Рекомбинантный штамм vv-gmcsf-s-lact вируса осповакцины, обладающий онколитической активностью и продуцирующий гранулоцитарно-макрофагальный колониестимулирующий фактор человека и секретируемую форму онкотоксического белка лактаптина

Изобретение относится к рекомбинантному штамму вируса осповакцины (VACV). Охарактеризованный рекомбинантный штамм VV-GMCSF-S-Lact сконструирован на основе штамма Л-ИВП вируса осповакцины, содержащего делеции фрагментов генов вирусной тимидинкиназы и ростового фактора, в районы которых встроены: ген гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека, структура которого соответствует кДНК матричной РНК ГМ-КСФ человека, в центральной части гена вирусной тимидинкиназы; и ген секретируемого лактаптина S-Lact, кодирующий фрагмент каппа-казеина человека 23-134 а.о. с «пришивкой» к его N-концу сигнального пептида ГМ-КСФ (MWLQSLLLLGTVACSIS), в левом концевом районе вирусного генома. Ген ГМ-КСФ человека экспрессируется под контролем природного промотора P7.5k вируса осповакцины и продуцирует секретируемую форму биологически активного ГМ-КСФ человека в клетках млекопитающих. Ген S-Lact экспрессируется под контролем синтетического промотора VACV Р7.5synth и продуцирует секретируемый онкотоксический белок лактаптин. Представленный штамм обладает адресной онколитической активностью в отношении клеток рака молочной железы человека in vitro и in vivo и депонирован в ГКВ возбудителей вирусных инфекций и риккетсиозов ФБУН ГНЦ ВБ «Вектор» под номером V-690. 6 ил., 1 табл., 5 пр.

 

Изобретение относится к рекомбинантному штамму вируса осповакцины (VACV), продуцирующему секретируемый гранулоцитарно-макрофагальный колониестимулирующий фактор (ГМ-КСФ) человека и онкотоксический белок лактаптин и обладающему онколитической активностью в отношении опухолей человека, и может быть использовано в биотехнологии, в частности, в генетической инженерии для разработки лекарственных средств нового поколения для борьбы с онкологическими заболеваниями, в частности раком молочной железы.

Адъювантные свойства ГМ-КСФ хорошо известны и широко используются при создании различных протективных и терапевтических вакцин (Weisbart, 1985; Fleischmann, 1986; Gaudernack, 1999; Warren, 2000; Morrissey, 1987; Yoon, 2006; Somasundaram, 2015 [1-7]). ГМ-КСФ эффективно стимулирует противоопухолевый иммунный ответ в комбинации с клеточными, вирусными и ДНК-вакцинными препаратами (Somasundaram, 2015; Lai, 2011; Hellerstein, 2012; Zhang, 2015; Chen, 2014; Fowler, 2012; Zheng, 2011 [7-13]). Показано, что ГМ-КСФ усиливает индукцию первичного иммунного ответа за счет активации и рекрутирования (chemo-attraction) антиген-презентирующих клеток (Weisbart, 1985; Fleischmann, 1986 [1-2]). ГМ-КСФ усиливает пролиферацию Т-клеток и индуцирует продукцию как Th1, так и Th2 (Morrissey, 1987; Yoon, 2006 [5-6]). ГМ-КСФ работает как генетический адъювант при совместном введении в клетку ДНК цитокина и антигена и увеличивает протективный иммунный ответ на 25-71% (Somasundaram, 2015; Wang, 2009; Hartoonian, 2009; Encke, 2006 [7, 14-16]).

Ген ГМ-КСФ широко используется в качестве трансгена при конструировании рекомбинантных онколитических вирусов (Кочнева, 2012 [17]). В частности, ген ГМ-КСФ человека был встроен в геном двух штаммов VACV: WR (JX-963) (Thorne, 2007 [18]) и Wyeth (JX-594) (Kirn, 2010 [19]) в район гена вирусной тимидинкиназы (tk-ген) под контролем синтетического ранне-позднего промотора VACV (Merchlinsky, 1997 [20]). Эти штаммы в настоящее время успешно проходят клинические испытания в качестве противоопухолевых препаратов (Breitbach, 2011 [21]).

На основе российского VACV штамма Л-ИВП (GenBank KP233807) нами сконструирован рекомбинантный штамм VV-GMCSF-S1/3, содержащий встройку гена ГМ-КСФ человека в центральной части tk-гена с одновременной его инактивацией (Кочнева, 2015 [22]). Ген ГМ-КСФ в составе рекомбинанта экспрессируется под контролем природного промотора VACV P7.5K и продуцирует секретируемую форму биологически активного ГМ-КСФ человека в клетках млекопитающих на уровне 1-40 мкг на мл культуральной среды (Гражданцева, 2015 [23]).

Штамм VV-GMCSF-S1/3 был использован нами в качестве реципиента для введения дополнительного трансгена лактаптина в район делеции еще одного гена фактора вирулентности VACV - гена вирусного ростового фактора (virus growth factor, VGF). Показано, что сочетанное подавление генов тимидинкиназы и ростового фактора VACV приводит к практически полному отсутствию репликации вируса в неделящихся клетках (McCart, 2007 [24]). Лактаптин является фрагментом каппа-казеина молока человека (23-134 а.о.), который специфически индуцирует гибель клеток рака молочной железы человека in vitro и in vivo (Koval, 2014 [25]). Встройка в качестве трансгена гена лактаптина в район делеции гена VGF способствует как дополнительной аттенуации (ослаблению) вируса в отношении нормальных клеток, так и усилению его литической (цитотоксической) активности в отношении клеток рака молочной железы.

В данной заявке на изобретение описывается модифицированная форма лактаптина (S-Lact), содержащая в N-концевой части белка сигнальный пептид ГМ-КСФ. Такая модификация обеспечивает секрецию лактаптина в межклеточное пространство и, так называемый, «эффект соседа» (bystander effect) (Алексеенко, 2011 [26]) - проникновение лактаптина в соседние клетки и индукция их гибели, что многократно усиливает терапевтический эффект.

Наиболее близким аналогом изобретения (прототипом) является рекомбинантный штамм VV-GMCSF-S1/3 (Патент РФ №2565544 Опубликован 20.10.2015, Бюл. № 29 [22]), сконструированный на основе штамма Л-ИВП вируса осповакцины, содержащий встройку гена ГМ-КСФ человека, структура которого соответствует кДНК матричной РНК ГМ-КСФ человека, представленной в GenBank под номером M11220.1, в центральной части гена вирусной тимидинкиназы между позициями 83665 и 83696 п.н. (GenBank Acc. DQ121394); ген ГМ-КСФ человека экспрессируется под контролем природного промотора Р7.5K вируса осповакцины и продуцирует секретируемую форму биологически активного ГМ-КСФ человека в клетках млекопитающих на уровне 40 мкг на мл культуральной среды; штамм VV-GMCSF-S1/3 депонирован в Государственной коллекции возбудителей вирусных инфекций и риккетсиозов ФБУН ГНЦ ВБ «Вектор» под номером V-631.

Однако рекомбинантный онколитический штамм-прототип не обеспечивает дополнительную аттенуацию (ослабление) вируса в отношении нормальных клеток и дополнительное усиление литической активности в отношении раковых клеток вследствие отсутствия в его конструкции цитотоксических генов, обеспечивающих специфическую гибель раковых клеток.

Техническим результатом заявляемого изобретения является обеспечение дополнительной аттенуации (ослабления) рекомбинантного онколитического вируса VACV в отношении нормальных клеток и усиление его литической активности в отношении раковых клеток.

Указанный технический результат достигается созданием двойного рекомбинантного штамма VV-GMCSF-S-Lact, сконструированного на основе умеренно патогенного российского штамма Л-ИВП вируса осповакцины, содержащего делеции фрагментов генов вирусной тимидинкиназы и ростового фактора, в районы которых встроены: ген гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека, структура которого соответствует кДНК матричной РНК ГМ-КСФ человека (GenBank Acc. M1 1220.1), в центральной части гена вирусной тимидинкиназы между позициями 81277 и 81308 п.н. (GenBank Acc. KP233807.1); ген ГМ-КСФ человека экспрессируется под контролем природного промотора P7.5k вируса осповакцины и продуцирует секретируемую форму биологически активного ГМ-КСФ человека в клетках млекопитающих; ген секретируемого лактаптина S-Lact, кодирующий фрагмент каппа-казеина человека 23-134 а.о. с «пришивкой» к его N-концу сигнального пептида ГМ-КСФ (MWLQSLLLLGTVACSIS) [нуклеотидная последовательность представлена в Приложении к заявке], в левом концевом районе вирусного генома между позициями 7770 и 8071 п.н. (GenBank Acc. KP233807.1); ген S-Lact экспрессируется под контролем синтетического промотора вируса осповакцины Р7.5synth и продуцирует секретируемый онкотоксический рекомбинантный белок лактаптин; штамм VV-GMCSF-S-Lact обладает высокой онколитической активностью в отношении клеток рака молочной железы человека как in vitro, так и in vivo и депонирован в Государственной коллекции возбудителей вирусных инфекций и риккетсиозов ФБУН ГНЦ ВБ «Вектор» под номером V-690.

Встройка в качестве трансгена гена секретируемой формы лактаптина в район делеции гена вирусного ростового фактора способствует, с одной стороны, аттенуации (ослаблению) вируса в отношении нормальных клеток, а с другой стороны - усилению его литической (цитотоксической) активности в отношении клеток рака молочной железы с дополнительным «эффектом соседа» (bystander effect) за счет секреции лактаптина из инфицированной клетки, что обеспечивает достижение заявляемого технического результата.

Штамм VV-GMCSF-S-Lact сконструирован путем одиночного кроссинговера между ДНК штамма VV-GMCSF-S1/3 и плазмидной ДНК pVGF-Sign-FR2-PE/L-Pat (фиг. 1) в цитоплазме клеток CV-1, последующей селекции полученной нестабильной конструкции с добавлением в культуральную среду пуромицина за счет наличия в ней гена устойчивости к этому антибиотику (Pat) (Кочнева, 2013 [27]) и внутримолекулярной рекомбинации после снятия селективных условий.

Штамм VV-GMCSF-S-Lact характеризуется следующими знаками:

Морфологические признаки. Штамм обладает свойствами типичного представителя VACV, но в отличие от векторного вируса имеет фенотип ТК-ГМКСФ+VGF-Lact+ (фиг. 2А). Показано, что при заражении клеток CV-1 штамм VV-GMCSF-S-Lact продуцирует секретируемые формы ГМ-КСФ и лактаптина (фиг. 3).

Физиолого-биохимические характеристики и культуральные свойства штамма. ДНК рекомбинантного штамма VV-GMCSF-S-Lact имеет длину около 200000 п.н. Наличие в его геноме встройки гена ГМ-КСФ человека и встройки гена S-Lact подтверждено методом ПЦР (фиг. 2Б) с использованием пар праймеров на область гена тимидинкиназы и вирусного ростового фактора соответственно. Позиции праймеров указаны на фиг. 2А. Экспрессия генов ГМ-КСФ и лактаптина и секреция белков в культуральную среду подтверждена Вестерн-блот анализом лизатов и культуральной среды клеток CV-1, инфицированных рекомбинантным штаммом VV-GMCSF-S-Lact. Экспрессию ГМ-КСФ определяли как описано в (Гражданцева, 2015 [23]) (фиг. 3A). Для выявления лактаптина использовали моноклональные антитела anti-RL2 (Koval, 2014 [25]) (фиг. 3Б). Встройка гена секретируемой формы лактаптина обеспечивает высокую цитотоксическую активность штамма VV-GMCSF-S-Lact в отношении клеток рака молочной железы человека MCF7, цитотоксическая доза вируса для которых составила 0,039 БОЕ/клетка. Онкоселективность штамма VV-GMCSF-S-Lact была показана на примере пары культур клеток раковая/нормальная эпителия молочной железы человека: MCF 10A – нормальные клетки эпителия молочной железы; MCF7 – эпителиальные клетки аденокарциномы молочной железы (фиг. 4). Как следует из фиг. 4 с увеличением множественности инфекции процент живых клеток в популяции нормальных клеток эпителия молочной железы MCF 10A уменьшается незначительно, в то время как аналогичные им клетки аденокарциномы молочной железы практически полностью лизируются при увеличении множественности инфекции рекомбинантных штаммов до 10 БОЕ/клетка. Как следует из Табл.1 индекс селективности штамма VV-GMCSF-S-Lact составляет больше 250.

Таблица 1. Сравнительная цитотоксическая активность рекомбинантного штамма VV-GMCSF-S-Lact на паре культур клеток эпителия молочной железы раковая/нормальная.

Культура клеток VV-GMCSF-S-Lact ,
ЦТД50*, БОЕ/клетка
MCF10A >10
MCF7 0,039***
Индекс селективности** >250

* ЦТД50 – доза вируса, вызывающая гибель 50%-тов клеток, выражена в количестве бляшкообразующих единиц (БОЕ) на клетку.

** Индекс селективности рассчитывали как отношение ЦТД50 в нормальных клетках к ЦТД50 в раковых клетках для каждого вирусного штамма.

*** Различия достоверны при Р<0,05.

Штамм VV-GMCSF-S-Lact обладает высокой противоопухолевой активностью in vivo, которая была продемонстрирована на модели SCID мышей с ксенографтами опухоли молочной железы человека MDA-MB-231 (фиг. 5). Мыши, леченные рекомбинантным штаммом VV-GMCSF-S-Lact, продемонстрировали достоверно меньший объем и вес опухоли в сравнении с контролем (введение буферного раствора).

Изобретение иллюстрируется следующими фигурами графических изображений:

- Фиг. 1. Физическая и генетическая карта плазмиды pVGF-Sign-FR2-PE/L-Pat. L-flank - ПЦР-фрагмент генома VACV штамма Л-ИВП длиной 944 п.н., соответствующий позициям нуклеотидов 6827-7770 депонированного в GenBank штамма L-IVP (Acc. KP233807.1), расположенный слева от гена VGF (ген VGF имеет длину 423 п.н. и соответствует позициям нуклеотидов 7801-8223 в GenBank Аcc. KP233807.1), и фланкированный сайтами узнавания эндонуклеаз рестрикции Nsil и SalI; R-flank - ПЦР-фрагмент генома VACV длиной 962 п.н., соответствующий позициям нуклеотидов 8071-9032 (GenBank Acc. KP233807.1), расположенный справа от гена вирусного ростового фактора и фланкированный сайтами узнавания эндонуклеаз рестрикции EcoRI и PvuII; P7.5synth (36 п.н.) и РE/L (41 п.н.) – синтетические ранний и ранне-поздний промоторы ВОВ (Merchlinsky, 1997 [20]); S – фрагмент сДНК матричной РНК гена ГМ-КСФ человека, содержащий сигнальную последовательность белка MWLQSLLLLGTVACSIS, размер 81 п.н.; Lact – фрагмент гена каппа-казеина (23-134 а.о.), содержащий лактаптин с добавлением последовательности, кодирующей Gly-Gly-Ser-6His и стоп-кодона на С-конце и ATG-кодона на N-конце, размер 366 п.н. (Semenov, 2010 [28]); Pat - ген пуромицин N-ацетилтрансферазы, определяющий устойчивость к пуромицину; АPr- ген β-лактамазы, определяющий устойчивость к ампициллину; ORI – область начала репликации.

- Фиг. 2. Структура рекомбинантного штамма VV-GMCSF-S-Lact. A – схема генома с указанием позиций праймеров (подписи как на фиг. 1). Б – результаты ПЦР-анализа рекомбинантного штамма VV-GMCSF-S-Lact с использованием пары праймеров (ТК-flank1 sense × TK-flank 2 as) для подтверждения встройки гена ГМ-КСФ (дорожки 1-2) и пары праймеров (Up35×Apa-L22) для подтверждения встройки гена секретируемой формы лактаптина (дорожки 3-4). Мв - маркер молекулярных весов 3000,1500,1000, 900,800,700…100. 1 - рекомбинант VV-GMCSF-S-Lact (фрагмент 1760 п.н.), 2 – исходный VACV штамм Л-ИВП (фрагмент 414 п.н.); 3 - рекомбинант VV-GMCSF-S-Lact (фрагмент 791 п.н.), 4 – исходный VACV штамм L-IVP (фрагмент 584 п.н.).

- Фиг. 3. Вестерн-блот анализ экспрессии генов ГМ-КСФ и S-Lact рекомбинантным штаммом VV-GMCSF-S-Lact в культуре клеток почки африканской зеленой мартышки CV-1. A – экспрессия гена ГМ-КСФ; размер негликозилированного зрелого ГМ-КСФ человека - 14.4 кДа (дорожка 5, негликозилированный ГМ-КСФ человека, продуцированный в клетках E.coli); дорожки 1,3 – изоформы ГМ-КСФ человека, соответствующие различной степени гликозилирования белка: 1 – культуральная среда клеток CV-1, инфицированных рекомбинантом VV-GMCSF-S-Lact; 2 – контроль, культуральная среда клеток CV-1, инфицированных Л-ИВП; 3 - лизат клеток CV-1, инфицированных рекомбинантом VV-GMCSF-S-Lact; 4 – контроль, лизат клеток CV-1, инфицированных Л-ИВП; М- контроль молекулярных весов; в качестве первичных антител использовали коммерческие поликлональные антитела кролика против ГМ-КСФ человека (PerroTech), в качестве вторичных антител - антикроличьи IgG, конъюгированные в фосфатазой (Sigma). Б – экспрессия гена S-Lact; К – контроль, лактаптин, продуцированный в клетках E.coli (14 кДа); М – контроль молекулярных весов; дорожка 1 - лизат клеток CV-1, инфицированных Л-ИВП; дорожка 2 - лизат клеток CV-1, инфицированных рекомбинантом VV-GMCSF-S-Lact; дорожка 3 – культуральная среда клеток CV-1, инфицированных рекомбинантом VV-GMCSF-S-Lact; дорожка 4 – культуральная среда клеток CV-1, инфицированных Л-ИВП. Для проявления белка использовали моноклональные антитела к лактаптину, конъюгированные с пероксидазой хрена F14-HRP.

- Фиг. 4. Онкоселективность рекомбинантного штамма VV-GMCSF-S-Lact на двух культурах клеток (нормальной и раковой) эпителия молочной железы: MCF10A – нормальный эпителий молочной железы; MCF7 – аденокарцинома молочной железы. Клетки выращивали в 96-ти луночных планшетах, инфицировали 10-кратными разведениями вируса в диапазоне доз 0,001 – 10 БОЕ на клетку, инкубировали 72 часа при 37°С в атмосфере 5% СО2 и оценивали процент гибели клеток в фотометрическом тесте с использованием субстрата для митохондриальных дегидрогеназ 2,3-бис-(2-метокси-4-нитро-5-сульфо-фенил)-2H-тетразолий-5-карбоксанилидa (реагент XTT). Тест основан на способности митохондриальных дегидрогеназ конвертировать водорастворимый ХТТ в формазан, который кристаллизуется внутри клетки. Перевод формазана в раствор с помощью феназин-метасульфата (PMS) и последующая фотометрия позволяют точно соотнести изменение оптической плотности раствора с изменением количества жизнеспособных клеток. Цитотоксическую активность для каждого разведения вируса оценивали в процентах живых клеток по отношению к контролю. За 100% принимали количество живых клеток в отрицательном контроле (неинфицированные клетки).

- Фиг. 5. Анализ противоопухолевой активности рекомбинантного штамма VV-GMCSF-S-Lact in vivo. В работе использовали самок SCID мышей, возраст 8-10 недель, вес 20-26 г. Опухоль – мышам прививали 2×106 клеток опухоли молочной железы человека MDA-MB-231 в смеси с матригелем (Matrigel, BD Bioscience) 2:1 подкожно в левую заднюю часть тела. Виротерапию начали через 14 дней после формирования хорошо видимых опухолей объемом 45-75 мм3, введение вируса в дозе 107 БОЕ/мышь в объеме 100 мкл осуществляли в область опухоли двукратно с интервалом 14 дней. Контроль – мышам вводили буферный раствор 0,005М ТРИС-НСl, рН 9.0 в объеме 100 мкл. А – динамика изменения объема опухоли; объем опухоли рассчитывали по формуле LxW2x0,5 (Yu, 2009 [29]). Измерения проводили каждые 2 недели. Общий период наблюдения – 28 дней. Б – вес извлеченной опухоли в группах сравнения в конечной точке наблюдения (28 день).

Для лучшего понимания сущности изобретения ниже следуют примеры его осуществления.

Пример 1. Конструирование рекомбинантной плазмидной ДНК pVGF-Sign-FR2-PE/L-Pat.

Плазмида pVGF-Sign-FR2-PE/L-Pat была получена на основе pXJP5.2 (Кочнева, 2015 [22]). На первом этапе правый и левый ТК-фланки pXJP5.2 были заменены на фрагменты генома VACV, расположенные слева (L-фланк) и справа (R-фланк) от гена VGF. Матрицей для амплификации фрагментов служила ДНК VACV штамма Л-ИВП (GenBank Acc. KP233807.1), праймеры для амплификации имели следующую структуру:

EcoRI

R-flank Up: 5’ – CTCCCGAATTCTCAGAAAACCCAAACACTACAACGT

PvuII

R-flank Low: 5’ – CTTCTCAGCTGGGAAACACCGATATGTGGAGGC

Nsil

L-flank Up: 5’ – CCCCCATGCATCACCATCATATCAACGCTGGTAACTAT

SalI

L-flank low: 5’ – TTTCCGTCGACTCAGTGTGTGTTTATGACAAGATTGGG

В структуры праймеров были введены сайты узнавания эндонуклеаз рестрикции для встраивания их в вектор pXJP5.2.

На втором этапе природный промотор VACV Р7.5k в плазмиде pXJP5.2 был заменен на синтетический P7.5synth с целью предотвращения внутримолекулярной нестабильности рекомбинантного штамма VV-GMCSF-S-Lact, в котором природный промотор используется для экспрессии гена ГМ-КСФ. Для проведения замены промотора были синтезированы два олигонуклеотида, которые при отжиге образуют следующую структуру:

SalI P7.5

5’ TCGAC GGCCAAAAATTGAAAAACTAGATCTATTTATTGCAC GCTAGC AAGCTT GGATCC G

G CCGGTTTTTAACTTTTTGATCTAGATAAATAACGTG CGATCG TTCGAA CCTAGG CTTAA

Nhe I HindIII BamH EcoRI

Полученный дуплекс был встроен в pXJP5.2 по SalI - EcoRI сайтам рестрикции. Далее в плазмиду по ClaI-сайту был встроен ген Pat под контролем синтетического промотора PE/L (Merchlinsky, 1997 [20]). Для этой цели сначала были синтезированы два олигонуклеотида, которые содержали последовательность промотора PE/L и сайты узнавания ряда рестриктаз. При отжиге они образуют дуплекс следующей структуры:

ClaI KpnI SpeI Nsil ClaI

CGATGGCCAAAAATTGAAATTTTATTTTTTTTTTTTGGAATATAAAGGTACCACTAGTATGCATAT

TACCGGTTTTTAACTTTAAAATAAAAAAAAAAAACCTTATATTTCCATGGTGATCATACGTATAGC

После встройки этого дуплекса по ClaI-сайту, в полученную плазмиду по KpnI – Nsil сайтам был встроен ген Pat. Фрагмент ДНК, содержащий ген Pat получали методом ПЦР на матрице pGEM-Puro-DS-Apo (Чумаков, 2013 [30]) с использованием пары праймеров, в состав которых введены сайты узнавания рестриктаз KpnI и Nsil:

KpnI

Puro Up 5´- GCATCGGTACCATGACCGAGTACAAGCCCACGG

Nsil

Puro Low 5´- GCATCATGCATTCAGGCACCGGGCTTGCGGGTCA

Полученная в результате лигирования плазмидная ДНК, обозначенная как pVGF-PE/L-Pat, содержит ген Pat под контролем синтетического ранне-позднего промотора PE/L (для селекции рекомбинантных клонов VACV), левый и правый фланки гена VGF для гомологичной рекомбинации c вирусной ДНК, приводящей к делеции фрагмента гена VGF размером 170 п.н., соответствующего позициям нуклеотидов 7801-8071 (GenBank Acc. KP233807.1), синтетический ранне-поздний промотор Р7.5synth и следующий за ним полилинкер для встройки трансгенов; селективный маркер - ген устойчивости к ампициллину.

В плазмиду pVGF-PE/L-Pat по HinIII – EcoRI сайтам под контроль промотора Р7.5synth был встроен ген лакаптина (Lact), полученный методом ПЦР на матрице плазмидной ДНК pGSDI/RL2 (Semenov, 2010 [28]) с использованием пары праймеров, обеспечивающих наличие в амплификационном фрагменте сайтов рестрикции HindIII и EcoRI:

HindIII

FR2 For 5´ –AATCCAAGCTTACCATGAACCAGAAACAACCAGCA

EcoRI

FR2 Rev 5´ –CTATCGAATTCTTAGTGATGGTGATGGTGATGTG

Полученная плазмида обозначена как pVGF-FR2-PE/L-Pat. Далее в эту плазмиду введена сигнальная последовательность гена ГМ-КСФ человека между промотором Р7.5synth и геном лактаптина с формированием единой рамки транскрипции секретируемой формы белка. Сигнальную последовательность получали методом ПЦР на матрице ДНК плазмиды pXJP5.2-GM-CSF (Кочнева, 2015 [22]) c использованием пары праймеров:

NheI

Leader F 5’- gcatcGCTAGCCCACGCGTCCGGGCTA

HindIII

Leader R 5’ – gcatcAAGCTTAGAGATGCTGCAGGCCACAGT

После обработки рестриктазами и электрофореза в 1,5% агарозном геле ПЦР-фрагмент размером 93 п. н., кодирующий сигнальную последовательность ГМ-КСФ, был выделен с использованием набора QIAquick Gel Extactionb kit (CША) и встроен в ДНК pVGF-FR2-PE/L-Pat по NheI – HindIII–сайтам. Структура полученной плазмидной ДНК, обозначенной как pVGF-Sign-FR2-PE/L-Pat (фиг. 1), подтверждена секвенированием района встройки.

Пример 2. Трансфекция клеток CV-1 рекомбинантной плазмидой pVGF-Sign-FR2-PE/L-Pat и получение рекомбинантного штамма VV-GMCSF-S-Lact.

Для проведения трансфекции ДНК плазмиды pVGF-Sign-FR2-PE/L-Pat была наработана в препаративных количествах из 1000 мл среды Лурия-Бертани и выделена с использованием набора лабораторных реагентов для выделения плазмидной ДНК, очищенной от эндотоксинов «EndoFree Plasmid Maxi Kit (Qiagen).

Рекомбинантные VACV получали с использованием реагента для трансфекции Lipofectamine™ LTX, 1мл и реагент Plus (Invitrogen). Трансфекцию проводили на 90%-ном монослое клеток CV-1, выращенном в шестилуночных планшетах (Greiner). Клетки инфицировали штаммом-реципиентом VV-GMCSF-S1/3 (Кочнева, 2015 [22]) с множественностью 0,05 БОЕ/клетка, и через 1 час инкубации при 37ºС добавляли смесь плазмидной ДНК (5 мгк)+липофектамин (20 мкл)+Реагент Plus в соответствии с рекомендацией производителя в 1 мл среды Opti-MEM (Invitrogen). Через 1 час инкубации при 37ºС в атмосфере 5% СО2 в лунки добавляли еще 2 мл среды Opti-MEM и инкубировали в тех же условиях еще 24-36 часов до развития цитопатического действия (ЦПД). Материал трижды замораживали-оттаивали и обрабатывали ультразвуком для получения гомогенной вирусной суспензии. Далее проводили селекцию рекомбинантов путем трех-кратного пассирования на монослое клеток CV-1 с добавлением пуромицина (Sigma) в концентрации 10мкг/мл среды DMEM (Invitrogen). Вирус клонировали методом бляшек под твердым агаровым покрытием и анализировали на наличие встройки гена S-Lact методом ПЦР с использованием праймеров Up35 5’- GTAAGCAAAGAATATAAGAATGAAGCGGTAATG AT- 3' и Apa-L22 5' – CGAGCACAATACCGGGAGATGG-3'. Позиции праймеров указаны на фиг. 2А. Вирусную ДНК для проведения ПЦР выделяли с использованием наборов «РИБО-сорб» (ЗАО «Интерлабсервис»). Размер амплифицированного фрагмента ДНК исходного штамма VV-GMCSF-S1/3 составлял 584 п.н. (фиг. 2Б), а рекомбинантного вируса со встройкой гена лактаптина – 791 п.н. Сохранение встройки гена ГМ-КСФ в составе полученного рекомбинанта подтверждали методом ПЦР вирусной ДНК с использованием пары праймеров на область гена тимидинкиназы TK-flank1 sense 5'- CAGAATTAATTAGACGAGTTAGACG и TK-flank 2 as 5' - TCTCGGTTTCCTCACCCAAT. Позиции праймеров указаны на фиг. 2А. Размер амплифицированного фрагмента ДНК рекомбинантного штамма со встройкой гена ГМ-КСФ составляет 1760 п.н., а штамма Л-ИВП без встройки – 414 п.н. (фиг. 2Б). Таким образом, полученный рекомбинантный штамм VV-GMCSF-S-Lact содержит две встройки: ген ГМ-КСФ в tk-гене вируса и ген S-Lact – в VGF гене. Отобранный рекомбинантный вариант VV-GMCSF-S-Lact дважды реклонировали, чтобы избежать следовых примесей исходного вируса, нарабатывали на монослое клеток CV-1 и очищали центрифугированием в градиенте плотности сахарозы (25-40%). Титр вируса определяли методом бляшек на монослое клеток CV-1, окрашенном фиксирующим раствором кристаллического фиолетового (2г/л кристаллический фиолетовый, 50 мл/л формальдегид, 100 мл/л этанол, вода). Очищенный рекомбинантный штамм VV-GMCSF-S-Lact с титром 109БОЕ/мл хранится в расфасованном виде при -80°С.

Пример 3. Оценка экспрессии генов ГМ-КСФ и S-Lact рекомбинантным штаммом VV-GMCSF-S-Lact.

ГМ-КСФ человека синтезируется в виде белка-предшественника (144 а.о.) с последующим отщеплением сигнального пептида (17 а.о.), таким образом, зрелый полипептид содержит 127 а.о. (14.4 кДа). Показано существование 16-ти различных изоформ ГМ-КСФ человека, продуцируемого в клетках эукариот. Эти изоформы, имеющие различный характер гликозилирования, обуславливают гетерогенность природного ГМ-КСФ и разброс молекулярных масс от 14.4 до 32 кДа.

Монослой клеток CV-1 (90% поверхности), выращенный в культуральном матрасе объемом 650 мл (Greiner), инфицировали рекомбинантным штаммом VV-GMCSF-S-Lact или исходным штаммом VACV Л-ИВП с множественностью 1 БОЕ/кл. Инкубировали 24 часа при 37°С в атмосфере 5% СО2, культуральную среду (DMEM) собирали, клетки разрушали лизирующим буфером (50mM TRIS-HClpH 7.5, 150mM NaCl, 1% Triton X-100, 5mM MgCl2, proteases inhibitor cocktail) в объеме 7 мл, проводили 3 раунда замораживания-оттаивания, затем трехкратную обработку ультразвуком (20 сек при 200-300 W с 10-ти сек охлаждением после каждой обработки). Культуральную среду и лизаты клеток центрифугировали 14000 rpm, 30 мин, 4°C, супернатанты анализировали в Western blot анализе отдельно на присутствие ГМ-КСФ (фиг. 3А) и лактаптина (фиг. 3Б). Электрофоретическое разделение белков проводили в камере «BioRad» в 5% концентрирующем и 14% разделяющем акриламидном геле при V=100. Перенос белков с геля осуществляли в камере MiniTrans-Blot cell «BioRad» на мембраны Immun-Blot TMPVDF Membrane for Protein Blotting 0,2µm при V=100 1 час 20 минут. Затем мембраны промывали буфером для переноса и помещали в блокирующий раствор - ТВS рН 7,4 с 5% молоком (Skim Milk Powder, Biochemika, Fluka) на 1 час при комнатной температуре (КТ) на качалке. Отмывали мембраны 3 раза по 5 минут ТВS рН 7,4 на качалке и анализировали со специфическими антителами.

При анализе ГМ-КСФ (фиг. 3А) в качестве первичных антител использовали кроличьи поликлональные антитела против ГМ-КСФ человека (PerroTech). В качестве вторичных антител – конъюгат антикроличьих антител с фосфатазой (Sigma). Мембрану инкубировали 16 часов, при +4ºС с первичными антителами в рабочей концентрации 0,2 мкг/мл, в ТВS рН 7,4 с 0,1% Tween-20 и 5% молока. После связывания с первичными антителами мембрану отмывали 3 раза по 5 минут ТВS рН 7,4 с 0,1% Tween-20 на качалке, затем проводили связывание с вторичными антителами в рабочем разведении 1:5000 в ТВS рН 7,4 с 0,1% Tween-20 и 5% молока в течение 1 часа при КТ на качалке. После связывания с конъюгатом отмывали 3 раза по 5 минут ТВS рН 7,4 с 0,1% Tween-20 на качалке и 1 раз буфером для субстрата (АР – буфер: 100 mMTris, 100mM NaCl, pH 9,5 с добавлением 50 mM MgCl2). В качестве субстрата использовали BCIP (5-bromo-4-chloro-3-indolyl phosphate) и NBT (NitroBluetetrazolium). Останавливали реакцию промыванием мембраны в дистиллированной воде.

Полученные результаты показывают, что ГМ-КСФ выявляется только в культуральной среде и лизатах клеток CV-1, инфицированных рекомбинантным штаммом VV-GMCSF-S-Lact (фиг. 3A). В клетках, инфицированных Л-ИВП, ГМ-КСФ не выявляется. В культуральной среде представлена секретированная форма ГМ-КСФ с большим молекулярным весом 25-32 кДа (фиг.3, дорожка 1) вследствие более полного гликозилирования, в отличие от внутриклеточного ГМ-КСФ, выявленного в лизатах клеток, где представлен широкий диапазон изоформ ГМ-КСФ от 18 до 32 кДа (фиг.3, дорожка 3). В качестве положительного контроля использовали негликозилированную форму ГМ-КСФ с молекулярным весом 14.4 кДа, полученную в клетках E.coli (фиг.3, дорожка 5).

При анализе лактаптина (фиг. 3Б) использовали моноклональные антитела к лактаптину, конъюгированные с пероксидазой хрена F14-HRP в концентрации 0,2 мкг/мл в ТВS рН 7,4 с 0,1% Tween-20 и 0,1% BSA. Инкубировали мембрану с антителами в течение ночи, ~ 16 часов, при +4ºС. Затем после 3-х кратной промывки ТВS рН 7,4 с 0,1% Tween-20 на качалке проявляли раствором DAB (ЗАО «Вектор-Бест»). Останавливали реакцию промыванием в дистиллированной воде. Молекулярная масса лактаптина составляет 14 кДа, белок не гликозилируется в клетках эукариот. Как следует из фиг. 3Б лактаптин выявляется в среде и лизатах клеток, инфицированных рекомбинантным штаммом VV-GMCSF-S-Lact, что свидетельствует о его экспрессии и секреции в составе рекомбинантного вируса.

Пример 4. Оценка цитолитической активности рекомбинантного штамма VV-GMCSF-S-Lact на двух культурах клеток (нормальной и раковой) эпителия молочной железы.

В работе использовали культуры клеток: MCF10A – нормальный эпителий молочной железы; MCF7 – аденокарцинома молочной железы.

Исследование цитолитической активности рекомбинантного штамма VV-GMCSF-S-Lact на культурах клеток молочной железы MCF7 и MDA-MB-231 проводили микрометодом на 96-луночных культуральных планшетах (Greiner) с использованием субстрата для митохондриальных дегидрогеназ 2,3-бис-(2-метокси-4-нитро-5-сульфо-фенил)-2H-тетразолий-5-карбоксанилидa (реагент XTT) (Sigma). В лунки планшета с 50%-ным монослоем клеток вносили десятикратные разведения вирусной суспензии с множественностью инфекции от 10 до 0,001 БОЕ/кл. (multiplicity of infection, MOI) в 100 мкл среды 199 (Биолот) с добавлением 2% фетальной сыворотки коров (HyClone). Планшеты помещали в термостат при температуре 37˚С, 5% СО2, влажности 85% и инкубировали 72 часа. После инкубации в каждую тестируемую лунку добавляли по 50 мкл реагента ХТТ и феназин-метасульфата (PMS) (Sigma), который получали добавлением к рабочему раствору с содержанием XTT 1 мг/мл раствора PMS 1,25 мМ из расчета: на каждый 1 мл ХТТ – 20 мкл PMS. Планшет инкубировали еще 3 часа и определяли оптическую плотность ОП490/620 на планшетном спектрофотометре SpectraCount (Packard). Строили график зависимости ОП от МОI и определяли процент живых клеток для каждой экспериментальной точки. За 100% принимали количество живых клеток в отрицательном контроле (неинфицированные клетки). Все расчеты проводили с использованием программного обеспечения LabView.

Как следует из фиг. 4 с увеличением множественности инфекции процент живых клеток в популяции нормальных клеток эпителия молочной железы MCF 10A уменьшается незначительно, в то время как аналогичные им клетки аденокарциномы молочной железы практически полностью лизируются при увеличении множественности инфекции до 10 БОЕ/клетка. Эти данные свидетельствуют о высокой цитотоксической активности рекомбинантного штамма VV-GMCSF-S-Lact в отношении опухолевых клеток молочной железы человека, а также о его онкоселективности и безопасности для нормальных клеток.

Пример 5. Оценка онколитической активности рекомбинантного штамма VV-GMCSF-S-Lact in vivo на модели SCID мышей с ксенографтами опухоли молочной железы человека MDA-MB-231.

Все работы с животными были проведены на базе Центра коллективного пользования «SPF-виварий» Института цитологии и генетики СО РАН. В работе использовали 10 самок иммунодефицитных мышей линии SCID, возраст 8-10 недель, вес 20-26 г. Опухоль – мышам прививали 2х106 клеток опухоли молочной железы человека MDA-MB-231 в смеси с матригелем (Matrigel, BD Bioscience) 2:1 подкожно в левую заднюю часть тела. Виротерапию начинали через 14 дней после формирования хорошо видимых опухолей объемом 45-75 мм3. Мыши были разделены на 2 группы по 5 штук каждая. Мышам первой группы вводили вирус в дозе 107 БОЕ/мышь в объеме 100 мкл в область опухоли двукратно с интервалом 14 дней. Мышам второй группы (контроль) вводили буферный раствор 0,005М ТРИС-НСl, рН 9.0 в объеме 100 мкл. Объем опухоли рассчитывали по формуле LxW2x0,5 (Yu, 2009 [29]). Измерения проводили каждые 2 недели. Общий период наблюдения – 28 дней (фиг. 5А). Эвтаназию мышей осуществляли методом ингаляции углекислым газом, опухоли извлекали и взвешивали (фиг. 5Б). Статистическую обработку результатов проводили с использованием t-критерия Стьюдента на уровне значимости 95%.

Как следует из фиг. 5А и Б размер и вес опухолей мышей, леченных рекомбинантным штаммом VV-GMCSF-S-Lact, достоверно меньше аналогичных показателей для мышей контрольной группы, что свидетельствует о высокой онколитической активности вируса в отношении опухолей молочной железы человека.

Таким образом, выше изложенные результаты (примеры 1-5) подтверждают достижение заявляемого технического результата, а именно: создан рекомбинантный штамм VV-GMCSF-S-Lact, обладающий адресной противоопухолевой активностью в отношении клеток рака молочной железы человека. Причем, встройка в качестве трансгена гена секретируемой формы лактаптина в район делеции гена вирусного ростового фактора способствует, с одной стороны, аттенуации (ослаблению) рекомбинантного онколитического вируса VACV в отношении нормальных клеток, а с другой стороны - усилению его литической (цитотоксической) активности в отношении клеток рака молочной железы с дополнительным «эффектом соседа» (bystander effect) за счет секреции лактаптина из инфицированной клетки (стр. 6, табл. 1).

Источники научно-технической и патентной информации

1. Weisbart R.H., Golde D.W., Cark S.C., Wong G.G., Gassan J.C. Human granulocyte-macrophage colony-stimulating factor is a neutrophil activator. // Nature. – 1985. – V. 314. – P. 361-363.

2. Fleischmann J., Golde D. W., Weisbart R. H., Gasson J. C. Granulocyte-macrophage colony-stimulating factor enhances phagocytosis of bacteria by human neutrophils. // Blood. – 1986. – V. 68(3). – P. 708-711.

3. Gaudernack G., Gjertsen M.K. Combination of GM-CSF with antitumor vaccine strategies. // Eur. J. Cancer. - 1999. – V. 35 (Suppl. 3). – P. 33–35.

4. Warren T.L., Weiner G.J. Uses of granulocyte-macrophage colony-stimulating factor in vaccine development. // Curr. Opin. Hematol. - 2000. – V. 7. – P. 168–173.

5. Morrissey P.J., Bressler L., Park L.S., Alpert A., Gillis S. Granulocyte-macrophage colony-stimulating factor augments the primary antibody response by enhancing the function of antigen-presenting cells. // J. Immunol. - 1987. – V. 15. – P. 1113–1119.

6. Yoon H.A., Aleyas A.G., George J.A., Park S.O., Han Y.W., Cho J.-G., Eo S.K. Cytokine GM-CSF genetic adjuvant facilitates prophylactic DNA vaccine against pseudorabies virus through enhanced immune responses. // Microbiol. Immunol. – 2006. – V. 50(2). – P. 83–92.

7. Somasundaram C. Recent advances and current status of GM-CSF as an adjuvant in DNA vaccines for viral diseases. // J. Investig. Genomics. – 2015. – V. 2(3). - 00025. DOI: 10.15406/jig.2015.02.00025

8. Lai L., Kwa S., Kozlowski P.A., Montefiori D.C., Ferrari G. et al. Prevention of infection by a granulocyte-macrophage colony-stimulating factor co-expressing DNA/modified vaccinia Ankara simian immunodeficiency virus vaccine. // J. Infect. Dis. – 2011. – V. 204(1). – P. 164-173.

9. Hellerstein M., Xu Y., Marino T., Lu S., Yi H. et al. Co-expression of HIV-1 virus-like particles and granulocyte-macrophage colony stimulating factor by GEO-D03 DNA vaccine. // Hum. Vaccin. Immunother. – 2012. – V. 8(11). – P. 1654-1658.

10. Zhang H., Qian P., Peng B., Shi L., Chen H. et al. A novel subunit vaccine co-expressing GM-CSF and PCV2b Cap protein enhances protective immunity against porcine circovirus type 2 in piglets. // Vaccine. – 2015. – V. 33(21). – P. 2449-2456.

11. Chen H., Gao N., Wu J., Zheng X., Li J. et al. Variable effects of the co-administration of a GM-CSF-expressing plasmid on the immune response to flavivirus DNA vaccines in mice. // Immunol. Lett. – 2014. - V. 162(1 Pt A). – P. 140-148.

12. Fowler V., Robinson L., Bankowski B., Cox S., Parida S. et al. A DNA vaccination regime including protein boost and electroporation protects cattle against foot-and-mouth disease. // Antiviral. Res. – 2012. – V. 94(1). – P. 25-34.

13. Zheng Q., Fan D., Gao N., Chen H., Wang J. et al. Evaluation of a DNA vaccine candidate expressing prM-E-NS1 antigens of dengue virus serotype 1 with or without granulocyte-macrophage colony-stimulating factor (GM-CSF) in immunogenicity and protection. // Vaccine. – 2011. – V. 29(4). – P. 763-771.

14. Wang X., Li J., Jiang P., Li Y., Zeshan B. et al. GM-CSF fused with GP3 and GP5 of porcine reproductive and respiratory syndrome virus increased the immune responses and protective efficacy against virulent PRRSV challenge. // Virus Res. – 2009. – V. 143(1). – P. 24-32.

15. Hartoonian C., Ebtekar M., Soleimanjahi H., Karami A., Mahdavi M. et al. Effect of immunological adjuvants: GM-CSF (granulocyte-monocyte colony stimulatingfactor) and IL-23 (interleukin-23) on immune responses generated against hepatitis C virus core DNA vaccine. // Cytokine. – 2009. – V. 46(1). – P. 43-50.

16. Encke J., Bernardin J., Geib J., Barbakadze G., Bujdoso R. et al. Genetic vaccination with Flt3-L and GM-CSF as adjuvants: Enhancement of cellular and humoral immune responses that results in protective immunity in a murine model of hepatitis C virus infection. // World J. Gastroenterol. – 2006. – V. 12(44). – P. 7118-7125.

17. Кочнева Г.В., Сиволобова Г.Ф., Юдина К.В., Бабкин И.В., Чумаков П.М., Нетесов С.В. Онколитические поксвирусы. // Молекулярная генетика, микробиология и вирусология. – 2012. – №1. – С. 8–15.

18. Thorne S.H., Hwang T.H., O’Gorman W.E., Bartlett D.L., Sei S., Kanji F., Brown C., Werier J., Cho J., Lee D., Wang Y., Bell J., Kirn D.H. Rational strain selection and engineering creates a broad-spectrum, systemically effective oncolytic poxvirus, JX-963. // J. Clin. Invest. – 2007. – V. 117. – P. 3350–3358.

19. Kirn D. Oncolytic vaccinia virus cancer therapy // U.S. Patent. – 2010. - №2010/0303714.

20. Merchlinsky M., Eckert D., Smith E., Zauderer M. Construction and characterization of vaccinia direct ligation vectors. // Virology. – 1997. – V. 238 – P. 444–451.

21. Breitbach C.J., Burke J., Jonker D., Stephenson J., Haas A.R., Chow L.Q. M., Nieva J., Hwang T., Moon A., Patt R., Pelusio A., Le Boeuf F., Burns J., Evgin L., De Silva N., Cvancic S., Robertson T., Je J., Lee Y., Parato K., Diallo J., Fenster A., Daneshmand M., Bell J.C., Kirn D.H. Intravenous delivery of a multi-mechanistic cancer-targeted oncolytic poxvirus in humans. // Nature. – 2011. – V. 477. – P. 99–102.

22. Кочнева Г.В., Сиволобова Г.Ф., Лупан Т.А., Гражданцева А.А., Чумаков П.М., Нетесов С.В. Рекомбинантный штамм VV-GMCSF-S1/3 вируса осповакцины, продуцирующий секретируемый гранулоцитарно-макрофагальный колониестимулирующий фактор человека. // Патент РФ. – 2015. - №2565544. - Бюл. № 29 (прототип).

23. Гражданцева А.А., Сиволобова Г.Ф., Ткачева А.В., Гилева И.П., Кулигина Е.В., Рихтер В.А., Кочнева Г.В. Высокоэффективная продукция биологически активного секретируемого гранулоцитарно-макрофагального колониестимулирующего фактора человека рекомбинантным вирусом осповакцины. // Биотехнология, 2015, №5, C. 1-9.

24. McCart A., Bartlett D., Moss B. Combined growth factor-deleted and thymidine kinase-deleted vaccinia virus vector. // US Patent. №7208313. – 2007.

25. Koval O.A. et al. Lactaptin induces p53-independent cell death associated with features of apoptosis and autophagy and delays growth of breast cancer cells in mouse xenografts. // PLоS one. – 2014. – V. 9 (4). – e93921

26. Алексеенко И.В., Копанцев Е.П., Виноградова Т.В., Свердлов Е.Д. Бицистронный вектор для совместной экспрессии гена-убийцы HSVtk и цитокина GM-CSF в раковых клетках. // Доклады академии наук. – 2011. – Т. 439. - №4. – С. 551-554.

27. Кочнева Г.В., Бабкина И.Н., Лупан Т.А., Гражданцева А.А., Юдин П.В., Сиволобова Г.Ф., Швалов А.Н., Попов Е.Г., Бабкин И.В., Нетесов С.В., Чумаков П.М. Апоптин усиливает онколитическую активность вируса осповакцины in vitro. // Молекулярная биология. 2013. Т. 47. № 5. С. 842-852.

28. Semenov D.V., Fomin A.S., Kuligina E.V., Koval O.A., Matveeva V.A., Babkina I.N., Tikunova N.V., Richter V.A.. Recombinant analogs of a novel milk pro-apoptotic peptide, lactaptin, and their effect on cultured human cells. // Protein. J. – 2010. – V. 29. – P.174–180.

29. Yu Z., Li S., Brader P., Chen N., Yu Y.A., Zhang Q., Szalay A.A., Fong Y., Wong R.J. Oncolytic vaccinia therapy of squamous cell carcinoma // Molecular Cancer. - 2009. - V. 8. - P. 45-53.

30. Чумаков П.М., Кочнева Г.В., Бабкина И.Н., Лупан Т.А., Гражданцева А.А., Юдин П.В., Сиволобова Г.Ф., Попов Е.Г., Нетесов С.В. Рекомбинантная плазмидная ДНК pGEM-Puro-DS-Apo, содержащая синтетический ген апоптина, фланкированный последовательностями генома вируса осповакцины из района С10L-С12L, и рекомбинантный штамм VVdGF-ApoS24/2 вируса осповакцины, продуцирующий апоптин. // Патент РФ. – 2013. - №2492238. - Бюл. № 25.

Приложение

<110> Федеральное государственное бюджетное учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (ИХБФМ СО РАН)

<120> Рекомбинантный штамм VV-GMCSF-S-Lact вируса осповакцины, обладающий онколитической активностью и продуцирующий гранулоцитарно-макрофагальный колониестимулирующий фактор человека и секретируемую форму онкотоксического белка лактаптина

<160> SEQ ID NO 1

<210> 1

<211> 423

<212>DNA

<213> chimeric gene consisting of human milk kappa-casein (residues 23-134) and human GM-CSF signal peptide (MWLQSLLLLGTVACSIS) (химерный ген, состоящий из фрагмента каппа-казеина человека (остатки 23-134) и сигнального пептида ГМ-КСФ человека (MWLQSLLLLGTVACSIS)

<400> 1

atg tgg ctg cag agc ctg ctg ctc ttg ggc act gtg gcc tgc agc 45

atc tct aag ctt atg aac cag aaa caa cca gca tgc cat gag aat 90

gat gaa aga cca ttc tat cag aaa aca gct cca tat gtc cca atg 135

tat tat gtg cca aat agc tat cct tat tat gga acc aat ttg tac 180

caa cgt aga cca gct ata gca att aat aat cca tat gtg cct cgc 225

aca tat tat gca aac cca gct gta gtt agg cca cat gcc caa att 270

cct cag cgg caa tac ctg cca aat agc cac cca ccc act gtg gta 315

cgt cgc cca aac ctg cat cca tca ttt att gcc atc ccc cca aag 360

aaa att cag gat aaa ata atc atc cct acc atc ggc gga tca cat 405

cac cat cac cat cac taa 423

Рекомбинантный штамм VV-GMCSF-S-Lact, сконструированный на основе штамма Л-ИВП вируса осповакцины, содержащий делеции фрагментов генов вирусной тимидинкиназы и ростового фактора, в районы которых встроены: ген гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека, структура которого соответствует кДНК матричной РНК ГМ-КСФ человека (GenBank Acc. M11220.1), в центральной части гена вирусной тимидинкиназы между позициями 81277 и 81308 п.н. (GenBank Acc. KP233807.1); ген ГМ-КСФ человека экспрессируется под контролем природного промотора P7.5k вируса осповакцины и продуцирует секретируемую форму биологически активного ГМ-КСФ человека в клетках млекопитающих; ген секретируемого лактаптина S-Lact, кодирующий фрагмент каппа-казеина человека 23-134 а.о. с «пришивкой» к его N-концу сигнального пептида ГМ-КСФ (MWLQSLLLLGTVACSIS), в левом концевом районе вирусного генома между позициями 7770 и 8071 п.н. (GenBank Acc. KP233807.1); ген S-Lact экспрессируется под контролем синтетического промотора вируса осповакцины Р7.5synth и продуцирует секретируемый онкотоксический рекомбинантный белок лактаптин; штамм VV-GMCSF-S-Lact обладает адресной онколитической активностью в отношении клеток рака молочной железы человека как in vitro, так и in vivo и депонирован в Государственной коллекции возбудителей вирусных инфекций и риккетсиозов ФБУН ГНЦ ВБ «Вектор» под номером V-690.



 

Похожие патенты:

Изобретение относится к области биотехнологии, вирусологии и медицины. Предложены вирионы аденоассоциированного вируса (AAV) с вариантным капсидным белком, где вирионы AAV демонстрируют большую инфекционность ретинальной клетки, когда вводятся интравитреальной инъекцией, по сравнению с AAV дикого типа.

Изобретение относится к области биотехнологии, вирусологии и иммунологии. Описаны новые аденовирусные штаммы с улучшенной серопревалентностью.

Изобретение относится к рекомбинантному штамму вируса осповакцины (ВОВ). Представленный рекомбинантный штамм VV-GMCSF-Lact сконструирован на основе штамма Л-ИВП вируса осповакцины, содержащего делеции фрагментов генов вирусной тимидинкиназы и ростового фактора, в районы которых встроены: ген гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека, структура которого соответствует к ДНК матричной РНК ГМ-КСФ человека, в центральной части гена вирусной тимидинкиназы; и ген лактаптина, кодирующий фрагмент каппа-казеина человека 23-134 а.о., в левом концевом районе вирусного генома.

Изобретение относится к области биотехнологии. Описан самокомплементарный аденоассоциированный вирусный вектор для лечения нарушений двигательных нейронов, таких как спинальная мышечная атрофия, боковой амиотрофический склероз, спинобульбарная мышечная атрофия, спиноцеребеллярная атаксия, первичный латеральный склероз и травматическое повреждение спинного мозга.

Изобретение относится к области биотехнологии и вирусологии. Описана самореплицирующаяся молекула РНК.

Настоящие изобретения относятся к области ветеринарных вакцин, в частности к области векторных вакцин для домашних птиц, основанных на рекомбинантном непатогенном вирусе болезни Марека (npMDV).

Представлена группа изобретений, касающаяся эпитопа, специфичного для вируса гепатита В (ВГВ), полинуклеотида, кодирующего эпитоп, экспрессионного рекомбинантного векора, рекомбинантного микроорганизма, вируса или клетки млекопитающих, способа получения эпитопа и способа получения антитела, специфично связывающегося с эпитопом.

Изобретение относится к области биотехнологии, вирусологии и медицины. Описана композиция, включающая рекомбинантный модифицированный вирус осповакцины Анкара.

Изобретения касаются системы стабильной экспрессии лентивирусных структурных и регуляторных белков, полустабильной линии пакующих клеток и способа получения лентивирусных векторов (LV) с использованием такой линии пакующих клеток.

Изобретения касаются способов получения стабильной линии пакующих лентивирусы клеток (варианты), стабильной линии пакующих лентивирусы клеток, способа получения лентивирусных векторов, линии клеток-продуцентов и способа производства лентивирусных векторов.

Изобретение относится к рекомбинантному штамму вируса осповакцины (ВОВ). Представленный рекомбинантный штамм VV-GMCSF-Lact сконструирован на основе штамма Л-ИВП вируса осповакцины, содержащего делеции фрагментов генов вирусной тимидинкиназы и ростового фактора, в районы которых встроены: ген гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека, структура которого соответствует к ДНК матричной РНК ГМ-КСФ человека, в центральной части гена вирусной тимидинкиназы; и ген лактаптина, кодирующий фрагмент каппа-казеина человека 23-134 а.о., в левом концевом районе вирусного генома.

Изобретение относится к области биотехнологии, конкретно к технологии получения генно-инженерных конструкций для экспрессии трансгенов в клетках млекопитающих, и может быть использовано для рекомбинантной продукции тромбоцитарного фактора роста человека.

Изобретение относится к области биотехнологии и касается рекомбинантного штамма вируса осповакцины. Охарактеризованный штамм сконструирован на основе штамма Л-ИВП вируса осповакцины и содержит встройку гена гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека, структура которого соответствует кДНК матричной РНК ГМ-КСФ человека, представленной в GenBank под номером Ml 1220.1.

Изобретение относится к области биохимии. Заявлен G-CSF-предшественник, содержащий сигнальный пептид и G-CSF-пептид, где сигнальный пептид имеет последовательность человеческого сигнального пептида дикого типа молекулы человеческого G-CSF/b, содержащего, по меньшей мере, одну из мутаций, включающих делецию Glu29, замену His21Phe и замену Gln28Leu.

Изобретение относится к области биотехнологии и иммунологии. Описаны биспецифические антитела против фактора роста сосудистого эндотелия человека VEGF и ангиопоэтина-2 человека ANG-2, способы их получения, фармацевтические композиции, содержащие указанные антитела, и их применения.

Изобретение относится к области биотехнологии. Описаны антисмысловые соединения, способы снижения уровня фактора 11 и способы лечения или предупреждения тромбоэмболических осложнений у индивидуума, нуждающегося в этом.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению G-CSF, и может быть использовано для продуцирования G-CSF в клетках Е.coli. Для эффективной продукции белка в клетках Е.coli оптимизируют последовательность ДНК, кодирующую G-CSF.

Изобретение относится к биотехнологии, в частности к генно-инженерному получению белков человека, и может быть использовано для получения эпидермального фактора роста человека (чЭФР) в клетках бактерий в виде гибридного белка с глутатион-3-трансферазой.

Изобретение относится к области генной инженерии, конкретно к созданию мутеинов рецептора фактора роста фибробластов (FGFR), и может быть использовано в медицине. Полипептид мутеина кислотной зоны внеклеточного домена (ECD) рецептора FGFR4 представляет собой химеру кислотной зоны FGFR4 ECD или вариант длинного кислотного бокса FGFR4 и имеет большее количество кислотных остатков в линкерной зоне D1-D2, чем FGFR4 ECD дикого типа.

Изобретение относится к биотехнологии. Описан синтетический, необязательно модифицированный олигонуклеотид длиной 10-30 нуклеотидов или длиной 19-30 нуклеотидов, где модификация выбрана из модифицированного сахарного фрагмента; модифицированной межнуклеотидной связи; модифицированного нуклеотида, а также из их сочетаний.

Изобретение относится к рекомбинантному штамму вируса осповакцины. Охарактеризованный рекомбинантный штамм VV-GMCSF-S-Lact сконструирован на основе штамма Л-ИВП вируса осповакцины, содержащего делеции фрагментов генов вирусной тимидинкиназы и ростового фактора, в районы которых встроены: ген гранулоцитарно-макрофагального колониестимулирующего фактора человека, структура которого соответствует кДНК матричной РНК ГМ-КСФ человека, в центральной части гена вирусной тимидинкиназы; и ген секретируемого лактаптина S-Lact, кодирующий фрагмент каппа-казеина человека 23-134 а.о. с «пришивкой» к его N-концу сигнального пептида ГМ-КСФ, в левом концевом районе вирусного генома. Ген ГМ-КСФ человека экспрессируется под контролем природного промотора P7.5k вируса осповакцины и продуцирует секретируемую форму биологически активного ГМ-КСФ человека в клетках млекопитающих. Ген S-Lact экспрессируется под контролем синтетического промотора VACV Р7.5synth и продуцирует секретируемый онкотоксический белок лактаптин. Представленный штамм обладает адресной онколитической активностью в отношении клеток рака молочной железы человека in vitro и in vivo и депонирован в ГКВ возбудителей вирусных инфекций и риккетсиозов ФБУН ГНЦ ВБ «Вектор» под номером V-690. 6 ил., 1 табл., 5 пр.

Наверх