N-[(9Н-флуорен-9-илметокси)карбонил]-L-валил-N-[2-(3-{[(2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3S,5S,7S)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2H-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил]окси}-3-оксопропил)-фенил]-L-аланинамида (#В203). К раствору #В202 (9 мг, 0,01 ммоль, 1 экв.) в N,N-диметилформамиде (0,4 мл) при КТ добавляли N,N-диизопропилэтиламин (8,5 мкл, 0,048 ммоль, 4 экв.), а затем 2,5-диоксопирролидин-1-ил-N-[(9Н-флуорен-9-илметокси)карбонил]-L-валинат (10,5 мг, 0,024 ммоль, 2 экв.) и реакционную смесь оставляли перемешиваться в течение 20 мин. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В203 в виде белого твердого вещества. Выход: 7,4 мг, 0,007 ммоль, 60%. ЖХ-МС (Протокол D): m/z 1031,9 [М+Н]+, время удерживания составляет 1,11 минуты.

Стадия 8. Синтез ацетатной соли L-валил-N-[2-(3-{[(2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3S,5S,7S)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2H-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил]окси}-3-оксопропил)фенил]-L-аланин-амида (#В204). Указанное в заголовке соединение получали с 87%-ным выходом из 7,4 мг (0,007 ммоль, 1,0 экв.) #В203 и 11,9 мг (0,14 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединения #В47. ЖХ-МС (Протокол D): m/z 809,9 [М+Н]+, время удерживания составляет 0,81 минуты.

Стадия 9. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-[2-(3-{[(2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3S,5S,7S)-7-(2-метокси-2-оксоэтил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил]окси}-3-оксопропил)фенил]-L-аланинамида (#В193). К раствору #В204 (5,3 мг, 0,006 ммоль, 1 экв.) в N,N-диметилформамиде (0,4 мл) при КТ добавляли N,N-диизопропилэтиламин (6,3 мкл, 0,036 ммоль, 6 экв.), а затем #В195 (2,9 мг, 0,007 ммоль, 1,2 экв.) и реакционную смесь оставляли перемешиваться в течение 10 мин. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В193 в виде белого твердого вещества. Выход: 4,1 мг, 0,004 ммоль, 65%. ЖХ-МС (Протокол D): m/z 1044,9 [М+Н]+, время удерживания составляет 0,95 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 9.42 (s, 1 H), 8.26-8.19 (m, 1 H), 8.14 (d, J=6,9 Гц, 1 H), 7.85-7.77 (m, 2 H), 7.30-7.10 (m, 4 H), 6.42-6.33 (m, 1 H), 6.25 (d, J=15,9 Гц, 1 H), 6.10 (dd, J=11,7 и 1,2 Гц, 1 H), 5.83 (dd, J=11,5 и 7,3 Гц, 1 H), 5.58 (dd, J=15,9 и 5,1 Гц, 1 H), 5.56-5.50 (m, 1 H), 4.55-4.42 (m, 2 H), 4.34-4.26 (m, 1 H), 4.20 (dd, J=8,8 и 6,9 Гц, 1 H), 3.81 (s, 2 H), 3.68-3.62 (m, 2 H), 3.60 (s, 3 H), 3.54-3.46 (m, 1 H), 3.07-2.99 (m, 2 H), 2.87-2.56 (m, 7 H), 2.35-2.08 (m, 5 H), 2.02-1.92 (m, 2 H), 1.88-1.61 (m, 8 H), 1.53-1.35 (m, 5 H), 1.33 (d, J=7.1 Гц, 3 Н), 1.28-1.19 (m, 4H), 1.06 (d, J=6,4 Гц, 3 H), 0.95 (d, J=7,3 Гц, 3 H), 0.85 (d, J=6,6 Гц, 3 H), 0.82 (d, J=6,6 Гц, 3 H).

Пример А#69

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-{4-[({[2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}тетрагидропиридазин-1(2Н)-ил]карбонил}окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В205)

Стадия 1. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]-амино}гексаноил)-L-валил-N5-карбамоил-N-(4-{[(тетрагидропиридазин-1(2H)-ил-карбонил)окси]метил}фенил)-L-орнитинамида (#В206). К раствору дигидрохлорида гексагидропиридазина (11,1 мг, 0,07 ммоль, 1 экв.) в N,N-диметилформамиде (0,4 мл) при КТ добавляли N,N-диизопропилэтиламин (49,3 мкл, 0,28 ммоль, 4 экв.) и 4-N,N-диметиламинопиридин (4,3 мг, 0,035 ммоль, 0,5 экв.), а затем #В45 (61,6 мг, 0,07 ммоль, 1 экв.) и реакционную смесь оставляли перемешиваться в течение 30 мин. Реакционную смесь очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 5% до 95%) с получением #В206 в виде белого твердого вещества. Выход: 19,8 мг, 0,024 ммоль, 34%. ЖХ-МС (Протокол D): m/z 827,63 [М+Н]+, время удерживания составляет 0,84 минуты.

Стадия 2. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]-амино}гексаноил)-L-валил-N-{4-[({[2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}тетрагидропиридазин-1(2H)-ил]карбонил}окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В207). К раствору #NP1 (15,5 мг, 0,029 ммоль, 2 экв.) в N,N-диметилформамиде (0,15 мл) при КТ добавляли N,N-диизопропилэтиламин (19,7 мкл, 0,11 ммоль, 8 экв.) и гексафторфосфат O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (11,3 мг, 0,029 ммоль, 2,1 экв.), а затем раствор #В206 (11,4 мг, 0,014 ммоль, 1 экв.) в N,N-диметилформамиде (0,6 мл) и реакционную смесь оставляли перемешиваться в течение 22 ч. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В207 в виде белого твердого вещества. Выход: 4,2 мг, 0,003 ммоль, 22%. ЖХ-МС (Протокол D): m/z 1345,2 [М+Н]+, время удерживания составляет 0,97 минуты.

Стадия 3. Синтез ацетатной соли N-(6-аминогексаноил)-L-валил-N-{4-[({[2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}тетрагидропиридазин-1(2H)-ил]арбонил}окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В208). Указанное в заголовке соединение получали с 67%-ным выходом из 9,8 мг (0,007 ммоль, 1,0 экв.) #В207 и 11,9 мг (0,14 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединения #В47. ЖХ-МС (Протокол D): m/z 1122,95 [М+Н]+, время удерживания составляет 0,74 минуты.

Стадия 4. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-{4-[({[2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}тетрагидропиридазин-1(2Н)-ил]карбонил}окси)метил]фенил}-N5-карбамоил-L-орнитинамид (#В205). Указанное в заголовке соединение получали с 52%-ным выходом из 5,6 мг (0,005 ммоль, 1 экв.) #В208, 1,7 мг (0,007 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 2,6 мг (0,02 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя процедуру, раскрытую для получения соединения #В150. ЖХ-МС (Протокол D): m/z 1244,9 [М+Н]+, время удерживания составляет 0,83 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 10.04 (br s, 1 H), 8.24 (br s, 1 H), 8.13 (br s, 1 H), 7.87-7.77 (m, 2 H), 7.65-7.55 (m, 2 H), 7.36-7.24 (m, 2 H), 6.88-6.77 (m, 1 H), 6.41-6.26 (m, 2 H), 6.10 (d, J=11,5 Гц, 1 H), 6.04-5.95 (m, 1 H), 5.86 (dd, J=11,5 и 7,3 Гц, 1 H), 5.66-5.48 (m, 2 H), 5.42 (br s, 1 H), 5.18-5.06 (m, 1 H), 5.05-4.94 (m, 1 H), 4.39-4.15 (m, 5 H), 4.11-3.98 (m, 1 H), 3.81 (s, 2 H), 3.68-3.60 (m, 2 H), 3.53-3.45 (m, 1 H), 3.28-3.20 (m, 2 H), 3.08-2.89 (m, 4 H), 2.85-2.72 (m, 2 H), 2.34-2.08 (m, 5 H), 2.02-1.92 (m, 4 H), 1.86-1.31 (m, 18 H), 1.28-1.20 (m, 4 H), 1.09-1.03 (m, 3 H), 0.94 (d, J=7,3 Гц, 3 H), 0.85 (d, J=6,6 Гц, 3 H), 0.82 (d, J=6,6 Гц, 3 H).

Пример А#70

Получение (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-гидразинил-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В209)

Стадия 1. Синтез (2Z,4S)-N-[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-гидразинил-2-оксоэтил)-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]-4-гидроксипент-2-енамида (#В209). К раствору #В4 (13,1 мг, 0,027 ммоль, 1 экв.) в тетрагидрофуране (0,4 мл) при 0°С добавляли DCC (11,7 мг, 0,054 ммоль, 2 экв.) и реакционную смесь перемешивали в течение 10 мин. Добавляли N-гидроксисукцинимид (6,3 мг, 0,054 ммоль, 2 экв.) и реакционную смесь оставляли перемешиваться в течение 5 ч при КТ. Реакционную смесь разбавляли ацетонитрилом, фильтровали и концентрировали. Остаток переносили в дихлорметан (0,5 мл) и добавляли раствор гидразина (1 М в THF, 270 мкл, 0,27 ммоль, 10 экв.). Реакционную смесь перемешивали в течение 10 мин, разбавляли диметилсульфоксидом, концентрировали для удаления дихлорметана и фильтровали. Неочищенный остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В209 в виде твердого вещества. Выход: 8,1 мг, 59%. ЖХ-МС (Протокол D): m/z 508,6 [M+H]+, время удерживания составляет 0,59 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 9.00 (s, 1 H), 7.76 (d, J=7,4 Гц, 1 Н), 6.29 (d, J=15,8 Гц, 1 Н) 5.98 (d, J=11,3 Гц, 1 Н), 5.86 (dd, J=11,3 и 7,4 Гц, 1 H), 5.60 (dd, J=15,8 и 5,5 Гц, 1 H), 5.56-5.48 (m, 1 H), 5.23-5.07 (m, 2 H), 5.06-4.98 (m, 1 H), 4.32-4.09 (m, 3 H), 3.70-3.59 (m, 2 H), 3.55-3.45 (m, 1 H), 3.25-3.19 (m, 1 H), 2.74 (d, J=5,1 Гц, 1 H), 2.58 (d, J=5,1 Гц, 1 H), 2.44 (dd, J=14,4 и 8,6 Гц, 1 H), 2.36-2.14 (m, 3 H), 1.93-1.58 (m, 8 H), 1.50-1.42 (m, 1 H), 1.11 (d, J=6,2 Гц, 3 H), 1.07 (d, J=6,2 Гц, 3 H), 0.96 (d, J=7,0 Гц, 3 H).

Пример А#71

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-7-[(6S,9S)-19-бром-6-метил-2,5,8,11,18-пентаоксо-9-(пропан-2-ил)-3,4,7,10,17-пентаазанонадец-1-ил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метил-пента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В210)

Стадия 1. Синтез 9Н-флуорен-9-илметил-{6-[(2,5-диоксопирролидин-1-ил)окси]-6-оксогексил}карбамата (#В211). К раствору 6-((((9Н-флуорен-9-ил)метокси)карбонил)амино)гексановой кислоты (6 г, 16,9 ммоль, 1 экв.) в тетрагидрофуране (250 мл) при 0°С добавляли N-гидроксисукцинимид (2,13 г, 18,5 ммоль, 1,1 экв.) и DCC (3,5 г, 18,59 ммоль, 1,1 экв.) и реакционную смесь перемешивали при 20°С в течение ночи. Реакционную смесь охлаждали до -20°С, фильтровали и концентрировали досуха. Остаток перемешивали в МТВЕ (метил-трет-бутиловый эфир, (300 мл)) в течение 20 мин и снова фильтровали. Осадок на фильтре сушили в вакууме с получением #В211 (5,6 г, 73%) в виде белого твердого вещества.

Стадия 2. Синтез N-(6-{[(9H-флуорен-9-илметокси)карбонил]-амино}гексаноил)-L-валина (#В212). К раствору L-валина (1,5 г, 12,8 ммоль, 1 экв.) в воде (60 мл) и тетрагидрофуране (30 мл) при 0°С добавляли NaHCO3 (1,37 г, 16,3 ммоль, 1,3 экв.). Затем при 0-10°С по каплям добавляли раствор #В211 (5,67 г, 12,6 ммоль, 0,98 экв.) в диметоксиэтане (80 мл) и тетрагидрофуране (80 мл) и реакционную смесь перемешивали при 20°С в течение 18 ч. РН реакционной смеси доводили до 4 посредством добавления лимонной кислоты и реакционную смесь концентрировали. Добавляли этилацетат (450 мл) и метанол (50 мл) и смесь перемешивали в течение 10 мин. Органический слой отделяли, сушили над сульфатом натрия и концентрировали досуха. Остаток очищали посредством флэш-колоночной хроматографии с элюированием смесью дихлорметан : метанол от 100:1 до 8:1 с получением #В212 (2,6 г, 45%) в виде белого твердого вещества.

Стадия 3. Синтез 2,5-диоксопирролидин-1-ил-N-(6-{[(9H-флуорен-9-илметокси)карбонил]амино}гексаноил)-L-валината (#В213). К раствору #В212 (2 г, 4,42 ммоль, 1 экв.) в тетрагидрофуране (60 мл) при 0°С добавляли N-гидроксисукцинимид (0,53 г, 4,65 ммоль, 1,05 экв.) и DCC (0,88 г, 4,65 ммоль, 1,05 экв.) и реакционную смесь перемешивали при 20°С в течение ночи. Реакционную смесь охлаждали до -20°С, фильтровали и концентрировали досуха. Остаток перемешивали в МТВЕ (300 мл) в течение 20 мин и фильтровали. Осадок на фильтре сушили в вакууме с получением #В213 (1,9 г, 79%) в виде белого твердого вещества.

Стадия 4. Синтез N-(6-{[(9H-флуорен-9-илметокси)карбонил]-амино}гексаноил)-L-валил-L-аланина (#В214). К раствору L-аланина (0,32 г, 3,6 ммоль, 1,04 экв.) в воде (15 мл) и тетрагидрофуране (10 мл) при 0°С добавляли NaHCO3 (0,44 г, 5,19 ммоль, 1,5 экв.). Затем по каплям при 0-10°С добавляли раствор #В213 (1,9 г, 3,46 ммоль, 1 экв.) в диметоксиэтане (30 мл) и реакционную смесь перемешивали при 20°С в течение 18 часов. РН реакционной смесь доводили до 4 посредством добавления лимонной кислоты и реакционную смесь концентрировали. Добавляли дихлорметан (400 мл) и метанол (50 мл) и смесь перемешивали в течение 10 мин. Органический слой отделяли, сушили над сульфатом натрия и концентрировали досуха. Остаток очищали посредством флэш-колоночной хроматографии с элюированием смесью дихлорметан : метанол от 100:1 до 8:1 с получением остатка, который три раза перекристаллизовывали из смеси метанол/тетрагидрофуран (3:1) с получением #В214 (490 мг, 27%) в виде белого твердого вещества. 1H ЯМР (400 МГц, DMSO): δ 12.48 (b, 1 H), 8.21 (b, 1 H), 7.91 (d, 2 H), 7.77 (d, 1 H), 7.68 (m, 2 H), 7.41 (m, 2 H), 7.33 (m, 2 H), 7.31 (m, 1 H), 4.29 (m, 2 H), 4.18 (m, 3 H), 2.94 (m, 2 H), 2.16 (m, 2 H), 1.93 (m, 1 H), 1.47 (m, 2 H), 1.37 (m, 2 H), 1.25 (m, 3 H), 1.21 (m, 2 H), 0,86 (m, 6 H).

Стадия 5. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-7-[(12S,15S)-1-(9Н-флуорен-9-ил)-15-метил-3,10,13,16,19-пентаоксо-12-(пропан-2-ил)-2-окса-4,11,14,17,18-пентаазаикозан-20-ил]-4-гидрокси-1,6-диоксаспиро-[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2H-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В215). К раствору #В214 (11,5 мг, 0,022 ммоль, 1,2 экв.) в N,N-диметилформамиде (0,2 мл) при КТ добавляли N,N-диизопропилэтиламин (12,7 мкл, 0,072 ммоль, 4 экв.) и гексафторфосфат O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (8,5 мг, 0,022 ммоль, 1,2 экв.), а затем раствор #В6 (10 мг, 0,018 ммоль, 1 экв.) в N,N-диметилформамиде (0,5 мл) и реакционную смесь оставляли перемешиваться в течение 35 мин. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В215 в виде белого твердого вещества. Выход: 14,6 мг, 0,014 ммоль, 77%. ЖХ-МС (Протокол D): m/z 1056,0 [М+Н]+, время удерживания составляет 0,94 минуты.

Стадия 6. Синтез ацетатной соли (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-7-(2-{2-[(2S)-2-({(2S)-2-[(6-аминогексаноил)амино]-3-метил-бутаноил}амино)пропаноил]гидразинил}-2-оксоэтил)-4-гидрокси-1,6-диокса-спиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2H-пиран-3-ил]амино}-5-оксопент-3-ен-2-илацетата (#В216). Указанное в заголовке соединение получали с 85%-ным выходом из 20,8 мг (0,02 ммоль, 1,0 экв.) #В215 и 34,1 мг (0,4 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединения #В47. ЖХ-МС (Протокол D): m/z 833,9 [М+Н]+, время удерживания составляет 0,65 минуты.

Стадия 7. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4E)-5-{(3R,4R,5R,7S)-7-[(6S,9S)-19-бром-6-метил-2,5,8,11,18-пентаоксо-9-(пропан-2-ил)-3,4,7,10,17-пентаазанонадец-1-ил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2H-пиран-3-ил}амино)-5-оксопент-3-ен-2-илацетата (#В210). Указанное в заголовке соединение получали с 57%-ным выходом из 15,2 мг (0,017 ммоль, 1 экв.) #В216, 6,1 мг (0,026 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 8,9 мг (0,068 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя процедуру, раскрытую для получения соединения #В150. ЖХ-МС (Протокол D): m/z 975,68 [M+Na]+, время удерживания составляет 0,76 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 9.93-9.80 (m, 2 H), 8.26-8.19 (m, 1 H), 8.14 (d, J=7,8 Гц, 1 Н), 7.98 (d, J=7,6 Гц, 1 Н), 7.85-7.73 (m, 2 H), 6.56 (br s, 1 H), 6.41-6.26 (m, 2 H), 6.11 (d, J=11,5 Гц, 1 Н), 5.86 (dd, J=11,7 и 7,6 Гц, 1 Н), 5.61 (dd, J=15,9 и 5,6 Гц, 1 Н), 5.56-5.48 (m, 1 H), 5.10-5.03 (m, 1 H), 4.39-4.13 (m, 4 H), 3.81 (s, 2 H), 3.69-3.60 (m, 2 H), 3.54-3.45 (m, 1 H), 3.25-3.19 (m, 1 H), 3.09-3.00 (m, 2 H), 2.74 (d, J=5,0 Гц, 1 Н), 2.58 (d, J=5,0, 1 H), 2.35-2.25 (m, 2 H), 2.24-2.05 (m, 3 H), 1.98 (s, 3 H), 1.96-1.75 (m, 4 H), 1.73-1.60 (m, 4 H), 1.55-1.33 (m, 5 H), 1.29-1.18 (m, 7 H), 1.07 (d, J=6,4 Гц, 3 H), 0.95 (d, J=7,3 Гц, 3 Н), 0.87-0.77 (m, 6 H).

Пример А#72

Получение (2R)-2-(пиридин-2-илдисульфанил)пропил-2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинкарбоксилата (#В217)

Стадия 1. Синтез метил-(2R)-2-(ацетилсульфанил)пропаноата (#В218). К раствору тиоацетата калия (3,9 г, 34,4 ммоль, 1,2 экв.) в N,N-диметилформамиде (60 мл) при КТ добавляли раствор S-метил-2-хлорпропаноата (3,5 г, 28,7 ммоль, 1 экв.) в N,N-диметилформамиде (10 мл) и смесь перемешивали при КТ в течение ночи. Смесь вливали в воду (150 мл) и три раза экстрагировали петролейным эфиром (100 мл). Экстракты промывали рассолом, сушили над сульфатом натрия и концентрировали в вакууме с получением #В218 (4,4 г, 94,8%) в виде светло-желтого масла.

Стадия 2. Синтез (2R)-2-сульфанилпропан-1-ола (#В219). К суспензии LAH (алюмогидрид лития, 3,4 г, 89,5 ммоль, 5 экв.) в тетрагидрофуране (116 мл) при 0°С добавляли раствор #В218 (2,9 г, 17,9 ммоль, 1 экв.) в тетрагидрофуране (29 мл) и смесь перемешивали при КТ в течение 1 ч. Реакционную смесь осторожно гасили 2 н. HCl (50 мл). Смесь пять раз экстрагировали дихлорметаном (100 мл) и экстракты сушили над сульфатом натрия. Раствор концентрировали в вакууме до примерно 150 мл и раствор использовали непосредственно на следующей стадии без дополнительной очистки.

Стадия 3. Синтез (2R)-2-(пиридин-2-илдисульфанил)пропан-1-ола (#В220). К раствору альдритиола-2 (5,9 г, 26,8 ммоль, 1,5 экв.) и уксусной кислоты (1,07 г, 17,9 ммоль, 1 экв.) в этаноле (120 мл) при 0°С добавляли раствор #В219 в THF (150 мл, приблизительно 17,9 ммоль, 1 экв.) и смесь перемешивали при КТ в течение ночи. Смесь концентрировали в вакууме и остаток очищали посредством хроматографии на силикагеле с элюированием смесью петролейный эфир : этилацетат (от 10:1 до 4:1) с получением желтого масла, которое повторно очищали посредством СФХ с получением #В220 (860 мг, 24%) в виде светло-желтого масла. 1Н ЯМР (400 Гц, CDCl3): δ 8.50 (m, 1 Н), 7.59 (m, 1 Н), 7.40 (d, 1 Н), 7.16 (m, 1 Н), 5.98 (m, 1 Н), 3.70 (m, 1 Н), 3.41 (m, 1 Н), 3.12 (m, 1 Н), 1.31 (d, 3 H).

Стадия 4. Синтез 4-нитрофенил-(2R)-2-(пиридин-2-илдисульфанил)-пропилкарбоната (#В221). К раствору #В220 (111 мг, 0,554 ммоль, 1 экв.) в дихлорметане (0,9 мл) при КТ по каплям добавляли пиридин (99,4 мкл, 1,22 ммоль, 2,2 экв.), а затем раствор 4-нитрофенилхлорформиата (140 мг, 0,665 ммоль, 1,2 экв.) в дихлорметане (0,9 мл) и реакционную смесь перемешивали в течение ночи. Реакционную смесь разбавляли дихлорметаном и водой, экстрагировали два раза и промывали рассолом и объединенные органические экстракты сушили над сульфатом натрия, фильтровали и концентрировали. Остаток очищали посредством хроматографии на силикагеле с элюированием дихлорметаном с получением #В221 в виде смолы. Выход: 45 мг, 0,23 ммоль, 22%. ЖХ-МС (Протокол D): m/z 367,2 [М+Н]+, время удерживания составляет 0,99 минуты.

Стадия 5. Синтез (2R)-2-(пиридин-2-илдисульфанил)пропил-2-{[(3R,5S,7R,8R)-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинкарбоксилата (#В217). К раствору #В6 (9,8 мг, 0,018 ммоль, 1 экв.) в N,N-диметилформамиде (0,1 мл) при КТ добавляли N,N-диизопропилэтиламин (12,7 мкл, 0,072 ммоль, 4 экв.), 2,6-лутидин (8,4 мкл, 0,072 ммоль, 4 экв.), 4-N,N-диметиламинопиридин (2,2 мг, 0,018 ммоль, 1 экв.), добавляли раствор #В221 (10 мг, 0,027 ммоль, 1,5 экв.) в N,N-диметилформамиде (0,3 мл) и реакционную смесь оставляли перемешиваться в течение 5,5 ч. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В217 в виде белого твердого вещества. Выход: 5,9 мг, 0,0076 ммоль, 42%. ЖХ-МС (Протокол D): m/z 777,51 [М+Н]+, время удерживания составляет 0,84 минуты. 1H ЯМР (500 МГц, CD3CN) δ 8.45-8.38 (m, 1 H), 8.15 (br s, 1 H), 7.84-7.73 (m, 2 H), 7.35 (br s, 1 H), 7.16 (add, J=7,3, 4,9 и 1,2 Гц, 1 H), 6.48-6.28 (m, 3 H), 5.97-5.84 (m, 2 H), 5.63 (dd, J=15,7 и 5,9 Гц, 1 H), 5.59-5.52 (m, 1 H), 4.40-4.26 (m, 2 H), 4.20-4.04 (m, 2 H), 3.83-3.75 (m, 1 H), 3.69-3.61 (m, 1 H), 3.56-3.49 (m, 1 H), 3.32 (d, J=4,7 Гц, 1 H), 3.24 (br s, 1 H), 2.79 (d, J=4,9 Гц, 1 H), 2.65-2.53 (m, 2 H), 2.47-2.38 (m, 1 H), 2.36-2.19 (m, 4 H), 1.97 (s, 3 H), 1.77-1.67 (m, 4 H), 1.66-1.58 (m, 1 H), 1.35-1.26 (m, 6 H), 1.07 (d, J=6,4 Гц, 3 H), 0.98 (d, J=7,3 Гц, 3 Н).

Пример А#73

Получение ацетатной соли N2-ацетил-L-лизил-L-валил-N5-карбамоил-N-[4-({[(2-{[(3R,5S,7R,8R)-8-гидрокси-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-гидразинил)карбонил]окси}метил)фенил]-L-орнитинамида (#В222)

Стадия 1. Синтез N2-ацетил-N6-(трет-бутоксикарбонил)-L-лизина (#В223). К смеси N6-(трет-бутоксикарбонил)-L-лизина (22,5 г, 91,5 ммоль, 1 экв.) и K2CO3 (63,1 г, 0,457 моль, 5 экв.) в смеси тетрагидрофуран/вода (200 мл/200 мл) при 0°С добавляли ацетилхлорид (8,62 г, 0,109 моль, 1,2 экв.) и смесь перемешивали при КТ в течение 4 ч. Смесь концентрировали в вакууме для удаления тетрагидрофурана и водный слой доводили до pH, равного 1, с помощью 2 М HCl и три раза экстрагировали EtOAc (100 мл). Экстракт промывали рассолом (100 мл), сушили над сульфатом натрия и концентрировали в вакууме с получением #В223 (23,1 г, 87,7%) в виде желтого масла.

Стадия 2. Синтез гидрохлоридной соли N2-ацетил-L-лизина (#В224). К раствору #В223 (23,1 г, 0,080 ммоль, 1 экв.) в этилацетате (400 мл) при 0°С под азотом добавляли HCl (газ) в этилацетате (250 мл). Смесь перемешивали при КТ в течение 4 ч и фильтровали. Твердое вещество промывали этилацетатом и сушили в вакууме с получением #В224 (18,5 г, более 100%) в виде белого твердого вещества, которое использовали без дополнительной очистки.

Стадия 3. Синтез N2-ацетил-N6-[(9Н-флуорен-9-илметокси)карбонил]-L-лизина (#В225). К смеси #В224 (8 г, 35,6 ммоль, 1 экв.) и NaHCO3 (5,99 г, 71,3 ммоль, 2 экв.) в смеси ацетон/вода (80 мл/80 мл) при 0°С добавляли раствор Fmoc-Cl (9,41 г, 36,3 ммоль, 1,02 экв.) в ацетоне (80 мл) и смесь перемешивали при КТ в течение 2 ч. Смесь доводили до pH, равного 3-4, с помощью 2 н. HCl и три раза экстрагировали этилацетатом (100 мл). Экстракты промывали рассолом (100 мл), сушили над сульфатом натрия и концентрировали в вакууме с получением неочищенного продукта (7 г) в виде желтого масла. К неочищенному продукту добавляли дихлорметан и трет-бутилметиловый эфир (100 мл) и суспензию перемешивали в течение 30 мин и затем фильтровали. Осадок на фильтре сушили в вакууме с получением #В225 (3,25 г, 22,2%) в виде белого твердого вещества.

Стадия 4. Синтез N2-ацетил-N6-[(9Н-флуорен-9-илметокси)карбонил]-L-лизил-L-валил-N5-карбамоил-N-[4-(гидроксиметил)фенил]-L-орнитинамида (#В226). К смеси #В225 (1,04 г, 2,54 ммоль, 1 экв.) в N,N-диметилформамиде (20 мл) при 0°С под азотом добавляли N-метилморфолин (769 мг, 7,61 ммоль, 3 экв.), 1-этил-3-(3-диметиламинопропил)карбодиимид-HCl (632 мг, 3,30 ммоль, 1,3 экв.), гидрат 1-гидроксибензотриазола (445 мг, 3,30 ммоль, 1,3 экв.) и L-валил-N5-карбамоил-N-[4-(гидроксимет)фенил]-L-орнитинамид (из WO 04010957, 1,01 г, 2,66 ммоль, 1,05 экв.) и смесь перемешивали при КТ в течение 2 ч. Смесь вливали в трет-бутилметиловый эфир (300 мл) и фильтровали. Твердое вещество промывали дихлорметаном (50 мл) и водой (50 мл) и сушили в вакууме с получением #В226 (1,87 г, 95,6%) в виде белого твердого вещества.

Стадия 5. Синтез N2-ацетил-N6-[(9Н-флуорен-9-илметокси)карбонил]-L-лизил-L-валил-N5-карбамоил-N-[4-({[(4-нитрофенокси)карбонил]окси}метил)-фенил]-L-орнитинамида (#В227). К смеси #В226 (1,87 г, 2,43 ммоль, 1 экв.) и бис-(4-нитрофенил)карбоната (2,21 г, 7,28 ммоль, 3 экв.) в N,N-диметилформамиде (30 мл) при 0°С под азотом добавляли N,N-диизопропилэтиламин (313 мг, 2,43 ммоль, 1 экв.) и смесь перемешивали при КТ в течение ночи. Смесь вливали в трет-бутилметиловый эфир (50 мл) и фильтровали. Твердое вещество (1,95 г) очищали посредством преп. ВЭЖХ с получением #В227 (580 мг, 25,7%) в виде белого твердого вещества. 1H ЯМР (400 Гц, DMSO-d6): δ 10.1 (s, 1 H), 8.29 (d, 2 H), 8.00 (d, 1 H), 7.86 (d, 1 H), 7.65 (d, 2 H), 7.64 (d, 1 H), 7.61 (m, 4 H), 7.40 (m, 2 H), 7.38 (m, 4 H), 7.30 (m, 3 H), 6.01 (br, 1 H), 5.21 (s, 2 H), 4.35 (br, 1 H), 4.27-4.15 (m, 5 H), 2.96 (m, 4 H), 1.98 (m, 1 H), 1.82 (s, 3 H), 1.65 (br, 3 H), 1.43-1.24 (m, 7 H), 0.83 (m, 6 H).

Стадия 6. Синтез N2-ацетил-N6-[(9Н-флуорен-9-илметокси)карбонил]-L-лизил-L-валил-N5-карбамоил-N-[4-({[(2-{[(3R,5S,7R,8R)-8-гидрокси-7-{(1E,3Е)-5-[(2S,3S,5R,6R)-5-[[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}метил)фенил]-L-орнитинамида (#В228). К раствору #В209 (8,1 мг, 0,016 ммоль, 1 экв.) в N,N-диметилформамиде (0,4 мл) при КТ добавляли 2,6-лутидин (7,5 мкл, 0,064 ммоль, 4 экв.), N,N-диизопропилэтиламин (11,3 мкл, 0,064 ммоль, 4 экв.) и 4-N,N-диметиламинопиридин (2 мг, 0,016 ммоль, 1 экв.), а затем #В227 (17,8 мг, 0,019 ммоль, 1,2 экв.), и реакционную смесь перемешивали в течение 5 ч. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В228 в виде белого твердого вещества. Выход: 5,5 мг, 0,004 ммоль, 26%. ЖХ-МС (Протокол D): m/z 1306,1 [М+Н]+, время удерживания составляет 0,81 минуты.

Стадия 7. Синтез ацетатной соли N2-ацетил-L-лизил-L-валил-N5-карбамоил-N-[4-({[(2-{[(3R,5S,7R,8R)-8-гидрокси-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метил-пента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-гидразинил)карбонил]окси}метил)фенил]-L-орнитинамида (#В222). Указанное в заголовке соединение получали с 79%-ным выходом из 9,5 мг (0,007 ммоль, 1,0 экв.) #В228 и 11,9 мг (0,14 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединения #В47. ЖХ-МС (Протокол D): m/z 1084,1 [М+Н]+, время удерживания составляет 0,58 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 10.10 (s, 1 Н), 8.22-8.12 (m, 1 H), 8.03 (d, J=7,8 Гц, 1 Н), 7.87-7.74 (m, 2 H), 7.64-7.53 (m, 2 H), 7.34-7.18 (m, 2 H), 6.31 (d, J=15,9 Гц, 1 Н), 6.09-6.01 (m, 1 H), 5.98 (d, J=11,8 Гц, 1 Н), 5.86 (dd, J=11,8 и 7,1 Гц, 1 Н), 5.66-5.56 (m, 1 H), 5.55-5.49 (m, 1 H), 5.44 (brs, 1 H), 5.23-4.91 (m, 3 H), 4.43-4.33 (m, 1 H), 4.30-4.21 (m, 2 H), 4.20-4.12 (m, 1 H), 3.69-3.59 (m, 1 H), 3.53-3.45 (m, 1 H), 3.07-2.88 (m, 2 H), 2.76-2.71 (m, 1 H), 2.61-2.56 (m, 1 H), 2.35-2.14 (m, 4 H), 2.04-1.53 (m, 18 H), 1.52-1.18(m, 10Н), 1.11 (d, J=6,4 Гц, 3 H), 1.06(d, J=6,4 Гц, 3 H), 0.95 (d, J=7,3 Гц, 3 Н), 0.85 (d, J=6,9 Гц, 3 Н), 0.82 (d, J=6,9 Гц, 3 Н).

Пример А#74

Получение метил-[(3R,5S,7R,8R)-8-гидрокси-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-метоксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В229)

Стадия 1. Синтез метил-[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-{[трет-бутил(диметил)силил]окси}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В230). К раствору #В55 (66,8 мг, 0,122 ммоль, 1 экв.) в дихлорметане при 0°C добавляли 2,6-лутидин (71,1 мкл, 0,61 ммоль, 5 экв.), а затем трет-бутил(хлор)диметилсилан (86,3 мкл, 0,366 ммоль, 3 экв.) и реакционную смесь оставляли нагреваться до КТ. Через 1 ч реакционную смесь охлаждали до 0°С, гасили водным NaHCO3, три раза экстрагировали дихлорметаном, сушили над сульфатом натрия, фильтровали и концентрировали. Остаток очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 100%) с получением #В230 в виде смолы. Выход: 68 мг, 0,001 ммоль, 84%. ЖХ-МС (Протокол D): m/z 686,58 [M+Na]+, время удерживания составляет 1,16 минуты.

Стадия 2. Синтез метил-[(3R,5S,7R,8R)-8-{[трет-6утил(диметил)-силил]окси}-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]-амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В231). К раствору #В230 (68 мг, 0,1 ммоль, 1 экв.) в метаноле (1 мл) при КТ добавляли K2CO3 (35,2 мг, 0,255 ммоль, 2,5 экв.) и реакционную смесь оставляли перемешиваться в течение 1 ч. Реакционную смесь фильтровали, промывая этилацетатом. Органический слой промывали водой и рассолом, сушили над сульфатом натрия и концентрировали. Остаток очищали посредством жидкостной хроматографии среднего давления с обращенной фазой с элюированием 0,02%-ной уксусной кислотой в воде (об./об.) и 0,02%-ной уксусной кислотой в ацетонитриле (об./об.) (от 10% до 100%) с получением #В231 в виде белого твердого вещества. Выход: 33,2 мг, 0,053 ммоль, 52%. ЖХ-МС (Протокол D): m/z 622,55 [M+H]+, время удерживания составляет 1,09 минуты.

Стадия 3. Синтез метил-[(3R,5S,7R,8R)-8-{[трет-бутил(диметил)силил]окси}-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-метокси-пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В232). К раствору #В231 (24,7 мг, 0,04 ммоль, 1 экв.) в N,N-диметилформамиде (0,5 мл) при КТ добавляли MeI (37,5 мкл, 0,6 ммоль, 15 экв.) и Ag2O (55,6 мг, 0,24 ммоль, 6 экв.) и реакционную смесь оставляли перемешиваться в течение 23 ч в темноте. Добавляли дополнительное количество MeI (38 мкл, 0,6 ммоль, 15 экв.) и Ag2O (55 мг, 0,24 ммоль, 6 экв.) и реакционную смесь перемешивали в течение дополнительных 25 ч. Реакционную смесь фильтровали через целит и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В232 в виде белого твердого вещества. Выход: 9,4 мг, 0,015 ммоль, 37%. ЖХ-МС (Протокол D): m/z 636,7 [М+Н]+, время удерживания составляет 1,19 минуты.

Стадия 4. Синтез метил-[(3R,5S,7R,8R)-8-гидрокси-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-метоксипент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В229). К раствору #В232 (12,6 мг, 0,02 ммоль, 1 экв.) в тетрагидрофуране (0,4 мл) при 0°С добавляли фторид тетрабутиламмония (1 М в тетрагидрофуране, 20,7 мкл, 0,02 ммоль, 1 экв.) и реакционную смесь оставляли нагреваться до КТ и перемешивали в течение 1 ч. Добавляли дополнительное количество фторида тетрабутиламмония (1 М в тетрагидрофуране, 10,3 мкл, 0,01 ммоль, 0,5 экв.) и реакционную смесь перемешивали в течение 45 мин. Реакционную смесь концентрировали, переносили в DMSO и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В229 в виде белого твердого вещества. Выход: 4,9 мг, 0,01 ммоль, 47%. ЖХ-МС (Протокол D): m/z 522,50 [М+Н]+, время удерживания составляет 0,79 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 7.75 (d, J=8,0 Гц, 1 H), 6.28 (d, J=15,8 Гц, 1 Н), 6.16 (d, J=11,7 Гц, 1 Н), 5.75 (dd, J=11,7 и 8,1 Гц, 1 Н), 5.58 (dd, J=15,8 и 5,1 Гц, 1 Н), 5.55-5.47 (m, 1 Н), 5.10-4.99 (m, 2 Н), 4.31-4.21 (m, 2 Н), 3.69-3.62 (m, 2 Н), 3.60 (s, 3 Н), 3.54-3.47 (m, 1 Н), 3.28-3.22 (m, 1 Н), 3.14 (s, 3 Н), 2.76 (d, J=5,1 Гц, 1 Н), 2.69-2.55 (m, 3 Н), 2.35-2.14 (m, 2 Н), 1.90-1.75 (m, 3 Н), 1.73-1.60 (m, 4 Н), 1.57-1.48 (m, 1 Н), 1.12 (d, J=6,4 Гц, 3 Н), 1.07 (d, J=6,4 Гц, 3 H), 0.95 (d, J=7,3 Гц, 3 Н).

Пример А#75

Получение ацетатной соли N2-ацетил-L-lysyl-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)-карбонил]-окси}метил)фенил]-N5-карбамоил-L-орнитинамида (#В233)

Стадия 1. Синтез N2-ацетил-N6-[(9H-флуорен-9-илметокси)карбонил]-L-лизил-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}-гидразинил)карбонил]окси}метил)фенил]-N6-карбамоил-L-орнитинамида (#В234). К раствору #В6 (20,5 мг, 0,037 ммоль, 1 экв.) в N,N-диметилформамиде (0,8 мл) при КТ добавляли 2,6-лутидин (17,3 мкл, 0,148 ммоль, 4 экв.), N,N-диизопропилэтиламин (26 мкл, 0,148 ммоль, 4 экв.) и 4-N,N-диметиламинопиридин (4,5 мг, 0,037 ммоль, 1 экв.), а затем #В227 (45 мг, 0,048 ммоль, 1,3 экв.) и реакционную смесь перемешивали в течение 4 ч. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В234 в виде белого твердого вещества. Выход: 18,5 мг, 0,014 ммоль, 37%. ЖХ-МС (Протокол D): m/z 1348,1 [М+Н]+, время удерживания составляет 0,88 минуты.

Стадия 2. Синтез ацетатной соли N2-ацетил-L-лизил-L-валил-N-[4-({[(2-{[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}гидразинил)карбонил]окси}-метил)фенил]-N5-карбамоил-L-орнитинамида (#В233). К раствору #В234 (18,5 мг, 0,014 ммоль, 1 экв.) в N,N-диметилформамиде (0,7 мл) при КТ добавляли пиперидин (27,6 мкл, 0,28 ммоль, 20 экв.) и реакционную смесь перемешивали в течение 20 мин. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением белого твердого вещества, которое затем очищали посредством хроматографии с обращенной фазой (Метод С, колонка Phenomenex Luna PFP(2)) с получением #В233 в виде белого твердого вещества. Выход: 8 мг, 0,07 ммоль, 50%. ЖХ-МС (Протокол D): m/z 1125,91 [М+Н]+, время удерживания составляет 0,63 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 10.11 (s, 1 Н), 8.43 (s, 1 Н), 8.19-8.11 (m, 1 H), 8.05 (d, J=8,1 Гц, 1 H), 7.86-7.76 (m, 2 H), 7.64-7.53 (m, 2 H), 7.34-7.18 (m, 2 H), 6.42-6.27 (m, 2 H), 6.16-6.04 (m, 2 H), 5.86 (dd, J=11,5 и 7,3 Гц, 1 H), 5.66-5.38 (m, 3 H), 5.12-4.89 (m, 3 H), 4.43-4.33 (m, 1 H), 4.32-4.22 (m, 2 H), 4.20-4.14 (m, 1 H), 3.68-3.59 (m, 1 H), 3.54-3.45 (m, 1 H), 3.07-2.86 (m, 2 H), 2.79-2.72 (m, 1 H), 2.71-2.65 (m, 1 H), 2.61-2.55 (m, 1 H), 2.34-2.14 (m, 4 H), 2.04-1.94 (m, 4 H), 1.92-1.75 (m, 7 H), 1.74-1.54 (m, 8 H), 1.53-1.19 (m, 12Н), 1.06 (d, J=6,4 Гц, 3 Н), 0.94 (d, J=7,1 Гц, 3 Н), 0.86 (d, J=6,8 Гц, 3 Н), 0.82 (d, J=6,8 Гц, 3 Н).

Пример А#76

Получение метил-[(3R,5S,7R,8R)-8-гидрокси-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В235)

Стадия 1. Синтез метил-[(3R,5S,7R,8R)-8-гидрокси-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-гидроксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В235). К раствору #В55 (60 мг, 0,11 ммоль, 1 экв.) в метаноле (1 мл) при КТ добавляли K2CO3 (37,7 мг, 0,273 ммоль, 2,5 экв.) и реакционную смесь оставляли перемешиваться в течение 1 ч. Реакционную смесь фильтровали, промывая этилацетатом. Органический слой промывали водой и рассолом, сушили над сульфатом натрия и концентрировали. Остаток очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В235 в виде белого твердого вещества. Выход: 31,2 мг, 0,06 ммоль, 56%. ЖХ-МС (Протокол D): m/z 530,43 [M+Na]+, время удерживания составляет 0,72 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 7.78 (d, J=7,6 Гц, 1 Н), 6.28 (d, J=16,0 Гц, 1 Н), 5.98 (d, J=11,8 Гц, 1 Н), 5.87 (dd, J=11,8 и 7,6 Гц, 1 Н), 5.58 (dd, J=16,0 и 5,2 Гц, 1 Н), 5.55-5.49 (m, 1 Н), 5.23-5.14 (m, 1 Н), 5.10 (d, J=4,7 Гц, 1 Н), 5.02 (d, J=6,1 Гц, 1 Н), 4.31-4.22 (m, 2 Н), 3.69-3.62 (m, 2 Н), 3.60 (s, 3 Н), 3.54-3.47 (m, 1 Н), 3.28-3.22 (m, 1 Н), 2.76 (d, J=5,1 Гц, 1 Н), 2.69-2.55 (m, 3 Н), 2.35-2.15 (m, 2 Н), 1.90-1.73 (m, 3 Н), 1.73-1.61 (m, 4 Н), 1.57-1.49 (m, 1 Н), 1.11 (d, J=6,5 Гц, 3 Н), 1.06 (d, J=6,2 Гц, 3 Н), 0.96 (d, J=7,5 Гц, 3 Н).

Пример А#77

Получение (2R)-2-(пиридин-2-илдисульфанил)пропил-[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В236)

Стадия 1. Синтез (2R)-2-(пиридин-2-илдисульфанил)пропил-[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В236). К раствору #NP1 (10,4 мг, 0,019 ммоль, 1 экв.) и #В220 (11,5 мг, 0,057 ммоль, 3 экв.) в дихлорметане (0,3 мл) при КТ добавляли 4-N,N-диметиламинопиридин (2,3 мг, 0,019 ммоль, 1 экв.) и N,N'-ди-изо-пропилкарбодиимид (8,9 мкл, 0,057 ммоль, 3 экв.) и реакционную смесь оставляли перемешиваться в течение 75 мин. Реакционную смесь концентрировали, переносили в DMSO и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В236 в виде белого твердого вещества. Выход: 7,6 мг, 0,011 ммоль, 55%. ЖХ-МС (Протокол D): m/z 719,58 [М+Н]+, время удерживания составляет 0,94 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 8.46-8.40 (m, 1 H), 7.86-7.74 (m, 3 H), 7.27-7.20 (m, 1 H), 6.41-6.32 (m, 1 H), 6.27 (d, J=16,1 Гц, 1 H), 6.10 (dd, J=11,7 и 1,5 Гц, 1 Н), 5.87 (dd, J=11,7 и 7,6 Гц, 1 H), 5.61 (dd, J=16,1 и 5,9 Гц, 1 H), 5.52-5.45 (m, 1 H), 5.02 (d, J=6,1 Гц, 1 H), 4.31-4.20 (m, 2 H), 4.18-4.06 (m, 2 H), 3.68-3.58 (m, 2 H), 3.52-3.44 (m, 1 H), 3.28-3.23 (m, 1 H), 2.76 (d, J=4,9 Гц, 1 H), 2.70 (dd, J=15,2 и 9,3 Гц, 1 H), 2.62-2.53 (m, 2 H), 2.34-2.14 (m, 2 H), 1.98 (s, 3 H), 1.86-1.72 (m, 4 H), 1.70-1.59 (m, 4 H), 1.29-1.21 (m, 6 H), 1.06 (d, J=6,4 Гц, 3 H), 0.94 (d, J=7,3 Гц, 3 H).

Пример А#78

Получение N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-{4-[({[({[(3R,5S,7R,8R)-7-{(1E,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]-карбамоил}окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В237)

Стадия 1. Синтез N-(6-{[(9Н-флуорен-9-илметокси)карбонил]-амино}гексаноил)-L-валил-N-{4-[({[({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]-ацетил}амино)метил]карбамоил}окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В238). К раствору #NP1 (20,4 мг, 0,038 ммоль, 1 экв.) в N,N-диметилформамиде (0,4 мл) при КТ добавляли N,N-диизопропилэтиламин (40,2 мкл, 0,228 ммоль, 6 экв.) и гексафторфосфат O-(7-азабензотриазол-1-ил)-N,N,N',N'-тетраметилурония (19 мг, 0,049 ммоль, 1,3 экв.), а затем раствор #В182 (34,2 мг, 0,038 ммоль, 1 экв.) в N,N-диметилформамиде (0,7 мл) и реакционную смесь оставляли перемешиваться в течение 45 мин. Реакционную смесь очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В238 в виде белого твердого вещества. Выход: 16,1 мг, 0,012 ммоль, 33%. ЖХ-МС (Протокол D): m/z 1305,3 [М+Н]+, время удерживания составляет 0,92 минуты.

Стадия 2. Синтез N-(6-аминогексаноил)-L-валил-N-{4-[({[({[(3R,5S,7R,8R)-7-(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]карбамоил}-окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В239). Указанное в заголовке соединение получали с 88%-ным выходом из 16,1 мг (0,012 ммоль, 1,0 экв.) #В238 и 20,4 мг (0,24 ммоль, 20,0 экв.) пиперидина, используя процедуру, раскрытую для получения соединения #В47. ЖХ-МС (Протокол D): m/z 1083,1 [М+Н]+, время удерживания составляет 0,67 минуты.

Стадия 3. Синтез N-{6-[(бромацетил)амино]гексаноил}-L-валил-N-{4-[({[({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)метил]карбамоил}-окси)метил]фенил}-N5-карбамоил-L-орнитинамида (#В237). Указанное в заголовке соединение получали с 62%-ным выходом из 11,5 мг (0,011 ммоль) #В239, 4 мг (0,017 ммоль, 1,5 экв.) 1-[(бромацетил)окси]пирролидин-2,5-диона и 5,7 мг (0,044 ммоль, 4,0 экв.) N,N-диизопропилэтиламина, используя процедуру, раскрытую для получения соединения #В150. ЖХ-МС (Протокол D): m/z 1203,2 [М+Н]+, время удерживания составляет 0,77 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 9.99 (s, 1 H), 8.45-8.37 (m, 1 H), 8.28-8.20 (m, 1 H), 8.15-8.05 (m, 1 H), 7.86-7.73 (m, 2 H), 7.62-7.54 (m, 2 H), 7.31-7.22 (m, 2 H), 6.41-6.33 (m, 1 H), 6.30 (d, J=15,9 Гц, 1 Н), 6.11 (dd, J=11,6 и 1,5 Гц, 1 H), 6.02-5.94 (m, 1 H), 5.86 (dd, J=11,6 и 7,6 Гц, 1 H), 5.60 (dd, J=15,9 и 5,6 Гц, 1 H), 5.56-5.48 (m, 1 H), 5.41 (s, 2 H), 5.04 (d, J=5,4 Гц, 1 H), 4.95 (s, 2 H), 4.43-4.15 (m, 5 H), 3.81 (s, 2 H), 3.69-3.60 (m, 2 H), 3.53-3.45 (m, 1 H), 3.25-3.18 (m, 1 H), 3.09-2.88 (m, 4 H), 2.73 (d, J=5,0 Гц, 1 H), 2.57 (d, J=5,0 Гц, 1 H), 2.34-2.08 (m, 5 H), 2.03-1.91 (m, 4 H), 1.91-1.74 (m, 4 H), 1.73-1.30 (m, 12 H), 1.29-1.18 (m, 4 H), 1.06 (d, J=6,4 Гц, 3 H), 0.94 (d, J=7,3 Гц, 3 H), 0.86 (d, J=6,6 Гц, 3 H), 0.83 (d, J=6,9 Гц, 3 H).

Пример А#79

Получение метил-[(3R,5S,7R,8R)-8-метокси-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-метоксипент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В240)

Стадия 1. Синтез метил-[(3R,5S,7R,8R)-8-метокси-7-{(1E,3E)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-метоксипент-2-еноил]амино}-3,6-диметилтетрагидро-2H-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-1,6-диоксаспиро[2.5]окт-5-ил]ацетата (#В240). К раствору #В235 (24,2 мг, 0,048 ммоль, 1 экв.) в N,N-диметилформамиде (0,5 мл) при КТ добавляли MeI (45 мкл, 0,7 ммоль, 15 экв.) и Ag2O (66,7 мг, 0,29 ммоль, 6 экв.) и реакционную смесь оставляли перемешиваться в течение 23 ч в темноте. Добавляли дополнительное количество MeI (45 мкл, 0,7 ммоль, 15 экв.) и Ag2O (67 мг, 0,29 ммоль, 6 экв.) и реакционную смесь перемешивали в течение дополнительных 24 ч. Реакционную смесь фильтровали через целит и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В240 в виде белого твердого вещества. Выход: 12,2 мг, 0,023 ммоль, 48%. ЖХ-МС (Протокол D): m/z 536,7 [M+H]+, время удерживания составляет 0,90 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 7.75 (d, J=8,0 Гц, 1 Н), 6.36 (d, J=15,8 Гц, 1 Н), 6.16 (d, J=11,7 Гц, 1 Н), 5.75 (dd, J=11,7 и 8,1 Гц, 1 Н), 5.62-5.50 (m, 2 Н), 5.10-4.99 (m, 1 Н), 4.58-4.51 (m, 1 Н), 4.28-4.18 (m, 1 Н), 3.70-3.62 (m, 2 Н), 3.60 (s, 3 Н), 3.55-3.47 (m, 1 Н), 3.32 (s, 3 Н), 3.14 (s, 3 Н), 2.96-2.91 (m, 1 Н), 2.70-2.63 (m, 2 Н), 2.58-2.52 (m, 1 Н), 2.35-2.16 (m, 2 Н), 2.06-1.97 (m, 1 Н), 1.88-1.75 (m, 2 Н), 1.73-1.60 (m, 4 Н), 1.18-1.09 (m, 4 Н), 1.07 (d, J=6,4 Гц, 3 Н), 0.96 (d, J=7,3 Гц, 3 Н).

Пример А#80

Получение (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2E,4Е)-5-{(3R,4R,5R,7S)-7-[(карбамоиламино)метил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-ил-ацетата (#В241) и (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{[(пропилкарбамоил)амино]метил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#В242)

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-(изоцианатометил)-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#В243). К раствору #NP1 (25,6 мг, 0,048 ммоль, 1 экв.) в дихлорметане (1 мл) при КТ добавляли триэтиламин (7,3 мг, 0,072 ммоль, 1,5 экв.), а затем дифенилрфосфорилазид (11,7 мкл, 0,053 ммоль, 1,1 экв.) и реакционную смесь оставляли перемешиваться в течение 20 ч. Реакционную смесь разбавляли дихлорметаном, три раза промывали 5%-ным NaHCO3 (водн.), сушили над сульфатом натрия и концентрировали в вакууме с получением желтого масла. Масло растворяли в ацетонитриле (1 мл) и нагревали до 50°С в течение 1 ч. Реакционную смесь охлаждали с получением #В243 в виде раствора в ацетонитриле, который исользовали без дополнительной очистки. Предполагали полное превращение. ЖХ-МС (Протокол D): m/z 533,6 [М+Н]+, время удерживания составляет 0,88 минуты.

Стадия 2. Синтез (2S,3Z)-5-({(2R,3R,5S,6S)-6-[(2Е,4Е)-5-{(3R,4R,5R,7S)-7-[(карбамоиламино)метил]-4-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил}-3-метилпента-2,4-диен-1-ил]-2,5-диметилтетрагидро-2Н-пиран-3-ил}амино)-5-оксопент-3-ен-2-ил-ацетата (#В241). К раствору #В243 (12,8 мг, 0,024 ммоль, 1 экв.) в ацетонитриле (0,5 мл) при КТ добавляли NH3 (7 М в метаноле, 34,3 мкл, 0,24 ммоль, 10 экв.) и реакционную смесь оставляли перемешиваться в течение 30 мин. Реакционную смесь концентрировали, разбавляли DMSO и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В241 в виде белого твердого вещества. Выход: 6,7 мг, 0,012 ммоль, 51%. ЖХ-МС (Протокол D): m/z 550,6 [М+Н]+, время удерживания составляет 0,72 минуты. 1H ЯМР (400 МГц, DMSO-d6) δ 7.79 (d, J=8,2 Гц, 1 Н), 6.41-6.25 (m, 2 H), 6.11 (d, J=11,7 Гц, 1 Н), 6.02-5.94 (m, 1 Н), 5.87 (dd, J=11,7 и 7,4 Гц, 1 Н), 5.64 (dd, J=16,0 и 5,9 Гц, 1 Н), 5.57-5.50 (m, 1 Н), 5.46 (br s, 1 Н), 5.01 (d, J=5,9 Гц, 1 Н), 4.32-4.23 (m, 1 Н), 3.88-3.77 (m, 1 Н), 3.70-3.60 (m, 2 Н), 3.55-3.46 (m, 1 Н), 3.25-3.04 (m, 3 Н), 2.75 (d, J=5,1 Гц, 1 Н), 2.60 (d, J=5,1 Гц, 1 Н), 2.35-2.13 (m, 2 Н), 1.98 (s, 3 Н), 1.88-1.59 (m, 8 Н), 1.46-1.37 (m, 1 Н), 1.25 (d, J=6,2 Гц, 3 Н), 1.07 (d, J=6,2 Гц, 3 H), 0.95 (d, J=7,0 Гц, 3 Н).

Стадия 3. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{[(пропилкарбамоил)амино]метил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2H-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#В242). К раствору #В243 (9 мг, 0,02 ммоль, 1 экв.) в ацетонитриле (0,4 мл) при КТ добавляли н-пропиламин (7 мкл, 0,085 ммоль, 5 экв.) и реакционную смесь перемешивали в течение 10 мин. Реакционную смесь разбавляли DMSO (0,7 мл), концентрировали в вакууме и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В242 в виде белого твердого вещества. Выход: 8 мг, 0,014 ммоль, 80%. ЖХ-МС (Протокол D): m/z 592,7 [М+Н]+, время удерживания составляет 0,80 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 7.80 (d, J=8,1 Гц, 1 Н), 6.41-6.32 (m, 1 Н), 6.28 (d, J=16,0 Гц, 1 Н), 6.11 (d, J=11,7 Гц, 1 Н), 6.00-5.93 (m, 1 Н), 5.91-5.81 (m, 2 H), 5.62 (dd, J=16,0 и 5,6 Гц, 1 H), 5.54-5.46 (m, 1 H), 5.02 (d, J=5,6 Гц, 1 H), 4.31-4.25 (m, 1 H), 3.86-3.77 (m, 1 H), 3.69-3.59 (m, 2 H), 3.53-3.45 (m, 1 H), 3.26-3.08 (m, 3 H), 2.97-2.88 (m, 2 H), 2.75 (d, J=5,1 Гц, 1 H), 2.60 (d, J=5,1 Гц, 1 H), 2.35-2.15 (m, 2 H), 1.98 (s, 3 H), 1.88-1.75 (m, 3 H), 1.73-1.60 (m, 4 H), 1.44-1.30 (m, 3 H), 1.25 (d, J=6,6 Гц, 3 H), 1.07 (d, J=6,4 Гц, 3 H), 0.95 (d, J=7,3 Гц, 3 H), 0.82 (каж. t, J=7,3 Гц, 3 Н).

Пример А#81

Получение (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2Е,4Е)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{[({[(2R)-2-(пиридин-2-илдисульфанил)пропил]окси}карбонил)-амино]метил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#В244)

Стадия 1. Синтез (2S,3Z)-5-{[(2R,3R,5S,6S)-6-{(2E,4E)-5-[(3R,4R,5R,7S)-4-гидрокси-7-{[({[(2R)-2-(пиридин-2-илдисульфанил)пропил]окси}карбонил)-амино]метил}-1,6-диоксаспиро[2.5]окт-5-ил]-3-метилпента-2,4-диен-1-ил}-2,5-диметилтетрагидро-2Н-пиран-3-ил]амино}-5-оксопент-3-ен-2-ил-ацетата (#В244). К раствору #В147 (8,2 мг, 0,014 ммоль, 1 экв.) в дихлорметане (0,4 мл) при КТ добавляли триэтиламин (12,3 мкл, 0,088 ммоль, 6,3 экв.), а затем #В221 (9,4 мг, 0,026 ммоль, 1,9 экв.) в дихлорметане (0,3 мл) и реакционную смесь перемешивали в течение 30 мин. Добавляли 4-N,N-диметиламинопиридин (1 мг, 0,008 ммоль, 0,6 экв.) и реакционную смесь оставляли перемешиваться в течение 2 ч. Реакционную смесь концентрировали, переносили в DMSO (800 мкл) и очищали посредством хроматографии с обращенной фазой (Метод А) с получением #В244 в виде белого твердого вещества. Выход: 4 мг, 0,005 ммоль, 40%. ЖХ-МС (Протокол D): m/z 734,33 [М+Н]+, время удерживания составляет 0,91 минуты. 1H ЯМР (500 МГц, DMSO-d6) δ 8.46-8.40 (m, 1 H), 7.85-7.76 (m, 2 H), 7.36-7.29 (m, 1 H), 7.26-7.20 (m, 1 H), 6.41-6.32 (m, 1 H), 6.25 (d, J=15,8 Гц, 1 H), 6.11 (d, J=11,6 Гц, 1 H), 5.87 (dd, J=11,6 и 7,6 Гц, 1 H), 5.61 (dd, J=15,8 и 6,0 Гц, 1 H), 5.50-5.43 (m, 1 H), 4.98 (d, J=6,2 Гц, 1 H), 4.29-4.22 (m, 1 H), 4.10-4.03 (m, 1 H), 4.01-3.85 (m, 2 H), 3.67-3.57 (m, 2 H), 3.52-3.44 (m, 1 H), 3.28-3.21 (m, 1 H), 3.02-2.93 (m, 1 H), 2.76 (d, J=5,1 Гц, 1 H), 2.57 (d, J=5,1 Гц, 1 H), 2.34-2.13 (m, 2 H), 1.98 (s, 3 H), 1.85-1.53 (m, 9 H), 1.28-1.20 (m, 6 H), 1.05 (d, J=6,2 Гц, 3 H), 0.93 (d, J=7,3 Гц, 3 Н).

Пример А#82

Получение N-(24-бром-23-оксо-4,7,10,13,16,19-гексаокса-22-азатетракозан-1-оил)-L-валил-N-{4-[({[2-({[(3R,5S,7R,8R)-7-{(1Е,3Е)-5-[(2S,3S,5R,6R)-5-{[(2Z,4S)-4-(ацетилокси)пент-2-еноил]амино}-3,6-диметилтетрагидро-2Н-пиран-2-ил]-3-метилпента-1,3-диен-1-ил}-8-гидрокси-1,6-диоксаспиро[2.5]окт-5-ил]ацетил}амино)этил]карбамоил}-окси)метил]-фенил}-N5-карбамоил-1-орнитинамида (#В245)

Стадия 1. Синтез трет-бутил-1-гидрокси-3,6,9,12,15,18-гексаоксагеникозан-21-оата (#В246). Смесь 3,6,9,12,15-пентаоксагептадекан-1,17-диола (25 г, 88,7 ммоль, 1 экв.), трет-бутилпроп-2-еноата (11,3 г, 88,7 ммоль, 1 экв.) и гидроксида бензилтриметиламмония (2,5 мл) перемешивали при 50°С в течение ночи. Реакционную смесь очищали посредством хроматографии на силикагеле, элюируя смесью этилацетат : дихлорметан (от 4% до приблизительно 10%) с получением #В246 (9,63 г, 25,7%) в виде желтого масла.

Стадия 2. Синтез трет-бутил-1-{[(4-метилфенил)сульфонил]окси}-3,6,9,12,15,18-гексаоксагеникозан-21-оата (#В247). К раствору #В246 (9,63 г, 23,5 ммоль, 1 экв.) и триэтиламина (3,56 г, 35,2 ммоль, 1,5 экв.) в дихлорметане (150 мл) при 0°С добавляли 4-метилбензолсульфонилхлорид (6,69 г, 35,2 ммоль, 1,5 экв.) и раствор перемешивали при КТ в течение ночи. Реакционную смесь промывали водным NaHCO3 (150 мл) и водную фазу повторно экстрагировали этилацетатом (200 мл × 3). Объединенные органические слои сушили над сульфатом натрия и концентрировали в вакууме, а остаток очищали посредством колоночной хроматографии на диоксиде кремния с элюированием смесью метанол:дихлорметан (от 0,5% до приблизительно 0,8%) с получением #В247 (9,21 г, 69,7%) в виде желтого масла.

Стадия 3. Синтез трет-бутил-1-азидо-3,6,9,12,15,18-гексаоксагеникозан-21-оата (#В248). К раствору #В247 (13,0 г, 23,0 ммоль, 1 экв.) в смеси ацетон/вода (150 мл/150 мл) добавляли азид натрия (3,20 г, 49,2 ммоль, 2,1 экв.) и йодид натрия (621 мг, 3,45 ммоль, 0,15 экв.) и реакционную смесь перемешивали при кипячении с обратным холодильником в течение ночи. Реакционную смесь экстрагировали этилацетатом (150 мл × 3) и органические фазы концентрировали в вакууме. Остаток очищали посредством колоночной хроматографии на диоксиде кремния с элюированием смесью этилацетат : петролейный эфир (12-35%) с получением #В248 (8,30 г, 83, 1%) в виде желтого масла.

Стадия 4. Синтез трет-бутил-1-амино-3,6,9,