Новые модуляторы и способы их применения



Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения
Новые модуляторы и способы их применения

Владельцы патента RU 2627176:

АббВай Стемсентркс ЭлЭлСи (US)

Изобретение относится к области биохимии. Заявлено антитело, специфически связывающееся с PTK7 (протеинтирозинкиназа 7) человека, а также конъюгат указанного антитела с цитотоксическим агентом. Также предложены нуклеиновые кислоты, кодирующие указанное антитело, и включающие их экспрессионные векторы и клетки-хозяева. Кроме того, предложены способы применения указанного антитела, в том числе в составе конъюгата, для диагностики и лечения рака у субъекта. Изобретение обеспечивает эффективное нацеливание на опухолевые стволовые клетки, что может быть использовано для лечения пациентов, страдающих от широкого спектра злокачественных образований. 16 н. и 36 з.п. ф-лы, 42 ил., 5 табл., 16 пр.

 

ПЕРЕКРЕСТНЫЕ ССЫЛКИ НА ЗАЯВКИ

В данной заявке заявлен приоритет предварительной заявки США 61/444614, поданной 18 февраля 2011 года и заявки PCT под номером PCT/US 2011/050451, поданной 2 сентября 2011 года, каждая из которых включена в данную заявку посредством ссылки во всей полноте.

Перечень последовательностей

Настоящая заявка содержит перечень последовательностей, который был представлен в ASCII формате посредством EFS-Web и включен в данное описание посредством ссылки во всей полноте. Указанная копия ASCII, созданная 26 января, 2012, называется 112304PCT.txt и имеет размер 163049 байт.

Область изобретения

Данная заявка в целом относится к новым композициям и способам их применения в предупреждении, лечении или облегчении гиперпролиферативных расстройств и любого их распространения, повторного проявления, рецидива или метастазов. В широком аспекте настоящее изобретение относится к применению модуляторов протеинтирозинкиназы 7 (PTK7), включая анти-PTK7 антитела и слитые конструкции, для лечения или профилактики опухолевых заболеваний. В особенно предпочтительных воплощениях настоящего изобретения предложено применение таких модуляторов PTK7 для иммунотерапевтического лечения злокачественных образований, включающего снижение частоты появления опухоль-инициирующих клеток.

Предшествующий уровень техники

Дифференцировка стволовых клеток и клеток-предшественников, а также клеточная пролиферация являются нормальными непрерывными процессами, которые действуют совместно для поддержания роста тканей во время органогенеза, а также замены клеток и восстановления большинства тканей в течение жизни всех живых организмов. Решения о дифференцировке и пролиферации часто контролируется многочисленными факторами и сигналами, которые уравновешены так, чтобы поддерживать решения относительно судьбы клеток и архитектуры тканей. Нормальная архитектура ткани в основном сохраняется клетками в ответ на сигналы микроокружения, которые регулируют деление клеток и созревание тканей. Соответственно, клеточная пролиферация и дифференцировка обычно происходит только по мере необходимости для замены поврежденных или умирающих клеток или для роста. К сожалению, нарушение клеточной пролиферации и/или дифференцировки может быть результатом множества факторов, в том числе, например, недостатка или избытка различных химических агентов, участвующих в передаче сигналов, наличия измененного микроокружения, генетических мутаций или любой их комбинации. Нарушение или какое-либо расстройство нормальной клеточной пролиферации и/или дифференцировки может привести к различным заболеваниям или расстройствам, в том числе к гиперпролиферативным расстройствам, таким как рак.

Обычные методы лечения рака включают химиотерапию, лучевую терапию, хирургию, иммунотерапию (например, модификаторы биологического ответа, вакцины или терапевтические средства направленного действия) или их комбинации. К сожалению, слишком многие виды рака не отвечают или минимально отвечают на такие традиционные методы лечения, предоставляя пациентам небольшой выбор. Например, у ряда больных в случае некоторых видов рака обнаруживаются генные мутации, которые делают их нечувствительными, несмотря на общую эффективность выбранной терапии. Кроме того, в зависимости от типа рака, некоторые доступные виды лечения, такие как хирургия, не могут являться реальной альтернативой. Ограничения, присущие существующим терапевтическим средствам, представляющим стандарт лечения, особенно очевидны при попытке лечить пациентов, прошедших предыдущее лечение и имеющих после этого рецидивы. В таких случаях безрезультатные схемы лечения и результирующее ухудшение состояния пациента может содействовать трудноизлечимым опухолям, которые часто проявляются, как относительно агрессивное заболевание, которое в конечном счете оказывается неизлечимым. Несмотря на большие успехи в диагностике и лечении рака на протяжении многих лет, уровень общей выживаемости для многих солидных опухолей остается в значительной степени неизменным из-за неспособности существующих методов лечения предотвратить рецидив, повторное проявление опухоли и метастазы. Таким образом, остается проблема разработки более целенаправленной и эффективной терапии.

Одно из перспективных направлений исследований включает использование терапевтических средств направленного действия для преследования онкогенных "затравочных" клеток, которые, по-видимому, лежат в основе многих видов рака. Исходя из этого, в настоящее время известно, что большинство твердых тканей содержит популяции взрослых, расположенных в тканях, стволовых клеток, образующих дифференцированные клеточные типы, которые составляют большую часть этой ткани. Опухоли, образующиеся в этих тканях, также состоят из гетерогенных популяций клеток, которые также возникают из стволовых клеток, но заметно отличаются по своей общей пролиферации и организации. Хотя все чаще признается, что большинство опухолевых клеток имеют ограниченную способность к пролиферации, меньшая часть популяции раковых клеток (общеизвестная как раковые стволовые клетки или CSC) обладает исключительной способностью активно самообновляться, тем самым наделяя опухоль присущей ей способностью к возобновлению. Более конкретно, гипотеза раковых стволовых клеток предполагает, что существует отдельная подгруппа клеток (то есть CSC) в каждой опухоли (приблизительно 0,1-10%), которая способна неограниченно самообновляться и образовывать опухолевые клетки с постепенным ограничением их репликативной способности в результате дифференцировки в клетки-предшественники опухоли и затем в окончательно дифференцированные опухолевые клетки.

В последние годы становится все более очевидным, что эти CSC (также известные как клетки, поддерживающие опухоль, или TPC) могут быть более резистентными к традиционным химиотерапевтическим агентам или облучению и, таким образом, сохраняться после стандартного клинического лечения, чтобы позже поддерживать рост трудноизлечимых опухолей, вторичных опухолей и содействовать образованию метастазов. В этом отношении раковые стволовые клетки вовлечены в стимулирование миграционного и инвазивного потенциала различных неоплазий. Кроме того, растущие доказательства свидетельствуют о том, что пути, регулирующие органогенез и/или самообновление расположенных в нормальных тканях стволовых клеток, разрегулированы или изменены в CSC, что приводит к непрерывному увеличению количества самообновляющихся раковых клеток и к образованию опухоли. См. в целом AI-Hajj et al., 2004, PMID: 15378087; и Dalerba et al., 2007, PMID: 17548814; каждый из которых включен в настоящее описание во всей полноте посредством ссылки. Таким образом, эффективность традиционных, а также более современных методов лечения посредством направленной доставки, по-видимому, ограничена существованием и/или появлением резистентных раковых клеток, которые способны поддерживать рак, даже вопреки этим разнообразным методам лечения. Huff et al., European Journal of Cancer 42: 1293-1297 (2006) и Zhou et al., Nature Reviews Drug Discovery 8: 806-823 (2009), каждый из которых включен в настоящее описание во всей полноте посредством ссылки. Такие наблюдения подтверждены устойчивой неспособностью традиционных циторедуктивных агентов существенно увеличивать выживаемость пациентов, страдающих от солидных опухолей, а также развитием более тонкого понимания того, как опухоли растут, рецидивируют и метастазируют. Соответственно, в современных стратегиях лечения опухолевых заболеваний признается важность ликвидации, уменьшения, подавления или стимуляции дифференцировки клеток, поддерживающих опухоль, с тем чтобы уменьшить возможность повторного проявления опухоли, метастазов или рецидивов у пациента.

Усилия по разработке таких стратегий включают последние работы с использованием нетрадиционных ксенотрансплантатных (NTX) моделей, в которых образцы первичных человеческих солидных опухолей имплантировали и пассировали исключительно мышам с ослабленным иммунитетом. Такие способы подтверждают существование субпопуляции клеток с уникальной способностью образовывать гетерогенные опухоли и поддерживать их рост в течение неопределенного времени при многих видах раковых заболеваний. Как ранее предполагалось, работа на NTX-моделях подтверждает, что идентифицированные CSC-субпопуляции опухолевых клеток являются более резистентными к циторедуктивным схемам лечения, таким как химиотерапия и лучевая терапия, что может объяснить несоответствие между показателями клинического ответа и общей выживаемостью. Кроме того, применение NTX-моделей в исследовании CSC вызвало фундаментальное изменение в разработке лекарственных средств и в доклинической оценке кандидатов в лекарственные средства, которое может привести к CSC-нацеленной терапии, оказывающей существенное воздействие на повторное проявление опухоли и метастазирование, тем самым повышая выживаемость пациентов. Несмотря на прогресс, главными проблемами являются имеющиеся технические трудности, связанные с обработкой первичной и/или ксенотрансплантатной опухолевой ткани, наряду с отсутствием экспериментальных оснований для характеристики отличительных особенностей CSC и способности к дифференцировке. Таким образом, по-прежнему сохраняется существенная потребность в селективном нацеливании на раковые стволовые клетки и разработке диагностических, профилактических или терапевтических соединений и методов, которые можно использовать в лечении, предупреждении и/или контролировании гиперпролиферативных расстройств.

Краткое изложение сущности изобретения

Эти и другие цели предусмотрены настоящим изобретением, которое в широком смысле относится к способам, соединениям, композициям и изделиям, которые можно использовать в лечении PTK7-ассоциированных расстройств (например, гиперпролиферативных расстройств или опухолевых заболеваний). В связи с этим в настоящем изобретении предлагаются новые модуляторы протеинтирозинкиназы (PTK7), которые эффективно нацеливаются на опухолевые или раковые стволовые клетки и могут быть использованы для лечения пациентов, страдающих от широкого спектра злокачественных образований. Как будет обсуждаться более подробно ниже, в настоящее время имеется семь известных изоформ PTK7 и раскрытые модуляторы предпочтительно содержат один или более из них или ассоциированы с одним или более из них. Кроме того, в некоторых воплощения раскрытые модуляторы PTK7 могут содержать любое соединение, которое распознает, конкурирует, является агонистом, является антагонистом, взаимодействует, связывается или соединяется с полипептидом PTK7 или его геном (или их фрагментом) и модулирует, регулирует, изменяет, меняет или модифицирует воздействие белка PTK7 на один или более физиологических путей. Таким образом, в широком смысле настоящее изобретение относится к выделенным модуляторам PTK7 и их применению. В предпочтительных воплощениях изобретение более конкретно относится к выделенным модуляторам PTK7, содержащим антитела (то есть антитела, которые иммунологически предпочтительно связываются, реагируют или ассоциируют по меньшей мере с одной изоформой PTK7). Кроме того, как подробно рассмотрено ниже, такие модуляторы могут быть использованы для получения фармацевтических композиций, полезных для профилактики, диагностики или лечения пролиферативных расстройств.

В отдельных воплощениях изобретения модуляторы PTK7 могут содержать полипептид PTK7 или его фрагмент либо в выделенной форме, либо слитым, либо соединенным с другими группировками (например, Fc-PTK7, PEG-PTK7 или PTK7, соединенный с группировкой, обеспечивающей направленную доставку). В других выбранных воплощениях модуляторы PTK7 могут содержать антагонисты PTK7, которые в контексте настоящей заявки, означают любую конструкцию или соединение, которое распознает, конкурирует, взаимодействует, связывается или соединяется с PTK7 и нейтрализует, устраняет, уменьшает, сенсибилизирует, перепрограммирует, ингибирует или контролирует рост опухолевых клеток, в том числе опухоль-инициирующих клеток. В предпочтительных воплощениях модуляторы PTK7 по настоящему изобретению содержат анти-PTK7 антитела, или их фрагменты, или их производные, которые, как было неожиданно обнаружено, останавливают, нейтрализуют, снижают, уменьшают, истощают, сдерживают, ослабляют, перепрограммируют, устраняют или иным способом ингибируют способность опухоль-инициирующих клеток размножаться, сохраняться, распространяться, пролиферировать или другим способом содействовать выживанию, повторному проявлению, регенерации и/или метастазированию опухолевых клеток. В особенно предпочтительных воплощениях антитела или иммунореактивные фрагменты могут быть соединены или конъюгированы с одним или более противораковыми агентами (например, с цитотоксическим агентом).

В отдельных воплощениях совместимые модуляторы PTK7 могут содержать антитело, имеющее вариабельную область легкой цепи и вариабельную область тяжелой цепи, где указанная вариабельная область легкой цепи включает аминокислотную последовательность, имеющую по меньшей мере 60%-ную идентичность с аминокислотной последовательностью, выбранной из группы, состоящей из аминокислотных последовательностей, представленных в SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58 и SEQ ID NO: 60 и, где указанная вариабельная область тяжелой цепи содержит аминокислотную последовательность, имеющую по меньшей мере 60%-ную идентичность с аминокислотной последовательностью, выбранной из группы, состоящей из аминокислотных последовательностей, представленных в SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59 и SEQ ID NO: 61.

Безусловно, с учетом настоящего описания специалисты в данной области могут легко идентифицировать CDR, связанные с каждой их вышеупомянутых вариабельных областей тяжелой и легкой цепи и использовать эти CDR для конструирования или изготовления химерных, гуманизированных или CDR-привитых антител без излишнего экспериментирования. Таким образом, в отдельных воплощениях настоящее изобретение относится к анти-PTK7 антителам, содержащим один или более CDR из последовательности вариабельной области, представленной на Фиг. 6А или Фиг. 6Б. В предпочтительных воплощениях такие антитела включают моноклональные антитела, а в более предпочтительных воплощениях включают химерные, CDR-привитые или гуманизированные антитела. Как описано более подробно ниже, другие воплощения включают антитела, конъюгированные или связанные с одним или более цитотоксическими агентами.

Соответственно, в других воплощениях настоящее изобретение включает гуманизированный модулятор PTK7, выбранный из группы, состоящей из hSC6.23, hSC6.24, hSC6.41 и hSC6.58. Другие воплощения относятся к модулятору PTK7, содержащему гуманизированное антитело, где указанное гуманизированное антитело включает вариабельную область легкой цепи и вариабельную область тяжелой цепи, где указанная вариабельная область легкой цепи включает аминокислотную последовательность, имеющую по меньшей мере 60%-ную идентичность с аминокислотной последовательностью, выбранной из группы, состоящей из аминокислотных последовательностей, представленных в SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66 и SEQ ID NO: 68 и, где указанная вариабельная область тяжелой цепи включает аминокислотную последовательность, имеющую по меньшей мере 60%-ную идентичность с аминокислотной последовательностью, выбранной из группы, состоящей из аминокислотных последовательностей, представленных в SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67 и SEQ ID NO: 69.

Как было указано ранее, один аспект настоящего изобретения включает неожиданные ассоциации PTK7 полипептидов с раковыми стволовыми клетками. Таким образом, в некоторых других воплощениях изобретение относится к модулятору PTK7, который снижает частоту появления опухоль-инициирующих клеток при введении субъекту. Предпочтительно уменьшение частоты появления определяют, используя анализ методом серийных разведений in vitro или in vivo. В особенно предпочтительных воплощениях такой анализ может быть выполнен с использованием анализа методом серийных разведений in vivo, включающего трансплантацию живых опухолевых клеток человека мышам с ослабленным иммунитетом. Альтернативно, анализ методом серийных разведений может быть выполнен с использованием анализа методом серийных разведений in vitro, включающего посев живых опухолевых клеток человека in vitro методом серийных разведений в условиях, поддерживающих образование колоний. В любом случае анализ, вычисление или количественное определение снижения частоты появления предпочтительно включает использование статистических параметров распределения Пуассона для обеспечения точного подсчета. Следует иметь в виду, что, хотя такие количественные методы являются предпочтительными, другие, менее трудоемкие методы, такие как проточная цитометрия или иммуногистохимия, также могут быть использованы для получения нужных значений и, соответственно, явным образом рассматриваются как входящие в объем настоящего изобретения. В таких случаях снижение частоты появления можно определить, используя проточный цитометрический анализ или иммуногистохимическое обнаружение поверхностных маркеров опухолевых клеток, которыми, как известно, богаты опухоль-инициирующие клетки.

Таким образом, в другом предпочтительном воплощении настоящее изобретение включает способ лечения PTK7-ассоциированного расстройства, включающий введение терапевтически эффективного количества модулятора PTK7 нуждающемуся в этом субъекту, в результате чего снижается частота появления опухоль-инициирующих клеток. Предпочтительно PTK7-ассоциированное расстройство включает опухолевое расстройство. И опять снижение частоты появления опухоль-инициирующих клеток предпочтительно определяют, используя анализ методом серийных разведений in vitro или in vivo.

В связи с этим следует иметь в виду, что настоящее изобретение основано, по меньшей мере частично, на обнаружении того, что PTK7-иммуногены ассоциированы с клетками, поддерживающими опухоль, (то есть раковыми стволовыми клетками), которые вовлечены в этиологию различных неоплазий. Более конкретно, в настоящей заявке неожиданно продемонстрировано, что введение различных типичных модуляторов PTK7 может опосредовать, снижать, истощать, ингибировать или ликвидировать онкогенную передачу сигналов опухоль-инициирующими клетками (то есть снижать частоту появления опухоль-инициирующих клеток). Эта уменьшенная, либо посредством истощения, нейтрализации, уменьшения, удаления, перепрограммирования или подавления опухоль-инициирующих клеток, либо посредством изменения морфологии опухолевых клеток (например, индуцированной дифференцировки, разрушения ниши), передача сигнала в свою очередь обеспечивает возможность более эффективного лечения PTK7-ассоциированных расстройств посредством ингибирования онкогенеза, поддержания опухоли, увеличения объема и/или метастазирования и ее повторного появления.

Помимо вышеупомянутых ассоциаций с раковыми стволовыми клетками, есть свидетельства, что изоформы PTK7 могут быть вовлечены в ангиогенез, миграцию эндотелиальных клеток и развитие определенные сигнальные каскады развития, которые связаны с онкогенезом (то есть Wnt-пути передачи сигнала). Вмешательство в такие клеточные взаимодействия с использованием новых модуляторов PTK7, описанных здесь, может, таким образом, облегчить или лечить расстройство посредством более чем одного механизма (то есть уменьшения опухоль-инициирующих клеток и нарушения пути передачи онкогенного сигнала) с обеспечением аддитивного или синергичного эффектов. Также в других предпочтительных воплощениях можно использовать клеточную интернализацию PTK7 клеточной поверхности для доставки модулятор-опосредованного противоракового агента. В связи с этим, следует понимать, что настоящее изобретение не ограничено каким-либо конкретным механизмом действия, а охватывает широкое использование раскрытых модуляторов для лечения PTK7-ассоциированных расстройств (в том числе различных неоплазий).

В других аспектах настоящего изобретения используется способность раскрытых модуляторов потенциально разрушать пути онкогенного выживания с одновременным подавлением опухоль-инициирующих клеток. Такие мультиактивные модуляторы PTK7 (например, антагонисты PTK7) могут оказаться особенно эффективными при использовании в комбинации со стандартными противораковыми агентами или циторедуктивными агентами. Соответственно, предпочтительные воплощения настоящего изобретения включают использование раскрытых модуляторов в качестве антиметастатических агентов для поддерживающей терапии после первоначального лечения. Кроме того, два или более антагонистов PTK7 (например, антитела, которые специфически связываются с двумя отдельными эпитопами на PTK7) можно использовать в комбинации в соответствии с идеями настоящего изобретения. Кроме того, как обсуждается более подробно ниже, модуляторы PTK7 по настоящему изобретению по настоящему изобретению можно использовать в конъюгированном или неконъюгированном состоянии и возможно в качестве сенсибилизирующего агента в комбинации с различными химическими или биологическими противораковыми агентами.

Соответственно, другое предпочтительное воплощение настоящего изобретения включает способ сенсибилизации опухоли субъекта к лечению противораковым агентом, включающий стадию введения модулятора PTK7 указанному субъекту. Другие воплощения включают способ уменьшения метастазирования после лечения, включающий введение модулятора PTK7 нуждающемуся в этом субъекту. В особенно предпочтительном аспекте изобретения модулятор PTK7 конкретно приводит к снижению частоты появления опухоль-инициирующих клеток, определенной с использованием in vitro или in vivo анализа методом серийных разведений

В более общем случае предпочтительные воплощения изобретения включают способ лечения PTK7-ассоциированного расстройства у нуждающегося в этом субъекта, включающий стадию введения модулятора PTK7 этому субъекту. В особенно предпочтительных воплощениях модулятор PTK7 соединен (например, конъюгирован) с противораковым агентом. В других воплощениях модулятор PTK7 интернализуется после соединения или связывания с PTK7 на или около поверхности клетки. Кроме того, полезные аспекты настоящего изобретения, включающие любое нарушение путей передачи сигнала и сопутствующие преимущества, могут быть достигнуты независимо от того, демонстрирует опухолевая ткань субъекта повышенный уровень PTK7 или уменьшенные или сниженные уровни PTK7 по сравнению с нормальной прилегающей тканью.

В еще одном аспекте настоящее изобретение включает способ лечения субъекта, страдающего от опухолевого заболевания, включающий стадию введения терапевтически эффективного количества по меньшей мере одного интернализованного модулятора PTK7. Предпочтительные воплощения включают введение интернализованных антительных модуляторов, где, в других выбранных воплощениях, интернализованные антительные модуляторы конъюгированы или соединены с цитотоксическим агентом.

Другие воплощения относятся к способу лечения субъекта, страдающего от PTK7-ассоциированного расстройства, включающему стадию введения терапевтически эффективного количества по меньшей мере одного истощающего модулятора PTK7.

В другом воплощении в настоящем изобретении предлагаются способы поддерживающей терапии, в которых раскрытые эффекторы или модуляторы вводят в течение некоторого периода времени после начальной процедуры (например, химиотерапии, лучевой терапии или хирургического вмешательства), предназначенной для удаления по меньшей мере части опухолевой массы. Такие схемы лечения могут быть введены на протяжении недель, месяцев и даже лет, где модуляторы PTK7 могут действовать профилактически с целью ингибирования метастазирования и/или повторного появления опухоли. В других воплощениях раскрытые модуляторы можно вводить в соответствии с известными циторедуктивными схемами для предупреждения или замедления метастазирования, поддержания опухоли или ее повторного появления.

Кроме того, следует понимать, что модуляторы PTK7 по настоящему изобретению могут быть изготовлены или выбраны так, чтобы взаимодействовать с одной изоформой PTK7 или с несколькими выбранными изоформами (то есть полученными как варианты сплайсинга) белка или, напротив, могут содержать пан-модулятор PTK7, который взаимодействует или связывается с некоторыми или всеми изоформами PTK7 (в настоящее время идентифицировано пять изоформ). Более конкретно, как описано здесь, предпочтительные модуляторы, такие как антитела, могут быть получены и выбраны так, чтобы они взаимодействовали с доменами, представленными единичными вариантами сплайсинга (например, при конкретных соединениях экзонов) или с Ig-доменами, которые сохраняются у многих или у всех изоформ PTK7. Очень важно для настоящего изобретения, что определенные изоформы могут предпочтительно экспрессироваться на TIC и, следовательно, могут служить терапевтическими мишенями для обеспечения селективного снижения частоты появления онкогенных клеток и/или истощения популяций раковых стволовых клеток.

Соответственно, в выбранном воплощении изобретение включает пан-модулятор PTK7. В других отдельных воплощениях изобретение включает модулятор PTK7, который иммуноспецифически соединяется с одним или более вариантами сплайсинга или изоформами. Предпочтительно, варианты сплайсинга могут быть выбраны из группы, состоящей из изоформы a, изоформы b, изоформы с и изоформы d. В других воплощениях настоящее изобретение относится к способу лечения субъекта, нуждающегося в этом, включающему введение терапевтически эффективного количества пан-модулятора PTK7. Другие воплощения относятся к способу лечения субъекта, нуждающегося в этом, включающему введение терапевтически эффективного количества модулятора PTK7, который иммуноспецифически соединяется с одной или более изоформами.

Очевидно, что, помимо терапевтических применений, описанных выше, модуляторы по настоящему изобретению можно использовать для диагностики PTK7-ассоциированных расстройств и, в частности, гиперпролиферативных расстройств. В некоторых воплощениях модулятор можно вводить субъекту и определять или контролировать in vivo. Специалистам в данной области техники понятно, что такие модуляторы могут быть мечеными или соединенными с маркерами или репортерными группами, как описано ниже, и могут быть обнаружены с использованием любого из нескольких стандартных методов (например, MRI (визуализация методом ядерного магнитного резонанса), CAT (компьютерная томография) сканирование, PET (позитронно-эмиссионная томография) сканирование и т.д.).

В других случаях модуляторы можно использовать в диагностических установках in vitro с использованием принятых в данной области операций. Таким образом, предпочтительное воплощение включает способ диагностики гиперпролиферативного расстройства у субъекта, нуждающегося в этом, включающий стадии:

а. получение образца ткани из указанного субъекта;

б. приведение образца ткани в контакт по меньшей мере с одним модулятором PTK7; и

в. обнаружение или количественное определение модулятора PTK7, соединенного с образцом.

Такие способы могут быть легко поняты с учетом настоящей заявки и могут быть легко осуществлены с использованием общедоступной промышленной технологии, такой как автоматические планшет-ридеры, специально предназначенные репортерные системы и т.д. В выбранных воплощениях модулятор PTK7 соединен с клетками, поддерживающими опухоль, присутствующими в образце. В других предпочтительных воплощениях стадия обнаружения и количественного определения включает снижение частоты появления опухоль-инициирующих клеток и их обнаружение. Кроме того, анализ методом серийных разведений может быть проведен, как упоминалось выше, и предпочтительно с использованием статистических параметров распределения Пуассона для обеспечения точного подсчета снижения частоты появления.

Аналогично, в настоящем изобретении также предложены наборы, которые полезны в диагностике и контроле PTK7-ассоциированных расстройств, таких как рак. С этой целью в настоящем изобретении предпочтительно предложено изделие, полезное для диагностики или лечения PTK7-ассоциированных расстройств, содержащее контейнер, содержащий модулятор PTK7 и инструкции по применению указанного модулятора PTK7 для лечения или диагностики PTK7-ассоциированного расстройства.

В других предпочтительных воплощениях изобретения также используются свойства раскрытых модуляторов как инструмента, полезного для идентификации, выделения, разделения или обогащения популяций или субпопуляций опухоль-инициирующих клеток посредством таких методов, как проточный цитометрический анализ, сортировка флуоресцентно-активированных клеток (FACS) или лазерное отделение.

Таким образом, другое предпочтительное воплощение настоящего изобретения направлено на способ идентификации, выделения, разделения или обогащения популяции опухоль-инициирующих клеток, включающий стадию приведения указанных опухоль-инициирующих клеток в контакт с модулятором PTK7.

Вышеизложенное представляет собой краткое изложение сущности изобретения и, таким образом, содержит, по необходимости, упрощения, обобщения и опускания деталей; следовательно, специалистам в данной области техники будет понятно, что краткое изложение является лишь иллюстративным и не предназначено являться каким-либо ограничением. Другие аспекты, характеристики и преимущества способов, композиций и/или устройств и/или других объектов, описанных здесь, станут очевидными из изложенного здесь руководства. Краткое изложение представлено для того, чтобы изложить в упрощенной форме ряд концепций, которые дополнительно описаны ниже в Подробном описании изобретения. Это краткое изложение не предназначено для определения ключевых или существенных признаков заявленного изобретения и не предназначено для использования в качества помощи для определении объема заявленного изобретения

Краткое описание графических материалов

На Фиг. 1А-В показаны, соответственно, последовательность нуклеиновой кислоты, кодирующая человеческий PTK7 (SEQ ID NO: 1), аминокислотная последовательность типичного варианта PTK7 человека (SEQ ID NO: 2), а на Фиг. 1В показаны выровненные и снабженные условными обозначениями последовательности четырех типичных изоформ PTK7 (SEQ ID NO: 3-6), где подчеркнутый участок на Фиг. 1А представляет собой открытую рамку считывания PTK7-1 открытая рамка считывания, подчеркнутый участок на Фиг. 1Б указывает внеклеточный домен PTK7, как определено здесь, а на Фиг. 1В показано белковое выравнивание четырех известных типичных изоформ белка PTK7 человека, как описано в базе данных генов NCBI (Национальный центр биотехнологической информации США) (учетные номера белков: изоформа a=NP_002812, изоформа b=NP_690619; изоформа c=NP_690620; изоформа d=NP_690621), где на Фиг. 1 В также раскрыты пептидные мотивы "GxGxFGxV," "HRDLxxxN" и "SDVWSxG" как SEQ ID NO: 11-13 соответственно.

На Фиг. 2 показаны графики, представляющие уровни экспрессии генов PTK7 у необработанных (-) и у обработанных иринотеканом (+) мышей при измерении с использованием секвенирования всей последовательности транскриптома популяций, значительно обогащенных клетками-предшественниками опухоли (TProg), и клетками, поддерживающими опухоль (TPC), и неонкогенными клетками (NTG), полученными из подгруппы всех образцов колоректальной опухоли.

На Фиг. 3 представлен график, показывающий относительные уровни генной экспрессии человеческого PTK7 в популяциях, значительно обогащенных клетками-предшественниками опухоли (TProg), и клетками, поддерживающими опухоль (TPC), полученных из мышей, несущих одну из четырех разных нетрадиционных ксенотрансплантатных (NTX) клеточных линий колоректальной опухоли или опухоли поджелудочной железы, и нормализированных относительно популяций, обогащенных неонкогенными клетками (NTG), при измерении с использованием количественной ОТ-ПЦР (полимеразная цепная реакция с обратной транскрипцией).

На Фиг. 4А и 4Б представлены графики, показывающие относительные уровни экспрессии гена человеческого PTK7 при измерении с использованием ОТ-ПЦР во всех образцах колоректальной опухоли от пациентов с I-IV стадией болезни, нормализованных относительно средней экспрессии в нормальной ткани толстой и прямой кишки (Фиг. 4А) или относительно нормальной соседней ткани (Фиг. 4Б).

На Фиг. 5А и 5Б показаны относительные и абсолютные уровни экспрессии генов, соответственно, человеческих генов PTK7 при измерении с помощью ОТ-ПЦР в целых образцах опухоли (серые точки) или сопоставимой NAT (нормальной соседней ткани; белые точки) из пациентов с одним из восемнадцати разных типов солидных опухолей.

На Фиг. 6А и 6Б представлены в табличном виде близлежащие аминокислотные последовательности вариабельных областей тяжелой и легкой цепей ряда мышиных и гуманизированных типичных модуляторов PTK7, выделенных, клонированных и разработанных, как описано в Примерах в данном описании.

На Фиг. 7А-7Д в графической и табличной форме представлены физико-химические характеристики типичных модуляторов PTK7, где на Фиг. 7А показаны характеристики связывания некоторых модуляторов с мышиным и человеческим PTK7, На Фиг. 7Б показаны данные по аффинности, биннингу и перекрестной реакционной способности для выбранных модуляторов, на Фиг. 7В и 7Г показаны сравнительные характеристики связывания выбранного мышиного модулятора и его гуманизированного аналога, а на Фиг. 7Д представлены аффинности связывания выбранных модуляторов с человеческим PTK7 и его мышиным ортологом.

На Фиг. 8А-8Ж показаны различные конструкции PTK7 в соответствии с настоящим изобретением, где на Фиг. 8А-8Е показаны аминокислотные последовательности шести вариантов модулятора PTK7 в форме конструкций Ig-PTK7-ECD, где варьируется участок внеклеточного домена каждой конструкции, а на Фиг. 8Ж схематически изображены семь Ig-доменов внеклеточной области PTK7 вместе с выявленными посредством ELISA участками связывания нескольких модуляторов PTK7, как указано с помощью скобок.

На Фиг. 9А-9Д показаны уровни белка PTK7 в разных лизатах опухоли и в NTX-образцах, где на Фиг. 9А-9Г показаны уровни в лизатах разных опухолей и на разных стадиях заболевания по сравнению с контролями нормальной соседней ткани и на Фиг. 9Д представлены гистограммы, иллюстрирующие окрашивание человеческих нетрадиционных ксенотрансплантатов выбранными модуляторами, где контрольное окрашивание (серый) сравнивали с окрашиванием неопухолевых (пунктирная линия) и предполагаемых раковых стволовых клеточных популяций (непрерывная линия).

На Фиг. 10А-10Д графически показана способность выбранного модулятора по настоящему изобретению интернализоваться при связывании с PTK7 на клеточной поверхности, где на Фиг. 10В показан сдвиг флуоресценции, связанный с типичным модулятором (то есть SC6.10.2, называемым H10 на Фиг. 10В), на Фиг. 10А и 10Б представлены контроли, а на Фиг. 10Г показано, что типичные модуляторы из супернатантов гибридомы могут быть подвергнуты скринингу в отношении интернализации по сравнении с очищенными контролями (SC6.2.35, SC6.10.2 и SC6.25.1, называемыми H2.35, H10.2 и H25.1 соответственно) и на Фиг. 10Д продемонстрирована степень интернализации различных модуляторов (каждая точка на графике представляет отдельный модулятор), где пунктирная линия указывает пороговое значения для фона и число молекул PTK7, которые интернализируются клеткой в ответ на событие связывания, откладывают по оси y.

На Фиг. 11А-11Г графически показана способность раскрытых модуляторов иммуноспецифически опосредовать доставку цитотоксических агентов и содействовать клеточной гибели, где на Фиг. 11А представлено применение трех типичных модуляторов (SC6.2.35, SC6.10.2 и SC6.25.3, называемых Н2.35, Н10.2 и Н25.3, соответственно) в качестве группировок, обеспечивающих направленную прямую доставку, чтобы направлять цитотоксические полезные грузы в клетки, экспрессирующие PTK7, и где на Фиг. 11Б-11Г проиллюстрирована способность четырех дополнительных типичных модуляторов уничтожать три отдельные клеточные линии, где на каждой фигуре нисходящая кривая свидетельствует о гибели клеток в результате интернализации токсина.

Фиг. 12 свидетельствует о способности трех типичных модуляторов PTK7 иммуноспецифически опосредовать доставку цитотоксических агентов и, тем самым, уменьшать жизнеспособность опухолевых клеток в различных NTX-опухолевых клеточных линиях.

На Фиг. 13А-13В показана способность раскрытых модуляторов уменьшать частоту появления клеток, поддерживающих опухоль, и ингибировать их онкогенный потенциал, где на Фиг. 13А и 13Б показано, что модулятор (то есть SC6.2.35 меченный SC6.H2) опосредует доставку цитотоксических агентов, влияющих на жизнеспособность двух отдельных NTX-клеточных популяций рака молочной железы, а на Фиг. 13В показана пониженная онкогенность обработанных клеточных линий при имплантации мышам с ослабленным иммунитетом.

На Фиг. 14 показана способность типичных гуманизированных модуляторов PTK7 по настоящему изобретению эффективно опосредовать иммуноспецифическую доставку и интернализацию цитотоксических агентов в PTK7-экспрессирующие клетки.

Подробное описание изобретения

I. Введение

В то время как настоящее изобретение может быть воплощено во многих разных формах, здесь описаны его конкретные иллюстративные воплощения, которые иллюстрируют принципы изобретения. Следует отметить, что настоящее изобретение не ограничено конкретными проиллюстрированными воплощениями. Кроме того, любые используемые здесь заголовки разделов, предназначены только для организационных целей и не должны быть истолкованы как ограничивающие описываемый объект.

Как уже упоминалось, неожиданно было обнаружено, что экспрессия PTK7 связана с опухолевым ростом и гиперпролиферативными расстройствами и, что такие лиганды представляют собой полезные опухолевые маркеры, которые можно использовать в лечении связанных с этим заболеваний. Более конкретно, было обнаружено, что модуляторы PTK7, такие как описаны здесь, можно с успехом использовать в диагностике, терагнозисе, лечении или предупреждении опухолевых заболеваний у пациентов, нуждающихся в этом. Соответственно, в то время как предпочтительные воплощения изобретения будут подробно рассмотрены ниже, в частности, в контексте раковых стволовых клеток и их взаимодействий с раскрытыми модуляторами, специалистам в данной области понятно, что объем настоящего изобретения не ограничен такими иллюстративными воплощениями. Точнее, настоящее изобретение и прилагаемая формула изобретения в целом и определенно направлены на модуляторы PTK7 и их применение в диагностике, терагнозисе, лечении или предупреждении различных PTK7-ассоциированных или - опосредованных расстройств, в том числе опухолевых или гиперпролиферативных расстройств, независимо от любого конкретного механизма действия или конкретного целевого опухолевого компонента.

Кроме того, следует понимать, что в отличие от многих раскрытий из уровня техники, настоящее изобретение в значительной степени направлено на иммуноспецифические модуляторы различных изоформ PTK7, а не на общие модуляторы протеинтирозинкиназы. То есть, в то время как класс протеинтирозинкиназных рецепторов широко вовлечен в некоторые типы расстройств и обычно является целью терапевтического вмешательства, специфические модуляторы PTK7 до сих пор привлекали меньше внимания.

Частично, это может быть связано с уверенностью в том, что вмешательство в общую PTK-активность (в частности малыми молекулами, которые взаимодействуют с консервативными доменами киназы) являются более эффективными с терапевтической точки зрения, так как избыточность киназы, скорее всего, компенсирует любой специфический антагонизм отдельных членов этого класса. Кроме того, PTK7, по сообщениям, содержит неактивный киназный домен (или псевдокиназный домен), который может препятствовать использованию ее в качестве терапевтической мишени.

В противоположность этому, настоящее изобретение включает применение иммуноспецифических модуляторов, которые предпочтительно взаимодействуют с одной или более изоформами PTK7, для обеспечения терапевтических преимуществ. Как кратко обсуждается выше, в некоторых воплощениях модуляторы по настоящему изобретению могут быть образованы и выбраны так, чтобы соединяться с одной изоформой PTK7, в то время как в других воплощениях выбранные модуляторы могут взаимодействовать с более чем одной изоформой или со всеми общепризнанными изоформами PTK7. В этих последних воплощениях настоящее изобретение может включать модуляторы, которые соединяются или взаимодействуют с более чем одной изоформой PTK7, тем самым обеспечивая неожиданный аддитивный или синергетический эффект, который может обеспечить инактивацию более чем одного пути, опосредованного PTK7.

В общем, как показано в настоящей заявке, раскрытые иммуноспецифические модуляторы PTK7 можно эффективно использовать для нацеливания на онкогенные клетки и их устранения или другого способа выведения из строя онкогенных клеток и лечения PTK7-ассоциированных расстройств (например, неоплазии). При использовании здесь термин "PTK7-ассоциированное расстройство" означает любое расстройство или заболевание (включая пролиферативные расстройства), которое отмечено, диагностировано или идентифицировано с помощью фенотипической аберрации экспрессии PTK7 в течение или на основании этиологии заболевания или расстройства. В этой связи фенотипическая аберрация может, например, включать повышенные или пониженные уровни экспрессии PTK7, аномальную экспрессию PTK7 на некоторых поддающихся определению клеточных популяциях или аномальную экспрессию PTK7 в неподходящей фазе или на неподходящей стадии клеточного цикла.

Кроме общей связи, охарактеризованной непосредственно выше, авторы настоящего изобретения обнаружили до сих пор неизвестную фенотипическую связь между выбранными опухоль-инициирующими клетками (TIC) и PTK7. В связи с этим было установлено, что выбранные TIC экспрессируют повышенные уровни PTK7 по сравнению с нормальными тканями и неонкогенными клетками (NTG), которые вместе составляют большую часть солидной опухоли. Таким образом, изоформы PTK7 содержат ассоциированные с опухолью маркеры (или антигены, или иммуногены) и, как было обнаружено, обеспечивают эффективные агенты для обнаружения и подавления TIC и ассоциированной с ними неоплазии благодаря измененным уровням белков на клеточной поверхности или микроокружению в опухоли. В частности, также было обнаружено, что модуляторы PTK7, в том числе иммунореактивные антагонисты и антитела, которые ассоциируют, связываются или взаимодействуют с белками, эффективно уменьшают частоту опухоль-инициирующих клеток и, следовательно, полезны для устранения, истощения, выведения из строя, уменьшения, содействия дифференцировке или иным образом исключения или ограничения способности этих опухоль-инициирующих клеток находиться в инактивированном состоянии и/или продолжать поддерживать рост опухоли, метастазирование или рецидив у пациента. Как описано более подробно ниже, субпопуляция TIC-опухолевых клеток состоит как из клеток, поддерживающих опухоль (TPC), так и из высокопролиферативных опухолевых клеток-предшественников (TProg).

В свете этих открытий, специалистам в данной области очевидно, что в настоящем изобретении также предлагаются модуляторы PTK7 и их применение в уменьшении частоты опухоль-инициирующих клеток. Как будет подробно обсуждаться ниже, модуляторы PTK7 по изобретению в широком смысле включают любое соединение, которое узнает, вступает с реакцию, конкурирует, выступает как антагонист, взаимодействует, связывается, выступает как агонист или соединяется с PTK7 или PTK7 или их генами. Посредством этих взаимодействий модуляторы PTK7 уменьшают или понижают частоту опухоль-инициирующих клеток. Раскрытые здесь типичные модуляторы содержат нуклеотиды, олигонуклеотиды, полинуклеотиды, пептиды или полипептиды. В некоторых предпочтительных воплощениях выбранные модуляторы содержат антитела к PTK7 или их иммунореактивные фрагменты или производные. Такие антитела могут быть антагонистическими или агонистическими по природе и возможно могут быть конъюгированы или соединены с цитотоксическим агентом. В других воплощениях модуляторы в рамках настоящего изобретения содержат PTK7-конструкцию, содержащую изоформу PTK7 или ее реакционноспособный фрагмент. Следует понимать, что такие конструкции могут содержать слитые белки и могут включать реакционноспособные домены из других полипептидов, таких как иммуноглобулины или модификаторы биологического ответа. В других аспектах модулятор PTK7 содержит совокупность нуклеиновых кислот, оказывающую нужные эффекты на уровне генома. Другие модуляторы, совместимые с данным руководством, будут подробно описаны ниже.

Независимо от выбранной, в конечном счете, формы модулятора, он предпочтительно находится в выделенном и очищенном состоянии перед введением субъекту. В связи с этим, термин "выделенный модулятор PTK7" следует понимать в широком смысле и в соответствии со стандартной фармацевтической практикой как обозначающий любой препарат или композицию, содержащую модулятор в состоянии, по существу не содержащем нежелательных примесей (биологических или иных). Как будет обсуждаться более подробно ниже, эти препараты могут быть очищены и приготовлены в виде необходимого препарата с использованием различных известных в данной области методов. Конечно, следует понимать, что такие выделенные препараты могут быть намеренно изготовлены или скомбинированы с целесообразными инертными или активными ингредиентами для улучшения коммерческих, производственных или терапевтические аспектов готового продукта и получения фармацевтических композиций.

II. Физиология PTK7

Протеинтирозинкиназа (PTK7), также известная как киназа карциномы толстой кишки 4 (CCK4), представляет собой рецепторную тирозинкиназу, первоначально клонированную из нормальных человеческих меланоцитов (Lee et al., Oncogene 8 (12). 1993) и отдельно из ткани карциномы толстой кишки (Mossie et al., Oncogene 11 (10). 1995). Ген PTK7 локализован на 6р21.1-р12.2. Пять сплайс-изоформ человеческого PTK7 были клонированы из кДНК яичек (Jung, Ji et al., Biochim Biophys Acta 1579. 2002). Относительное содержание изоформ относительно друг друга различается между яичками и линиями гепатомы или карциномы толстой кишки, но функциональное значение этих изоформ, если таковое имеется, неизвестно. Биоинформатические анализы позволили предположить, что мыши могут экспрессировать растворимую изоформу Ptk7 из альтернативно сплайсируемых мРНК (Forrest, Taylor et al., Genome Biol 7, 2006). В контексте настоящей заявки, следует понимать, что термины "PTK7" и "CCK4" могут быть использованы взаимозаменяемо и включают варианты сплайсинга, изоформы, видовые ортологи и гомологи человеческого PTK7, если иное не диктуется контекстными ограничениями. Кроме того, следует понимать, что эти термины также могут относиться к любому производному или фрагменту нативной или вариантной формы PTK7, которая содержит эпитоп, с которым модулятор белка PTK7 (например, антитело или иммунореактивный фрагмент) может специфически связываться.

Полноразмерный белок PTK7 представляет собой трансмембранный белок I типа с внеклеточным доменом (ECD) из 674 аминокислот, за которым следует короткий ТМ (трансмембранный) участок и цитоплазматический домен из 345 аминокислот. Полная нуклеиновокислотная последовательность типичной изоформы человеческого PTK7 (то есть вариант транскрипции PTK7-1) имеет учетный номер Genbank NMJ302821 и представлен на Фиг. 1А (SEQ ID NO: 1). Аналогично, полноразмерная типичная аминокислотная последовательность белка PTK7-1 показана на Фиг. 1Б (SEQ ID NO: 2). Следует отметить, что белок PTK7 в SEQ ID NO: 2 отличается от продукта трансляции подчеркнутой последовательности нуклеиновой кислоты SEQ ID NO: 1 (то есть изоформы а, как показано в SEQ ID NO: 3) тем, что в положении 93 на Фиг. 1Б имеется точечная мутация (L→P). Что касается изоформ, то на Фиг. 1В показано аннотированное выравнивание аминокислотных последовательностей четырех типичных изоформ PTK7, как сообщается в Genbank (учетные номера белков: изоформа a=NP_002812, SEQ ID NO: 3; изоформа b=NP_690619, SEQ ID NO: 5; изоформа c=NP_690620, SEQ ID NO: 6; изоформа d=NP_690621, SEQ ID NO: 4). Как ранее упоминалось, последовательность, соответствующая изоформе а, соответствует продукту трансляции открытой рамки считывания варианта 1 PTK7, представленного на Фиг. 1А и является самой длинной из изоформ. Как показано, другие сплайс-изоформы кодируют внеклеточные домены, лишенные различных Igcam доменов, относительно изоформы a. Все изоформы кодируют тот же самый внутриклеточный домен. Консервативные субмотивы в каталитическом домене протеинсерин/тирозинкиназы показаны ниже выравниваний PTK7, как и аннотации изменений в белке PTK7, которые, как полагают, приводят его киназный домен в неактивное состояние (например, изменения в субдоменах I и VII).

В любом случае зрелый полноразмерный PTK7 ECD содержит семь иммуноглобулин-подобных доменов, при этом, как показано на Фиг. 1В, различные сплайс-варианты кодируют изоформы PTK7, которые отличаются структурой своих ECD. Все изоформы содержат цитоплазматический домен с существенной гомологией к домену, обнаруженному в общем классе тирозинкиназ. Однако PTK7 не имеет обнаруживаемой тирозинкиназной активности и, как таковая, принадлежит к подсемейству псевдокиназ, у которых несколько аминокислотных замен в различных консервативных субдоменах киназ, приводят к нарушению связывания с ATP (Kroiher et al. Bioessays 23 (1), 2001). В частности, ключевые остатки в субдоменах I и VII изменены в PTK7 так, что нарушены непосредственные взаимодействия с не подлежащими переносу фосфатами ATP, а также хелатирование кофактора Mg2+, соединяющего эти фосфаты (Hanks et al., Methods Enzymol 200.1991).

Также следует принимать во внимание, что полипептиды PTK7, совместимые с настоящим изобретением, могут находиться в форме "зрелого" белка или могут быть частью более крупного белка, такого как слитый белок. Часто является полезным включать дополнительные аминокислотные последовательности, которые содержат секреторные или лидерные последовательности, пре-, про- или препробелковую последовательность, или последовательность, которая способствует очистке, такую как аффинная метка, например, но без ограничения ими, несколько остатков гистидина, FLAG-метка, HA-метка или myc-метка. Также могут быть использованы дополнительные последовательности, которые могут обеспечить стабильность при рекомбинантном получении. Такие последовательности возможно могут быть удалены, как того требует включение отщепляемой последовательности в качестве дополнительной последовательности или ее части. Таким образом, полипептид PTK7, как определено здесь, может содержать конструкции, слитые со вспомогательными группировками, включающими другие полипептиды. Такие дополнительные последовательности и аффинные метки хорошо известны в данной области и могут быть получены с использованием стандартных биохимических методов.

Заключение о биологическом значении функции PTK7, несмотря на ее неактивный киназный домен, может быть сделано на основании присутствия консервативных ортологов у видов от Hydra через Drosophila до курицы и человека, у каждого из которых, согласно анализу последовательности, прогнозируется отсутствие киназной активности (Kroiher et al., 2001). На основании высокой консервативности специфического мотива TM-домена, связанного со склонностью к спираль-спиральной ассоциации и того факта, что PTK обычно димеризуется в ответ на вхождение в контакт с лигандом, было сделано предположение, что TM-домен может опосредовать димеризацию PTK7 (Kroiher et al., 2001). Более позднее исследование позволило предположить, что TM-домен PTK7 не способствует преимущественной самоассоциации (Kobus et al., Biochemistry 44(5). 2005), но не исключает гетеромерных взаимодействий с TM-доменами других RTK или компонентов сигнального комплекса. Таким образом, предполагается, что псевдокиназный домен PTK7 сам по себе непосредственно не передает сигнал, но может взаимодействовать в качестве каркаса для других молекул в пути передачи сигнала или может рекрутировать другую(ие) тирозинкиназу(ы) (Kroiher et al., 2001).

PTK7 человека не экспрессируется в толстой кишке взрослых людей, хотя она экспрессируется в толстой кишке эмбриона и различных клеточных линиях карциномы толстой кишки (Mossie et al. выше, 1995), а также в метастатическом колоректальном раке (Saha et al., Science 294 (5545) 2001). Другие нормальные ткани и клетки, о которых сообщалось, что они экспрессируют PTK7, включают легкие, щитовидную железу и яичники (Mossie, Jallal et al. 1995), CD4+ ранние Т-клетки, мигрирующие из тимуса (Haines et al., J Exp Med 206 (2) 2009), и нормальные миелоидные предшественники и CD34+CD38- клетки костного мозга (Prebet et al., Blood 116(13). 2010). В отношении раковых тканей, экспрессия PTK7 также была обнаружена в клетках карциномы ободочной кишки (Mossie et al. 1995); в образцах AML (острый миелоидный лейкоз) (Muller-Tidow, et al. Clin Cancer Res 10 (4), 2004); в CD34 - пре-TALL (T-клеточный острый лимфобластный лейкоз) клетках (Shangguan et al., J Proteome Res 7 (5) 2008) и в карциноме желудка (Gorringe et al., Genes Chromosomes Cancer 42 (3), 2005). Интересно, что несмотря на первоначальное клонирование из нормальных меланоцитов, PTK7, как сообщается, была утеряна в метастазирующей меланоме (Easty et al., Int J Cancer 71 (6), 1997). PTK7 также может быть утеряна в некоторых видах рака груди, содержащих делеции хромосомы 6р21 (Piao et al., Genes Chromosomes Cancer 30(2), 2001), хотя экспрессия варьируется в клеточных линиях рака груди (Su et al., J Cancer 1 2010). PTK7 также экспрессируется аденокарциномой легких, где более сильные уровни экспрессии коррелируют с более благоприятным прогнозом для этих опухолей (Endoh et al., J Clin Oncol 22 (5), 2004). Тонкое картирование амплификаций участка 6p12-p21 в остеосаркомах показало, что увеличения числа копий не обязательно приводят к повышенной экспрессии PTK7, как определено с помощью количественной ОТ-ПЦР (Lu et al., Mol Cancer Res 6 (6), 2008).

Лиганд или лиганды PTK7 неизвестны, хотя PTK7 была связана с различными биологическими путями передачи сигнала и процессами развития. Структура иммуноглобулинподобного ECD-домена белка позволяет предположить, что он может быть участником или детектором межклеточного контакта и адгезии. Ортолог PTK7 у Drosophila, ОТК, ассоциируется с плексином в качестве потенциального корецептора для передачи сигнала посредством семафорина при поиске пути аксонами (Winberg et al., Neuron 32 (1), 2001). Недавно было продемонстрировано взаимодействие между плексином А1 и PTK7 у Xenopus (Wagner et al., Biochem Biophys Res Commun 402 (2) 2010), в то время как ортолог PTK7 у курицы, KLG, как было показано, взаимодействует с плексином А1 и Sema6D в комплексе, важном для морфогенеза сердца курицы ((Toyofuku et al., Genes Dev 18 (4). 2004). Растворимый PTK7 (sPTK7) использовали, чтобы показать роль PTK7 в VEGF-индуцированном ангиогенезе, а также в in vitro формировании трубки, миграции и инвазии эндотелиальных клеток человека (Shin et al., Biochem Biophvs Res Commun 371 (4), 2008). Мышиный PTK7 также был связан с эпидермальными процессами заживления ран, для которых требовалась реорганизация актинового цитоскелета и клеточная миграция (Caddy et al., Dev Cell 19 (1), 2010).

Что касается конкретных сигнальных каскадов, то PTK7, по-видимому, является компонентом различных сигнальных путей Wnt, важных для развития (Puppo et al., EMBO Rep 12 (1), 2010). Мыши, не экспрессирующие или экспрессирующие сильно гипоморфную мутацию в Ptk7, умирают перинатально, демонстрируя фенотипы, согласующиеся с ролью PTK7 в пути планарной клеточной полярности (PCP) (Lu et al., Nature 430 (6995), 2004). Аналогично, chuzhoi мыши, содержащие мутантные белки PTK7 с тремя аминокислотными вставками в ECD демонстрируют PCP-дефектные фенотипы (Paudyal, Damrau et al. 2010). Было показано, что мышиная PTK7 генетически взаимодействует с другими PCP-генами, включая Vangl2 (Lu et al., 2004), Celsr1 (Paudyal, Damrau et al. 2010), Scrb1 и Grhl3 (Caddy et al., 2010). Матричная металлопротеиназа мембранного типа 1 (MT1-MMP) расщепляет PTK7 с высвобождением растворимой PTK7 (то есть sPTK7) и дисрегуляция баланса МТ1-ММР активности и продуцирования sPTK7 приводит к дефектам конвергентного растяжения (convergent extension) у рыб данио (zebrafish), что также сопоставимо с ролью PTK7 в PCP-пути (Golubkov et al., J Biol Chem 285 (46), 2010). У Xenopus PTK7 был обнаружен в комплексе с dsh и Wnt-рецептором fz7 в неканоническом сигнальном пути Wnt (Shnitsar et al., Development 135 (24), 2008), поскольку можно было показать, что на взаимодействия между PTK7 и β-катенином динамически влияет на канонический сигнальный путь Wnt в мышиных клетках. (Puppo et al., 2010). Дополнительно, консервативный сайт связывания транскрипционного фактора TCF/LEF в промоторе PTK7 позволяет предположить, что он является Wnt-регулируемый геном и может объяснить активацию PTK7 в некоторых типах колоректального рака, так как в этих опухолях часто нарушен сигнальный путь Wnt (Katoh, Int J Mol Med 20 (3), 2007).

В раковых тканях в дополнение к ее способности модулировать Wnt-пути, описанные выше, PTK, по-видимому, передает пропролиферативные и антиапоптотические сигналы в линии карциномы толстой кишки НСТ116, фенотипы, которых можно реверсировать посредством РНКи (интерференция РНК)-опосредованного нокдауна PTK7 (Meng et al., PLoS One 5 (11), 2010). PTK7 антиапоптотические сигналы придают резистентность к антрациклин-опосредованной гибели клеток в AML бластах, которые можно реверсировать с использованием растворимого белка PTK7-Fc (Prebet et al., 2010). Избыточная экспрессия PTK7 определенными раковыми клетками используется в стратегии направленной доставки даунорубицина в T-ALL клетки в культуре с использованием аптамеров, которые связываются с PTK7 и затем подвергаются интернализации (Xiao et al., Chemistry 14 (6), 2008).

В дополнение к вышеупомянутым характеристикам в настоящем описании продемонстрировано, что экспрессия PTK7 повышена в различных популяциях опухоль-инициирующих клеток. Наряду с сопутствующей активацией PTK7 по меньшей мере в некоторых неонкогенных клетках объемной опухоли, увеличивается вероятность того, что PTK7-опосредованные взаимодействия лиганда с рецептором могут запускать клеточные сигнальные каскады, связанные с пролиферацией, неоангиогенезом и/или метастазированием опухоли. Без связи с какой-либо конкретной теорией считается, что модуляторы PTK7 по настоящему изобретению (особенно антагонистические или нейтрализирующие воплощения) действуют, по меньшей мере частично, путем либо снижения частоты или устранения опухоль-инициирующих клеток, тем самым препятствуя распространению опухоли или ее выживанию способом, отличающимся от традиционных стандартных схем лечения (например, иринотеканом), или через иммунотерапевтическую передачу сигнала или доставку полезной нагрузки, способной убить PTK7-экспрессирующие клетки. Например, снижение активности раковых стволовых клеток посредством антагонизации PTK7 может включать просто стимулирование клеточной пролиферации на фоне химиотерапевтических схем лечения, которые ликвидируют пролиферирующие клетки, или индукцию дифференцировки опухоль-инициирующих клеток таким образом, что их способность к самообновлению (то есть неограниченная пролиферация и поддержание мультипотентности) теряется. Альтернативно, в предпочтительных воплощениях рекрутмент цитотоксических Т-клеток к PTK7-экспрессирующим клеткам или доставка эффективного токсина, конъюгированного с анти-PTK7 антителом, способным к интернализации, может селективно убивать TPC.

II. Клетки, поддерживающие опухоль

В отличие от руководств в уровне техники, в настоящем изобретении предложены модуляторы PTK7, которые особенно полезны для нацеливания на опухоль-инициирующие клетки и особенно на клетки, поддерживающие опухоль, тем самым облегчая лечение, ведение или предупреждение опухолевых заболеваний. Более конкретно, как указано ранее, неожиданно было обнаружено, что специфические субпопуляции опухолевых клеток экспрессируют PTK7 и могут модифицировать локализованную координацию передачи сигналов посредством морфогена, важную для самообновления раковых стволовых клеток и выживаемости клеток. Таким образом, в предпочтительных воплощениях модуляторы PTK7 можно использовать для снижения частоты появления опухоль-инициирующих клеток, в соответствии с настоящим руководством, и, тем самым, облегчения лечения и ведения гиперпролиферативных заболеваний.

При использовании здесь термин "опухоль-инициирующая клетка" (TIC) охватывает как клетки, поддерживающие опухоль (TPC; то есть раковые стволовые клетки или CSC), так и высокопролиферативные клетки-предшественники опухоли (называемые TProg), которые вместе, как правило, составляют уникальную субпопуляцию (то есть 0,1-40%) объема опухоли или массы. В контексте данного описания термины "клетки, поддерживающие опухоль" и "раковые стволовые клетки" или "неопластические стволовые клетки" являются эквивалентными и могут быть использованы здесь взаимозаменяемо. Наоборот, TPC отличаются от TProg тем, что они могут полностью повторять состав опухолевых клеток, существующий в опухоли, и обладают способностью к неограниченному самообновлению, как показано с помощью серийной трансплантации (два или более пассажей у мышей) небольших количеств выделенных клеток. Как будет обсуждаться более подробно ниже, сортировка флуоресцентно-активированных клеток (FACS) с использованием подходящих клеточных поверхностных маркеров представляет собой надежный способ выделения высокообогащенных клеточных субпопуляций (например, с чистотой более 99,5%) благодаря, по меньшей мере частично, своей способности различать одиночные клетки и скопления клеток (то есть дублеты и т.д.). С помощью таких методов было показано, что при трансплантации мышам с ослабленным иммунитетом небольшого количества высокоочищенных клеток TProg, они могут поддерживать рост опухоли в первичном трансплантате. Однако в отличие от очищенных субпопуляций TPC, TProg образовывали опухоли, которые не отражают полностью фенотипическую клеточную гетерогенность родительской опухоли и являются явно неэффективными в возобновлении серийного онкогенеза при последующих трансплантациях. Напротив, субпопуляции TPC полностью восстанавливают клеточную гетерогенность родительских опухолей и могут эффективно инициировать опухоли при серийном выделении и трансплантации. Таким образом, специалистам в данной области понятно, что определяющей разницей между TPC и TProg, хотя они обе могут индуцировать опухоли в первичных трансплантатах, является уникальная способность TPC постоянно поддерживать рост гетерогенной опухоли при серийных трансплантациях с небольшим числом клеток. Другие общие подходы для характеристики TPC включают морфологию и определение клеточных поверхностных маркеров, транскрипционного профиля и реакции на лекарственные средства, хотя экспрессия маркера может меняться в зависимости от условий культивирования и пассажа клеточной линии in vitro.

Соответственно, в контексте настоящего изобретения, клетки, поддерживающие опухоль, аналогично нормальным стволовым клеткам, которые поддерживают клеточную иерархию в нормальной ткани, предпочтительно, определяют по их способности к бесконечному самообновлению при сохранении способности к мультилинейной дифференцировке. Клетки, поддерживающие опухоль, таким образом, способны образовать как онкогенное потомство (то есть опухоль-инициирующие клетки: TPC и TProg), так и неонкогенное (NTG) потомство. При использовании здесь, неонкогенная клетка (NTG) относится к опухолевой клетке, которая происходит из опухоль-инициирующих клеток, но сама по себе не обладает способностью к самообновлению или образованию гетерогенных линий опухолевых клеток, составляющих опухоль. В эксперименте NTG-клетки не способны воспроизводимо образовывать опухоли у мышей, даже при трансплантации избыточных количеств клеток.

Как указано, TProg также относятся к категории опухоль-инициирующих клеток (или TIC) благодаря их ограниченной способности генерировать опухоли у мышей. TProg являются потомством TPC и обычно способны к конечному числу несамообновляющихся клеточных делений. Кроме того, клетки TProg можно дополнительно разделить на ранние клетки-предшественники опухоли (ЕТР) и поздние клетки-предшественники опухоли (LTP), каждые из которых можно отличить по фенотипу (например, клеточным поверхностным маркерам) и разным способностям воссоздавать архитектуру опухолевой клетки. Несмотря на такие технические различия, и ЕТР, и LTP функционально отличаются от TPC тем, что они, как правило, менее способны к серийному воссозданию опухолей при трансплантации небольших количеств клеток и, как правило, не отражают гетерогенность родительской опухоли. Несмотря на вышеуказанные различия, также было показано, что различные популяции TProg могут, в редких случаях, приобретать способность к самообновлению, обычно присущую стволовым клеткам, и сами становятся TPC (или CSC). В любом случае оба типа опухоль-инициирующих клеток, по всей видимости, представлены в массе типичной опухоли одного пациента и подлежат лечению модуляторами, как описано здесь. То есть, описанные композиции, как правило, эффективны в снижении частоты появления или в изменении хемочувствительности таких PTK7-положительных опухоль-инициирующих клеток, независимо от конкретного воплощения или смеси, представленных в опухоли.

В контексте настоящего изобретения TPC являются более онкогенными, относительно более неактивными и часто более химиорезистентными, чем TProg (как ЕТР, так и LTP), NTG-клетки и инфильтрующие опухоль клетки, происходящие не из TPC (например, фибробласты/строма, эндотелиальные и гемопоэтические клетки), которые составляют основной объем опухоли. Учитывая, что обычные способы лечения и схемы лечения в значительной степени были разработаны так, чтобы и уменьшать массу опухолей, и атаковать быстро пролиферирующие клетки, TPC, вероятно, являются более резистентными к обычным терапевтическим средствам и схемам лечения, чем быстрее пролиферирующие TProg и другие клеточные популяции массивных опухолей. Кроме того, TPC часто проявляют другие характеристики, которые делают их относительно химиорезистентными к обычным терапевтическим средствам, такие как повышенная экспрессия транспортеров множественной лекарственной резистентности, усиленные механизмы репарации ДНК и антиапоптотические белки. Эти свойства, каждое из которых вносит вклад в устойчивость TPC к лекарственным средствам, являются главной причиной неудач стандартных онкологических схем лечения в обеспечении длительной пользы для большинства пациентов с поздней стадией неоплазии; то есть не удается адекватно нацелиться и уничтожить те клетки, которые поддерживают постоянный рост опухоли и ее повторное проявление (то есть TPC или CSC).

В отличие от многих вышеупомянутых способов лечения из уровня техники, новые композиции по настоящему изобретению предпочтительно снижают частоту появления опухоль-инициирующих клеток при введении субъекту независимо от формы и конкретной мишени (например, генетический материал, PTK7-антитело или слитая лигандная конструкция) выбранного модулятора. Как отмечалось выше, снижение частоты появления опухоль-инициирующих клеток может происходить в результате а) удаления, истощения, сенсибилизации, подавления или ингибирования опухоль-инициирующих клеток; б) контролирования роста, распространения или повторного появления опухоль-инициирующих клеток; в) нарушения инициации, распространения, сохранения или пролиферации опухоль-инициирующих клеток; или г) препятствования иным способом выживаемости, регенерации и/или метастазированию онкогенных клеток. В некоторых воплощениях снижение частоты появления опухоль-инициирующих клеток происходит в результате изменения одного или более физиологических путей. Изменение пути посредством сокращения или удаления опухоль-инициирующих клеток или модификации их активности (например, индуцированная дифференцировка, нарушение ниши) или иное вмешательство в их способность оказывать воздействия на окружение опухоли или другие клетки, в свою очередь обеспечивает возможность более эффективного лечения PTK7-ассоциированных расстройств путем ингибирования онкогенеза, поддержания опухоли и/или метастазирования и повторного появления.

В число методов, которые можно использовать для оценки такого сокращения частоты появления опухоль-инициирующих клеток, входит анализ методом серийных разведений либо in vitro, либо in vivo, предпочтительно с последующим подсчетом с использованием статистических параметров распределения Пуассона или оценкой частоты появления предварительно установленных определяющих событий, таких как наличие или отсутствие способности генерировать опухоли in vivo. В то время как такой анализ методом серийных разведений является предпочтительным методом подсчета снижения частоты появления опухоль-инициирующих клеток, другие менее требовательные методы также могут быть использованы для эффективного, хотя и немного менее точного, определения нужных значений, и являются полностью совместимые с данным руководством. Таким образом, как очевидно специалистам в данной области, также можно определить снижение значений частоты появления с помощью хорошо известных методов проточной цитометрии или иммуногистохимического анализа. В отношении всех указанных выше способов см., например, Dylla et al. 2008, PMCID: PMC2413402 и Hoey et al. 2009, PMID: 19664991; каждый из которых включен в данную заявку посредством ссылки во всей полноте.

Что касается анализа методом серийных разведений, in vitro подсчет частоты появления опухоль-инициирующих клеток может быть осуществлен путем помещения либо фракционированных, либо нефракционированных опухолевых клеток человека (например, из обработанных и необработанных опухолей соответственно) в ростовые условия in vitro, которые способствуют колониеобразованию. Таким образом, колониеобразующие клетки можно сосчитать с помощью простого подсчета и характеристики колоний, или посредством анализа, состоящего, например, из помещения человеческих опухолевых клеток в планшеты в серийных разведениях и оценки каждой лунки, либо как положительной, либо как отрицательной в отношении образования колоний по меньшей мере через 10 суток после посева. Эксперименты или анализы с серийным разведением in vivo, которые, как правило, являются более точными по их способности определить частоту появления опухоль-инициирующих клеток, включают трансплантацию человеческих опухолевых клеток, либо из необработанного контроля, либо из обработанных клеток, например мышам с ослабленным иммунитетом в серийных разведениях, и последующую оценку каждой мыши либо как положительную, либо как отрицательную в отношении образования опухоли через по меньшей мере 60 суток после трансплантации. Выведение значений частоты появления клеток посредством анализа методом серийных разведений in vitro или in vivo предпочтительно выполняли, применяя статистические параметры распределения Пуассона к известной частоте появления положительных и отрицательных событий, тем самым получая частоту событий, соответствующих определению положительного события; в данном случае образования колонии или опухоли соответственно.

Что касается других методов, совместимых с настоящим изобретением, которые можно использовать для вычисления частоты появления опухоль-инициирующих клеток, наиболее распространенными являются методы количественной проточной цитометрии и метода иммуногистохимического окрашивания. Хотя эти методы не так точны, как анализ методом серийных разведений, описанный непосредственно выше, эти методики гораздо менее трудоемки и обеспечивают приемлемые значения за относительно короткий период времени. Таким образом, следует понимать, что специалист может применять определение профиля маркеров клеточной поверхности с помощью проточной цитометрии с использованием одного или более антител или реагентов, связывающих белки клеточной поверхности, которыми, как известно из уровня техники, богаты опухоль-инициирующие клетки (например, потенциально совместимые маркеры, как описано в Примере 1 ниже) и таким образом измерять уровни TIC в различных образцах. С помощью еще одного совместимого метода специалист в данной области может определить частоту появления TIC in situ (например, в срезе ткани) посредством иммуногистохимии с использованием одного или более антител или реагентов, которые способны связывать белки клеточной поверхности, которыми, как предполагается, отличаются эти клетки.

Используя любой из вышеупомянутых методов, можно затем количественно определить снижения частоты появления TIC (или TPC в них), обеспечиваемую раскрытыми модуляторами PTK7 (в том числе конъюгированными с цитотоксическими агентами) в соответствии с руководством в данной заявке. В некоторых случаях соединения по настоящему изобретению могут снижать частоту появления TIC (с помощью различных механизмов, указанных выше, включая удаление, индуцированную дифференцировку, разрушение ниши, подавление и т.д.) на 10%, 15%, 20%, 25%, 30% или даже на 35%. В других воплощениях снижение частоты появления TIC может составлять около 40%, 45%, 50%, 55%, 60% или 65%. В некоторых воплощениях раскрытые соединения могут снижать частоту появления TIC на 70%, 75%, 80%, 85%, 90% или даже 95%. Конечно, следует понимать, что любое снижение частоты появления TIC вероятно приведет к соответствующему снижению онкогенности, устойчивости, повторного проявления и агрессивности неоплазии.

IV. Модуляторы PTK7

В любом случае настоящее изобретение направлено на применение модуляторов PTK7, в том числе антагонистов PTK7 для диагностики, терагнозиса, лечения и/или профилактики различных расстройств, включая любое из числа PTK7-ассоциированных злокачественных образований. Раскрытые модуляторы можно использовать отдельно или в сочетании с широким спектром противораковых соединений, таких как химиотерапевтические или иммунотерапевтические агенты (например, терапевтические антитела) или модификаторы биологического ответа. В других выбранных воплощениях два или более отдельных модуляторов PTK7 можно использовать в комбинации, чтобы обеспечить усиленные противоопухолевые эффекты или можно использовать для изготовления полиспецифических конструкций.

В некоторых воплощениях модуляторы PTK7 по настоящему изобретению включают нуклеотиды, олигонуклеотиды, полинуклеотиды, рептиды или полипептиды. Еще более предпочтительно, модуляторы включают растворимый PTK7 (sPTK7) или его форму, вариант, производное или фрагмент, включая, например, слитые PTK7-конструкции (например, PTK7-FC, PTK7-нацеленная группировка и т.д.) или PTK7-конъюгаты (например, PTK7-PEG (полиэтиленгликоль), PTK7-цитотоксический агент, PTK7-brm (модификатор биологического ответа), и т.д.). Следует также иметь в виду, что, в других воплощениях, модуляторы PTK7 включают антитела или их иммунореактивные фрагменты или производные. В особенно предпочтительных воплощениях модуляторы по настоящему изобретению включают нейтрализирующие антитела или их производные или их фрагменты. В других воплощениях модуляторы PTK7 могут содержать интернализованные антитела или их фрагменты. В других воплощениях модуляторы PTK7 могут включать истощающие антитела или их фрагменты. Кроме того, как и вышеупомянутые слитые конструкции, эти антительные модуляторы могут быть конъюгированы, связаны или иным образом соединены с выбранными цитотоксическими агентами, полимерами, модификаторами биологического ответа (BRM) и т.п.для обеспечения направленной иммунотерапии с различными (и возможно многочисленными) механизмами действия. Как упоминалось выше, такие антитела могут быть пан-PTK7 антителами и соединяться с двумя или более изоформами PTK7 или иммуноспецифическими антителами, которые селективно взаимодействуют с одной изоформой. В других воплощениях модуляторы могут работать на генетическом уровне и могут содержать такие компоненты, как антисмысловые конструкции, миРНК (малые интерферирующие РНК), микроРНК и т.п.

Кроме того, следует понимать, что раскрытые модуляторы PTK7 могут истощать, подавлять активность, нейтрализовать, устранять или ингибировать рост, размножение или выживаемость опухолевых клеток, в частности TPC, и/или ассоциированную неоплазию посредством различных механизмов, включая агонизм и антагонизм выбранных путей или устранение специфических клеток в зависимости, например, от формы модулятора PTK7, любой присоединенной полезной нагрузки или дозы и способа доставки. Соответственно, в то время как предпочтительные воплощения, раскрытые в данной заявке, направлены на истощение, ингибирование или подавление субпопуляций специфических опухолевых клеток, таких как клетки, поддерживающие опухоль, следует подчеркнуть, что такие воплощения являются только иллюстративными, и ни в каком смысле не ограничивающими. Скорее, как изложено в прилагаемой формуле изобретения, настоящее изобретение в широком смысле направлено на модуляторы PTK7 и их применение в лечении, терапии или профилактике различных PTK7-ассоциированных гиперпролиферативных расстройств независимо от любого конкретного механизма или целевой популяции опухолевых клеток.

В том же смысле раскрытые воплощения настоящего изобретения могут включать один или более антагонистов PTK7, которые соединены с PTK7. В связи с этим следует иметь в виду, что антагонисты PTK7 по настоящему изобретению могут включать любой лиганд, полипептид, пептид, слитый белок, антитело или его иммунологически активный фрагмент или производное, который распознает, вступает во взаимодействие, связывается, объединяется, конкурирует, соединяется или иным образом взаимодействует с белком PTK7 или его фрагментом и устраняет, подавляет активность, уменьшает, ингибирует, препятствует, сдерживает или контролирует рост опухоль-инициирующих клеток или других опухолевых клеток, включая клетки опухолевой массы или NTG. В выбранных воплощениях модуляторы PTK7 включают антагонисты PTK7.

При использовании здесь "антагонист" относится к молекуле, способной нейтрализовать, блокировать, ингибировать, отменять, уменьшать или препятствовать активностям конкретного или специфического белка, включая связывание рецепторов с лигандами или взаимодействие ферментов с субстратами. В более общем смысле антагонисты по изобретению могут включать антитела и их антигенсвязывающие фрагменты или производные, белки, пептиды, гликопротеины, гликопептиды, гликолипиды, полисахариды, олигосахариды, нуклеиновые кислоты, антисмысловые конструкции, миРНК, микроРНК, биоорганические молекулы, пептидомиметики, фармакологические агенты и их метаболиты, последовательности, контролирующие транскрипцию и трансляцию, и тому подобное. Антагонисты также могут включать низкомолекулярные ингибиторы, слитые белки, рецепторные молекулы и производные, которые специфически связываются с белком, тем самым блокируя его связывание с целевым субстратом, антагонистические варианты белка, антисмысловые молекулы, направленные на белок, РНК-аптамеры и рибозимы против белка.

При использовании здесь и применении к двум или более молекулам или соединениям, термины "узнает" или "соединяется" означают реакцию, связывание, специфическое связывание, комбинацию, взаимодействие, соединение, связь, объединение, слияние, поглощение или присоединение, ковалентное или нековалентное, молекул, где одна молекула оказывает эффект на другую молекулу.

Кроме того, как показано в примерах в данной заявке, некоторые модуляторы PTK7 человека могут, в некоторых случаях, перекрестно реагировать с PTK7 из видов, не являющихся человеком (например, мыши). В других случаях типичные модуляторы могут быть специфичными к одной или более изоформам PTK7 человека и не обнаруживают перекрестной реактивности с ортологами PTK7 из других видов. Конечно, в сочетании с идеями данной заявки такие воплощения могут включать пан-PTK7 антитела, которые соединяются с двумя или более изоформами из одного вида или антитела, которые исключительно соединяются с одной изоформой.

В любом случае, как будет обсуждаться более подробно ниже, специалистам в данной области очевидно, что раскрытые модуляторы можно использовать в конъюгированной или неконъюгированной форме. Таким образом, модулятор может быть соединен или конъюгирован (например, ковалентно или нековалентно) с фармацевтически активными соединениями, модификаторами биологического ответа, противораковыми агентами, цитотоксическими или цитостатическими агентами, диагностическими группировками или биосовместимыми модификаторами. В этом отношении следует иметь в виду, что такие конъюгаты могут включать пептиды, полипептиды, белки, слитые белки, молекулы нуклеиновой кислоты, малые молекулы, миметики, синтетические лекарственные препараты, неорганические молекулы, органические молекулы и радиоизотопы. Кроме того, как указано в данном описании, выбранный конъюгат может быть ковалентно или нековалентно связан с модулятором PTK7 в различных молярных соотношениях в зависимости, по меньшей мере частично, от метода, используемого для осуществления конъюгации.

Антитела

а. Обзор

Как уже упоминалось, особенно предпочтительные воплощения настоящего изобретения включают модуляторы PTK7 в форме антител, которые, предпочтительно, соединяются с одной или более изоформами PTK7. Термин "антитело" используется в наиболее широком смысле и конкретно включает синтетические антитела, моноклональные антитела, олигоклональные или поликлональные антитела, мультиклональные антитела, рекомбинантные антитела, интратела, полиспецифические антитела, биспецифические антитела, моновалентные антитела, поливалентные антитела, человеческие антитела, гуманизированные антитела, химерные антитела, CDR-привитые антитела, приматизированные антитела, Fab-фрагменты, P(ab')-фрагменты, одноцепочечные FvFcs (scFvFc), одноцепочечные Fvs (scFv), антиидиотипические (анти-Id) антитела и любые другие иммунологически активные фрагменты антител, при условии, что они проявляют нужную биологическую активность (то есть иммуноспецифическое или иммунопредпочтительное соединение или связывание с PTK7). В более широком смысле, антитела по настоящему изобретению включают иммуноглобулиновые молекулы и иммунологически активные фрагменты иммуноглобулиновых молекул, то есть молекулы, которые содержат антигенсвязывающий сайт, причем эти фрагменты могут быть или могут не быть слитыми с другим иммуноглобулиновым доменом, включая, но не ограничиваясь ими, с Fc-участком или его фрагментом. Кроме того, как описано более подробно в данной заявке, термины "антитело" и "антитела", в частности, включают Fc-варианты, как описано ниже, в том числе полноразмерные антитела и варианты Fc-слияний, содержащие Fc-участки или их фрагменты, возможно содержащие по меньшей мере одну модификацию аминокислотного остатка и слитые с иммунологически активным фрагментом иммуноглобулина.

Как описано более подробно ниже, общие термины "антитело" или "иммуноглобулин" содержат пять различных классов антител, которые можно различить биохимически и, в зависимости от аминокислотной последовательности константного домена их тяжелых цепей, можно легко отнести к соответствующему классу. В силу исторических причин основные классы интактных антител называются IgA, IgD, IgE, IgG и IgM. У человека классы IgG и IgA можно дополнительно разделить на признанные подклассы (изотипы), то есть IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2 в зависимости от структуры и некоторых биохимических свойств. Следует понимать, что изотипы IgG у человека названы в порядке их распространенности в сыворотке, причем наиболее распространенным является IgG1.

Хотя все пять классов антител (то есть IgA, IgD, IgE, IgG и IgM) и все изотипы (то есть IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2), а также их варианты входят в объем настоящего изобретения, предпочтительные воплощения, включающие класс иммуноглобулина IgG обсуждаются более подробно исключительно для иллюстрации. Однако следует понимать, что такое описание просто демонстрирует типичные композиции и способы осуществления настоящего изобретения на практике и никоим образом не ограничивает объем изобретения или прилагаемой формулы изобретения.

В этом отношении человеческие иммуноглобулины IgG содержат две идентичные легкие полипептидные цепи с молекулярной массой приблизительно 23000 дальтон и две идентичные тяжелые цепи с молекулярной массой 53000-70000 в зависимости от изотипа. Константные домены тяжелой цепи, которые соответствуют разным классам антител, обозначены соответствующей строчной греческой буквой α, δ, δ, γ и μ соответственно. Легкие цепи антител из любого вида позвоночных могут быть отнесены к одному из двух четко отличающихся типов, называемых каппа (κ) и лямбда (λ), на основании аминокислотных последовательностей их константных доменов. Специалистам в данной области понятно, что структуры субъединиц и трехмерные конфигурации разных классов иммуноглобулинов хорошо известны.

Четыре цепи соединены дисульфидными связями в Y-конфигурацию, где легкие цепи захватывают в вилку тяжелые цепи, начиная с устья Y и далее через вариабельную область до двух концов Y. Каждая легкая цепь связана с тяжелой цепью одной ковалентной дисульфидной связью, в то время как две дисульфидные связи в шарнирной области соединяют тяжелые цепи. Соответствующие тяжелые и легкие цепи также имеют расположенные на регулярном расстоянии друг от друга внутрицепочечные дисульфидные мостики, число которых может меняться в зависимости от изотипа IgG.

Каждая тяжелая цепь имеет на одном конце вариабельный домен (VH), за которым следует ряд константных доменов. Каждая легкая цепь имеет вариабельный домен на одном конце (VL) и константный домен на другом конце; константный домен легкой цепи выровнен с первым константным доменом тяжелой цепи, и вариабельный домен легкой цепи выровнен с вариабельным доменом тяжелой цепи. В связи с этим следует понимать, что вариабельные домены участков как легкой (VL), так и тяжелой (VH) цепи определяют антигенное распознавание и специфичность к антигену. Напротив, константные домены легкой цепи (CL) и тяжелой цепи (CH1, CH2 или CH3) придают и регулируют важные биологические свойства, такие как секреция, трансплацентарная подвижность, время полужизни в кровотоке, связывание комплемента и тому подобное. Принято, что нумерация доменов константного участка увеличивается по мере удаления от сайта связывания антигена или амино-конца антитела. Таким образом, амино- или N-конец антитела содержит вариабельную область, а карбокси- или С-конец содержит константный участок. Таким образом, домены CH3 и CL фактически включают карбокси-конец тяжелой и легкой цепи соответственно.

Термин "вариабельный" связан с тем, что некоторые участки вариабельных доменов значительно различаются своими последовательностями у иммуноглобулинов и эти горячие точки в значительной степени определяют связывание и специфические характеристик конкретного антитела. Эти гипервариабельные сайты проявляются в трех сегментах, известных как области, определяющие комплементарность (CDR), в вариабельных доменах как легкой цепи, так и тяжелой цепи соответственно. Наиболее консервативные участки вариабельных доменов, фланкирующие CDR, называются каркасными участками (FR). Более конкретно, в природных мономерных IgG-антителах шесть CDR, присутствующих на каждом плече антитела, представляют собой короткие, несоприкасающиеся аминокислотные последовательности, которые специфически располагаются с образованием антигенсвязывающего сайта, когда антитело приобретает свою трехмерную конфигурацию в водной среде.

Каркасные участки, содержащие остатки вариабельных доменов тяжелой и легкой цепи, демонстрируют меньшую межмолекулярную вариабельность аминокислотной последовательности. Скорее, каркасные участки большей частью принимают β-складчатую конформацию, а CDR образуют петли, которые соединяются и в некоторых случаях образуют часть β-складчатой структуры. Таким образом, эти каркасные участки действуют, чтобы сформировать остов, который обеспечивает размещение шести CDR в правильной ориентации посредством межцепочечных нековалентных взаимодействий. Антигенсвязывающий сайт, образованный таким образом расположенными CDR, определяет поверхность, комплементарную эпитопу на иммунореактивном антигене. Эта комплементарная поверхность способствует нековалентному связыванию антитела с эпитопом иммунореактивного антигена. Понятно, что положения и состав CDR могут быть легко определены специалистом в данной области техники с использованием определений, приведенных в данном описании изобретения.

Как описано более подробно ниже, все или часть вариабельных областей тяжелой и легкой цепи могут быть рекомбинированы или сконструированы с использованием стандартных методов рекомбинации и экспрессии с получением эффективных антител. То есть вариабельная область тяжелой или легкой цепи из первого антитела (или любой ее участок) может быть смешана и подобрана к любому выбранному участку вариабельной области тяжелой или легкой цепи из второго антитела. Например, в одном воплощении, целая вариабельная область легкой цепи, содержащая три CDR легкой цепи первого антитела, может быть спарена с целой вариабельной областью тяжелой цепи, содержащей три CDR тяжелой цепи второго антитела, с получением функционального антитела. Кроме того, в других воплощениях отдельные CDR тяжелой и легкой цепи, полученные из различных антител, могут быть смешаны или подобраны с получением нужного антитела, имеющего оптимизированные характеристики. Таким образом, типичное антитело может содержать три CDR легкой цепи из первого антитела, две CDR тяжелой цепи, полученные из второго антитела, и третью CDR тяжелой цепи из третьего антитела.

Более конкретно, в контексте настоящего изобретения следует понимать, что любая из раскрытых CDR тяжелой и легкой цепи, происходящая из аминокислотных последовательностей мышиной вариабельной области, представленная на Фиг. 6А или Фиг. 6Б может быть трансформирована таким образом, чтобы обеспечить оптимизированные анти-PTK7 (например, анти-hPTK7) антитела согласно настоящему руководству. То есть, одна или более CDR, полученных из близлежащих аминокислотных последовательностей вариабельной области легкой цепи, представленных на Фиг. 6А (SEQ ID NO: 20-60, четные номера) или близлежащих аминокислотных последовательностей вариабельной области тяжелой цепи, представленных на Фиг. 6Б (SEQ ID NO: 21-61, нечетные номера) могут быть включены в модулятор PTK7 и, в особенно предпочтительных воплощениях, в CDR-привитое или гуманизированное антитело, которое иммуноспецифически связывается с одной или более изоформами PTK7. Примеры аминокислотных последовательностей вариабельной области легкой (SEQ ID NO: 62-68, четные номера) и тяжелой (SEQ ID NO: 63-69, нечетные номера) цепи таких гуманизированных модуляторов также представлены на Фиг. 6А и 6Б. Взятые вместе эти новые аминокислотные последовательности представляют двадцать один мышиный и четыре гуманизированных типичных модулятора в соответствии с настоящим изобретением. Кроме того, соответствующие нуклеиновокислотные последовательности каждой из двадцати одного типичного мышиного модулятора и четырех гуманизированных модуляторов, представленных на Фиг. 6А и 6Б, включены в перечень последовательностей, прилагаемый к настоящей заявке (SEQ ID NO: 120-169).

В любом случае, номера остатков области, определяющей комплементарность, можно определить по Kabat et al. (1991, NIH Publication 91-3242, National Technical Information Service, Springfield, Va.), в частности остатки 24-34 (CDR1), 50-56 (CDR2) и 89-97 (CDR3) в вариабельном домене легкой цепи и 31-35 (CDR1), 50-65 (CDR2) и 95-102 (CDR3) в вариабельном домене тяжелой цепи. Следует обратить внимание на то, что CDR значительно варьируются от антитела к антителу (и в сущности не проявляют гомологии с консенсусными последовательностями Kabat). Максимальное выравнивание остатков каркаса часто требует вставки спейсерных остатков в системе нумерации, используемой для области Fv. Кроме того, идентичность некоторых отдельных остатков для любого взятого номера положения по Kabat может варьироваться от одной цепи антитела к другой цепи антитела из-за межвидовой или аллельной дивергенции. См. также Chothia et al., J. Mol. Biol. 196: 901-917 (1987); Chothie et al., Nature 342, pp. 877-883 (1989), MacCallum et al., J. Mol. Biol. 262: 732-745 (1996) и S. Dubel, ed., Handbooko of Therapeutic Abtibodies, 3rd ed., WILEY-VCH Verlag GmbH and Co. (2007), где определения включают перекрывание или подмножества аминокислотных остатков при сравнении друг с другом. Каждая из вышеупомянутых работ включена в данную заявку посредством ссылки во всей полноте, и аминокислотные остатки, которые содержат участки связывания или CDR, как определено в каждой из вышеупомянутых ссылок, и которые приведены для сравнения ниже.

Определения СОК

Как обсуждалось здесь, специалист в данной области может легко определить, идентифицировать, установить происхождение и/или пронумеровать CDR по Kabat et al., Chothia et al. или MacCallum et al. для каждой соответствующей последовательности тяжелой и легкой цепи, представленной на Фиг. 6А или Фиг. 6Б. Соответственно, каждая из исследуемых CDR, а также антитела, содержащие CDR, определенные согласно всем таким системам нумерации прямо включены в объем настоящего изобретения. В более широком смысле термин "аминокислотный остаток вариабельной области CDR" включает аминокислоты в CDR, определенные при использовании любого основанного на последовательности или структуре метода, как изложено выше.

При использовании здесь термин "аминокислотные остатки каркасного участка (FR) вариабельной области" относится к аминокислотам каркасного участка цепи Ig. Термин "каркасный участок" или "FR-участок", при использовании здесь, включает аминокислотные остатки, которые являются частью вариабельной области, но не частью CDR (например, с использованием определения CDR по Kabat). Следовательно, каркасный участок вариабельной области является прерывистой последовательностью длиной примерно 100-120 аминокислот, но включает только аминокислоты, расположенные за пределами CDR.

В качестве конкретного примера вариабельной области тяжелой цепи и CDR, определенных по Kabat et al., каркасный участок 1 соответствует домену вариабельной области, содержащему аминокислоты 1-30; каркасный участок 2 соответствует домену вариабельной области, содержащему аминокислоты 36-49; каркасный участок 3 соответствует домену вариабельной области, содержащему аминокислоты 66-94, и каркасный участок 4 соответствует домену вариабельной области от аминокислоты 103 до конца вариабельной области. Каркасные участки легкой цепи аналогично разделены каждой из вариабельных областей CDR легкой цепи. Аналогично, при использовании определения CDR по Chothia et al. (например, CDR-L1 23-34, CDR-L2 50-56, CDR-L3 89-97; CDR-H1 26-32, CDR-H2 50-58, CDR-H3 95-102) или по McCallum et al. границы каркасные участки разделены соответствующими концами CDR, как описано выше.

Учитывая вышеупомянутые структурные соображения, специалистам в данной области понятно, что антитела по настоящему изобретению могут включать любое из ряда функциональных воплощений. В этом отношении, совместимые антитела могут включать любое иммунореактивное антитело (как этот термин определен в данном описании), которое обеспечивает нужный физиологический ответа у субъекта. В то время как любые раскрытые антитела можно использовать в сочетании с идеями настоящего изобретения, определенные воплощения изобретения включают химерные, гуманизированные или человеческие моноклональные антитела или их иммунореактивные фрагменты. Тем не менее, другие воплощения могут, например, включать гомогенные или гетерогенные мультимерные конструкции, Fc-варианты и конъюгированные или измененные посредством гликозилирования антитела. Кроме того, следует понимать, что такие конфигурации не являются взаимоисключающими и, что совместимые отдельные антитела могут включать один или более функциональных аспектов, раскрытых в данной заявке. Например, совместимое антитело может включать одноцепочечное диатело с гуманизированными вариабельными областями или полностью человеческое полноразмерное антитело IgG3 с модификациями Fe, которые меняют профиль гликозилирования для изменения времени полужизни в сыворотке. Другие типичные воплощения очевидны специалистам в данной области и могут быть легко узнаны как входящие в объем изобретения.

б. Получение антител

Хорошо известно и показано в Примерах ниже, что различные животные-хозяева, в том числе кролики, мыши, крысы и т.д., могут быть привиты и использованы для получения антител в соответствии с идеями данной заявки. Известные в данной области адъюванты, которые можно использовать для усиления иммунного ответа, в зависимости от вида привитого животного включают, но не ограничиваются ими, адъювант Фрейнда (полный и неполный), минеральные гели, такие как гидроксид алюминия, поверхностно-активные вещества, такие как лизолецитин, плюроновые полиолы, полианионы, пептиды, масляные эмульсии, гемоцианины фиссурелии, динитрофенол и потенциально полезные адъюванты человека, такие как BCG (бацилла Кальметта-Герена) и Corynebacterium parvum. Такие адъюванты могут защищать антиген от быстрого рассредоточения путем ограничения его в локальном отложении, или они могут содержать вещества, которые стимулируют организмы-хозяева секретировать факторы, хемотаксические для макрофагов и других компонентов иммунной системы. Предпочтительно, при введении полипептида схема иммунизации будет включать два или более введений полипептида, произведенных в течение несколько недель.

После иммунизации животного иммуногеном PTK7 (например, растворимым PTK7 или sPTK7), который может содержать выбранные изоформы и/или пептиды, или живыми клетками или клеточными препаратами, экспрессирующими нужный белок, антитела и/или антителопродуцирующие клетки можно получить из этого животного, используя известные в данной области методы. В некоторых воплощениях поликлональную анти-PTK7 антителосодержащую сыворотку получают посредством обескровливания или умерщвления животного. Сыворотку можно использовать в исследовательских целях в форме, полученной из животного, или, альтернативно, анти-PTK7 антитела могут быть частично или полностью очищены с получением иммуноглобулиновых фракций или гомогенных препаратов антител.

в Моноклональные антитела

В то время как поликлональные антитела могут быть использованы в некоторых аспектах настоящего изобретения, предпочтительные воплощения включают использование PTK7-реакционноспособных моноклональных антител. При использовании здесь, термин "моноклональное антитело" или "mAb" относится к антителу, полученному из популяции по существу гомогенных антител, то есть отдельные антитела, составляющие популяцию, являются идентичными, за исключением возможных мутаций, например естественных мутаций, которые могут присутствовать в незначительных количествах. Таким образом, модификатор "моноклональное" указывает, что антитело по природе не является смесью отдельных антител и может быть использовано вместе с любым типом антитела. В некоторых воплощениях такое моноклональное антитело включает антитело, содержащее полипептидную последовательность, которая связывается или соединяется с PTK7, где PTK7-связывающую полипептидную последовательность получали посредством процесса, включающего селекцию одной связывающей мишень полипептидной последовательности из множества полипептидных последовательностей.

В предпочтительных воплощениях антителопродуцирующие клеточные линии получают из клеток, выделенных из иммунизированного животного. После иммунизации животное умерщвляют и лимфатические узлы и/или В-клетки селезенки иммортализуют хорошо известными в данной области способами, как показано в прилагаемых Примерах. Методы иммортализации клеток включают, без ограничения ими, трансфекцию их онкогенами, инфицирование их онкогенным вирусом и культивирование их в условиях, селетирующих иммортализованные клетки, воздействие на них канцерогенных или мутагенных соединений, слияние их с иммортализованной клеткой, например клеткой миеломы, и инактивацию генов-супрессоров опухолей. При слиянии с клетками миеломы, клетки миеломы предпочтительно не секретируют полипептиды иммуноглобулинов (несекреторная клеточная линия). Как показано в Примерах ниже, иммортализованные клетки можно подвергнуть скринингу с использованием PTK7 (включая выбранные изоформы) или ее иммунореактивного участка. В предпочтительном воплощении первичный скрининг выполняли с использованием иммуноферментного анализа (ELISA) или радиоиммуноанализа.

В общем случае, отдельные моноклональные антитела в соответствии с настоящим изобретением могут быть приготовлены с использованием разнообразных методов, известных в данной области техники, включая гибридомы, рекомбинантные методы, технологии фагового дисплея, дрожжевые библиотеки, трансгенных животных (например, XenoMouse® или HuMAb Mouse®) или их комбинации. Например, моноклональные антитела могут быть получены с использованием метода гибридомы, как в общих чертах описано выше и более подробно в Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., в: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981), каждый из которых включен в данное описание изобретения. Используя описанные протоколы, антитела предпочтительно генерируют у млекопитающих посредством множества подкожных или внутрибрюшинных инъекций соответствующего антигена и адъюванта. Как обсуждалось ранее, эта иммунизация обычно вызывает иммунный ответ, который включает продукцию антигенреактивных антител (которые могут быть полностью человеческими, если иммунизированное животное является трансгенным) из активированных спленоцитов или лимфоцитов. В то время как полученные антитела могут быть собраны из сыворотки животного с получением поликлональных препаратов, обычно более желательно выделить отдельные лимфоциты из селезенки, лимфатических узлов или периферической крови, чтобы получить гомогенные препараты моноклональных антител. Как правило, лимфоциты получают из селезенки и иммортализуют для получения гибридом.

Например, как описано выше, процесс селекции может заключаться в селекции уникального клона из множества клонов, таких как пул гибридомных клонов, фаговых клонов и рекомбинантных ДНК-клонов. Следует понимать, что выбранная PTK7-связывающаяся последовательность может быть дополнительно изменена, например с целью улучшения аффинности к мишени, гуманизации мишеньсвязывающей последовательности, улучшения ее продуцирования в клеточной культуре, снижения ее иммуногенности in vivo, создания полиспецифического антитела и т.д., и что антитело, содержащее измененную мишеньсвязывающую последовательность, также представляет собой моноклональное антитело по данному изобретению. В отличие от препаратов поликлональных антител, которые обычно включают отдельные антитела, направленные против разных детерминант (эпитопов), каждое моноклональное антитело препарата моноклонального антитела направлено против одной детерминанты на антигене. В дополнение к их специфичности, преимуществом препаратов моноклональных антител является то, что они, как правило, не загрязнены другими иммуноглобулинами, которые могут обладать перекрестной реакционной способностью.

г. Химерные антитела

В другом воплощении антитело по изобретению может содержать химерные антитела, полученные из ковалентно связанных сегментов белка из по меньшей мере двух разных видов или типов антител. Следует понимать, что при использовании здесь термин "химерные антитела" относится к конструкциям, в которых часть тяжелой и/или легкой цепи идентична или гомологична соответствующим последовательностям в антителах, происходящих из определенных видов или принадлежащих конкретному классу или подклассу антител, тогда как остальная часть цепи(ей) идентична или гомологична соответствующим последовательностям в антителах, происходящих из других видов или принадлежащих другому классу или подклассу антител, а также к фрагментам таких антител, при условии, что они проявляют нужную биологическую активность (патент США 4816567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984)). В одном типичном воплощении химерное антитело согласно данному изобретению может содержать мышиные аминокислотные последовательности VH и VL и константные участки, происходящие из человека. В других совместимых воплощениях химерное антитело по настоящему изобретению может содержать CDR-привитое или гуманизированное антитело, как описано ниже.

Как правило, целью создания химерного антитела является создание химеры, в которой количество аминокислот от предполагаемого вида является максимальным. Одним примером является CDR-привитое антитело, в котором антитело содержит одну или более областей, определяющих комплементарность (CDR), из конкретных видов или принадлежащих конкретному классу или подклассу антител, в то время как остальная часть цепи(ей) антител(а) является/являются идентичной(ыми) или гомологичной(ыми) соответствующей последовательности антител, происходящих из других видов или принадлежащих другому классу или подклассу антител. Для применения у людей, вариабельную область или выбранные CDR из антитела грызуна часто прививают в антитело человека, заменяя природные вариабельные области или CDR человеческого антитела. Преимуществами этих конструкций, как правило, является обеспечение полной силы модуляторный функций (например, CDC, ADCC и т.д.) при одновременном снижении нежелательных иммунных ответов на антитело у субъекта.

д. Гуманизированные антитела

Гуманизированное антитело аналогично CDR-привитому антителу. Как правило, гуманизированное антитело получают из моноклонального антитела, изначально образованного у животного, не являющегося человеком. При использовании здесь, гуманизированные формы нечеловеческих (например, мышиных) антител представляют собой химерные антитела, которые содержат минимальную последовательность, происходящую из нечеловеческого иммуноглобулина. В одном воплощении гуманизированное антитело представляет собой человеческий иммуноглобулин (реципиентное или акцепторное антитело), в котором остатки из CDR реципиентного антитела замещены остатками из CDR нечеловеческих видов (донорное антитело), таких как мышь, крыса, кролик или примат, не являющийся человеком, имеющих нужную специфичность, аффинность и/или активность.

Как правило, гуманизация антитела включает анализ гомологии последовательностей и канонических структур как донорного, так и реципиентного антитела. В выбранных воплощениях реципиентное антитело может содержать консенсусные последовательности. Чтобы создать консенсусные человеческие каркасы, каркасы из нескольких аминокислотных последовательностей человеческой тяжелой цепи или легкой цепи могут быть выравнены, чтобы идентифицировать консенсусную аминокислотную последовательность. Кроме того, во многих случаях один или более каркасных остатков в вариабельном домене человеческого иммуноглобулина замещены соответствующими нечеловеческими остатками из донорного антитела. Эти каркасные замещения определяют методами, хорошо известными в данной области техники, например путем моделирования взаимодействий CDR и каркасных остатков для идентификации каркасных остатков, важных для связывания антигена, и сравнения последовательности для идентификации необычных каркасных остатков в конкретных положениях. Такие замещения помогают поддерживать подходящую трехмерную конфигурацию привитого(ых) CDR и часто улучшают множество показателей по сравнению с аналогичными конструкциями без замещений в каркасе. Кроме того, гуманизированные антитела могут содержать остатки, которые не встречаются в реципиентном антителе или в донорном антителе. Эти модификации могут быть сделаны, чтобы дополнительно улучшить эффективность антител с использованием хорошо известных методов.

CDR-привитые и гуманизированные антитела описаны, например, в патентах США 6180370, 5693762, 5693761, 5585089 и 5530101. В общем случае, гуманизированное антитело содержит по существу все из по меньшей мере одного и обычно двух вариабельных доменов, где все или по существу все CDR соответствуют CDR нечеловеческого иммуноглобулина, и все или по существу все каркасные участки являются каркасными участками последовательности человеческого иммуноглобулина. Гуманизированное антитело возможно также содержит по меньшей мере часть константного участка иммуноглобулина (Fe), обычно человеческого иммуноглобулина. Более подробно см., например, Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332: 323-329 (1988); и Presta, Curr. Op. Struct. Biol. 2: 593-596 (1992). См. также, например, Vaswani and Hamilton, Ann. Allergy, Asthma & Immunol. 1: 105-115 (1998); Harris, Biochem. Soc. Transactions 23: 1035-1038 (1995); Hurle and Gross, Curr. Op. Biotech. 5: 428-433 (1994); и патенты США 6982321 и 7087409. Еще один способ называется гуманиринг (humaneering) и описан, например, в патенте США 2005/0008625. В контексте настоящей заявки термин "гуманизированные антитела" включает CDR-привитые антитела (то есть человеческие антитела, содержащие одну или более привитую нечеловеческую CDR) без замещений в каркасе или с минимальными замещениями в каркасе.

Дополнительно, нечеловеческое анти-EFNA антитело также может быть модифицировано посредством специфической делеции эпитопов человеческих Т-клеток или деиммунизации способами, раскрытыми в WO 98/52976 и WO 00/34317. В кратком изложении, вариабельные области тяжелой и легкой цепи антитела можно проанализировать в отношении пептидов, которые связываются с MHC (главный комплекс гистосовместимости) класса II; эти пептиды представляют собой потенциальные эпитопы Т-клеток (как определено в WO 98/52976 и WO 00/34317). Для обнаружения потенциальных эпитопов Т-клеток можно применить подход с использованием компьютерного моделирования, называемый «методом протягивания пептида", а также в базе данных пептидов, связывающих человеческий МНС класса II, можно искать мотивы, присутствующие в последовательностях VH и VL, как описано в WO 98/52976 и WO 00/34317. Эти мотивы связываются с любым из 18 основных DR-аллотипов MHC класса II и, таким образом, образуют потенциальные эпитопы Т-клеток. Обнаруженные потенциальные эпитопы Т-клеток могут быть удалены путем замещения небольших количеств аминокислотных остатков в вариабельных областях или посредством единичных аминокислотных замен. Если возможно, осуществляют консервативные замены. Часто, но не исключительно, можно использовать аминокислоты, свойственные для этого положения в последовательностях антитела зародышевой линии человека. После идентификации деиммунизирующих изменений можно сконструировать нуклеиновые кислоты, кодирующие VH и VL, посредством мутагенеза или других синтетических методов (например, синтеза de novo, замещения кассет и так далее). Мутагенизированные вариабельные последовательности возможно могут быть слиты с человеческим константным участком.

В выбранных воплощениях по меньшей мере 60%, 65%, 70%, 75% или 80% остатков вариабельной области гуманизированного антитела соответствуют остаткам родительских последовательностей каркасного участка (FR) и CDR. В других воплощениях по меньшей мере 85% или 90% остатков гуманизированного антитела соответствуют остаткам родительских последовательностей каркасного участка (FR) и CDR. В еще одном предпочтительном воплощении более чем 95% остатков гуманизированного антитела соответствуют остаткам родительских последовательностей каркасного участка (FR) и CDR.

Гуманизированные антитела могут быть изготовлены с использованием обычных методов молекулярной биологии и биомолекулярной инженерии, как описано здесь. Эти методы включают выделение, обработку и экспрессию нуклеиновокислотных последовательностей, которые кодируют все или часть вариабельных областей Fv иммуноглобулина по меньшей мере из одной тяжелой или легкой цепи. Источники таких нуклеиновых кислот хорошо известны специалистам в данной области и могут быть получены, например, из гибридомы, эукариотической клетки или фага, продуцирующих антитело или иммунореактивный фрагмент против определенной мишени, как описано выше, из генов иммуноглобулина зародышевой линии или из синтетических конструкций. Рекомбинантная ДНК, кодирующая гуманизированное антитело, затем может быть клонирована в подходящий экспрессирующий вектор.

Последовательности зародышевой линии человека, например, раскрыты в Tomlinson, I. A. et al. (1992) J. Mol. Biol. 227: 776-798; Cook, G. P. et al. (1995) Immunol. Today 16: 237-242; Chothia, D. et al. (1992) J. Mol. Bio. 227:799-817; и Tomlinson et al. (1995) EMBO J 14:4628-4638. Каталог V BASE предоставляет собой полный каталог последовательностей вариабельной области человеческого иммуноглобулина (см. Retter et al., (2005) Nuc Acid Res 33: 671-674). Эти последовательности можно использовать в качестве источника человеческих последовательностей, например каркасных участков и CDR. Как указано здесь, также можно использовать консенсусные человеческие каркасные участки, например, как описано в патенте США 6300064.

е. Человеческие антитела

Специалистам в данной области понятно, что, в дополнение к вышеупомянутым антителам, антитела по настоящему изобретению могут включать полностью человеческие антитела. В контексте настоящей заявки термин "человеческое антитело" включает антитело, которое имеет аминокислотную последовательность, соответствующую последовательности антитела, продуцируемого человеком, и/или было изготовлено с использованием любого из методов изготовления человеческих антител, как описано здесь. Данное определение человеческого антитела, в частности, исключает гуманизированное антитело, содержащее нечеловеческие антигенсвязывающие остатки.

Человеческие антитела можно получить с использованием различных методов, известных в данной области. Как упоминалось выше, можно использовать методы фагового дисплея для обеспечения иммуноактивных связывающих областей в соответствии с настоящим описанием. Таким образом, в некоторых воплощениях изобретения предложены способы получения анти-PTK7 антител или их антигенсвязывающих участков, включающие стадии синтеза библиотеки антител (предпочтительно человеческих) на фаге, скрининга этой библиотеки с помощью выбранной PTK7 или ее антителосвязывающего участка, выделения фага, связывающего PTK7, и получения иммунореактивных фрагментов из фага. В качестве примера один способ получения библиотеки антител для применения в методах фагового дисплея включает стадии иммунизации животных, не являющихся человеком, содержащих локус человеческого или нечеловеческого иммуноглобулина, выбранной PTK7 или ее антигенным участком для получения иммунного ответа, выделение антителопродуцирующих клеток из иммунизированного животного; выделение РНК, кодирующей тяжелые и легкие цепи антитела по изобретению из выделенных клеток, обратное транскрибирование РНК с получением кДНК, амплификация кДНК с использованием праймеров, и вставка кДНК в вектор для фагового дисплея таким образом, чтобы антитела экспрессировались на фаге. Более конкретно, ДНК, кодирующую домены VH и VL, рекомбинируют с линкером scFv посредством PCR и клонируют в фагмидный вектор (например, pCANTAB 6 или pComb 3 HSS). Затем этот вектор может быть подвергнут электропорации в E.coli, после чего E.coli инфицируют хелперным фагом. Используемый в данных способах фаг, как правило, представляет собой нитчатый фаг, включающий fd и M13, а домены VH и VL обычно рекомбинантно слиты либо с фаговым геном III, либо с геном VIII.

Рекомбинантные человеческие анти-PTK7 антитела по изобретению могут быть выделены посредством скрининга библиотеки рекомбинантных комбинаторных антител, полученной как описано выше. В предпочтительном воплощении эта библиотека представляет собой библиотеку scFv-фагового дисплея, полученную с использованием человеческих VL и VH кДНК, полученных из мРНК, выделенных из В-клеток. Методы получения и скрининга таких библиотек хорошо известны в данной области и наборы для создания библиотек фагового дисплея имеются в продаже (например, the Pharmacia Recombinant Phage Antibody System, номер по каталогу 27-9400-01; и Stratagene SurfZAP™ phage display kit, номер по каталогу 240612). Имеются также другие методы и реагенты, которые можно использовать в создании и скрининге библиотек дисплея антител (см., например, патент США 5223409; публикации РСТ WO 92/18619, WO 91/17271, WO 92/20791, WO 92/15679, WO 93/01288, WO 92/01047, WO 92/09690; Fuchs et al., Bio/Technology 9: 1370-1372 (1991); Hay et al., Hum. Antibod. Hybridomas 3: 81-85 (1992); Huse et al., Science 246: 1275-1281 (1989); McCafferty et al., Nature 348: 552-554 (1990); Griffiths et al., EMBO J. 12: 725-734 (1993); Hawkins et al., J. Mol. Biol. 226: 889-896 (1992); Clackson et al., Nature 352: 624-628 (1991); Gram et al., Proc. Natl. Acad. Sci. USA 89: 3576-3580 (1992); Garrad et al., Bio/Technology 9: 1373-1377 (1991); Hoogenboom et al., Nue. Acid Res. 19: 4133-4137 (1991); и Barbas et al., Proc. Natl. Acad. Sci. USA 88: 7978-7982 (1991).

Антитела, продуцируемые интактными библиотеками (природными или синтетическими), могут обладать умеренной аффинностью (Ka примерно от 106 до 107 М-1), но созревание аффинности также можно имитировать in vitro путем конструирования и повторной селекции из вторичных библиотек, как описано в данной области техники. Например, мутация может быть введена случайным образом in vitro посредством применения допускающей ошибки полимеразы (как сообщается в Leung et al., Technique, 1: 11-15 (1989)) в способе Hawkins et al., J. Mol. Biol., 226: 889-896 (1992) или в способе Gram et al., Proc. Natl. Acad. Sci. USA, 89: 3576-3580 (1992). Дополнительно, созревание аффинности может быть выполнено посредством случайных мутаций одного или более CDR, например с использованием PCR с праймерами, имеющими произвольные последовательности, охватывающие представляющий интерес CDR, в выбранных отдельных Fv клонах, и скрининга клонов с высокой аффинностью. В WO 9607754 описан способ индукции мутагенеза в области, определяющей комплементарность, легкой цепи иммуноглобулина для создания библиотеки генов легкой цепи. Другой эффективный подход состоит в рекомбинации доменов VH или VL, выбранных посредством фагового дисплея, с репертуарами природных вариантов домена V, полученных из неиммунизированных доноров, и скрининге на более высокую аффинность в нескольких раундах реорганизации цепи, как описано в Marks et al., Biotechnol., 10: 779-783 (1992). Этот метод позволяет получать антитела и фрагменты антител с константой диссоциации Kd (koff/kon) примерно 10-9 M или менее.

Кроме того, следует понимать, что можно использовать аналогичные методики с применением библиотек, содержащих эукариотические клетки (например, дрожжи), которые экспрессируют связывающие пары на своей поверхности. Как и в методе фагового дисплея, эукариотические библиотеки подвергают скринингу в отношении интересующего антигена (то есть PTK7) и выделяют и клонируют клетки, экспрессирующие кандидатсвязывающие пары. Могут быть выполнены стадии оптимизации содержания библиотеки и созревания аффинности реактивных связывающих пар. См., например, патент США 7700302 и заявку 12/404059. В одном воплощении человеческое антитело выбирают из фаговой библиотеки, где фаговая библиотека экспрессирует человеческие антитела (Vaughan et al. Nature Biotechnology 14: 309-314 (1996): Sheets et al. Proc. Natl. Acad. Sci. 95: 6157-6162 (1998)); Hoogenboom and Winter, J. Mol. Biol, 227: 381 (1991); Marks et al., J. Mol. Biol, 222: 581 (1991)). В других воплощениях человеческие связывающие пары могут быть выделены из библиотек комбинаторных антител, образованных в эукариотических клетках, таких как дрожжи. См. например, патент США 7700302. Такие методы, предпочтительно, позволяют осуществить скрининг большого числа кандидатов-модуляторов и обеспечивают относительно легкую обработку последовательностей кандидатов (например, посредством созревания аффинности или рекомбинантных перегруппировок).

Человеческие антитела также могут быть получены путем введения локуса человеческого иммуноглобулина трансгенным животным, например мышам, у которых эндогенные гены иммуноглобулина частично или полностью инактивированы. При введении наблюдается продуцирование человеческого антитела, которое во всех отношениях очень близко напоминает наблюдаемое у людей, в том числе перегруппировку и сборку генов, и репертуар антител. Такой подход описан, например, в патентах США 5545807; 5545806; 5569825; 5625126; 5633425; 5661016, а также 6075181 и 6150584, рассматривающих Xenomouse® технологию, наряду со следующими научными публикациями: Marks et al., Bio/Technology 10: 779-783 (1992); Lonberg et al., Nature 368: 856-859 (1994); Morrison, Nature 368:812-13 (1994); Fishwild et al., Nature Biotechnology 14: 845-51 (1996); Neuberger, Nature Biotechnology 14: 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995). Альтернативно, человеческое антитело может быть получено посредством иммунизации человеческих В-лимфоцитов, продуцирующих антитела, направленные против целевого антигена (такие В-лимфоциты могут быть извлечены из субъекта, страдающего опухолевым заболеванием, или могут быть иммунизированы in vitro). См., например, Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boerner et al., J. Immunol, 147 (1): 86-95 (1991); и патент США 5750373.

VI. Характеристики антител

Независимо от того, как он получены, и какую из вышеупомянутых форм принимает антительный модулятор (например, гуманизированный, человеческий и т.д.), предпочтительные воплощения раскрытых модуляторов могут обладать различными характеристиками. В связи с этим, анти-PTK7 антителопродуцирующие клетки (например, гибридомы или дрожжевые колонии) могут быть отобраны, клонированы и дополнительно подвергнуты скринингу в отношении нужных характеристик, включающих, например, устойчивый рост, высокий уровень продуцирования антител и, как описано более подробно ниже, желательные свойства антител. Гибридомы могут быть размножены in vivo в сингенных животных, в животных, лишенных иммунной системы, например бестимусных мышах, или в культуре клеток in vitro. Методы селекции, клонирования и размножения гибридом и/или колоний, каждая из которых продуцирует отдельный вид антител, хорошо известны специалистам в данной области техники.

а. Нейтрализирующие антитела

В особенно предпочтительных воплощениях модуляторы по настоящему изобретению включают нейтрализирующие антитела или их производные или фрагменты. Термин "нейтрализирующее антитело" или "нейтрализирующий антагонист" относится к антителу или антагонисту, который связывается или взаимодействует с молекулой PTK7 и препятствует связыванию или ассоциации лиганда с любым связывающим партнером, прерывая таким образом биологический ответ (например, фосфорилирование или VEGF-индуцированный ангиогенез), который в противном случае будет иметь место при взаимодействии молекул. При оценке связывания и специфичности антитела или его иммунологически функционального фрагмента или производного, антитело или фрагмент будет по существу ингибировать связывание лиганда с его связывающим партнером или субстратом, когда избыток антитела снижает количество связывающего партнера, соединенного с целевой молекулой, по меньшей мере примерно на 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% или более при измерении, например, с помощью фосфорилирования или выбранных субстратов (Shin et al, Biochem and Biophys Res Com, Vol. 371: 4) или в in vitro конкурентном связывающем анализе. В случае антител к PTK7, например, нейтрализующее антитело или антагонист предпочтительно ослабляет способность к фосфорилированию PTK7 в отношении специфического субстрата по меньшей мере примерно на 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% или более. Следует иметь в виду, что эту уменьшенную активность можно измерить непосредственно, используя известные в данной области техники методы, или можно измерить по влиянию, которое такое уменьшение оказывает на вторичные активности, такие как ангиогенез.

б. Интернализированные антитела

Хотя данные показывают, что PTK7 или его выбранные изоформы могут присутствовать в растворимой форме, по меньшей мере некоторые PTK7 вероятно остаются в ассоциации с клеточной поверхностью, тем самым обеспечивая возможность интернализации раскрытых модуляторов. Соответственно, анти-PTK7 антитела по настоящему изобретению могут быть интернализованы, по меньшей мере до некоторой степени, клетками, которые экспрессируют PTK7. Например, анти-PTK7 антитело, которое связывается с PTK7 на поверхности опухоль-инициирующей клетки, может быть интернализовано опухоль-инициирующей клеткой. В особенно предпочтительных воплощениях такие анти-PTK7 антитела могут быть соединены или конъюгированы с противораковыми агентами, такими как цитотоксические группировки, которые убивают клетки при интернализации.

При использовании здесь, интернализованное анти-PTK7 антитело представляет собой антитело, захваченное клеткой при связывании с PTK7, соединенной с клеткой млекопитающего. Интернализованное антитело включает фрагменты антитела, человеческое или гуманизированное антитело и конъюгаты антител. Интернализация может происходить in vitro или in vivo. Для терапевтического применения интернализация может происходить in vivo. Количество интернализованых молекул антител может быть достаточным или эффективным для уничтожения PTK7-экспрессирующей клетки, особенно PTK7-экспрессирующей опухоль-инициирующей клетки. В зависимости от активности антитела или конъюгата антитела, в некоторых случаях захват одной молекулы антитела клеткой является достаточным для уничтожения целевой клетки, с которой связывается антитело. Например, некоторые токсины являются высокоактивными в уничтожении, так что интернализация одной молекулы токсина, конъюгированной с антителом, является достаточной для уничтожения опухолевой клетки. Интернализуется ли анти-PTK7 антитело при связывании PTK7 с клеткой млекопитающего можно определить с помощью различных анализов, в том числе описанных в Примерах ниже (например, Примеры 12 и 13). Методы обнаружения интернализации антитела клеткой также описаны в патенте США 7619068, который включен в данную заявку посредством ссылки во всей своей полноте.

в. Истощающие антитела

В других предпочтительных воплощениях модуляторы по настоящему изобретению включают истощающие антитела или их производные или фрагменты. Термин "истощающее антитело" относится к антителу или фрагменту, который связывается или соединяется с PTK7 на или около поверхности клетки и индуцирует, стимулирует или вызывает смерть или ликвидацию клетки (например, посредством комплементзависимой цитотоксичности или антителозависимой клеточной цитотоксичности). В некоторых воплощениях, обсуждаемых более подробно ниже, выбранные истощающие антитела соединены или конъюгированы с цитотоксическим агентом. Предпочтительно, истощающее антитело способно удалить, инактивировать, ликвидировать или убить по меньшей мере 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97% или 99% клеток, поддерживающих опухоль, в определенной клеточной популяции. В некоторых воплощениях клеточная популяция может содержать обогащенные, разделенные, очищенные или выделенные клетки, поддерживающие опухоль. В других воплощениях клеточная популяция может содержать образцы целой опухоли или экстракты гетерогенной опухоли, которые содержат клетки, поддерживающие опухоль. Специалистам в данной области понятно, что стандартные биохимические методы, как описано в Примерах ниже (например, в Примерах 13 и 14) можно использовать для мониторинга и количественной оценки истощения онкогенных клеток или клеток, поддерживающих опухоль, согласно данному руководству.

г. Связывание с эпитопом

Кроме того, следует иметь в виду, что раскрытые анти-PTK7 антитела будут вступать в ассоциацию или связываться с отдельными эпитопами или детерминантами, представленными выбранной(ыми) мишенью(ями). При использовании здесь, термин "эпитоп" относится к той части антигена-мишени, который может распознаваться и специфически связываться конкретным антителом. Когда антиген представляет собой полипептид, такой как PTK7, эпитопы могут быть сформированы как соседними аминокислотами, так и несоседними аминокислотами, которые стали соседними посредством третичного складывания белка. Эпитопы, образованные соседними аминокислотами, как правило, сохраняются при денатурации белка, в то время как эпитопы, образованные в результате третичного складывания, обычно теряются при денатурации белка. Эпитоп, как правило, включает по меньшей мере 3, а еще чаще по меньшей мере 5 или 8-10 аминокислот в уникальной пространственной конформации. Более конкретно, специалисту понятно, что термин "эпитоп" включает любую белковую детерминанту, способную к специфическому связыванию с иммуноглобулином или Т-клеточным рецептором, или к иному взаимодействию с молекулой. Эпитопные детерминанты обычно состоят из химически активных поверхностных группировок молекул, таких как аминокислоты, или углеводы, или боковые цепи Сахаров, и обычно имеют специфические трехмерные структурные характеристики, а также специфические зарядные характеристики. Кроме того, эпитоп может быть линейным или конформационным. В линейном эпитопе все точки взаимодействия между белком и взаимодействующей молекулой (например, антителом) расположены линейно вдоль первичной аминокислотной последовательности белка. В конформационном эпитопе точки взаимодействие расположены на аминокислотных остатках в белке, которые линейно отделены друг от друга.

Если нужный эпитоп на антигене определен, можно создать антитела к этому эпитопу, например путем иммунизации пептидом, содержащим этот эпитоп, с использованием методов, описанных в настоящем изобретении. Альтернативно, в процессе поиска, создание и характеристика антител может дать информацию о нужных эпитопах. На основании этой информации затем можно конкурентно отбирать антитела на связывание с этим же эпитопом. Подход к достижению этого заключается в проведении конкурентных исследований для обнаружения антител, которые конкурентно связываются друг с другом, то есть антител, конкурирующих за связывание с антигеном. Высокопроизводительный процесс сортировки антител, основанный на их перекрестной конкуренции, описан в WO 03/48731.

При использовании здесь термин "сортировка" относится к способу группировки антител на основании их антигенсвязывающих характеристик. Оценка групп является в некоторой степени произвольной, зависящей от того, насколько различаются наблюдаемые связывающие партнеры тестируемых антител. Таким образом, в то время как данный метод является полезным инструментом классификации антител по настоящему изобретению, группы не всегда прямо коррелируют с эпитопами и такие первоначальные результаты определения следует дополнительно подтвердить другими известными в данной области методами.

С такой оговоркой можно определить, связывается выбранное первичное антитело (или его фрагмент) с тем же эпитопом или перекрестно конкурирует за связывание со вторым антителом, посредством использования методов, известных в данной области и изложенных здесь в Примерах. В одном воплощении первичному антителу по изобретению позволяют связываться с PTK7 в насыщающих условиях и затем измеряют способность вторичных антител связываться с PTK7. Если тестируемое антитело способно связываться с PTK7 одновременно с первичным анти-PTK7 антителом, тогда вторичное антитело связывается с другим эпитопом, чем первичное антитело. Однако, если вторичное антитело не способно связываться с PTK7 одновременно с первичным антителом, тогда вторичное антитело связывается с тем же самым эпитопом, перекрывающимся эпитопом или эпитопом, который находится в непосредственной близости от эпитопа, связанного с первичным антителом. Как известно в данной области техники и подробно описано в Примерах ниже, необходимые данные могут быть получены с использованием твердофазного прямого или непрямого радиоиммунологического анализа (RIA), твердофазного прямого или непрямого иммуноферментного анализа (EIA), конкурентного сэндвич-анализа, системы Biacore™ (то есть поверхностного плазмонного резонанса - GE Healthcare), анализатора ForteBio® (то есть двухполосной интерферометрии - ForteBio, Inc.) или метода проточной цитометрии. Термин "поверхностный плазмонный резонанс", при использовании здесь, относится к оптическому явлению, которое позволяет проводить анализ специфических взаимодействий в режиме реального времени путем обнаружения изменений концентраций белка на биосенсоре матрицы. В особенно предпочтительном воплощении анализ выполняют с использованием аппаратов Biacore или ForteBio, как показано в Примерах ниже.

Термин "конкурировать" при использовании в контексте антител означает конкуренцию между антителами, определенную посредством анализа, в котором тестируемое антитело или иммунологически функциональный фрагмент предупреждает или ингибирует специфическое связывание контрольного антитела с общим антигеном. Как правило, такой анализ включает использование очищенного антигена, связанного с твердой поверхностью, или клеток, несущих либо немеченый тестируемый иммуноглобулин, либо меченый контрольный иммуноглобулин. Конкурентное ингибирование измеряют путем определения количества метки, связанной с твердой поверхностью или клетками в присутствии тестируемого иммуноглобулина. Обычно тестируемый иммуноглобулин присутствует в избытке. Антитела, идентифицированные посредством конкурентного анализа (конкурирующие антитела), включают антитела, связывающиеся с тем же эпитопом, что и контрольное антитело, и антитела, связывающиеся с соседним эпитопом, расположенным достаточно близко к эпитопу, связанному контрольным антителом, для того чтобы имело место пространственное затруднение. Дополнительные подробности методов определения конкурентного связывания приведены здесь в Примерах. Обычно, когда конкурирующее антитело присутствует в избытке, оно ингибирует специфическое связывание контрольного антитела с общим антигеном по меньшей мере на 40%, 45%, 50%, 55%, 60%, 65%, 70% или 75%. В некоторых случаях связывание ингибируется по меньшей мере на 80%, 85%, 90%, 95% или 97% или более.

Кроме эпитопной специфичности раскрытые антитела могут быть охарактеризованы с использованием ряда разных физических характеристик, включающих, например, аффинности связывания, температуру плавления (Tm) и изоэлектрические точки.

д. Аффинность связывания

В связи с этим настоящее изобретение также охватывает применение антител, которые имеют высокую аффинность связывания с выбранным PTK7 или, в случае пан-антител, более чем с одним типом PTK7. Считается, что антитело по изобретению специфически связывается со своим целевым антигеном, когда константа диссоциации Kd (koff/kon) составляет ≤10-8 М. Антитело специфически связывается с антигеном с высокой аффинностью, когда Kd составляет ≤5×10-9 М и с очень высокой аффинностью, когда Kd составляет ≤5×10-10 М. В одном воплощении изобретения антитело имеет Kd≤10-9 М и скорость диссоциации составляет примерно 1×10-4/ сек. В одном воплощении изобретения скорость диссоциации составляет <1×10-5/сек. В других воплощениях изобретения антитела связываются с PTK7 с Kd между примерно 10-8 М и 10-10 М, а в еще одном воплощении они связываются с Kd≤2×10-10 М. Другие выбранные воплощения настоящего изобретения включают антитела, которые имеют константу диссоциации или Kd (koff/kon) менее 10-2 М, менее 5×10-2 М, менее 10-3 М, менее 5×10-3 М, менее 10-4 М, менее 5×10-4 М, менее 10-5 М, менее 5×10-5 М, менее 10-6 М, менее 5×10-6 М, менее 10-7 М, менее 5×10-7 М, менее 10-8 М, менее 5×10-8 М, менее 10-9 М, менее 5×10-9 М, менее 10-10 М, менее 5×10-10 М, менее 10-11 М, менее 5×10-11 М, менее 10-12 М, менее 5×10-12 М, менее 10-13 М, менее 5×10-13 М, менее 10-14 М, менее 5×10-14 М, менее 10-15 М или менее 5×10-15 М.

В конкретных воплощениях антитело по изобретению, которое иммуноспецифически связывается с PTK7, имеет константу скорости ассоциации или скорость kon по меньшей мере 105 М-1 с-1, по меньшей мере 2×105 М-1 с-1, по меньшей мере 5×105 М-1 сек-1, по меньшей мере 106 М-1 с-1, по меньшей мере 5×106 М-1 с-1, по меньшей мере 107 М-1 с-1, по меньшей мере 5×107 М-1 с-1 или по меньшей мере 108 М-1 сек-1.

В другом воплощении антитело по изобретению, которое иммуноспецифически связывается с PTK7 имеет константу скорости диссоциации или скорость kon менее 10-1 с-1, менее 5×10-1 с-1, менее 10-2 с-1, менее 5×10-2 с-1, менее 10-3 с-1, менее 5×10-3 с-1, менее 10-4 с-1, менее 5×10-4 с-1, менее 10-5 с-1, менее 5×10-5 с-1, менее 10-6 с-1 менее 5×10-6 с-1, менее 10-7 с-1, менее 5×10-7 с-1, менее 10-8 с-1, менее 5×10-8 с-1, менее 10-9 с-1, менее 5×10-9 с-1 или менее 10-10 с-1.

В других выбранных воплощениях настоящего изобретения анти-PTK7 антитела имеют константу аффинности или Ka (kon/koff) по меньшей мере 102 М-1, по меньшей мере 5×102 М-1, по меньшей мере 103 М-1, по меньшей мере 5×103 М-1, по меньшей мере 104 М-1, по меньшей мере 5×104 М-1 по меньшей мере 105 М-1, по меньшей мере 5×105 М-1 по меньшей мере 106 М-1, по меньшей мере 5×106 М-1, по меньшей мере 107 М-1, по меньшей мере 5×107 М-1, по меньшей мере 108 М-1, по меньшей мере 5×108 М-1 по меньшей мере 109 М-1, по меньшей мере 5×109 М-1, по меньшей мере 1010 М-1, по меньшей мере 5×1010 М-1, по меньшей мере 1011 М-1, по меньшей мере 5×1011 М-1 по меньшей мере 1012 М-1, по меньшей мере 5×1012 М-1, по меньшей мере 1013 М-1 по меньшей мере 5×1013 М-1, по меньшей мере 1014 М-1 по меньшей мере 5×1014 М-1, по меньшей мере 1015 М-1 или по меньшей мере 5×1015 М-1.

е. Изоэлектрические точки

В дополнение к вышеупомянутым связывающим свойствам, анти-PTK7 антитела и их фрагменты, подобно всем полипептидам, имеют изоэлектрическую точку (pI), которую обычно определяют как pH, при котором полипептид не несет суммарного заряда. В данной области техники известно, что растворимость белка обычно является самой низкой при pH раствора, равном изоэлектрической точке (pI) этого белка. Таким образом, можно оптимизировать растворимость путем изменения количества и локализации ионизируемых остатков в антителе для корректировки pI. Например, на pI полипептида можно влиять посредством осуществления подходящих аминокислотных замен (например, путем замены заряженной аминокислоты, такой как лизин, на незаряженный остаток, такой как аланин). Без привязки к какой-либо конкретной теории, аминокислотные замены в антителе, которые приводят к изменению pI указанного антитела, могут улучшать растворимость и/или стабильность этого антитела. Специалисту в данной области понятно, какие аминокислотные замещения будут наиболее подходящими для конкретного антитела для достижения нужной pI.

pI белка может быть определена различными способами, включая, но не ограничиваясь ими, изоэлектрическую фокусировку и различные компьютерные алгоритмы (см., например Bjellqvist et al., 1993, Electrophoresis 14: 1023). В одном воплощении pI анти-PTK7 антител по изобретению находится между или является выше, чем примерно 6,5, примерно 7,0, примерно 7,5, примерно 8,0, примерно 8,5, или примерно 9,0. В другом воплощении pI анти-PTK7 антител по изобретению находится между или является выше, чем 6,5, 7,0, 7,5, 8,0, 8,5, или 9,0. В еще одном воплощении, замены, приводящие к изменениям PI антител по изобретению, не уменьшают значительно их аффинность связывания с PTK7. Как описано более подробно ниже, конкретно предусмотрено, что замещение(я) Fc-участка, которое(ые) приводит(ят) к изменению связывания с FcγR, также может(ут) привести к изменению pI. В предпочтительном воплощении замещение(я) Fc-участка специально выбрано(ы) так, чтобы осуществлять и желательное изменение FcγR-связывания, и любое желательное изменение pI. При использовании здесь, значение pI определяют как pI преобладающей заряженной формы.

ж. Термическая стабильность

Также следует понимать, что Tm Fab-домена антитела может служить хорошим индикатором термической стабильности антитела и может дополнительно служить показателем срока годности. Tm представляет собой температуру 50%-ного разворачивания для данного домена или последовательности. Более низкая Tm указывает на большее агрегирование/меньшую стабильность, в то время как более высокая Tm указывает на меньшее агрегирование/большую стабильность. Таким образом, антитела или фрагменты или производные, имеющие высокую Tm, являются предпочтительными. Кроме того, используя признанные в данной области методы, можно изменить композицию антиPTK7 антител или их доменов, чтобы увеличить или оптимизировать молекулярную стабильность. См., например, патент США 7960142. Таким образом, в одном воплощении, Fab-домен выбранного антитела имеет значение Tm выше, чем по меньшей мере 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 105°C, 110°C, 115°C или 120°C. В другом воплощении, Fab-домен антитела имеет значение Tm выше, чем по меньшей мере примерно 50°C, примерно 55°C, примерно 60°C, примерно 65°C, примерно 70°C, примерно 75°C, примерно 80°C, примерно 85°C, примерно 90°C, примерно 95°C, примерно 100°C, примерно 105°C, примерно 110°C, примерно 115°C или примерно 120°C. Температуры термического плавления (Tm) белкового домена (например, домена Fab) могут быть измерены с использованием любого стандартного метода, известного в данной области техники, например посредством дифференциальной сканирующей калориметрии (см., например, Vermeer et al., 2000, Biophys. J. 78: 394-404; Vermeer et al., 2000, Biophys. J. 79: 2150-2154, обе включены в данное описание изобретения посредством ссылки).

VII. Фрагменты и производные модулятора PTK7

Независимо от того включают ли агенты по настоящему изобретению интактные слитые конструкции, антитела, фрагменты или производные, выбранные модуляторы будут вступать в реакцию, связываться, объединяться, образовывать комплекс, присоединяться, прикрепляться, смыкаться, взаимодействовать или иным образом вступать в ассоциацию с PTK7 и тем самым обеспечивать нужные противоопухолевые эффекты. Специалистам в данной области понятно, что модуляторы, включающие анти-PTK7 антитела, взаимодействуют или вступают в ассоциацию с PTK7 посредством одного или более связывающих сайтов, экспрессируемых на антителе. Более конкретно, при использовании здесь, термин "связывающий сайт" включает участок полипептида, которая отвечает за селективное связывание с целевой молекулой, представляющей интерес (например, ферментом, антигеном, лигандом, рецептором, субстратом или ингибитором). Связывающие домены содержат по меньшей мере один связывающий сайт (например, интактное антитело IgG имеет два связывающих домена и два связывающих сайта). Типичные связывающие домены включают вариабельный домен антитела, рецептор-связывающий домен лиганда, лигандсвязывающий домен рецептора или ферментативный домен. В контексте настоящего изобретения типичный активный участок PTK7 (например, часть слитой конструкции Fc-PTK7) может содержать сайт связывания с субстратом или способствовать фосфорилированию.

а. Фрагменты

Независимо от того, какая форма модулятора (например, химерная, гуманизированная и т.д.) выбрана для осуществления изобретения на практике, следует понимать, что его иммунореактивные фрагменты можно использовать в соответствии с данным руководством. В самом широком смысле термин "фрагмент антитела" включает по меньшей мере часть интактного антитела (например, природного иммуноглобулина). Более конкретно, термин "фрагмент" относится к части или участку антитела или цепи антитела (или молекулы PTK7 в случае Fc-слияний), содержащей меньше аминокислотных остатков, чем интактное или полное антитело или цепь антитела. Термин "антигенсвязывающий фрагмент" относится к полипептидному фрагменту иммуноглобулина или антитела, который связывается с антигеном или конкурирует с интактным антителом (то есть с интактным антителом, из которого они были получены) за связывание с антигеном (то есть специфическое связывание). При использовании здесь термин "фрагмент молекулы антитела" включает антигенсвязывающие фрагменты антитела, например легкую цепь антитела (VL), тяжелую цепь антитела (VH), одноцепочечное антитело (scFv), фрагмент F(ab')2, фрагмент Fab, фрагмент Fd, фрагмент Fv, фрагменты однодоменного антитела, диатела, линейные антитела, молекулы одноцепочечного антитела и полиспецифические антитела, образованные из фрагментов антител. Аналогичным образом, активный фрагмент PTK7 содержит часть молекулы PTK7, которая сохраняет способность взаимодействовать с субстратами или рецепторами PTK7 и модифицировать их таким же образом, что и интактный PTK7 (например, фосфорилированием - хотя, возможно, с несколько меньшей эффективностью).

Специалистам в данной области понятно, что фрагменты можно получить посредством химической или ферментативной обработки интактного или полного модулятора (например, антитела или цепи антитела) или рекомбинантными способами. В связи с этим, в то время как различные фрагменты антител определены в терминах расщепления интактного антитела, специалисту понятно, что такие фрагменты можно синтезировать de novo либо химически, либо используя методы рекомбинантной ДНК. Таким образом, при использовании здесь, термин "антитело" явным образом включает антитела или их фрагменты или производные, получаемые посредством модификации целых антител или синтезируемые de novo с использованием методов рекомбинантных ДНК.

Более конкретно, в результате расщепления антител папаином получают два идентичных антигенсвязывающих фрагмента, называемых Fab-фрагментами, каждый из которых имеет один антигенсвязывающий сайт, и остаточный фрагмент Fe, название которого отражает его способность легко кристаллизоваться. В результате обработки пепсином получают фрагмент F(ab')2, который имеет два антигенсвязывающих сайта и все еще способен к перекрестному связыванию антигена. Fab-фрагмент также содержит константный домен легкой цепи и первый константный домен (CH1) тяжелой цепи. Fab'-фрагменты отличаются от Fab-фрагментов добавлением нескольких остатков на карбоксильном конце CH1-домена тяжелой цепи, включая один или более цистеинов из шарнирной области антитела. Fab'-SH является здесь обозначением Fab', в котором цистеиновый(е) остаток(ки) константных доменов несет(ут) по меньшей мере одну свободную тиольную группу. Фрагменты Р(ab')2-антитела первоначально были получены, как пара фрагментов Fab' с шарнирными цистеинами между ними. Известны также другие химические сочетания фрагментов антител. Более подробное описание других фрагментов антител см., например, в Fundamental Immunology, W.Ε. Paul, ed., Raven Press, N.Y. (1999).

Также следует понимать, что фрагмент Fv представляет собой фрагмент антитела, который содержит полный сайт узнавания и связывания антигена. Эта область состоит из димера вариабельного домена одной тяжелой и одной легкой цепи в близкой ассоциации, которая может быть ковалентной по природе, например в scFv. Именно в этой конфигурации три CDR каждого вариабельного домена взаимодействуют с образованием антигенсвязывающего сайта на поверхности димера VH-VL. Вместе шесть CDR или их подмножество придают антителу антигенсвязывающую специфичность. Однако, даже один вариабельный домен (или половина Fv, содержащая только три CDR, специфичных к антигену) обладает способностью узнавать и связывать антиген, хотя обычно с более низкой аффинностью, чем полный связывающий сайт.

В других воплощениях фрагмент антитела, например, содержащий Fc-участок, сохраняет по меньшей мере одну из биологических функций, обычно ассоциированных с Fc-участком в случае присутствия в интактном антителе, такую как связывание FcRn, модуляция времени полужизни антитела, функция ADCC (антителозависимая клеточная цитотоксичность) и связывание комплемента. В одном воплощении фрагмент антитела является моновалентным антителом, которое имеет время полужизни in vivo по существу аналогичное интактному антителу. Например, такой фрагмент антитела может содержать антигенсвязывающее плечо, соединенное с последовательностью Fe, способной придать фрагменту стабильность in vivo.

б. Производные

В другом воплощении также понятно, что модуляторы по изобретению могут быть моновалентными или поливалентными (например, бивалентными, трехвалентными и т.д.). При использовании здесь, термин "валентность" относится к числу возможных сайтов связывания мишени (то есть PTK7), ассоциированных с антителом. Каждый сайт связывания мишени специфически связывает одну целевую молекулу или конкретное положение или локус на целевой молекуле. Когда антитело по настоящему изобретению содержит более одного сайта связывания мишени (поливалентное антитело), каждый сайт связывания мишени может специфически связывать одинаковые или разные молекулы (например, может связываться с разными лигандами, или разными антигенами, или разными эпитопами или положениями на одном и том же антигене). В контексте настоящего изобретения рассматриваемые антитела предпочтительно имеют по меньшей мере один сайт связывания, специфичный к человеческому PTK7. В одном воплощении антитела по настоящему изобретению являются моновалентными, так что каждый связывающий сайт молекулы специфически связывается с одним положением или эпитопом PTK7. В других воплощениях антитела являются поливалентными, так что они содержат больше одного связывающего сайта, и разные связывающие сайты специфически ассоциируют более чем с одним положением или эпитопом. В таких случаях множественные эпитопы могут присутствовать на выбранном PTK7-полипептиде или сплайс-варианте, или один эпитоп может присутствовать на PTK7 в то время как второй, другой эпитоп может присутствовать на другой молекуле или поверхности. См., например, патент США 2009/0130105.

Как упоминалось выше, поливалентные антитела могут иммуноспецифически связываться с разными эпитопами нужной целевой молекулы или могут иммуноспецифически связываться как с целевой молекулой, так и с гетерологичным эпитопом, таким как гетерологичный полипептид или твердый материал носителя. Хотя предпочтительные воплощения анти-PTK7 антител связывают только два антигена (то есть биспецифические антитела), антитела с дополнительными специфичностями, такие как триспецифические антитела, также охвачены настоящим изобретением. Примеры биспецифических антител включают, без ограничения ими, антитела с одним плечом, направленным против PTK7, и другим плечом, направленным против любого другого антигена (например, модуляторного клеточного маркера). Методы получения биспецифических антител известны в данной области. Традиционное получение полноразмерных биспецифических антител основано на со-экспрессии двух пар тяжелая цепь-легкая цепь иммуноглобулина, где две цепи обладают разной специфичностью (Millstein et al., 1983, Nature, 305:537-539). Другие, более сложные, совместимые, полиспецифические конструкции и способы их получения описаны в патенте США 2009/0155255.

В других воплощениях вариабельные домены антитела с нужными специфичностями связывания (сайты объединения антитело-антиген) слиты с последовательностями константного домена иммуноглобулина. Слияние предпочтительно осуществляют с константным доменом тяжелой цепи иммуноглобулина, содержащим по меньшей мере часть шарнирной области, CH2- и/или CH3-области. В одном примере первая константная область тяжелой цепи (CH1), содержащая сайт, необходимый для связывания с легкой цепью, присутствует по меньшей мере в одном из слияний. ДНК, кодирующие слияния тяжелой цепи иммуноглобулина и, если необходимо, легкой цепи иммуноглобулина, встроены в отдельные экспрессирующие векторы и котрансфецированы в подходящий организм-хозяин. Это обеспечивает большую гибкость в корректировке взаимных соотношений трех полипептидных фрагментов в воплощениях, где неравные соотношения трех полипептидных цепей, используемых в конструкции, обеспечивают оптимальные результаты. Однако можно встраивать кодирующие последовательности для двух или всех трех полипептидных цепей в один экспрессирующий вектор, когда экспрессия по меньшей мере двух полипептидных цепей в равных соотношениях приводит к высоким выходам или когда соотношения не имеют особого значения.

В одном воплощении такого подхода биспецифические антитела состоят из гибридной тяжелой цепи иммуноглобулина с первой специфичностью связывания в одном плече (например, PTK7) и гибридной пары тяжелая цепь-легкая цепь иммуноглобулина (представляющей вторую специфичность связывания) в другом плече. Было обнаружено, что ассиметричная структура облегчает отделение нужного биспецифического соединения от нежелательных комбинаций цепей иммуноглобулина, так как присутствие легкой цепи иммуноглобулина только в одной половине биспецифической молекулы обеспечивает легкий способ отделения. Такой подход раскрыт в WO 94/04690. Дополнительные подробности получения биспецифических антител см., например, в Suresh et al., 1986, Methods in Enzymology, 121:210. Согласно другому подходу, описанному в WO96/27011, можно сконструировать пару молекул антител для максимизации процента гетеродимеров, выделяемых из рекомбинантной клеточной культуры. Предпочтительная поверхность раздела включает по меньшей мере часть домена CH3 константного домена антитела. В данном способе одну или более небольших боковых цепей аминокислот с поверхности раздела первой молекулы антитела заменяют более крупными боковыми цепями (например, тирозином или триптофаном). Компенсационные полости размера, идентичного или аналогичного большой(им) боковой(ым) цепи(ям) создаются на поверхности раздела второй молекулы антитела путем замены больших аминокислотных боковых цепей меньшими (например, аланин или треонин). Это обеспечивает механизм увеличения выхода гетеродимера по сравнению с другими нежелательными конечными продуктами, такими как гомодимеры.

Биспецифические антитела также включают сшитые или гетероконъюгированные антитела. Например, одно из антител в гетероконъюгате может быть связано с авидином, а другое с биотином. Такие антитела, например, предложены для нацеливания клеток иммунной системы на нежелательные клетки (патент США 4676980) и для лечения ВИЧ-инфекции (WO 91/00360, WO 92/200373 и EP 03089). Гетероконъюгированные антитела могут быть получены с использованием любого удобного метода сшивания. Пригодные сшивающие агенты хорошо известны в данной области и раскрыты в патент США 4676980, наряду с рядом сшивающих методик

VIII. Модуляторы PTK7 - Модификации константного участка

а. Fc-участок и Fc-рецепторы

Специалистам в данной области понятно, что в дополнение к различным модификациям, заменам, вставкам или делециям в вариабельной или связывающей области раскрытых модуляторов (например, FC-PTK7 или анти-PTK7 антител), представленных выше, выбранные воплощения настоящего изобретения также могут содержать замещения или модификации константного участка (то есть Fc-участка). В частности, предполагается, что модуляторы PTK7 по изобретению могут содержать, помимо прочего, одну или более дополнительных замен, мутаций и/или модификаций аминокислотных остатков, что приводит к соединению с предпочтительными характеристиками, включающими, без ограничения ими: измененную фармакокинетику, увеличенное времени полужизни в сыворотке, повышенную аффинность связывания, пониженную иммуногенность, повышенное продуцирование, измененное связывание Fc-лиганда, повышенную или пониженную активность ADCC или CDC (комплементзависимая цитотоксичность), измененное гликозилирование и/или дисульфидные связи, и измененная специфичность связывания. В связи с этим следует иметь в виду, что эти Fc-варианты преимущественно могут быть использованы для усиления эффективных противоопухолевых свойств раскрытых модуляторов.

Термин "Fc-участок" используется в данной заявке для обозначения C-концевого участка тяжелой цепи иммуноглобулина, включая Fc-участки с нативной последовательностью и вариантные Fc-участки. Хотя границы Fc-участка тяжелой цепи иммуноглобулина могут варьироваться, Fc-участок тяжелой цепи IgG человека обычно простирается от аминокислотного остатка в положении Cys226 или от Pro230, до его карбоксильного конца. C-концевой лизин (остаток 447 согласно европейской системе нумерации) Fc-участка может быть удален, например в процессе изготовления или очистки антитела или при рекомбинантном конструировании нуклеиновой кислоты, кодирующей тяжелую цепь антитела. Соответственно, композиция интактных антител может содержать популяции антител, где все остатки K447 удалены, популяции антител, где остатки K447 не удалены, и популяции антител, имеющие смесь антител с остатком или без остатка K447. Функциональный Fc-участок обладает эффекторной функцией Fc-участка с нативной последовательностью. Типичные эффекторные функции включают связывание C1q; CDC; связывание Fc-рецептора; ADCC; фагоцитоз; уменьшение числа клеточных поверхностных рецепторов (например, B-клеточного рецептора; BCR) и т.д. Для таких эффекторных функций, как правило, требуется, чтобы Fc-участок был объединен со связывающим доменом (например, вариабельным доменом антитела), и они могут быть оценены с помощью различных анализов, как раскрыто, например, в определениях в данном описании.

Fc-рецептор или FcR обозначает рецептор, который связывается с Fc-участком антитела. В некоторых воплощениях FcR представляет собой нативный человеческий FcR. В некоторых воплощениях FcR связывается с IgG антителом (гамма-рецептор) и включает рецепторы подклассов FcγRI, Fc.RM и FcγRIII, в том числе аллельные варианты и альтернативно сплайсированные формы этих рецепторов. Рецепторы FcγII включают FcγRIIA (активирующий рецептор) и FcγRIIB (ингибирующий рецептор), которые имеют аналогичные аминокислотные последовательности, отличающиеся главным образом своими цитоплазматическими доменами. Активирующий рецептор Fey RIIA содержит иммунорецепторный тирозиновый активирующий мотив (ITAM) в своем цитоплазматическом домене. Ингибирующий рецептор FγRIIB содержит иммунорецепторный тирозиновый ингибирующий мотив (ITIM) в своем цитоплазматическом домене (см., например, Daeron, Annu. Rev. Immunol. 15: 203-234 (1997)). FcR рассматриваются, например, в Ravetch and Kinet, Annu. Rev. Immunol 9: 457-92 (1991); Capel et al., Immunomethods 4: 25-34 (1994); и de Haas et al., J. Lab. Clin. Med. 126: 330-41 (1995). Другие FcR, в том числе те, которые будут идентифицированы в будущем, охвачены здесь термином FcR. Термин Fc-рецептор или FcR также включает неонатальный рецептор, FcRn, который, в некоторых случаях, отвечает за перенос материнских IgG плоду (Guyer et al., J. Immunol. 117: 587 (1976) and Kim et al., J. Immunol. 24: 249 (1994)) и регуляцию гомеостаза иммуноглобулинов. Известны методы измерения связывания с FcRn (см., например, Ghetie and Ward., Immunol. Today 18 (12): 592-598 (1997); Ghetie et al., Nature Biotechnology, 15(7):637-640 (1997); Hinton et al., J. Biol. Chem. 279(8):6213-6216 (2004); WO 2004/92219 (Hinton et al.).

б. Функции Fc

При использовании здесь "комплементзависимая цитотоксичность" и "CDC" относится к лизису целевой клетки в присутствии комплемента. Путь активации комплемента инициируется связыванием первого компонента системы комплемента (C1q) с молекулой, например антитела, образующей комплекс с когнатным антигеном. Для оценки активации комплемента можно выполнить анализ CDC, например, как описано в Gazzano-Santoro et al., 1996, J. Immunol. Methods, 202 :163.

Кроме того, антителозависимая клеточноопосредованная цитотоксичность или ADCC относится к форме цитотоксичности, при которой секретируемый Ig, связанный с Fc-рецепторами (FcR), присутствующими на некоторых цитотоксических клетках (например, естественных киллерах (NK), нейтрофилах и макрофагах) позволяет этим цитотоксическим эффекторным клеткам специфически связываться с целевой клеткой, несущей антиген, и затем убивать эту целевую клетку цитотоксинами. Специфические высокоаффинные IgG антитела направлены на целевое плечо цитотоксических клеток и абсолютно необходимы для такой гибели. Лизис целевой клетки является внеклеточным, требует непосредственного контакта между клетками и не требует участия комплемента.

Варианты PTK7-модулятора с измененной аффинностью связывания FcR или активностью ADCC обладают либо повышенной, либо ослабленной активностью связывания FcR и/или активностью ADCC по сравнению родительским или немодифицированным антителом или с модулятором, содержащим Fc-участок с нативной последовательностью. Вариант модулятора, который демонстрирует повышенное связывание с FcR, связывается по меньшей мере с одним FcR с лучшей аффинностью, чем родительское или немодифицированное антитело или модулятор, содержащий Fc-участок с нативной последовательностью. Вариант, который демонстрирует уменьшенное связывание с FcR, связывается по меньшей мере с одним FcR с меньшей аффинностью, чем родительское или немодифицированное антитело или модулятор, содержащий Fc-участок с нативной последовательностью. Такие варианты, которые демонстрируют уменьшенное связывание с FcR, могут обладать незначительным связыванием или не иметь существенного связывания с FcR, например 0-20% связывания с FcR по сравнению с нативной последовательностью Fc-участка IgG, например, как определено с помощью хорошо известных в данной области методов.

Что касается FcRn, антитела по настоящему изобретению также содержат или охватывают варианты Fe с модификациями в константном участке, которые обеспечивают время полужизни (например, время полужизни в сыворотке) у млекопитающего, предпочтительно человека, более 5 суток, более 10 суток, более 15 суток, предпочтительно более 20 суток, более 25 суток, более 30 суток, более 35 суток, более 40 суток, более 45 суток, более 2 месяцев, более 3 месяцев, более 4 месяцев или более 5 месяцев. Увеличение времени полужизни антител (или Fc-содержащих молекул) по настоящему изобретению у млекопитающего, предпочтительно человека, приводит к более высокому титру сыворотки указанных антител или фрагментов антител у млекопитающего и, таким образом, снижает частоту введения указанных антител или фрагментов антитела, и/или снижает вводимую концентрацию указанных антител или фрагментов антител. Антитела с увеличенным временем полужизни in vivo можно получить с помощью методов, хорошо известных специалистам в данной области. Например, антитела с увеличенным временем полужизни in vivo можно получить путем модификации (например, замены, делеции или добавления) аминокислотных остатков, которые определены как участвующие во взаимодействие между Fc-доменом и рецептором FcRn (см., например, международную публикацию WO 97/34631; WO 04/029207; патент США 6737056 и патент США 2003/0190311). Связывание с человеческим FcRn in vivo и время полужизни в сыворотке человеческих высокоаффинных FcRn-связывающих полипептидов можно оценить, например, на трансгенных мышах или в трансфицированных клеточных линиях человека, экспрессирующих человеческий FcRn, или на приматах, которым вводят полипептиды с вариантным Fc-участком. В WO 2000/42072 описаны варианты антител с улучшенным или ослабленным связыванием с FcRns. См. также, например, Shields et al. J. Biol. Chem. 9(2):6591-6604 (2001).

в. Модификации гликозилирования

В других воплощениях профили гликозилирования или композиции антител по изобретению являются модифицированными. Более конкретно, предпочтительные воплощения настоящего изобретения могут содержать одну или более сконструированных гликоформ, то есть измененный профиль гликозилирования или измененную композицию углеводов, ковалентно присоединенных к молекуле, содержащей Fc-участок. Сконструированные гликоформы могут быть полезны для различных целей, включая, но не ограничиваясь ими, повышение или снижение эффекторной функции, увеличение аффинности антитела к целевому антигену или облегчение получения антитела. В случаях, когда желательной является пониженная эффекторная функция, следует понимать, что молекула может быть сконструирована для экспрессии в агликозилированной форме. Такие углеводные модификации могут быть выполнены, например, путем изменения одного или более сайтов гликозилирования в последовательности антитела. Это означает, что можно сделать одну или более аминокислотных замен, что приводит к удалению одного или более сайтов гликозилирования вариабельной области каркасного участка, тем самым устраняя гликозилирование в этом сайте (см., например, патенты США 5714350 и 6350861). С другой стороны, повышенные эффекторные функции или улучшенное связывание может быть придано Fc-содержащей молекуле посредством конструирования одного или более дополнительных сайтов гликозилирования.

Дополнительно или альтернативно можно получить вариант Fe, который имеет измененную гликозилированную композицию, например гипофукозилированное антитело, имеющее пониженное количество фукозильных остатков, или антитело, имеющее увеличенные гемисекционные GlcNAc структуры. Было показано, что эти и подобные профили гликозилирования увеличивают ADCC-способность антител.

Сконструированные гликоформы можно получить любым способом, известным специалисту в данной области, например, используя сконструированные штаммы или штаммы, экспрессирующие варианты, посредством коэкспрессии с одним или более ферментами (например, N-ацетилглюкозаминилтрансферазой III (GnTH 1)), посредством экспрессии молекулы, содержащей Fc-участок в различных организмах или клеточных линиях из различных организмов или посредством модификации углевода(ов) после экспрессии молекулы, содержащей Fc-участок. См., например, Shields, R. L. et al. (2002) J. Biol. Chem. 277: 26733-26740; Umana et al. (1999) Nat. Biotech. 17: 176-1, а также европейский патент ЕР 1176195; РСТ публикации WO 03/035835; WO 99/54342, Umana et al, 1999, Nat. Biotechnol 17: 176-180; Davies et al., 20017 Biotechnol Bioeng 74: 288-294; Shields et al, 2002, J Biol Chem 277: 26733-26740; Shinkawa et al., 2003, J Biol Chem 278: 3466-3473) патент США 6602684; заявки США 10/277370; 10/113929; РСТ WO 00/61739А1; РСТ WO 01/292246А1; РСТ WO 02/311140А1; РСТ WO 02/30954А1; Potillegent™ технологию (Biowa, Inc.); технологию конструирования гликозилирования GlycoMAb™ (GLYCART biotechnology AG); WO 00061739; EA 01229125; патент США 2003/0115614; Okazaki et al., 2004, JMB, 336: 1239-49.

IX. Экспрессия модулятора

а. Обзор

ДНК, кодирующая нужные модуляторы EFNA, может быть легко выделена и секвенирована с использованием обычных процедур (например, с использованием олигонуклеотидных зондов, которые способны специфически связываться с генами, кодирующими тяжелые и легкие цепи антител). Выделенные и субклонированные гибридомные клетки (или колонии, полученные из фагов и дрожжей) могут являться предпочтительным источником такой ДНК, если модулятор представляет собой антитело. Если необходимо, нуклеиновую кислоту можно дополнительно обработать, как описано здесь, для создания агентов, включающих слитые белки или химерные, гуманизированные или полностью человеческие антитела. Более конкретно, выделенную ДНК (которую может быть модифицирована) можно использовать для клонирования последовательностей константной и вариабельной области для получения антител, как описано в патенте США 7709611.

Такой типичный способ предусматривает экстракцию РНК из выбранных клеток, превращение в кДНК, и амплификацию посредством PCR с использованием антителоспецифических праймеров. Подходящие праймеры хорошо известны в данной области и, как приведено в качестве примера в данном описании, легкодоступны из различных коммерческих источников. Следует понимать, что для экспрессии рекомбинантного человеческого или нечеловеческого антитела, выделенного путем скрининга комбинаторной библиотеки, ДНК, кодирующую антитело, клонируют в рекомбинантный экспрессирующий вектор и вводят в клетки-хозяева, включающие клетки млекопитающих, клетки насекомых, клетки растений, дрожжи и бактерии. В других воплощениях модуляторы вводят и экспрессируют при помощи обезьяньих клеток COS (африканской зеленой мартышки), клеток NS0, клеток яичника китайского хомячка (CHO) или клеток миеломы, которые иначе не продуцируют нужную конструкцию. Как обсуждается более подробно ниже, трансформированные клетки, экспрессирующие нужный модулятор, могут быть выращены в относительно больших количествах, чтобы обеспечить клинические и коммерческие поставки слитой конструкции или иммуноглобулина.

Независимо от того, получали или выделяли нуклеиновую кислоту, кодирующую необходимую часть модулятора PTK7, с помощью метода фагового дисплея, из дрожжевых библиотек, с помощью метода, основанного на гибридоме, синтетически или из коммерческих источников, следует понимать, что настоящее изобретение явным образом охватывает молекулы нуклеиновой кислоты и последовательности, кодирующие модуляторы PTK7, включая слитые белки и анти-PTK7 антитела или их антигенсвязывающие фрагменты или производные. Данное изобретение также охватывает нуклеиновые кислоты или молекулы нуклеиновых кислот (например, полинуклеотиды), которые гибридизуются в условиях гибридизации высокой жесткости или, альтернативно, в условиях гибридизации средней или низкой жесткости (например, как определено ниже), с полинуклеотидами, комплементарными нуклеиновым кислотам, имеющим полинуклеотидную последовательность, которая кодирует модулятор по изобретению или его фрагмент или вариант. Термин "молекула нуклеиновой кислоты" или "выделенная молекула нуклеиновой кислоты", используемый здесь, как предполагается, включает по меньшей мере молекулы ДНК и молекулы РНК. Молекула нуклеиновой кислоты может быть одноцепочечной или двухцепочечной, но предпочтительно является двухцепочечной ДНК. Кроме того, настоящее изобретение включает любой носитель или конструкцию, включающую такой полинуклеотид, кодирующий модулятор, включая, без ограничения ими, векторы, плазмиды, клетки-хозяева, космиды или вирусные конструкции.

Термин "выделенная нуклеиновая кислота" означает, что нуклеиновую кислоту (1) амплифицировали in vitro, например посредством полимеразной цепной реакции (ПЦР), (2) рекомбинантно получали посредством клонирования, (3) очищали, например путем расщепления и гель-электрофоретического фракционирования, или (4) синтезировали, например посредством химического синтеза. Выделенная нуклеиновая кислота представляет собой нуклеиновую кислоту, которая подходит для обработки методами рекомбинантной ДНК.

Более конкретно также предложены нуклеиновые кислоты, которые кодируют модулятор, в том числе одну или обе цепи антитела по изобретению, или его фрагмент, производное, мутеин или вариант, полинуклеотиды, достаточные для использования в качестве гибридизационных зондов, PCR-праймеры или праймеры для секвенирования для идентификации, анализа, мутации или амплификации полинуклеотида, кодирующего полипептид, антисмысловые нуклеиновые кислоты для ингибирования экспрессии полинуклеотида и комплементарные последовательности вышеизложенного. Нуклеиновые кислоты могут быть любой длины. Они могут быть длиной, например, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000 или более нуклеотидов, и/или могут содержать одну или более дополнительных последовательностей, например регуляторных последовательностей, и/или являться частью более крупной нуклеиновой кислоты, например вектора. Эти нуклеиновые кислоты могут быть одноцепочечными или двухцепочечными и могут включать РНК- и/или ДНК-нуклеотиды и их искусственные варианты (например, пептидные нуклеиновые кислоты). Нуклеиновые кислоты, кодирующие модуляторы по изобретению, в том числе антитела или их иммунореактивные фрагменты или производные, предпочтительно выделены, как описано выше.

б. Гибридизация и идентичность

Как указано, в изобретении также предлагаются нуклеиновые кислоты, которые гибридизуются с другими нуклеиновыми кислотами в определенных условиях гибридизации. Методы гибридизации нуклеиновых кислот хорошо известны в данной области техники. См., например, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. В контексте настоящей заявки в качестве умеренно жестких условий гибридизации используют раствор для предварительного промывания, содержащий 5х хлорид натрия/цитрат натрия (SSC), 0,5% SDS (додецилсульфат натрия), 1,0 мМ EDTA (этилендиаминтетрауксусная кислота) (pH 8,0), буфер для гибридизации, состоящий из примерно 50% формамида, 6×SSC, и температуру гибридизации 55°C (или другие аналогичные растворы для гибридизации, например раствор, содержащий примерно 50% формамида, с температурой гибридизации 42°C), и следующие условия для промывания - 60°C, в 0,5×SSC, 0,1% SDS. В жестких условиях гибридизация происходит в 6xSSC при 45°C, с последующими одним или более промываниями в 0,1xSSC, 0,2% SDS при 68°C.Кроме того, специалист в данной области техники может управлять условиями гибридизации и/или промывания с целью увеличения или уменьшения жесткости гибридизации, таким образом, чтобы нуклеиновые кислоты, содержащие нуклеотидные последовательности, которые по меньшей мере на 65, 70, 75, 80, 85, 90, 95, 98 или 99% идентичны друг другу, обычно остаются гибридизованными друг с другом. В целом, в контексте настоящего описания изобретения термин "по существу идентичная" в отношении последовательности нуклеиновой кислоты следует понимать, как последовательность нуклеотидов, демонстрирующую по меньшей мере примерно 85%, или 90%, или 95%, или 97%-ую идентичность последовательности со стандартной нуклеиновокислотной последовательностью.

Основные параметры, влияющие на выбор условий гибридизации, и руководство для разработки подходящих условий, изложены, например, в Sambrook, Fritsch and Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 и 11; и Current Protocols in Molecular Biology, 1995, Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 и 6.3-6.4) и могут быть легко определены специалистами в данной области на основании, например, длины и/или совокупности оснований нуклеиновой кислоты.

Следует понимать, что нуклеиновые кислоты могут, согласно изобретению, присутствовать отдельно или в комбинации с другими нуклеиновыми кислотами, которые могут быть гомологичными или гетерологичными. В предпочтительных воплощениях нуклеиновая кислота функционально связана с последовательностями, контролирующими экспрессию, которые могут быть гомологичными или гетерологичными в отношении указанной нуклеиновой кислоты. В этом контексте термин "гомологичный" означает, что нуклеиновая кислота в природных условиях также функционально связана с последовательностью, контролирующей экспрессию, и термин "гетерологичный" означает, что нуклеиновая кислота в природных условиях функционально не связана с последовательностью, контролирующей экспрессию.

в. Экспрессия

Нуклеиновая кислота, такая как нуклеиновая кислота, экспрессирующая РНК и/или белок или пептид, и последовательность, контролирующая экспрессию, функционально связаны друг с другом, если они ковалентно соединены друг с другом таким образом, что экспрессия или транскрипция указанной нуклеиновой кислоты находится под контролем или под влиянием указанной последовательности, контролирующей экспрессию. Если нуклеиновую кислоту следует транслировать в функциональный белок, тогда, при последовательности, контролирующей экспрессию, функционально связанной с кодирующей последовательностью, индукция указанной последовательности, контролирующей экспрессию, приводит к транскрипции указанной нуклеиновой кислоты, не вызывая сдвига рамки считывания кодирующей последовательности или же указанная кодирующая последовательность не способна транслироваться в нужный белок или пептид.

Термин "последовательность, контролирующая экспрессию" включает, согласно изобретению, промоторы, сайты связывания рибосомы, энхансеры и другие контролирующие элементы, которые регулируют транскрипцию гена или трансляцию мРНК. В конкретных воплощениях изобретения последовательности, контролирующие экспрессию, можно регулировать. Точная структура последовательностей, контролирующих экспрессию, может варьироваться в зависимости от вида или типа клетки, но, как правило, содержит 5-нетранскрибируемые и 5'- и 3'-нетранслируемые последовательности, которые вовлечены в инициацию транскрипции и трансляции, соответственно, такие как TATA-бокс, кэпирующая последовательность, последовательность CAAT и тому подобное. Более конкретно, 5'-нетранскрибируемые последовательности, контролирующие экспрессию, содержат промоторную область, которая включает промоторную последовательность для контроля транскрипции функционально связанной нуклеиновой кислоты. Последовательности, контролирующие экспрессию, также могут содержать энхансерные последовательности или вышерасположенные активаторные последовательности.

Согласно изобретению, термин "промотор" или "промоторная область" относится к нуклеиновокислотной последовательности, которая расположена выше (5') экспрессируемой последовательности нуклеиновой кислоты и контролирует экспрессию последовательности, обеспечивая узнавание и сайт связывания РНК-полимеразы. Промоторная область может включать дополнительные сайты узнавания и связывания дополнительных факторов, вовлеченных в регуляцию транскрипции гена. Промотор может контролировать транскрипцию прокариотического или эукариотического гена. Кроме того, промотор может быть индуцибельным и может инициировать транскрипцию в ответ на индуцирующий агент, или может быть конститутивным, если транскрипция не контролируется индуцирующим агентом. Ген, находящийся под контролем индуцибельного промотора, не экспрессируется или лишь незначительно экспрессируется в случае отсутствия индуцирующего агента. В присутствии индуцирующего агента ген включается или уровень транскрипции увеличивается. Это опосредовано, в большинстве случаев, связыванием конкретного транскрипционного фактора.

Предпочтительные промоторы по изобретению включают промоторы SP6, T3 и T7 полимераз, человеческий U6 RNA промотор, CMV промотор и их искусственные гибридные промоторы (например, CMV), где участок или участки слиты с участком или участками промоторов генов других клеточных белков, таких как, например, человеческий GAPDH (глицеральдегид-3-фосфатдегидрогеназа), включая или не включая дополнительный(е) интрон(ы).

Согласно изобретению, термин "экспрессия" используется в своем наиболее широком значении и включает продуцирование РНК или РНК и белка/пептида. Он также включает частичную экспрессию нуклеиновых кислот. Кроме того, экспрессия может осуществляться временно или стабильно.

В предпочтительном воплощении молекула нуклеиновой кислоты согласно изобретению находится в векторе, если целесообразно, вместе с соответствующим промотором, который контролирует экспрессию этой нуклеиновой кислоты. Термин "вектор" используется здесь в своем наиболее широком значении и включает любой вспомогательный носитель нуклеиновой кислоты, который позволяет вводить указанную нуклеиновую кислоту, например, в прокариотические и/или эукариотические клетки и, если целесообразно, встраивать в геном. Векторы такого типа предпочтительно реплицируются и/или экспрессируются в клетках. Векторы могут включать плазмиды, фагмиды, бактериофаги или вирусные геномы. При использовании здесь термин "плазмида", как правило, относится к конструкции экстрахромосомного генетического материала, обычно кольцевому ДНК дуплексу, который может реплицироваться независимо от хромосомной ДНК.

При осуществлении на практике настоящего изобретения следует понимать, что можно использовать многие общепринятые методы молекулярной биологии, микробиологии и рекомбинантной ДНК. Такие общепринятые методы относятся к векторам, клеткам-хозяевам и рекомбинантным методам, описанным здесь. Эти методы хорошо известны и объяснены, например, в Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, Calif.; Sambrook et al., Molecular Cloning-Α Laboratory Manual (3rd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 2000 и Current Protocols in Molecular Biology, F.M. Ausubel et al., eds., выше. Другие полезные ссылки, например по выделению и культивированию клеток (например, для последующего выделения нуклеиновой кислоты или белка), включают Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, третье издание, Wiley-Liss, New York и ссылки, указанные в нем; Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons, Inc. New York, N.Y.; Gamborg and Phillips (Eds.) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg New York) and Atlas and Parks (Eds.) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, Fla. Методы получения нуклеиновых кислот (например, посредством in vitro амплификации, очистки из клеток или химического синтеза), методы обработки нуклеиновых кислот (например, сайт-направленный мутагенез, расщепление рестриктазами, лигирование и т.д.) и различные векторы, клеточные линии и т.д., полезные в обработке и получении нуклеиновых кислот, описаны в вышеупомянутых ссылках. Кроме того, по существу любой полинуклеотид (в том числе, например, меченные или биотинилированные полинуклеотиды) может быть индивидуально или стандартно заказан в любом из множества коммерческих источников.

Таким образом, в одном аспекте настоящего изобретения предлагаются рекомбинантные клетки-хозяева, обеспечивающие возможность рекомбинантной экспрессии антител по изобретению или их участков. Антитела, продуцируемые путем экспрессии в таких рекомбинантных клетках-хозяевах, называются в данной заявке рекомбинантными антителами. В настоящем изобретении также предлагаются клетки, являющиеся потомками таких клеток-хозяев, и антитела, продуцируемые ими.

При использовании здесь термин "рекомбинантная клетка-хозяин" (или просто "клетка-хозяин") означает клетку, в которую был встроен рекомбинантный экспрессирующий вектор. Следует понимать, что рекомбинантная клетка-хозяин и клетка-хозяин означает не только клетку конкретного субъекта, но также и потомство такой клетки. Так как некоторые модификации могут иметь место в последующих поколениях в результате либо мутаций, либо влияния окружающей среды, такое потомство может, на самом деле, не быть идентичным родительской клетке, но тем не менее оно включено в объем используемого здесь термина "клетка-хозяин". Такие клетки могут содержать вектор по изобретению, как описано выше.

В другом аспекте настоящего изобретения предлагается способ получения антитела или его участка, как описано здесь. Согласно одному воплощению, указанный способ включает культивирование клетки, трансфицированной или трансформированной вектором, как описано выше, и воспроизводящий антитело или его участок.

Как указано выше, экспрессия антитела по изобретению (или его фрагмента или вариантов) предпочтительно включает экспрессирующий(е) вектор(ы), содержащий(е) полинуклеотид, который кодирует нужное анти-PTK7 антитело. Методы, которые хорошо известны специалистам в данной области, можно использовать для конструирования экспрессирующих векторов, содержащих последовательности, кодирующие антитело, и соответствующие транскрипционные и трансляционные контрольные сигналы. Эти методы включают, например, методы рекомбинантной ДНК in vitro, методы синтеза и методы генетической рекомбинации in vivo. В воплощениях изобретения, таким образом, предлагаются реплицируемые векторы, содержащие нуклеотидную последовательность, кодирующую анти-PTK7 антитело по изобретению (например, целое антитело, тяжелую или легкую цепь антитела, вариабельный домен тяжелой или легкой цепи антитела, или его часть, или CDR тяжелой или легкой цепи, одноцепочечный Fv или их фрагменты или варианты), функционально связанную с промотором. В предпочтительных воплощениях такие векторы могут включать нуклеотидную последовательность, кодирующую тяжелую цепь молекулы антитела (или ее фрагмент), нуклеотидную последовательность, кодирующую легкую цепь антитела (или ее фрагмент) или и тяжелую и легкую цепь.

Когда нуклеотиды по настоящему изобретению выделены и модифицированы согласно данному руководству, их можно использовать для получения выбранных модуляторов, включая анти-PTK7 антитела или их фрагменты.

X. Получение и очистка модулятора

Используя общепризнанные методы молекулярной биологии и современные методы экспрессии белка, можно получить значительные количества необходимых модуляторов. Более конкретно, молекулы нуклеиновой кислоты, кодирующие модуляторы, такие как антитела, полученные и сконструированные, как описано выше, могут быть встроены в хорошо известные и коммерчески доступные системы продуцирования белка, содержащие различные типы клеток-хозяев, для получения преклинических, клинических или коммерческих количеств нужного фармацевтического продукта. Следует понимать, что в предпочтительных воплощениях нуклеиновокислотные молекулы, кодирующие модуляторы, встроены в векторы или экспрессирующие векторы, которые обеспечивают эффективную интеграцию в выбранные клетки-хозяева с последующим высоким уровнем экспрессии нужного модулятора PTK7.

Предпочтительно, молекулы нуклеиновой кислоты, кодирующие модуляторы PTK7 и векторы, содержащие эти нуклеиновокислотные молекулы, можно использовать для трансфекции подходящей клетки-хозяина млекопитающего, растения, бактерии или дрожжей, хотя следует понимать, что для производства модулятора можно использовать прокариотические системы. Трансфекцию можно осуществлять посредством любого известного метода введения полинуклеотидов в клетку-хозяина. Способы введения гетерологичных полинуклеотидов в клетки млекопитающих хорошо известны в данной области техники и включают декстран-опосредованную трансфекцию, осаждение фосфатом кальция, полибрен-опосредованную трансфекцию, слияние протопластов, электропорацию, инкапсуляцию полинуклеотида(ов) в липосомы и непосредственную микроинъекцию ДНК в ядро. Кроме того, молекулы нуклеиновых кислот можно вводить в клетки млекопитающих с помощью вирусных векторов. Методы трансформации клеток млекопитающих хорошо известны в данной области техники. См., например, патенты США 4399216, 4912040, 4740461 и 4959455. Кроме того, методы трансформации клеток растений хорошо известны в данной области техники, в том числе, например, трансформация, опосредованная агробактерией, биолистическая трансформация, прямая инъекция, электропорация и вирусная трансформация. Методы трансформации бактериальных и дрожжевых клеток также хорошо известны в данной области техники.

Кроме того, клетка-хозяин может быть котрансфицирована двумя экспрессирующими векторами по изобретению, например первым вектором, кодирующим полипептид, полученный из тяжелой цепи, и вторым вектором, кодирующим полипептид, полученный из легкой цепи. Эти два вектора могут содержать идентичные селектируемые маркеры, что обеспечивает по существу эквивалентную экспрессию полипептидов тяжелой и легкой цепи. Альтернативно можно использовать один вектор, который кодирует и способен экспрессировать полипептиды и тяжелой и легкой цепи. В таких ситуациях легкую цепь предпочтительно помещают перед тяжелой цепью, чтобы избежать избытка токсичной свободной тяжелой цепи. Кодирующие последовательности тяжелых и легких цепей могут содержать кДНК или геномную ДНК.

а. Системы экспрессии хозяина

Множество систем экспрессирующих векторов в клетках-хозяевах, многие из которых имеются в продаже, совместимы с данным руководством и могут быть использованы для экспрессии модуляторов по изобретению. Такие системы экспрессии хозяина представляют собой носители, с помощью которых интересующие кодирующие последовательности можно экспрессировать и затем очищать, а также представляют собой клетки, которые могут, будучи трансформированы или трансфицированы соответствующими нуклеотидными кодирующими последовательностями, экспрессировать молекулу по изобретению in situ. Такие системы включают, но не ограничиваются ими, микроорганизмы, такие как бактерии (например, E.coli, B.subtilis, Streptomyces), трансформированные экспрессирующими векторами на основе рекомбинантной ДНК бактериофага, плазмидной ДНК или космидной ДНК, содержащими последовательности, кодирующие модулятор; дрожжи (например, Saccharomyces, Pichia), трансфицированные рекомбинантными дрожжевыми экспрессирующими векторами, содержащими последовательности кодирующие модулятор; системы клеток насекомых, инфицированные рекомбинантными вирусными экспрессирующими векторами (например, бакуловирус), содержащие последовательности, кодирующие модулятор; системы клеток растений (например, Nicotiana, Arabidopsis, ряска, зерновые, пшеница, картофель и т.д.), инфицированные рекомбинантными вирусными экспрессирующими векторами (например, вирусом мозаики цветной капусты, CaMV; вирусом табачной мозаики, TMV) или трансфицированные рекомбинантными плазмидными экспрессирующими векторами (например, Ti плазмида), содержащими последовательности, кодирующие модулятор; или системы клеток млекопитающих (например, клетки COS, CHO, BHK, 293, 3T3), имеющие рекомбинантные экспрессирующие конструкции, содержащие промоторы, полученные из генома клеток млекопитающих (например, металлотионеиновый промотор) или из вирусов млекопитающих (например, поздний промотор аденовируса; 7.5K промотор вируса осповакцины).

В бактериальных системах число экспрессирующих векторов может быть преимущественно выбрано в зависимости от предполагаемого использования экспрессируемой молекулы. Например, когда должно быть произведено большое количество такого белка для получения фармацевтических композиций модулятора, может быть желательно использовать векторы, которые управляют экспрессией высоких уровней слитых белковых продуктов, которые легко очищаются. Такие векторы включают, но не ограничиваются ими, Е.coli экспрессирующий вектор pUR278 (Ruther et al., EMBO 1. 2: 1791 (1983)), в котором кодирующая последовательность может быть лигирована отдельно в вектор в рамке с кодирующей областью lac Z, так что продуцируется слитый белок; pIN векторы (Inouye & Inouye, Nucleic Acids Res. 13: 3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24: 5503-5509 (1989)); и тому подобное. Также можно использовать pGEX векторы для экспрессии чужеродных полипептидов в виде слитых белков с глутатион-5-трансферазой (GST). В целом, такие слитые белки являются растворимыми и могут быть легко очищены из лизируемых клеток посредством абсорбции и связывания с матриксными глутатион-агарозными сферообразными частицами и затем элюированы в присутствии свободного глутатиона. Разработаны pGEX векторы, включающие сайты расщепления тромбином или протеазой фактором Ха, так чтобы клонируемый продукт целевого гена мог быть высвобожден из GST-группировки.

В системе насекомых можно использовать Autographa californica nuclear polyhedrosis virus (AcNPV) (вирус ядерного полиэдроза калифорнийской люцерновой совки) в качестве вектора, экспрессирующего чужеродные гены. Вирус выращивают в клетках Spodoptera frugiperda. Кодирующие последовательности можно клонировать отдельно в несущественные области (например, ген полиэдрина) вируса и помещать под контроль промотора AcNPV (например, промотора полиэдрина).

В клетках-хозяевах млекопитающих ряд систем, основанных на вирусной экспрессии, можно использовать для введения нужной нуклеотидной последовательности. В случае использования аденовируса в качестве экспрессирующего вектора, представляющую интерес кодирующую последовательность можно лигировать с аденовирусным транскрипционным/трансляционным контролирующим комплексом, например поздним промотором и тройной лидерной последовательностью. Этот химерный ген затем можно встроить в аденовирусный геном посредством in vitro или in vivo рекомбинации. Вставка в несущественную область вирусного генома (например, область E1 или E3) приводит к рекомбинантному вирусу, который является жизнеспособным и способен экспрессировать молекулу в инфицированных хозяевах (например, см. Logan & Shenk, Proc. Natl. Acad. Sci. USA 8 1: 355-359 (1984)). Специфические сигналы инициации также могут требоваться для эффективной трансляции встроенных кодирующих последовательностей. Эти сигналы включают инициирующий кодон ATG и соседние последовательности. Кроме того, инициирующий кодон должен находиться в фазе с рамкой считывания нужной кодирующей последовательности, чтобы обеспечить трансляцию всей вставки. Эти экзогенные трансляционные контролирующие сигналы и инициирующие кодоны могут быть различного происхождения, как природными, так и синтетическими. Эффективность экспрессии можно увеличить путем включения подходящих энхансерных элементов транскрипции, терминаторов транскрипция и т.д. (см., например, Bittner et al., Methods in Enzymol. 153: 51-544 (1987)). Таким образом, совместимые клеточные линии млекопитающих, доступные в качестве хозяев для экспрессии, хорошо известны в данной области техники и включают многие иммортализованные клеточные линии, доступные в Американской коллекции типовых культур (ATCC). Они включают, среди прочего, клетки яичника китайского хомячка (CHO), клетки NS0, клетки SP2, клетки HEK-293Т, клетки 293 Freestyle (Life Technologies), клетки NIH-3T3, клетки HeLa, клетки почки новорожденного хомяка (BHK), клетки почки африканской зеленой мартышки (COS), клетки гепатоклеточной карциномы человека (например, Hep G2), клетки A549 и ряд других клеточных линий.

Для длительного, высокоэффективного продуцирования рекомбинантных белков предпочтительной является стабильная экспрессия. Соответственно, с использованием стандартных общепризнанных методов могут быть сконструированы клеточные линии, которые стабильно экспрессируют выбранный модулятор. Вместо использования экспрессирующих векторов, которые содержат вирусные точки начала репликации, клетки-хозяева могут быть трансформированы ДНК, контролируемой подходящими элементами контроля экспрессии (например, промотором, энхансером, последовательностями, терминаторами транскрипции, сайтами полиаденилирования и т.д.) и селектируемым маркером. Вслед за введением чужеродной ДНК, сконструированные клетки могут расти в течение 1-2 суток в обогащенной среде с последующим переносом на селективную среду. Селектируемый маркер в рекомбинантной плазмиде придает устойчивость к селекции и позволяет клеткам стабильно интегрировать плазмиду в свои хромосомы и расти с образованием фокусов, которые в свою очередь можно клонировать и увеличивать до клеточных линий. Этот метод преимущественно может быть использован для конструирования клеточных линий, которые экспрессируют молекулу. Такие сконструированные клеточные линии могут быть особенно полезны для скрининга и оценки композиций, которые прямо или опосредованно взаимодействуют с молекулой.

В данной области техники хорошо известен и может быть использован ряд селективных систем, включая, но не ограничиваясь ими, использование генов тимидинкиназы вируса простого герпеса (Wigler et al., Cell 11:223 (1977)), гипоксантингуанинфосфорибозилтрансферазы (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48: 202 (1992)) и аденинфосфорибозилтрансферазы (Lowy et al., Cell 22:8 17 (1980)) в клетках tk-, hgprt- или aprt- соответственно. Также, антиметаболическую устойчивость можно использовать как основу для селекции следующих генов: dhfr, который придает устойчивость к метотрексату (Wigler et al., Natl. Acad. Sci. USA 77: 357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78: 1527 (1981)); gpt, который придает устойчивость к микофеноловой кислоте (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, который придает устойчивость к аминогликозиду G-418 (Clinical Pharmacy 12: 488-505; Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260: 926-932 (1993); и Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); TIB TECH 11 (5): 155-215 (May, 1993)); и hygro, который придает устойчивость к гигромицину (Santerre et al., Gene 30: 147 (1984)). Способы, широко известные в области методов рекомбинантной ДНК, можно в установленном порядке применять для селекции необходимого рекомбинантного клона, и такие способы описаны, например, в Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); и в главах 12 и 13, в Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150: 1 (1981). Следует понимать, что один особенно предпочтительный способ получения стабильной высокоэффективной клеточной линии включает систему экспрессии гена глутаминсинтетазы (система GS), которая обеспечивает эффективный подход для повышения экспрессии в определенных условиях. Система GS обсуждается во всей полноте или частично в связи с европейскими патентами 0216846, 0256055, 0323997 и 0338841, каждый из которых включен в данную заявку посредством ссылки.

Кроме того, можно выбирать штамм клетки-хозяина, который модулирует экспрессию встроенных последовательностей или модифицирует и подвергает процессингу продукт гена желательным конкретным образом. Такие модификации (например, гликозилирование) и процессинг (например, расщепление) белковых продуктов могут быть важными для функционирования и/или очистки белка. Разные клетки-хозяева имеют характерные и специфические механизмы посттрансляционного процессинга и модификации белков и продуктов гена. Как известно в данной области, можно выбрать подходящие клеточные линии или системы хозяев, которые обеспечивают нужную модификацию и процессинг экспрессируемого полипептида. С этой целью эукариотические клетки-хозяева, которые обладают клеточным аппаратом для надлежащего процессинга первичного транскрипта, гликозилирования и фосфорилирования продукта гена, являются особенно эффективными для применения в настоящем изобретении. Соответственно, особенно предпочтительные клетки-хозяева млекопитающих включают, но не ограничиваются ими, CHO, VERY, BHK, HeLa, COS, NSO, MDCK, 293, 3T3, W138, а также клеточные линии рака молочной железы, такие как, например, BT483, Hs578T, HTB2, BT20 и T47D, и нормальную клеточную линию молочной железы, такую как, например, CRL7030 и HsS78Bst. В зависимости от модулятора и выбранной системы продуцирования специалисты в данной области могут легко выбрать и оптимизировать клетки-хозяева для эффективной экспрессии модулятора.

б. Химический синтез

Следует понимать, что, кроме вышеупомянутых систем клеток-хозяев, модуляторы по изобретению могут быть химически синтезированы с использованием методов, известных в данной области (например, см. Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., и Hunkapiller, M., et al., 1984, Nature 310: 105-111). Например, пептид, соответствующий полипептидному фрагменту по изобретению, можно синтезировать с использованием пептидного синтезатора. Кроме того, при необходимости неклассические аминокислоты или химические аналоги аминокислот можно вставить в качестве замены или добавления в полипептидную последовательность. Неклассические аминокислоты включают, но не ограничиваются ими, D-изомеры обычных аминокислот, 2,4-диаминомасляную кислоту, a-аминоизомасляную кислоту, 4-аминомасляную кислоту, Abu, 2-аминомасляную кислоту, g-Abu, e-Ahx, 6-аминокапроновую кислоту, Aib, 2-аминоизомасляную кислоту, 3-аминопропионовую кислоту, орнитин, норлейцин, норвалин, гидроксипролин, саркозин, цитруллин, гомоцитруллин, цистеиновую кислоту, трет-бутилглицин, трет-бутилаланин, фенилглицин, циклогексилаланин, b-аланин, фтор-аминокислоты, сконструированные аминокислоты, такие как b-метил-аминокислоты, Ca-метил-аминокислоты, Na-метил-аминокислоты и аналоги аминокислот в целом. Кроме того, аминокислота может быть D (правовращающей) или L (левовращающей).

в. Трансгенные системы

Модуляторы PTK7 по изобретению также можно получить трансгенно путем получения млекопитающего или растения, которое является трансгенным в отношении представляющих интерес последовательностей тяжелой и легкой цепи иммуноглобулина (или их фрагментов или производных или вариантов), и получения нужных компонентов в извлекаемой форме. Применительно к трансгенному получению в млекопитающих, анти-PTK7 антитела, например, можно получить и извлечь из молока коз, коров и других млекопитающих. См., например, патенты США 5827690, 5756687, 5750172 и 5741957. В некоторых воплощениях не являющиеся человеком трансгенные животные, которые содержат локус человеческого иммуноглобулина, иммунизированы PTK7 или его иммуногенной частью, как описано выше. Методы получения антител в растениях описаны, например, в патентах США 6046037 и 5959177.

Согласно данному руководству не являющиеся человеком трансгенные животные или растения можно получить путем введения одной или более молекул нуклеиновой кислоты, кодирующих модулятор PTK7 по изобретению, в животное или растение посредством стандартных трансгенных методов. См. Hogan и патент США 6417429. Трансгенные клетки, используемые для получения трансгенного животного, могут быть эмбриональными стволовыми клетками или соматическими клетками или оплодотворенной яйцеклеткой. Трансгенные не являющиеся человеком организмы могут быть химерными, нехимерными гетерозиготами и нехимерными гомозиготами. См., например, Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual 2nd ed., Cold Spring Harbor Press (1999); Jackson et al., Mouse Genetics and Transgenics: A Practical Approach, Oxford University Press (2000); и Pinkert, Transgenic Animal Technology: A Laboratory Handbook, Academic Press (1999) В некоторых воплощениях, трансгенные, не являющиеся человеком животные имеют целевой разрыв и замещение целевой конструкцией, которая кодирует, например, интересующую тяжелую цепь и/или легкую цепь. В одном воплощении трансгенные животные содержат и экспрессируют молекулы нуклеиновой кислоты, кодирующие тяжелые и легкие цепи, которые специфически связываются с PTK7. В то время как анти-PTK7 антитела можно получить в любом трансгенном животном, в особенно предпочтительных воплощениях не являющиеся человеком животные представляют собой мышей, крыс, овец, свиней, коз, крупный рогатый скот или лошадей. В дополнительных воплощениях не являющееся человеком трансгенное животное экспрессирует нужный фармацевтический продукт в кровь, молоко, мочу, слюну, слезы, слизь и другие физиологические жидкости, из которых его легко получить с использованием общепризнанных методов очистки.

Вероятно, модуляторы, включая антитела, экспрессируемые разными клеточными линиями или в трансгенных животных, будут иметь отличные друг от друга профили гликозилирования. Однако все модуляторы, кодируемые молекулами нуклеиновой кислоты, представленными здесь, или содержащие аминокислотные последовательности, представленные здесь, являются частью настоящего изобретения, независимо от статуса гликозилирования молекулы и, в более общем смысле, независимо от присутствия или отсутствия посттрансляционной(ых) модификации(ий). Также изобретение охватывает модуляторы, которые по-разному модифицированы во время или после трансляции, например посредством гликозилирования, ацетилирования, фосфорилирования, амидирования, получения производных с помощью известных защитных/блокирующих групп, протеолитического расщепления, соединения с молекулой антитела или другим клеточным лигандом и т.д. Любую из многочисленных химических модификаций можно выполнять с помощью известных методов, включая, но не ограничиваясь ими, специфическое химическое расщепление с помощью бромциана, трипсина, химотрипсина, папаина, протеазы V8, NaBH4, ацетилирования, формилирования, окисления, восстановления, метаболического синтеза в присутствии туникамицина и т.д. Различные посттрансляционные модификации также охваченные изобретением, включают, например, N-связанные или О-связанные углеводные цепи, процессинг N-концов или С-концов, присоединение химических группировок к аминокислотному каркасу, химические модификации N-связанной или O-связанной углеводной цепи и добавление или удаление N-концевого остатка метионина в результате экспрессии в прокариотической клетке-хозяине. Кроме того, как представлено в тексте и Примерах ниже, полипептиды также могут быть модифицированы с помощью детектируемого маркера, такого как ферментативная, флуоресцентная, радиоизотопная или аффинная метка, позволяющая обнаружить и выделить модулятор.

г. Очистка

Если модулятор по изобретению был получен посредством рекомбинантной экспрессии или любым другим методом, раскрытым в данном описании изобретения, его можно очистить любым, известным в данной области методом очистки иммуноглобулинов или, в более общем смысле, любым другим стандартным методом очистки белков. При этом можно выделить модулятор. При использовании здесь, выделенный модулятор PTK7 представляет собой модулятор, который идентифицирован и выделен и/или извлечен из компонента его естественного окружения. Загрязняющие компоненты его природного окружения представляют собой вещества, которые мешают диагностическим или терапевтическим применениям полипептида и могут включать ферменты, гормоны и другие белковые или небелковые растворенные вещества. Выделенные модуляторы включают модулятор in situ в рекомбинантных клетках, так как по меньшей мере один компонент полипептидного природного окружения будет отсутствовать

При использовании рекомбинантных методов модулятор PTK7 (например, анти-PTK7 антитело или его производное или фрагмент) может продуцироваться внутриклеточно, в периплазматическом пространстве или непосредственно секретироваться в среду. Если нужная молекула продуцируется внутриклеточно, на первой стадии дебрис в форме частиц, или клетки-хозяева или лизированные фрагменты, можно удалить, например посредством центрифугирования или ультрафильтрации. Например, в Carter, et al., Bio/Technology 10: 163 (1992) описан процесс выделения антител, секретируемых в периплазматическое пространство Е.coli. В кратком изложении, клеточную массу оттаивают в присутствии ацетата натрия (pH 3,5), EDTA и фенилметилсульфонилфторида (PMSF) в течение примерно 30 минут. Клеточный дебрис можно удалить путем центрифугирования. Если антитело секретируется в среду, супернатанты из таких экспрессирующих систем, как правило, сначала концентрируют с использованием имеющегося в продаже фильтра для концентрирования белка, например, устройства для ультрафильтрации Amicon или Millipore Pellicon. Ингибитор протеазы, такой как PMSF, может быть включен в любую из вышеуказанных стадий для ингибирования протеолиза и антибиотики могут быть включены для предотвращения роста случайных загрязнений.

Модуляторную композицию (например, fc-PTK7 или анти-PTK7 антитело), полученную из клеток, можно очистить с использованием, например, гидроксиапатитной хроматографии, гель-электрофореза, диализа и аффинной хроматографии, при этом аффинная хроматография является предпочтительным методом очистки. Пригодность белка А в качестве аффинного лиганда зависит от вида и изотипа любого Fc-домена иммуноглобулина, который присутствует в выбранной конструкции. Белок А можно использовать для очистки антител, которые основаны на тяжелых цепях IgG1, IgG2 или IgG4 человека (Lindmark, et al., J Immunol Meth 62: 1 (1983)). Белок G рекомендуется для всех мышиных изотипов и для IgG3 человека (Guss, et al., EMBO J 5: 1567 (1986)). Матрица, к которой присоединен аффинный лиганд, чаще всего представляет собой агарозу, но также имеются другие матрицы. Механически стабильные матрицы, такие как стекло с контролируемым размером пор или поли(стиролдивинил)бензол, обеспечивают большие скорости потока и более короткое время обработки, чем может быть достигнуто с помощью агарозы. Если антитело содержит домен CH3, полезной для очистки является смола Bakerbond АВХ™ (J.T. Baker; Phillipsburg, N.J.). Другие методы очистки белка, такие как фракционирование на ионообменной колонке, осаждение этанолом, ВЭЖХ с обращенной фазой, хроматография на диоксиде кремния, хроматография на гепарине, сефарозная хроматография на анионо- или катионообменной смоле (такой как колонка с полиаспарагиновой кислотой), хроматофокусирование, SDS-PAGE (электрофорез в полиакриламидном геле с додецилсульфатом натрия) и осаждение сульфатом аммония, также доступны в зависимости от выделяемого антитела. В особенно предпочтительных воплощениях модуляторы по настоящему изобретению будут очищены, по меньшей мере частично, с использованием аффинной хроматографии с участием белка А или белка G.

XI. Конъюгированные модуляторы PTK7

Если модуляторы по изобретению были очищены, согласно данному руководству, они могут быть связаны, слиты, конъюгированы (например, ковалентно или нековалентно) или другим образом соединены с фармацевтически активными или диагностическими группировками или биосовместимыми модификаторами. Здесь термин "конъюгировать" используется в широком смысле и означает любую молекулу, находящуюся в ассоциации с раскрытыми модуляторами, независимо от способа ассоциации. В связи с этим понятно, что такие конъюгаты могут содержать пептиды, полипептиды, белки, полимеры, молекулы нуклеиновой кислоты, небольшие молекулы, миметики, синтетические лекарственные средства, неорганические молекулы, органические молекулы и радиоизотопы. Кроме того, как указано выше, выбранный конъюгат может быть ковалентно или нековалентно соединен с модулятором и может иметь различные молярные соотношения в зависимости, по меньшей мере частично, от метода, используемого для осуществления конъюгирования.

В предпочтительных воплощениях очевидно, что модуляторы по изобретению могут быть конъюгированы или находиться в ассоциации с белками, полипептидами или пептидами, которые придают им выбранные характеристики (такими как биотоксины, биомаркеры, метки для очистки и т.д.). В более общем случае, в выбранных воплощениях настоящее изобретение охватывает применение модуляторов или их фрагментов, рекомбинантно слитых или химически конъюгированных (включая ковалентные и нековалентные конъюгации) с гетерологичным белком или полипептидом, где полипептид содержит по меньшей мере 10, по меньшей мере 20, по меньшей мере 30, по меньшей мере 40, по меньшей мере 50, по меньшей мере 60, по меньшей мере 70, по меньшей мере 80, по меньшей мере 90 или по меньшей мере 100 аминокислот. Эта конструкция не обязательно должна быть непосредственно связана, но может быть соединена через линкерные последовательности. Например, антитела могут быть использованы для нацеливания гетерологичных полипептидов на определенные клеточные типы, экспрессирующие PTK7, или in vitro или in vivo, посредством слияния или конъюгирования модуляторов по настоящему изобретению с антителами, специфичными к конкретным рецепторам клеточной поверхности. Кроме того, модуляторы, слитые или конъюгированные с гетерологичными полипептидами, также могут быть использованы в иммуноанализах in vitro и могут быть совместимы со способом очистки, известным в данной области. См., например, международную публикацию WO 93/21232; европейский патент ЕР 439095; Naramura et al., 1994, Immunol. Lett. 39: 91-99; патент США 5474981; Gillies et al., 1992, PNAS 89: 1428-1432; и Fell et al., 1991, J. Immunol. 146: 2446-2452.

а. Биосовместимые модификаторы

В предпочтительном воплощении модуляторы по изобретению могут быть конъюгированы или другим способом соединены с биосовместимыми модификаторами, которые можно использовать, при необходимости, для регулирования, изменения, улучшения или ослабления характеристик модулятора. Например, антитела или слитые конструкции с увеличенным временем полужизни in vivo можно получить путем присоединения молекул полимера с относительно высокой молекулярной массой, таких как имеющийся в продаже полиэтиленгликоль (PEG) или аналогичные биосовместимые полимеры. Специалистам в данной области понятно, что PEG можно получить с множеством различных молекулярных масс и молекулярных конфигураций, которые могут быть выбраны, чтобы придать конкретные свойства антителу (например, можно скорректировать время полужизни). PEG можно присоединить к модуляторам или фрагментам или производным антитела посредством или без помощи мультифункционального линкера, либо посредством сайт-специфической конъюгации PEG с N- или C-концом указанных антител или фрагментов антитела, либо посредством эпсилон-аминогрупп, присутствующих на остатках лизина. Можно использовать получение производных линейных или разветвленных полимеров, приводящее к минимальной потере биологической активности. За степенью конъюгации можно с большой точностью следить с помощью SDS-PAGE и масс-спектрометрии, чтобы обеспечить оптимальную конъюгацию молекул PEG с молекулами антител. Непрореагировавший PEG может быть отделен от конъюгатов антитело-PEG, например посредством гель-фильтрации или ионнообменной хроматографии. Аналогичным образом, раскрытые модуляторы могут быть конъюгированы с альбумином для того, чтобы сделать антитело или фрагмент антитела более стабильным in vivo или обеспечить более продолжительное временя полужизни in vivo. Эти способы хорошо известны в данной области техники, см., например, международную публикацию WO 93/15199, WO 93/15200 и WO 01/77137; и европейский патент 0413622. Другие биосовместимые конъюгаты являются очевидными для специалистов и могут быть легко идентифицированы в соответствии с данным руководством.

б. Диагностические и детектируемые агенты

В других предпочтительных воплощениях модуляторы по настоящему изобретению или их фрагменты или производные конъюгированы с диагностическим или детектируемым агентом, маркером или репортером, который может представлять собой биологическую молекулу (например, пептид или нуклеотид), небольшую молекулу, флуорофор или радиоизотоп. Меченые модуляторы могут быть полезны для мониторинга развития или прогрессирования гиперпролиферативных расстройств или как часть клинической процедуры тестирования для определения эффективности конкретной терапии, включающей раскрытые модуляторы (т.е. терагностики). Такие маркеры или репортеры также могут быть полезны для очистки выбранного модулятора, отделения или выделения TIC либо во время доклинических процедур, либо в токсикологических исследованиях.

Такая диагностика и обнаружение могут быть выполнены путем соединения модулятора с детектируемыми веществами, включая, но не ограничиваясь ими, различные ферменты, включающие, например, пероксидазу хрена, щелочную фосфатазу, бета-галактозидазу или ацетилхолинэстеразу; простетические группы, такие как, но не ограничиваясь ими, стрептавидин/биотин и авидин/биотин; флуоресцентные вещества, такие как, но не ограничиваясь ими, умбеллиферон, флуоресцеин, флуоресцеина изотиоцианат, родамин, дихлортриазиниламин-флуоресцеин, дансилхлорид или фикоэритрин; люминесцентные вещества, такие как, но не ограничиваясь им, люминол; биолюминесцентные вещества, такие как, но не ограничиваясь ими, люцифераза, люциферин и экворин; радиоактивные вещества, такие как, но не ограничиваясь ими, йод (131I, 125I, 123I, 121I), углерод (14C), сера (35S), тритий (3H), индий (115In, 113In, 112In, 111In) и технеций (99Tc), таллий (201Ti), галлий (68Ga, 67Ga), палладий (103Pd), молибден (99Mo), ксенон (133Xe), фтор (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 105Rh, 97Ru, 68Ge, 57Co, 65Zn, 85Sr, 32P, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn и 117Tin; позитрон-испускающие металлы с использованием различных видов позитронно-эмиссионной томографии, нерадиоактивные ионы парамагнитных металлов и молекулы, которые помечены радиоактивными изотопами или конъюгированы с конкретными радиоизотопами. В таких воплощениях соответствующая методика обнаружения хорошо известна в данной области и доступна из различных коммерческих источников.

Как указано выше, в других воплощениях модуляторы или их фрагменты могут быть слиты с маркерными последовательностями, такими как пептид или флуорофор, для облегчения процедур очистки или диагностики, таких как иммуногистохимия или FAC. В предпочтительных воплощениях маркерная аминокислотная последовательность представляет собой гексагистидиновый (SEQ ID NO: 7) пептид, такой как, наряду с прочими, тег, представленный в векторе pQE (Qiagen), многие из которых имеются в продаже. Как описано в Gentz et al., 1989, Proc. Natl. Acad. Sci. USA 86: 821-824, например, гексагистидин обеспечивает удобную очистку слитого белка. Другие пептидные теги, полезные для очистки, включают, но не ограничиваются ими, тег гемагглютинина "HA", который соответствует эпитопу, полученному из белка гемагглютинина вируса гриппа (Wilson et al., 1984, Cell 37: 767) и тег "flag" (патент США 4703004).

в. Терапевтические группировки

Как уже упоминалось, модуляторы или их фрагменты или производные также могут быть конъюгированы, связаны или слиты, или иным образом соединены с терапевтической группировкой, такой как противораковые агенты, цитотоксин или цитотоксический агент, например цитостатический или цитопатический агент, терапевтический агент или ион радиоактивного металла, например альфа- или бета-излучатели. При использовании здесь, цитотоксин или цитотоксический агент включает любой агент или терапевтическую группировку, которая губительная для клеток и может ингибировать рост или выживание клеток. Примеры включают паклитаксел, цитохалазин В, грамицидин D, этидия бромид, эметин, митомицин, этопозид, тенопозид, винкристин, винбластин, колхицин, доксорубицин, даунорубицин, дигидроксиантрацин, майтанзиноиды, такие как DM-1 и DM-4 (Immunogen, Inc.), дион, митоксантрон, митрамицин, актиномицин D, 1-дегидротестостерон, глкжокортикоиды, прокаин, тетракаин, лидокаин, пропранолол, пуромицин, эпирубицин и циклофосфамид и его аналоги или гомологи. Дополнительные цитотоксины включают ауристатины, в том числе монометилауристатин Ε (MMAE) и монометилауристатин F (MMAF) (Seattle Genetics, Inc.), аманитины, такие как альфа-аманитин, бета-аманитин, гамма-аманитин или эпсилон-аманитин (Heidelberg Pharma AG), агенты, связывающиеся с малой бороздой ДНК, такие как производные дуокармицина (Syntarga, B.V.) и модифицированные димеры пирролобензодиазепина (PBD, Spirogen, Ltd). Кроме того, в одном воплощении модуляторы PTK7 по настоящему изобретению могут быть соединены с анти-CD3 связывающими молекулами для рекрутмента цитотоксических Т-клеток и нацеливания их на опухоль-инициирующие клетки (ΒΠΈ технология; см., например, Fuhrmann, S. et. al. Annual Meeting of AACR Abstract No. 5625 (2010), который включен сюда посредством ссылки).

Дополнительные совместимые терапевтические группировки включают цитотоксические агенты, включая, но не ограничиваясь ими, антиметаболиты (например, метотрексат, 6-меркаптопурин, 6-тиогуанин, цитарабин, 5-фторурацил-декарбазин), алкилирующие агенты (например, мехлорэтамин, тиотепа, хлорамбуцил, мелфалан, кармустин (BCNU) и ломустин (CCNU), циклофосфамид, бусульфан, дибромоманнитол, стрептозотоцин, митомицин C и цис-дихлордиамин платины(II) (DDP) цисплатин), антрациклины (например, даунорубицин (ранее дауномицин) и доксорубицин), антибиотики (например, дактиномицин (ранее актиномицин), блеомицин, митрамицин и антрамицин (АМС)) и антимитотические агенты (например, винкристин и винбластин). Более подробный перечень терапевтических группировок можно найти в публикации PCT WO 03/075957 и патенте США 2009/0155255, каждый из которых включен в данную заявку посредством ссылки.

Выбранные модуляторы также могут быть конъюгированы с терапевтическими группировками, такими как радиоактивные вещества, или с макроциклическими хелаторами, полезными для конъюгирования ионов радиоактивных металлов (см. выше примеры радиоактивных веществ). В некоторых воплощениях, макроциклический хелатор представляет собой 1,4,7,10-тетраазациклододекан-N,N',Nʺ,N'''-тетрауксусную кислоту (DOTA), которая может быть присоединена к антителу посредством линкерной молекулы. Такие линкерные молекулы общеизвестны в данной области и описаны в Denardo et al., 1998, Clin Cancer Res. 4:2483; Peterson et al., 1999, Bioconjug. Chem. 10:553; и Zimmerman et al., 1999, Nucl. Med. Biol. 26:943.

Примеры радиоизотопов, которые могут быть совместимы с этим аспектом изобретения, включают, без ограничения ими, йод (131I, I251, I231, I211), углерод (14C), медь (62Cu, 64Cu, 67Cu), серу (35S), тритий (3H), индий (115In, 113In, 112In, 111In), висмут (212Bi, 213Bi), технеций (99Tc), таллий (201Ti), галлий (68Ga, 67Ga), палладий (103Pd), молибден (99Mo), ксенон (133Xe), фтор (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 105Rh, 97Ru, 68Ge, 57Co, 65Zn, 65Sr, 32P, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn, 117Tin, 225Ac, 76Br и 211At. Другие радионуклиды также можно использовать в качестве диагностических и терапевтических агентов, особенно радионуклиды в диапазоне энергии от 60 до 4000 кэВ. В зависимости от подлежащего лечению состояния и желаемого терапевтического профиля, специалисты в данной области техники могут легко выбрать подходящий радиоизотоп для использования с раскрытыми здесь модуляторами.

Модуляторы PTK7 по настоящему изобретению также могут быть конъюгированы с терапевтической группировкой или лекарственным средством, который модифицирует данный биологический ответ (например, модификаторами биологического ответа или BRM). То есть терапевтические агенты или группировки, совместимые с настоящим изобретением, не следует рассматривать как ограниченные классическими химическими терапевтическими агентами. Например, в особенно предпочтительных воплощениях лекарственная группировка может быть белком или полипептидом или его фрагментом, обладающим нужной биологической активностью. Такие белки могут включать, например, токсин, такой как абрин, рицин A, онконаза (или другая цитотоксическая РНКаза), экзотоксин синегнойной палочки, холерный токсин или дифтерийный токсин; белок, такой как фактор некроза опухоли, α-интерферон, β-интерферон, фактор роста нервов, тромбоцитарный фактор роста, тканевой активатор плазминогена, апоптотический агент, например TNF-α, TNF-β, AIM I (см. международную публикацию WO 97/33899), AIM II (см. международную публикацию WO 97/34911), лиганд Fas (Takahashi et al., 1994, J. Immunol., 6: 1567) и VEGI (см. международную публикацию WO 99/23105), тромботический агент или антиангиогенный агент, например ангиостатин или эндостатин; или модификатор биологического ответа, такой как, например, лимфокин (например, интерлейкин-1 ("IL-1"), интерлейкин-2 ("IL-2"), интерлейкин-6 ("IL-6"), гранулоцитарно-макрофагальный колониестимулирующий фактор ("GM-CSF") и гранулоцитарный колониестимулирующий фактор ("G-CSF")) или фактор роста (например, гормон роста ("GH")). Как указано выше, методы слияния или конъюгирования модуляторов с полипептидными группировками известны в данной области. В дополнение к ранее раскрытым тематическим ссылкам см., например, патенты США 5336603; 5622929; 5359046; 5349053; 5447851 и 5112946; ЕР 307434; ЕР 367166; публикации PCT WO 96/04388 и WO 91/06570; Ashkenazi et al., 1991, PNAS USA 88:10535; Zheng et al., 1995, J Immunol 154:5590; и Vil et al., 1992, PNAS USA 89: 11337, каждая из которых включена в данную заявку посредством ссылки. Ассоциация модулятора с группировкой не обязательно должна быть непосредственной, но может быть осуществлена через линкерные последовательности. Такие линкерные молекулы общеизвестны в данной области и описаны в Denardo et al., 1998, Clin Cancer Res 4: 2483; Peterson et al., 1999, Bioconjug Chem 10: 553; Zimmerman et al., 1999, Nuci Med Biol 26: 943; Garnett, 2002, Adv Drug Deliv Rev 53: 171, каждая из которых включена в данную заявку.

В целом, способы конъюгирования терапевтических группировок или цитотоксических агентов с модуляторами хорошо известны. Группировки можно конъюгировать с модуляторами любым общепризнанным способом, включая, но не ограничиваясь ими, альдегидную связь/связь Шиффа, сульфгидрильную связь, кислотолабильную связь, цис-аконитильную связь, гидразонную связь, ферментативно разрушаемую связь (см. в общем Garnett, 2002, Adv Drug Deliv Rev 53:171). Также см., например, Amon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs in Cancer Therapy", в Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp.243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", в Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp.623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", в Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", в Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), и Thorpe et al., 1982, Immunol. Rev. 62: 119. В предпочтительных воплощениях модулятор PTK7, который конъюгирован с терапевтической группировкой или цитотоксическим агентом, может быть интернализован клеткой при связывании с молекулой PTK7, соединенной с клеточной поверхностью, тем самым обеспечивая доставку терапевтически полезного груза.

XII. Диагностика и скрининг

а. Диагностика

Как указано выше, в настоящем изобретении предлагаются in vitro или in vivo способы обнаружения, диагностики или мониторинга гиперпролиферативных расстройств и способы скрининга клеток пациента для идентификации онкогенных клеток, в том числе TPC. Такие способы включают идентификацию субъекта, имеющего рак, для лечения или мониторинга развития рака, включающую приведение пациента или образца, полученного от пациента, в контакт с выбранным модулятором PTK7, как описано здесь, и обнаружение присутствия или отсутствия, или уровня ассоциации модулятора со связанным или свободным PTK7 в образце. Если модулятор содержит антитело или его иммунологически активный фрагмент, ассоциация с конкретным PTK7 в образце вероятно означает, что образец может содержать клетки, поддерживающие опухоль (например, раковые стволовые клетки), что указывает на то, что субъекта, имеющего рак, можно эффективно лечить с помощью модулятора PTK7, как описано здесь. Способы могут дополнительно включать стадию сравнения уровня связывания с контролем. Напротив, когда выбранный модулятор представляет собой Fc-PTK7, можно использовать и контролировать связывающие свойства выбранного PTK7 (прямо или косвенно, in vivo или in vitro) при контакте с образцом для получения нужной информации. Другие диагностические или терагностические способы, совместимые с данным руководством, хорошо известны в данной области техники и могут быть осуществлены на практике с использованием имеющихся в продаже веществ, таких как специализированные репортерные системы.

В особенно предпочтительном воплощении модуляторы по настоящему изобретению можно использовать для выявления и количественного определения уровней PTK7 в образце, взятом от пациента (например, в плазме или крови), которое можно, в свою очередь, использовать для обнаружения, диагностики или контролирования PTK7-ассоциированных расстройств, в том числе гиперпролиферативных расстройств. В родственных воплощениях модуляторы по настоящему изобретению можно использовать для обнаружения, контролирования и/или количественной оценки циркулирующих опухолевых клеток in vivo или in vitro (см., например, WO 2012/0128801, который включен в настоящее описание посредством ссылки). В других предпочтительных воплощениях циркулирующие опухолевые клетки могут включать раковые стволовые клетки.

Типичные совместимые методы анализа включают радиоиммуноанализы, иммуноферментный анализы, анализы конкурентного связывания, флуоресцентный иммуноанализ, иммуноблот-анализ, Вестерн-блот-анализ, анализы посредством проточной цитометрии и анализы ELISA. В целом, обнаружение PTK7 в биологическом образце или измерение ферментативной активности PTK7 (или ее ингибирование) может быть осуществлено с использованием любого известного в данной области анализа. Совместимая in vivo терагностика или диагностика может включать признанные в данной области методы визуализации или контроля, такие как магнитно-резонансная томография (MRI), компьютерная томография (например, САТ(компьютерная аксиальная томография)-сканирование), позитронная томография (например, PET-сканирование), рентгенография, ультразвук и т.д. Специалисты в данной области легко могут узнать и осуществить подходящие методы обнаружения, контроля и визуализации (часто содержащие имеющиеся в продаже источники) на основании этиологии, патологических проявлений или клинического развития заболевания.

В другом воплощении изобретения предлагается способ анализа развития рака и/или патогенеза in vivo. В другом воплощении анализ развития рака и/или патогенеза in vivo включает определение степени развития опухоли. В еще одном воплощении анализ включает идентификацию опухоли. В еще одном воплощении анализ развития опухоли выполняют на первичной опухоли. В еще одном воплощении анализ выполняют в течение некоторого времени в зависимости от типа рака, как это известно специалисту в данной области. В еще одном воплощении дополнительный анализ вторичных опухолей, происходящих из метастазирующих клеток первичной опухоли, осуществляют in vivo. В еще одном воплощении анализируют размер и форму вторичных опухолей. В некоторых воплощениях выполняют дополнительный анализ ех vivo.

В еще одном воплощении изобретения предлагается способ анализа развития и/или патогенеза рака in vivo, включающий определение метастазирования клеток и количественное определение уровня циркулирующих опухолевых клеток. В еще одном воплощении анализ метастазирования клеток включает определение прогрессирующего роста клеток в месте, которое отделено от первичной опухоли. В еще одном воплощении, анализ места метастазирования клеток включает путь опухолевого распространения. В некоторых воплощениях клетки могут распространяться через кровеносные сосуды, лимфатические сосуды, полости тела или их комбинацию. В еще одном воплощении анализ метастазирования клеток выполняют, принимая во внимание миграцию клеток, распространение, экстравазацию, пролиферацию или их комбинацию.

В некоторых примерах онкогенные клетки у субъекта или в образце, взятом у субъекта, можно оценить или охарактеризовать с использованием раскрытых модуляторов для того, чтобы установить исходный уровень перед терапией или схемой лечения. В других примерах образец получают от субъекта, подвергавшегося лечению. В некоторых примерах образец берут от субъекта по меньшей мере примерно через 1, 2, 4, 6, 7, 8, 10, 12, 14, 15, 16, 18, 20, 30, 60, 90 суток, 6 месяцев, 9 месяцев, 12 месяцев или более 12 месяцев после начала или окончания лечения субъекта. В некоторых примерах онкогенные клетки оценивают или характеризуют после определенного числа доз (например, после 2, 5, 10, 20, 30 или более доз лечения). В других примерах онкогенные клетки характеризуют или оценивают через 1 неделю, 2 неделю, 1 месяц, 2 месяца, 1 год, 2 года, 3 года, 4 года или более после получения одной или более терапий.

В другом аспекте и, как описано более подробно ниже, в настоящем изобретении предлагаются наборы для определения, контролирования или диагностики гиперпролиферативного расстройства, идентифицирующие субъекта, имеющего такое расстройство, для возможного лечения или мониторинга развития (или регрессии) расстройства у пациента, где набор содержит модулятор, как описано здесь, и реагенты для определения влияния модулятора на образец.

б. Скрининг

Модуляторы PTK7 и клетки, культуры, популяции и композиции, содержащие их, в том числе их потомки, также можно использовать для скрининга или идентификации соединений или агентов (например, лекарственных средств), которые влияют на функцию или активность опухоль-инициирующих клеток или их потомство посредством взаимодействия с PTK7 (например, его полипептидные или генетические компоненты). Следовательно, в изобретении дополнительно предлагаются системы и способы оценки или идентификации соединения или агента, который может влиять на функцию или активность опухоль-инициирующих клеток или их потомства посредством соединения с PTK7 или его субстратами. Такие соединения и агенты могут быть кандидатами в лекарственные средства, которые отбирают, например, для лечения гиперпролиферативного расстройства. В одном воплощении система или способ включает опухоль-инициирующие клетки, имеющие PTK7, и соединение или агент (например, лекарственное средство), где клетки и соединение или агент (например, лекарственное средство) находятся в контакте друг с другом.

В изобретении также предложены способы скрининга и идентификации модуляторов PTK7 или агентов и соединений для изменения активности или функции опухоль-инициирующих клеток или потомства клеток. В одном воплощении способ включает контактирование опухоль-инициирующих клеток или их потомства с тестируемым агентом или соединением; и определение, модулирует ли этот тестируемый агент или соединение активность или функцию ассоциированных с PTK7 опухоль-инициирующих клеток.

Тестируемый агент или соединение, модулирующие PTK7-зависимую активность или функцию таких опухоль-инициирующих клеток или их потомства внутри популяции, идентифицирует тестируемый агент или соединение в качестве активного агента. Примеры активности или функции, которые могут быть модулированы, включают изменения морфологии клеток, экспрессии маркера, дифференцировки или дедифференцировки, созревания, пролиферации, жизнеспособности, апоптоза или клеточной гибели клеток-предшественников нейронов или их потомства.

Контактирование, при использовании в отношении клеток или клеточной культуры или стадии способа или лечения, означает непосредственное или опосредованное взаимодействие между композицией (например, ассоциированная с PTK7 клетка или клеточная культура) и другим упомянутым объектом. Конкретным примером непосредственного взаимодействия является физическое взаимодействие. Конкретным примером опосредованного взаимодействия является воздействие композиции на промежуточную молекулу, которая в свою очередь воздействует на указанный объект (например, клетку или клеточную культуру).

В этом аспекте изобретения "модулирует" указывает на влияние на активность или функцию опухоль-инициирующих клеток или потомства клеток способом, совместимым с определением воздействий на клеточную активность или функцию, который, как было определено, является релевантным к конкретному аспекту (например, метастазированию или пролиферации) опухоль-инициирующих клеток или потомства клеток по изобретению. Примеры активностей и функций включают, но не ограничиваются ими, морфологические измерения, маркеры развития, дифференцировку, пролиферацию, жизнеспособность, клеточное дыхание, митохондриальную активность, целостность мембраны или экспрессию маркеров, ассоциированных с определенными условиями. Соответственно, соединение или агент (например, кандидат в лекарственные средства) можно оценить по его воздействию на опухоль-инициирующие клетки или потомство клеток, посредством приведения таких клеток или потомства клеток в контакт с соединением или агентом и измерения любой модуляции активности или функции опухоль-инициирующих клеток или потомства клеток, как описано здесь или известно специалисту.

Способы скрининга и идентификации агентов и соединений включают способы, пригодные для высокопроизводительного скрининга, который включает массивы клеток (например, микроматрицы), расположенные или помещенные, возможно, в заранее определенных положениях или местах. Высокопроизводительными роботизированными или ручными способами обработки можно исследовать химические взаимодействия и определить уровни экспрессии множества генов в течение короткого периода времени. Разработаны способы, использующие молекулярные сигналы (например, флуорофоры) и автоматизированные анализы, которые обрабатывают информацию в очень быстром темпе (см., например, Pinhasov et al., Comb. Chem. High Throughput Screen. 7: 133 (2004)). Например, технология микроматрицы была широко использована для исследования взаимодействия тысяч генов одновременно, обеспечивая при этом информацию для конкретных генов (см., например, Mocellin and Rossi, Adv. Exp. Med. Biol. 593: 19 (2007)).

Такими методами скрининга (например, высокопроизводительными) можно быстро и эффективно идентифицировать активные агенты и соединения. Например, клетки могут быть расположены или размещены (предварительно посеяны) в культуральной чашке, пробирке, колбе, роллер-флаконе или планшете (например, в одном многолуночном планшете или чашке, таких как 8-, 16-, 32-, 64-, 96-, 384- и 1536-мультилуночный планшет или чашка), возможно в определенных положениях для идентификации потенциально терапевтических молекул. Библиотеки, которые можно скринировать, включают, например, библиотеки небольших молекул, библиотеки фагового дисплея, дрожжевые дисплейные библиотеки полностью человеческого антитела (Adimab, LLC), библиотеки миРНК и аденовирусных векторов для трансфекции.

XIII. Фармацевтические препараты и терапевтические применения

а. Композиции и способы введения

В зависимости от формы модулятора наряду с любым дополнительным конъюгатом, способа предполагаемой доставки, лечения или контролирования заболевания, и многих других параметров, можно разработать, при желании, композиции по настоящему изобретению в соответствии с признанными в данной области методами. То есть в различных воплощениях настоящего изобретения разработаны композиции, содержащие модуляторы PTK7, с широким множеством фармацевтически приемлемых носителей (см., например, Gennaro, Remington: The Science and Practice of Pharmacy with Facts and Comparisons: Drugfacts Plus, 20th ed. (2003); Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th ed., Lippencott Williams and Wilkins (2004); Kibbe et al., Handbook of Pharmaceutical Excipients, 3rd ed., Pharmaceutical Press (2000)). Различные фармацевтически приемлемые носители, которые включают наполнители, адъюванты и разбавители, легкодоступны их многочисленных коммерческих источников. Кроме того, также доступен ряд фармацевтически приемлемых вспомогательных веществ, таких как pH-регулирующие агенты и буферные агенты, регулирующие тоничность агенты, стабилизаторы, смачивающие агенты и тому подобные. Некоторые неограничивающие примеры носителей включают физиологический раствор, буферный солевой раствор, декстрозу, воду, глицерин, этанол и их комбинации.

В частности, следует понимать, что в некоторых воплощениях терапевтические композиции по изобретению можно вводить в чистом виде или с минимальным количеством дополнительных компонентов. Напротив, модуляторы PTK7 по настоящему изобретению возможно могут быть приготовлены в виде препарата так, чтобы содержать подходящие фармацевтически приемлемые носители, включающие эксципиенты и вспомогательные вещества, которые хорошо известны в данной области техники и являются относительно инертными веществами, облегчающими введение модулятора или помогающими в переработке активных соединений в препараты, фармацевтически оптимизированные для доставки в место действия. Например, эксципиент может придавать форму или консистенцию или действовать в качестве разбавителя для улучшения фармакокинетики модулятора. Подходящие эксципиенты включают, но не ограничиваются ими, стабилизаторы, смачивающие агенты и эмульгаторы, соли для изменения осмолярности, инкапсулирующие агенты, буферы и усилители проникновения через кожу.

Раскрытые модуляторов для системного введения могут быть приготовлены в виде препаратов для энтерального, парентерального или местного введения. Действительно, все три типа композиции могут быть использованы одновременно для достижения системного введения активного ингредиента. Эксципиенты, а также композиции для парентерального и непарентерального введения лекарственного средства, представлены в Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing (2000). Подходящие композиции для парентерального введения включают водные растворы активных соединений в водорастворимой форме, например водорастворимые соли. Кроме того, можно вводить суспензии активных соединений в виде подходящих масляных суспензий для инъекций. Подходящие липофильные растворители или носители включают жирные масла, например кунжутное масло, или синтетические эфиры жирных кислот, например этилолеат или триглицериды. Водные инъекционные суспензии могут содержать вещества, которые увеличивают вязкость суспензии, и включают, например, натрийкарбоксиметилцеллюлозу, сорбит и/или декстран. Возможно, что суспензия также может содержать стабилизаторы. Также можно использовать липосомы для инкапсуляции агента для доставки в клетку.

Подходящие препараты для энтерального введения, включают твердые или мягкие желатиновые капсулы, пилюли, таблетки, включая таблетки с оболочкой, эликсиры, суспензии, сиропы или ингаляции и их контролируемые высвобождаемые формы.

В целом, соединения и композиции по изобретению, содержащие модуляторы PTK7, можно вводить in vivo нуждающемуся в этом субъекту посредством различных способов, включая, но не ограничиваясь ими, пероральное, внутривенное, внутриартериальное, подкожное, парентеральное, интраназальное, внутримышечное, внутрисердечное, внутрижелудочковое, внутритрахеальное, буккальное, ректальное, внутрибрюшинное, внутрикожное, местное, чрескожное и интратекальное, или путем имплантации или ингаляции. Интересующие композиции могут быть изготовлены в виде препаратов в твердой, полутвердой, жидкой или газообразной форме, включая, но не ограничиваясь ими, таблетки, капсулы, порошки, гранулы, мази, растворы, суппозитории, клизмы, инъекции, ингаляции и аэрозоли. Подходящая композиция и путь введения могут быть выбраны в соответствии с предполагаемым применением и терапевтической схемой.

б. Дозы

Аналогично, конкретная схема приема лекарственного средства, т.е. доза, время и повторение, зависит от конкретного субъекта и его анамнеза. Эмпирические соображения, такие как фармакокинетика (например, время полужизни, скорость выведения и т.д.) будут вносить свой вклад в определение дозы. Частота введения может быть определена и скорректирована в течение курса терапии и основана на сокращении количества гиперпролиферативных или опухолевых клеток, в том числе опухоль-инициирующих клеток, поддерживая уменьшение таких опухолевых клеток, уменьшая пролиферацию опухолевых клеток или замедляя развитие метастазов. Кроме того, могут быть пригодными препараты интересующей терапевтической композиции с замедленным непрерывным высвобождением. Как упоминалось выше, в данной области известны различные композиции и устройства для достижения устойчивого высвобождения.

С терапевтической точки зрения фармацевтические композиции вводят в количестве эффективном для лечения или профилактики конкретного показания. Терапевтически эффективное количество, как правило, зависит от массы субъекта, подвергаемого лечению, его или ее физического состояния здоровья, обширности состояния, подлежащего лечению, или возраста субъекта, подвергаемого лечению. В целом, модуляторы PTK7 по изобретению можно вводить в количестве в диапазоне от примерно 10 мкг/кг массы тела до примерно 100 мг/кг массы тела на дозу. В некоторых воплощениях модуляторы PTK7 по изобретению могут быть введены в количестве в диапазоне от примерно 50 мкг/кг массы тела до примерно 5 мг/кг массы тела на дозу. В некоторых других воплощениях модуляторы PTK7 по изобретению могут быть введены в количестве в диапазоне от примерно 100 мкг/кг массы тела до примерно 10 мг/кг массы тела на дозу. Возможно, модуляторы PTK7 по изобретению могут быть введены в количестве в диапазоне от примерно 100 мкг/кг массы тела до примерно 20 мг/кг массы тела на дозу. Кроме того, возможно, модуляторы PTK7 по изобретению могут быть введены в количестве в диапазоне от примерно 0,5 мг/кг массы тела до примерно 20 мг/кг массы тела на дозу. В некоторых воплощениях предложенные соединения по настоящему изобретению вводят в дозе по меньшей мере примерно 100 мкг/кг массы тела, по меньшей мере примерно 250 мкг/кг массы тела, по меньшей мере примерно 750 мкг/кг массы тела, по меньшей мере примерно 3 мг/кг массы тела, по меньшей мере примерно 5 мг/кг массы тела, по меньшей мере примерно 10 мг/кг массы тела.

Другие режимы дозирования могут быть спрогнозированы на основании расчетов площади поверхности тела (BSA), как раскрыто в патенте США 7744877, который включен в данную заявку посредством ссылки во всей полноте. Как хорошо известно в данной области, BSA рассчитывают, используя рост и массу пациента, и она предоставляет собой размер субъекта, представленный площадью поверхности его или ее тела. В выбранных воплощениях изобретения с использованием BSA, модуляторы можно вводить в дозах от 10 мг/м2 до 800 мг/м2. В других предпочтительных воплощениях модуляторы вводят в дозах от 50 мг/м2 до 500 мг/м2 и еще более предпочтительно в дозе 100 мг/м2, 150 мг/м2, 200 мг/м2, 250 мг/м2, 300 мг/м2, 350 мг/м2, 400 мг/м2 или 450 мг/м2. Конечно, следует понимать, что, независимо от того как рассчитаны дозы, многократные дозы можно вводить в течение выбранного периода времени, чтобы обеспечить абсолютную дозу, которая значительно выше отдельных введений.

В любом случае модуляторы PTK7 предпочтительно вводят, как это требуется субъектам, нуждающимся в этом. Определение частоты введения может быть сделано специалистом в данной области техники, таким как лечащий врач, на основании рассмотрения состояния, подвергаемого лечению, возраста субъекта, подвергаемого лечению, тяжести состояния, подвергаемого лечению, общего состояния здоровья субъекта, подвергаемого лечению и тому подобное. Как правило, эффективную дозу модулятора PTK7 вводят пациенту за один или более раз. В частности, эффективную дозу модулятора вводят субъекту раз в месяц, чаще одного раза в месяц или реже одного раза в месяц. В некоторых воплощениях эффективная доза модулятора PTK7 может быть введена за несколько раз, в том числе в течение по меньшей мере месяца, по меньшей мере шести месяцев или по меньшей мере года. В других воплощениях интервал между введением раскрытых модуляторов может составлять несколько дней (2, 3, 4, 5, 6 или 7), несколько недель (1, 2, 3, 4, 5, 6, 7 или 8) или несколько месяцев (1, 2, 3, 4, 5, 6, 7 или 8).

Дозы и схемы приема лекарственных средств также можно определить эмпирически для раскрытых терапевтических композиций у субъектов, которые получали одно или более введений. Например, субъекты могут получать постепенно увеличивающиеся дозы терапевтической композиции, полученной, как описано здесь. Для оценки эффективности выбранной композиции можно следить за маркером конкретного заболевания, расстройства или состояния, как описано выше. В воплощениях, где субъект болен раком, это включает непосредственные измерения размера опухоли посредством пальпации или визуального наблюдения, косвенное измерение размера опухоли при помощи рентгеновских или других методов визуализации; улучшение при оценке посредством непосредственной биопсии опухоли и микроскопическое исследование образца опухоли; измерение косвенного опухолевого маркера (например, PSA для рака предстательной железы) или антигена, определенного в соответствии с описанными здесь способами, уменьшение боли или паралича; улучшение речи, зрения, дыхания или других форм инвалидности, связанных с опухолью; повышенный аппетит; или повышение качества жизни, измеренное согласно признанным тестам, или удлинение сроков выживания. Специалисту в данной области техники очевидно, что доза будет варьироваться в зависимости от субъекта, типа опухолевого состояния, стадии опухолевого состояния, начало ли опухолевое состояние метастазировать в другие области у субъекта и применяемого в прошлом и настоящем лечения.

в. Комбинированная терапия

Комбинированная терапия, предусмотренная изобретением, может быть особенно полезна в уменьшении или ингибировании нежелательной пролиферации опухолевых клеток (например, эндотелиальных клеток), уменьшении частоты возникновения рака, уменьшении или предупреждении рецидива рака, или уменьшении или предупреждении распространения или метастазирования рака. В таких случаях соединения по настоящему изобретению могут функционировать как сенсибилизирующие или хемосенсибилизирующие агенты путем ликвидации поддержки TPC и сохранения опухолевой массы (например, NTG-клеток) и позволяют более эффективно использовать современное стандартное лечение с помощью циторедуктивных или противораковых агентов. То есть комбинированную терапию, включающую модулятор PTK7 и один или более противораковых агентов, можно использовать для ослабления установленного рака, например для уменьшения количества присутствующих раковых клеток и/или уменьшения тяжести опухоли, или облегчения по меньшей мере одного проявления или побочного эффекта рака. Таким образом, комбинированная терапия относится к введению модулятора PTK7 и одного или более противораковых агентов, которые включают, не ограничиваясь ими, цитотоксические агенты, цитостатические агенты, химиотерапевтические агенты, противораковые агенты направленной доставки, модификаторы биологического ответа, иммунотерапевтические агенты, противораковые вакцины, антиангиогенные агенты, цитокины, гормональные терапевтические средства, лучевую терапию и антиметастатические агенты.

Согласно способам по настоящему изобретению, не требуется, чтобы комбинированные результаты являлись аддитивными относительно эффектов, наблюдаемых, когда каждое лечение (например, анти-PTK7 антитело и противораковый агент) проводят отдельно. Хотя по меньшей мере аддитивные эффекты являются, как правило, желательными, любое увеличение противоопухолевого эффекта выше эффекта монотерапии, является полезным. Кроме того, в изобретении не требуется, чтобы комбинированное лечение демонстрировало синергический эффект. Тем не менее, специалистам в данной области техники должно быть понятно, что в некоторых выбранных комбинациях, которые включают предпочтительные воплощения, может наблюдаться синергизм.

Для осуществления на практике комбинированной терапии согласно изобретению, модулятор PTK7 (например, анти-PTK7 антитело) в комбинации с одним или более противораковыми агентами может быть введен субъекту, нуждающемуся в этом, способом, эффективным для получения в результате этого противораковой активности у субъекта. Модулятор PTK7 и противораковый агент представлены в количествах, эффективных, и в течение периода времени, эффективного для их комбинированного присутствия и их комбинированных действий в окружении опухоли, как это целесообразно. Для достижения этой цели модулятор PTK7 и противораковый агент могут быть введены субъекту одновременно, либо в виде одной композиции, либо в виде двух или более отдельных композиций с использованием одного и того же или разных путей введения.

Альтернативно, модулятор может предшествовать или следовать за лечением с помощью противоракового агента, например через интервалы, варьирующиеся от минут до недель. В некоторых воплощениях, когда противораковый агент и антитело применяются у субъекта по отдельности, период времени между каждым введением является таким, чтобы противораковый агент и модулятор могли оказывать комбинированное воздействие на опухоль. В конкретном воплощении предполагается, что противораковый агент и модулятор PTK7 вводят с интервалом от примерно 5 минут до примерно двух недель друг от друга.

В других воплощениях могут пройти несколько суток (2, 3, 4, 5, 6 или 7), несколько недель (1, 2, 3, 4, 5, 6, 7 или 8) или несколько месяцев (1, 2, 3, 4, 5, 6, 7 или 8) между введением модулятора и противоракового агента. Модулятор PTK7 и один или более противораковых агентов (комбинированная терапия) можно вводить один раз, два раза или по меньшей мере в течение периода времени, пока состояние лечат, облегчают или вылечивают. Предпочтительно комбинированную терапию вводят несколько раз. Комбинированную терапию можно вводить от трех раз в сутки до одного раза в каждые шесть месяцев. Введение можно осуществлять по расписанию, например три раза в сутки, два раза в сутки, раз в сутки, один раз каждые двое суток, один раз каждые трое суток, один раз в неделю, один раз каждые две недели, один раз каждый месяц, один раз каждые два месяца, один раз каждые три месяца, один раз каждые шесть месяцев или можно вводить непрерывно с помощью мининасоса. Как указано ранее, комбинированную терапию можно вводить пероральным, мукозальным, буккальным, интраназальным, ингаляционным, внутривенным, подкожным, внутримышечным, парентеральным, внутриопухолевым путем или местно. Комбинированная терапия может быть введена в участок, удаленный от места опухоли. Комбинированную терапию, как правило, вводят до тех пор, пока опухоль присутствует, при условии, что комбинированная терапия вызывает остановку роста опухоли или рака, или уменьшение ее массы или объема.

В одном воплощении модулятор PTK7 вводят в комбинации с одним или более противораковыми агентами в течение короткого цикла лечения субъекту, нуждающемуся в этом. Продолжительность лечения антителом может варьироваться в соответствии с конкретным используемым противораковым агентом. Изобретение также предусматривает прерывистое введение или суточные дозы, разделенные на несколько частичных введений. Подходящее время лечения для конкретного противоракового средства очевидно специалисту в данной области, и изобретение предусматривает непрерывную оценку оптимальных схем лечения для каждого противоракового средства.

Настоящее изобретение предполагает по меньшей мере один цикл, предпочтительно более одного цикла, в течение которого применяется комбинированная терапия. Подходящий период времени для одного цикла очевиден специалисту, также как общее количество циклов и интервал между циклами. Изобретение предполагает непрерывную оценку оптимальных схем лечения для каждого модулятора и противоракового агента. Кроме того, в изобретении также предлагается более одного введения либо анти-PTK7 антитела, либо противоракового агента. Модулятор и противораковый агент можно вводить взаимозаменяемо, через сутки или через неделю; либо может быть выполнена последовательность лечения антителом, а затем одна или более лечебных процедур терапии противораковым агентом. В любом случае, как понятно специалистам в данной области техники, подходящие дозы химиотерапевтических агентов, как правило, находятся вблизи уже используемых в клинической терапии доз, где химиотерапевтические агенты вводят отдельно или в комбинации с другими химиотерапевтическими агентами.

В другом предпочтительном воплощении модуляторы PTK7 по настоящему изобретению можно использовать в поддерживающей терапии для снижения или устранения возможности рецидива опухоли после первого появления заболевания. Предпочтительно расстройство будут лечить и исходная масса опухоли будет удалена, уменьшена или иным образом улучшена, так что у пациента исчезают симптомы или пациент находится в стадии ремиссии. В это время субъекту можно вводить фармацевтически эффективные количества раскрытых модуляторов один или более раз, даже несмотря на то, что имеются незначительные указания или вообще нет указаний на заболевание при использовании стандартных диагностических процедур. В некоторых воплощениях эффекторы могут быть введены на регулярной основе в течение некоторого периода времени. Например, модуляторы PTK7 можно вводить еженедельно, каждые две недели, ежемесячно, каждые шесть недель, каждые два месяца, каждые три месяца, каждые шесть месяцев или ежегодно. С учетом изложенного в данной заявке, специалист в данной области может легко определить благоприятные дозы и схемы приема лекарственных средств для снижения возможности рецидива заболевания. Кроме того, такое лечение может продолжаться в течение недель, месяцев, лет или даже в течение неопределенного срока в зависимости от реакции пациента и клинических и диагностических параметров.

В еще одном предпочтительном воплощении эффекторы по настоящему изобретению можно использовать профилактически для предупреждения или уменьшения возможности метастазирования опухоли после циторедуктивной процедуры. При использовании в настоящем описании изобретения, циторедуктивная процедура определена в широком смысле и означает любую процедуру, метод или способ, который ликвидирует, уменьшает, лечит или улучшает состояние опухоли или пролиферацию опухоли. Примеры циторедуктивных процедур включают, без ограничения ими, хирургию, лучевую терапию (то есть направленное излучение), химиотерапию или абляцию. В подходящее время, легко определяемое специалистом в данной области с учетом данного описания, модуляторы PTK7 можно вводить, как предложено, с помощью клинических и диагностических или терагностических процедур для уменьшения метастазирования опухоли. Модуляторы можно вводить один или более раз в фармацевтически эффективных дозах, определенных с использованием стандартных методов. Предпочтительно, режим дозирования сопровождается подходящими методами диагностики или мониторинга, которые позволяют его модифицровать по мере необходимости.

г. Противораковые агенты

Используемый здесь термин "противораковый агент" означает любой агент, который можно использовать для лечения клеточного пролиферативного расстройства, такого как рак, в том числе цитотоксические агенты, цитостатические агенты, антиангиогенные агенты, циторедуктивные агенты, химиотерапевтические агенты, радиотерапию и радиотерапевтические агенты, противораковые агенты направленной доставки, модификаторы биологического ответа, антитела и иммунотерапевтические средства. Следует понимать, что в выбранных воплощениях, как обсуждалось выше, противораковые агенты могут включать конъюгаты и могут находиться в ассоциации с модуляторами перед введением.

Термин "цитотоксический агент" означает вещество, которое уменьшает или ингибирует функцию клеток и/или вызывает разрушение клеток, то есть это вещество является токсичным для клеток. Как правило, это вещество является природной молекулой, полученной из живого организма. Примеры цитотоксических агентов включают, но не ограничены ими, низкомолекулярные токсины или ферментативно-активные токсины бактерий (например, дифтерийный токсин, эндотоксин и экзотоксин Pseudomonas, стафилококковый энтеротоксин А), грибов (например, α-сакрин, рестриктоцин), растений (например, абрин, рицин, модецин, вискумин, противовирусный белок фитолакки, сапорин, гелонин, моморидин, трихосантин, токсин ячменя, белки Aleurites fordii, диантиновые белки, белки Phytolacca americana (PAPI, PAPII и PAP-S), ингибитор Momordica charantia, курцин, кротин, ингибитор мыльнянки лекарственной, гелонин, митегеллин, рестриктоцин, феномицин, неомицин и трикотецены) или животных, например цитотоксические РНКазы, такие как внеклеточные РНКазы поджелудочной железы; ДНКаза I, в том числе ее фрагменты и/или варианты.

Химиотерапевтический агент означает химическое соединение, которое неспецифически уменьшает или ингибирует рост, пролиферацию и/или выживаемость раковых клеток (например, цитотоксические или цитостатические агенты). Такие химические агенты часто направлены на внутриклеточные процессы, необходимые для роста клеток или их деления, и, таким образом, особенно эффективны против раковых клеток, которые обычно быстро растут и делятся. Например, винкристин деполимеризует микротрубочки и, таким образом, предотвращает вступление клеток в митоз. В целом, химиотерапевтические агенты могут включать любой химический агент, который ингибирует или предназначен для ингибирования раковой клетки или клетки, которая может стать раковой или создать онкогенное потомство (например, TIC). Такие агенты часто вводят, и они часто являются наиболее эффективными в комбинации, например в композиции CHOP (циклофосфамид, гидроксилдауномицин (доксорубин), онковин (винкристин) и преднизон).

Примеры противораковых агентов, которые можно использовать в комбинации (или конъюгированными) с модуляторами по настоящему изобретению включают, но не ограничиваются ими, алкилирующие агенты, алкилсульфонаты, азиридины, этиленимины и метиламеламины, ацетогенины, камптотецин, бриостатин, каллистатин, CC-1065, криптофицины, доластатин, дуокармицин, элеутеробин, панкратистатин, саркодиктиин, спонгистатин, азотистые иприты, антибиотики, энедииновые антибиотики, динемицин, бисфосфонаты, эсперамицин, хромопротеиновые энедииновые антибиотические хромофоры, аклациномизины, актиномицин, аутрамицин, азасерин, блеомицины, кактиномицин, карабицин, карминомицин, карцинофилин, хромомицины, дактиномицин, даунорубицин, деторубицин, 6-диазо-5-оксо-L-норлейцин, ADRIAMYCIN® доксорубицин, эпирубицин, эзорубицин, идарубицин, марцелломицин, митомицины, микофеноловая кислота, ногаламицин, оливомицины, пепломицин, потфиромицин, пуромицин, квеламицин, родорубицин, стрептонигрин, стрептозоцин, туберцидин, убенимекс, зиностатин, зорубицин, антиметаболиты, аналоги фолиевой кислоты, аналоги пурина, андрогены, антиадреналиновые средства, пополнитель фолиевой кислоты, такой как фолиновая кислота, ацеглатон, альдофосфамида гликозид, аминолевулиновая кислота; энилурацил; амсакрин; бестрабуцил; бизантрен, эдатраксат; дефофамин, демеколцин; диазиквон; элфорнитин; эллиптиния ацетат; эпотилон, этоглюцид; нитрат галлия; гидроксимочевина; лентинан; лонидайнин; майтанзиноиды, митогуазон, митоксантрон, мопиданмол; нитраэрин, пентостатин, фенамет, пирарубицин, лозоксантрон, подофилиновая кислота; 2-этилгидразид; прокарбазин; PSK® полисахаридный комплекс (JHS Natural Products, Eugene, OR); разоксан; ризоксин; сизофиран; спирогерманий; тенуазоновая кислота; триазиквон; 2,2',2ʺ-трихлортриэтиламин; трихотецены (особенно токсин T-2, верракурин A, роридин A и ангуидин); уретан; виндезин; дакарбазин; манномустин; митобронитол; митолактол; пипоброман; гацитозин; арабинозид ("Ara-C"); циклофосфамид; тиотепа; таксоиды, хлоранбуцил, GEMZAR® гемцитабин; 6-тиогуанин; меркаптопурин; метотрексат; аналоги платины, винбластин; платина; этопозид (VP-16); ифосфамид; митоксантрон; винкристин; NAVELBINE® винорелбин; новантрон; тенипозид; эдатрексат; дауномицин; аминоптерин; кселода; ибандронат; иринотекан (Camptosar, CPT-11), ингибитор топоизомеразы RFS 2000; дифторметилорнитин (DMFO); ретиноиды; капецитабин; комбретастатин; лейковорин (LV); оксалиплатин; ингибиторы PKC-альфа, Raf, H-Ras, EGFR и VEGF-A, которые уменьшают клеточную пролиферацию, и фармацевтически приемлемые соли, кислоты или производные любого из вышеупомянутых агентов. Кроме того, в это оперделение включены антигормональные агенты, которые регулируют или ингибируют действие гормона на опухоли, такие как антиэстрогены и селективные модуляторы рецепторов эстрогена (SERM), ингибиторы ароматазы, которые ингибируют фермент ароматазу, регулирующий выработку эстрогена в надпочечниках, и антиандрогены; а также троксацитабин (1,3-диоксолановый аналог нуклеозина цитозина); антисмысловые олигонуклеотиды; рибозимы, такие как ингибитор экспрессии VEGF и ингибитор экспрессии HER2; вакцины, PROLEUKIN® rIL-2; ингибитор топоизомеразы 1 LURTOTECAN®; ABARELIX® rmRH; винорелбин и эсперамицины и фармацевтически приемлемые соли, кислоты или производные любого из вышеупомянутых агентов. Другие воплощения включают применение антител, одобренных для лечения рака, включающих, без ограничения ими, ритуксимаб, трастузумаб, гемтузумаб озогамицин, алемтузумаб, ибритумомаб тиуксетан, тозитумомаб, бевацизумаб, цетуксимаб, панитумумаб, офатумумаб, ипилимумаб и брентуксимаб ведотин. Специалисты в данной области способны легко идентифицировать дополнительные противораковые агенты, которые совместимы с данным руководством

д. Радиотерапия

В настоящем изобретении также предлагается комбинация модуляторов PTK7 с радиотерапией (то есть любым механизмом, индуцирующим локальное повреждение ДНК в опухолевых клетках, таким как гамма-облучение, рентгеновское облучение, УФ-облучение, микроволновое облучение, электронное облучение и подобные). Также рассматривается комбинированная терапия с использованием непосредственной доставки радиоизотопов в опухолевые клетки, которая может быть использована в сочетании с противораковым агентом направленной доставки или другими нацеливающими средствами. Как правило, лучевую терапию применяют в виде импульсов в течение периода времени от примерно 1 до примерно 2 недель. Лучевую терапию можно применять к субъектам, имеющим рак головы и шеи в течение примерно 6 до 7 недель. Лучевую терапию возможно можно применять в виде однократной дозы или в виде многократных последовательных доз.

е. Опухолевые состояния

При введении отдельно или в комбинации с противораковым агентом или радиотерапией, модуляторы PTK7 по настоящему изобретению особенно полезны для общего лечения у пациентов или субъектов опухолевых состояний, которые могут включать доброкачественные или злокачественные опухоли (например, опухоли почек, печени, почек, мочевого пузыря, молочной железы, желудка, яичников, толстой кишки, предстательной железы, поджелудочной железы, легкого, щитовидной железы, печеночные карциномы; саркомы, глиобластомы; и различные опухоли головы и шеи); лейкозы и лимфолейкозы; другие расстройства, такие как нейрональные, глиальные, астроцитарные, гипоталамические и другие железистые, макрофагальные, эпителиальные, стромальные и бластоцельные расстройства; и воспалительные, ангиогенные, иммунологические расстройства и расстройства, вызванные патогенами. Особенно предпочтительными мишенями для лечения терапевтическими композициями и способами по настоящему изобретению являются опухолевые состояния, включающие солидные опухоли. В других предпочтительных воплощениях модуляторы по настоящему изобретению можно использовать для диагностики, предупреждения или лечения гематологических злокачественных образований. Предпочтительно субъектом или пациентом, подвергаемым лечению, является человек, хотя используемые здесь термины определенно включают любые виды млекопитающих.

В частности, опухолевые состояния, являющиеся объектом лечения согласно настоящему изобретению, могут быть выбраны из группы, включающей, без ограничения ими, опухоли надпочечников, СПИД-ассоциированный рак, альвеолярную саркому мягких тканей, астроцитомы, рак мочевого пузыря (плоскоклеточная карцинома и переходноклеточная карцинома), рак кости (адамантинома, аневризматическая костная киста, остеохондрома, остеосаркома), рак головного и спинного мозга, метастатические опухоли головного мозга, рак молочной железы, опухоли каротидного тельца, рак шейки матки, хондросаркому, хордому, хромофобную почечно-клеточную карциному, светлоклеточную карциному, рак толстой кишки, колоректальный рак, кожную доброкачественную фиброзную гистиоцитому, десмопластические мелкокруглоклеточные опухоли, эпендимомы, опухоли Юинга, внескелетную миксоидную хондросаркому, несовершенный костный фиброгенез, фиброзную дисплазию кости, рак желчного пузыря и желчных протоков, гестационную трофобластическую болезнь, опухоли половых клеток, раковые заболевания головы и шеи, опухоли островков поджелудочной железы, саркому Калоши, рак почек (нефробластому, папиллярный рак почки), лейкозы, липому/доброкачественные липоматозные опухоли, липосаркому/злокачественные липоматозные опухоли, рак печени (гепатобластому, гепатоцеллюлярную карциному), лимфомы, раковые заболевания легких (мелкоклеточный рак, аденокарциному, плоскоклеточную карциному, крупноклеточную карциному и т.д.), медуллобластому, меланому, менингиому, множественную эндокринную неоплазию, множественную миелому, миелодиспластический синдром, нейробластому, нейроэндокринные опухоли, рак яичников, раковые заболевания поджелудочной железы, папиллярный рак щитовидной железы, опухоли паращитовидных желез, педиатрический рак, опухоли оболочек периферических нервов, феохромоцитому, опухоли гипофиза, рак предстательной железы, заднюю увеальную меланому, редкие гематологические расстройства, почечный метастатический рак, рабдоидную опухоль, рабдомиобластому, саркомы, рак кожи, саркомы мягких тканей, плоскоклеточный рак, рак желудка, синовиальную саркому, рак яичек, карциному тимуса, тимому, метастатический рак щитовидной железы и раковые заболевания матки (рак шейки матки, рак эндометрия и лейомиому). В некоторых предпочтительных воплощениях раковые клетки выбраны из группы солидных опухолей, включая, но не ограничиваясь ими, рак молочной железы, немелкоклеточный рак легких (NSCLC), мелкоклеточный рак легких, рак поджелудочной железы, рак толстой кишки, рак предстательной железы, саркомы, почечный метастатический рак, метастатический рак щитовидной железы и светлоклеточную карциному.

Что касается гематологических злокачественных опухолей, следует понимать, что соединения и способы по настоящему изобретению могут быть особенно эффективны в лечении разных В-клеточных лимфом, в том числе низкодифференцированной/NHL (неходжкинская лимфома) фолликулярной клеточной лимфомы (FCC), лимфомы из клеток мантийной зоны (MCL), диффузной крупноклеточной лимфомы (DLCL), мелкоклеточной лимфоцитарной лимфомы (SL) NHL, среднедифференцированной/фолликулярной NHL, среднедифференцированной диффузной NHL, высокодифференцированной иммунобластной NHL, высокодифференцированной лимфобластной NHL, высокодифференцированной мелкоклеточной лимфомы с нерассеченными ядрами NHL, массивной лимфаденопатии NHL, макроглобулинемии Вальденстрема, лимфоплазмацитоидной лимфомы (LPL), лимфомы из клеток мантии (MCL), фолликулярной лимфомы (FL), диффузной крупноклеточной лимфомы (DLCL), лимфомы Беркитта (BL), СПИД-ассоциированных лимфом, моноцитной B-клеточной лимфомы, ангиоиммунобластной лимфоаденопатии, мелкоклеточной лимфоцитарной лимфомы, фолликулярной, диффузной крупноклеточной, диффузной мелкоклеточной с расщепленным ядром, крупноклеточной иммунобластной лимфобластомы, мелкоклеточной лимфомы с нерассеченными ядрами, Беркитта и не-Беркитта, фолликулярной, преимущественно крупноклеточной; фолликулярной, преимущественно мелкоклеточной с расщепленным ядром; и фолликулярной, смесь мелкоклеточных с расщепленным ядром и крупноклеточных лимфом. См., Gaidono et al., " Lymphomas", IN CANCER: PRINCIPLES & PRACTICE OF ONCOLOGY, Vol. 2: 2131-2145 (DeVita et al., eds., 5.sup.th ed. 1997). Специалистам в данной области должно быть понятно, что эти лимфомы часто имеют разные названия в связи с изменением систем классификации, и что пациенты, имеющие лимфомы, классифицируемые под разными названиями, также будут получать пользу из комбинированных схем лечения по настоящему изобретению.

В других предпочтительных воплощениях модуляторы PTK7 можно эффективно использовать для лечения определенных миелоидных и гематологических злокачественных опухолей, в том числе лейкозов, таких как хронический лимфоцитарный лейкоз (CLL or B-CLL) или острый миелоидный лейкоз AML. Такие лейкозы преимущественно являются заболеваниями пожилых людей, распространенность которых начинает увеличиваться после пятидесяти лет и достигает пика к концу шестидесятых годов. CLL, как правило, включает в себя пролиферацию опухолевых лимфоцитов периферической крови. Клинические проявления CLL включают лимфоцитоз, лимфаденопатию, спленомегалию, анемию и тромбоцитопению. AML также называется острый миелобластный лейкоз, острая миелобластная лейкемия, острый гранулоцитарный лейкоз и острая нелимфоцитарная лейкемия. В основе патофизиологии AML лежит арест клеток костного мозга на самых ранних стадиях развития при созревании. В случае любого расстройства специалисты в данной области могут легко подобрать схему лечения в свете настоящего описания с использованием клинически принятых процедур.

Настоящее изобретение также относится к предупреждению или профилактическому лечению субъектов, у которых имеются доброкачественные или предраковые опухоли. Не предполагается исключать из лечения с использованием настоящего изобретения какой-либо конкретный тип опухоли или опухолевого расстройства. Однако тип опухолевых клеток может быть важным для применения изобретения в комбинации со вспомогательными терапевтическими агентами, в частности химиотерапевтическими агентами и противораковыми агентами с направленной доставкой.

Другие предпочтительные воплощения настоящего изобретения включают применение модуляторов PTK7 для лечения субъектов, страдающих от солидных опухолей. У таких субъектов многие из этих солидных опухолей включают ткани, имеющие различные генетические мутации, которые могут сделать их особенно чувствительными к лечению раскрытыми эффекторами. Например, мутации KRAS, APC и CTNNB1 и CDH1 являются относительно распространенными у пациентов с колоректальным раком. Кроме того, пациенты, страдающие от опухолей, с этими мутациями, как правило, наиболее трудно поддаются лечению с применением имеющейся в настоящее время терапии; особенно пациенты с мутациями KRAS. KRAS-активирующие мутации, которые обычно приводят к замене одной аминокислоты, также вовлечены в другие трудные для лечения злокачественные образования, включающие аденокарциномы легких, муцинозную аденому и протоковую карциному поджелудочной железы.

В настоящее время наиболее надежный прогноз будут ли пациенты с колоректальным раком реагировать на EGFR- или VEGF-ингибирующие лекарственные средства, например, заключается в тестировании на некоторые KRAS-"активирующие" мутации. KRAS мутирован в 35-45% случаев колоректального рака, и пациенты, опухоли которых экспрессируют мутантный KRAS, не реагируют эффективно на эти лекарственные средства. Например, мутации KRAS позволяют прогнозировать отсутствие реакции на терапию панитумумабом и цетуксимабом в случае колоректального рака (Lievre et al. Cancer Res 66: 3992-5; Karapetis et al. NEJM 359: 1757-1765). Приблизительно 85% пациентов с колоректальным раком имеют мутации в гене APC (Markowitz & Bertagnolli. NEJM 361: 2449-60) и более 800 мутаций АРС были описаны у пациентов с семейным аденоматозным полипозом и колоректальным раком. Большинство этих мутаций приводит к усечению белка APC с пониженной функциональной способностью опосредовать разрушение бета-катенина. Мутации гена бета-катенина, CTNNB1, также могут привести к повышенной стабилизации белка, результатом чего является импорт в ядро и последующая активация нескольких онкогенных транскрипционных программ, что также представляет собой механизм онкогенеза в результате неспособности мутантного APC нужным образом опосредовать разрушение бета-катенина, что требуется для контролирования программ нормальной клеточной пролиферации и дифференцировки.

Потеря экспрессии CDH1 (E-кадгерина) является еще одним распространенным явлением при колоректальном раке, часто наблюдаемым на более поздних стадиях заболевания. E-кадгерин является главным участником адгериновых соединений, которые соединяют и организуют клетки в эпителиальные слои. Обычно E-кадгерин физически отделяет бета-катенин (CTNNB1) на плазматической мембране; потеря экспрессии C-кадгерина при колоректальном раке приводит к локализации бета-катенина в ядре и транскрипционной активации пути бета-катенин/WNT. Аберрантная передача сигнала бета-катенин/WNT играет главную роль в онкогенезе, и бета-катенин ядра вовлечен в стволовость рака (Schmalhofer et al., 2009 PMID 19153669). E-кадгерин необходим для экспрессии и функционирования EphA2, известного партнера по связыванию для лигандов PTK7 в клетках эпителия (Dodge Zantek et al., 1999 PMID 10511313; Orsulic S and Kemler R, 2000 PMID 10769210). Используя модуляторы, которые связываются с PTK7-лигандами и выступают в роли агониста или антагониста рецепторного связывания, можно модифицировать, прерывать или реверсировать проонкогенные процессы. Альтернативно, модуляторы PTK7 предпочтительно могут связываться с опухолевыми клетками с аберрантным PTK7 взаимодействиями, основанным на предпочтениях связывания модуляторов PTK7. Поэтому пациентам с раковыми заболеваниями, имеющим вышеупомянутые генетические признаки, может быть полезно лечение вышеупомянутыми модуляторами PTK7.

XIV. Изделия

Также предложены фармацевтические упаковки и наборы, содержащие один или более контейнеров, содержащих одну или более доз модулятора PTK7. В некоторых воплощениях предложена стандартная дозировка, содержащая предварительно определенное количество композиции, содержащей, например, анти-PTK7 антитело, вместе с одним или более дополнительными агентами или без них. Для других воплощений такая стандартная дозировка поставляется в одноразовом предварительно заполненном шприце для инъекций. В других воплощениях композиция, содержащаяся в стандартной дозировке, может содержать физиологический раствор, сахарозу и тому подобное; буфер, например фосфатный, и тому подобное; и/или быть приготовлена в виде препарата в пределах стабильного и эффективного диапазона pH. Альтернативно, в некоторых воплощениях композиция может быть представлена в виде лиофилизированного порошка, которые может быть восстановлен при добавлении подходящей жидкости, например стерильной воды. В некоторых предпочтительных воплощениях композиция содержит одно или более веществ, которые ингибируют агрегацию белка, включая, но не ограничиваясь ими, сахарозу и аргинин. Любая этикетка на контейнере(ах) или приложенная к контейнеру(ам) указывает, что включенная композиция используется для диагностики или лечения предпочтительного болезненного состояния.

В настоящем изобретении также предлагаются наборы для получения однодозовых или многодозовых единиц введения модулятора PTK7 и, возможно, одного или более противораковых агентов. Набор содержит контейнер и этикетку или вкладыш, расположенный на контейнере или приложенный к контейнеру. Подходящие контейнеры включают, например, бутылки, флаконы, шприцы и т.д. Контейнеры могут быть изготовлены из различных материалов, таких как стекло или пластмасса. Контейнер содержит композицию, которая является эффективной для лечения состояния, и может иметь стерильное входное отверстие (например, контейнер может представлять собой пакет для внутривенного раствора или флакон, имеющий пробку, прокалываемую иглой для подкожной инъекции). Такие наборы обычно содержат в подходящем контейнере фармацевтически приемлемую композицию модулятора PTK7 и, возможно, один или более противораковых агентов в том же или в других контейнерах. Наборы могут также содержать другие фармацевтически приемлемые композиции для диагностики или комбинированной терапии. Например, в дополнение к модулятору PTK7 по изобретению, такие наборы могут содержать один или более из множества противораковых агентов, таких как химиотерапевтические или радиотерапевтические лекарственные средства; антиангиогенные агенты; антиметастатические агенты; противораковые агенты направленной доставки; цитотоксические агенты; и/или другие противораковые агенты. Такие наборы также могут предоставлять подходящие реагенты для конъюгирования модулятора PTK7 с противораковым агентом или диагностическим агентом (например, см. патент США 7422739, который включен в данную заявку посредством ссылки во всей полноте).

В частности, наборы могут иметь один контейнер, содержащий модулятор PTK7, с дополнительными компонентами или без них, или они могут иметь различные контейнеры для каждого нужного агента.. В случае, если предлагаются комбинированные терапевтические средств для конъюгации, один раствор может быть предварительно смешан, либо в эквивалентной молярной комбинации, либо с избытком одного компонента по сравнению с другим. Альтернативно, модулятор PTK7 и любой дополнительный противораковый агент набора может храниться отдельно, внутри отдельных контейнеров перед введением пациенту. Наборы могут также содержать второй/третий контейнер для хранения стерильного, фармацевтически приемлемого буфера или другого разбавителя, такого как бактериостатическая вода для инъекций (BWFI), фосфатного буферного физиологического раствора (PBS), раствор Рингера и раствор декстрозы.

Когда компоненты набора представлены в одном или более жидких растворах, жидкий раствор предпочтительно представляет собой водный раствор, причем стерильный водный раствор является особенно предпочтительным. Однако, компоненты набора могут быть представлены в виде сухого(их) порошка(ов). Когда реагенты или компоненты представлены в виде сухого порошка, этот порошок может быть восстановлен путем добавления подходящего растворителя. Предполагается, что растворитель также может находиться в Другом контейнере.

Как указано кратко выше, наборы также могут содержать средства, с помощью которых можно вводить антитело и любые дополнительные компоненты человеку или животному, например одну или более игл и шприцев, или даже глазную пипетку, пипетку или другой аналогичный аппарат, с помощью которого композицию можно инъецировать, или вводить животному, или наносить на больной участок тела. Наборы по настоящему изобретению, как правило, включают средства, вмещающие флаконы или тому подобное, и другие компоненты в строгой изоляции для коммерческой продажи, такие как, например, отлитые под давлением или полученные выдувным формованием пластиковые контейнеры, в которых можно размещать и хранить флаконы и другие устройства. Любая этикетка или вкладыш указывает, что композицию модулятора PTK7 используют для лечения рака, например колоректального рака.

В других предпочтительных воплощениях модуляторы по настоящему изобретению можно использовать совместно с диагностическими или терапевтическими устройствами, полезными для диагностики или лечении пролиферативных расстройств, или они могут включать их. Например, в предпочтительном воплощении, соединения и композиции по настоящему изобретению могут быть объединены с определенными диагностическими устройствами или инструментами, которые можно использовать для обнаружения, мониторинга, количественного определения или профилирования клеток или маркерных соединений, вовлеченных в этиологию или проявления пролиферативных расстройств. В особенно предпочтительных воплощениях устройства можно использовать для обнаружения, мониторинга и/или количественного определения циркулирующих опухолевых клеток, как in vivo, так и in vitro (см., например, WO 2012/0128801, который включен в данное описание посредством ссылки). В других предпочтительных воплощениях и как обсуждалось выше, циркулирующие клетки опухоли могут включать раковые стволовые клетки.

XV. Реагенты для исследования

В других предпочтительных воплощениях изобретения также используются свойства раскрытых модуляторов как инструмента, полезного для идентификации, выделения, разделения или обогащения популяций или субпопуляций опухоль-инициирующих клеток посредством таких методов, как проточная цитометрия, сортировка флюоресцентно-активированных клеток (FACS), сортировка магнитно-активированных клеток (MACS) или лазерный срез. Специалистам в данной области понятно, что модуляторы можно использовать в нескольких совместимых процедурах для характеристики и обработки TIC-клеток, в том числе раковых стволовых клеток (например, см. заявки США 12/686359, 12/669136 и 12/757649, каждая из которых включена в данную заявку посредством ссылки во всей полноте).

XVI. Разное

Если в описании изобретения не определено иное, научные и технические термины, используемые в связи с настоящим изобретением, имеют значения, которые обычно понятны специалистам в этой области техники. Кроме того, если иное не предусмотрено контекстом, термины в единственном числе включают множественное число, а термины во множественном числе включают единственное число. В частности, при использовании в данном описании и прилагаемой формуле изобретения, формы единственного числа "a," "an" и "the" включают множественное число, если контекст четко не указывает иное. Таким образом, например, ссылка на "белок" включает в себя множество белков, ссылка на "клетку" включает смеси клеток и так далее. Кроме того, диапазоны, приведенные в данной заявке и прилагаемой формуле изобретения, включают как конечные точки, так и все точки между этими конечными точками. Таким образом, диапазон от 2,0 до 3,0 включает 2,0, 3,0, и все точки между 2,0 и 3,0.

Как правило, терминология, используемая в отношении и методов клеточных и тканевых культур, молекулярной биологии, иммунологии, микробиологии, генетики, химии белка и нуклеиновых кислот, а также гибридизации, описанных здесь, хорошо известна и широко применяется в данной области. Методы и способы по настоящему изобретению, как правило, осуществляют в соответствии с обычными способами, хорошо известными в данной области, и как описано в различных общих и более конкретных ссылках, которые указаны и обсуждаются в данном описании, если не указано иное. См., например, Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1998); и Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). Ферментативные реакции и способы очистки осуществляются в соответствии с инструкциями производителя, как обычно выполняется в данной области или как описано в данном описании изобретения. Терминология, используемая в связи с лабораторными процедурами и методами аналитической химии, синтетической органической химии, медицинской и фармацевтической химии, описанными здесь, хорошо известна и широко используется в данной области.

Все ссылки или документы, раскрытые или указанные в данном описании, без ограничения, включены сюда посредством ссылки во всей своей полноте. Кроме того, любые заголовки разделов, используемые здесь, предназначены для организационных целей и не должны быть истолкованы как ограничивающие описываемый предмет.

Примеры

Настоящее изобретение, в общем виде описанное выше, будет легче понять посредством ссылки на следующие примеры, которые приведены в качестве иллюстрации и не предназначены для ограничения настоящего изобретения. Данные примеры не следует рассматривать как указывающие на то, что приведенные ниже эксперименты представляют собой все или единственные выполненные эксперименты. Если не указано иное, части являются частями по массе, молекулярная масса представляет собой среднемассовую молекулярную массу, температура представлена в градусах по Цельсию, и давление равно или близко к атмосферному.

Пример 1

Обогащение популяций опухоль-инициирующих клеток

Для характеристики клеточной гетерогенности солидных опухолей, как они существуют у пациентов с раковыми заболеваниями, выяснения отличительных признаков клеток, поддерживающих опухоль (TPC; то есть раковых стволовых клеток: CSC) с использованием конкретных фенотипических маркеров и идентификации клинически значимых терапевтических мишеней, был разработан и поддерживался с использованием общепризнанных методов большой банк нетрадиционных ксенотрансплантатных (NTX) опухолей. Банк NTX-опухолей, содержащий большое число дискретных линий опухолевых клеток, размножали в мышах с ослабленным иммунитетом посредством многочисленных пассажей гетерогенных опухолевых клеток, изначально полученных от многочисленных больных раком пациентов, страдающих разнообразными солидными злокачественными опухолями. Постоянная доступность большого числа отдельных опухолевых клеточных линий NTX с ранних пассажей, имеющих четко определенное происхождение линий, значительно облегчает идентификацию и выделение TPC, так как они обеспечивают возможность воспроизводимой и неоднократной характеристики клеток, очищенных из клеточных линий. Более конкретно, выделенные или очищенные TPC наиболее точно определяют ретроспективно, в соответствии с их способностью создавать фенотипически и морфологически гетерогенные опухоли у мышей, которые повторяют образец опухоли пациента, из которого получена клетка. Таким образом, способность использовать небольшие популяции выделенных клеток для создания полностью гетерогенных опухолей у мышей убедительно указывает на то, что выделенные клетки содержат TPC. В этой работе применение минимально пассированных NTX-клеточных линий значительно упрощает эксперименты in vivo и обеспечивает легко проверяемые результаты. Кроме того, опухоли NTX с ранних пассажей также отвечают на терапевтические агенты, такие как иринотекан (то есть Camptosar®), что обеспечивает клинически значимое понимание механизмов, лежащих в основе управления опухолевым ростом, устойчивости к имеющимся в настоящее время терапевтическим средствам и рецидива опухоли.

Когда были созданы опухолевые клеточные линии NTX, фенотипы составляющих опухолевых клеток анализировали, используя проточную цитометрию для определения дискретных маркеров, которые можно использовать для характеристики, выделения, очистки или обогащения опухоль-инициирующих клеток (TIC) и разделения или анализа клеток TPC и TProg внутри таких популяций. В связи с этим авторы использовали запатентованную протеомную платформу (то есть PhenoPrint™ Array), которая обеспечивала быструю характеристику клеток на основании экспрессии белка и сопутствующую идентификацию потенциально полезных маркеров. PhenoPrint Array представляет собой запатентованную протеомную платформу, содержащую сотни отдельных связывающих молекул, многие из которых получены из коммерческих источников, нанесенных в 96-луночные планшеты, где каждая лунка содержит отдельное антитело в фикоэритриновом флуоресцентном канале и множество дополнительных антител в разных флуорохромах, упорядоченных в каждой лунке по всему планшету. Это позволяет определять уровни экспрессии интересующего антигена в субпопуляции выбранных опухолевых клеток за счет быстрого включения релевантных клеток или устранения нерелевантных клеток через нефикоэритриновые каналы. При использовании PhenoPrint Array в комбинации с хорошо известными в данной области методами расщепления ткани, трансплантации и использования стволовых клеток (AI-Hajj et al., 2004, Dalerba et al., 2007 и Dylla et al., 2008, выше, каждая из которых включена в данную заявку посредством ссылки во всей полноте), можно эффективно идентифицировать релевантные маркеры и затем выделить и трансплантировать с высокой эффективностью конкретные субпопуляции опухолевых клеток человека.

Соответственно, при формировании различных NTX-опухолевых клеточных линий, как это обычно делается для человеческих опухолей в мышах с тяжелым иммунодефицитом, опухоли резецировали из мышей после достижения 800 - 2000 мм3, и клетки расщепляли в одноклеточные суспензии, используя общепризнанные методы ферментативного расщепления (см., например, патент США 2007/0292414, который включен в данную заявку). Данные, полученные от этих суспензий с использованием PhenoPrint Array, представляют как абсолютную (на клетку), так и относительную (по сравнению с другими клетками в популяции) экспрессию поверхностного белка на поклеточной основе, что приводит к более комплексной характеристике и разделению на группы клеточных популяций. В частности, применение PhenoPrint Array позволяет осуществить быструю идентификацию белков или маркеров, которые в перспективе позволять отличить TIC или TPC от NTG массы опухолевых клеток и опухолевой стромы и, будучи выделены из NTX-опухолевых моделей, обеспечивают относительно быструю характеристику субпопуляций опухолевых клеток, экспрессирующих разные уровни специфических белков клеточной поверхности. В частности, белки с гетерогенной экспрессией во всей популяции опухолевых клеток обеспечивают возможность выделения и трансплантации отдельных и высокоочищенных субпопуляций опухолевых клеток, экспрессирующих и высокий и низкий уровень конкретного белка или маркера в мышах с ослабленным иммунитетом, тем самым облегчая оценку того, какой - одной или другой субпопуляцией обогащены TPC.

Термин "обогащение" используется как синоним выделения клеток и означает, что выход (фракция) клеток одного типа увеличен относительно фракции других типов клеток по сравнению с исходной или начальной клеточной популяцией. Предпочтительно, обогащение относится к увеличению процента примерно на 10%, примерно на 20%, примерно на 30%, примерно на 40%, примерно на 50% или более чем 50% одного типа клеток в клеточной популяции по сравнению с исходной популяцией клеток.

При использовании здесь "маркер" в контексте клетки или ткани означает любую характеристику в форме химического или биологического объекта, которая идентифицируемо ассоциирована с, или конкретно обнаружена в или на конкретной клетке, клеточной популяции или ткани, включая идентифицируемые в или на ткани или клеточной популяции, пораженной заболеванием или расстройством. Как показано, маркеры могут быть морфологическими, функциональными или биохимическими по своей природе. В предпочтительных воплощениях маркер представляет собой антиген клеточной поверхности, который дифференциально или предпочтительно экспрессируется конкретными типами клеток (например, TPC) или клетками в определенных условиях (например, в конкретные моменты клеточного цикла или в клетках, находящихся в определенной нише). Предпочтительно, такие маркеры представляют собой белки и, более предпочтительно, имеют эпитопы для антител, аптамеров или других связывающих молекул, известных в данной области. Однако, маркер может состоять из любой молекулы, обнаруженной на поверхности или в клетке, включая, но не ограничиваясь ими, белки (пептиды и полипептиды), липиды, полисахариды, нуклеиновые кислоты и стероиды. Примеры морфологических характеристик или признаков маркера включают, без ограничения ими, форму, размер и отношение ядра к цитоплазме. Примеры функциональных характеристик или признаков маркера включают, без ограничения ими, способность прикрепляться к конкретным субстратам, способность включать или исключать определенные красители, например, без ограничения ими, исключать липофильные красители, способность мигрировать в определенных условиях и способность дифференцироваться в определенные линии. Маркерами также могут быть белки, экспрессируемые генами-репортерами, например геном-репортером, экспрессируемым клеткой в результате включения нуклеиновокислотной последовательности, кодирующей репортерный ген, в клетку и его транскрипции, приводящей к получению репортерного белка, который можно использовать в качестве маркера. Такие гены-репортеры, которые можно использовать в качестве маркеров, представляют собой, например, но не ограничены ими, флуоресцентные белковые ферменты, хромомерные белки, гены устойчивости и тому подобное.

В аналогичном смысле термин "фенотип маркера" в контексте ткани, клетки или клеточной популяции (например, стабильный TPC-фенотип) означает любой маркер или комбинацию маркеров, которые можно использовать для характеристики, идентификации, разделения, выделения или обогащения конкретной клетки или клеточной популяции (например, посредством FACS). В конкретных воплощениях фенотип маркера представляет собой фенотип клеточной поверхности, который может быть определен путем обнаружения или определения экспрессии комбинации клеточных поверхностных маркеров.

Специалистам в данной области понятно, что многочисленные маркеры (или их отсутствие) связаны с различными популяциями раковых стволовых клеток и используются для выделения или характеристики субпопуляций опухолевых клеток. В этом отношении типичные маркеры раковых стволовых клеток включают ОСТ4, Nanog, STAT3, ЕРСАМ, CD24, CD34, NB84, TrkA, GD2, CD133, CD20, CD56, CD29, B7H3, CD46, рецептор трансферрина, JAM3, карбоксипептидазу M, ADAM9, онкостатин M, Lgr5, Lgr6, CD324, CD325, нестин, Sox1, Bmi-1, eed, easyhl, easyh2, mf2, yy1, smarcA3, smarckA5, smarcD3, smarcEl, mllt3, FZD1, FZD2, FZD3, FZD4, FZD6, FZD7, FZD8, FZD9, FZD10, WNT2, WNT2B, WNT3, WNT5A, WNT10B, WNT16, AXIN1, BCL9, MYC, (TCF4) SLC7A8, IL1RAP, TEM8, TMPRSS4, MUC16, GPRC5B, SLC6A14, SLC4A11, PPAP2C, CAV1, CAV2, PTPN3, EPHA1, EPHA2, SLC1A1, CX3CL1, ADORA2A, MPZL1, FLJ10052, C4.4A, EDG3, RARRES1, TMEPAI, PTS, CEACAM6, NID2, STEAP, ABCA3, CRIM1, IL1R1, OPN3, DAF, MUC1, MCP, CPD, NMA, ADAM9, GJA1, SLC19A2, ABCA1, PCDH7, ADCY9, SLC39A1, NPC1, ENPP1, N33, GPNMB, LY6E, CELSR1, LRP3, C20orf52, TMEPAI, FLVCR, PCDHA10, GPR54, TGFBR3, SEMA4B, PCDHB2, ABCG2, CD166, AFP, BMP-4, β-катенин, CD2, CD3, CD9, CD14, CD31, CD38, CD44, CD45, CD74, CD90, CXCR4, декорин, EGFR, CD105, CD64, CD16, CD16a, CD16b, GLU, GLI2, CD49b и CD49f. См., например, Schulenburg et al., 2010, PMID: 20185329, патент США 7632678 и патенты США 2007/0292414, 2008/0175870, 2010/0275280, 2010/0162416 и 2011/0020221, каждый из которых включен в данную заявку посредством ссылки. Следует понимать, что ряд этих маркеров включен в PhenoPrint Array, описанный выше.

Аналогично, неограничивающие примеры фенотипов клеточной поверхности, ассоциированных с раковыми стволовыми клетками определенных опухолевых типов, включают CD44hiCD24low, ALDH+, CD133+, CD123+, CD34+CD38+, CD44+CD24-, CD46hiCD324+CD66c-, CD133+CD34+CD10-CD19+, CD138+CD34-CD19+, CD133+RC2+, CD44+α2β1hiCD133+, CD44+CD24+ESA+, CD271+, ABCB5+, а также другие фенотипы клеточной поверхности раковых стволовых клеток, которые известны в данной области. См., например, Schulenburg et al., 2010, выше, Visvader et al., 2008, PMID: 18784658 и патент США 2008/0138313, каждый из которых включен в настоящее описание во всей своей полноте посредством ссылки. Специалистам в данной области понятно, что фенотипы маркеров, такие как приведены непосредственно выше, можно использовать в сочетании со стандартным анализом методом проточной цитометрии и процедурами сортировки клеток для характеристики, выделения, очистки или обогащения TIC- и/или TPC-клеток или клеточных популяций для дальнейшего анализа. В связи с настоящим изобретением интересно, что CD46, CD324 и возможно CD66c, интенсивно или гетерогенно экспрессируются на поверхности многих человеческих опухолевых клеток колоректального рака ("CR"), молочной железы ("BR"), немелкоклеточного рака легкого (NSCLC), мелкоклеточного рака легкого (SCLC), поджелудочной железы ("РА"), предстательной железы ("PR"), почки ("KDY"), меланомы ("Mel"), яичника ("OV") и рака головы и шеи ("HN"), независимо от того, являются анализируемые опухолевые образцы первичной опухолью пациента или полученными от пациента NTX-опухолями.

Клетки с отрицательной экспрессией (то есть "-") определены здесь как клетки, экспрессия которых равна или менее 95 го процентиля экспрессии, наблюдаемой с контрольным изотипом антитела в канале флуоресценции при наличии мечения полным антителоокрашивающим коктейлем других представляющих интерес белков в дополнительных каналах эмиссии флуоресценции. Специалистам в данной области понятно, что эта процедура определения отрицательных событий упоминается, как "флуоресценция минус" или "FMO" окрашивание. Клетки с экспрессией более 95-го процентиля экспрессии, наблюдаемой с контрольным изотипом антитела с использованием процедуры FMO окрашивания, описанной выше, определены здесь как "положительные" (то есть"+"). Как определено здесь, существуют различные популяции клеток в широком смысле определенные как "положительные". Во-первых, клетки с низкой экспрессией (то есть "lo"), в общем случае определены, как клетки с наблюдаемой экспрессией выше 95-го процентиля, определенного с использованием FMO-окрашивания контрольного изотипа антитела и в пределах одного стандартного отклонения от 95-го процентиля экспрессии, наблюдаемой с контрольным изотипом антитела с использованием процедуры FMO-окрашивания, описанной выше. Клетки с "высокой" экспрессией (то есть "hi") можно определить, как клетки с наблюдаемой экспрессией выше 95-го процентиля, определенного с использованием FMO-окрашивания контрольного изотипа антитела и имеющие более чем одно стандартное отклонение выше 95-го процентиля экспрессии, наблюдаемого с контрольным изотипом антитела с использованием процедуры FMO-окрашивания, описанной выше. В других воплощениях в качестве демаркационной точки между отрицательным и положительным FMO-окрашиванием предпочтительно можно использовать 99-ый процентиль и в особенно предпочтительных воплощениях процентиль может быть больше 99%.

Используя методы быстрой идентификации и ранжирования антигенов колоректальной опухоли, такие как описано выше, основанные на интенсивности экспрессии и гетерогенности нескольких NTX-опухолей от пациентов с колоректальным раком, кандидантные TPC-антигены дополнительно оценивали путем сравнения опухоли и соседней нормальной ткани и затем выбирали на основании, по меньшей мере частично, повышенной или пониженной регуляции конкретного антигена в злокачественных клетках. Кроме того, системный анализ различных клеточной поверхностных маркеров в отношении их способности улучшать возможность трансплантации полностью гетерогенных опухолей мышам (то есть онкогенность) и последующая комбинация этих маркеров, значительно улучшали разрешающую способность метода и улучшали возможность приспосабливать метод сортировки флуоресцентно-активированных клеток (FACS) для идентификации и характеристики отдельных, высокообогащенных субпопуляций опухолевых клеток, которые исключительным образом содержали всю опухолеобразующую способности при трансплантации (то есть опухоль-инициирующие клетки).

Следует повторить, что термин "опухоль-инициирующая клетка (TIC)" или "онкогенная (TG)" клетка включает как клетки, поддерживающие опухоль (TPC; то есть раковые стволовые клетки), так и высокопролиферативные клетки-предшественники опухоли (TProg), которые вместе обычно составляют уникальную субпопуляцию (то есть 0,1-25%) объема или массы опухоли; их характеристики определены выше. Большинство опухолевых клеток, охарактеризованных таким способом, лишены данной опухолеобразующей способности и, таким образом, могут быть определены, как неонкогенные клетки (NTG). Неожиданно наблюдалось, что наиболее разные маркеры, идентифицированные с использованием запатентованного PhenoPrint Array, не продемонстрировали способности обогащать популяции опухоль-инициирующих клеток в колоректальных опухолях с использованием стандартных протоколов FACS, но комбинации разных маркеров можно было использовать для идентификации двух субпопуляций опухоль-инициирующих клеток: TPC и TProg. Специалистам в данной области понятно, что определение разницы между TPC и TProg заключается в способности TPC постоянно питать рост опухоли при серийной трансплантации с низким количеством клеток, хотя обе популяции являются опухоль-инициирующими в первичных трансплантатах. Кроме того, до обнаружения этого авторами настоящего изобретения, было неизвестно, что маркер/белки, используемые в комбинации для обогащения как TPC, так и TProg, ассоциированы с клетками, обладающими такой активностью в любой ткани или новообразовании, хотя другие исследователи определили клеточные поверхностные маркеры или ферментативную активность, которые могут быть аналогичным образом использованы для обогащения онкогенных клеток (Dylla et al 2008, выше). Как указано ниже, конкретные опухолевые клеточные субпопуляции, выделенные с использованием комбинаций маркеров клеточной поверхности, упоминаемых выше, затем анализировали с использованием полного транскриптома технологии секвенирования нового поколения для идентификации и характеристики дифференциально экспрессирующихся генов.

Пример 2

Выделение и анализ образцов РНК из обогащенных популяций опухоль-инициирующих клеток

Установившуюся колоректальную NTX-опухолевую линию SCRX-CR4 пассировали, как описано в Примере 1, и использовали для инициирования опухолей у мышей с ослабленным иммунитетом. Как только размер опухоли достигал ~300 мм, мышей рандомизировали и лечили с помощью 15 мг/кг иринотекана, 25 мг/кг гемцитабина или контрольного носителя (PBS) два раза в неделю в течение по меньшей мере двадцати суток до умерщвления. Извлекали опухоли, и клетки TPC, TProg и NTG соответственно, выделяли из свежерезецированных колоректальных NTX-опухолей и, аналогично, клетки TG и NTG выделяли из NTX-опухолей поджелудочной железы, как правило, с использованием метода, представленного в Примере 1. В частности, клеточные популяции выделяли с помощью FACS и немедленно осаждали и лизировали в лизирующем буфере Qiagen RLTplus RNA (Qiagen, Inc.). Затем лизаты хранили при -80°C до использования. После оттаивания экстрагировали общую РНК, используя набор для выделения Qiagen RNeasy isolation kit (Qiagen, Inc.) в соответствии с инструкциями производителя, и производили количественное определение на Nanodrop (Thermo Scientific) и Bioanalyzer 2100 (Agilent Technologies), снова используя протоколы производителя и рекомендованные настройки прибора. Полученный в результате препарат общей РНК был пригоден для генетического секвенирования и анализа.

Образцы общей РНК, полученные из соответствующих клеточных популяций, выделенных, как описано выше, из мышей, обработанных носителем или химиотерапевтическим агентом, готовили для секвенирования целого транскриптома с использованием Applied Biosystems SOLiD 3.0 (Секвенирование посредством олиголигирования/обнаружения) платформы для секвенирования следующего поколения (Life Technologies), начиная с 5 нг общей РНК на образец. Данные, полученные с помощью SOLiD платформы, были соотнесены с 34609 генами из генома человека и обеспечили возможность обнаружения PTK7 в нескольких образцах.

Как правило, платформа SOLiD3 для секвенирования следующего поколения позволяет параллельное секвенирование клонально амплифицированных фрагментов РНК/ДНК, соединенных с сферообразными частицами. Секвенирование путем лигирования с олигонуклеотидами, меченными красителями, затем используют для получения 50 считываний оснований каждого фрагмента, присутствующего в образце, суммарно более чем с 50 миллионами считываний, создающими значительно более точное представление об уровне экспрессии белков генома с транскрипта мРНК. Платформа SOUD3 способна захватывать не только экспрессированные, но и SNP (однонуклеотидный полиморфизм), известные и неизвестные события альтернативного сплайсинга и, возможно, вновь открытые экзоны, основанные исключительно на охвате считывания (считывания, уникальным образом сопоставленные с положениями в геноме). Таким образом, применение этой платформы следующего поколения обеспечивает возможность определения различий в уровне экспрессии транскрипта, а также различий или предпочтений в конкретных вариантах сплайсинга этих экспрессируемых транскриптов мРНК. Кроме того, для анализа с платформой SOUD3 с использованием модифицированного протокола для суммарного транскриптома от Applied Biosystems требуется только приблизительно 5 нг исходного вещества перед амплификацией. Это важно, так как извлечение общей РНК из отсортированных клеточных популяций, где подмножество TPC-клеток, например, значительно меньше по количеству, чем NTG или объемные опухоли, и приводит к получению очень малых количеств пригодного исходного вещества.

Данные повторного анализа секвенирования, полученные с помощью платформы SOLiD3, были нормализованы и преобразованы и соотношения рассчитаны в соответствии со стандартной промышленной практикой. Как показано на Фиг. 2, уровни экспрессии гена PTK7 (выраженные в виде считываний на миллион, соотнесенных с экзонами; RPM_3K30h) измеряли в соответствующих клеточных субпопуляциях опухоли SCRX-CR4. Анализ данных показал, что PTK7 был активирован на уровне транскрипта в 2-4 раза выше NTG-популяции и на 50-200% выше TProg-популяции у мышей после обработки наполнителем или иринотеканом, соответственно.

Подробно описанные выше наблюдения показывают, что экспрессия PTK7, как правило, повышена в популяциях TPC и позволяет предположить, что PTK7 может играть важную роль в онкогенезе и поддержании опухоли, таким образом, представляя прекрасную мишень для иммунотерапевтических подходов.

Пример 3

ПЦР-Анализ PTK7 в режиме реального времени в обогащенных популяциях опухоль-инициирующих клеток

Для подтверждения дифференциальной экспрессии PTK7, наблюдаемой посредством секвенирования целого транскриптома в популяциях TPC по сравнению с клетками TProg и NTG в колоректальном раке, и TG по сравнению с NTG-клетками в раке поджелудочной железы, использовали количественный ПЦР-анализ в режиме реального времени TaqMan® для измерения уровней экспрессии гена в соответствующих клеточных популяциях, выделенных из различных NTX-линий, как указано выше. Следует понимать, что такой ПЦР-анализ в режиме реального времени обеспечивает возможность более прямого и быстрого измерения уровней экспрессии генов для различных мишеней с использованием праймеров и наборов зондов, специфичных к конкретному интересующему гену. Количественный ПЦР-анализ в режиме реального времени TaqMan® выполняли на Applied Biosystems 7900НТ Machine (Life Technologies), используемом для измерения PTK7 и экспрессии гена PTK7 в многочисленных популяциях клеточных линий NTX, полученных от пациентов, и в соответствующих контролях. Кроме того, анализ выполняли, как указано в инструкциях, прилагаемых к TaqMan System, и с использованием имеющихся в продаже наборов PTK7 и PTK7 праймеров/зондов (Life Technologies).

Как видно на Фиг. 3, количественное ПЦР-исследование экспрессии гена в режиме реального времени было выполнено с использованием NTG и TPC популяций, выделенных из 2 различных колоректальных NTX-опухолевых линий (SCRX-CR4 & CR5) и опухолевой линии поджелудочной железы (SCRX-РАЗ). Клеточные популяции TProg также были выделены и проанализированы на SCRx-CR4. Данные, представленные на Фиг. 3, показывают, что экспрессия гена PTK7 повышена более чем в 2-раза в колоректальных TPC по сравнению с NTG-клетками из тех же опухолей. PTK7 был также повышена более чем в 2 раза в TPC у мышей, подвергнутых лечению иринотеканом, и в TIC-клеточной популяции опухолей поджелудочной железы (например, SCRx-РАЗ). Наблюдение повышенной экспрессии PTK7 в NTX TPC препаратах по сравнению с NTG-клеточными контролями в NTX-опухолях, полученных от пациентов с колоректальным и панкреатическим раком, с использованием общепризнанной методики количественного ПЦР-анализа в режиме реального времени подтвердил более чувствительный характер данных, полученных с помощью SOLiD3 секвенирования целого транскриптома из предыдущего Примера. Такие результаты дополнительно подтвердили наблюдаемую связь между уровнями экспрессии PTK7 и клетками, лежащими в основе онкогенеза, устойчивости к терапии и рецидивом.

Пример 4

Экспрессия PTK7 в нефракционированных образцах колоректальной опухоли

В свете того, что экспрессия гена PTK7, как было обнаружено, повышена в популяциях TPC из колоректальных опухолей по сравнению с клетками TProg и NTG из тех же опухолей, были выполнены эксперименты для определения, наблюдается ли также повышенная экспрессия PTK7 в нефракционированных образцах колоректальной опухоли по сравнению с нормальной соседней тканью (NAT). Также производили измерения для определения экспрессии PTK7 в опухолях по сравнению с уровнем в образцах нормальных тканей (NL).

В частности, Custom TumorScan qPCR (Origene Technologies) 384-луночные панели, содержащие 110 образцов колоректальной опухоли пациентов на разных стадиях, нормальную соседнюю ткань и 48 нормальных тканей, были запланированы и изготовлены с использованием известных в данной области методов. Используя процедуры, подробно описанные в Примере 3, и те же наборы PTK7-специфических праймеров/зондов, TaqMan количественный ПЦР-анализ в режиме реального времени выполняли в лунках обычных планшетов.

На Фиг. 4А и 4Б показаны результаты данных по экспрессии в графическом формате, нормализованные относительно средней экспрессии в нормальной ткани толстой и прямой кишки. В частности, на Фиг. 4А обобщены данные, полученные с использованием 168 образцов ткани, полученных от 110 пациентов с колоректальным раком с разными стадиями заболевания (I-IV) (35 образцов из которых являются нормальной соседней (NAT) тканью пациентов с колоректальным раком) и 48 нормальных тканей из других мест (NL ткань). На графике данные для каждого образца ткани/пациента представлены точкой, со среднегеометрическим значением для каждой популяции, нанесенным по оси X, представленным в виде линии. Аналогично, на Фиг. 4Б представлены данные из 24 сопоставимых образцов от пациента с колоректальным раком, полученных из опухоли (T) или нормальной соседней ткани (N) на разных стадиях заболевания (I-IV). На графике данные представлены на последовательной выборочной основе со связями между соответствующими опухолевой и нормальной соседней тканью отдельных пациентов. Экспрессия PTK7 заметно выше в большинстве сопоставимых опухолей по сравнению с нормальной соседней тканью, с дифференциальной экспрессией на стадиях 3 и 4, достигающей статистической значимости (n≥4, P≤0.037). Обе Фиг. 4А и 4Б указывают на то, что на всех четырех представленных стадиях уровень экспрессии гена PTK7 повышен в большинстве колоректальных опухолей и в сопоставимых образцах опухоли относительно нормальной соседней ткани. Кроме того, среднее значение экспрессии гена PTK7 на любой стадии колоректального рака является повышенным по сравнению с большинством исследованных нормальных тканей (Фиг. 4А). Эти результаты демонстрируют, что экспрессия PTK7 повышена в колоректальном раке и в сочетании с вышеприведенными наблюдениями, что экспрессия PTK7 является самой высокой в колоректальных TPC и панкреатических TIC, позволяет предположить, что терапевтическое нацеливание на онкогенные клетки, экспрессирующие PTK7, может принести значительную терапевтическую пользу раковым пациентам.

Пример 5

Дифференциальная экспрессия PTK7 в типичных образцах опухоли

Для дополнительной оценки экспрессии гена PTK7 в дополнительных образцах опухоли колоректального рака пациента и образцах опухоли пациентов с диагнозом 1-го из 18 других различных типов солидной опухоли, выполняли Taqman qOT-ПЦР с использованием TissueScan™ qPCR (Origene Technologies) 384-луночных панелей, которые были специально приготовлены, как описано в Примере, но включали образцы солидных опухолей из 18 других типов опухоли, а не только колоректальные образцы. Результаты измерений представлены на Фиг. 5А и 5Б и показывают, что экспрессия гена PTK7 значительно повышена в некоторых типах солидных опухолей.

В связи с этим на Фиг. 5А и 5Б показаны относительные и абсолютные уровни экспрессии генов, соответственно, человеческого PTK7 в целых образцах опухоли (серые точки) или сопоставимой нормальной соседней ткани (NAT; белые точки) из пациентов с одним из восемнадцати разных типов солидных опухолей. На Фиг. 5А данные нормализованы относительно средней экспрессии гена в NAT для каждого анализируемого типа опухоли. На Фиг. 5Б, абсолютную экспрессию PTK7 оценивали в различных тканях/опухолях, и данные на график наносили в виде числа циклов (Ct), необходимого для достижения экспоненциальной амплификации посредством количественной ПЦР в режиме реального времени. Неамплифицированным образцам приписывали значение Ct 45, которое представляет собой последний цикл амплификации в экспериментальном протоколе. Каждая точка представляет собой отдельный образец ткани со средним значением, представленным в виде черной линии.

При использовании обычных панелей OriGene TissueScan Array, было обнаружено, что большинство пациентов с диагнозом колоректальный рак и большинство пациентов с диагнозом рак надпочечников, эндометрия, пищевода, печени, щитовидной железы и мочевого пузыря имеют значительно более высокий уровень экспрессии гена PTK7 в опухолях по сравнению с NAT, что позволяет предположить, что PTK7 может играть роль в онкогенезе и/или опухолевом развитии этих опухолей. Также имеются подгруппы пациентов с раком легких и поджелудочной железы с повышенной экспрессией PTK7 по сравнению с NAT. Из этих исследований ясно, что экспрессия гена PTK7, как правило, была умеренной в большинстве образцов NAT; при этом, самая высокая экспрессия наблюдалась в молочной железе, шейке матки, яичниках, поджелудочной железе, семенниках и мочевом пузыре. И опять же эти данные свидетельствуют, что повышенная экспрессия PTK7 указывает на и, возможно, регулирует онкогенез или сохранение опухоли у пациентов с выбранными гиперпролиферативными расстройствами.

Пример 6

Получение и экспрессия PTK7-иммуногенов

С целью получения и характеристики некоторых модуляторов PTK7 в соответствии с настоящим изобретением, были сконструированы и экспрессированы две формы PTK7-иммуногена. Первоначально коммерческий экспрессирующий вектор, pCMV6-XL4-PTK7, был приобретен у Origene, Inc. Последовательность полноразмерной ORF (подчеркнутая часть на Фиг. 1А) была подтверждена, затем субклонирована посредством ПЦР в сайты EcoRI и Notl лентивирусного вектора pCDH-EF1-MCS-T2A-GFP (System Biosciences). Этот лентивирусный вектор экспрессирует полноразмерный белок PTK7, слитый с рибосомальным скиппинг-пептидом Т2А и GFP селективным маркером, делая возможной мультицистронную экспрессию в трансдуцированных клетках. Этот лентивирусный вектор использовали для трансдукции клеток 293Т или клеток BALB/c 3T3 согласно стандартным протоколам. Кроме того pCMV6-XL4-PTK7 использовали для временной экспрессии белка PTK7 на поверхности клеток 293Т через 48-часов после трансфекции клеток с использованием полиэтиленимина. Препараты плазматической мембраны были получены из клеток, сверхэкспрессирующих PTK7, с использованием дифференциального центрифугирования.

В других случаях растворимые PTK7-иммуногены получали и экспрессировали с использованием экспрессирующего вектора рЕЕ12.4 (Lonza AG), в котором часть кДНК PTK7, кодирующая внеклеточный домен (ECD) белка, кодирует последовательность, обозначенную подчеркнутыми аминокислотами на Фиг. 1Б). В первом случае ECD-фрагмент субклонировали внутри рамки считывания ниже лидирующей последовательности IgK и выше эпитопной метки 8xHis (SEQ ID NO: 8). Растворимый His-меченый PTK7 ECD- иммуноген получали посредством временной трансфекции клеток СНО- KSV(Bnpyc саркомы Капоши) и очистки секретируемого белка из клеточного супернатанта с использованием смол Ni-NTA (никельнитрилотриуксусная кислота) и стандартных способов (Qiagen Inc.). Кроме вышеупомянутой конструкции PTK7-ECD-HiS, препаратов плазмы и трансфицированных клеток, описанных выше, была получена и экспрессирована конструкция Fc-PTK7-ECD. Этот процесс был инициирован посредством ПЦР-амплификации ECD-фрагмента, представленного на Фиг. 1Б с использованием высокоточной ДНК-полимеразы горячего старта KOD Hot Start DNA Polymerase (EMD Chemicals). Прямой праймер, используемый в этой ПЦР реакции, имеет PTK7- последовательность: GCCATTGTCTTCATCAAGCAGCC (SEQ ID NO: 9) и также включает сайт рестрикции 5' HindIII и мышиный IgG-каппа сигнальный пептид/лидерную последовательность для секреции продукта в супернатант культуры. Обратный праймер, используемый для амплификации этих конструкций, имеет PTK7-последовательность: CTGGATCATCTTGTAGGGGGGAG (SEQ ID NO: 10) и включает сайты рестрикции 5' DraIII и BgIII, позволяющие клонирование в обратном направлении белка Fe IgG2 человека, который был заказан как синтезированный ген (ДНК 2.0 Inc.).

Затем амплифицированные или субклонированные продукты переносили в конечный экспрессирующий вектор рЕЕ12.4 (Lonza AG) с использованием сайтов рестрикции HindIII и EcoRI и точность была подтверждена с помощью ДНК-секвенирования. Плазмиды были временно трансфицированы либо в CHO-S, либо в 293Т суспензионные клетки и очищены либо с помощью никель-аффинной колонки для His-меченого белка, либо белка А для Fc-слитого продукта. Продукты были дополнительно очищены с помощью гель-фильтрации с использованием колонки Superdex200 (GE Healthcare) в фосфатно-солевом буфере (PBS), pH 7,2, и количественным определением очищенного слитого с использованием метода Бредфорда (Bradford, 1976: PMID 942051).

Пример 7

Получение анти-PTK7 антител с использованием hPTK7 иммуногенов

Модуляторы PTK-7 в виде мышиных антител получали согласно данному руководству путем инокуляции, соответственно, клеток BALB/3T3 или HEK 293, сверхэкспрессирующих полноразмерные hPTK7, hPTK7-His или hPTK7-Fc, изготовленные, как представлено в предыдущем Примере. С этой целью три линии мышей-самок (по 3 каждой: Balb/c, CD-1, FVB) иммунизировали препаратами вышеуказанных PTK7-иммуногенов. Всех мышей иммунизировали посредством инъекций в подушечки лап 10 мкг выбранной конструкции PTK7 или 1X106 клеток, в каждом случае, эмульгированных с равным объемом

TiterMax® или квасцовым адъювантом.

Анализы посредством FACS или твердофазного ELISA использовали для скрининга мышиной сыворотки на мышиные IgG антитела, специфичные к PTK7 человека. Для ELISA планшеты покрывали PTK7-HiS в разных концентрациях, в диапазоне от 0,01 до 1 мкг/мл, в PBS в течение ночи. После промывания PBS, содержащим 0,02% (об./об.) Твин-2, лунки блокировали 3% (масса/объем) BSA в PBS или 2% FCS в PBS, 200 мкл/лунка в течение 1 часа при комнатной температуре. Разведения мышиной сыворотки инкубировали на планшетах, покрытых PTK7-HiS в количестве 50 мкл/лунка при комнатной температуре в течение 1 часа. Планшеты промывали и затем инкубировали с 50 мкл/лунка HRP-меченых IgG козы против мыши, разведенных 1:10,000 в 3% BSA-PBS или 2% FCS в PBS, в течение 1 часа при комнатной температуре. Планшеты промывали и к ним добавляли 100 мкл/лунка раствора TMB-субстрата (Thermo Scientific 34028) на 15 минут при комнатной температуре. В конце добавляли равный объем 2М H2SO4 для блокирования реакции с субстратом и анализировали OD 450 (оптическая плотность при 450 нм) с помощью спектрофотометра.

Как указано, мышиную сыворотку также тестировали на наличие анти-PTK7 антител посредством FACS против клеток, сверхэкспрессирующих человеческую PTK7, трансдуцированных также GFP. В кратком изложении 1×105 BALB/3T3 клеток на лунку, трансдуцировали человеческим PTK7 и GFP, инкубировали в течение 30 минут с 100 мкл мышиной сыворотки, разведенной 1:100 в PBS/2% FCS. Клетки промывали PBS/2% FCS и затем инкубировали с 50 мкл/образец IgG козы против мыши, меченных DyeLight 649, вторичных, специфичных к Fc-фрагменту, разведенных 1:200 в PBS/2% FCS. Через 15 минут инкубации клетки дважды промывали PBS/2% FCS и ресуспендировали в PBS/2% FCS с DAPI (4',6-диамидин-2-фенилиндол) и анализировали посредством FACS.

Иммунизированных мышей с положительной сывороткой умерщвляли и дренирующие лимфатические узлы (подколенные и паховые, если они были увеличены) вырезали и использовали в качестве источника антителопродуцирующих клеток. Одноклеточную суспензию B-клеток (375×106 клеток) подвергали слиянию с несекретирующими клетками миеломы P3×63Ag8.653 (ATCC#CRL-1580) в соотношении 1:1 посредством электрослияния. Электрослияние клеток выполняли с использованием ВТХ Hybrimmune System или модели ЕСМ2001 (оба ВТХ Harvard Apparatus) в соответствии с инструкциями производителя. После электрослияния клетки ресуспендировали в среде для селекции гибридом с добавлением азасерина (Sigma #А9666) (DMEM (Cellgro, каталожный номер 15-017-СМ), содержащей 15% эмбриональной сыворотки (Fetal Clone I serum, Hyclone), 10% BM-Condimed (Roche Applied Sciences), 1 мМ пирувата натрия, 4 мМ L-глутамина, 100 ME пенициллина-стрептомицина, 50 мкМ 2-меркаптоэтанола и 100 мкМ гипоксантина). При первом слиянии клетки помещали в количестве 2Х104/лунка в плоскодонные микротитрационные планшеты с последующей двухнедельной инкубацией в селективной HAT-среде (среда с гипоксантином, аминоптерином и тимидином) (Sigma, CRL P-7185). При втором слиянии клетки помещали в четыре колбы Т225 с 90 мл селективной среды на колбу. Эти колбы затем помещали в увлажненный 37°C инкубатор, содержащий 5% CO2 и 95% воздуха, на 6-7 суток.

После роста библиотеку, содержащую клетки от второго слияния в Т225 (колбы с площадью поверхности 225 см2), сортировали с использованием сортировщика клеток FACSAria I и помещали в количестве 1 клетка/лунку в 96-луночные U-образные планшеты Falcon (оба от BD Biosciences). Все оставшиеся неиспользованными клетки библиотеки гибридом замораживали для дальнейшего тестирования в случае необходимости. Отобранные гибридомы затем выращивали в 200 мкл культуральной среды, содержащей 15% эмбриональной сыворотки Fetal Clon I serum (от Hyclone), 10% BM-Condimed (Roche Applied Sciences), 1 мМ пирувата натрия, 4 мМ L-глутамина, 100 ME пенициллина-стрептомицина, 50 мкМ 2-меркаптоэтанола и 100 мкМ гипоксантина. После 10-14 суток роста обоих слияний в 96 луночных планшетах супернатанты из каждой лунки оценивали на антитела, взаимодействующие с мышиным PTK7, используя анализ ELISA или FACS.

В кратком изложении, 96-луночные планшеты (VWR, 610744) покрывали 1 мкг/мл мышиного PTK7-HiS в натрий-карбонатном буфере и оставляли на ночь при 4°C.Планшеты промывали и блокировали 2% FCS-PBS в течение одного часа при 37°C и использовали немедленно или хранили при 4°C.Неразбавленные супернатанты гибридомы инкубировали на планшетах в течение одного часа при комнатной температуре. Планшеты промывали и зондировали HRP-меченым IgG козы против мыши, разведенным 1:10000 в 1% BSA-PBS, в течение одного часа при комнатной температуре. После инкубации с раствором субстрата, как описано выше, планшеты считывали при OD450.

Лунки с положительным ростом гибридом, секретирующих мышиные иммуноглобулины, подвергали скринингу на специфичность к человеческому PTK7 с использованием анализа FACS, аналогичного описанному выше. В кратком изложении, 1×105 BALB/3T3 клеток/лунка, трансдуцированных человеческим PTK7 и GFP инкубировали в течение 30 минут с 25-100 мкл супернатанта гибридом. Клетки дважды промывали PBS/2%FCS и затем инкубировали 50 мкл/образец IgG козы против мыши, меченных DyeLight 649, вторичных, специфичных к Fc-фрагменту, разведенных 1:200 в PBS/2% FCS. После 15 минут инкубации клетки дважды промывали PBS/2% FCS и ресуспендировали в PBS/2%FCS с DAPI (Life Technologies) и анализировали посредством FACS. Для второго слияния полученные PTK7-специфичные клональные гибридомы размножали и криоконсервировали в среде для замораживания CS-10 (Biolife Solutions) и хранили в жидком азоте.

Для первого слияния субклонирование выполняли на выбранных антигенположительных лунках с использованием посева методом серийных разведений. Планшеты визуально анализировали на наличие роста одиночных колоний, и супернатанты из лунок с одиночными колониями подвергали скринингу посредством антигенспецифического ELISA и FACS подтверждения, как описано выше. Полученные клональные популяции размножали, замораживали в среде для замораживания (90% FBS, 10% DMSO) и хранили в жидком азоте.

Для первого слияния PTK7-секретирующие гибридомы из положительных лунок (4 попадания OD405 в 20 мин >0,75) выбирали для дальнейшей характеристики.

В результате посева клонов второго слияния на 48 планшетов (4608 лунок) получали приблизительно 65% эффективность клонирования с сотнями попаданий. Выбранные клоны обеспечили несколько дюжин мышиных антител, которые обладали иммуноспецифичностью к человеческому PTK7, некоторые из которых также вступали в перекрестную реакцию с мышиным PTK7.

Пример 8

Секвенирование и гуманизация модуляторов PTK7

8(а). Секвенирование:

На основании вышеизложенного был выбран для секвенирования и дальнейшего анализа ряд типичных отдельных моноклональных антител, которые связываются с иммобилизованным человеческим PTK7, и антител, которые перекрестно взаимодействуют с мышиным PTK7 с очевидно высокой аффинностью. Как показано в таблице на Фиг. 6А и 6Б, анализ последовательности вариабельных областей легкой цепи (Фиг. 6А) и вариабельных областей тяжелой цепи (Фиг. 6Б) из выбранных моноклональных антител, полученных в Примере 7, подтвердил, что многие имели новые области, определяющие комплементарность, и часто показывают новые перестановки VDJ. Обратите внимание, что области, определяющие комплементарность, показанные на Фиг. 6А и 6Б, определены из VBASE2 анализа.

В частности, на Фиг. 6А показаны близлежащие аминокислотные последовательности двадцати одной новой мышиной вариабельной области легкой цепи из анти-PTK7 антитела (SEQ ID NO: 20-60, четные номера) и четырех гуманизированных вариабельных областей легкой цепи (SEQ ID NO: 62-68, четные номера), полученных из типичных мышиных легких цепей. Аналогично, на Фиг. 6Б показаны близлежащие аминокислотные последовательности двадцати одной новой мышиной вариабельной области тяжелой цепи (ЗЕО Ю N0: 21-61, нечетные номера) из тех же анти-PTK7 антител и четырех гуманизированных вариабельных областей тяжелой цепи (SEQ ID NO: 63-69, нечетные номера) из тех же мышиных антител, что и антитела, обеспечивающие гуманизированные легкие цепи. Таким образом, взятые вместе Фиг. 6А и 6Б представляют аннотированные последовательности двадцати одного мышиного анти-PTK7 антитела (обозначенные SC6.2.35, SC6.10.2, SC6.4.1, SC6.50.1, SC6.3, SC6.4, SC6.6, SC6.7, SC6.13, SC6.14, SC6.15, SC6.19, SC6.20, SC6.21, SC6.23, SC6.24, SC6.26, SC6.29, SC6.41, SC6.58 и SC6.59) и четырех гуманизированных антител (обозначенных hSC6.23, hSC6.24, hSC6.41 и hSC6.58). Обратите внимание, что обозначения SC6.4.1 и SC6.4 просто отражают аномалию наименования, и что модуляторы действительно содержат два дискретных антитела с новыми последовательностями вариабельных областей тяжелой и легкой цепи.

Для целей настоящей заявки номера последовательностей (SEQ ID NO) каждого конкретного антитела являются последовательными. Таким образом, mAb SS6.2.35 содержит SEQ ID NO: 20 и 21 для вариабельной области легкой и тяжелой цепи, соответственно. При этом SC6.10.2 включает SEQ ID NO: 22 и 23, SC6.4.1 включает SEQ ID NO: 24 и 25, и так далее. Кроме того, соответствующие нуклеиновокислотные последовательности для каждой аминокислотной последовательности антитела на Фиг. 6А и 6Б включены в настоящую заявку в виде прилагаемого перечня последовательностей. Включенные нуклеиновокислотные последовательности содержат номера последовательностей SEQ ID NO, которые на одну сотню больше номера соответствующей аминокислотной последовательности (тяжелой или легкой цепи). Таким образом, нуклеиновокислотные последовательности, кодирующие аминокислотные последовательности вариабельной области тяжелой и легкой цепи mAb SC6.2.35 (то есть SEQ ID NO: 20 и 21), включают SEQ ID NO: 120 и 121. Другие нуклеиновокислотные последовательности антител, включающие те, которые кодируют гуманизированные конструкции, пронумерованы аналогично.

В качестве первой стадии секвенирования типичных модуляторов отобранные клетки гибридомы лизировали в реагенте Trizol® (Life Technologies) с получением PHK. При этом от 104 до 105 клеток ресуспендировали в 1 мл Trizol и энергично встряхивали после добавления 200 мкл хлороформа. Затем образцы центрифугировали при 4°C в течение 10 минут и водную фазу переносили в чистую пробирку, куда добавляли равный объем изопропанола. Пробирки еще раз энергично встряхивали и оставляли инкубироваться при комнатной температуре в течение 10 минут перед центрифугированием при 4°C в течение 10 минут. Полученные осадки РНК промывали один раз 1 мл 70%-ного этанола и быстро сушили при комнатной температуре, затем ресуспендировали в 40 мкл воды, обработанной DEPC (диэтилпирокарбонат). Качество препаратов PHK определяли путем фракционирования 3 мкл в 1% агарозном геле, затем хранили при -80°C до использования.

Вариабельную область тяжелой цепи Ig каждой гибридомы амплифицировали, используя смесь праймеров, содержащую тридцать два специфичных праймера мышиной 5-лидерной последовательности, разработанных для нацеливания на весь репертуар мышиных VH, в комбинации с 3' мышиным Су праймером, специфичным для всех изотипов мышиного Ig. 400 п.о. (пар оснований) ПЦР-фрагмент VH секвенировали с обоих концов, используя тех же ПЦР-праймеры. Аналогично, смесь тридцати двух праймеров для 5' Vk лидерной последовательности, разработанных для амплификации каждого из Vk-семейств мыши, в комбинации с одним обратным праймером, специфичным к мышиному константному участку каппа-цепи, использовали для амплификации и секвенирования легкой каппа-цепи. Транскрипты VH и VL амплифицировали, используя 100 нг общей РНК, используя полимеразную цепную реакцию с обратной транскрипцией (ОТ-ПЦР).

В общей сложности для каждой гибридомы проводили восемь ОТ-ПЦР реакций: четыре для V легкой каппа-цепи и четыре для V тяжелой гамма-цепи (γ1). Набор для одностадийной ОТ-ПЦР (QIAGEN One Step RT-PCR) использовали для амплификации (Qiagen, Inc.). Этот набор включает смесь обратных транскриптаз Sensiscript и Omniscript, HotStarTaq ДНК-полимеразу, смесь dNTP (дезоксирибонуклеотидтрифосфат), буфер и Q-Solution, новую добавку, которые делает возможной эффективную амплификацию «трудных» (например, GC-богатых) матриц. Извлеченные ПЦР-продукты были непосредственно секвенированы с использованием специфических праймеров V-области. Нуклеотидные последовательности анализировали, используя IMGT для идентификации V, D и J генных сегментов зародышевой линии с самой высокой гомологией последовательности. Полученные последовательности сравнивали с известными последовательностями ДНК зародышевой линии V- и J-областей Ig, используя базу данных V-BASE2 (Retter et al., выше) и посредством выравнивания генов VH и VL с базой данных зародышевой линии мышей.

Готовили реакционные смеси, которые включали 3 мкл РНК, 0,5 каждого из праймеров для тяжелой цепи или легкой каппа-цепи в концентрации 100 мкМ, 5 мкл 5-кратного ОТ-ПЦР буфера, 1 мкл dNTPs, 1 мкл ферментативной смеси, содержащей обратную транскриптазу и ДНК-полимеразу и 0,4 мкл ингибитора рибонуклеазы RNasin (PromegaBioSystem). Реакционная смесь содержала все реагенты, необходимые как для обратной транскрипции, так и для ПЦР. Программа для термального циклера состояла из RT-стадии при 50°C в течение 30 минут, при 95°C в течение 15 минут, затем 30 циклов из (95°C в течение 30 секунд, 48°C в течение 30 секунд, 72°C в течение 1,0 минуты). Затем следовало конечное инкубирование при 72°C в течение 10 минут.

Для получения ПЦР-продуктов для непосредственного ДНК-секвенирования, их очищали с использованием набора QIAquick™ PCR Purification kit в соответствии с протоколом производителя. ДНК элюировали из спин-колонки, используя 50 мкл стерильной воды, и затем обе нити подвергали непосредственному секвенированию. Еще раз полученные ДНК последовательности анализировали с использованием VBASE2 (данные не показаны) для получения аннотированных последовательностей, представленных на Фиг. 6А и 6Б. В частности, как описано выше, аннотированные аминокислотные последовательности двадцати одной вариабельной области тяжелой и легкой цепей анти-PTK7 антитела мыши представлены на Фиг. 6А и 6Б.

8(б). Гуманизация:

Четыре мышиных антитела, полученных в Примере 7, были гуманизированы с использованием прививки области, определяющей комплементарность (CDR). Человеческие каркасные участки для тяжелых и легких цепей были выбраны на основании сходства последовательности и структуры с функциональными генами зародышевой линии человека. При этом структурное сходство оценивали посредством сравнения мышиной канонической CDR-структуры с кандидатами человеческого происхождения, имеющими аналогичные канонические структуры, как описано в Chothia et al. (выше).

Более конкретно, мышиные антитела SC6.23, SC6.24, SC6.41 и SC6.58 были гуманизированы с использованием метода автоматизированной CDR-прививки (Abysis Database, UCL Business Pic.) и стандартных методов молекулярной инженерии с получением модуляторов hSC6.23, hSC6.24, hSC6.41 и hSC6.58. Человеческие каркасные участки вариабельных областей были выбраны на основании наибольшей гомологии их последовательности с мышиной каркасной последовательностью и их канонической структуры. Для анализа, распределение аминокислот к каждому из CDR-доменов проводят в соответствии с нумерацией согласно Kabat et al. Несколько вариантов гуманизированного антитела были созданы для получения оптимального гуманизированного антитела, где гуманизированные антитела, как правило, сохраняли антигенсвязывающие области, определяющие комплементарность (CDR), из мышиной гибридомы в сочетании с человеческими каркасными участками. В конечном итоге было установлено, что гуманизированные моноклональные антитела SC6.23, SC6.24, SC6.41 и SC6.58 связываются с человеческим антигеном PTK7 с аффинностью, аналогичной их мышиным аналогам, как измерено с использованием системы Biacore.

Процедуры молекулярного конструирования выполняли, используя общепризнанные методы. С этой целью общую мРНК экстрагировали из гибридомы в соответствии с протоколом производителя (Trizol® Plus RNA Purification System, Life Technologies). Последовательность праймера, специфичного к 5-лидерной последовательности, предназначенную для амплификации каждой гибридомы, использовали в комбинации с человеческим 3'Cγl праймером для амплификации и клонирования вариабельных областей каждого гуманизированного антитела. Аналогично, 5' Vk лидерная последовательность, конкретно предназначенная для амплификации каждой из Vk-областей в комбинации с одним обратным праймером, специфичным к человеческому константному участку каппа-цепи использовали для амплификации и клонирования легкой каппа-цепи. Амплифицированные фрагменты клонировали в виде химерных человеческих гамма1/каппа-цепей и использовали в качестве исходных данных для каждого гуманизированного моноклонального антитела.

Из информации о нуклеотидной последовательности были получены данные, касающиеся V, D и J генных сегментов тяжелых и легких цепей SC6.23, SC6.24, SC6.41 и SC6.58. На основании данных о последовательности были разработаны новые наборы праймеров, специфичных к лидерной последовательности Ig VH- и VK-цепи антител, для клонирования рекомбинантных моноклональных антител. Затем последовательности выравнивали с последовательностями Ig зародышевой линии мыши. Гены тяжелой цепи SC6.23 были идентифицированы как VH36096 (V), DSP2.3 (D) и JH3. Гены тяжелой цепи SC6.24 были идентифицированы как VHJ558 (V), DSP2.7 (D) и JH4. Гены тяжелой цепи SC6.41 были идентифицированы как IGHV14-4 (V), DFL16.1 (D) и JH2. Гены тяжелой цепи SC6.58 были идентифицированы как IGHV4-1 (V), DFL16.1 (D) и JH4. Все четыре легкие цепи относились к классу К. Гены легкой цепи были идентифицированы как IGKV14-111 и JK5 для SC6.23 mAb, IGKV3-5 и JK1 для SC6.24 mAb, последовательность зародышевой линии IGKV2-137 и JK4 для SC6.41 mAb и последовательности зародышевой линии IGKV17-121 и JK4 для SC6.58 легкой каппа-цепи. Эти результаты обобщены в ТАБЛИЦЕ 1, непосредственно ниже.

Полученные последовательности тяжелой и легкой цепи из всех четырех клонов выравнивали с функциональными последовательностями вариабельной области человека и рассматривали с точки зрения гомологии и канонической структуры. Результат анализа тяжелой и легкой цепи показан ниже в ТАБЛИЦАХ 2 и 3, соответственно.

Поскольку селекция зародышевой линии и методы CDR-прививки обеспечивают получение антител, которые, как правило, сохраняют свои связывающие характеристики, очевидно, нет большой необходимости вводить мышиные остатки в большинство конструкций.

Как упоминалось выше, аминокислотные последовательности гуманизированных вариабельных областей тяжелых цепей и гуманизированных легких каппа-цепей для всех четырех антител показаны на Фиг. 6А и 6Б (SEQ ID NO: 62-69) и соответствующие нуклеиновокислотные последовательности (SEQ ID NO: 162-169) представлены в прилагаемом перечне последовательностей.

Более конкретно, аминокислотные последовательности и соответствующие нуклеиновокислотные последовательности гуманизированной легкой цепи SC6.23 (SEQ ID NO: 62 и 162) и гуманизированной тяжелой цепи (SEQ ID NO: 63 и 163) показаны на Фиг. 6А и 6Б и в перечне последовательностей. Аналогично, аминокислотные последовательности и соответствующие нуклеиновокислотные последовательности гуманизированной легкой цепи SC6.24 (SEQ ID NO: 64 и 164) и гуманизированной тяжелой цепи (SEQ ID NO: 65 и 165) показаны таким же образом. Другое воплощение изобретения проиллюстрировано аминокислотными последовательностями и соответствующими нуклеиновокислотными последовательностями гуманизированной легкой цепи SC6.41 (SEQ ID NO: 66 и 166) и гуманизированной тяжелой цепи (SEQ ID NO: 67 и 167). В еще одном воплощении представлены аминокислотные последовательности и соответствующие нуклеиновокислотные последовательности гуманизированной легкой цепи SC6.58 (SEQ ID NO: 68 и 168) и гуманизированной тяжелой цепи (SEQ ID NO: 69 и 169). Как показано в Примерах ниже, каждое из вышеуказанных гуманизированных антител функционирует как эффективный модулятор PTK7 согласно данному руководству.

В каждом случае раскрытые модуляторы экспрессировали и выделяли, используя общепризнанные методы. С этой целью синтетические гуманизированные вариабельный фрагменты ДНК (Integrated DNA Technologies) обеих тяжелых цепей клонировали в человеческий IgG1 экспрессирующий вектор. Вариабельные фрагменты легкой цепи клонировали в человеческий C-каппа экспрессирующий вектор. Антитела экспрессировали посредством котрансфекции тяжелой и легкой цепи в клетки CHO.

Более конкретно, для получения антител выполняли направленное клонирование ПЦР-продуктов мышиного и гуманизированного вариабельного гена в экспрессирующие векторы на основе человеческого иммуноглобулина. Все праймеры, используемые в Ig ген-специфических ПЦР, включали сайты рестрикции (AgeI и XhoI для IgH, XmaI и DraIII для IgK), которые обеспечивали возможность непосредственного клонирования в экспрессирующие векторы, содержащие константные участки человеческого IgG1, и IGK, соответственно. В кратком изложении, ПЦР-продукты очищали с помощью набора для очистки Qiaquick PCR purification kit (Qiagen, Inc.) с последующим гидролизом посредством AgeI и XhoI (IgH), XmaI и DraIII (IgK) соответственно. Гидролизованные ПЦР-продукты очищали перед лигированием в экспрессирующие векторы. Реакции лигирования проводили в общем объеме 10 мкл с 200 ЕД Т4-ДНК лигазы (New England Biolabs), 7,5 мкл гидролизованного и очищенного ген-специфического ПЦР-продукта и 25 нг линеаризованного ДНК-вектора. Компетентные бактерии Е.coli DH10B (Life Technologies) трансформировали посредством теплового шока при 42°C с 3 мкл продукта лигирования и помещали на ампициллиновые чашки (100 мкг/мл). Затем Agel-EcoRI фрагмент VH-области вставляли в те же сайты экспрессирующего вектора pEE6.4HuIgG1, в то время как синтетическую Xmal-Dralll VK-вставку клонировали в Xmal-Dralll сайты соответствующего экспрессирующего вектора pEE12.4Hu-каппа.

Клетки, продуцирующие гуманизированные антитела, были получены посредством трансфекции клеток HEK 293 соответствующими плазмидами с использованием реагента 293fectin. При этом плазмидную ДНК очищали с помощью QIAprep спин-колонок (Qiagen). Клетки почек эмбриона человека (HEK) 293Т (АТСС номер CRL-11268) культивировали в 150 мм чашках (Falcon, Becton Dickinson) в стандартных условиях в модифицированной Дульбекко среде Игла (DMEM) с добавлением 10% инактивированной нагреванием FCS (эмбриональная телячья сыворотка), 100 мкг/мл стрептомицина, 100 ЕД/мл пенициллина G (все от Life Technologies).

Для временной трансфекции клетки выращивали до 80%-ной конфлюентности. Равные количества IgH и соответствующей векторной ДНК цепи IgL (12,5 мкг каждой векторной ДНК) добавляли к 1,5 мл Opti-MEM, смешанной с 50 мкл реагента для трансфекции HEK 293 в 1,5 мл Opti-MEM. Смесь инкубировали в течение 30 мин при комнатной температуре и распределяли поровну в чашки для культивирования. Супернатанты собирали через три дня после трансфекции, заменяли 20 мл свежей DMEM с добавлением 10% FBS и собирали еще раз на 6 сутки после трансфекции. Культуральные супернатанты очищали от клеточного дебриса посредством центрифугирования при 800 g в течение 10 мин и хранили при 4°C. Рекомбинантные химерные и гуманизированные антитела очищали с помощью сферообразных частиц белка G (GE Healthcare).

Пример 9

Характеристики модуляторов PTK7

9(a). Основные характеристики модуляторов

Различные методы использовали для анализа иммунохимических характеристик выбранных модуляторов PTK7 (как мышиных, так и гуманизированных), как указано выше. В частности, ряд этих антител охарактеризовали в отношении аффинности, кинетики, биннинга и перекрестной реакционной способности к гомологам яванского макака и мыши (например, с помощью ForteBio). Также была измерена посредством Вестерн-блота реактивность модуляторов с использованием восстановленных и невосстановленных образцов, чтобы получить некоторое представление о том, являются эпитопы линейными или нет. В дополнение к данным связыванию с мышиным и человеческим антигеном, представленным на Фиг. 7А, в табличной форме на Фиг. 7Б представлены результаты характеристики антител для выбранных мышиных модуляторов. Наконец, как показано на Фиг. 7 В-7Д, измеряли аффинность выбранных мышиных и гуманизированных модуляторов, используя интерферометрический анализ в биослое на ForteBIO RED (ForteBIO, Inc.) со стандартным рядом концентраций антигена. В целом, выбранные модуляторы демонстрировали относительно высокие аффинности в наномолярном диапазоне.

В соответствии с настоящим изобретением, для обеспечения точности, аффинность модулятора измеряли тремя способами. Во-первых, сигнал связывания измеряли для фиксированного количества антитела, тестируемого против серийных разведений антигена в ELISA для определения относительной модуляторной активности (данные не показаны). Во-вторых, затем измеряли аффинности и кинетические константы kon и koff выбранных эффекторов, используя интерферометрический анализ в биослое на ForteBIO RED (ForteBIO, Inc.) со стандартным рядом концентраций антигена. Наконец, аффинность выбранных модуляторов измеряли посредством поверхностного плазмонного резонанса (Biacore System, GE Healthcare). На основании стандартной серии концентрации антигена и используя 1:1 модель связывания Ленгмюра, определяли Kd связывания антитела с антигеном и кинетические константы kon и koff (например, см. Фиг. 7В и 7Д) с помощью принятых в данной области методов. В общем случае, выбранные эффекторы, мышиные или гуманизированные, демонстрировали относительно высокие аффинности в наномолярном диапазоне. В таблице на Фиг. 7Б верхний индекс В обозначает измерения аффинности, полученные с помощью Biacore, в то время как верхний индекс F обозначает измерения, выполненные на ForteBio.

Предварительная работа также была выполнена, чтобы определить, содержит ли эпитоп, узнаваемый эффектором PTK7, соседние аминокислоты или образован несоседними аминокислотами, ставшими соседними из-за вторичной структуры антигена. При этом выполняли Вестерн-блоттинг в восстанавливающих (например, используя 0,5 M DTT) и невосстанавливающих условиях. В частности, используя стандартные, хорошо известные в данной области методы электрофореза, антиген PTK7 в обоих состояниях прогоняли через гели и блотировали перед воздействием выбранными модуляторами. Как показано на Фиг. 7Б, были протестированы два модулятора PTK7, которые по существу взаимодействовали только с антигеном, в котором дисульфидные связи были неповрежденными (NR). Активность остальных модуляторов PTK7 не тестировали в отношении Вестерн-блот активности.

Что касается биннинга антител, то использовали анализатор ForteBio Octet Red96 Analyzer (ForteBio, Inc.) в соответствии с инструкциями производителя и признанный в данной области сэндвич-метод [Analytical Biochemistry 386: 172-180 (2009)] для идентификации антител, которые связываются с одинаковыми или разными бинами. В кратком изложении, антитело (AM) было захвачено антимышиным захватывающим чипом до использования высокой концентрации несвязывающего антитела 15 мкг/мл (100 нМ) для блокирования чипа и получения исходного уровня. Мономерный рекомбинантный hPTK7-His (изоформа a), как представлено в Примере 6 (при 500 нМ), был затем захвачен специфическим антителом (AM) и наконечник погружали в лунку либо с тем же антителом (AM) в качестве контроля, либо в лунку с другим антителом (Ab2), где оба антитела составляют 4 мкг/мл (25 нМ). Если с новым антителом наблюдалось дополнительное связывание, тогда AM и Ab2 определяли, как относящиеся к разным бинам. Если не происходило дополнительного связывания, аналогичного контрольному AM, тогда Ab2 определяли, как относящийся к тому же бину. Этот способ может быть распространен на скрининг больших библиотек уникальных антител с использованием целого ряда антител, представляющих уникальные бины в 96-луночном планшете. Типичные данные для трех типичных модуляторов показаны на Фиг. 7А, как для человеческого, так и для мышиного антигена PTK7. На Фиг. 7А показано, что в то время как SC6.10.2 совсем не связывается с мышиным антигеном, SC6.2.35 связывается примерно на 10% с человеческим антигеном и SC6.25.1 связывается с мышиным PTK7-HiS с такой же аффинностью (примечание; антитела обозначены как H2.35, H 10.2 и H25.1 на Фиг. 7А). Кроме того, было установлено, что каждое из этих тестируемых антител относится к разным бинам. Аналогично, биннинг-анализ выполняли для девяти дополнительных модуляторов PTK7, результаты представлены на Фиг. 7Б. Эти данные идентифицировали по меньшей мере семь отдельных бинов, узнаваемых тестируемыми модуляторами. ND в таблице указывает, что данные не были определены.

Наконец, перекрестную реактивность в отношении гомологов PTK7 яванского макака и мыши оценивали в ForteBio, используя серию концентраций с рекомбинантно экспедируемыми, мономерными антигенами. Как показано на Фиг. 7Б, несколько типичных модуляторов взаимодействовали с мышиным PTK7, в то время как все антитела перекрестно взаимодействовали с очень похожим PTK7 яванского макака.

9(б). Характеристики гуманизированного модулятора

Используя методы, представленные выше в данном Примере, гуманизированные конструкции hSC6.23, hSC6.24, hSC6.41 и hSC6.58 анализировали, чтобы определить их связывающие характеристики. Кроме того, связывание гуманизированного антитела непосредственно сравнивали с родительским мышиным антителом для обоих антител, чтобы определить любые незначительные изменения в константах скоростей, вызванные процессом гуманизации.

Более конкретно, аффинность мышиного SC6.23 измеряли посредством Biacore, используя поверхностный плазмонный резонанс (SPR), с получением результатов, представленных на Фиг. 7 В. На основании ряда концентраций 25, 12,5 и 6,25 нМ (образующих кривые сверху вниз на Фиг. 7 В и 7Е) и использования 1:1 модели связывания Ленгмюра, было определено, что Kd связывания антитела с антигеном составляет 2,3 нМ. Аналогичные эксперименты, проведенные затем с гуманизированной конструкцией SC6.23, показали аналогичные результаты (Фиг. 7Е), указывая на то, что процесс гуманизации не оказывал негативного влияния на аффинность. При этом измерения показали, что гуманизированная конструкция имела аффинность 3,9 нМ, что вполне укладывается в пределы, приемлемые для терапевтического антитела. Аналогичные измерения для каждой гуманизированной конструкции, описанной в Примере 8, представлены на Фиг. 7Д и, наряду с другими методами, изложенными в этом Примере, показывают, что раскрытые гуманизированные модуляторы PTK7 обладают качествами, нужными для терапевтических антител.

Пример 10

Определение эпитопа для выбранных модуляторов PTK7

Для дополнительного уточнения данных по биннингу и определения эпитопных участков, определяемых выбранными модуляторами PTK7, созданными, как указано выше, конструировали и экспрессировали несколько разных вариантов ECD PTK7. В частности, были сконструированы делеционные мутанты PTK7 путем использования праймеров, которые амплифицировали различные Ig-домены PTK7 и сливали их с сайтом рестрикции BgIII выше человеческого IgG2 Fc-домена, заказанного в качестве синтетического гена (ДНК 2,0). Эти Fc-слитые белки затем клонировали в экспрессирующий вектор pEE12.4 (Lonza AG) с использованием сайтов рестрикции HindiII и EcoRI. Выделенные, не содержащие эндотоксин плазмидные ДНК (Plasmids DNA, Qiagen Inc.) использовали для трансфекции прикрепленных 293 клеток с использованием 293Fectin (Life Technologies). Через 72 часа после трансфекции собирали супернатант от 293 трансфицированных клеток. Более конкретно, были сконструированы следующие делеционные конструкции, слитые с Fc-областью:

Аминокислотные последовательности первых шести из этих конструкций представлены на Фиг. 8А-8Е (содержащие выбранные PTK7 ECD наряду с Fc-участком). Последовательность седьмой конструкции, включает внеклеточный домен изоформы а (SEQ ID NO: 3), как представлено на Фиг. 1В, слитый с Fc-доменом.

Используя эти конструкции, несколько модуляторов тестировали на их способность узнавать белки PTK7 с делециями определенных Ig-доменов. Посредством ELISA анализа, включающего использование конструкций с делецией домена и проводимого в стандартных условиях. При этом слияния PTK7 Ig домен Fc были захвачены на планшете ELISA, покрытым IgG Fc-специфическим (Jackoson Immunoresearch) антителом козы против человека. Способность каждого мышиного анти-PTK7 антитела связываться с различными делеционными Fc-слитыми белками затем определяли с помощью HRP-меченного FC-специфического антитела козы против мыши.

С использованием этого анализа типичные модуляторы были идентифицированы как направленные против конкретных PTK7 Ig доменов. Пример результатов ELISA определяет каждый типичный обнаруженный эпитоп или картину связывания и включен в Таблицу 4 непосредственно ниже.

Моноклональные антитела против PTK7, по-видимому, узнают несколько разных эпитопов на основании разных картин положительного связывания в анализе ELISA (Таблица 4 и Фиг. 8Ж). Следует отметить, что на Фиг. 8Ж модуляторы указаны, какбМ, а не SC6, и SC6.2.35 и SC6.10.2 указаны как H2.35 и H10.2. Ни одно из антител не связывается только с эпитопом в пределах 1д-доменов 6-7, но эти два домена могут вносить вклад во вторичную/третичную структуру слитой конструкции Ig3-7 Fc, которая связывалась SC6.18 и SC6.31 (ОТСУТСТВУЕТ В ТАБЛИЦЕ). Кроме того, три антитела (SC6.2.35, SC6.4.1 и SC6.10.2) узнают эпитоп в первых четырех Ig-доменах и ни одно из антител не связывается с эпитопом в пределах Ig-доменов 6-7. В первых четырех Ig-доменах SC6.2.35 связывается с эпитопом в пределах доменов 1-2. SC6.4.1 узнает эпитоп в границах Ig-доменов 2 и 3. Напротив, SC6.10.2, по-видимому, чувствителен к любым делециям в первых четырех Ig-доменах и, следовательно, все четыре Ig-подобные домена, по-видимому, вовлечены в определение эпитопа SC6.10.2. Аналогично, некоторые антитела связываются только с полноразмерной конструкцией, Ig-доменами 1-7, указывая, что Ig-делеции могут разрушать некоторые сайты связывания или вторичную структуру этих эпитопов. На Фиг. 8Ж представлена схема этих картин связывания, включая дополнительные антитела и сопоставимые данные, показывающие локализацию связывания раскрытых модуляторов, где 7 Ig-доменов PTK7 ECD представлены в форме блоков, а скобки используются для отметки выявленного положения эпитопа внутри этого ECD соответствующих анти-PTK7 антител.

Пример 11

Экспрессия белка PTK7 в типичных образцах опухоли

После документального подтверждения повышенных уровней экспрессии генов и генерации антител против PTK7 в предыдущих Примерах, искали свидетельство экспрессии соответствующего белка PTK7 в выбранных популяциях опухолей пациента. С этой целью были представлены обращенно-фазовые панели лизата опухолевого белка (ProteoScan™ Arrays; OriGene Technologies), содержащие 4 разведения 432 лизатов ткани из 11 типов опухоли или их соответствующую соседнюю ткань, наряду с контролями, состоящим из клеток HEK 293 без или с ТР53-сверхэкспрессией, обеспечиваемой экзогенным промотором. Экспрессию белка PTK7 в лизатах в этой панели определяли, используя мышиное моноклональное PTK7 антитело, полученное, как изложено в Примере 7 и которое узнает белок PTK7, посредством Вестерн блоттинга (например, клон SC6.2.35). Реагенты и протоколы для колориметрического обнаружения были предоставлены производителем ProteoScan Arrays, пятна на полученной панели были преобразованы в цифровые изображения с использованием планшетного сканера с помощью программного обеспечения BZScan2 Java (INSERM-TAGC) для количественного определения интенсивности пятна.

Результаты таких анализов указывают, что экспрессия белка PTK7 активирована в подгруппе образцов опухоли, полученных от пациентов с меланомой, немелкоклеточным раком легкого (NSCLC), мелкоклеточным раком легкого (SCLC), колоректальным раком, раком поджелудочной железы, молочной железы и яичника. Типичные данные этих анализов для выбранных опухолей показаны на Фиг. 9А-9Г. В частности, на Фиг. 9А показано, что экспрессия белка PTK7 оказывается значительно более высокой в подгруппе образцов колоректальной опухоли; особенной у пациентов с IV стадией заболевания, по сравнению с нормальной соседней тканью или образцами опухолевой ткани, полученными на более ранних стадиях заболевания. Как показано на Фиг. 9Б, экспрессия белка PTK7 была также повышена в большинстве нейроэндокринных опухолей поджелудочной железы, а также в подгруппах пациентов с раком молочной железы (Фиг. 9В) и яичника (Фиг. 9Г), соответственно. Данные были получены, как описано выше, и представлены в виде средней интенсивности пикселей на пятно (интенсивность пятна). Горизонтальная черная полоса в каждом образце представляет среднее значение для образцов в каждой соответствующей категории.

Эти данные подтверждают наблюдения в вышеприведенных Примерах, что сверхэкспрессия PTK7 связана с TIC и/или TPC в колоректальном раке и может быть вовлечена в пролиферацию и/или выживаемость. С учетом вышеприведенных Примеров, показывающих, что: а) экспрессия гена PTK7 преимущественно связана с клеточной субпопуляцией TPC в колоректальном раке и клеточной субпопуляцией TG в опухолях поджелудочной железы; б) что экспрессия белка PTK7 выше в клеточной субпопуляции TIC; в) экспрессия белка PTK7 повышена во всех образцах опухоли поздней стадии колоректального рака; и г) общее наблюдение заключается в том, что TIC чаще появляются на поздних стадиях опухоли, следует, что PTK7 ассоциирован с клетками, лежащими в основе опухолевого роста, резистентности к терапии и рецидива опухоли, таким образом подтверждая предположение, что PTK7 может играть существенную роль в поддержке TPC и/или TIC в вышеупомянутых опухолях.

В свете этих результатов экспрессию PTK7 оценивали в популяциях неонкогенных (NTG) и стволовых раковых клеток (CSC) ксенотрансплантатов опухоли молочной железы (BR), легкого (LU), яичника (OV), толстой кишки (CR) и почек (KDY) человека, используя проточную цитометрию. Как изложено в Примере 1, NTG и CSC-обогащенные популяции могут быть идентифицированы, подвергнуты наблюдению и обогащены с использованием фенотипических маркеров CD46-/loCD324- и CD46hiCD324+ соответственно. Соответственно, человеческие опухолевые ксенотрансплантаты из мыши с ослабленным иммунитетом собирали, расщепляли и совместно окрашивали имеющимися в продаже анти-CD46, анти-CD324 и анти-PTK7 (Miltenyi Biotech) антителами перед оценкой экспрессии PTK7 с использованием проточной цитометрии в популяции CD46-/loCD324-NTG и популяции CD46hiCD324+CSC. Более конкретно, проточный цитометрический анализ выполняли, используя стандартные методики, на проточном цитометре BD FACSCanto™ II (BD Biosciences) с контролями окрашивания изотипа и "флуоресценция минус один" (FMO), используемыми для подтверждения специфичности окрашивания.

Результаты для типичных образцов опухоли молочной железы, легкого, яичника, колоректальной опухоли и опухоли почки показаны на Фиг. 9Д, где контрольный изотип обозначен серым цветом, популяция NTG-клеток представлена штрихованной линией и CSC-обогащенная популяция показана сплошной линией. Следует иметь в виду, что в то время как поверхностное PTK7 окрашивание было относительно низким в NTG-популяциях каждой из этих опухолей, поверхностное PTK7 окрашивание было заметно повышенным в CSC-обогащенных популяциях. Эти результаты были подтверждены (данные не показаны) с использованием ряда раскрытых модуляторов и представляют более чем двадцать пять уникальных исследованных NTX-линий (содержащих различные солидные опухоли).

Коррелированная картина экспрессии PTK7 с другими поверхностными маркерами TPC была дополнительно функционально отображена в исследованиях онкогенности в NSCLC раке и раке яичника. Опухолевые популяции PTK7- и PTK7+ были выделены из расщепленных человеческих опухолевых ксенотрансплантатов, окрашенных, как описано выше, посредством сортировки флуоресцентно-активированных клеток (FACS) и равные количества смешивали с Matrigel (BD Biosciences) и подкожно трансплантировали мышам-реципиентам NOD/SCID. В то время как клетки PTK7- не продуцировали опухоли у мышей-реципиентов, опухолевые клетки PTK7+ постоянно продуцировали быстро растущие опухоли, как NSCLC рака, так и рака яичника. Таким образом, в соответствии с данным руководством, PTK7 функционально отображает TPC в раке яичника и NSCLC и представляет еще одно доказательство пользы раскрытых модуляторов в качестве диагностических и терагностических агентов.

Пример 12

Выбранные модуляторы PTK7 интернализуются клетками K562 и G401

Модуляторы PTK7 из гибридом, полученных посредством иммунизации мышей, как описано выше, подвергали скринингу в отношении их способности интернализоваться в клетках K562 и G401.

С этой целью клетки K562 в начальной концентрации 106/мл (одноклеточная суспензия) блокировали человеческим TruStain (Biolegend, Inc., 422302) в течение 10 минут при комнатной температуре. Клетки разбавляли до 50×103 клеток на реакцию. Образцы-дубликаты окрашивали в течение 30 минут на льду супернатантом антитела при конечном объеме 50 мкл, затем промывали средой для FACS-окрашивания (FSM; 2% эмбриональной бычьей сыворотки/забуференный физиологический раствор Хэнка/25 мМ HEPES [pH 7,4]; Mediatech, Inc.) для удаления несвязанного антитела. За этим следовало второе окрашивание антителами осла против мыши Alexa647 (Life Technologies) в течение 30 минут на льду. Затем клетки промывали еще раз для удаления несвязанного антитела, и образцы ресуспендировали в среде для интернализации (2% эмбриональной бычьей сыворотки/среда Дульбекко, модифицированная по способу Исков) и инкубировали в 5% CO2 при 37°C (или при 4°C для контроля) в течение 1 часа, чтобы обеспечить интернализацию. Реакцию останавливали, перенося образцы на лед и добавляя ледяной FSM. Для удаления любого неинтернализованного и оставшегося на клеточной поверхности антитела, образцы обрабатывали фосфатным буфером с низким pH (PBS [pH 2.0]) в течение 10 минут на льду. После этой стадии "кислотного отделения" образцы тщательно промывали FSM, ресуспендировали в 150 мкл FSM, содержащей 2 мкг/мл DAPI (Life Technologies), и анализировали на проточном цитометре BD FACS Canto. Любое увеличение флуоресценции выше детектируемого у клеток, инкубируемых на льду в этом эксперименте, связано со способностью к интернализации антитела, которая защищает флуоресцентную молекулу от удаления с клеточной поверхности при обработке фосфатным буфером с низким pH. Все инкубации выполняли в среде для окрашивания FACS, если не указано иное.

При скрининге отдельных клонов супернатантов PTK7 антителосодержащих гибридом с использованием протокола отделения, описанного выше, несколько супернатантов показали положительный сдвиг флуоресценции по сравнению с неокрашенными клетками и IgG-отрицательными контрольными антителами (Фиг. 10А и 10В). Интернализация антитела наблюдалась с несколькими анти-PTK7 антителами, как показала способность этих антител защищать вторичные антитела Alexa647 от кислотной зачистки, и привела к сдвигу флуоресценции вправо. Клон антитела SC6.10.2 (то есть H10 на Фиг. 10В) является примером типичной способности к интернализации анти-PTK7 антителами с такой активностью. По сравнению с IgG контролями, приблизительно 15% PTK7 антителосодержащих супернатантов (4 of 27) индуцировали интернализацию. При использовании клеток K562 эти данные демонстрируют, что подгруппа антител, способная связывать PTK7 ECD, захватывает антиген, так как он присутствует на клетках, и способны к эффективной интернализации.

Дополнительные данные, указывающие, что раскрытые модуляторы могут опосредовать интернализацию в различных типичных клеточных линиях, показаны на Фиг. 10Г. В частности, было обнаружено, что клеточная линия глиобластомы (G401 Wilm's Tumor cells) экспрессирует высокие уровни PTK7 (данные не показаны), позволяя предположить, что эта клеточная линия может быть более чувствительной в выбранных условиях анализа и, следовательно, способна более эффективно идентифицировать модуляторы, способные индуцировать интернализацию. В целом, при использовании этих клеток с вышеупомянутой процедурой кислотного отделения, 170 уникальных гибридомных супернатантов из Примера 7 были подвергнуты скринингу, чтобы определить содержат ли они интернализованные антитела. Очищенные антитела SC6.2.35, SC6.10.2 и SC6.25.3 (обозначенные как H2.35, H10.2 и H25.3 на Фиг. ЮГ), которые были идентифицированы в вышеуказанном скриннинге, использовали в качестве положительных контролей (Фиг. 10Г). Способность модуляторов, присутствующих в шести типичных супернатантах (идентифицированных посредством обозначения лунок), к интернализации, показана непосредственно под контролем. Благодаря этому улучшенному анализу было показано, что многочисленные модуляторы, полученные посредством иммунизации, описанной выше, были способны связывать и интернализовать PTK7 (о чем свидетельствует 1A02, 1F02, 2A03 и 2F10), хотя не каждый клон (2F11 и 2F09) обладает этой способностью.

В еще одной демонстрации свойств раскрытых модуляторов было обнаружено, что все экранированные антитела, которые связываются с клетками G401 в значительной степени, до некоторой степени интернализуются (Фиг. 10Д). Как показано пунктирной линией на Фиг. 10Д положительное клеточное окрашивание составляло 4% на основании мышиных изотипических контрольных антител, которые продемонстрировали неспецифическое окрашивание 0-3% клеток. Средние интенсивности флуоресценции клеток G401, окрашенных каждым антителом, измеряли после стадии кислотного отделения (то есть после интернализации) при 37°C и 4°C и интерполировали к относительному числу рецепторов на клетку с использованием 8-пиковые радужные сферообразные частицы (8-peak Rainbow beads, BD Spherotech #559123), которые содержат известное число флуоресцентных молекул. Число интернализированных рецепторов рассчитывали путем вычитания числа рецепторов, полученных из образцов, прошедших стадию интернализации при 4°C (контроль), из числа рецепторов при 37°C. Было отмечено, что PTK7-специфические антитела являются гетерогенными по своей способности индуцировать интернализацию, принимая во внимание десятикратную разницу в числе интернализированных рецепторов, независимо от уровня связывания клеток (верхний правый квадрант Фиг. 10Д).

Пример 13

Модуляторы PTK7 облегчают доставку цитотоксических агентов

Направленная доставка цитотоксического лекарственного средства, стабильно связанного с антителом, представляет собой правомочный антительный подход, который может обеспечить значительную терапевтическую пользу для пациентов с солидными опухолями. Для того чтобы определить, способны ли интернализованные PTK7-специфические антитела, описанные выше, опосредовать доставку цитотоксического агента живым клеткам, выполняли анализ гибели клеток in vitro, где стрептавидин, конъюгированный с инактивирующим рибосомы белком сапорином (Advanced Targeting Systems), был связан с биотинилированными PTK7 антителами, и через 72 часа определяли способность этих сапориновых комплексов интернализовать и убивать клетки посредством измерения жизнеспособности клеток.

В частности, 1×104 клеток G401 Wilm's Tumor помещали в лунки 96-луночного планшета. Модуляторы PTK7 в форме анти-PTK7 антител, как описано выше, очищали от супернатантов, биотинилировали и затем разбавляли до 20 мкг/мл. Аликвоту каждого антитела смешивали 1:1 со стрептавидином-ZAP (Advanced Targeting Systems), перемешивали в течение 5 секунд и затем инкубировали при комнатной температуре в течение 1 часа. Затем были сделаны три дополнительных серийных 10-кратных разведений комплексов антитело-сапорин и 50 мкл каждой смеси, соответственно, добавляли в лунки, содержащие клетки G401. Затем смесь клетка/антитело-сапорин инкубировали при 37°C/5%CO2 в течение 24 часов. После этой инкубации клетки центрифугировали в круглодонных 96-луночных планшетах, супернатант удаляли и в каждую лунку добавляли 100 мкл свежей культуральной среды. Затем клетки инкубировали в течение еще 72 часов перед подсчетом живых клеток с помощью CellTiter-Glo (Promega Inc.) согласно инструкции производителя.

С помощью анализа клеточной гибели, описанного выше, было показано, что типичные интернализирующие модуляторы PTK7, содержащие антитела из клонов SC6.2.35, SC6.10.2 и SC6.25.3 (обозначенные H2.35, H10.2 и H25.3 на Фиг 11А) опосредуют интернализацию токсина сапорина и клеточную гибель. Более конкретно, на Фиг. 11А ясно показана способность этих модуляторов осуществлять клеточную гибель через PTK7-опосредованную интернализацию в отличие от контрольного антитела неспецифического изотипа (то есть MOPC). Эти данные демонстрируют, что раскрытые модуляторы являются иммуноспецифичными к PTK7 и способны эффективно опосредовать доставку цитотоксического полезного груза и убивать PTK7-положительные клетки путем ассоциации с клеточной поверхностью.

В продолжение вышеупомянутого анализа гибели клеток была продемонстирована доставка цитотоксического полезного груза посредством PTK7-специфических антител с использованием четырех более типичных модуляторов (SC6.23, SC6.41, SC6.51 и SC6.58) с SC6.10.2, использованным в качестве положительного контроля. С этой целью следующие типы клеток помещали в 96-луночные планшеты для культуры тканей в соответствующей культуральной среде (500 клеток на лунку) за один день до добавления антител и токсина: клетки G401 Wilm's Tumor, HEK293T, сконструированные с использованием ретровирусной трансдукции для экспрессии молекул PTK7 на их клеточной поверхности (здесь обозначены, как клетки 293.PTK7) и HEK293T, выступающие в качестве контроля.

Для этого анализа очищенные модуляторы PTK7 в разных концентрациях добавляли в лунки, содержащие посеянные клетки. После добавления модуляторов фиксированное количество антимышиного IgG Fab-фрагмента, ковалентно связанного с сапорином (Fab-ZAP, Advanced Targeting Systems, #IT-48) в концентрации 4 нМ добавляли в лунки и культуры инкубировали в течение 72 часов. Количество жизнеспособных клеток определяли, как описано выше, используя CellTiter-Glo. Необработанные значения люминесценции, полученные с использованием культур, содержащих клетки с сапорин-Fab-фрагментом (но не модулятор) принимали за 100% эталонные величины и все другие подсчеты рассчитывали соответственно (упоминаются как "Нормализованные RLU").

С помощью этого анализа было продемонстрировано, что все протестированные PTK7 антитела (но не изотипические контрольные антитела) способны убивать клетки-мишени (Фиг. 11Б-11Г), где на Фиг. 11Б, 11В и 11Г показано влияние модулятора на клетки G401, клетки 293.PTK7 и клетки HEK293T соответственно. Следует отметить, что модулятор-опосредованная интернализация и гибель клеток зависит от типа клеток (сравните клетки G401 на Фиг. 11Б и клетки HEK293T на Фиг. 11Г), уровня экспрессии PTK7 на клетках-мишенях (сравните клетки 293.PTK7 на Фиг. 11В и клетки HEK293T на Фиг. 11Г) и собственной способности различных модуляторов к интернализации. Анализ также показывает, что интернализация в первую очередь происходит в результате связывания PTK7-специфического антитела с клеточной поверхностью без необходимости в дополнительном сшивании. На основании данных, используемых для получения кривых доза-эффект на Фиг. 11Б-11Г (и аналогично полученных значений для дополнительных модуляторов - не показано), определяли 50% эффективную концентрацию ("EC50") для каждой комбинации тестируемый модулятор/клетка-мишень. В частности, в Таблице 5 непосредственно внизу перечислены EC50 (в пМ) для тринадцати модуляторов, определенные для каждого из трех типов клеток с использованием анализа, описанного непосредственно выше. ND указывает, что значение не было определено.

Несмотря на некоторый отмеченный разброс данных в отношении гибели для отдельных модуляторов, наблюдались общие тенденции, очевидная из данных, представленных в Таблице 5. При этом модуляторы, как правило, были более эффективны в опосредовании клеточной гибели сконструированных PTK сверхэкспрессирующих 293 клеток, чем G401 клеток или 293 клеток дикого типа. Интересно, что многие из протестированных модуляторов были относительно эффективны в опосредовании гибели несконструированных G401 опухолевых клеток, которые, как известно, экспрессируют PTK7 на клеточной поверхности. Такие воспроизводимые результаты свидетельствуют о терапевтическом потенциале широкого ряда интернализующих модуляторов PTK7, как показано в примерах в данном описании.

Пример 14

Модуляторы PTK7 облегчают доставку цитотоксических агентов в онкогенные клетки

Для подтверждения результатов предыдущего Примера и демонстрации того, что PTK7 модуляторы могут опосредовать интернализацию токсина и клеточную гибель первичных человеческих опухолевых клеток, мышиные линиеобедненные NTX клетки (то есть человеческие опухолевые клетки, размноженные в виде ксенотрансплантатов с небольшим количеством пассажей мышах с ослабленным иммунитетом) помещали в планшет и затем подвергали воздействию анти-PTK7 антител и Fab-ZAP.

В частности, NTX-опухоли, полученные от пациентов с раком легких (LU), яичника (OV) и меланомой (SK), расщепляли в одноклеточную суспензию и высевали на планшеты Primaria™ (BD Biosciences) в бессывороточной среде, обогащенной фактором роста, с использованием общепризнанных методов, которые способствуют пролиферации раковых стволовых клеток. Через 3-5 суток культивирования при 37°C/5%CO2/5%O2 клетки приводили в контакт с изотипическим контрольным (IgG2a) антителом или одним из трех мышиных анти-PTK7 антител (0,1 нМ SC6.2.35, SC6.10.2 или SC6.25.1; - меченные SC6.H2, SC6.H10 и SC6.H25), и Fab-ZAP (40 нМ), как в общих чертах изложено в предыдущем Примере. Модулятор-опосредованную сапориновую цитотоксичность затем оценивали путем количественного определения оставшегося числа клеток с использованием CellTiter Glo в соответствии с инструкциями производителя через 5-7 суток. Результаты были нормализованы по отношению к необработанным клеткам.

Как видно на Фиг. 12, воздействие каждого из протестированных модуляторов (но не изотипического контроля) привело к снижению числа жизнеспособных клеток для всех типов опухолей. При этом следует иметь в виду, что количество погибших клеток, по-видимому, зависит от конкретной опухолевой клеточной линии, а также от конкретного модулятора. Эти данные указывают, что модуляторы по настоящему изобретению могут иммуноспецифически ассоциировать с различными антигенэкспрессирующими клетками из различных типов опухоли, интернализовать и тем самым опосредовать гибель составляющих клеток. Кроме того, способность раскрытых модуляторов делать это в отношении NTX-опухолевых клеточных линий, культивируемых в условиях, способствующих пролиферации раковых стволовых клеток, как описано ранее, в значительной степени свидетельствует об их способности избирательно ликвидировать раковые стволовые клетки.

Пример 15

Модуляторы PTK7 снижают онкогенность раковых стволовых клеток

Для дополнительного подтверждения способности раскрытых модуляторов снижать частоту раковых стволовых клеток и воздействовать на их онкогенный потенциал, клетки NTX-опухоли молочной железы обрабатывали SC6.2.35 и затем имплантировали их мышам с ослабленным иммунитетом.

При этом две полученные от пациентов раком молочной железы NTX опухоли (BR13 и BR64) расщепляли и человеческие опухолевые клетки культивировали в условиях, которые, как известно в данной области, поддерживают онкогенные клетки, и обрабатывали модулятором PTK7 (и изотипическим контролем) и Fab-ZAP, как изложено в предыдущем Примере. Затем измеряли цитотоксичность с точки зрения жизнеспособности клеток с использованием Cell Titer Glo в соответствии с инструкциями производителя через четырнадцать суток после воздействия. Результаты опять были нормализованы к необработанным клеткам.

Как видно на Фиг. 13А и 13Б соответственно, клетки опухоли молочной железы, полученные из BR13 (Фиг. 13А) и из BR64 (Фиг. 13Б), были в значительной степени ликвидированы посредством модулятор PTK7-опосредованной иммуноспецифической ассоциации и интернализации цитотоксического агента сапорина. Более конкретно, лечение с помощью 0,2 нМ модулятора PTK7 SC6.2.35 (SC6.H2) привело к ликвидации приблизительно 70-80% клеток, в то время как IgG2a контрольные обработанные клетки почти не подверглись воздействию. Эти результаты согласуются с результатами, наблюдаемыми в Примере 13, и дополнительно демонстрируют широкую применимость настоящего изобретения, основанного на способности раскрытых модуляторов ликвидировать клетки, поддерживающие опухоль, полученные из различных опухолей.

Чтобы подтвердить, что раскрытые модуляторы ликвидируют опухоль-инициирующие клетки, обработанные препараты двух клеточных линий рака молочной железы трансплантировали мышам, чтобы определить, остаются ли живыми опухоль-инициирующие клетки. Более конкретно, собирали клетки из трех параллельных лунок, каждую независимо, промывали PBS, содержащим 2% BSA, ресуспендировали в 100 мкл и затем трансплантировали отдельным мышам с ослабленным иммунитетом, как правило, используя операции, изложенные в Примере 1. Мышей еженедельно контролировали в отношении опухолевого роста и измеряли любые появляющееся опухоли, чтобы рассчитать их объем. Только у мышей с трансплантированными клетками NTX BR13 и BR64, обработанных IgG-контролем, развивались опухоли, в то время как у мышей с трансплантированными клетками, контактировавшими с модуляторами PTK7, не развивались. Эти результаты демонстрируют, что TIC ликвидируются модуляторами PTK7, способными опосредовать доставку токсина (Фиг. 13В).

Анализ данных показывает, что имплантация живых клеток, оставшихся после лечения каждой клеточной линии опухоли молочной железы модулятором PTK7 и сапорином, не приводит к образованию опухолей. С другой стороны, контрольные клетки из обеих клеточных линий рака молочной железы (то есть те, которые были обработаны изотипическим контрольным антителом) были способны возобновлять опухолевый рост при имплантации. В частности, у двух из трех мышей, которым имплантировали каждую контрольную клеточную линию (BR22 и BR64), развивались измеряемые опухоли, что указывает на то, что имплантируемые клетки включали клетки, поддерживающие опухоль. Что еще более важно, неспособность обработанных модулятором клеток образовывать опухоли убедительно означает, что имплантированные клетки не включали клеток, поддерживающих опухоль. То есть вероятно, что лечение комбинацией модулятор PTK7/сапорин селективно нацелено на, и ликвидирует, клетки, поддерживающие опухоль в соответствии с настоящим изобретением. В любом случае эти данные показывают, что лечение с помощью раскрытых модуляторов эффективно снижает онкогенный потенциал опухолевых клеток.

Пример 16

Гуманизированные модуляторы PTK7 опосредуют доставку цитотоксических агентов

Так как в качестве предпочтительных воплощений настоящего изобретения скорее всего будут использоваться гуманизированные модуляторы PTK7 в терапевтических целях, была выполнено исследование с целью продемонстрировать, что гуманизированные анти-PTK7 антитела (изготовленные, как описано в Примере 8) функционируют, как эффективные медиаторы гибели клеток посредством доставки цитотоксических агентов.

В частности, три типичных гуманизированных модулятора PTK7 (hSC6.23, hSC6.58 и hSC6.24) использовали, чтобы опосредовать введение цитотоксической полезной нагрузки и ликвидировать онкогенные клетки в соответствии с данным руководством. В целом, используя протокол, изложенный в Примере 13 выше, клетки HEK293, сконструированные для PTK7 экспрессии (то есть клетки 293.PTK7), подвергали воздействию разных концентраций выбранных модуляторов и сапорина, соединенного с античеловеческим Fab (Fab-ZAP human, Advanced Targeting Systems). После инкубации клетки промывали и затем оценивали сапорин-индуцированную и модулятор-опосредованную цитотоксичность посредством количественного определения оставшегося числа клеток, используя CellTiter Glo в соответствии с инструкциями производителя через 5-7 суток. Результаты были нормализованы к необработанным клеткам и графически представлены на Фиг. 14.

Изучение кривых, представленных на Фиг. 14, показало, что все три протестированных модулятора PTK7 были очень эффективны в индукции интернализации цитотоксической полезной нагрузки, снижающей жизнеспособность клеток. При этом каждый модулятор обеспечивал 50%-ное снижение жизнеспособности клеток в концентрации от 1 до 10 пМ и более чем 80%-ное снижение жизнеспособности клеток в концентрации 100 пМ. И опять, в соответствии с данным описанием, эти данные указывают на высокоэффективные модуляторы, которые могут иммуноспецифически опосредовать доставку цитотоксических агентов в выбранные клеточные популяции.

Специалистам в данной области понятно, что настоящее изобретение может быть воплощено в других конкретных формах без отклонения от его сути или его главных признаков. Поскольку в вышеизложенном описании настоящего изобретения раскрыты только его типичные воплощения, следует понимать, что другие варианты рассматриваются, как входящие в объем настоящего изобретения. Соответственно, настоящее изобретение не ограничено конкретными воплощениями, подробно описанными здесь. Скорее, следует обращаться к прилагаемой формуле как показателю объема и содержания данного изобретения.

1. Выделенное антитело или его антигенсвязывающий фрагмент, которое специфически связывается с PTK7 (протеинтирозинкиназа 7) человека, содержащее:

а) три CDR вариабельной области легкой цепи, представленной в SEQ ID NO: 62, и три CDR вариабельной области тяжелой цепи, представленной в SEQ ID NO: 63; или

б) три CDR вариабельной области легкой цепи, представленной в SEQ ID NO: 64, и три CDR вариабельной области тяжелой цепи, представленной в SEQ ID NO: 65.

2. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее:

а) вариабельную область легкой цепи, содержащую три CDR, представленные как остатки 24-34 из SEQ ID NO: 62 для VL CDR1, остатки 50-56 из SEQ ID NO: 62 для VL CDR2 и остатки 89-97 из SEQ ID NO: 62 для VL CDR3; и

б) вариабельную область тяжелой цепи, содержащую три CDR, представленные как остатки 31-35 из SEQ ID NO: 63 для VH CDR1, остатки 50-65 из SEQ ID NO: 63 для VH CDR2 и остатки 95-102 из SEQ ID NO: 63 для VH CDR3;

где нумерация CDR является нумерацией по Kabat.

3. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее:

а) вариабельную область легкой цепи, содержащую три CDR, представленные как остатки 23-34 из SEQ ID NO: 62 для VL CDR1, остатки 50-56 из SEQ ID NO: 62 для VL CDR2 и остатки 89-97 из SEQ ID NO: 62 для VL CDR3; и

б) вариабельную область тяжелой цепи, содержащую три CDR, представленные как остатки 26-32 из SEQ ID NO: 63 для VH CDR1, остатки 50-58 из SEQ ID NO: 63 для VH CDR2 и остатки 95-102 из SEQ ID NO: 63 для VH CDR3;

где нумерация CDR является нумерацией по Chothia.

4. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее:

а) вариабельную область легкой цепи, содержащую три CDR, представленные как остатки 30-36 из SEQ ID NO: 62 для VL CDR1, остатки 46-55 из SEQ ID NO: 62 для VL CDR2 и остатки 89-96 из SEQ ID NO: 62 для VL CDR3; и

б) вариабельную область тяжелой цепи, содержащую три CDR, представленные как остатки 30-35 из SEQ ID NO: 63 для VH CDR1, остатки 47-58 из SEQ ID NO: 63 для VH CDR2 и остатки 93-101 из SEQ ID NO: 63 для VH CDR3;

где нумерация CDR является нумерацией по MacCallum.

5. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее вариабельную область легкой цепи, имеющую аминокислотную последовательность, которая по меньшей мере на 60% идентична SEQ ID NO: 62, и вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, которая по меньшей мере на 60% идентична SEQ ID NO: 63.

6. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее вариабельную область легкой цепи, представленную в SEQ ID NO: 62, и вариабельную область тяжелой цепи, представленную в SEQ ID NO: 63.

7. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее:

а) вариабельную область легкой цепи, содержащую три CDR, представленные как остатки 24-34 из SEQ ID NO: 64 для VL CDR1, остатки 50-56 из SEQ ID NO: 64 для VL CDR2 и остатки 89-97 из SEQ ID NO: 64 для VL CDR3; и

б) вариабельную область тяжелой цепи, содержащую три CDR, представленные как остатки 31-35 из SEQ ID NO: 65 для VH CDR1, остатки 50-65 из SEQ ID NO: 65 для VH CDR2 и остатки 95-102 из SEQ ID NO: 65 для VH CDR3;

где нумерация CDR является нумерацией по Kabat.

8. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее:

а) вариабельную область легкой цепи, содержащую три CDR, представленные как остатки 23-34 из SEQ ID NO: 64 для VL CDR1, остатки 50-56 из SEQ ID NO: 64 для VL CDR2 и остатки 89-97 из SEQ ID NO: 64 для VL CDR3; и

б) вариабельную область тяжелой цепи, содержащую три CDR, представленные как остатки 26-32 из SEQ ID NO: 65 для VH CDR1, остатки 50-58 из SEQ ID NO: 65 для VH CDR2 и остатки 95-102 из SEQ ID NO: 65 для VH CDR3;

где нумерация CDR является нумерацией по Chothia.

9. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее:

а) вариабельную область легкой цепи, содержащую три CDR, представленные как остатки 30-36 из SEQ ID NO: 64 для VL CDR1, остатки 46-55 из SEQ ID NO: 64 для VL CDR2 и остатки 89-96 из SEQ ID NO: 64 для VL CDR3; и

б) вариабельную область тяжелой цепи, содержащую три CDR, представленные как остатки 30-35 из SEQ ID NO: 65 для VH CDR1, остатки 47-58 из SEQ ID NO: 65 для VH CDR2 и остатки 93-101 из SEQ ID NO: 65 для VH CDR3;

где нумерация CDR является нумерацией по MacCallum.

10. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее вариабельную область легкой цепи, имеющую аминокислотную последовательность, которая по меньшей мере на 60% идентична SEQ ID NO: 64, и вариабельную область тяжелой цепи, имеющую аминокислотную последовательность, которая по меньшей мере на 60% идентична SEQ ID NO: 65.

11. Антитело или его антигенсвязывающий фрагмент по п.1, содержащее вариабельную область легкой цепи, представленную в SEQ ID NO: 64, и вариабельную область тяжелой цепи, представленную в SEQ ID NO: 65.

12. Антитело или его антигенсвязывающий фрагмент по любому из пп.1-11, представляющее собой нейтрализирующее антитело, истощающее антитело и/или интернализованное антитело.

13. Антитело или его антигенсвязывающий фрагмент по любому из пп.1-11, представляющее собой моноклональное антитело, химерное антитело, CDR-привитое антитело, гуманизированное антитело или его антигенсвязывающий фрагмент.

14. Конъюгат антитела, который специфически связывается с PTK7 человека, содержащий антитело или его антигенсвязывающий фрагмент по любому из пп.1-11, причем это антитело или его антигенсвязывающий фрагмент конъюгированы, связаны или иным образом ассоциированы с цитотоксическим агентом.

15. Фармацевтическая композиция для связывания РТК7 человека, содержащая антитело или его антигенсвязывающий фрагмент по любому из пп.1-11.

16. Фармацевтическая композиция для связывания РТК7 человека, содержащая конъюгат антитела по п.14.

17. Нуклеиновая кислота, кодирующая вариабельную область легкой цепи антитела или его антигенсвязывающего фрагмента по любому из пп.1-11.

18. Нуклеиновая кислота, кодирующая вариабельную область тяжелой цепи антитела или его антигенсвязывающего фрагмента по любому из пп.1-11.

19. Нуклеиновая кислота, кодирующая вариабельную область легкой цепи и вариабельную область тяжелой цепи антитела или его антигенсвязывающего фрагмента по любому из пп.1-11.

20. Экспрессирующий вектор, содержащий нуклеиновую кислоту по любому из пп.17-19.

21. Экспрессирующая клетка-хозяин, содержащая нуклеиновую кислоту по любому из пп.17-19.

22. Экспрессирующая клетка-хозяин, содержащая вектор по п.20.

23. Способ обнаружения, диагностики или мониторинга рака у субъекта, включающий стадии:

(а) приведения клеток субъекта в контакт с антителом или его антигенсвязывающим фрагментом по любому из пп.1-11;

(б) удаления несвязанного антитела или его антигенсвязывающего фрагмента; и

(в) обнаружения связанного антитела или его антигенсвязывающего фрагмента.

24. Способ по п.23, где рак представляет собой рак молочной железы, рак яичников, колоректальный рак, рак поджелудочной железы, рак легкого или рак кожи.

25. Способ по п.24, где рак представляет собой рак яичников.

26. Способ по п.24, где рак молочной железы представляет собой трижды отрицательный рак молочной железы.

27. Способ по п.24, где рак легкого представляет собой немелкоклеточный рак легкого.

28. Способ лечения рака у субъекта, включающий введение этому субъекту терапевтически эффективной дозы конъюгата антитела, содержащего антитело или его антигенсвязывающий фрагмент по любому из пп.1-11, где это антитело или его антигенсвязывающий фрагмент конъюгированы, связаны или иным образом ассоциированы с цитотоксическим агентом.

29. Способ по п.28, где рак представляет собой рак молочной железы, рак яичников, колоректальный рак, рак поджелудочной железы, рак легкого или рак кожи.

30. Способ по п.29, где рак представляет собой рак яичников.

31. Способ по п.29, где рак молочной железы представляет собой трижды отрицательный рак молочной железы.

32. Способ по п.29, где рак легкого представляет собой немелкоклеточный рак легкого.

33. Способ снижения частоты появления опухоль-инициирующих клеток у субъекта, включающий введение этому субъекту конъюгата антитела, содержащего антитело или его антигенсвязывающий фрагмент по любому из пп.1-11, где это антитело или его антигенсвязывающий фрагмент конъюгированы, связаны или иным образом ассоциированы с цитотоксическим агентом.

34. Способ по п.33, где субъект имеет рак, выбранный из группы, состоящей из рака молочной железы, рака яичников, колоректального рака, рака поджелудочной железы, рака легкого или рака кожи.

35. Способ по п.34, где рак представляет собой рак яичников.

36. Способ по п.34, где рак молочной железы представляет собой трижды отрицательный рак молочной железы.

37. Способ по п.34, где рак легкого представляет собой немелкоклеточный рак легкого.

38. Применение антитела или его антигенсвязывающего фрагмента по любому из пп.1-11 в изготовлении лекарственного средства для обнаружения, диагностики или мониторинга рака у субъекта.

39. Применение по п.38, где рак представляет собой рак молочной железы, рак яичников, колоректальный рак, рак поджелудочной железы, рак легкого или рак кожи.

40. Применение по п.39, где рак представляет собой рак яичников.

41. Применение по п.39, где рак молочной железы представляет собой трижды отрицательный рак молочной железы.

42. Применение по п.39, где рак легкого представляет собой немелкоклеточный рак легкого.

43. Применение антитела или его антигенсвязывающего фрагмента по любому из пп.1-11 в изготовлении лекарственного средства для лечения рака у субъекта, где это антитело или его антигенсвязывающий фрагмент конъюгированы, связаны или иным образом ассоциированы с цитотоксическим агентом.

44. Применение по п.43, где рак представляет собой рак молочной железы, рак яичников, колоректальный рак, рак поджелудочной железы, рак легкого или рак кожи.

45. Применение по п.44, где рак представляет собой рак яичников.

46. Применение по п.44, где рак молочной железы представляет собой трижды отрицательный рак молочной железы.

47. Применение по п.44, где рак легкого представляет собой немелкоклеточный рак легкого.

48. Применение антитела или его антигенсвязывающего фрагмента по любому из пп.1-11 в изготовлении лекарственного средства для снижения частоты появления опухольинициирующих клеток у субъекта, где это антитело или его антигенсвязывающий фрагмент конъюгированы, связаны или иным образом ассоциированы с цитотоксическим агентом.

49. Применение по п.48, где рак представляет собой рак молочной железы, рак яичников, колоректальный рак, рак поджелудочной железы, рак легкого или рак кожи.

50. Применение по п.49, где рак представляет собой рак яичников.

51. Применение по п.49, где рак молочной железы представляет собой трижды отрицательный рак молочной железы.

52. Применение по п.49, где рак легкого представляет собой немелкоклеточный рак легкого.



 

Похожие патенты:

Изобретение относится к медицине, а именно к иммунологии, и может быть использовано для определения нейтрализующих антител (HAT) в сыворотке крови больных рассеянным склерозом, леченных препаратами интерферона-бета (ИФНβ).

Изобретение относится к области медицины и представляет собой способ прогнозирования риска развития быстрорастущей миомы матки, заключающийся в том, что исследуют ультразвуковые параметры матки с подсчетом количества миоматозных узлов, методом краевой дегидратации менструальных выделений (МВ) определяют наличие параллельных и волокнистых структур и рассчитывают коэффициент Р: где z рассчитывают по формуле:z=b1×x1+b2×x2+b3×х3+а,где b1 - коэффициент, равный 2,172; x1 - волокнистые структуры в MB: наличие «2»; отсутствие «1»; b2 - коэффициент, равный 2,238; x2 - параллельные структуры в MB: наличие «2»; отсутствие «1»; b3 - коэффициент, равный 1,568; x3 - количество узлов; а - константа, равная –10,915; и при значении Р>0,5 дополнительно методом иммуноферментного анализа исследуют уровни лигандов APRIL и TRAIL, и при значении APRIL более 11,1 нг/мл, TRAIL менее 22,5 пг/мл прогнозируют риск развития быстрорастущей миомы матки.

Изобретение относится к области медицины и биологии, в частности к исследованиям таких канцерогенных веществ, как нитрозамины, модифицирующие апоптоз у детей, проживающих в неблагоприятных условиях среды обитания.

Изобретение относится к медицине, а именно к онкологии и патоморфологии, и может быть использовано для дифференциальной диагностики опухолей аногенитальных маммароподобных желез.

Настоящее изобретение касается способа предварительной оценки, будет ли терапевтическое средство, выбранное из группы полипептид, антитело или иммуноадгезин, иметь необходимую скорость выведения у яванского макака, человека.
Изобретение относится к области медицины, к лабораторной диагностике в гинекологии и касается способа определения вида эндометриоза яичника. Способ включает анализ транскриптома эндометриоидной ткани очага эндометриоза яичника путем проведения исследования экспрессии гена TIMP1, при превышении экспрессии гена TIMP1 относительно гена выше 0,5 о.е.
Изобретение относится к медицине, в частности к гематологии, и может быть использовано для прогнозирования течения апластической анемии после спленэктомии. Для этого после удаления селезенки определяют ее массу.

Изобретение относится к медицине, а именно к онкологии, и может быть использовано при лечении сарком мягких тканей для прогнозирования возникновения рецидива. Для этого с помощью проточной цитофлюориметрии проводят определение процентного содержания T-regs(CD3+CD4+CD25+CD127dim) лимфоцитов от количества CD3+CD4+клеток в гомогенатах образцов опухолевой ткани и в ткани линии резекции после хирургического удаления опухоли.

Изобретение относится к области ветеринарной микробиологии и касается иммуноферментной тест-системы для серологической диагностики анаэробной энтеротоксемии сельскохозяйственных животных, вызываемой бактериями Clostridium perfringens (Cl.

Изобретение относится к области медицины, а именно к авиакосмической медицине, и может быть использовано для оценки оптимального уровня компенсаторно-приспособительных и адаптационных возможностей организма космонавтов в условиях космического полета.

Изобретение относится к области биохимии. Заявлены связывающие белки, представляющие собой иммуноглобулины с двойными вариабельными доменами, которые связывают IL-1α и IL-1β.

Изобретение относится к области биохимии, в частности к выделенной молекуле нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, а также к экспрессирующему вектору, клетке-хозяину, растения, части растения, семени растения, культуре ткани растения, ее содержащего.

Данное изобретение относится к иммунологии. Предложено антитело, связывающее кластерин, и его антигенсвязывающий фрагмент.

Группа изобретений относится к получению 2,4-дигидроксимасляной кислоты (2,4-ДГМ). Предложен способ получения 2,4-ДГМ, включающий первую стадию превращения малата в 4-фосфомалат с использованием фермента, способного осуществить подобное превращение, вторую стадию превращения 4-фосфомалата в малат-4-полуальдегид с использованием фермента, способного осуществить подобное превращение, и третью стадию превращения малат-4-полуальдегида в 2,4-ДГМ с использованием фермента, способного осуществить подобное превращение.

Настоящее изобретение относится к биохимии, в частности к полипептиду, обладающему активностью цитохрома P450. Указанный полипептид способен окислять такие соединения терпена, как моно- или полициклические монотерпены и сесквитерпены.

Настоящее изобретение относится к биохимии, в частности к мутантному полипептиду полимеразы ВГВ, содержащему мутантный домен полимеразы ВГВ с внутренней делецией, которая подавляет функциональную активность полимеразы, и мутантный домен РНКазы Н с внутренней делецией и мутациями, которые подавляют функциональную активность РНКазы Н.

Изобретение относится к области биохимии, в частности к способу получения безмаркерных трансгенных растений каланхоэ, экспрессирующих ген цекропина P1. Изобретение позволяет создавать биобезопасные лекарственные растения каланхоэ с высоким уровнем накопления целевого продукта и в сокращенные по времени сроки.

Изобретение относится к области биотехнологии, конкретно к гипоаллергенным вариантам главного аллергена Malus domectica, и может быть использовано в медицине для лечения аллергических заболеваний.

Изобретение относится к области биохимии, в частности к выделенной нуклеиновой кислоте, кодирующей полипептид слияния, обладающий активностью бета-1,4-N-ацетилглюкозаминилтрансферазы III (GnTIII) или бета-1,4-галактозилтрансферазы (GalT).

Изобретение относится к области биохимии. Описаны антиген-связывающие фрагменты (Fab), селективно связывающиеся с ботулиническим нейротоксином С, в частности гуманизированные Fab.

Изобретение относится к области биохимии. Заявлены связывающие белки, представляющие собой иммуноглобулины с двойными вариабельными доменами, которые связывают IL-1α и IL-1β.

Изобретение относится к области биохимии. Заявлено антитело, специфически связывающееся с PTK7 человека, а также конъюгат указанного антитела с цитотоксическим агентом. Также предложены нуклеиновые кислоты, кодирующие указанное антитело, и включающие их экспрессионные векторы и клетки-хозяева. Кроме того, предложены способы применения указанного антитела, в том числе в составе конъюгата, для диагностики и лечения рака у субъекта. Изобретение обеспечивает эффективное нацеливание на опухолевые стволовые клетки, что может быть использовано для лечения пациентов, страдающих от широкого спектра злокачественных образований. 16 н. и 36 з.п. ф-лы, 42 ил., 5 табл., 16 пр.

Наверх