Трансгенное растение осины, устойчивое к гербицидам

Изобретение относится к области биохимии, в частности к трансгенному растению осины, обладающему устойчивостью к фосфинотрицину по сравнению с нетрансформированным растением и не имеющему сомаклональных изменений. Указанное растение содержит ген BAR, кодирующий фермент фосфинотрицин-ацетилтрансферазу, и получено путем агробактериального переноса указанного гена BAR в осину Pt. Изобретение позволяет эффективно получать растение осины, устойчивое к фосфотрицину. 2 з.п. ф-лы, 3 ил., 2 табл.

 

Изобретение относится к области генетической инженерии и биотехнологии растений, и может быть использовано для удешевления процедуры получения новых саженцев и повышения качества посадочного материала для нужд целлюлозно-бумажной промышленности.

Несмотря на то, что Российская Федерация обладает примерно 1/4 мировых запасов древесины, ее доступность в значительной степени ограничена. Доступная для переработки близость лесов является важным показателем для целлюлозно-бумажной промышленности. Интенсивные лесозаготовки при отсутствии вложений в восстановление лесов могут привести к полной потере конкурентоспособности отечественной ЦБП. Учитывая современное состояние лесного хозяйства и уровня развития генной инженерии растений, восстановление лесов должно производиться с использованием плантационного способа ведения лесного хозяйства, используя для этих целей высокопродуктивные формы лесных пород с новыми ценными признаками.

Осина является ценной лесной породой благодаря хорошей скорости роста и качеству древесины, причем последние годы ее ценность неуклонно возрастает, поскольку осина нетребовательна к климатическим условиям и к почвам.

Целью предлагаемого изобретения является внедрение в генотип осины трансгена, придающего растению устойчивость к гербициду, что позволит в значительной степени удешевить получение посадочного материала за счет обработки питомников осины гербицидами сплошного действия. Экономия достигается за счет снижения числа проходов сельхозтехники и уменьшения доли ручного труда. Качество трансгенного посадочного материала осины также будет выше по сравнению с диким генотипом за счет своевременного и массового устранения сорной растительности.

Поставленная цель достигается за счет следующего: механизм действия одного из самых распространенных гербицидов, используемых в сельском хозяйстве, фосфинотрицина, или глюфосината основан на прямом ингибировании фермента глутаминсинтетазу. Блокирование глутаминсинтетазы фосфинотрицином приводит к быстрому истощению запаса глутамина в клетках растения, накоплению аммиака в фотосинтезирующих тканях и отравлению растения (Чумиков И.А. Технология Либерти Линк новый инструмент для успешной борьбы с сорняками / И.А. Чумиков // ΑΓΡΟ XXI. - 2002. - №1. - С. 20-21). Ген bar кодирует фермент фосфинотрицинацетилтрансферазу, который ацетилируюет свободную NH2 группу в молекуле фосфинотрицина, делая ее неактивной в отношении глутаминсинтетазы. Растения, в геном которых внедрен этот ген, начинают продуцировать фосфинотрицинацетилтрансферазу и, как следствие, обретают устойчивость к действию фосфинотрицина (Сингер М. Гены и геномы / М. Сингер, П. Берг. М.: Мир, 1998).

Суть изобретения состоит в том, что в геном осины был интегрирован ген bar (SEQ ID NO: 1). Для трансформации осины использовали штамм Agrobacterium tumefaciens СВЕ21 с Ti-плазмидой рСВЕ21. Агробактериальный штамм содержал бинарный вектор pBI-Bar, содержащий ген bar под контролем 35S промотора.

Анализ известных продуктов, проведенный по научно-технической и патентной документации, показал, что совокупность существенных признаков заявляемого продукта неизвестна из уровня техники, следовательно продукт соответствует условию патентоспособности изобретения - «новизна».

Предлагаемый продукт получают следующим образом.

Агробактериальная трансформация осины:

1. В 50 мл жидкой среды Luria-Bertoni (LB) (10 г/л триптона, 5 г/л дрожжевого экстракта, 10 г/л NaCl), дополнительно содержащей 50 мг/л канамицина, добавляли 100 мкл суспензии агробактериальных клеток и инкубировали при 27-28°С в течение суток. Суспензию наросших клеток осаждали центрифугированием, промывали и ресуспендировали в 50 мл жидкой среды MS (Murashige Т. & Skoog F., A revised medium for rapid growth and bioassays with tobacco tissue culture. // Physiol. Plant, 15 (1962) 473-497).

2. В чашки Петри заливали по 25 мл агаризованной среды MSm (соли MS + 20 мМ KNO3+10 мМ NH4NO3) с добавлением 0,5 мг/л 2,4-дихлорфеноксиуксусной кислоты (2,4-Д).

3. Нарезали междоузлия микрорастений осины (экспланты) длиной 5-10 мм.

4. Экспланты заливали агробактериальной суспензией в среде MS и инкубировали 20 минут при комнатной температуре.

5. Затем экспланты подсушивали их на фильтровальной бумаге и помещали на среду MSm.

6. Экспланты инкубировали на свету в течение двух суток, после чего промывали их в дистиллированной воде с добавлением цефотаксима (1 г/л) в течение 20-30 минут.

7. Отмытые экспланты подсушивали на фильтрах и раскладывали на среду MSm, содержащую 0,5 мг/л зеатина, 30 мг/л канамицина и 500 мг/л цефотаксима. На данной среде производилась регенерация и селекция трансформантов.

Регенерировавшие растения, демонстрирующие нормальный рост в присутствии селективного агента канамицина, проверяли на наличие вставки гена bar с использованием метода полимеразной цепной реакции (ПЦР), параллельно оценивая регенераты на наличие агробактериальной контаминации. Для этого из микрорастений выделяли тотальную растительную ДНК по стандартной методике Rogers и Benedich (Rogers S.O., Bendich A.J. (1994). Extraction of DNA from plant, fungal and algal tissues. In:, Gelvin SB, Schilperoort RA (eds) Plant Molecular Biology Manual. Boston, MA: Kluwer Academic Publishers, D 1: 1-8).

ПЦР анализ ДНК отдельных регенерантов проводили в следующих условиях: реакционная смесь содержала 16 мМ (NH4)SO2 0,01% бычий сывороточный альбумин, 200 мкМ каждого дНТФ, 0,4 мкМ каждого праймера, 0,05 ед./мкл Taq-полимеразы, 1-5 нг/мкл растительной ДНК. Реакции проводили на амплификаторе MJ MiniTM Gradient Thermal Cycler (BIO-RAD). Режим амплификации: 3 мин денатурация при 96°С, 45 сек денатурация при 94°С, 45 сек отжиг при 58°С, элонгация 1 мин при 72°С, 5 мин достройка при 72°С, 31 цикл амплификации. Все линии осины в первую очередь анализировались на наличие агробактериальной контаминации. Геномная ДНК анализировалась на присутствие агробактериального гена VirB. Для этого бралась пара праймеров Vir-B1 (SEQ ID NO: 2) и VirB2 (SEQ ID NO: 3). Ожидаемый размер амплифицируемого фрагмента 670 п. н. Результаты анализа показали, что все шесть анализируемых линий не были контаминированы агробактериями (фиг. 1).

После этого все шесть линий и две линии, проверенные на агробактериальную контаминацию ранее, были проанализированы на наличие вставки гена bar с использованием пары праймеров bar-1 (SEQ ID NO: 4) и bar-2 (SEQ ID NO: 5). Анализ препаратов геномной ДНК регенерировавших растений показал, что во всех линиях содержалась вставка гена bar (фиг. 2).

Трансформанты с подтвержденной вставкой гена bar были размножены в условиях in vitro и после укоренения адаптированы к естественным условиям окружающей среды. Через 6 месяцев после адаптации, трансгенные линии осины, а также нетрансформированная линия (Pt) были проанализированы в условиях закрытого грунта на устойчивость к полулетальной (5 мг/л) и летальной (10 мг/л) дозам фосфинотрицина (фиг. 3). Результаты анализа показали, что большинство линий приобрели различную устойчивость к действию фосфинотрицина. Наибольшая степень устойчивости к гербициду отмечалось у трансгенных линий ptXIBar23a и ptXIBar30a (Таблица 1), в то время как у линии ptXIBar31a устойчивость была очень низкой (1,8 и 2,3 балла), но поскольку она была все же выше, чем в контроле (2,2 и 2,9 балла) можно предположить, что низкий уровень экспрессии трансгена в этой линии связан с частичной инактивацией гена на транскрипционном или посттранскрипционном уровне.

На стадии регенерации, особенно в присутствии мощного синтетического ауксина 2,4-Д, возможно возникновение сомаклональных мутаций в геноме осины, большинство которых проявляется фенотипически. Для выявления потенциальных сомаклональных мутантов мы провели сравнительный анализ растений по высоте и форме листа. В результате анализа не было выявлено каких-либо отличий по высоте растений (таблица 2) или форме/размере листьев между нетрансгенным контролем и трансгенными линиями.

Таким образом, были получены трансгенные линии осины, фенотипически не отличающиеся от дикого типа и обладающие устойчивостью к гербицидам.

Краткое описание чертежей

Фиг. 1. Результаты ПЦР-анализа шести трансгенных линий осины на присутствие агробактериального гена VirB

Размер ожидаемого амплифицируемого фрагмента 670 п. о. M - молекулярный маркер, К+ - геномная ДНК агробактерий (положительный контроль), К- - нетрансформированное растение (отрицательный контроль), H2O - вода, 1-6 - трансгенные линии осины).

Фиг. 2. Результаты ПЦР-анализа шести трансгенных линий осины на присутствие гена bar

Размер ожидаемого амплифицируемого фрагмента 310 п. о. M - молекулярный маркер, К+ - плазмидная ДНК (положительный контроль), К- - нетрансформированное растение (отрицательный контроль), H2O - вода, 1-8 - трансгенные линии осины).

Фиг. 3. Поражение верхних листьев растений осины летальной дозой фосфинотрицина (10 мг/л)

Поражение верхних листьев растений осины летальной дозой фосфинотрицина (10 мг/л)

Перечень последовательностей:

SEQ ID No: 1. Нуклеотидная последовательность гена bar: GAATCCGGACAGAATTCCCAACCCGCCCTTCGATTTTTCTGATCATGCAGTACCCTGTCCGGCCACGAGG

GGAGGCGGGATGCCGTCGGAACGTACAGAGGTGCAGGTCAGGTCGGGAGTCGAGGCCGACCTCAAAGCCC

TCACCGACATCTACAACCACTATGTACGTGAGACGCCCATCACATTCGATACCGCCGCCTTCACGCCGGA

AGAGCGCCGCCCTTGGCTGCTCTCCCACCCTGAAGACGGACCGCACCGGCTGATGGTTGCCACGGGCGCG

GACTCACAGGAGATTCTTGGGTACGCCACCAGCAGTCCTTTCCGCGCCAAGCCCGCCTACACCACCTCCG

TCGAGGTGACCGTCTACGTCGCCCCGGACGCGGCTGGCCGTGGCATCGGCACGCTCCTCTACGGCGCCCT

CTTCGAGGCGCTGGCGGGCGAGGATCTCCACCGCGCCTACGCGGGCATCGCCCAGCCCAACGAAGCGTCC

ACGCGGCTGCATGAACGCTTCGGGTTCCGGCATGTCGGCACCTACCGGGAGGTGGGCCGCAAGTTCGGAC

GGTACTGGGACGTGGCCTGGTACGAGAGGGAGCTGTAGCCGTACGCCGACCAGCAGCCGTACGCCGTTCA

GCCGAACTGCACCGACCGCTTCGCCAGCCCCAGCCAGAAGCCGTC

SEQ ID No: 2. Нуклеотидная последовательность праймера Vir-B1:

GGCTACATCGAAGATCGTATGAATG

SEQ ID No: 3. Нуклеотидная последовательность праймера Vir-B2:

GACTATAGCGATGGTTACGATGTTGAC

SEQ ID No: 4. Нуклеотидная последовательность праймера bar-1:

TGCACCATCGTCAACCACTA

SEQ ID No: 5. Нуклеотидная последовательность праймера bar-2:

ACAGCGACCACGCTCTTGAA

1. Трансгенное растение осины, обладающее устойчивостью к фосфинотрицину по сравнению с нетрансформированным растением и не имеющее сомаклональных изменений, содержащее ген BAR с SEQ ID NO: 1, кодирующий фермент фосфинотрицин-ацетилтрансферазу и полученное путем агробактериального переноса указанного гена BAR в осину Pt.

2. Трансгенное растение по п. 1, которое демонстрирует устойчивость к фосфинотрицину, примененному в условиях защищенного грунта в дозах, полулетальной (5 мг/л) и летальной (10 мг/л) для нетрансформированных растений осины.

3. Трансгенное растение по п. 1, которое демонстрирует отсутствие сомаклональных изменений, выражающихся в отличиях по высоте и форме/размеру листьев.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к выделенной молекуле нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, а также к экспрессирующему вектору, клетке-хозяину, растения, части растения, семени растения, культуре ткани растения, ее содержащего.

Изобретение относится к области биохимии, в частности к конструкции нуклеиновой кислоты и химерному белку для локализации полипептида в хлоропласт, а также к конструкции для экспрессии нацеливающего хлоропласты полипептида в клетке растения.

Изобретение относится к области биохимии, в частности к способу получения безмаркерных трансгенных растений каланхоэ, экспрессирующих ген цекропина P1. Изобретение позволяет создавать биобезопасные лекарственные растения каланхоэ с высоким уровнем накопления целевого продукта и в сокращенные по времени сроки.

Изобретение относится к области биохимии, в частности к трансгенному растению для замедления или предотвращения развития устойчивости к белкам Cry1Ab и DIG-3 у кукурузного мотылька (ЕСВ), его семени, а также к способу предотвращения развития устойчивости к белку Cry1Ab и DIG-3 у ECB с его использованием.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-9670.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-7899.

Изобретение относится к области биохимии, в частности к способу трансформации растительной клетки, где способ включает контакт растительных клеток незрелых зародышей кукурузы с клетками Agrobacterium в жидкой среде, содержащей неионное трисилоксановое поверхностно-активное вещество.

Изобретение относится к области биохимии, в частности к зерну пшеницы Triticum aestivum, имеющему повышенное содержание амилозы по сравнению с зерном пшеницы дикого типа, к растению пшеницы Triticum aestivum, которое продуцирует зерно, которое имеет пониженный уровень или активность общего белка SBEII, а также к способу получения указанного зерна.

Изобретение относится к генетическому контролю нападения видов насекомых-вредителей. В частности, к предотвращению или борьбе с нападением вредителей на растения с применением молекулы интерферирующей рибонуклеиновой кислоты (РНК).

Изобретение относится к области биохимии, в частности к конструкту нуклеиновой кислоты для экспрессии множественных генов в клетках и тканях растений, а также к способу получения трансгенного растения и способу получения трансгенной клетки с его использованием.

Изобретение относится к области биохимии, в частности к выделенной молекуле нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, а также к экспрессирующему вектору, клетке-хозяину, растения, части растения, семени растения, культуре ткани растения, ее содержащего.

Изобретение относится к области биохимии, в частности к способу борьбы с насекомыми-вредителями, такими как Pseudoplusia includens (соевая совка), Anticarsia gemmatalis (гусеница бархатных бобов), Spodoptera frugiperda (травяная совка).

Изобретение относится к сельскому хозяйству, в частности к области растениеводства и селекции. Изобретение представляет собой способ оценки селекционного материала гороха посевного на интенсивность фотосинтеза листьев, включающий измерение интенсивности поглощения молекул углекислого газа на единицу поверхности листьев первого плодоносящего узла в фазу плодообразования, при этом измерения проводят с 9:00 до 11:00 часов дня с помощью переносного газоанализатора марки LI-6400 XT, который фиксирует и показывает значение интенсивности фотосинтеза на цифровом экране, при этом измерительную камеру прикрепляют к листу растения и в течение 1,5-2 минут ожидают стабилизации газообмена в измерительной камере.

Изобретение относится к области биохимии, в частности к способу получения безмаркерных трансгенных растений каланхоэ, экспрессирующих ген цекропина P1. Изобретение позволяет создавать биобезопасные лекарственные растения каланхоэ с высоким уровнем накопления целевого продукта и в сокращенные по времени сроки.

Изобретение относится к области биохимии, в частности к трансгенному растению для замедления или предотвращения развития устойчивости к белкам Cry1Ab и DIG-3 у кукурузного мотылька (ЕСВ), его семени, а также к способу предотвращения развития устойчивости к белку Cry1Ab и DIG-3 у ECB с его использованием.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-9670.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-7899.

Изобретение относится к области биохимии, в частности к муке канолы, полученной из темных семян канолы, где содержание белка муки канолы составляет от 43% до 44% в расчете на 88% сухого вещества, 3% масла.

Изобретение относится к области биохимии, в частности к способу идентификации растения, включающему по крайней мере одну детерминанту устойчивости сорта растения сои к соевой цистообразующей нематоде (SCN), а также к способу получения SCN-устойчивого растения сои, представляющего собой интерес сорта, включающему стадии скрещивания растения сои, имеющего признак устойчивости к SCN, с растением сои SCN-неустойчивого сорта, представляющий интерес, применение маркер-вспомогательной селекции, а также размножение растений сои F1 с получением SCN-устойчивого растения сои.

Изобретение относится к области биохимии, в частности к зерну пшеницы Triticum aestivum, имеющему повышенное содержание амилозы по сравнению с зерном пшеницы дикого типа, к растению пшеницы Triticum aestivum, которое продуцирует зерно, которое имеет пониженный уровень или активность общего белка SBEII, а также к способу получения указанного зерна.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ клонального микроразмножения растений сем. Betulaceae, включающий размещение верхушечных и боковых почек на агаризованной питательной среде Мурасиге-Скуга in vitro для индукции микропобегов и их элонгации, с переносом на жидкую среду для укоренения, где индукцию микропобегов осуществляют из апикальной ткани вегетативных почек экспланта, индукцию, элонгацию и мультипликацию полученных микропобегов проводят на агаризованной питательной среде, содержащей минеральную основу по Мурасиге-Скуга и дополнительно включающей 0,25-2,0 мг/л БАП, 20000-30000 мг/л сахарозы, 6000 мг/л агара, а укоренение осуществляют размещением одновременно необходимого количества микропобегов в сосуде на перфорированной площадке, закрепленной выше уровня жидкой питательной среды, содержащей уменьшенную вдвое концентрацию макросолей по Мурасиге-Скуга, включающей дополнительно 0,2-0,6 мг/л ИМК и 15000-20000 мг/л сахарозы, и осуществляют в автоматическом режиме циклическое чередование процессов экспозиции микропобегов в воздушной среде, влажностью 80-90%, и погружения их в жидкую питательную среду на 1-3 мин 2-3 раза в сутки путем подъема ее уровня, с дополнительной аэрацией воздуха внутри сосуда по 2-4 минуты через равные промежутки времени от 10 до 15 раз в сутки в течение 16-часового фотопериода. Изобретение позволяет повысить скорость роста и развития микропобегов, активировать корнеобразование in vitro, увеличить приживаемость. 2 табл.

Изобретение относится к области биохимии, в частности к трансгенному растению осины, обладающему устойчивостью к фосфинотрицину по сравнению с нетрансформированным растением и не имеющему сомаклональных изменений. Указанное растение содержит ген BAR, кодирующий фермент фосфинотрицин-ацетилтрансферазу, и получено путем агробактериального переноса указанного гена BAR в осину Pt. Изобретение позволяет эффективно получать растение осины, устойчивое к фосфотрицину. 2 з.п. ф-лы, 3 ил., 2 табл.

Наверх