Набор последовательностей нуклеотидов для медицинской технологии детекции наиболее частых в россии делеций гена dmd методом мультиплексного пцр/пдаф анализа

Изобретение относится к области биотехнологии, конкретно к молекулярной биологии и генетике. Заявлен набор последовательностей нуклеотидов, который может быть использован для диагностики частых у жителей РФ делеций гена DMD, ответственного за мышечную дистрофию Дюшена/Беккера, исходя из частот мутаций среди пациентов - жителей Российской Федерации. Изобретение позволяет провести эффективную диагностику делеций, затрагивающих промоторную область; 3, 4, 6, 8, 13, 17, 19, 32 42, 43, 44, 45, 47, 48, 50, 51, 52, 53, 60 экзоны гена DMD в гемизиготном состоянии. 1 ил.

 

Изобретение относится к области медицины и биотехнологии, конкретно к молекулярной биологии и генетике.

Миодистрофия Дюшенна (МДД) - наследственное заболевание, которое начинается в возрасте 2-5 лет и характеризуется прогрессирующей мышечной слабостью, атрофией и псевдогипертрофией проксимальных мышц, нередко сопровождается кардиомиопатиями и нарушением интеллекта. На ранних этапах заболевания наблюдается повышенная утомляемость при ходьбе, изменение походки («утиная походка»). При этом происходит постепенная деградация мышечных тканей. 95% больных перестают ходить в возрасте 8-12 лет. В возрасте 18-20 лет больные, как правило, умирают, часто от дыхательной недостаточности. Выделяют аллельную МДД форму - мышечную дистрофию Беккера (МДБ), которая характеризуется сходными клиническими проявлениями, более поздним началом (примерно в 10-16 лет) и более мягким течением. Такие больные часто сохраняют способность ходить до 20 лет, а некоторые - до 50-60 лет, хотя в патологический процесс вовлечены те же мышцы, что и при МДД. Продолжительность жизни таких больных сокращена незначительно (Boland BJ, Silbert PL, Groover RV et al. Skeletal, cardiac, and smooth muscle failure in Duchenne muscular dystrophy. Pediatr Neurol. 1996 Jan; 14(1): 7-12. PubMed PMID: 8652023.).

Мышечная дистрофия Дюшена (МДД) встречается приблизительно у одного из 2500-4000 новорожденных мальчиков. Точная частота мышечной дистрофии Беккера до сих пор не определена ( S, Kavaslar GN, E, et al. Deletion pattern in the dystrophin gene in Turks and a comparison with Europeans and Indians. Ann Hum Genet. 2000 Jan; 64 (Pt 1): 33-40. PubMed PMID: 11388892; Shomrat R, Gluck E, Legum C, Shiloh Y. Relatively low proportion of dystrophin gene deletions in Israeli Duchenne and Becker muscular dystrophy patients. Am J Med Genet. 1994 Feb 15; 49(4): 369-73. PubMed PMID: 8160727.)

Биохимическим маркером заболевания является повышенный (в 50-200) раз уровень креатинфосфокиназы (КФК) в крови. У носительниц поврежденного гена уровень КФК в среднем также несколько повышен.

Тип наследования мышечной дистрофии Дюшена - Х-сцепленный рецессивный, т.е. им страдают почти исключительно мальчики, женщины же с поврежденным геном в одной из Х-хромосом являются носительницами МДД. Приблизительно в 2/3 случаев сын получает хромосому с повреждением от матери-носительницы, в остальных случаях заболевание возникает в результате мутации de novo в половых клетках матери либо в предшественниках этих клеток (Caskey СТ, Nussbaum RL, Cohan LC, Pollack L. Sporadic occurrence of Duchenne muscular dystrophy: evidence for new mutation. Clin Genet. 1980 Nov; 18(5): 329-41. PubMed PMID: 7460369.) Ген DMD, ответственный за прогрессирующую мышечную дистрофию Дюшена/Беккера (МДД/МДБ), находится в локусе Хр21.2, имеет размер 2,6 млн п.н. и состоит из 79 экзонов. В 70% случаев мутации, приводящие к МДД/МДБ, представляют собой протяженные делеции (от одного до нескольких десятков экзонов), в 20% случаев - точковые мутации и в 10% случаев - дупликации. Из-за наличия так называемых «горячих участков» делеций амплификация 19 экзонов и промоторной области гена DMD позволяет выявлять примерно 90% всех крупных делеций. Поиск точковых мутаций затруднен из-за большого размера гена и отсутствия мажорных мутаций (Tuffery-Giraud S, С, Leturcq F, et al. Genotype-phenotype analysis in 2,405 patients with a dystrophinopathy using the UMD-DMD database: a model of nationwide knowledgebase. Hum Mutat. 2009 Jun; 30(6): 934-45. doi: 10.1002/humu.20976. PubMed PMID: 19367636).

Наличие любого типа мутаций (делеции/дупликации в одном или нескольких экзонах, «точковые» мутации) является молекулярно-генетическим подтверждением клинического диагноза миодистрофии Дюшена/Беккера и позволяет проводить дородовую диагностику в данной семье.

На сегодняшний день для детекции делеций гена DMD у больных мышечными дистрофиями Дюшена/Беккера применяются следующие методики. Метод мультиплексной проба-зависимой лигазной реакции (Janssen В, Hartmann С, Scholz V et al. MLPA analysis for the detection of deletions, duplications and complex rearrangements in the dystrophin gene: potential and pitfalls. Neurogenetics. 2005 Feb; 6(1): 29-35. Epub 2005 Jan 18. PubMed PMID: 15655674) Достоинствами данного метода является его высокая точность, возможность детектировать не только делеций, но и дупликации гена дистрофина, возможность определения мутации в гетерозиготном состоянии. Основными недостатками данного метода являются трудоемкость анализа, высокая стоимость исследования, необходимость наличия дорогостоящего оборудования (генетического анализатора - секвенатора) для проведения исследования, высокие требования к качеству биологического материала для анализа.

ПЦР в реальном времени (Zhang Т, Liu S, Wei Т. et al. Development of a comprehensive real-time PCR assay for dystrophin gene analysis and prenatal diagnosis of Chinese families. Clin Chim Acta. 2013 Sep 3; 424: 33-8. doi: 10.1016/j.cca.2013.05.006. Epub 2013 May 13. PubMed PMID: 23680072.)

Достоинством данного метода является теоретическая возможность детектировать не только делеций, но и дупликации гена DMD, а также возможность выявления делеций в гетерозиготном состоянии. К недостаткам относится низкая точность исследования, относительно высокая стоимость и трудоемкость анализа, необходимость наличия дорогостоящей аппаратуры.

Задачей заявляемого изобретения является создание оптимального набора последовательностей олигонуклеотидов для анализа гемизиготных делеций гена DMD, ответственного за мышечные дистрофии Дюшена/Беккера исходя из частот делеций различных участков гена среди пациентов в Российской Федерации.

Задача решается путем создания оптимального набора последовательностей олигонуклеотидов для детекции делеций любого из следующих фрагментов гена DMD либо их совокупности: промоторной области; 3, 4, 6, 8, 13, 17, 19, 32, 42, 43, 44, 45, 47, 48, 50, 51, 52, 53, 60 экзонов.

Техническим результатом заявленного изобретения является создание оптимального набора последовательностей олигонуклеотидов для детекции делеций любог, из следующих фрагментов гена DMD либо их совокупности: промоторной области; 3, 4, 6, 8, 13, 17, 19, 32 42, 43, 44, 45, 47, 48, 50, 51, 52, 53, 60 экзонов с использованием мультиплексной полимеразной цепной реакции (ПЦР) с визуализацией результата методом электрофореза в полиакриамидном геле.

Технический результат достигается подбором оптимального набора последовательностей олигонуклеотидов для мультиплексной ПЦР промоторной области; 3, 4, 6, 8, 13, 17, 19, 32 42, 43, 44, 45, 47, 48, 50, 51, 52, 53, 60 экзонов гена DMD, имеющих следующий нуклеотидный состав:

SEQ ID NO 1 5'-TTGAATACATTGGTTAAATCCCAACATG-3'

SEQ ID NO 2 5'-CCTGAATAAAGTCTTCCTTACCACAC-3'

SEQ ID NO 3 5'-TCATCCATCATCTTCGGCAGATTAA-3'

SEQ ID NO 4 5'-CAGGCGGTAGAGTATGCCAAATGAAAATCA-3'

SEQ ID NO 5 5'-GAAATTGGCTCTTTAGCTTGTGTTTC-3'

SEQ ID NO 6 5'-GGAGAGTAAAGTGATTGGTGGAAAATC-3'

SEQ ID NO 7 5'-GAACATGTCAAAGTCACTGGACTTCATGG-3'

SEQ ID NO 8 5'-ATATATGTGTTACCTACCCTTGTCGGTCC-3'

SEQ ID NO 9 5'-CTTTCTTTGCCAGTACAACTGCATGTG-3'

SEQ ID NO 10 5'-CATTCCTATTAGATCTGTCGCCCTAC-3'

SEQ ID NO 11 5'-CTTGATCCATATGCTTTTACCTGCA-3'

SEQ ID NO 12 5'-TCCATCACCCTTCAGAACCTGATCT-3'

SEQ ID NO 13 5'-TTGAAAGAATTCAGAATCAGTGGGATG-3'

SEQ ID NO 14 5'-CTTGGTTTCTGTGATTTTCTTTTGGATTG-3'

SEQ ID NO 15 5'-TTGTCGGTCTCCTGCTGGTCAGTG-3'

SEQ ID NO 16 5'-CAAAGCCCTCACTCAAACATGAAGC-3'

SEQ ID NO 17 5'-AGGAGAAATTGCGCCTCTGAAAGAGAACG-3'

SEQ ID NO 18 5'-CTGCAGAAGCTTCCATCTGGTGTTCAGG-3'

SEQ ID NO 19 5'-AATGCAGGATTTGGAACAGAGGCGTCC-3'

SEQ ID NO 20 5'-TTCGATCCGTAATGATTGTTCTAGCCTC-3'

SEQ ID NO 21 5'-TTCTACCACATCCCATTTTCTTCCA-3'

SEQ ID NO 22 5'-GATGGCAAAAGTGTTGAGAAAAAGTC-3'

SEQ ID NO 23 5'-GACTTTCGATGTTGAGATTACTTTCCC-3'

SEQ ID NO 24 5'-AAGCTTGAGATGCTCTCACCTTTTCC-3'

SEQ ID NO 25 5'-GTCCTTTACACACTTTACCTGTTGAG-3'

SEQ ID NO 26 5'-GGCCTCATTCTCATGTTCTAATTA-3'

SEQ ID NO 27 5'-CACCAAATGGATTAAGATGTTCATGAAT-3'

SEQ ID NO 28 5'-TCTCTCTCACCCAGTCATCACTTCATAG-3'

SEQ ID NO 29 5'-AATAGGAGTACCTGAGATGTAGCAGAAAT-3'

SEQ ID NO 30 5'-CTGACCTTAAGTTGTTCTTCCAAAGCAG-3'

SEQ ID NO 31 5'-CCACATGTAGGTCAAAAATGTAATGAA-3'

SEQ ID NO 32 5'-GTCTCAGTAATCTTCTTACCTATGACTATGG-3'

SEQ ID NO 33 5'- CGTTGTTGCATTTGTCTGTTTCAGTTAC-3'

SEQ ID NO 34 5'-GTCTAACCTTTATCCACTGGAGATTTG-3'

SEQ ID NO 35 5'-GGAAACCAACTTGAGAGAGAAGGCGGGT-3'

SEQ ID NO 36 5'-GTAATTGCCTCCCAGATCTGAGTCCTGTAG-3'

SEQ ID NO 37 5'-CACACTGTCCGTGAAGAAACGATGATG-3'

SEQ ID NO 38 5'-TTAGCACAGAGGTCAGGAGCATTGAG-3'

SEQ ID NO 39 5'-ATGTCTCCATGAAGTTTCGATTATTCC-3'

SEQ ID NO 40 5'-CACACTCTTTGTTTCCAATGCAGGC-3'.

На первом этапе на основе нуклеотидной последовательности гена DMD (NCBI NM_004006.2) таким образом, чтобы продукты амплификации имели разницу длин, достаточную для детекции в ПААГ.

Изобретение поясняется фигурой. На фигуре представлены результаты электрофоретического разделения продуктов двух мультиплексных ПЦР. В случае отсутствия в образцах ДНК делеций промоторной области; 3, 4, 6, 8, 13, 17, 19, 32 42, 43, 44, 45, 47, 48, 50, 51, 52, 53, 60 экзонов гена DMD в гемизиготном состоянии на электрофорезе наблюдаются по 10 полос в каждом из мультиплексов. В мультиплексе 1 наблюдаются полосы длинами 506-410-388-357-307-268-212-196-139-113 пар нуклеотидов, соответствующие продуктам амплификации последовательности экзонов 48-3-51-43-45-44-53-4-60-52 гена DMD. В мультиплексе 2 наблюдаются полосы длинами 459-416-360-271-238-202-181-168-155-122 пар нуклеотидов, соответствующие продуктам амплификации последовательности экзонов 19-17-8-50-13-6-47-промотерной области-42-32 гена DMD. При наличии делеций полосы, соответствующие делетированным фрагментам гена, отсутствуют.

Для проведения молекулярно-генетического исследования ДНК выделяется из лимфоцитов периферической крови человека с использованием набора реактивов выделения DNA Prep100 (DIAtom™) по протоколу производителя. Для приготовления растворов, необходимых для проведения ПЦР, использовались импортные реагенты высокой степени очистки. Последовательности олигонуклеотидных праймеров были синтезированы ЗАО «Евроген», г. Москва. Амплификацию всех исследуемых фрагментов ДНК проводили методом ПЦР на программируемом термоциклере МС2 фирмы «ДНК-технология» (Россия) в двух пробирках по десять соответствующих фрагментов в каждой из пробирок в объеме 25 мкл реакционной смеси следующего состава: 20-100 нг геномной ДНК; по 0.25 мкМ каждого оригинального олигопраймера (SEQ ID NO: 1-3); по 200 мкМ каждого нуклеозидтрифосфата; 1,0 единица активности ДНК-полимеразы Biotaq («БиоМастер»); буфер для ПЦР (67 мM Tris-HCl; 16.6 мM (NH4)2SO4; 0.01% Twin-20; pH 8.8); 6,0 мM MgCl2; 20-30 мкл минерального масла.

Параметры ПЦР были следующие: денатурация двухцепочечной ДНК при t=95°C в течении 5 минут, далее 30 циклов полимеразной цепной реакции t=94°C -45 секунд, t=60°C - 45 секунд, t=72°C - 45 секунд, окончательная элонгация при t=72°C в течение 7 минут.

Визуализацию результатов ПЦР производили в 8% геле с соотношением акриламида (АА) и бисакриламида (БА) 29:1. Для заливки 8% ПААГ готовили раствор следующего состава: 13,3 мл 30%-ного раствора АА и БА; 5 мл 10×ТВЕ; 31,7 мл дистиллированной воды. Непосредственно перед заливкой геля в раствор добавляли 400 мкл 10%-ного персульфата амония и 48 мкл ТЕМЕД. В качестве электрофорезного буфера использовали 1×TBE. Проводили префорез в течение 20 мин. Пробы для нанесения на гель готовились следующим образом: 10 мкл смеси после ПЦР-реакции смешивали с 2 мкл буфера для нанесения. Состав буфера для нанесения проб: 25% бромфенолового синего; 25% ксилолцианола; 30% глицерина; 20% дистилированной воды. Проводили электрофорез при 15-18 В/см в течение 2 часов. В качестве маркера молекулярного веса использовали ДНК фага λ, рестрицированную PstI.

После разделения фрагментов гель окрашивали в растворе бромистого этидия (0,1 мкг/мл в 1×TBE) в течение 20 минут, промывали водой. Результаты исследования регистрировались на гель-документирующей системе GelDoc® 2000.

Таким образом, представленный материал показывает, что предлагаемый способ позволяет эффективно детектировать делеций любого, из следующих фрагментов гена DMD либо их совокупности: промоторной области; 3, 4, 6, 8, 13, 17, 19, 32 42, 43, 44, 45, 47, 48, 50, 51, 52, 53, 60 экзонов в гемизиготном состоянии которые встречаются у 60% российских больных мышечной дистрофией Дюшена/Беккера. Применение данного изобретения позволяет оптимизировать молекулярно-генетическую диагностику мышечной дистрофии Дюшена/Беккера, позволяет проводить высокоинформативную диагностику на биологическом материале низкого качества, например пятнах крови. Низкая себестоимость и простота исследования позволяют применять данный способ детекции практически в любой ПЦР-лаборатории с минимальным набором оборудования и реактивов.

ПЕРЕЧЕНЬ НУКЛЕОТИДОВ

SEQ ID NO 1 5'-TTGAATACATTGGTTAAATCCCAACATG-3'

SEQ ID NO 2 5'-CCTGAATAAAGTCTTCCTTACCACAC-3'

SEQ ID NO 3 5'-TCATCCATCATCTTCGGCAGATTAA-3'

SEQ ID NO 4 5'-CAGGCGGTAGAGTATGCCAAATGAAAATCA-3'

SEQ ID NO 5 5'-GAAATTGGCTCTTTAGCTTGTGTTTC-3'

SEQ ID NO 6 5'-GGAGAGTAAAGTGATTGGTGGAAAATC-3'

SEQ ID NO 7 5'-GAACATGTCAAAGTCACTGGACTTCATGG-3'

SEQ ID NO 8 5'-ATATATGTGTTACCTACCCTTGTCGGTCC-3'

SEQ ID NO 9 5'-CTTTCTTTGCCAGTACAACTGCATGTG-3'

SEQ ID NO 10 5'-CATTCCTATTAGATCTGTCGCCCTAC-3'

SEQ ID NO 11 5'-CTTGATCCATATGCTTTTACCTGCA-3'

SEQ ID NO 12 5'-TCCATCACCCTTCAGAACCTGATCT-3'

SEQ ID NO 13 5'-TTGAAAGAATTCAGAATCAGTGGGATG-3'

SEQ ID NO 14 5'-CTTGGTTTCTGTGATTTTCTTTTGGATTG-3'

SEQ ID NO 15 5'-TTGTCGGTCTCCTGCTGGTCAGTG-3'

SEQ ID NO 16 5'-CAAAGCCCTCACTCAAACATGAAGC-3'

SEQ ID NO 17 5'-AGGAGAAATTGCGCCTCTGAAAGAGAACG-3'

SEQ ID NO 18 5'-CTGCAGAAGCTTCCATCTGGTGTTCAGG-3'

SEQ ID NO 19 5'-AATGCAGGATTTGGAACAGAGGCGTCC-3'

SEQ ID NO 20 5'-TTCGATCCGTAATGATTGTTCTAGCCTC-3'

SEQ ID NO 21 5'-TTCTACCACATCCCATTTTCTTCCA-3'

SEQ ID NO 22 5'-GATGGCAAAAGTGTTGAGAAAAAGTC-3'

SEQ ID NO 23 5'-GACTTTCGATGTTGAGATTACTTTCCC-3'

SEQ ID NO 24 5'-AAGCTTGAGATGCTCTCACCTTTTCC-3'

SEQ ID NO 25 5'- GTCCTTTACACACTTTACCTGTTGAG-3'

SEQ ID NO 26 5'-GGCCTCATTCTCATGTTCTAATTA-3'

SEQ ID NO 27 5'-CACCAAATGGATTAAGATGTTCATGAAT-3'

SEQ ID NO 28 5'-TCTCTCTCACCCAGTCATCACTTCATAG-3'

SEQ ID NO 29 5'-AATAGGAGTACCTGAGATGTAGCAGAAAT-3'

SEQ ID NO 30 5'-CTGACCTTAAGTTGTTCTTCCAAAGCAG-3'

SEQ ID NO 31 5'-CCACATGTAGGTCAAAAATGTAATGAA-3'

SEQ ID NO 32 5'-GTCTCAGTAATCTTCTTACCTATGACTATGG-3'

SEQ ID NO 33 5'-CGTTGTTGCATTTGTCTGTTTCAGTTAC-3'

SEQ ID NO 34 5'-GTCTAACCTTTATCCACTGGAGATTTG-3'

SEQ ID NO 35 5'-GGAAACCAACTTGAGAGAGAAGGCGGGT-3'

SEQ ID NO 36 5'-GTAATTGCCTCCCAGATCTGAGTCCTGTAG-3'

SEQ ID NO 37 5'-CACACTGTCCGTGAAGAAACGATGATG-3'

SEQ ID NO 38 5'-TTAGCACAGAGGTCAGGAGCATTGAG-3'

SEQ ID NO 39 5'-ATGTCTCCATGAAGTTTCGATTATTCC-3'

SEQ ID NO 40 5'-CACACTCTTTGTTTCCAATGCAGGC-3'

Набор последовательностей олигонуклеотидов для детекции делеций любого из следующих фрагментов гена DMD либо их совокупности: промоторной области; 3, 4, 6, 8, 13, 17, 19, 32 42, 43, 44, 45, 47, 48, 50, 51, 52, 53, 60 экзонов в гемизиготном состоянии, которые встречаются у 60% российских больных мышечной дистрофией Дюшена/Беккера, состоящий из SEQ ID NO:1 - 40.



 

Похожие патенты:

Изобретение относится к биохимии и области медицинской микробиологии. Описан способ подвидовой дифференциации штаммов возбудителя чумы Yersinia pestis.
Изобретение относится к биохимии. Описан способ выявления контаминации вирусами культуры клеток иммунопероксидазным методом, включающий взаимодействие антигена с мечеными антителами в неинфицированной культуре клеток и учет результатов реакции по интенсивности окрашивания образовавшегося комплекса под микроскопом.

Изобретение относится к биохимии. Описан способ диагностики рака толстой кишки путем определения уровня метилирования промоторной области гена COL1A2, посредством проведения пиросеквенирования, отличающийся тем, что исследуют уровень метилирования CpG динуклеотидов в промоторной области гена COL1A2, и при обнаружении снижения метилирования в опухолевой ткани на 10% и более по сравнению с нормальной тканью, делают вывод о высокой вероятности рака толстой кишки.

Изобретение относится к сельскому хозяйству. Способ увеличения срока годности биоудобрения на основе клубеньковых бактерий основан на использовании технологии лиофилизации бактериальных культур и возможности их последующей регенерации и наращивания на питательных средах непосредственно перед обработкой ими посевного материала, при котором 125 мл вновь наращенной культуры будет достаточно для обработки 20-25 кг посевного материала.

Изобретение относится к области молекулярной биологии и биотехнологии. Изобретение представляет собой набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции (ПЦР) полной кодирующей последовательности гена мембранного протеина системы секреции III типа (TTSS) HrcV возбудителя мелиоидоза.

Изобретение относится к области молекулярной биологии и биотехнологии. Изобретение представляет собой набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции гена ompA/motB, кодирующего поверхностный протеин OmpA/MotB возбудителя мелиоидоза.

Предлагаемый способ относится к фотобиотехнологии, промышленной микробиологии, аквакультуре, экологии, альгологии, биохимии, может быть также использован в пищевой промышленности, животноводстве при производстве кормов, в медицинской и ветеринарной микробиологии.
Изобретение относится к технологии производства биопрепаратов для растениеводства. Изобретение представляет собой способ получения базовой композиции биопрепарата для растениеводства, включающий в себя наработку биомассы гриба Mortierella alpina ВКПМ F-1134, удаление культуральной жидкости, извлечение из мицелия комплекса жирных кислот с преобладанием арахидоновой кислоты, приготовление из него спиртового раствора с введением дополнительных компонентов, где гриб выращивается на поверхности тонкого слоя жидкой питательной среды, инокуляция которой осуществляется до розлива, процесс культивирования длится 18-19 суток, разрушение мицелия осуществляется криодеструкцией и щелочным гидролизом, в конечный продукт добавляется биоразлагаемый детергент, где наработка биомассы происходит на картофельном отваре с добавлением глюкозы и хлорида кальция, наработка биомассы происходит в термостате, биомасса подвергается криодеструкции во влажном состоянии, щелочной гидролиз биомассы проводится при температуре 60°С, стадию щелочного гидролиза совмещают с первым этапом экстракции жирных кислот благодаря использованию раствора гидроксида натрия в 96% этиловом спирте, на втором этапе экстракции жирных кислот в качестве экстрагента используется н-гексан, комплекс жирных кислот после удаления н-гексана перерастворяется в 96% этиловом спирте.
Группа изобретений относится к микробиологии. Предложены жидкая микробиологическая питательная среда и ее применение.

Изобретение относится к биохимии. Описан липополисахарид, антагонист эндотоксинов, продуцируемый штаммом Rhodobacter capsulatus PG, депонированным в ВКМ ИБФМ РАН под номером В-2381 Д, в качестве средства для дифференцировки моноцитоподобных клеток.

Изобретения относятся в целом к микробным инокулянтам. Микробный инокулянт для использования в увеличении роста растений, продуктивности растений и/или качества почвы содержит штаммы двух или более видов бактерий, выбранных из Lactobacillus parafarraginis, Lactobacillus buchneri, Lactobacillus rapi и Lactobacillus zeae. Микробный инокулянт содержит по меньшей мере один бактериальный штамм, выбранный из Lactobacillus parafarraginis Lp18, Lactobacillus buchneri Lb23, Lactobacillus rapi Lr24 и Lactobacillus zeae Lz26. Применение инокулянта в качестве удобрения. Композиция удобрения содержит микробный инокулянт. Применение композиции удобрения. Способ увеличения роста и/или продуктивности растений. Способ улучшения качества почвы. Способ рекультивации деградированной почвы или пастбища. Изобретения позволяют получить удобрения на основе микроорганизмов, которые являются эффективными в обеспечении питательных веществ для роста растений и являются экологически безопасными. 8 н. и 27 з.п. ф-лы, 11 ил., 5 табл., 9 пр.

Изобретение относится к области вирусологии. Предложен состав агарового покрытия для выявления вируса Мачупо. Первичное агаровое покрытие содержит: аминокислотный витаминный комплекс (АВК), раствор Эрла, фетальную телячью сыворотку, 5%-ный раствор бикарбоната натрия, деминерализованную воду, 2,9%-ный раствор 1-глутамина, антибиотики, бактоагар «BacteriologCal» или «Bacto™ Agar». Вторичное агаровое покрытие содержит: аминокислотный витаминный комплекс (АВК), раствор Эрла, фетальную телячью сыворотку, бикарбонат натрия, деминерализованную воду, 0,1%-ный раствор нейтрального красного, бактоагар «Bacteriologi Cal» или « Bacto™ Agar». Изобретение обеспечивает увеличение чувствительности метода выявления вируса Мачупо. 3 табл., 4 пр.
Изобретение относится к сельскому хозяйству. Осуществляют активацию субстратов посредством воспроизведения в субстрате, предназначенном для выращивания растений, ассоциативного симбиоза композиции микробиологических инокулянтов и живой биомассы зеленых микроводорослей, либо сине-зеленых микроводорослей, либо комбинации зеленых и сине-зеленых микроводорослей, обеспечивающего воспроизведение в субстрате процесса кислородно-углеродного цикла аналогично происходящему в условиях естественного почвенного биоценоза. Производят внесение в субстрат композиции микробиологических инокулянтов, питание которых осуществляют за счет внесения в субстрат живой биомассы зеленых микроводорослей, либо сине-зеленых микроводорослей, либо комбинации зеленых и сине-зеленых микроводорослей. Обеспечивается образование, накопление и разложение органических веществ до легкоусваиваемых корневой системой форм. 6 з.п. ф-лы.
Изобретение относится к сельскому хозяйству. Осуществляют обеспечение питания корневой системы растения посредством воспроизведения в субстрате, предназначенном для выращивания растений, ассоциативного симбиоза композиции микробиологических инокулянтов и живой биомассы зеленых микроводорослей, либо сине-зеленых микроводорослей, либо комбинации зеленых и сине-зеленых микроводорослей, обеспечивающего воспроизведение в субстрате процесса кислородно-углеродного цикла аналогично происходящему в условиях естественного почвенного биоценоза. Производят внесение в субстрат композиции микробиологических инокулянтов, питание которых осуществляют за счет внесения в субстрат живой биомассы зеленых микроводорослей, либо сине-зеленых микроводорослей, либо комбинации зеленых и сине-зеленых микроводорослей. Обеспечивается образование, накопление и разложение органических веществ до легкоусваиваемых корневой системой форм. 6 з.п. ф-лы.
Изобретения относятся к экологии. Биологически активный препарат, ускоряющий минерализацию останков, включает смесь спор непатогенных бактерий, принадлежащих к виду Bacillus, причем дополнительно включает компонент, сдерживающий влагу - глинистый нетоксичный минерал, способный разбухать при гидратации в 14-16 раз, питательные вещества, витамины, микроэлементы и источник тепловой активации для поддержания жизнедеятельности непатогенных бактерий в виде пероксида калия K2O2 и/или пероксида натрия Na2O2. Способы ускорения минерализации останков при помощи биологического препарата. Изобретения позволяют ускорить минерализацию останков при низких температурах и при неблагоприятном гидрологическом режиме, а также способствовать оздоровлению окружающей среды. 6 н. и 7 з.п. ф-лы.

Изобретение относится к области биотехнологии, конкретно к бис-Met-гистонам, и может быть использовано в медицине. Молекула нуклеиновой кислоты кодирует полипептид, состоящий из двух остатков метионина в качестве первого и второго N-концевых аминокислотных остатков, соединенных через пептидную связь со зрелым эукариотическим гистоном H1. 3. Полипептид получают путем культивирования клетки-хозяина, трансформированной вектором экспрессии, включающим указанную молекулу нуклеиновой кислоты. Полипептид используют в составе фармацевтической композиции для лечения рака, бактериальных, вирусных или грибковых инфекций. Также полипептид используют в составе композиции для диагностики пациента в отношении наличия ответа на фармацевтическую композицию, содержащую указанный полипептид, или в отношении излечимости с ее помощью. Изобретение позволяет увеличить эффективность рекомбинантной экспрессии и облегчить определение указанного полипептида в присутствии эндогенных гистонов при сохранении биологической активности зрелого эукариотического гистона H1. 3. 12 н. и 4 з.п. ф-лы, 3 ил., 6 табл., 7 пр.

Изобретение относится к области биохимии. Описан способ дифференциации штаммов Yersinia pestis на основной и неосновные подвиды методом ПЦР в режиме реального времени. Указанный способ включает в себя амплификацию исследуемой ДНК при помощи сконструированных праймеров в присутствии флуорисцентных меток FAM и HEX и гасителей флуоресценции RTQ1 и BHQ2. Изобретение расширяет арсенал способов дифференциации штаммов Yersinia pestis. 2 з.п. ф-лы, 2 пр.

Изобретение относится к области биохимии. Описана группа объектов, включающая способ определения бактерии вида Dickeya solani методом петлевой изотермической амплификации (LAMP) и набор праймеров для определения бактерии вида Dickeya solani методом петлевой изотермической амплификации (LAMP). В одном из вариантов изобретения в реакции амплификации участка последовательности целевого гена используют набор олигонуклеотидных праймеров, включающий: праймер FIP, имеющий нуклеотидную последовательность SEQ ID NO: 7, или его гомолог, праймер BIP, имеющий нуклеотидную последовательность SEQ ID NO: 8, или его гомолог, праймер F3, имеющий нуклеотидную последовательность SEQ ID NO: 9, или его гомолог, праймер В3, имеющий нуклеотидную последовательность SEQ ID NO: 10, или его гомолог; причем указанные гомологи праймеров FIP, BIP, F3 и В3 имеют гомологию не менее чем 95% по сравнению с соответствующими нуклеотидными последовательностями SEQ ID NOs: 7, 8, 9 и 10 при условии, что такие гомологичные праймеры могут гибридизоваться с целевым геном infB, кодирующим фактор инициации трансляции IF-2. Изобретение расширяет арсенал средств для определения бактерии вида Dickeya solani. 2 н. и 6 з.п. ф-лы, 3 ил., 2 пр.

Изобретение относится к медицине и биологии, в частности к диагностике, а именно: к ДНК-анализу, и может быть использовано для выявления мутаций резистентности к макролидным антибиотикам у Mycoplasma genitalium и Mycoplasma pneumonia, а именно в позициях 2058/2059 и 2611 23S рРНК. Для детекции мутаций разрабатывают два реверсных праймера для М. pneumoniae: Mpn2611-Rv AAGCAACACTCTTCAATCTTCC(T-BHQ1)А и Mpn2059-Rv3 ATCAATATTATGCTACAGTAAAGCT(T-BHQ1)CAG, а также два реверсных праймера для М. genitalium: Mge2611-Rev AGCAAAGCTCTTCAATCTTCC(T-BHQ1)G и Mge2059-Rv3 ATCAATATTATGCTACAGTAAAGCT(T-BHQ1)CACG. Применение предложенного способа позволяет снизить трудозатраты и время анализа за счет использования технологии ПЦР в режиме реального времени. 2 ил., 3 табл., 2 пр.

Изобретение относится к биотехнологии. Изобретение представляет собой штамм суспензионной культуры клеток растения диоскорея дельтовидная (Dioscorea deltoidea Wall) под обозначением ИФР-ДМ-05-pro №89, депонированный в Российскую коллекцию высших растений при Федеральном государственном бюджетном учреждении науки Институте физиологии растений им. К.А.Тимирязева Российской академии наук (ВРККК BP ИФР РАН), - продуцент протодиосцина. Изобретение позволяет получить суспензионный штамм диоскореи дельтовидной Dioscorea deltoidea Wall - продуцент протодиосцина со стабильными ростовыми параметрами, устойчивым синтезом протодиосцина в процессе промышленного аппаратного культивирования и отсутствием сезонной зависимости его получения. 2 ил.

Изобретение относится к области биотехнологии, конкретно к молекулярной биологии и генетике. Заявлен набор последовательностей нуклеотидов, который может быть использован для диагностики частых у жителей РФ делеций гена DMD, ответственного за мышечную дистрофию ДюшенаБеккера, исходя из частот мутаций среди пациентов - жителей Российской Федерации. Изобретение позволяет провести эффективную диагностику делеций, затрагивающих промоторную область; 3, 4, 6, 8, 13, 17, 19, 32 42, 43, 44, 45, 47, 48, 50, 51, 52, 53, 60 экзоны гена DMD в гемизиготном состоянии. 1 ил.

Наверх