Применение стимуляторов иммунной защиты для борьбы с вредными бактериальными организмами на культурных растениях

Изобретение относится к стимуляторам иммунной защиты для борьбы с вредными бактериальными организмами на культурных растениях. Вредные бактериальные организмы выбирают из группы, к которой относятся Burkholderia glumae на рисе, Candidates Liberibacter spec. и/или Xanthomonas axonopodis pv. citri на цитрусовых, Pseudomonas syringae pv. actinidae на киви, Xanthomonas campestris и/или Xanthomonas campestris pv. pruni на персиках, Pseudomonas syringae pv. glycinea и/или Xanthomonas axonopodis pv. glycines на сое, Pseudomonas syringae и/или Pseudomonas syringae pv. tomato на томатах, Pseudomonas syringae, Pseudomonas syringae pv. lachrymans на огурцах и/или Streptomyces scabies на картофеле. Стимулятором иммунной защиты является изотианил. Изобретение позволяет реализовать указанное назначение. 2 н. и 4 з.п. ф-лы, 2 ил., 16 табл.

 

Настоящее изобретение касается применения стимуляторов иммунной защиты для борьбы с выбранными вредными бактериальными организмами на культурных растениях, причем вредные бактериальные организмы выбирают из группы, к которой относятся Acidovorax avenae, Burkholderia spec., Burkholderia glumae, Candidates Liberibacter spec., Corynebacterium, Erwinia spec., Pseudomonas syringae, Pseudomonas syringae pv. actinidae, Pseudomonas syringae pv. glycinea, Pseudomonas syringae pv. tomato, Pseudomonas syringae pv. lachrymans, Streptomyces spp., Xanthomonas spp., Xanthomonas axonopodis, Xanthomonas axonopodis pv. citri, Xanthomonas axonopodis pv. glycines, Xanthomonas campestris, Xanthomonas campestris pv. musacearum, Xanthomonas campestris pv. pruni, Xanthomonas fragariae и Xanthomonas transluscens. В предпочтительном аспекте изобретения стимулятором иммунной защиты является изотианил. Настоящее изобретение также касается способа борьбы с выбранными вредными бактериальными организмами на культурных растениях путем обработки стимулятором иммунной защиты.

ВВЕДЕНИЕ И УРОВЕНЬ ТЕХНИКИ

В Международной патентной заявке WO 2010/089055 A2 и соответствующей Европейской патентной заявке EP 2393363 A2 в целом раскрывается применение серосодержащих аналогов гетероароматических кислот согласно общей формуле (I) для борьбы с вредными бактериальными организмами на культурных растениях. Общая формула (I) охватывает, помимо прочих, стимуляторы иммунной защиты тиадинил (соединение I-1) и изотианил (соединение I-15) из списка 20 разных предпочтительных специфических соединений. Стимулятор иммунной защиты ацибензолар-S-метил и пробеназол не охватываются формулой (I). Кроме того, заявка в целом касается различных штаммов бактерий и различных растений, подлежащих обработке. Заявка конкретно касается только одного конкретного примера, в котором описывается применение соединения I-15 (изотианила) при обработке риса для защиты от Xanthomonas campestris pv. oryzae. С учетом этого настоящее изобретение может рассматриваться как селективное изобретение в отношении документа WO 2010/089055 A2, причем из первого общего списка соединений выбирают стимуляторы иммунной защиты изотианил и тиадинил, а из второго общего списка различных вредных бактериальных организмов выбирают конкретные штаммы бактерий. Применение стимулятора иммунной защиты ацибензолар-S-метила и пробеназола, которые также являются предпочтительными согласно настоящему изобретению, для борьбы с вредными бактериальными организмами на культурных растениях документом WO 2010/089055 A2 не охватывается. Следующий, еще более конкретный выбор касается применения стимуляторов иммунной защиты для борьбы с конкретными вредными бактериальными организмами на конкретных растениях. Авторами настоящего изобретения неожиданно было обнаружено благоприятный эффект таких выбранных соединений в борьбе с конкретными выбранными вредными для растений бактериями, в частности, для конкретных бактерий.

Благоприятный эффект и новое применение выбранных стимуляторов иммунной защиты впервые был продемонстрирован авторами настоящего изобретения и ранее не указывался в источниках существующего уровня техники.

Бактерии в качестве патогенов на культурных растениях встречаются, помимо прочего, в умеренном или теплом и влажном климате, в котором они вызывают бактериозы многих культурных растений со значительными экономическими потерями в некоторых случаях.

Например, рис может быть заражен бактериями Acidovorax avenae или Burkholderia glumae, вызывающими бурую пятнистость или бактериальную гниль зерен, соответственно.

Позеленение цитрусовых (болезнь цитрусовых "желтый дракон", HLB, дегенерация флоэмы жилок цитрусовых (CVPD), болезнь желтых побегов, вертициллезное увядание (на Филиппинах), libukin (на Тайване) и верхушечное усыхание цитрусовых (в Индии)), вызываемое видами Candidatus Liberibacter, возможно, является наиболее губительной болезнью цитрусовых и сильно снижает урожайность, уменьшает экономическую ценность плодов и в конце концов может привести к гибели всего растения. Виды Candidatus Liberibacter представляют род грамотрицательных бактерий семейства Rhizobiaceae. Представители рода являются растительными патогенами, которые чаще всего переносятся листоблошками. Болезнь характеризуется общими симптомами пожелтения прожилок и прилежащих тканей; с последующим пожелтением или мозаичностью всего листа; затем происходит преждевременная дефолиация, отмирание верхушек побегов, гниение питающих корешков и боковых корней и снижение мощности; в итоге это приводит к гибели всего растения. Пораженные деревья останавливаются в росте, имеют множество несезонных цветков (большинство из которых опадают) и дают мелкие плоды неправильной формы с толстой бледной кожурой, которые внизу остаются зелеными. Плоды этих деревьев имеют горьковатый вкус. Инфицированные деревья не выздоравливают, и способа излечения не существует. Борьба с HLB основывается на профилактических мерах борьбы с переносчиками с применением системных инсектицидов и контактных инсектицидов. Однако спектр эффективности и активности этих соединений не всегда полностью удовлетворителен. Свежеинфицированные деревья демонстрируют первые симптомы после латентного периода 6-12 месяцев. Кроме того, инфицированные деревья желательно выкорчевывать для предотвращения дальнейшей инвазии листоблошек и распространения болезни. Средства лечения от болезни цитрусовых "желтый дракон" нет, и усилия по борьбе с болезнью не обеспечивают быстрого результата, поскольку инфицированные цитрусовые растения трудно поддаются уходу, восстановлению и изучению. В исследованиях Службы сельскохозяйственных исследований использовали инфицированные болезнью цитрусовых "желтый дракон" деревья лимона для инфицирования барвинка с целью изучения болезни. Растения барвинка легко инфицируются болезнью и демонстрируют хорошую реакцию при экспериментальной обработке антибиотиками. Исследователи испытывают воздействие пенициллин-О-натрия и биоцида 2,2-дибромо-3-нитрилопропионамида в качестве потенциальных средств лечения для инфицированных цитрусовых растений на основе положительных результатов, наблюдаемых при применении на инфицированном барвинке. Бактерии HLB живут и размножаются исключительно во флоэме цитрусовых деревьев. Однако на данный момент существует лишь несколько бактерицидов для борьбы с HLB, например, международная заявка WO 2011/029536 A2 касается применения циклических кетоенолов против видов Candidatus liberibacter.

Некроз цитрусовых представляет собой болезнь, поражающую виды цитрусовых и вызываемую бактерией Xanthomonas axonopodis pv. citri (=Xanthomonas campestris pv. citri). Инфекция вызывает повреждение на листьях, стеблях и плодах цитрусовых деревьев, включая лайм, апельсин и грейпфрут. Будучи безвредным для человека, некроз существенно влияет на жизнеспособность цитрусовых деревьев, вызывая преждевременное опадание листьев и плодов; инфицированные некрозом плоды безопасны для потребления, но слишком неприглядны для продажи. Это влияние ухудшается из-за того, что наличие некроза цитрусовых в регионе становится причиной немедленных карантинных ограничений, препятствующих перемещению свежих плодов. Считается, что некроз цитрусовых возник в регионе Юго-Восточной Азии - Индии. Он также распространен в Японии, Южной и Центральной Африке и на Среднем Востоке, в Бангладеш, Океании, в некоторых странах Южной Америки и на Флориде. В некоторых регионах мира некроз цитрусовых ликвидирован, а в других выполняются программы по ликвидации (цитрусовые рощи уничтожены с целью искоренения болезни), однако болезнь остается эндемичной в большинстве регионов, в которых она возникла. Из-за быстрого распространения, высокого потенциала поражения и влияния на экспортные продажи и внутреннюю торговлю некроз цитрусовых представляет значительную угрозу во всех регионах, в которых выращиваются цитрусовые.

Отрасль производства киви подвергается широкому поражению инфекциями видов Pseudomonas; например, инфекция Pseudomonas syringae pv. actinidae (Psa) впервые была распознана в Новой Зеландии и в Японии, а также в Италии, где она сильно поражает золотистый киви. В настоящее время проводятся интенсивные исследования и испытания возможных средств борьбы с поражением киви инфекцией Psa.

Бактериальная парша клубней картофеля (обыкновенная парша) представляет новую проблему в ключевых картофелеводческих регионах, сильно ухудшая качество клубней. Пораженные клубни картофеля классифицируются как низкокачественные, с низкой рыночной ценой, а в случае сильного поражения картофель бывает трудно продать. Среди фермеров бытует мнение, что масштабы болезни возрастают с каждым годом.

Инфицирование видом Erwinia, например, может вызывать гибель всех плодовых плантаций, таких, как яблоневые или грушевые. Также известна мокрая бактериальная гниль картофеля, образование опухолей в растениях, пораженных инфекциями агробактерий, а также большое количество некротических болезней в случае поражения зерновых, таких, как пшеница или рис, овощей или цитрусовых видами Xanthomonas.

Стандартное лечение, направленное против вредных бактериальных организмов, включает применение антибиотиков, таких, как, например, стрептомицин, бластицидин S или касугамицин, и в принципе является единственным эффективным способом борьбы с бактериями на культурных растениях. Однако этот подход приемлем только в редких случаях, поскольку эти антибиотики обладают теми же механизмами действия, что и антибиотики, применяемые в медицине и ветеринарии, и существуют большие опасения в отношении применения антибиотиков для защиты растений. Существуют опасения, что это способствует выработке резистентности; кроме того, большинство антибиотиков дороги и часто могут быть получены лишь с применением биотехнологий и других способов. Другой подход к борьбе с бактериями на растениях предполагает применение оксихлорида меди, который имеет недостатки из-за необходимости применения высоких доз при стандартном лечении. Оксихлорид меди применяют, например, для борьбы с Pseudomonas syringae, например, для защиты томатов. Кроме того, оксихлорид меди считается фитотоксичным, и его применение все более ограничивается, поскольку известно, что он накапливается в почве. Кроме того, композиции оксихлорида меди обычно оставляют видимые остатки на листьях и плодах, которые не приветствуются потребителями и считаются неприемлемыми.

Таким образом, существует большая потребность в конкретных эффективных способах борьбы с бактериальными болезнями на культурных растениях, которые также требовали бы лишь небольшого количества применяемого вещества и не причиняли повреждений для растений или вреда для здоровья людей и животных.

Было обнаружено, что стимуляторы иммунной защиты, предпочтительными из которых являются ацибензолар-S-метил, изотианил, пробеназол и тиадинил, или их комбинации, являются особенно подходящими для борьбы с вредными бактериальными организмами из группы, к которой относятся Acidovorax avenae, Burkholderia spec., Burkholderia glumae, Candidates Liberibacter spec., Corynebacterium, Erwinia spec., Pseudomonas syringae, Pseudomonas syringae pv. actinidae, Pseudomonas syringae pv. glycinea, Pseudomonas syringae pv. tomato, Pseudomonas syringae pv. lachrymans, Streptomyces spp., Xanthomonas spp., Xanthomonas axonopodis, Xanthomonas axonopodis pv. citri, Xanthomonas axonopodis pv. glycines, Xanthomonas campestris, Xanthomonas campestris pv. musacearum Xanthomonas campestris pv. pruni, Xanthomonas fragariae и Xanthomonas transluscens, на культурных растениях.

ПРОБЛЕМА, ТРЕБУЮЩАЯ РЕШЕНИЯ

Цель настоящего изобретения состояла в обеспечении новых активных соединений для борьбы с выбранными вредными бактериальными организмами на культурных растениях.

ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Проблема, лежащая в основе настоящего изобретения, решается путем определения благоприятного воздействия стимуляторов иммунной защиты, предпочтительными из которых являются ацибензолар-S-метил, изотианил, пробеназол и тиадинил, в лечении культурных растений от выбранных вредных бактериальных организмов.

В контексте настоящего изобретения стимуляторы иммунной защиты означают соединения, характеризующиеся их способностью стимулировать собственные механизмы защиты растений, таким образом, чтобы растение было защищено от инфекции. Стимуляторы иммунной защиты в таких случаях используются для индуцирования ранних и сильных генов, известных как индукторы защиты растений. Они запускают более сильное и/или быстрое индуцирование растением защитных генов после инвазии патогенов. Согласно настоящему изобретению, примерами стимуляторов иммунной защиты являются:

Ацибензолар-S-метил:

,

Из них предпочтительными являются ацибензолар-S-метил, изотианил, пробеназол и тиадинил или их комбинации; наиболее предпочтительным стимулятором иммунной защиты является изотианил.

Стимуляторы иммунной защиты согласно настоящему изобретению в соответствующих случаях могут существовать в форме смесей различных возможных изомерных форм, в частности, стереоизомеров, таких, как оптические изомеры.

Стимуляторы иммунной защиты согласно настоящему изобретению могут применяться для борьбы с вредными бактериальными организмами. Согласно настоящему изобретению, к вредным бактериальным организмам относятся, помимо прочих, бактерии, вызывающие поражение растений или частей растений.

К бактериям, помимо прочих, относятся Actinobacteria и Proteobacteria, и их выбирают из семейств Xanthomonadaceae, Pseudomonadaceae, Enterobacteriaceae, Microbacteriaceae и Rhizobiaceae.

Согласно настоящему изобретению, вредные бактериальные организмы выбирают из группы, к которой относятся:

Acidovorax avenae (=Pseudomonas avenae, Pseudomonas avenae subsp. avenae, Pseudomonas rubrilineans), включая, например, Acidovorax avenae subsp. avenae (=Pseudomonas avenae subsp. avenae), Acidovorax avenae subsp. cattleyae (=Pseudomonas cattleyae), Acidovorax avenae subsp. citrulli (=Pseudomonas pseudoalcaligenes subsp. citrulli, Pseudomonas avenae subsp. citrulli));

Burkholderia spec., включая, например, Burkholderia andropogonis (=Pseudomonas andropogonis, Pseudomonas woodsii), Burkholderia caryophylli (=Pseudomonas caryophylli), Burkholderia cepacia (=Pseudomonas cepacia), Burkholderia gladioli (=Pseudomonas gladioli), Burkholderia gladioli pv. agaricicola (=Pseudomnas gladioli pv. agaricicola), Burkholderia gladioli pv. alliicola (=Pseusomonas gladioli pv. alliicola), Burkholderia gladioli pv. gladioli (=Pseudomonas gladioli, Pseudomonas gladioli pv. gladioli), Burkholderia glumae (=Pseudomonas glumae), Burkholderia plantarii (=Pseudomonas plantarii) Burkholderia solanacearum (=Ralstonia solanacearum);

Candidatus Liberibacter spec., включая, например, Liberibacter africanus (Laf), Liberibacter americanus (Lam), Liberibacter asiaticus (Las), Liberibacter europaeus (Leu), Liberibacter psyllaurous, Liberibacter solanacearum (Lso);

Corynebacterium, включая, например, Corynebacterium fascians, Corynebacterium flaccumfaciens pv. flaccumfaciens, Corynebacterium michiganensis, Corynebacterium michiganense pv. tritici, Corynebacterium michiganense pv. nebraskense, Corynebacterium sepedonicum;

Erwinia spec., включая, например, Erwinia amylovora, Erwinia ananas, Erwinia carotovora (=Pectobacterium carotovorum), Erwinia carotovora subsp. atroseptica, Erwinia carotovora subsp. carotovora, Erwinia chrysanthemi, Erwinia chrysanthemi pv. zeae, Erwinia dissolvens, Erwinia herbicola, Erwinia rhapontic, Erwinia stewartiii, Erwinia tracheiphila, Erwinia uredovora;

Pseudomonas syringae, включая, например, Pseudomonas syringae pv. Actinidiae (Psa), Pseudomonas syringae pv. atrofaciens, Pseudomonas syringae pv. coronafaciens, Pseudomonas syringae pv. glycinea, Pseudomonas syringae pv. lachrymans, Pseudomonas syringae pv. maculicola Pseudomonas syringae pv. papulans, Pseudomonas syringae pv. striafaciens, Pseudomonas syringae pv. syringae, Pseudomonas syringae pv. tomato, Pseudomonas syringae pv. tabaci;

Streptomyces ssp., включая, например, Streptomyces acidiscabies, Streptomyces albidoflavus, Streptomyces candidus (=Actinomyces candidus), Streptomyces caviscabies, Streptomyces collinus, Streptomyces europaeiscabiei, Streptomyces intermedius, Streptomyces ipomoeae, Streptomyces luridiscabiei, Streptomyces niveiscabiei, Streptomyces puniciscabiei, Streptomyces retuculiscabiei, Streptomyces scabiei, Streptomyces scabies, Streptomyces setonii, Streptomyces steliiscabiei, Streptomyces turgidiscabies, Streptomyces wedmorensis;

Xanthomonas axonopodis, включая, например, Xanthomonas axonopodis pv. alfalfae (=Xanthomonas alfalfae), Xanthomonas axonopodis pv. aurantifolii (=Xanthomonas fuscans subsp.aurantifolii), Xanthomonas axonopodis pv. allii (=Xanthomonas campestris pv. allii), Xanthomonas axonopodis pv. axonopodis, Xanthomonas axonopodis pv. bauhiniae (=Xanthomonas campestris pv. bauhiniae), Xanthomonas axonopodis pv. begoniae (=Xanthomonas campestris pv. begoniae), Xanthomonas axonopodis pv. betlicola (=Xanthomonas campestris pv. betlicola), Xanthomonas axonopodis pv. biophyti (=Xanthomonas campestris pv. biophyti), Xanthomonas axonopodis pv. cajani (=Xanthomonas campestris pv. cajani), Xanthomonas axonopodis pv. cassavae (=Xanthomonas cassavae, Xanthomonas campestris pv. cassavae), Xanthomonas axonopodis pv. cassiae (=Xanthomonas campestris pv. cassiae), Xanthomonas axonopodis pv. citri (=Xanthomonas citri), Xanthomonas axonopodis pv. citrumelo (=Xanthomonas alfalfae subsp. citrumelonis), Xanthomonas axonopodis pv. clitoriae (=Xanthomonas campestris pv. clitoriae), Xanthomonas axonopodis pv. coracanae (=Xanthomonas campestris pv. coracanae), Xanthomonas axonopodis pv. cyamopsidis (=Xanthomonas campestris pv. cyamopsidis), Xanthomonas axonopodis pv. desmodii (=Xanthomonas campestris pv. desmodii), Xanthomonas axonopodis pv. desmodiigangetici (=Xanthomonas campestris pv. desmodiigangetici), Xanthomonas axonopodis pv. desmodiilaxiflori (=Xanthomonas campestris pv. desmodiilaxiflori), Xanthomonas axonopodis pv. desmodiirotundifolii (=Xanthomonas campestris pv. desmodiirotundifolii), Xanthomonas axonopodis pv. dieffenbachiae (=Xanthomonas campestris pv. dieffenbachiae), Xanthomonas axonopodis pv. erythrinae (=Xanthomonas campestris pv. erythrinae), Xanthomonas axonopodis pv. fascicularis (=Xanthomonas campestris pv. fasciculari), Xanthomonas axonopodis pv. glycines (=Xanthomonas campestris pv. glycines), Xanthomonas axonopodis pv. khayae (=Xanthomonas campestris pv. khayae), Xanthomonas axonopodis pv. lespedezae (=Xanthomonas campestris pv. lespedezae), Xanthomonas axonopodis pv. maculifoliigardeniae (=Xanthomonas campestris pv. maculifoliigardeniae), Xanthomonas axonopodis pv. malvacearum (=Xanthomonas citri subsp. malvacearum), Xanthomonas axonopodis pv. manihotis (=Xanthomonas campestris pv. manihotis), Xanthomonas axonopodis pv. martyniicola (=Xanthomonas campestris pv. martyniicola), Xanthomonas axonopodis pv. melhusii (=Xanthomonas campestris pv. melhusii), Xanthomonas axonopodis pv. nakataecorchori (=Xanthomonas campestris pv. nakataecorchori), Xanthomonas axonopodis pv. passiflorae (=Xanthomonas campestris pv. passiflorae), Xanthomonas axonopodis pv. patelii (=Xanthomonas campestris pv. patelii), Xanthomonas axonopodis pv. pedalii (=Xanthomonas campestris pv. pedalii), Xanthomonas axonopodis pv. phaseoli (=Xanthomonas campestris pv. phaseoli, Xanthomonas phaseoli), Xanthomonas axonopodis pv. phaseoli var. fuscans (=Xanthomonas fuscans), Xanthomonas axonopodis pv. phyllanthi (=Xanthomonas campestris pv. phyllanthi), Xanthomonas axonopodis pv. physalidicola (=Xanthomonas campestris pv. physalidicola), Xanthomonas axonopodis pv. poinsettiicola (=Xanthomonas campestris pv. poinsettiicola), Xanthomonas axonopodis pv. punicae (=Xanthomonas campestris pv. punicae), Xanthomonas axonopodis pv. rhynchosiae (=Xanthomonas campestris pv. rhynchosiae), Xanthomonas axonopodis pv. ricini (=Xanthomonas campestris pv. ricini), Xanthomonas axonopodis pv. sesbaniae (=Xanthomonas campestris pv. sesbaniae), Xanthomonas axonopodis pv. tamarindi (=Xanthomonas campestris pv. tamarindi), Xanthomonas axonopodis pv. vasculorum (=Xanthomonas campestris pv. vasculorum), Xanthomonas axonopodis pv. vesicatoria (=Xanthomonas campestris pv. vesicatoria, Xanthomonas vesicatoria), Xanthomonas axonopodis pv. vignaeradiatae (=Xanthomonas campestris pv. vignaeradiatae), Xanthomonas axonopodis pv. vignicola (=Xanthomonas campestris pv. vignicola), Xanthomonas axonopodis pv. vitians (=Xanthomonas campestris pv. vitians);

Xanthomonas campestris pv. musacearum, Xanthomonas campestris pv. pruni (=Xanthomonas arboricola pv. pruni), Xanthomonas fragariae;

Xanthomonas translucens (=Xanthomonas campestris pv. hordei), включая, например, Xanthomonas translucens pv. arrhenatheri (=Xanthomonas campestris pv. arrhenatheri), Xanthomonas translucens pv. cerealis (=Xanthomonas campestris pv. cerealis), Xanthomonas translucens pv. graminis (=Xanthomonas campestris pv. graminis), Xanthomonas translucens pv. phlei (=Xanthomonas campestris pv. phlei), Xanthomonas translucens pv. phleipratensis (=Xanthomonas campestris pv. phleipratensis), Xanthomonas translucens pv. poae (=Xanthomonas campestris pv. poae), Xanthomonas translucens pv. secalis (=Xanthomonas campestris pv. secalis), Xanthomonas translucens pv. translucens (=Xanthomonas campestris pv. translucens), Xanthomonas translucens pv. undulosa (=Xanthomonas campestris pv. undulosa.

Предпочтительно вредные бактериальные организмы выбирают из группы, к которой относятся:

Acidovorax avenae subsp. avenae (=Pseudomonas avenae subsp. avenae), Acidovorax avenae subsp. citrulli (=Pseudomonas pseudoalcaligenes subsp. citrulli, Pseudomonas avenae subsp. citrulli), Burkholderia glumae (=Pseudomonas glumae), Burkholderia solanacearum (=Ralstonia solanacearum), Candidatus Liberibacter spec., как определено выше, Corynebacterium michiganense pv. nebraskense, Erwinia amylovora, Erwinia carotovora (=Pectobacterium carotovorum), Erwinia carotovora subsp.atroseptica, Erwinia carotovora subsp. carotovora, Erwinia chrysanthemi, Erwinia chrysanthemi pv. zeae, Erwinia herbicola, Erwinia stewartiii, Erwinia uredovora, Pseudomonas syringae, Pseudomonas syringae pv. actinidiae (Psa), Pseudomonas syringae pv. glycinea, Pseudomonas syringae pv. lachrymans, Pseudomonas syringae pv. papulans, Pseudomonas syringae pv. syringae, Pseudomonas syringae pv. tomato, Pseudomonas syringae pv. tabaci, Streptomyces scabies, Xanthomonas axonopodis pv. citri, Xanthomonas axonopodis pv. glycines (=Xanthomonas campestris pv. glycines), Xanthomonas axonopodis pv. punicae (=Xanthomonas campestris pv. punicae), Xanthomonas axonopodis pv. vesicatoria (=Xanthomonas campestris pv. vesicatoria, Xanthomonas vesicatoria), Xanthomonas campestris, Xanthomonas campestris pv. musacearum, Xanthomonas campestris pv. pruni (=Xanthomonas arboricola pv. pruni), Xanthomonas fragariae, Xanthomonas translucens pv. translucens (=Xanthomonas campestris pv. translucens).

В более предпочтительном аспекте настоящего изобретения вредные бактериальные организмы выбирают из группы, к которой относятся:

Acidovorax avenae (=Pseudomonas avenae, Pseudomonas avenae subsp.avenae, Pseudomonas rubrilineans), как определено выше, Burkholderia spec., как определено выше, Burkholderia glumae, Candidatus Liberibacter spec., как определено выше, Corynebacterium, как определено выше, Erwinia spec., как определено выше, Erwinia amylovora, Erwinia carotovora (=Pectobacterium carotovorum), Erwinia carotovora subsp. atroseptica, Erwinia carotovora subsp. carotovora, Erwinia chrysanthemi, Erwinia chrysanthemi pv. zеае, Erwinia herbicola, Erwinia stewartiii, Erwinia uredovora, Pseudomonas syringae, как определено выше, Pseudomonas syringae pv. actinidae, Pseudomonas syringae pv. glycinea, Pseudomonas syringae pv. tomato, Pseudomonas syringae pv. lachrymans, Streptomyces spp., Streptomyces scabies, Xanthomonas spp., Xanthomonas axonopodis, как определено выше, Xanthomonas axonopodis pv. citri, Xanthomonas axonopodis pv. glycines, Xanthomonas campestris, Xanthomonas campestris pv. musacearum, Xanthomonas campestris pv. pruni (=Xanthomonas arboricola pv. pruni), Xanthomonas fragariae и Xanthomonas translucens (=Xanthomonas campestris pv. hordei), как определено выше.

Еще более предпочтительным выбором являются:

Acidovorax avenae, Burkholderia spec., Burkholderia glumae, Candidatus Liberibacter spec., Corynebacterium, Erwinia spec., Pseudomonas syringae, Pseudomonas syringae pv. actinidae, Pseudomonas syringae pv. glycinea, Pseudomonas syringae pv. tomato, Pseudomonas syringae pv. lachrymans, Streptomyces spp., Xanthomonas spp., Xanthomonas axonopodis, Xanthomonas axonopodis pv. citri, Xanthomonas axonopodis pv. glycines, Xanthomonas campestris, Xanthomonas campestris pv. musacearum, Xanthomonas campestris pv. pruni, Xanthomonas fragariae и Xanthomonas transluscens.

В еще более предпочтительном аспекте настоящего изобретения вредные бактериальные организмы выбирают из группы, к которой относятся:

Acidovorax avenae, Burkholderia spec., Burkholderia glumae, Candidatus Liberibacter spec., Corynebacterium, Erwinia amylovora, Erwinia carotovora, Erwinia carotovora subsp.atroseptica, Erwinia carotovora subsp.carotovora, Erwinia chrysanthemi, Erwinia chrysanthemi pv. zeae, Erwinia herbicola, Erwinia stewartiii, Erwinia uredovora, Pseudomonas syringae, Pseudomonas syringae pv. actinidae, Pseudomonas syringae pv. glycinea, Pseudomonas syringae pv. lachrymans, Pseudomonas syringae pv. tomato, Streptomyces scabies, Xanthomonas axonopodis, Xanthomonas axonopodis pv. citri, Xanthomonas axonopodis pv. glycines, Xanthomonas campestris, Xanthomonas campestris pv. musacearum, Xanthomonas campestris pv. pruni, Xanthomonas fragariae и Xanthomonas translucens.

Наиболее предпочтительно выбор осуществляют из группы, к которой относятся:

Burkholderia glumae, Candidatus Liberibacter spec., Xanthomonas axonopodis pv. citri, Pseudomonas syringae, Pseudomonas syringae pv. actinidae, Pseudomonas syringae pv. glycinea, Pseudomonas syringae pv. lachrymans, Pseudomonas syringae pv. tomato, Streptomyces scabies, Xanthomonas axonopodis pv. glycines, Xanthomonas campestris pv. pruni и Xanthomonas campestris.

Таким образом, стимуляторы иммунной защиты согласно настоящему изобретению могут применяться для защиты растений от инвазий вышеупомянутых патогенов в течение определенного периода последующей обработки. Период, в течение которого обеспечивается защита, в целом длится от 1 до 10 дней, предпочтительно - от 1 до 7 дней после обработки растений активными соединениями. В зависимости от формы применения, доступность активных соединений для растения может регулироваться заданным способом.

Надлежащая толерантность растений к стимуляторам иммунной защиты в концентрациях, требуемых для борьбы с болезнями растений, позволяет обрабатывать надземные и подземные части растений, материал для вегетативного размножения и почву.

Стимуляторы иммунной защиты согласно настоящему изобретению также приемлемы для повышения урожайности, обладают меньшей токсичностью и хорошо переносятся растениями.

В контексте настоящего изобретения после нанесения на растения наблюдался благоприятный эффект.

В соответствии с изобретением, обработке могут подвергаться все части. Под растениями в данном контексте следует понимать все части растений и популяции растений, например, желательные и нежелательные дикие растения или культурные растения (включая встречающиеся в природе культурные растения). Культурные растения могут быть растениями, получаемыми путем традиционной селекции и оптимизации или биотехнологическими и рекомбинантными способами или с применением комбинаций этих способов, включая трансгенные растения и сорта растений, независимо от их защиты Правами растениеводов-селекционеров. К таким способам относятся, например, двойные гаплоиды, слияние протопластов, случайный или направленный мутагенез, а также молекулярные или генетические маркеры.

Части растений означают все надземные и подземные части и органы растений, такие, как трава, псевдостебли, побеги, листья, прицветники, листовые влагалища, черешки, листовые пластины, цветки и корни, среди примеров которых могут быть упомянуты листья, хвоя, черешки, стебли, цветки, плодовые тела, плоды, банановые гроздья и семена, а также корни, клубни, корневища, отростки, боковые побеги, вторичные побеги. К частям растений также относятся выращенный материал и материал для вегетативного и генеративного размножения, например, обрезки, клубни, корневища, отпрыски и семена.

Как уже было упомянуто выше, все растения могут обрабатываться в соответствии с изобретением. В предпочтительном варианте осуществления обработке подвергаются виды и сорта растений и их части, встречающиеся в дикой природе или получаемые традиционными способами биологической селекции, такими, как гибридизация, культивирование меристем, вегетативное размножение, соматический эмбриогенез, прямой органогенез или слияние протопластов. В еще одном предпочтительном варианте осуществления обработке подвергаются трансгенные растения и сорта растений, получаемые рекомбинантными способами в комбинации с традиционными способами (генетически модифицированные организмы), например, трансформации с применением Agrobacterium или бомбардировке эмбриогенных клеток частицами и вегетативному размножению. Растения включают все упомянутые выше части растений.

В соответствии с изобретением, особое предпочтение отдается обработке растений сортов, которые в любом случае являются коммерческими или используемыми. Под сортами растений следует понимать растения с новыми свойствами ("признаками"), полученные путем традиционной селекции, путем мутагенеза или при помощи технологий рекомбинантных ДНК. Они могут быть сортами, разновидностями, биотипами и генотипами.

Способ обработки согласно изобретению может применяться для обработки генетически модифицированных организмов (ГМО), например, растений или семян. Генетически модифицированные растения (или трансгенные растения) представляют собой растения, в которых гетерологичный ген был устойчиво интегрирован в геном. Выражение "гетерологичный ген" по сути означает ген, создаваемый или собираемый за пределами растения и при включении в ядерный, хлоропластный или митохондриальный геном обеспечивает трансформированное растение с новыми или улучшенными агрономическими или другими свойствами путем экспрессии нужного белка или полипептида или путем понижающей регуляции или подавления экспрессии другого(их) гена(ов), присутствующих в растении (с применением, например, антисмысловой технологии, технологии косупрессии или РНК-интерференции [РНКи]). Гетерологичный ген, расположенный в геноме, также называется трансген. Трансген, определяемый его конкретным расположением в геноме растения, называется трансформацией или трансгенным объектом.

К растениям и сортам растений, которые предпочтительно подлежат обработке согласно изобретению, относятся все растения, включающие генетический материал, обеспечивающий для этих растений конкретные преимущества и полезные свойства (достигаемые путем селекции и/или биотехнологическими средствами).

Растения, поддающиеся обработке согласно изобретению, представляют собой гибридные растения, которые уже экспрессируют характеристики гетерозиса или гибридной силы, в результате чего обеспечивается в целом более высокая урожайность, сила, здоровье и резистентность к факторам биотического и абиотического стресса. Такие растения, как правило, получают путем скрещивания инбредной родительской линии с мужской стерильностью (материнской формы) с другой инбредной родительской линией с мужской фертильностью (отцовской формой). Гибридные семена, как правило, получают от растений с мужской стерильностью и продают производителям. Растения с мужской стерильностью иногда, например, в случае кукурузы) могут быть получены путем удаления метелок (т.е., механического удаления мужских репродуктивных органов или мужских цветков), однако чаще мужская стерильность является результатом генетических детерминантов в геноме растения. В этом случае, в особенности, если продуктом, который должен быть получен от гибридных растений, являются семена, обычно желательно обеспечить полное восстановление мужской фертильности в гибридных растениях, содержащих генетические детерминанты, отвечающие за мужскую стерильность. Это может осуществляться путем обеспечения наличия у мужских родителей соответствующих генов-восстановителей фертильности, способных восстанавливать мужскую фертильность в гибридных растениях, содержащих генетические детерминанты, отвечающие за мужскую стерильность. Генетические детерминанты для мужской стерильности могут находиться в цитоплазме. Примеры цитоплазматической мужской стерильности (CMS) были описаны, например, для видов Brassica. Однако генетические детерминанты для мужской стерильности также могут находиться в ядерном геноме. Растения с мужской стерильностью также могут быть получены при помощи биотехнологии растений, таких, как генная инженерия. Особенно подходящие способы получения растений с мужской стерильностью описываются в документе WO 89/10396, согласно которому, например, рибонуклеазу, такую, как барназа, селективно экспрессируют в клетках тапетума тычинок. Затем фертильность может быть восстановлена путем экспрессии в клетках тапетума ингибитора рибонуклеазы, такого, как барстар.

Растения или сорта растений (получаемые при помощи биотехнологии растений, таких, как генная инженерия), которые также могут обрабатываться согласно изобретению, являются резистентными к насекомым трансгенными растениями, т.е., растениями с приобретенной резистентностью к инвазиям определенных насекомых. Такие растения могут быть получены путем генетической трансформации или путем селекции растений, содержащих мутацию, обеспечивающую такую резистентность к насекомым.

Могут быть упомянуты следующие растения, которые могут подвергаться обработке в соответствии с изобретением:

хлопок, лен, виноградная лоза, овощи и фрукты (например, киви, ананас), такие виды, как розоцветные (например, семечковые, такие, как яблони и груши, а также косточковые, такие, как абрикосы, вишни, миндаль и персики, и сочные плоды, такие, как клубника) или гранат рода Punica видов Ribesioidae, Juglandaceae, Betulaceae, Anacardiaceae, Fagaceae, Moraceae, Oleaceae, Actinidaceae, Lauraceae, Musaceae (например, банановые деревья и банановые плантации, а также банан овощной), виды Rubiaceae (например, кофе), виды Theaceae, Sterculiceae, Rutaceae (например, цитрусовые, лимоны, апельсины и грейпфруты); виды Solanaceae (например, томаты), виды Liliaceae, Asteraceae (например, салат), виды Umbelliferae, Cruciferae, Chenopodiaceae, Cucurbitaceae (например, огурцы, дыни, тыквы, кабачки), виды Alliaceae (например, порей, лук), виды Papilionaceae (например, горох); основные культурные растения, такие, как виды Gramineae (например, кукуруза, дерновые травы, злаки, такие, как пшеница, рожь, рис, ячмень, овес, сорго, просо и тритикале), виды Asteraceae (например, подсолнечник), виды Brassicaceae (например, капуста, такая, как белокочанная капуста и краснокочанная капуста, брокколи, цветная капуста, брюссельская капуста, пекинская капуста, кольраби, редис, а также масличный рапс, горчица, хрен и кресс-салат), виды Fabacae (например, фасоль, арахис), виды Papilionaceae (например, соя), виды Solanaceae (например, картофель), виды Chenopodiaceae (например, сахарная свекла, кормовая свекла, листовая свекла, свекловица); культурные растения и декоративные растения в садах и лесах; и в каждом из случаев - генетически модифицированные типы этих растений.

Предпочтительно стимуляторы иммунной защиты согласно настоящему изобретению применяются для обработки растений, выбранных из группы, к которой относятся:

овощи и фрукты (например, киви, дыня, ананас), такие, как виды Rosaceae (например, семечковые, такие, как яблони и груши, а также косточковые, такие, как абрикосы, вишни, миндаль и персики, и сочные плоды, такие, как клубника) или гранат рода Punica, виды Musaceae (например, банановые деревья и банановые плантации, а также банан овощной), виды Rutaceae (например, цитрусовые, лимоны, апельсины и грейпфруты); овощи, такие, как виды Solanaceae (например, томаты), виды Cucurbitaceae (например, огурцы, дыни, тыквы, кабачки), основные культурные растения, такие, как виды Gramineae (например, кукуруза, дерновые травы, злаки, такие, как пшеница, рожь, рис, ячмень, овес, сорго, просо и тритикале), виды Brassicaceae (например, капуста, такая, как белокочанная капуста и краснокочанная капуста, брокколи, цветная капуста, брюссельская капуста, пекинская капуста, кольраби, редис, а также масличный рапс, горчица, хрен и кресс-салат), виды Papilionaceae (например, соя), виды Solanaceae (например, картофель); и в каждом из случаев генетически модифицированные типы этих растений.

Еще более предпочтительной является обработка растений, выбранных из группы, к которой относятся:

фрукты, овощи, картофель, злаки, кукуруза, рис и соя.

Из них предпочтительным выбором является группа, к которой относятся:

киви, дыня, ананас, семечковые, такие, как яблони, груши и гранат, косточковые, такие, как персики, сочные плоды, такие, как клубника, банановые деревья и банановые плантации, а также банан овощной, цитрусовые, лимоны, апельсины и грейпфрут; томаты, огурцы, дыни, тыквы, кукуруза, злаки, такие, как пшеница, рис, капуста, цветная капуста, соя, картофель; и в каждом из случаев генетически модифицированные типы этих растений.

Наиболее предпочтительным выбором являются следующие культурные растения, подвергаемые обработке в соответствии с настоящим изобретением: яблони, бананы, цитрусовые, киви, дыни, персики, груши, ананас, семечковые, гранат, капуста, цветная капуста, огурцы, тыквы, томаты, картофель, пшеница, рис и соя.

А также: цитрусовые, киви, персики, огурцы, томаты, картофель, пшеница и соя.

Еще один предпочтительный аспект настоящего изобретения касается применения стимуляторов иммунной защиты для борьбы с как минимум одним из следующих вредителей:

Acidovorax avenae и/или Burkholderia glumae на рисе; Candidatus Liberibacter spec., и/или Xanthomonas axonopodis pv. citri на цитрусовых; Corynebacterium на кукурузе; Pseudomonas syringae pv. actinidae на киви; Xanthomonas campestris на персиках, бананах и/или бананах овощных; Xanthomonas axonopodis на гранате; Pseudomonas syringae pv. glycinea и/или Xanthomonas axonopodis на сое; Burkholderia spec., и/или Xanthomonas transluscens на злаках (предпочтительно на пшенице); Pseudomonas syringae, Pseudomonas syringae pv. tomato и/или Xanthomonas campestris на томатах; Pseudomonas syringae и/или Pseudomonas syringae pv. lachrymans на огурцах; Erwinia carotovora, Erwinia carotovora subsp.atroseptica и/или Streptomyces scabies на картофеле; Erwinia carotovora на бананах и/или бананах овощных.

Согласно изобретению, большее предпочтение отдается применению стимуляторов иммунной защиты для борьбы с как минимум одним из следующих вредителей: Acidovorax avenae и/или Burkholderia spec., (предпочтительно Burkholderia glumae) на рисе; Candidatus Liberibacter spec., и/или Xanthomonas axonopodis (предпочтительно Xanthomonas axonopodis pv. citri) на цитрусовых; Pseudomonas syringae (предпочтительно Pseudomonas syringae pv. actinidae) на киви; Xanthomonas campestris и/или Xanthomonas campestris pv. pruni на персиках; Pseudomonas syringae (предпочтительно Pseudomonas syringae pv. glycinea) и/или Xanthomonas axonopodis (предпочтительно Xanthomonas axonopodis pv. glycines (=Xanthomonas campestris pv. glycines) на сое; Burkholderia spec., и/или Xanthomonas transluscens на злаках; Pseudomonas syringae (предпочтительно Pseudomonas syringae pv. tomato) и/или Xanthomonas campestris на томатах; Pseudomonas syringae и/или Pseudomonas syringae pv. lachrymans на огурцах; а также Erwinia atroseptica, Erwinia carotovora и/или Streptomyces scabies на картофеле.

Наиболее предпочтительным является применение стимуляторов иммунной защиты для борьбы с Burkholderia glumae на рисе, Liberibacter spec., и/или Xanthomonas axonopodis pv. citri на цитрусовых, Pseudomonas syringae pv. actinidiae (Psa) на киви, Pseudomonas syringae pv. glycinea и/или Xanthomonas axonopodis pv. glycines на сое, Pseudomonas syringae и/или Pseudomonas syringae pv. tomato на томатах и Xanthomonas campestris и/или Xanthomonas campestris pv. pruni на персиках, Pseudomonas syringae Pseudomonas syringae pv. lachrymans на огурцах и/или Streptomyces scabies на картофеле.

Формы применения

Обработку растений и частей растений согласно изобретению комбинациями или композициями активных соединений осуществляют непосредственно или путем воздействия на их окружение, среду или место для хранения с применением традиционных способов обработки, например, путем погружения, опрыскивания, распыления, орошения, выпаривания, опыливания, аэрозольного орошения, разбрасывания, ценообразования, нанесения кистью, напыления, полива (пропитывания), капельного орошения и, в случае материала для размножения, в частности, в случае семян, в форме порошка для сухой обработки семян, раствора для обработки семян, водорастворимого порошка для полусухого протравливания, путем инкрустирования, путем нанесения одного или нескольких покрытий и т.п. Предпочтение отдается применению путем погружения, опрыскивания, распыления, орошения, выпаривания, опыливания, аэрозольного орошения, разбрасывания, пенообразования, нанесения кистью, напыления, полива (пропитывания) и капельного орошения. Настоящее изобретение также включает обработку в ящиках в питомнике.

В особенно предпочтительном варианте осуществления настоящего изобретения стимуляторы иммунной защиты или их композиции применяют для нанесения в форме растворов, эмульсий или суспензий, применяемых путем опрыскивания, для обработки материала для вегетативного размножения или для нанесения на корневища или листья.

В зависимости от соответствующих физических и/или химических свойств, выбранный стимулятор иммунной защиты может быть преобразован в традиционные композиции, такие, как растворы, эмульсии, суспензии, порошки, пены, пасты, гранулы, саше, аэрозоли, микроинкапсулирован в полимерные вещества, и холодные и горячие ULV-композиции аэрозольного орошения.

Эти композиции приготавливают известным способом, например, путем смешивания стимуляторов иммунной защиты с расширителями, то есть, жидкими растворителями, сжиженными газами под давлением и/или твердыми носителями, необязательно с применением поверхностно-активных веществ, то есть, эмульгаторов и/или диспергаторов и/или пенообразователей. Если в качестве расширителя используют воду, также существует возможность использования, например, органического растворителя в качестве сорастворителя. В целом подходящими жидкими растворителями являются: ароматические соединения, такие, как ксилол, толуол или алкилнафталины, хлорированные ароматические соединения или хлорированные алифатические углеводороды, такие, как хлоробензолы, хлороэтилены или метиленхлорид, алифатические углеводороды, такие, как циклогексан или парафины, например, фракции минеральных масел, спирты, такие, как бутанол или гликоль, и их эфиры и сложные эфиры, кетоны, такие, как ацетон, метилэтилкетон, метилизобутилкетон или циклогексанон, сильнополярный растворитель, такой, как диметилформамид и диметилсульфоксид, и вода, а также минеральные, животные и растительные масла, такие, как, например, пальмовое масло или другие масла из семян растений. Под сжиженными газообразными расширителями или носителями следует понимать жидкости, которые являются газообразными при нормальной температуре и нормальном давлении, например, газы-вытеснители аэрозолей, такие, как галогеноуглеводороды и бутан, пропан, азот и диоксид углерода.

Подходящими твердыми носителями являются, например, перемолотые природные минералы, такие, как каолины, глины, тальк, мел, кварц, аттапульгит, монтмориллонит или диатомит, и перемолотые синтетические минералы, такие, как высокодисперсный кремнезем, глинозем и силикаты. Примерами подходящих твердых носителей для гранул могут быть: измельченные и фракционированные естественные породы, такие, как кальцит, пемза, мрамор, сепиолит, доломит, синтетические гранулы неорганических и органических материалов и гранулы органического материала, такого, как опилки, кокосовая кожура, кукурузные початки и черешки табачного листа. Примерами подходящих эмульгаторов и/или пенообразователей являются: неионные, катионные и анионные эмульгаторы, такие, как полиоксиэтиленовые сложные эфиры жирной кислоты, полиоксиэтиленовые эфиры жирной кислоты, например, полигликолевые эфиры алкиларила, алкилсульфонаты, алкилсульфаты, арилсульфонаты и белковые гидролизаты. Примерами подходящих диспергаторов являются: отработанные лигносульфитные щелоки и метилцеллюлоза.

В композициях могут применяться адгезивы, такие, как карбоксиметилцеллюлоза, природные и синтетические полимеры в форме порошка, гранул или латексов, например, аравийская камедь, поливиниловый спирт, поливинил ацетат и природные фосфолипиды, такие, как цефалины и лецитины, и синтетические фосфолипиды. Другими добавками могут быть минеральные и растительные масла.

Возможно применение красителей, таких, как неорганические пигменты, например, оксид железа, оксид титана, берлинская лазурь, и органических красящих веществ, таких, как ализарин, азо и металлофталоцианины, и меченых питательных элементов, таких, как соли железа, марганца, бора, меди, кобальта, молибдена и цинка.

В целом композиции содержат от 0,1 до 95% по массе активного соединения (стимулятора иммунной защиты), предпочтительно - от 0,5 до 90%.

Борьба с определенными вредными бактериальными организмами путем обработки материала для вегетативного размножения растений известна давно и является предметом постоянного совершенствования. Однако обработка материала для вегетативного размножения связана с рядом проблем, которые не всегда могут быть удовлетворительно решены. Таким образом, существует потребность в разработке способов защиты материала для вегетативного размножения и выращивания растений, которое позволяет обходиться без дополнительного применения средств защиты растений после сева или после прорастания растений, или как минимум значительно снизить их применение. Кроме того, существует потребность в оптимизации количества применяемого активного соединения, таким образом, чтобы материал для вегетативного размножения и прорастающее растение были максимально защищены от инвазий вредных бактериальных организмов, однако без повреждения самого растения применяемым активным соединением. В частности, при осуществлении способов обработки материала для вегетативного размножения также должны учитываться характерные свойства трансгенных растений с целью достижения оптимальной защиты материала для вегетативного размножения и прорастающего растения при максимально низкой норме внесения средств защиты растений.

Таким образом, настоящее изобретение, в частности, также касается способа защиты материала для вегетативного размножения и прорастающих растений от инвазий определенных вредных бактериальных организмов путем обработки семян и материала для вегетативного размножения соединением или композицией согласно изобретению.

Изобретение также касается применения соединений согласно изобретению для обработки материала для вегетативного размножения с целью защиты материала для вегетативного размножения и прорастающего растения от определенных вредных бактериальных организмов.

Одно из преимуществ настоящего изобретения состоит в том, что, благодаря особым системным свойствам соединений согласно изобретению, обработка материала для вегетативного размножения этими соединениями защищает не только сам материал для вегетативного размножения, но и растения, которые из него вырастают после сева, от этих вредных бактериальных организмов. Таким образом, можно обойтись без непосредственной обработки культуры во время сева или вскоре после него.

Другое преимущество состоит в том, что соединения согласно изобретению могут применяться, в частности, также в трансгенном материале для вегетативного размножения.

Соединения согласно изобретению являются подходящими для защиты материала для вегетативного размножения любого сорта растений, используемого в сельском хозяйстве, в оранжереях, в лесном хозяйстве или в садоводстве. В частности, это может быть материал для вегетативного размножения указываемых авторами предпочтительных растений.

В пределах объема настоящего изобретения соединения согласно изобретению применяют для материала для вегетативного размножения отдельно или в соответствующей композиции. Предпочтительно материал для вегетативного размножения обрабатывают в состоянии, в котором он достаточно устойчив, во избежание повреждения во время обработки. В целом материал для вегетативного размножения может обрабатываться в любой момент от сбора до посева или высаживания. Как правило, применяют материал для вегетативного размножения, отделенный от растения и освобожденный от початков, скорлупы, стеблей, кожуры, волокон или мякоти плодов.

При обработке материала для вегетативного размножения в целом следует обращать внимание на то, чтобы количество соединения или композиции согласно изобретению и/или других добавок, применяемых для материала для вегетативного размножения было выбрано таким образом, чтобы не оказывалось отрицательного воздействия на прорастание материала для вегетативного размножения, или чтобы не повреждалось растение, выращиваемое из такого материала. Это должно учитываться, в частности, в случае активных соединений, которые при определенных нормах внесения могут иметь фитотоксический эффект.

Соединения или композиции согласно изобретению могут применяться непосредственно, то есть, без содержания других компонентов и без разбавления. В целом предпочтение отдается применению соединений или композиций для материала для вегетативного размножения в форме соответствующей композиции. Подходящие композиции и способы обработки семян и материала для вегетативного размножения известны специалистам в данной области.

Соединения или композиции, которые могут применяться в соответствии с изобретением, могут быть преобразованы в традиционные композиции, такие, как растворы, эмульсии, суспензии, порошки, пены и ULV-композиции.

Эти композиции приготавливают известным способом путем смешивания стимуляторов иммунной защиты с традиционными добавками, такими, как, например, традиционные расширители, а также растворители или разбавители, красители, увлажнители, диспергаторы, эмульгаторы, противовспениватели, консерванты, вторичные загустители, адгезивы, гиббереллины, минеральные и растительные масла, а также вода.

Все красители, которые могут присутствовать в композициях, которые могут применяться в соответствии с изобретением, являются красителями, которые обычно применяются для таких целей. В этом контексте могут применяться пигменты, умеренно растворимые в воде, и красители, растворимые в воде. В качестве примеров могут быть упомянуты красители, известные под названиями Rhodamin В, C.I. Pigment Red 112 и C.I. Solvent Red 1.

Увлажнителями, которые могут присутствовать в композициях, которые могут применяться в соответствии с изобретением, могут быть все вещества, которые традиционно применяются для рецептирования агрохимических активных соединений и которые способствуют увлажнению. Предпочтительными являются алкилнафталинсульфонаты, такие, как диизопропил- или диизобутилнафталинсульфонаты.

Все подходящие диспергаторы и/или эмульгаторы, которые могут присутствовать в композициях, применяемых в соответствии с изобретением могут быть неионными, анионными и катионными диспергаторами, которые традиционно применяются для рецептирования агрохимических активных соединений. Предпочтение отдается следующим: неионным или анионным диспергаторам или смесям неионных или анионных диспергаторов. Среди подходящих неионных диспергаторов могут быть упомянуты, в частности, блок-полимеры этиленоксида / пропиленоксида, эфиры алкилфенолполигликолей и эфиры тристирилфенолполигликолей и их фосфатированные или сульфатированные производные. Подходящими анионными диспергаторами являются, в частности, лигносульфонаты, соли полиакриловой кислоты и конденсаты арилсульфоната / формальдегида.

Противовспенивателями, которые могут присутствовать в композициях, применяемых в соответствии с изобретением, могут быть все противовспенивающие вещества, традиционно используемые для рецептирования агрохимических активных соединений. Предпочтение отдается кремнийорганическим противовспенивателям и стеарату магния.

Консервантами, которые могут присутствовать в композициях, применяемых в соответствии с изобретением, могут быть все вещества, которые могут применяться с этими целями в агрохимических композициях. В качестве примеров могут быть упомянуты дихлорофен и полуформаль бензилового спирта.

Вторичными загустителями, которые могут присутствовать в композициях, применяемых в соответствии с изобретением могут быть все вещества, которые могут применяться с этими целями в агрохимических композициях. Предпочтение отдается производным целлюлозы, производным акриловой кислоты, ксантану, модифицированным глинам и высокодисперсному кремнезему.

Адгезивами, которые могут присутствовать в композициях, применяемых в соответствии с изобретением, могут быть все традиционные связующие вещества, которые могут использоваться в протравах. Предпочтительными являются поливинилпирролидон, поливинилацетат, поливиниловый спирт и тилоза.

Гиббереллинами, которые могут присутствовать в композициях, применяемых в соответствии с изобретением предпочтительно являются Гиббереллин А1, Гиббереллин A3 (гибберелловая кислота), Гиббереллин А4, Гиббереллин А7. Особенно предпочтительной является гибберелловая кислота.

Гиббереллины известны (ср. R. Wegler "Chemie der Pflanzenschutz- und Schädlingsbekämpfungsmittel" [Chemistry of plant protection and pesticide agents], volume 2, Springer Verlag, Berlin-Heidelberg-New York, 1970, стр. 401-412).

Композиции, применяемые в соответствии с изобретением, могут применяться для лечения различных типов семян, либо непосредственно, либо после предварительного разведения водой. Таким образом, концентраты препаратов, получаемых из них путем разведения водой, могут использоваться для протравливания семян. Композиции, применяемые в соответствии с изобретением или их разведенные препараты также могут применяться для обработки материала для вегетативного размножения трансгенных растений. В таких случаях также возможны дополнительные синергетические эффекты в комбинации с веществами, образуемыми путем экспрессии.

Норма внесения композиций, которые могут применяться в соответствии с изобретением, может колебаться в широком диапазоне. Она зависит от содержания соответствующего активного соединения в композициях и от материала для вегетативного размножения. Как правило, нормы внесения активного соединения составляют от 0,001 до 50 г на килограмм материала для вегетативного размножения, предпочтительно - от 0,01 до 15 г на килограмм материала для вегетативного размножения.

Комбинации / композиции

Предпочтительные стимуляторы иммунной защиты согласно настоящему изобретению (1.1) ацибензолар-S-метил, (1.2) изотианил, (1.3) пробеназол и (1.4) тиадинил могут применяться сами по себе или в композициях, а также в комбинации с известными бактерицидами, фунгицидами, акарицидами, нематицидами, гербицидами, инсектицидами, питательными микроэлементами и содержащими питательные микроэлементы соединениями, антидотами, липохитоолигосахаридными соединениями (LCO), продуктами, улучшающими почву, или продуктами, снижающими стресс растений, например, Myconate, например, с целью расширения спектра действия или предотвращения развития резистентности.

В контексте изобретения липохитоолигосахаридное (LCO) соединение представляет собой соединение, имеющее общую LCO-структуру, т.е., олигомерный остов β-1,4-связанных N-ацетил-D-глюкозаминовых остатков с N-связанной жирнокислотной цепью на невосстанавливающем конце, как описывается в Патенте США №5,549718; Патенте США №5,646,018; Патенте США №5,175,149; и Патенте США №5,321,011. Эта основная структура может содержать модификации или замещения, содержащиеся в природных LCO, такие, как описываемые в публикациях Spaink, Critical Reviews in Plant Sciences 54: 257-288, 2000; D'Haeze and Holsters, Glycobiology 12: 79R-105R, 2002. Природные LCO определяются как соединения, встречающиеся в природе. Эта основная структура также может содержать модификации или замещения, которые еще не встречались в природных LCO. Примерами таких аналогов, для которых конъюгированная амидная связь имитируется бензамидной связью, или которые включают функцию бензиламидного типа, являются следующие соединения формулы (I), которые описываются в документах WO 2005/063784 и WO 2008/071672, содержание которых включено в это описание путем ссылки. LCO-соединения могут быть выделены прямо из конкретной культуры бактериальных штаммов Rhizobiaceae, синтезированы химическим путем или получены химико-ферментным путем. Благодаря последнему способу, может быть образован олигосахаридный скелет путем культивирования рекомбинантных бактериальных штаммов, таких, как Escherichia coli, в биореакторе, а затем химическим путем может быть присоединена липидная цепь. LCO, используемые в вариантах осуществления изобретения, могут быть получены из природных бактериальных штаммов Rhizobiaceae, вырабатывающих LCO, таких, как штаммы Azorhizobium, Bradyrhizobium (включая В. japonicum), Mesorhizobium, Rhizobium (включая R. leguminosarum), Sinorhizobium (включая S. meliloti), или из бактериальных штаммов, подвергнутых генной инженерии для выработки LCO. Эти способы известны специалистам в данной области и описываются, например, в патентах США №№5,549,718 и 5,646,018, включенных в это описание путем ссылки. В публикации Hungria и Stacey (Soil Biol. Biochem. 29: 819-830, 1997) перечисляются LCO-структуры, производимые различными видами микориз. LCO могут использоваться в разных формах очищения и могут применяться отдельно или с микоризами. Способы обеспечения только LCO включают простое удаление клеток микориз из смеси LCO и микориз или продолжение выделения и очистки молекул LCO путем отделения фазы растворителя LCO с последующей хроматографией HPLC, как описывается в публикации Lerouge, et. al (документ US 5,549,718). Очистке может способствовать повторная HPLC, и очищенные молекулы LCO могут быть подвергнуты высушиванию замораживанием для долгосрочного хранения. Этот способ приемлем для получения LCO из всех родов и видов Rhizobiaceae. На рынке присутствуют коммерческие продукты, содержащие LCO, такие, как OPTIMIZE® (EMD Crop Bioscience). LCO-соединения, которые могут быть или не быть идентичными природным LCO, также могут быть получены путем химического синтеза и/или при помощи генной инженерии. Синтез молекул олигосахаридов-предшественников для построения LCO подвергнутыми генной инженерии организмами описывается в публикации Samain et al., Carbohydrate Research 302: 35-42, 1997. Получение многих LCO-соединений, при котором олигосахаридный скелет получают путем культивирования рекомбинантных бактериальных штаммов, таких, как рекомбинантные клетки Escherichia coli, включающие гетерологичный ген из микориз, и липидная цепь прикреплена химически, описывается в документах WO 2005/063784 и WO 2008/07167, содержание которых включено в это описание путем ссылки. Примерами липохитоолигосахаридных соединений являются, помимо прочих, LCO-соединения, конкретно описанные в документе WO 2010/125065.

Предпочтительно стимуляторы иммунной защиты присутствуют в композиции, включающей как минимум еще одно соединение, выбранное из группы, к которой относятся бактерициды, антибиотики, фунгициды, инсектициды, гербициды, питательные микроэлементы и содержащие питательные микроэлементы соединения, а также липохитоолигосахаридные соединения (LCO). Предпочтительно это как минимум еще одно соединение выбрано из группы, к которой относятся:

Антибиотики, такие, как касугамицин, стрептомицин, окситетрациклин, валидамицин, гентамицин, ауреофунгин, бластицидин-S, циклогексимид, гризеофульвин, мороксидин, натамицин, полиоксины, полиоксорим и их комбинации.

Фунгициды:

(1) Ингибиторы биосинтеза эргостерола, например, альдиморф, азаконазол, битертанол, бромуконазол, ципроконазол, диклобутразол, дифеноконазол, диниконазол, диниконазол-М, додеморф, додеморф ацетат, эпоксиконазол, этаконазол, фенаримол, фенбуконазол, фенгексамид, фенпропидин, фенпропиморф, флуквинконазол, флурпримидол, флусилазол, флутриафол, фурконазол, фурконазол-цис, гексаконазол, имазалил, имазалил сульфат, имибенконазол, ипконазол, метконазол, миклобутанил, нафтифин, нуаримол, окспоконазол, паклобутразол, пефуразоат, пенконазол, пипералин, прохлораз, пропиконазол, протиоконазол, пирибутикарб, пирифенокс, хинконазол, симеконазол, спироксамин, тебуконазол, тербинафин, тетраконазол, триадимефон, триадименол, тридеморф, трифлумизол, трифорин, тритиконазол, униконазол, униконазол-р, виниконазол, вориконазол, 1-(4-хлорофенил)-2-(1Н-1,2,4-триазол-1-ил)циклогептанол, метил 1-(2,2-диметил-2,3-дигидро-1Н-инден-1-ил)-1Н-имидазол-5-карбоксилат, N'-{5-(дифторометил)-2-метил-4-[3-(триметилсилил)пропокси]фенил}-N-этил-N-метилимидоформамид, N-этил-N-метил-N'-{2-метил-5-(трифторометил)-4-[3-(триметилсилил)пропокси]фенил}имидоформамид и 0-[1-(4-метоксифенокси)-3,3-диметилбутан-2-ил]1Н-имидазол-1-карботиоат.

(2) Ингибиторы дыхательной цепи в комплексе I или II, например, биксафен, боскалид, карбоксин, дифлуметорим, фенфурам, флуопирам, флутоланил, флуксапироксад, фураметпир, фурмециклокс, изопиразам (смесь синэпимерного рацемата 1RS,4SR,9RS и антиэпимерного рацемата 1RS,4SR,9SR), изопиразам (антиэпимерный рацемат 1RS,4SR,9SR), изопиразам (антиэпимерный энантиомер 1R,4S,9S), изопиразам (антиэпимерный энантиомер 1S,4R,9R), изопиразам (синэпимерный рацемат 1RS,4SR,9RS), изопиразам (синэпимерный энантиомер 1R,4S,9R), изопиразам (синэпимерный энантиомер 1S,4R,9S), мепронил, оксикарбоксин, перфлуфен, пентиопирад, седаксан, тифлузамид, 1-метил-N-[2-(1,1,2,2-тетрафтороэтокси)фенил]-3-(трифторометил)-1Н-пиразол-4-карбоксамид, 3-(дифторометил)-1-метил-N-[2-(1,1,2,2-тетрафтороэтокси)фенил]-1Н-пиразол-4-карбоксамид, 3-(дифторометил)-N-[4-фторо-2-(1,1,2,3,3,3-гексафторопропокси)фенил]-1-метил-1Н-пиразол-4-карбоксамид, N-[1-(2,4-дихлорофенил)-1-метоксипропан-2-ил]-3-(дифторометил)-1-метил-1Н-пиразол-4-карбоксамид, 5,8-дифторо-N-[2-(2-фторо-4-{[4-(трифторометил)пиридин-2-ил]окси}фенил)этил]хиназолин-4-амин, N-[9-(дихлорометилен)-1,2,3,4-тетрагидро-1,4-метанонафталин-5-ил]-3-(дифторометил)-1-метил-1Н-пиразол-4-карбоксамид, N-[(1S,4R)-9-(дихлорметилен)-1,2,3,4-тетрагидро-1,4-метанонафталин-5-ил]-3-(дифторометил)-1-метил-1Н-пиразол-4-карбоксамид и N-[(1R,4S)-9-(диxлopoмeтилeн)-1,2,3,4-тетрагидро-1,4-метанонафталин-5-ил]-3-(дифторометил)-1-метил-1Н-пиразол-4-карбоксамид.

(3) Ингибиторы дыхательной цепи в комплексе III, например, аметоктрадин, амисульбром, азоксистробин, циазофамид, куметоксистробин, кумоксистробин, димоксистробин, энестробурин, фамоксадон, фенамидон, феноксистробин, флуоксастробин, крезоксим-метил, метоминостробин, оризастробин, пикоксистробин, пираклостробин, пираметостробин, пираоксистробин, пирибенкарб, трихлопирикарб, трифлоксистробин, (2Е)-2-(2-{[6-(3-хлоро-2-метилфенокси)-5-фторопиримидин-4-ил]окси}фенил)-2-(метоксиимино)-1H-метилэтанамид, (2Е)-2-(метоксиимино)-N-метил-2-(2-{[({(1E)-1-[3-(трифторометил)фенил]этилиден}амино)окси]метил}фенил)этанамид, (2Е)-2-(метоксиимино)-N-метил-2-{2-[(Е)-({1-[3-(трифторометил)фенил]этокси}имино)метил]фенил}этанамид, (2Е)-2-{2-[({[(1Е)-1-(3-{[(E)-1-фторо-2-фенилэтенил]окси}фенил)этилиден]амино}окси)метил]фенил}-2-(метоксиимино)-N-метилэтанамид, (2Е)-2-{2-[({[(2Е,3Е)-4-(2,6-дихлорофенил)бут-3-ен-2-илиден]амино}окси)метил]фенил}-2-(метоксиимино)-n-метилэтанамид, 2-хлоро-N-(1,1,3-триметил-2,3-дигидро-1Н-инден-4-ил)пиридин-3-карбоксамид, 5-метокси-2-метил-4-(2-{[({(1Е)-1-[3-(трифторометил)фенил]этилиден}амино)окси]метил}фенил)-2,4-дигидро-3Н-1,2,4-триазол-3-он, метил (2Е)-2-{2-[({циклопропил[(4-метоксифенил)имино]метил}сульфанил)метил]фенил}-3-метоксипроп-2-еноат, N-(3-этил-3,5,5-триметилциклогексил)-3-(формиламино)-2-гидроксибензамид, 2-{2-[(2,5-диметилфенокси)метил]фенил}-2-метокси-N-метилацетамид и (2R)-2-{2-[(2,5-диметилфенокси)метил]фенил}-2-метокси-N-метилацетамид.

(4) Ингибиторы митоз и деления клеток, например, беномил, карбендазим, хлорфеназол, диэтофенкарб, этабоксам, флуопиколид, фуберидазол, пенцикурон, тиабендазол, тиофанат-метил, тиофанат, зоксамид, 5-хлоро-7-(4-метилпиперидин-1-ил)-6-(2,4,6-трифторофенил)[1,2,4]триазоло[1,5-а]пиримидин и 3-хлоро-5-(6-хлоропиридин-3-ил)-6-метил-4-(2,4,6-трифторофенил)пиразин.

(5) Соединения, которые могут иметь множественное действие, например, бордосская жидкость, каптафол, калган, хлороталонил, гидроксид меди, нафтенат меди, оксид меди, оксихлорид меди, сульфат меди(2+), дихлофлуанид, дитианон, додин, свободное основание додина, фербам, фторофольпет, фольпет, гуазатин, гуазатин ацетат, иминоктадин, иминоктадин албесилат, иминоктадинтриацетат, манмедь, манкозеб, манеб, метирам, метирам цинк, оксин-медь, пропамидин, пропинеб, сера и препараты серы, включющие полисульфид кальция, тирам, толилфлуанид, зинеб и зирам.

(6) Соединения, способные вызывать защиту у хозяина, например, ацибензолар-S-метил, изотианил, пробеназол и тиадинил.

(7) Ингибиторы биосинтеза аминокислот и/или белков, например, андоприм, бластицидин-S, ципродинил, касугамицин, касугамицин гидрохлорид гидрат, мепанипирим, пириметанил и 3-(5-фторо-3,3,4,4-тетраметил-3,4-дигидроизохинолин-1-ил)хинолин.

(8) Ингибиторы выработки АТФ, например, фентинацетат, фентинхлорид, фентингидроксид и силтиофам.

(9) Ингибиторы синтеза клеточных стенок, например, бентиаваликарб, диметоморф, флуморф, ипроваликарб, мандипропамид, полиоксины, полиоксорим, валидамицин А и валифеналат.

(10) Ингибиторы синтеза липидов и мембран, например, бифенил, хлоронеб, дихлоран, эдифенфос, этридиазол, йодокарб, ипробенфос, изопротиолан, пропамокарб, пропамокарб гидрохлорид, протиокарб, пиразофос, хинтозин, текназол и толкофос-метил.

(11) Ингибиторы биосинтеза меланина, например, карпропамид, диклоцимет, феноксанил, фталид, пирохилон, трициклазол и 2,2,2-трифтороэтил {3-метил-1-[(4-метилбензоил)амино]бутан-2-ил}карбамат.

(12) Ингибиторы синтеза нуклеиновых кислот, например, беналаксил, беналаксил-М (киралаксил), бупиримат, клозилакон, диметиримол, этиримол, фуралаксил, гимексазол, металаксил, металаксил-М (мефеноксам), офураце, оксадиксил и оксолиновая кислота.

(13) Ингибиторы трансдукции сигнала, например, хлозолинат, фенпиклонил, флудиоксонил, ипродион, процимидон, хиноксифен и винклозолин.

(14) Соединения способные функционировать в качестве разобщителя, например, бинапакрил, динокап, феримзон, флуазинам и мептилдинокап.

(15) Другие соединения, например, бентиазол, бентоксазин, капсимицин, карвон, хинометионат, пириофенон (хлазафенон), куфранеб, цифлуфенамид, цимоксанил, ципросульфамид, дазомет, дебакарб, дихлорофен, дикломезин, дифензокват, дифензокват метилсульфат, дифениламин, экомат, фенпиразамин, флуметовер, фтороимид, флусульфамид, флутианил, фозетил-алюминий, фозетил-кальций, фозетил-натрий, гексахлоробензол, ирумамицин, метасульфокарб, метилизотиоцианат, метрафенон, милдиомицин, натамицин, диметилдитиокарбамат никеля, нитротал-изопропил, октилинон, оксамокарб, оксифентиин, пентахлорфенол и соли, фенотрин, фосфорная кислота и ее соли, пропамокарб-фозетилат, пропанозин-натрий, прохиназид, пириморф, (2Е)-3-(4-трет-бутилфенил)-3-(2-хлоропиридин-4-ил)-1-(морфолин-4-ил)проп-2-ен-1-он, (2Z)-3-(4-трет-бутилфенил)-3-(2-хлоропиридин-4-ил)-1-(морфолин-4-ил)проп-2-ен-1-он, пирролнитрин, тебуфлоквин, теклофталам, толнифанид, триазоксид, трикламид, зариламид, (3S,6S,7R,8R)-S-бензил-3-[({3-[(изобутирилокси)метокси]-4-метоксипиридин-2-ил}карбонил)амино]-6-метил-4,9-диоксо-1,5-диоксонан-7-ил 2-метилпропаноат, 1-(4-{4-[(5R)-5-(2,6-дифторофенил)-4,5-дигидро-1,2-оксазол-3-ил]-1,3-тиазол-2-ил}пиперидин-1-ил)-2-[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]этанон, 1-(4-{4-[(5S)-5-(2,6-дифторофенил)-4,5-дигидро-1,2-оксазол-3-ил]-1,3-тиазол-2-ил}пиперидин-1-ил)-2-[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]этанон, 1-(4-{4-[5-(2,6-дифторофенил)-4,5-дигидро-1,2-оксазол-3-ил]-1,3-тиазол-2-ил}пиперидин-1-ил)-2-[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]этанон, 1-(4-метоксифенокси)-3,3-диметилбутан-2-ил 1Н-имидазол-1-карбоксилат, 2,3,5,6-тетрахлоро-4-(метилсульфонил)пиридин, 2,3-дибутил-6-хлоротиено[2,3-d]пиримидин-43)-он, 2-[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]-1-(4-{4-[(5R)-5-фенил-4,5-дигидро-1,2-оксазол-3-ил]-1,3-тиазол-2-ил}пиперидин-1-ил)этанон, 2-[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]-1-(4-{4-[(5S)-5-фенил-4,5-дигидро-1,2-оксазол-3-ил]-1,3-тиазол-2-ил}пиперидин-1-ил)этанон, 2-[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]-1-{4-[4-(5-фенил-4,5-дигидро-1,2-оксазол-3-ил)-1,3-тиазол-2-ил]пиперидин-1-ил}этанон, 2-бутокси-6-йодо-3-пропил-4Н-хромен-4-он, 2-хлоро-5-[2-хлоро-1-(2,6-дифторо-4-метоксифенил)-4-метил-1Н-имидазол-5-ил]пиридин, 2-фенилфенол и соли, 3-(4,4,5-трифторо-3,3-диметил-3,4-дигидроизохинолин-1-ил)хинолин, 3,4,5-трихлоропиридин-2,6-дикарботитрил, 3-[5-(4-хлорофенил)-2,3-диметил-1,2-оксазолидин-3-ил]пиридин, 3-хлоро-5-(4-хлорофенил)-4-(2,6-дифторофенил)-6-метилпиразин, 4-(4-хлорофенил)-5-(2,6-дифторофенил)-3,6-диметилпиразин, 5-амино-1,3,4-тиадиазол-2-тиол, 5-хлоро-N'-фенил-N'-(проп-2-ин-1-ил)тиофен-2-сульфоногидразид, 5-фторо-2-[(4-фторобензил)окси]пиримидин-4-амин, 5-фторо-2-[(4-метилбензил)окси]пиримидин-4-амин, 5-метил-6-октил[1,2,4]триазоло[1,5-а]пиримидин-7-амин, этил (2Z)-3-амино-2-циано-3-фенилпроп-2-еноат, N'-(4-{[3-(4-хлоробензил)-1,2,4-тиадиазол-5-ил]окси}-2,5-диметилфенил)-N-этил-N-метилимидоформамид, N-(4-хлоробензил)-3-[3-метокси-4-(проп-2-ин-1-илокси)фенил]пропанамид, N-[(4-хлорофенил)(циано)метил]-3-[3-метокси-4-(проп-2-ин-1-илокси)фенил]пропанамид, N-[(5-бромо-3-хлоропиридин-2-ил)метил]-2,4-дихлоропиридин-3-карбоксамид, N-[1-(5-бромо-3-хлоропиридин-2-ил)этил]-2,4-дихлоропиридин-3-карбоксамид, N-[1-(5-бромо-3-хлоропиридин-2-ил)этил]-2-фторо-4-йодопиридин-3-карбоксамид, N-{(Е)-[(циклопропилметокси)имино][6-(дифторометокси)-2,3-дифторофенил]метил}-2-фенилацетамид, N-{(Z)-[(циклопропилметокси)имино][6-(дифторометокси)-2,3-дифторофенил]метил}-2-фенилацетамид, N'-{4-[(3-трет-бутил-4-циано-1,2-тиазол-5-ил)окси]-2-хлоро-5-метилфенил}-N-этил-N-метилимидоформамид, N-метил-2-(1-{[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]ацетил}пиперидин-4-ил)-N-(1,2,3,4-тетрагидронафталин-1-ил)-1,3-тиазол-4-карбоксамид, N-метил-2-(1-{[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]ацетил}пиперидин-4-ил)-N-[(1R)-1,2,3,4-тетрагидронафталин-1-ил]-1,3-тиазол-4-карбоксамид, N-метил-2-(1-{[5-метил-3-(трифторометил)-1Н-пиразол-1-ил]ацетил}пиперидин-4-ил)-N-[(1S)-1,2,3,4-тетрагидронафталин-1-ил]-1,3-тиазол-4-карбоксамид, пентил{6-[({[(1-метил-1Н-тетразол-5-ил)(фенил)метилиден]амино}окси)метил]пиридин-2-ил}карбамат, феназин-1-карбоновая кислота, хинолин-8-ол, хинолин-8-ол сульфат (2:1) и трет-бутил {6-[({[(1-метил-1Н-тетразол-5-ил)(фенил)метилен]амино} окси)метил] пиридин-2-ил}карбамат.

(16) Другие соединения, например, 1-метил-3-(трифторометил)-N-[2'-(трифторометил)бифенил-2-ил]-1Н-пиразол-4-карбоксамид, N-(4'-хлоробифенил-2-ил)-3-(дифторометил)-1-метил-1Н-пиразол-4-карбоксамид, N-(2',4'-дихлоробифенил-2-ил)-3-(дифторометил)-1-метил-1Н-пиразол-4-карбоксамид, 3-(дифторометил)-1-метил-N-[4'-(трифторометил)бифенил-2-ил]-1Н-пиразол-4-карбоксамид, N-(2',5'-дифторобифенил-2-ил)-1-метил-3-(трифторометил)-1Н-пиразол-4-карбоксамид, 3-(дифторометил)-1-метил-N-[4'-(проп-1-ин-1-ил)бифенил-2-ил]-1Н-пиразол-4-карбоксамид, 5-фторо-1,3-диметил-N-[4'-(проп-1-ин-1-ил)бифенил-2-ил]-1Н-пиразол-4-карбоксамид, 2-хлоро-N-[4'-(проп-1-ин-1-ил)бифенил-2-ил]пиридин-3-карбоксамид, 3-(дифторометил)-N-[4'-(3,3-диметилбут-1-ин-1-ил)бифенил-2-ил]-1-метил-1Н-пиразол-4-карбоксамид, N-[4'-(3,3-диметилбут-1-ин-1-ил)бифенил-2-ил]-5-фторо-1,3-диметил-1Н-пиразол-4-карбоксамид, 3-(дифторометил)-N-(4'-этинилбифенил-2-ил)-1-метил-1Н-пиразол-4-карбоксамид, N-(4'-этинилбифенил-2-ил)-5-фторо-1,3-диметил-1Н-пиразол-4-карбоксамид, 2-хлоро-N-(4'-этинилбифенил-2-ил)пиридин-3-карбоксамид, 2-хлоро-N-[4'-(3,3-диметилбут-1-ин-1-ил)бифенил-2-ил]пиридин-3-карбоксамид, 4-(дифторометил)-2-метил-N-[4'-(трифторометил)бифенил-2-ил]-1,3-тиазол-5-карбоксамид, 5-фторо-N-[4'-(3-гидрокси-3-метилбут-1-ин-1-ил)бифенил-2-ил]-1,3-диметил-1Н-пиразол-4-карбоксамид, 2-хлоро-N-[4'-(3-гидрокси-3-метилбут-1-ин-1-ил)бифенил-2-ил]пиридин-3-карбоксамид, 3-(дифторометил)-N-[4'-(3-метокси-3-метилбут-1-ин-1-ил)бифенил-2-ил]-1-метил-1Н-пиразол-4-карбоксамид, 5-фторо-N-[4'-(3-метокси-3-метилбут-1-ин-1-ил)бифенил-2-ил]-1,3-диметил-1Н-пиразол-4-карбоксамид, 2-хлоро-N-[4'-(3-метокси-3-метилбут-1-ин-1-ил)бифенил-2-ил]пиридин-3-карбоксамид, (5-бромо-2-метокси-4-метилпиридин-3-ил)(2,3,4-триметокси-6-метилфенил)метанон, N-[2-(4-{[3-(4-хлорофенил)проп-2-ин-1-ил]окси}-3-метоксифенил)этил]-N2-(метилсульфонил) валинамид, 4-оксо-4-[(2-фенилэтил)амино]бутановая кислота и бут-3-ин-1-ил{6-[({[(Z)-(1-метил-1Н-тетразол-5-ил)(фенил)метилен]амино}окси)метил]пиридин-2-ил}карбамат и их комбинации. Инсектициды, акарициды и нематициды:

(1) Ингибиторы ацетилхолинэстеразы (AChE), например, карбаматы, например, Аланикарб, Альдикарб, Бендиокарб, Бенфуракарб, Бутокарбоксим, Бутоксикарбоксим, Карбарил, Карбофуран, Карбосульфан, Этиофенкарб, Фенобукарб, Форметанат, Фуратиокарб, Изопрокарб, Метиокарб, Метомил, Метолкарб, Оксамил, Пиримикарб, Пропоксур, Тиодикарб, Тиофанокс, Триазамат, Триметакарб, ХМС и Ксилилкарб; или органофосфаты, например, Ацефат, Азаметифос, Азинфос-этил, Азинфос-метил, Кадусафос, Хлорэтоксифос, Хлорфенвинфос, Хлормефос, Хлорпирифос, Хлорпирифос-метил, Каумафос, Цианофос, Деметон-S-метил, Диазинон, Дихлорфос/DDVP, Дикротофос, Диметоат, Диметилвинфос, Дисульфотон, EPN, Этион, Этопрофос, Фамфур, Фенамифос, Фенитротион, Фентион, Фостиазат, Гептенофос, Имициафос, Изофенфос, Изопропил O-(метоксиаминотио-фосфорил) салицилат, Изоксатион, Малатион, Мекарбам, Метамидофос, Метидатион, Мевинфос, Монокротофос, Налед, Ометоат, Оксидеметон-метил, Паратион, Паратион-метил, Фентоат, Форат, Фосалон, Фосмет, Фосфамидон, Фоксим, Пиримифос-метил, Профенофос, Пропетамфос, Протиофос, Пираклофос, Пиридафентион, Хиналфос, Сульфотеп, Тебупиримифос, Темефос, Тербуфос, Тетрахлорвинфос, Тиометон, Триазофос, Трихлорфон и Вамидотион.

(2) Антагонисты ГАМК-зависимых хлоридных каналов, например, хлорорганические циклодиены, например, Хлордан и Эндосульфан; или фенилпиразолы (фипролы), например, Этипрол и Фипронил.

(3) Модуляторы натриевых каналов / потенциал-зависимые блокаторы натриевых каналов, например, пиретроиды, например, Акринатрин, Аллетрин, d-цис-транс-аллетрин, d-транс-аллетрин, Бифентрин, Биоаллетрин, Биоаллетрин S-циклофентенил, Биоресметрин, Циклопротрин, Цифлутрин, бета-Цифлутрин, Цигалотрин, лямбда-Цигалотрин, гамма-Цигалотрин, Циперметрин, альфа-Циперметрин, бета-Циперметрин, тета-Циперметрин, дзета-Циперметрин, Цифенотрин [(1R)-транс-изомеры], Дельтаметрин, Эмпентрин [(EZ)-(1R) изомеры), Эсфенвалерат, Этофенпрокс, Фенпропатрин, Фенвалерат, Флуцитринат, Флуметрин, тау-Флувалинат, Галфенпрокс, Имипротрин, Кадетрин, Перметрин, Фенотрин [(1R)-транс-изомер), Праллетрин, Пиретрин (пиретрум), Ресметрин, Силафлуофен, Тефлутрин, Тетраметрин, Тетраметрин [(1R) изомеры)], Тралометрин и Трансфлутрин; или DDT; или Метоксихлор.

(4) Агонисты никотинового ацетилхолинового рецептора (nAChR), например, неоникотиноиды, например, Ацетамиприд, Клотианидин, Динотефуран, Имидаклоприд, Нитенпирам, Тиаклоприд и Тиаметоксам; или Никотин.

(5) Аллостерические активаторы никотинового ацетилхолинового рецептора (nAChR), например, спинозины, например, Спинеторам и Спиносад.

(6) Активаторы хлоридных каналов, например, авермектины/милбемицины, например, Абамектин, Эмамектин бензоат, Лепимектин и Милбемектин.

(7) Имитаторы ювенильных гормонов, например, аналоги ювенильных гормонов, например, Гидропрен, Кинопрен и Метопрен; или Феноксикарб; или Пирипроксифен.

(8) Разные неспецифические (универсальные) ингибиторы, например, алкилгалогениды, например, метилбромид и другие алкилгалогениды; или хлорпикрин; или сульфурилфторид; или бура; или антимонилтартрат калия.

(9) Избирательные блокаторы питания равнокрылых, например, Пиметрозин; или Флоникамид.

(10) Ингибиторы роста клещей, например, Клофентезин, Гекситиазокс и Дифловидазин; или Этоксазол.

(11) Микробные разрушители мембран кишечника насекомых, например, Bacillus thuringiensis подвида israelensis, Bacillus sphaericus, Bacillus thuringiensis подвида aizawai, Bacillus thuringiensis подвида kurstaki, Bacillus thuringiensis подвида tenebrionis и белки культур ВТ: Cry1Ab, Cry1Ac, Cry1Fa, Cry2Ab, mCry3A, Cry3Ab, Cry3Bb, Cry34/35Ab1.

(12) Ингибиторы митохондриальной АТФ-синтазы, например, Диафентиурон; или оловоорганические акарициды, например, Азоциклотин, Цигексатин и Фенбутатин оксид; или Пропаргит; или Тетрадифон.

(13) Разобщители окислительного фосфорилирования через разрыв градиента протонов, например, Хлорфенапир, DNOC и Сульфурамид.

(14) Блокаторы каналов никотинового ацетилхолинового рецептора (nAChR), например, Бенсультап, Картап гидрохлорид, Тиоциклам, Тиосультап-натрий.

(15) Ингибиторы биосинтеза хитина, тип 0, например, Бистрифлурон, Хлорфлуазурон, Дифлубензурон, Флуциклоксурон, Флуфеноксурон, Гексафлумурон, Луфенурон, Новалурон, Новифлумурон, Тефлубензурон и Трифлумурон.

(16) Ингибиторы биосинтеза хитина, тип 1, например, Бупрофезин.

(17) Соединения, нарушающие линьку, например, Циромазин.

(18) Агонисты рецепторов экдизона, например, Хромафенозид, Галофенозид, Метоксифенозид и Тебуфенозид.

(19) Агонисты рецепторов октопамина, например, Амитраз.

(20) Ингибиторы переноса электронов митохондриального комплекса III, например, Гидраметилнон; или Ацехиноцил; или Флуациприм.

(21) Ингибиторы переноса электронов митохондриального комплекса I, например, акарициды METI, например, Феназахин, Фенпироксимат, Пиримидифен, Пиридабен, Тебуфенпирад и Толфенпирад; или Ротенон (деррис).

(22) Потенциал-зависимые блокаторы натриевых каналов, например, Индоксакарб или Метафлумизон.

(23) Ингибиторы ацетил-СоА-карбоксилазы, например, производные тетроновой и тетрамовой кислоты, например, Спиродиклофен, Спиромесифен и Спиротетрамат.

(24) Ингибиторы переноса электронов митохондриального комплекса IV, например, фосфины, например, фосфид алюминия, фосфид кальция, фосфин и фосфид цинка; или Цианид.

(25) Ингибиторы переноса электронов митохондриального комплекса II, например, Циенопирафен.

(28) Модуляторы рианодинового рецептора, например, диамиды, например, Хлорантранилипрол и Флубендиамид.

Другие активные ингредиенты с неизвестным или неопределенным способом действия, например, Амидофлумет, Азадирахтин, Бенклотиаз, Бензоксимат, Бифеназат, Бромопропилат, Хинометионат, Криолит, Циантранилипрол (Циазипир), Цифлуметофен, Дикофол, Дифловидазин, Флуенсульфон, Флуфенерим, Флуфипрол, Флуопирам, Флуфенозид, Имидаклотиз, Ипродион, Меперфлутрин, Пиридалил, Пирифлухиназон, Тетраметилфлутрин и йодометан; а также продукты на основе Bacillus firmus (включая, помимо прочих, штамм CNCM I-1582, такие, как, например, VOTiVOтм, BioNem) или одно из следующих известных активных соединений: 3-бромо-N-{2-бромо-4-хлоро-6-[(1-циклопропилэтил)карбамоил]фенил}-1-(3-хлоропиридин-2-ил)-1Н-пиразол-5-карбоксамид (известный из документа WO 2005/077934), 4-{[(6-бромопиридин-3-ил)метил](2-фтороэтил)амино}фуран-2(5Н)-он (известный из документа WO 2007/115644), 4-{[(6-фторопиридин-3-ил)метил](2,2-дифтороэтил)амино}фуран-2(5Н)-он (известный из документа WO 2007/115644), 4-{[(2-хлоро-1,3-тиазол-5-ил)метил](2-фтороэтил)амино}фуран-2(5Н)-он (известный из документа WO 2007/115644), 4-{[(6-хлоропиридин-3-ил)метил] (2-фтороэтил)амино}фуран-2(5Н)-он (известный из документа WO 2007/115644), Флупирадифурон, 4-{[(6-хлор-5-фторопиридин-3-ил)метил](метил)амино}фуран-2(5Н)-он (известный из документа WO 2007/115643), 4-{[(5,6-дихлоропиридин-3-ил)метил](2-фтороэтил)амино}фуран-2(5Н)-он (известный из документа WO 2007/115646), 4-{[(6-хлоро-5-фторопиридин-3-ил)метил](циклопропил)амино}фуран-2(5Н)-он (известный из документа WO 2007/115643), 4-{[(6-хлоропиридин-3-ил)метил](циклопропил)амино}фуран-2(5Н)-он (известный из документа ЕР-А-0539588), 4-{[(6-хлорпиридин-3-ил)метил](метил)амино}фуран-2(5Н)-он (известный из документа ЕР-А-0539588), {[1-(6-хлоропиридин-3-ил)этил](метил)оксидо-λ4-сульфанилиден} цианамид (известный из документа WO 2007/149134) и его диастереомеры {[(1R)-1-(6-хлоропиридин-3-ил)этил](метил)оксидо-λ4-сульфанилиден} цианамид (А) и {[(1S)-1-(6-хлоропиридин-3-ил)этил](метил)оксидо-λ4-сульфанилиден} цианамид (В) (также известный из документа WO 2007/149134), а также Сульфоксафлор и его диастереомеры [(R)-метил(оксидо){(1R)-1-[6-(трифторометил)пиридин-3-ил]этил}-λ4-сульфанилиден]цианамид (А1) и [(S)-метил(оксидо){(1S)-1-[6-(трифторометил)пиридин-3-ил]этил}-λ4-сульфанилиден]цианамид (А2), указываемый как группа диастереомеров А (известный из WO 2010/074747, WO 2010/074751), [(R)-метил(оксидо){(1S)-1-[6-(трифторометил)пиридин-3-ил]этил}-λ4-сульфанилиден]цианамид (В1) и [(S)-метил(оксидо){(1R)-1-[6-(трифторометил)пиридин-3-ил]этил}-λ4-сульфанилиден]цианамид (В2), указываемый как группа диастереомеров В (также известный из документов WO 2010/074747, WO 2010/074751), и 11-(4-хлоро-2,6-диметилфенил)-12-гидрокси-1,4-диокса-9-азадиспиро[4.2.4.2]тетрадец-11-ен-10-он (известный из документа WO 2006/089633), 3-(4'-фторо-2,4-диметилбифенил-3-ил)-4-гидрокси-8-окса-1-азаспиро[4.5]дец-3-ен-2-он (известный из документа WO 2008/067911), 1-{2-фторо-4-метил-5-[(2,2,2-трифторэтил)сульфинил]фенил}-3-(трифторометил)-1Н-1,2,4-триазол-5-амин (известный из документа WO 2006/043635), [(3S,4aR,12R,12aS,12bS)-3-[(циклопропилкарбонил)окси]-6,12-дигидрокси-4,12b-диметил-11-оксо-9-(пиридин-3-ил)-1,3,4,4а,5,6,6а, 12,12а,12b-декагидро-2Н,11Н-бензо[f]пирано[4,3-b]хромен-4-ил]метил циклопропанкарбоксилат (известный из документа WO 2008/066153), 2-циано-3-(дифторометокси)-N,N-диметилбензолсульфонамид (известный из документа WO 2006/056433), 2-циано-3-(дифторометокси)-N-метилбензолсульфонамид (известный из документа WO 2006/100288), 2-циано-3-(дифторометокси)-N-этилбензолсульфонамид (известный из документа WO 2005/035486), 4-(дифторометокси)-N-этил-N-метил-1,2-бензотиазол-3-амин 1,1-диоксид (известный из документа WO 2007/057407), N-[1-(2,3-диметилфенил)-2-(3,5-диметилфенил)этил]-4,5-дигидро-1,3-тиазол-2-амин (известный из документа WO 2008/104503), {1'-[(2Е)-3-(4-хлорофенил)проп-2-ен-1-ил]-5-фтороспиро [индол-3,4'-пиперидин]-1(2Н)-ил}(2-хлоропиридин-4-ил)метанон (известный из документа WO 2003/106457), 3-(2,5-диметилфенил)-4-гидрокси-8-метокси-1,8-диазаспиро[4.5]дец-3-ен-2-он (известный из документа WO 2009/049851), 3-(2,5-диметилфенил)-8-метокси-2-оксо-1,8-диазаспиро[4.5]дец-3-ен-4-ил этилкарбонат (известный из документа WO 2009/049851), 4-(бут-2-ин-1-илокси)-6-(3,5-диметилпиперидин-1-ил)-5-фторопиримидин (известный из документа WO 2004/099160), (2,2,3,3,4,4,5,5-октафторопентил)(3,3,3-трифторопропил)малононитрил (известный из документа WO 2005/063094), (2,2,3,3,4,4,5,5-октафторопентил)(3,3,4,4,4-пентафторобутил)малононитрил (известный из документа WO 2005/063094), 8-[2-(циклопропилметокси)-4-(трифторометил)фенокси]-3-[6-(трифторометил)пиридазин-3-ил]-3-азабицикло[3.2.1]октан (известный из документа WO 2007/040280), Флометоквин, PF1364 (CAS-Reg.No. 1204776-60-2) (известный из документа JP 2010/018586), 5-[5-(3,5-дихлорофенил)-5-(трифторометил)-4,5-дигидро-1,2-оксазол-3-ил]-2-(1Н-1,2,4-триазол-1-ил)бензонитрил (известный из документа WO 2007/075459), 5-[5-(2-хлоропиридин-4-ил)-5-(трифторометил)-4,5-дигидро-1,2-оксазол-3-ил]-2-(1Н-1,2,4-триазол-1-ил)бензонитрил (известный из документа WO 2007/075459), 4-[5-(3,5-дихлорофенил)-5-(трифторометил)-4,5-дигидро-1,2-оксазол-3-ил]-2-метил-N-{2-оксо-2-[(2,2,2-трифтороэтил)амино]этил}бензамид (известный из документа WO 2005/085216), 4-{[(6-хлоропиридин-3-ил)метил](циклопропил)амино}-1,3 -оксазол-2(5Н)-он, 4-{[(6-хлоропиридин-3-ил)метил](2,2-дифтороэтил)амино}-1,3-оксазол-2(5Н)-он, 4-{[(6-хлоропиридин-3-ил)метил](этил)амино}-1,3-оксазол-2(5Н)-он, 4-{[(6-хлоропиридин-3-ил)метил](метил)амино}-1,3-оксазол-2(5Н)-он (все известные из документа WO 2010/005692), NNI-0711 (известный из документа WO 2002/096882), 1-ацетил-N-[4-(1,1,1,3,3,3-гексафторо-2-метоксипропан-2-ил)-3-изобутилфенил]-N-изобутирил-3,5-диметил-1Н-пиразол-4-карбоксамид (известный из документа WO 2002/096882), метил 2-[2-({[3-бромо-1-(3-хлоропиридин-2-ил)-1Н-пиразол-5-ил]карбонил}амино)-5-хлоро-3-метилбензоил]-2-метилгидразинкарбоксилат (известный из документа WO 2005/085216), метил 2-[2-({[3-бромо-1-(3-хлоропиридин-2-ил)-1Н-пиразол-5-ил]карбонил}амино)-5-циано-3-метилбензоил]-2-этилгидразинкарбоксилат (известный из документа WO 2005/085216), метил 2-[2-({[3-бромо-1-(3-хлоропиридин-2-ил)-1Н-пиразол-5-ил]карбонил}амино)-5-циано-3-метилбензоил]-2-метилгидразинкарбоксилат (известный из документа WO 2005/085216), метил 2-[3,5-дибромо-2-({[3-бромо-1-(3-хлоропиридин-2-ил)-1Н-пиразол-5-ил]карбонил}амино)бензоил]-1,2-диэтилгидразинкарбоксилат (известный из документа WO 2005/085216), метил 2-[3,5-дибромо-2-({[3-бромо-1-(3-хлоропиридин-2-ил)-1Н-пиразол-5-ил]карбонил}амино)бензоил]-2-этилгидразинкарбоксилат (известный из документа WO 2005/085216), (5RS,7RS;5RS,7SR8К)-1-(6-хлоро-3-пиридилметил)-1,2,3,5,6,7-гексагидро-7-метил-S-нитро-5-пропоксиимидазо[1,2-а]пиридин (известный из документа WO 2007/101369), 2-{6-[2-(5-фторопиридин-3-ил)-1,3-тиазол-5-ил]пиридин-2-ил}пиримидин (известный из документа WO 2010/006713), 2-{6-[2-(пиридин-3-ил)-1,3-тиазол-5-ил]пиридин-2-ил}пиримидин (известный из документа WO 2010/006713), 1-(3-хлоропиридин-2-ил)-N-[4-циано-2-метил-6-(метилкарбамоил)фенил]-3-{[5-(трифторометил)-1Н-тетразол-1-ил]метил}-1Н-пиразол-5-карбоксамид (известный из документа WO 2010/069502), 1-(3-хлоропиридин-2-ил)-N-[4-циано-2-метил-6-(метилкарбамоил)фенил]-3-{[5-(трифторометил)-2Н-тетразол-2-ил]метил}-1Н-пиразол-5-карбоксамид (известный из документа WO 2010/069502), N-[2-(трет-бутилкарбамоил)-4-циано-6-метилфенил]-1-(3-хлоропиридин-2-ил)-3-{[5-(трифторометил)-1Н-тетразол-1-ил]метил}-1Н-пиразол-5-карбоксамид (известный из документа WO 2010/069502), N-[2-(трет-бутилкарбамоил)-4-циано-6-метилфенил]-1-(3-хлоропиридин-2-ил)-3-{[5-(трифторометил)-2Н-тетразол-2-ил]метил}-1Н-пиразол-5-карбоксамид (известный из документа WO 2010/069502), (1Е)-Н-[(6-хлоропиридин-3-ил)метил]-N-циано-N-(2,2-дифтороэтил)этанимидамид (известный из документа WO 2008/009360), N-[2-(5-амино-1,3,4-тиадиазол-2-ил)-4-хлоро-6-метилфенил]-3-бромо-1-(3-хлоропиридин-2-ил)-1Н-пиразол-5-карбоксамид (известный из документа CN 102057925), и метил 2-[3,5-дибромо-2-({[3-бромо-1-(3-хлоропиридин-2-ил)-1Н-пиразол-5-ил]карбонил}амино)бензоил]-2-этил-1-метил гидразинкарбокси лат (известный из документа WO 2011/049233) и их комбинации.

Предпочтительными партнерами по комбинации из группы инсектицидов являются имидаклоприд и спиротетрамат.

Питательные микроэлементы и содержащие питательные микроэлементы соединения:

В контексте настоящего изобретения питательными микроэлементами и содержащими питательные микроэлементы соединениями являются соединения, выбранные из группы, к которой относятся активные ингредиенты, содержащие как минимум один ион металла, выбранный из группы, к которой относятся цинк, марганец, молибден, железо и медь или питательный микроэлемент бор. В более предпочтительном варианте эти питательные микроэлементы и содержащие питательные микроэлементы соединения выбирают из группы, к которой относятся цинкосодержащие соединения Пропинеб, Полиоксин Z (соль цинка), цинеб, цирам, цинк тиодазол, нафтенат цинка и манкозеб (также содержащий марганец), марганецсодержащие соединения манеб, метирам и манмедь (также содержащий медь), железосодержащее соединение фербам, медь (Cu) и медьсодержащие соединения бордосская жидкость, бургундская жидкость, Cheshunt mixture, оксихлорид меди, сульфат меди, основный сульфат меди (например, трехосновный сульфат меди), оксид меди, октаноат меди, гидроксид меди, оксин-медь, ацетат меди-аммония, нафтенат меди, хелатная медь (например, в форме аминокислотных хелатов), манмедь, аципетакс-медь, ацетат меди, основный карбонат меди, олеат меди, силикат меди, хромат меди-цинка, куфранеб, купробам, saisentong, тиодиазол-медь и их комбинации.

В более предпочтительном варианте питательные микроэлементы и содержащие питательные микроэлементы соединения выбирают из группы, к которой относятся (4.1) медь (Си), (4.2) гидроксид меди, (4.3) сульфат меди, (4.4) оксихлорид меди, (4.5) Пропинеб и (4.6) Манкозеб. В еще более предпочтительном варианте питательные микроэлементы и содержащие питательные микроэлементы соединения выбирают из группы, к которой относятся (4.2) гидроксид меди, (4.3) сульфат меди и (4.5) Пропинеб.

Липохитоолигосахаридные соединения (LCO) (5).

Предпочтительным партнером по комбинации из группы фунгицидов является (2.1) фозетил-Аl (фозетил-алюминий). Еще одним предпочтительным партнером по комбинации из группы фунгицидов является (2.2) перфлуфен.

Другие предпочтительные партнеры по комбинации из группы фунгицидов выбирают из стробилуринов, фунгицидов, относящихся к группе ингибиторов дыхательной цепи в комплексе III, таких, как, например, (3.1) аметоктрадин, (3.2) амисульбром, (3.3) азоксистробин, (3.4) циазофамид, (3.5) куметоксистробин, (3.6) кумоксистробин, (3.7) димоксистробин, (3.8) энестробурин (документ WO 2004/058723), (3.9) фамоксадон (документ WO 2004/058723), (3.10) фенамидон (документ WO 2004/058723), (3.11) феноксистробин, (3.12) флуоксастробин (документ WO 2004/058723), (3.13) крезоксим-метил (документ WO 2004/058723), (3.14) метоминостробин (документ WO 2004/058723), (3.15) оризастробин (документ WO 2004/058723), (3.16) пикоксистробин (документ WO 2004/058723), (3.17) пираклостробин (документ WO 2004/058723), (3.18) пираметостробин (документ WO 2004/058723), (3.19) пираоксистробин (документ WO 2004/058723), (3.20) пирибенкарб (документ WO 2004/058723), (3.21) трихлопирикарб, (3.22) трифлоксистробин (документ WO 2004/058723), (3.23) (2Е)-2-(2-{[6-(3-хлоро-2-метилфенокси)-5-фторопиримидин-4-ил]окси}фенил)-2-(метоксиимино)-N-метилэтанамид (документ WO 2004/058723), (3.24) (2Е)-2-(метоксиимино)-N-метил-2-(2-{[({(1Е)-1-[3-(трифторометил)фенил]этилиден}амино)окси]метил}фенил)этанамид (документ WO 2004/058723), (3.25) (2Е)-2-(метоксиимино)-N-метил-2-{2-[(Е)-({1-[3-(трифторометил)фенил]этокси}имино)метил]фенил}этанамид (158169-73-4), (3.26) (2Е)-2-{2-[({[(1Е)-1-(3-{[(Е)-1-фторо-2-фенилэтенил]окси}фенил)этилиден]амино}окси)метил]фенил}-2-(метоксиимино)-N-метилэтанамид (326896-28-0), (3.27) (2Е)-2-{2-[({[(2Е,3Е)-4-(2,6-дихлорофенил)бут-3-ен-2-илиден]амино}окси)метил]фенил}-2-(метоксиимино)-N-метилэтанамид, (3.28) 2-хлоро-N-(1,1,3-триметил-2,3-дигидро-1Н-инден-4-ил)пиридин-3-карбоксамид (119899-14-8), (3.29) 5-метокси-2-метил-4-(2-{[({(1Е)-1-[3-(трифторометил)фенил]этилиден}амино)окси]метил}фенил)-2,4-дигидро-3Н-1,2,4-триазол-3-он, (3.30) метил (2Е)-2-{2-[({циклопропил[(4-метоксифенил)имино]метил}сульфанил)метил]фенил}-3-метоксипроп-2-еноат, (3.31) N-(3-этил-3,5,5-триметилциклогексил)-3-(формиламино)-2-гидроксибензамид, (3.32) 2-{2-[(2,5-диметилфенокси)метил]фенил}-2-метокси-N-метилацетамид и (3.33) (2R)-2-{2-[(2,5-диметилфенокси)метил]фенил}-2-метокси-N-метилацетамид. Согласно более предпочтительному варианту осуществления настоящего изобретения, партнеры по комбинации из группы стробилуриновых фунгицидов выбирают из (3.3) азоксистробина и (3.22) трифлоксистробина.

Предпочтительный партнер по комбинации из группы антибиотиков выбирают из группы, к которой относятся (6.1) касугамицин, (6.2) стрептомицин и (6.3) окситетрациклин.

Согласно настоящему изобретению, предпочтение отдается следующим двойным комбинациям, выбранным из группы, к которой относятся:

(1.1)+(2.1), (1.2)+(2.1), (1.3)+(2.1), (1.4)+(2.1),

(1.1)+(2.2), (1.2)+(2.2), (1.3)+(2.2), (1.4)+(2.2),

(1.1)+(3.1), (1.1)+(3.2), (1.1)+(3.3), (1.1)+(3.4), (1.1)+(3.5), (1.1)+(3.6), (1.1)+(3.7), (1.1)+(3.8), (1.1)+(3.9), (1.1)+(3.10), (1.1)+(3.11), (1.1)+(3.12), (1.1)+(3.13), (1.1)+(3.14), (1.1)+(3.15), (1.1)+(3.16), (1.1)+(3.17), (1.1)+(3.18), (1.1)+(3.19), (1.1)+(3.20), (1.1)+(3.21), (1.1)+(3.22), (1.1)+(3.23), (1.1)+(3.24), (1.1)+(3.25), (1.1)+(3.26), (1.1)+(3.27), (1.1)+(3.28), (1.1)+(3.29), (1.1)+(3.30), (1.1)+(3.31), (1.1)+(3.32), (1.1)+(3.33),

(1.2)+(3.1), (1.2)+(3.2), (1.2)+(3.3), (1.2)+(3.4), (1.2)+(3.5), (1.2)+(3.6), (1.2)+(3.7), (1.2)+(3.8), (1.2)+(3.9), (1.2)+(3.10), (1.2)+(3.11), (1.2)+(3.12), (1.2)+(3.13), (1.2)+(3.14), (1.2)+(3.15), (1.2)+(3.16), (1.2)+(3.17), (1.2)+(3.18), (1.2)+(3.19), (1.2)+(3.20), (1.2)+(3.21), (1.2)+(3.22), (1.2)+(3.23), (1.2)+(3.24), (1.2)+(3.25), (1.2)+(3.26), (1.2)+(3.27), (1.2)+(3.28), (1.2)+(3.29), (1.2)+(3.30), (1.2)+(3.31), (1.2)+(3.32), (1.2)+(3.33),

(1.3)+(3.1), (1.3)+(3.2), (1.3)+(3.3), (1.3)+(3.4), (1.3)+(3.5), (1.3)+(3.6), (1.3)+(3.7), (1.3)+(3.8), (1.3)+(3.9), (1.3)+(3.10), (1.3)+(3.11), (1.3)+(3.12), (1.3)+(3.13), (1.3)+(3.14), (1.3)+(3.15), (1.3)+(3.16), (1.3)+(3.17), (1.3)+(3.18), (1.3)+(3.19), (1.3)+(3.20), (1.3)+(3.21), (1.3)+(3.22), (1.3)+(3.23), (1.3)+(3.24), (1.3)+(3.25), (1.3)+(3.26), (1.3)+(3.27), (1.3)+(3.28), (1.3)+(3.29), (1.3)+(3.30), (1.3)+(3.31), (1.3)+(3.32), (1.3)+(3.33),

(1.4)+(3.1), (1.4)+(3.2), (1.4)+(3.3), (1.4)+(3.4), (1.4)+(3.5), (1.4)+(3.6), (1.4)+(3.7), (1.4)+(3.8), (1.4)+(3.9), (1.4)+(3.10), (1.4)+(3.11), (1.4)+(3.12), (1.4)+(3.13), (1.4)+(3.14), (1.4)+(3.15), (1.4)+(3.16), (1.4)+(3.17), (1.4)+(3.18), (1.4)+(3.19), (1.4)+(3.20), (1.4)+(3.21), (1.4)+(3.22), (1.4)+(3.23), (1.4)+(3.24), (1.4)+(3.25), (1.4)+(3.26), (1.4)+(3.27), (1.4)+(3.28), (1.4)+(3.29), (1.4)+(3.30), (1.4)+(3.31), (1.4)+(3.32), (1.4)+(3.33),

(1.1)+(4.1), (1.1)+(4.2), (1.1)+(4.3), (1.2)+(4.1), (1.2)+(4.2), (1.2)+(4.3), (1.3)+(4.1), (1.3)+(4.2), (1.3)+(4.3), (1.4)+(4.1), (1.4)+(4.2), (1.4)+(4.3), (1.1)+(4.4), (1.1)+(4.5), (1.1)+(4.6), (1.2)+(4.4), (1.2)+(4.5), (1.2)+(4.6), (1.3)+(4.4), (1.3)+(4.5), (1.3)+(4.6), (1.4)+(4.4), (1.4)+(4.5), (1.4)+(4.6),

(1.1)+(5), (1.2)+(5), (1.3)+(5), (1.4)+(5),

(1.1)+(6.1), (1.1)+(6.2), (1.1)+(6.3), (1.2)+(6.1), (1.2)+(6.2), (1.2)+(6.3), (1.3)+(6.1), (1.3)+(6.2), (1.3)+(6.3), (1.4)+(6.1), (1.4)+(6.2), (1.4)+(6.3).

Из них еще более предпочтительными являются следующие комбинации:

(1.1)+(2.1), (1.2)+(2.1), (1.3)+(2.1), (1.4)+(2.1), (1.1)+(2.2), (1.2)+(2.2), (1.3)+(2.2), (1.4)+(2.2), (1.1)+(3.3), (1.1)+(3.22), (1.2)+(3.3), (1.2)+(3.22), (1.3)+(3.3), (1.3)+(3.22), (1.4)+(3.3), (1.4)+(3.22), (1.1)+(4.2), (1.2)+(4.2), (1.3)+(4.2), (1.4)+(4.2), (1.1)+(4.3), (1.2)+(4.3), (1.3)+(4.3), (1.4)+(4.3), (1.1)+(4.5), (1.2)+(4.5), (1.3)+(4.5), (1.4)+(4.5), (1.1)+(5), (1.2)+(5), (1.3)+(5), (1.4)+(5), (1.1)+(6.1), (1.2)+(6.1), (1.3)+(6.1), (1.4)+(6.1), (1.1)+(6.2), (1.2)+(6.2), (1.3)+(6.2), (1.4)+(6.2), (1.1)+(6.3), (1.2)+(6.3), (1.3)+(6.3), (1.4)+(6.3).

Из них еще более предпочтительными являются следующие комбинации:

(1.1)+(2.1), (1.2)+(2.1), (1.1)+(2.2), (1.2)+(2.2), (1.1)+(3.3), (1.1)+(3.22), (1.2)+(3.3), (1.2)+(3.22), (1.1)+(4.2), (1.2)+(4.2), (1.1)+(4.3), (1.2)+(4.3), (1.1)+(4.5), (1.2)+(4.5), (1.1)+(5), (1.2)+(5), (1.1)+(6.1), (1.2)+(6.1), (1.1)+(6.2), (1.2)+(6.2), (1.1)+(6.3), (1.2)+(6.3).

Наибольшее предпочтение отдается следующим комбинациям:

(1.2)+(2.1), (1.2)+(2.2), (1.2)+(3.3), (1.2)+(3.22), (1.2)+(4.2), (1.2)+(4.3), (1.2)+(4.5), (1.2)+(5), (1.2)+(6.1), (1.2)+(6.2), (1.2)+(6.3).

Из них комбинация (1.2)+(2.1) является наиболее предпочтительной.

Все вышеупомянутые двойные комбинации могут сочетаться с как минимум еще одним известным бактерицидом, антибиотиком, фунгицидом, акарицидом, нематицидом, гербицидом, инсектицидом, питательными микроэлементами и содержащим питательный микроэлемент соединением, антидотом, липохитоолигосахаридами (LCO), продуктом, улучшающим почву или продуктом, снижающим стресс растений, например, Myconate, например, с целью расширения спектра действия или предотвращения развития резистентности.

Согласно настоящему изобретению, предпочтение отдается следующим тройным комбинациям, выбранным из группы, к которой относятся:

(1.1)+(2.1)+(3.1), (1.1)+(2.1)+(3.2), (1.1)+(2.1)+(3.3), (1.1)+(2.1)+(3.4), (1.1)+(2.1)+(3.5), (1.1)+(2.1)+(3.6), (1.1)+(2.1)+(3.7), (1.1)+(2.1)+(3.8), (1.1)+(2.1)+(3.9), (1.1)+(2.1)+(3.10), (1.1)+(2.1)+(3.11), (1.1)+(2.1)+(3.12), (1.1)+(2.1)+(3.13), (1.1)+(2.1)+(3.14), (1.1)+(2.1)+(3.15), (1.1)+(2.1)+(3.16), (1.1)+(2.1)+(3.17), (1.1)+(2.1)+(3.18), (1.1)+(2.1)+(3.19), (1.1)+(2.1)+(3.20), (1.1)+(2.1)+(3.21), (1.1)+(2.1)+(3.22), (1.1)+(2.1)+(3.23), (1.1)+(2.1)+(3.24), (1.1)+(2.1)+(3.25), (1.1)+(2.1)+(3.26), (1.1)+(2.1)+(3.27), (1.1)+(2.1)+(3.28), (1.1)+(2.1)+(3.29), (1.1)+(2.1)+(3.30), (1.1)+(2.1)+(3.31), (1.1)+(2.1)+(3.32), (1.1)+(2.1)+(3.33),

(1.2)+(2.1)+(3.1), (1.2)+(2.1)+(3.2), (1.2)+(2.1)+(3.3), (1.2)+(2.1)+(3.4), (1.2)+(2.1)+(3.5), (1.2)+(2.1)+(3.6), (1.2)+(2.1)+(3.7), (1.2)+(2.1)+(3.8), (1.2)+(2.1)+(3.9), (1.2)+(2.1)+(3.10), (1.2)+(2.1)+(3.11), (1.2)+(2.1)+(3.12), (1.2)+(2.1)+(3.13), (1.2)+(2.1)+(3.14), (1.2)+(2.1)+(3.15), (1.2)+(2.1)+(3.16), (1.2)+(2.1)+(3.17), (1.2)+(2.1)+(3.18), (1.2)+(2.1)+(3.19), (1.2)+(2.1)+(3.20), (1.2)+(2.1)+(3.21), (1.2)+(2.1)+(3.22), (1.2)+(2.1)+(3.23), (1.2)+(2.1)+(3.24), (1.2)+(2.1)+(3.25), (1.2)+(2.1)+(3.26), (1.2)+(2.1)+(3.27), (1.2)+(2.1)+(3.28), (1.2)+(2.1)+(3.29), (1.2)+(2.1)+(3.30), (1.2)+(2.1)+(3.31), (1.2)+(2.1)+(3.32), (1.2)+(2.1)+(3.33),

(1.3)+(2.1)+(3.1), (1.3)+(2.1)+(3.2), (1.3)+(2.1)+(3.3), (1.3)+(2.1)+(3.4), (1.3)+(2.1)+(3.5), (1.3)+(2.1)+(3.6), (1.3)+(2.1)+(3.7), (1.3)+(2.1)+(3.8), (1.3)+(2.1)+(3.9), (1.3)+(2.1)+(3.10), (1.3)+(2.1)+(3.11), (1.3)+(2.1)+(3.12), (1.3)+(2.1)+(3.13), (1.3)+(2.1)+(3.14), (1.3)+(2.1)+(3.15), (1.3)+(2.1)+(3.16), (1.3)+(2.1)+(3.17), (1.3)+(2.1)+(3.18), (1.3)+(2.1)+(3.19), (1.3)+(2.1)+(3.20), (1.3)+(2.1)+(3.21), (1.3)+(2.1)+(3.22), (1.3)+(2.1)+(3.23), (1.3)+(2.1)+(3.24), (1.3)+(2.1)+(3.25), (1.3)+(2.1)+(3.26), (1.3)+(2.1)+(3.27), (1.3)+(2.1)+(3.28), (1.3)+(2.1)+(3.29), (1.3)+(2.1)+(3.30), (1.3)+(2.1)+(3.31), (1.3)+(2.1)+(3.32), (1.3)+(2.1)+(3.33),

(1.4)+(2.1)+(3.1), (1.4)+(2.1)+(3.2), (1.4)+(2.1)+(3.3), (1.4)+(2.1)+(3.4), (1.4)+(2.1)+(3.5), (1.4)+(2.1)+(3.6), (1.4)+(2.1)+(3.7), (1.4)+(2.1)+(3.8), (1.4)+(2.1)+(3.9), (1.4)+(2.1)+(3.10), (1.4)+(2.1)+(3.11), (1.4)+(2.1)+(3.12), (1.4)+(2.1)+(3.13), (1.4)+(2.1)+(3.14), (1.4)+(2.1)+(3.15), (1.4)+(2.1)+(3.16), (1.4)+(2.1)+(3.17), (1.4)+(2.1)+(3.18), (1.4)+(2.1)+(3.19), (1.4)+(2.1)+(3.20), (1.4)+(2.1)+(3.21), (1.4)+(2.1)+(3.22), (1.4)+(2.1)+(3.23), (1.4)+(2.1)+(3.24), (1.4)+(2.1)+(3.25), (1.4)+(2.1)+(3.26), (1.4)+(2.1)+(3.27), (1.4)+(2.1)+(3.28), (1.4)+(2.1)+(3.29), (1.1)+(2.1)+(3.30), (1.1)+(2.1)+(3.31), (1.1)+(2.1)+(3.32), (1.1)+(2.1)+(3.33),

(1.1)+(2.1)+(4.1), (1.1)+(2.1)+(4.2), (1.1)+(2.1)+(4.3), (1.2)+(2.1)+(4.1), (1.2)+(2.1)+(4.2), (1.2)+(2.1)+(4.3), (1.3)+(2.1)+(4.1), (1.3)+(2.1)+(4.2), (1.3)+(2.1)+(4.3), (1.4)+(2.1)+(4.1), (1.4)+(2.1)+(4.2), (1.4)+(2.1)+(4.3), (1.1)+(2.1)+(4.4), (1.1)+(2.1)+(4.5), (1.1)+(2.1)+(4.6), (1.2)+(2.1)+(4.4), (1.2)+(2.1)+(4.5), (1.2)+(2.1)+(4.6), (1.3)+(2.1)+(4.4), (1.3)+(2.1)+(4.5), (1.3)+(2.1)+(4.6), (1.4)+ (2.1)+(4.4), (1.4)+(2.1)+(4.5), (1.4)+(2.1)+(4.6),

(1.1)+(2.1)+(5), (1.2)+(2.1)+(5), (1.3)+(2.1)+(5), (1.4)+(2.1)+(5),

(1.1)+(2.1)+(6.1), (1.1)+(2.1)+(6.2), (1.1)+(2.1)+(6.3), (1.2)+(2.1)+(6.1), (1.2)+(2.1)+(6.2), (1.2)+(2.1)+(6.3), (1.3)+(2.1)+(6.1), (1.3)+(2.1)+(6.2), (1.3)+(2.1)+(6.3), (1.4)+(2.1)+(6.1), (1.4)+(2.1)+(6.2), (1.4)+(2.1)+(6.3),

(1.1)+(3.1)+(4.1), (1.1)+(3.2)+(4.1), (1.1)+(3.3)+(4.1), (1.1)+(3.4)+(4.1), (1.1)+(3.5)+(4.1), (1.1)+(3.6)+(4.1), (1.1)+(3.7)+(4.1), (1.1)+(3.8)+(4.1), (1.1)+(3.9)+(4.1), (1.1)+(3.10)+(4.1), (1.1)+(3.11)+(4.1), (1.1)+(3.12)+(4.1), (1.1)+(3.13)+(4.1), (1.1)+(3.14)+(4.1), (1.1)+(3.15)+(4.1), (1.1)+(3.16)+(4.1), (1.1)+(3.17)+(4.1), (1.1)+(3.18)+(4.1), (1.1)+(3.19)+(4.1), (1.1)+(3.20)+(4.1), (1.1)+(3.21)+(4.1), (1.1)+(3.22)+(4.1), (1.1)+(3.23)+(4.1), (1.1)+(3.24)+(4.1), (1.1)+(3.25)+(4.1), (1.1)+(3.26)+(4.1), (1.1)+(3.27)+(4.1), (1.1)+(3.28)+(4.1), (1.1)+(3.29)+(4.1), (1.1)+(3.30)+(4.1), (1.1)+(3.31)+(4.1), (1.1)+(3.32)+(4.1), (1.1)+(3.33)+(4.1),

(1.1)+(3.1)+(4.2), (1.1)+(3.2)+(4.2), (1.1)+(3.3)+(4.2), (1.1)+(3.4)+(4.2), (1.1)+(3.5)+(4.2), (1.1)+(3.6)+(4.2), (1.1)+(3.7)+(4.2), (1.1)+(3.8)+(4.2), (1.1)+(3.9)+(4.2), (1.1)+(3.10)+(4.2), (1.1)+(3.11)+(4.2), (1.1)+(3.12)+(4.2), (1.1)+(3.13)+(4.2), (1.1)+(3.14)+(4.2), (1.1)+(3.15)+(4.2), (1.1)+(3.16)+(4.2), (1.1)+(3.17)+(4.2), (1.1)+(3.18)+(4.2), (1.1)+(3.19)+(4.2), (1.1)+(3.20)+(4.2), (1.1)+(3.21)+(4.2), (1.1)+(3.22)+(4.2), (1.1)+(3.23)+(4.2), (1.1)+(3.24)+(4.2), (1.1)+(3.25)+(4.2), (1.1)+(3.26)+(4.2), (1.1)+(3.27)+(4.2), (1.1)+(3.28)+(4.2), (1.1)+(3.29)+(4.2), (1.1)+(3.30)+(4.2), (1.1)+(3.31)+(4.2), (1.1)+(3.32)+(4.2), (1.1)+(3.33)+(4.2),

(1.1)+(3.1)+(4.3), (1.1)+(3.2)+(4.3), (1.1)+(3.3)+(4.3), (1.1)+(3.4)+(4.3), (1.1)+(3.5)+(4.3), (1.1)+(3.6)+(4.3), (1.1)+(3.7)+(4.3), (1.1)+(3.8)+(4.3), (1.1)+(3.9)+(4.3), (1.1)+(3.10)+(4.3), (1.1)+(3.11)+(4.3), (1.1)+(3.12)+(4.3), (1.1)+(3.13)+(4.3), (1.1)+(3.14)+(4.3), (1.1)+(3.15)+(4.3), (1.1)+(3.16)+(4.3), (1.1)+(3.17)+(4.3), (1.1)+(3.18)+(4.3), (1.1)+(3.19)+(4.3), (1.1)+(3.20)+(4.3), (1.1)+(3.21)+(4.3), (1.1)+(3.22)+(4.3), (1.1)+(3.23)+(4.3), (1.1)+(3.24)+(4.3), (1.1)+(3.25)+(4.3), (1.1)+(3.26)+(4.3), (1.1)+(3.27)+(4.3), (1.1)+(3.28)+(4.3), (1.1)+(3.29)+(4.3), (1.1)+(3.30)+(4.3), (1.1)+(3.31)+(4.3), (1.1)+(3.32)+(4.3), (1.1)+(3.33)+(4.3),

(1.1)+(3.1)+(4.4), (1.1)+(3.2)+(4.4), (1.1)+(3.3)+(4.4), (1.1)+(3.4)+(4.4), (1.1)+(3.5)+(4.4), (1.1)+(3.6)+(4.4), (1.1)+(3.7)+(4.4), (1.1)+(3.8)+(4.4), (1.1)+(3.9)+(4.4), (1.1)+(3.10)+(4.4), (1.1)+(3.11)+(4.4), (1.1)+(3.12)+(4.4), (1.1)+(3.13)+(4.4), (1.1)+(3.14)+(4.4), (1.1)+(3.15)+(4.4), (1.1)+(3.16)+(4.4), (1.1)+(3.17)+(4.4), (1.1)+(3.18)+(4.4), (1.1)+(3.19)+(4.4), (1.1)+(3.20)+(4.4), (1.1)+(3.21)+(4.4), (1.1)+(3.22)+(4.4), (1.1)+(3.23)+(4.4), (1.1)+(3.24)+(4.4), (1.1)+(3.25)+(4.4), (1.1)+(3.26)+(4.4), (1.1)+(3.27)+(4.4), (1.1)+(3.28)+(4.4), (1.1)+(3.29)+(4.4), (1.1)+(3.30)+(4.4), (1.1)+(3.31)+(4.4), (1.1)+(3.32)+(4.4), (1.1)+(3.33)+(4.4),

(1.1)+(3.1)+(4.5), (1.1)+(3.2)+(4.5), (1.1)+(3.3)+(4.5), (1.1)+(3.4)+(4.5), (1.1)+(3.5)+(4.5), (1.1)+(3.6)+(4.5), (1.1)+(3.7)+(4.5), (1.1)+(3.8)+(4.5), (1.1)+(3.9)+(4.5), (1.1)+(3.10)+(4.5), (1.1)+(3.11)+(4.5), (1.1)+(3.12)+(4.5), (1.1)+(3.13)+(4.5), (1.1)+(3.14)+(4.5), (1.1)+(3.15)+(4.5), (1.1)+(3.16)+(4.5), (1.1)+(3.17)+(4.5), (1.1)+(3.18)+(4.5), (1.1)+(3.19)+(4.5), (1.1)+(3.20)+(4.5), (1.1)+(3.21)+(4.5), (1.1)+(3.22)+(4.5), (1.1)+(3.23)+(4.5), (1.1)+(3.24)+(4.5), (1.1)+(3.25)+(4.5), (1.1)+(3.26)+(4.5), (1.1)+(3.27)+(4.5), (1.1)+(3.28)+(4.5), (1.1)+(3.29)+(4.5), (1.1)+(3.30)+(4.5), (1.1)+(3.31)+(4.5), (1.1)+(3.32)+(4.5), (1.1)+(3.33)+(4.5),

(1.1)+(3.1)+(4.6), (1.1)+(3.2)+(4.6), (1.1)+(3.3)+(4.6), (1.1)+(3.4)+(4.6), (1.1)+(3.5)+(4.6), (1.1)+(3.6)+(4.6), (1.1)+(3.7)+(4.6), (1.1)+(3.8)+(4.6), (1.1)+(3.9)+(4.6), (1.1)+(3.10)+(4.6), (1.1)+(3.11)+(4.6), (1.1)+(3.12)+(4.6), (1.1)+(3.13)+(4.6), (1.1)+(3.14)+(4.6), (1.1)+(3.15)+(4.6), (1.1)+(3.16)+(4.6), (1.1)+(3.17)+(4.6), (1.1)+(3.18)+(4.6), (1.1)+(3.19)+(4.6), (1.1)+(3.20)+(4.6), (1.1)+(3.21)+(4.6),

(1.1)+(3.22)+(4.6), (1.1)+(3.23)+(4.6), (1.1)+(3.24)+(4.6), (1.1)+(3.25)+(4.6), (1.1)+(3.26)+(4.6), (1.1)+(3.27)+(4.6), (1.1)+(3.28)+(4.6), (1.1)+(3.29)+(4.6), (1.1)+(3.30)+(4.6), (1.1)+(3.31)+(4.6), (1.1)+(3.32)+(4.6), (1.1)+(3.33)+(4.6),

(1.2)+(3.1)+(4.1), (1.2)+(3.2)+(4.1), (1.2)+(3.3)+(4.1), (1.2)+(3.4)+(4.1), (1.2)+(3.5)+(4.1), (1.2)+(3.6)+(4.1), (1.2)+(3.7)+(4.1), (1.2)+(3.8)+(4.1), (1.2)+(3.9)+(4.1), (1.2)+(З10)+(4.1), (1.2)+(3.11)+(4.1), (1.2)+(3.12)+(4.1), (1.2)+(3.13)+(4.1), (1.2)+(3.14)+(4.1), (1.2)+(3.15)+(4.1), (1.2)+(3.16)+(4.1), (1.2)+(3.17)+(4.1), (1.2)+(3.18)+(4.1), (1.2)+(3.19)+(4.1), (1.2)+(3.20)+(4.1), (1.2)+(3.21)+(4.1), (1.2)+(3.22)+(4.1), (1.2)+(3.23)+(4.1), (1.2)+(3.24)+(4.1), (1.2)+(3.25)+(4.1), (1.2)+(3.26)+(4.1), (1.2)+(3.27)+(4.1), (1.2)+(3.28)+(4.1), (1.2)+(3.29)+(4.1), (1.2)+(3.30)+(4.1), (1.2)+(3.31)+(4.1), (1.2)+(3.32)+(4.1), (1.2)+(3.33)+(4.1),

(1.2)+(3.1)+(4.2), (1.2)+(3.2)+(4.2), (1.2)+(3.3)+(4.2), (1.2)+(3.4)+(4.2), (1.2)+(3.5)+(4.2), (1.2)+(3.6)+(4.2), (1.2)+(3.7)+(4.2), (1.2)+(3.8)+(4.2), (1.2)+(3.9)+(4.2), (1.2)+(3.10)+(4.2), (1.2)+(3.11)+(4.2), (1.2)+(3.12)+(4.2), (1.2)+(3.13)+(4.2), (1.2)+(3.14)+(4.2), (1.2)+(3.15)+(4.2), (1.2)+(3.16)+(4.2), (1.2)+(3.17)+(4.2), (1.2)+(3.18)+(4.2), (1.2)+(3.19)+(4.2), (1.2)+(3.20)+(4.2), (1.2)+(3.21)+(4.2), (1.2)+(3.22)+(4.2), (1.2)+(3.23)+(4.2), (1.2)+(3.24)+(4.2), (1.2)+(3.25)+(4.2), (1.2) +(3.26)+(4.2), (1.2)+(3.27)+(4.2), (1.2)+(3.28)+(4.2), (1.2)+(3.29)+(4.2), (1.2)+(3.30)+(4.2), (1.2)+(3.31)+(4.2), (1.2)+(3.32)+(4.2), (1.2)+(3.33)+(4.2),

(1.2)+(3.1)+(4.3), (1.2)+(3.2)+(4.3), (1.2)+(3.3)+(4.3), (1.2)+(3.4)+(4.3), (1.2)+(3.5)+(4.3), (1.2)+(3.6)+(4.3), (1.2)+(3.7)+(4.3), (1.2)+(3.8)+(4.3), (1.2)+(3.9)+(4.3), (1.2)+(3.10)+(4.3), (1.2)+(3.11)+(4.3), (1.2)+(3.12)+(4.3), (1.2)+(3.13)+(4.3), (1.2)+(3.14)+(4.3), (1.2)+(3.15)+(4.3), (1.2)+(3.16)+(4.3), (1.2)+(3.17)+(4.3), (1.2)+(3.18)+(4.3), (1.2)+(3.19)+(4.3), (1.2)+(3.20)+(4.3), (1.2)+(3.21)+(4.3), (1.2)+(3.22)+(4.3), (1.2)+(3.23)+(4.3), (1.2)+(3.24)+(4.3), (1.2)+(3.25)+(4.3), (1.2)+(3.26)+(4.3), (1.2)+(3.27)+(4.3), (1.2)+(3.28)+(4.3), (1.2)+(3.29)+(4.3), (1.2)+(3.30)+(4.3), (1.2)+(3.31)+(4.3), (1.2)+(3.32)+(4.3), (1.2)+(3.33)+(4.3),

(1.2)+(3.1)+(4.4), (1.2)+(3.2)+(4.4), (1.2)+(3.3)+(4.4), (1.2)+(3.4)+(4.4), (1.2)+(3.5)+(4.4), (1.2)+(3.6)+(4.4), (1.2)+(3.7)+(4.4), (1.2)+(3.8)+(4.4), (1.2)+(3.9)+(4.4), (1.2)+(3.10)+(4.4), (1.2)+(3.11)+(4.4), (1.2)+(3.12)+(4.4), (1.2)+(3.13)+(4.4), (1.2)+(3.14)+(4.4), (1.2)+(3.15)+(4.4), (1.2)+(3.16)+(4.4), (1.2)+(3.17)+(4.4), (1.2)+(3.18)+(4.4), (1.2)+(3.19)+(4.4), (1.2)+(3.20)+(4.4), (1.2)+(3.21)+(4.4), (1.2)+(3.22)+(4.4), (1.2)+(3.23)+(4.4), (1.2)+(3.24)+(4.4), (1.2)+(3.25)+(4.4), (1.2)+(3.26)+(4.4), (1.2)+(3.27)+(4.4), (1.2)+(3.28)+(4.4), (1.2)+(3.29)+(4.4), (1.2)+(3.30)+(4.4), (1.2)+(3.31)+(4.4), (1.2)+(3.32)+(4.4), (1.2)+(3.33)+(4.4),

(1.2)+(3.1)+(4.5), (1.2)+(3.2)+(4.5), (1.2)+(3.3)+(4.5), (1.2)+(3.4)+(4.5), (1.2)+(3.5)+(4.5), (1.2)+(3.6)+(4.5), (1.2)+(3.7)+(4.5), (1.2)+(3.8)+(4.5), (1.2)+(3.9)+(4.5), (1.2)+(3.10)+(4.5), (1.2)+(3.11)+(4.5), (1.2)+(3.12)+(4.5), (1.2)+(3.13)+(4.5), (1.2)+(3.14)+(4.5), (1.2)+(3.15)+(4.5), (1.2)+(3.16)+(4.5), (1.2)+(3.17)+(4.5), (1.2)+(3.18)+(4.5), (1.2)+(3.19)+(4.5), (1.2)+(3.20)+(4.5), (1.2)+(3.21)+(4.5), (1.2)+(3.22)+(4.5), (1.2)+(3.23)+(4.5), (1.2)+(3.24)+(4.5), (1.2)+(3.25)+(4.5), (1.2)+(3.26)+(4.5), (1.2)+(3.27)+(4.5), (1.2)+(3.28)+(4.5), (1.2)+(3.29)+(4.5), (1.2)+(3.30)+(4.5), (1.2)+(3.31)+(4.5), (1.2)+(3.32)+(4.5), (1.2)+(3.33)+(4.5),

(1.2)+(3.1)+(4.6), (1.2)+(3.2)+(4.6), (1.2)+(3.3)+(4.6), (1.2)+(3.4)+(4.6), (1.2)+(3.5)+(4.6), (1.2)+(3.6)+(4.6), (1.2)+(3.7)+(4.6), (1.2)+(3.8)+(4.6), (1.2)+(3.9)+(4.6), (1.2)+(3.10)+(4.6), (1.2)+(3.11)+(4.6), (1.2)+(3.12)+(4.6), (1.2)+(3.13)+(4.6), (1.2)+(3.14)+(4.6), (1.2)+(3.15)+(4.6), (1.2)+(3.16)+(4.6), (1.2)+(3.17)+(4.6), (1.2)+(3.18)+(4.6), (1.2)+(3.19)+(4.6), (1.2)+(3.20)+(4.6), (1.2)+(3.21)+(4.6), (1.2)+(3.22)+(4.6), (1.2)+(3.23)+(4.6), (1.2)+(3.24)+(4.6), (1.2)+(3.25)+(4.6), (1.2)+(3.26)+(4.6), (1.2)+(3.27)+(4.6), (1.2)+(3.28)+(4.6), (1.2)+(3.29)+(4.6), (1.2)+(3.30)+(4.6), (1.2)+(3.31)+(4.6), (1.2)+(3.32)+(4.6), (1.2)+(3.33)+(4.6),

(1.3)+(3.1)+(4.1), (1.3)+(3.2)+(4.1), (1.3)+(3.3)+(4.1), (1.3)+(3.4)+(4.1), (1.3)+(3.5)+(4.1), (1.3)+(3.6)+(4.1), (1.3)+(3.7)+(4.1), (1.3)+(3.8)+(4.1), (1.3)+(3.9)+(4.1), (1.3)+(3.10)+(4.1), (1.3)+(3.11)+(4.1), (1.3)+(3.12)+(4.1), (1.3)+(3.13)+(4.1), (1.3)+(3.14)+(4.1), (1.3)+(3.15)+(4.1), (1.3)+(3.16)+(4.1), (1.3)+(3.17)+(4.1), (1.3)+(3.18)+(4.1), (1.3)+(3.19)+(4.1), (1.3)+(3.20)+(4.1), (1.3)+(3.21)+(4.1), (1.3)+(3.22)+(4.1), (1.3)+(3.23)+(4.1), (1.3)+(3.24)+(4.1), (1.3)+(3.25)+(4.1), (1.3)+(3.26)+(4.1), (1.3)+(3.27)+(4.1), (1.3)+(3.28)+(4.1), (1.3)+(3.29)+(4.1), (1.3)+(3.30)+(4.1), (1.3)+(3.31)+(4.1), (1.3)+(3.32)+(4.1), (1.3)+(3.33)+(4.1),

(1.3)+(3.1)+(4.2), (1.3)+(3.2)+(4.2), (1.3)+(3.3)+(4.2), (1.3)+(3.4)+(4.2), (1.3)+(3.5)+(4.2), (1.3)+(3.6)+(4.2), (1.3)+(3.7)+(4.2), (1.3)+(3.8)+(4.2), (1.3)+(3.9)+(4.2), (1.3)+(3.10)+(4.2), (1.3)+(3.11)+(4.2), (1.3)+(3.12)+(4.2), (1.3)+(3.13)+(4.2), (1.3)+(3.14)+(4.2), (1.3)+(3.15)+(4.2), (1.3)+(3.16)+(4.2), (1.3)+(3.17)+(4.2), (1.3)+(3.18)+(4.2), (1.3)+(3.19)+(4.2), (1.3)+(3.20)+(4.2), (1.3)+(3.21)+(4.2), (1.3)+(3.22)+(4.2), (1.3)+(3.23)+(4.2), (1.3)+(3.24)+(4.2), (1.3)+(3.25)+(4.2), (1.3)+(3.26)+(4.2), (1.3)+(3.27)+(4.2), (1.3)+(3.28)+(4.2), (1.3)+(3.29)+(4.2), (1.3)+(3.30)+(4.2), (1.3)+(3.31)+(4.2), (1.3)+(3.32)+(4.2), (1.3)+(3.33)+(4.2),

(1.3)+(3.1)+(4.3), (1.3)+(3.2)+(4.3), (1.3)+(3.3)+(4.3), (1.3)+(3.4)+(4.3), (1.3)+(3.5)+(4.3), (1.3)+(3.6)+(4.3), (1.3)+(3.7)+(4.3), (1.3)+(3.8)+(4.3), (1.3)+(3.9)+(4.3), (1.3)+(3.10)+(4.3), (1.3)+(3.11)+(4.3), (1.3)+(3.12)+(4.3), (1.3)+(3.13)+(4.3), (1.3)+(3.14)+(4.3), (1.3)+(3.15)+(4.3), (1.3)+(3.16)+(4.3), (1.3)+(3.17)+(4.3), (1.3)+(3.18)+(4.3), (1.3)+(3.19)+(4.3), (1.3)+(3.20)+(4.3), (1.3)+(3.21)+(4.3), (1.3)+(3.22)+(4.3), (1.3)+(3.23)+(4.3), (1.3)+(3.24)+(4.3), (1.3)+(3.25)+(4.3), (1.3)+(3.26)+(4.3), (1.3)+(3.27)+(4.3), (1.3)+(3.28)+(4.3), (1.3)+(3.29)+(4.3), (1.3)+(3.30)+(4.3), (1.3)+(3.31)+(4.3), (1.3)+(3.32)+(4.3), (1.3)+(3.33)+(4.3),

(1.3)+(3.1)+(4.4), (1.3)+(3.2)+(4.4), (1.3)+(3.3)+(4.4), (1.3)+(3.4)+(4.4), (1.3)+(3.5)+(4.4), (1.3)+(3.6)+(4.4), (1.3)+(3.7)+(4.4), (1.3)+(3.8)+(4.4), (1.3)+(3.9)+(4.4), (1.3)+(3.10)+(4.4), (1.3)+(3.11)+(4.4), (1.3)+(3.12)+(4.4), (1.3)+(3.13)+(4.4), (1.3)+(3.14)+(4.4), (1.3)+(3.15)+(4.4), (1.3)+(3.16)+(4.4), (1.3)+(3.17)+(4.4), (1.3)+(3.18)+(4.4), (1.3)+(3.19)+(4.4), (1.3)+(3.20)+(4.4), (1.3)+(3.21)+(4.4), (1.3)+(3.22)+(4.4), (1.3)+(3.23)+(4.4), (1.3)+(3.24)+(4.4), (1.3)+(3.25)+(4.4), (1.3)+(3.26)+(4.4), (1.3)+(3.27)+(4.4), (1.3)+(3.28)+(4.4), (1.3)+(3.29)+(4.4), (1.3)+(3.30)+(4.4), (1.3)+(3.31)+(4.4), (1.3)+(3.32)+(4.4), (1.3)+(3.33)+(4.4),

(1.3)+(3.1)+(4.5), (1.3)+(3.2)+(4.5), (1.3)+(3.3)+(4.5), (1.3)+(3.4)+(4.5), (1.3)+(3.5)+(4.5), (1.3)+(3.6)+(4.5), (1.3)+(3.7)+(4.5), (1.3)+(3.8)+(4.5), (1.3)+(3.9)+(4.5), (1.3)+(3.10)+(4.5), (1.3)+(3.11)+(4.5), (1.3)+(3.12)+(4.5), (1.3)+(3.13)+(4.5), (1.3)+(3.14)+(4.5), (1.3)+(3.15)+(4.5), (1.3)+(3.16)+(4.5), (1.3)+(3.17)+(4.5), (1.3)+(3.18)+(4.5), (1.3)+(3.19)+(4.5), (1.3)+(3.20)+(4.5), (1.3)+(3.21)+(4.5), (1.3)+(3.22)+(4.5), (1.3)+(3.23)+(4.5), (1.3)+(3.24)+(4.5), (1.3)+(3.25)+(4.5), (1.3)+(3.26)+(4.5), (1.3)+(3.27)+(4.5), (1.3)+(3.28)+(4.5), (1.3)+(3.29)+(4.5), (1.3)+(3.30)+(4.5), (1.3)+(3.31)+(4.5), (1.3)+(3.32)+(4.5), (1.3)+(3.33)+(4.5),

(1.3)+(3.1)+(4.6), (1.3)+(3.2)+(4.6), (1.3)+(3.3)+(4.6), (1.3)+(3.4)+(4.6), (1.3)+(3.5)+(4.6), (1.3)+(3.6)+(4.6), (1.3)+(3.7)+(4.6), (1.3)+(3.8)+(4.6), (1.3)+(3.9)+(4.6), (1.3)+(3.10)+(4.6), (1.3)+(3.11)+(4.6), (1.3)+(3.12)+(4.6), (1.3)+(3.13)+(4.6), (1.3)+(3.14)+(4.6), (1.3)+(3.15)+(4.6), (1.3)+(3.16)+(4.6), (1.3)+(3.17)+(4.6), (1.3)+(3.18)+(4.6), (1.3)+(3.19)+(4.6), (1.3)+(3.20)+(4.6), (1.3)+(3.21)+(4.6), (1.3)+(3.22)+(4.6), (1.3)+(3.23)+(4.6), (1.3)+(3.24)+(4.6), (1.3)+(3.25)+(4.6), (1.3)+(3.26)+(4.6), (1.3)+(3.27)+(4.6), (1.3)+(3.28)+(4.6), (1.3)+(3.29)+(4.6), (1.3)+(3.30)+(4.6), (1.3)+(3.31)+(4.6), (1.3)+(3.32)+(4.6), (1.3)+(3.33)+(4.6),

(1.4)+(3.1)+(4.1), (1.4)+(3.2)+(4.1), (1.4)+(3.3)+(4.1), (1.4)+(3.4)+(4.1), (1.4)+(3.5)+(4.1), (1.4)+(3.6)+(4.1), (1.4)+(3.7)+(4.1), (1.4)+(3.8)+(4.1), (1.4)+(3.9)+(4.1), (1.4)+(3.10)+(4.1), (1.4)+(3.11)+(4.1), (1.4)+(3.12)+(4.1), (1.4)+(3.13)+(4.1), (1.4)+(3.14)+(4.1), (1.4)+(3.15)+(4.1), (1.4)+(3.16)+(4.1), (1.4)+(3.17)+(4.1), (1.4)+(3.18)+(4.1), (1.4)+(3.19)+(4.1), (1.4)+(3.20)+(4.1), (1.4)+(3.21)+(4.1), (1.4)+(3.22)+(4.1), (1.4)+(3.23)+(4.1), (1.4)+(3.24)+(4.1), (1.4)+(3.25)+(4.1), (1.4)+(3.26)+(4.1), (1.4)+(3.27)+(4.1), (1.4)+(3.28)+(4.1), (1.4)+(3.29)+(4.1), (1.4)+(3.30)+(4.1), (1.4)+(3.31)+(4.1), (1.4)+(3.32)+(4.1), (1.4)+(3.33)+(4.1),

(1.4)+(3.1)+(4.2), (1.4)+(3.2)+(4.2), (1.4)+(3.3)+(4.2), (1.4)+(3.4)+(4.2), (1.4)+(3.5)+(4.2), (1.4)+(3.6)+(4.2), (1.4)+(3.7)+(4.2), (1.4)+(3.8)+(4.2), (1.4)+(3.9)+(4.2), (1.4)+(3.10)+(4.2), (1.4)+(3.11)+(4.2), (1.4)+(3.12)+(4.2), (1.4)+(3.13)+(4.2), (1.4)+(3.14)+(4.2), (1.4)+(3.15)+(4.2), (1.4)+(3.16)+(4.2), (1.4)+(3.17)+(4.2), (1.4)+(3.18)+(4.2), (1.4)+(3.19)+(4.2), (1.4)+(3.20)+(4.2), (1.4)+(3.21)+(4.2), (1.4)+(3.22)+(4.2), (1.4)+(3.23)+(4.2), (1.4)+(3.24)+(4.2), (1.4)+(3.25)+(4.2), (1.4)+(3.26)+(4.2), (1.4)+(3.27)+(4.2), (1.4)+(3.28)+(4.2), (1.4)+(3.29)+(4.2), (1.4)+(3.30)+(4.2), (1.4)+(3.31)+(4.2), (1.4)+(3.32)+(4.2), (1.4)+(3.33)+(4.2),

(1.4)+(3.1)+(4.3), (1.4)+(3.2)+(4.3), (1.4)+(3.3)+(4.3), (1.4)+(3.4)+(4.3), (1.4)+(3.5)+(4.3), (1.4)+(3.6)+(4.3), (1.4)+(3.7)+(4.3), (1.4)+(3.8)+(4.3), (1.4)+(3.9)+(4.3), (1.4)+(3.10)+(4.3), (1.4)+(3.11)+(4.3), (1.4)+(3.12)+(4.3), (1.4)+(3.13)+(4.3), (1.4)+(3.14)+(4.3), (1.4)+(3.15)+(4.3), (1.4)+(3.16)+(4.3), (1.4)+(3.17)+(4.3), (1.4)+(3.18)+(4.3), (1.4)+(3.19)+(4.3), (1.4)+(3.20)+(4.3), (1.4)+(3.21)+(4.3), (1.4)+(3.22)+(4.3), (1.4)+(3.23)+(4.3), (1.4)+(3.24)+(4.3), (1.4)+(3.25)+(4.3), (1.4)+(3.26)+(4.3), (1.4)+(3.27)+(4.3), (1.4)+(3.28)+(4.3), (1.4)+(3.29)+(4.3), (1.4)+(3.30)+(4.3), (1.4)+(3.31)+(4.3), (1.4)+(3.32)+(4.3), (1.4)+(3.33)+(4.3),

(1.4)+(3.1)+(4.4), (1.4)+(3.2)+(4.4), (1.4)+(3.3)+(4.4), (1.4)+(3.4)+(4.4), (1.4)+(3.5)+(4.4), (1.4)+(3.6)+(4.4), (1.4)+(3.7)+(4.4), (1.4)+(3.8)+(4.4), (1.4)+(3.9)+(4.4), (1.4)+(3.10)+(4.4), (1.4)+(3.11)+(4.4), (1.4)+(3.12)+(4.4), (1.4)+(3.13)+(4.4), (1.4)+(3.14)+(4.4), (1.4)+(3.15)+(4.4), (1.4)+(3.16)+(4.4), (1.4)+(3.17)+(4.4), (1.4)+(3.18)+(4.4), (1.4)+(3.19)+(4.4), (1.4)+(3.20)+(4.4), (1.4)+(3.21)+(4.4), (1.4)+(3.22)+(4.4), (1.4)+(3.23)+(4.4), (1.4)+(3.24)+(4.4), (1.4)+(3.25)+(4.4), (1.4)+(3.26)+(4.4), (1.4)+(3.27)+(4.4), (1.4)+(3.28)+(4.4), (1.4)+(3.29)+(4.4), (1.4)+(3.30)+(4.4), (1.4)+(3.31)+(4.4), (1.4)+(3.32)+(4.4), (1.4)+(3.33)+(4.4),

(1.4)+(3.1)+(4.5), (1.4)+(3.2)+(4.5), (1.4)+(3.3)+(4.5), (1.4)+(3.4)+(4.5), (1.4)+(3.5)+(4.5), (1.4)+(3.6)+(4.5), (1.4)+(3.7)+(4.5), (1.4)+(3.8)+(4.5), (1.4)+(3.9)+(4.5), (1.4)+(3.10)+(4.5), (1.4)+(3.11)+(4.5), (1.4)+(3.12)+(4.5), (1.4)+(3.13)+(4.5), (1.4)+(3.14)+(4.5), (1.4)+(3.15)+(4.5), (1.4)+(3.16)+(4.5), (1.4)+(3.17)+(4.5), (1.4)+(3.18)+(4.5), (1.4)+(3.19)+(4.5), (1.4)+(3.20)+(4.5), (1.4)+(3.21)+(4.5), (1.4)+(3.22)+(4.5), (1.4)+(3.23)+(4.5), (1.4)+(3.24)+(4.5), (1.4)+(3.25)+(4.5), (1.4)+(3.26)+(4.5), (1.4)+(3.27)+(4.5), (1.4)+(3.28)+(4.5), (1.4)+(3.29)+(4.5), (1.4)+(3.30)+(4.5), (1.4)+(3.31)+(4.5), (1.4)+(3.32)+(4.5), (1.4)+(3.33)+(4.5),

(1.4)+(3.1)+(4.6), (1.4)+(3.2)+(4.6), (1.4)+(3.3)+(4.6), (1.4)+(3.4)+(4.6), (1.4)+(3.5)+(4.6), (1.4)+(3.6)+(4.6), (1.4)+(3.7)+(4.6), (1.4)+(3.8)+(4.6), (1.4)+(3.9)+(4.6), (1.4)+(3.10)+(4.6), (1.4)+(3.11)+(4.6), (1.4)+(3.12)+(4.6), (1.4)+(3.13)+(4.6), (1.4)+(3.14)+(4.6), (1.4)+(3.15)+(4.6), (1.4)+(3.16)+(4.6), (1.4)+(3.17)+(4.6), (1.4)+(3.18)+(4.6), (1.4)+(3.19)+(4.6), (1.4)+(3.20)+(4.6), (1.4)+(3.21)+(4.6), (1.4)+(3.22)+(4.6), (1.4)+(3.23)+(4.6), (1.4)+(3.24)+(4.6), (1.4)+(3.25)+(4.6), (1.4)+(3.26)+(4.6), (1.4)+(3.27)+(4.6), (1.4)+(3.28)+(4.6), (1.4)+(3.29)+(4.6), (1.4)+(3.30)+(4.6), (1.4)+(3.31)+(4.6), (1.4)+(3.32)+(4.6), (1.4)+(3.33)+(4.6), (1.1)+(3.1)+(5), (1.1)+(3.2)+(5), (1.1)+(3.3)+(5), (1.1)+(3.4)+(5), (1.1)+(3.5)+(5), (1.1)+(3.6)+(5), (1.1)+(3.7)+(5), (1.1)+(3.8)+(5), (1.1)+(3.9)+(5), (1.1)+(3.10)+(5), (1.1)+(3.11)+(5), (1.1)+(3.12)+(5), (1.1)+(3.13)+(5), (1.1)+(3.14)+(5), (1.1)+(3.15)+(5), (1.1)+(3.16)+(5), (1.1)+(3.17)+(5), (1.1)+(3.18)+(5), (1.1)+(3.19)+(5), (1.1)+(3.20)+(5), (1.1)+(3.21)+(5), (1.1)+(3.22)+(5), (1.1)+(3.23)+(5), (1.1)+(3.24)+(5), (1.1)+(3.25)+(5), (1.1)+(3.26)+(5), (1.1)+(3.27)+(5), (1.1)+(3.28)+(5), (1.1)+(3.29)+(5), (1.1)+(3.30)+(5), (1.1)+(3.31)+(5), (1.1)+(3.32)+(5), (1.1)+(3.33)+(5),

(1.2)+(3.1)+(5), (1.2)+(3.2)+(5), (1.2)+(3.3)+(5), (1.2)+(3.4)+(5), (1.2)+(3.5)+(5), (1.2)+(3.6)+(5), (1.2)+(3.7)+(5), (1.2)+(3.8)+(5), (1.2)+(3.9)+(5), (1.2)+(3.10)+(5), (1.2)+(3.11)+(5), (1.2)+(3.12)+(5), (1.2)+(3.13)+(5), (1.2)+(3.14)+(5), (1.2)+(3.15)+(5), (1.2)+(3.16)+(5), (1.2)+(3.17)+(5), (1.2)+(3.18)+(5), (1.2)+(3.19)+(5), (1.2)+(3.20)+(5), (1.2)+(3.21)+(5), (1.2)+(3.22)+(5), (1.2)+(3.23)+(5), (1.2)+(3.24)+(5), (1.2)+(3.25)+(5), (1.2)+(3.26)+(5), (1.2)+(3.27)+(5), (1.2)+(3.28)+(5), (1.2)+(3.29)+(5), (1.2)+(3.30)+(5), (1.2)+(3.31)+(5), (1.2)+(3.32)+(5), (1.2)+(3.33)+(5),

(1.3)+(3.1)+(5), (1.3)+(3.2)+(5), (1.3)+(3.3)+(5), (1.3)+(3.4)+(5), (1.3)+(3.5)+(5), (1.3)+(3.6)+(5), (1.3)+(3.7)+(5), (1.3)+(3.8)+(5), (1.3)+(3.9)+(5), (1.3)+(3.10)+(5), (1.3)+(3.11)+(5), (1.3)+(3.12)+(5), (1.3)+(3.13)+(5), (1.3)+(3.14)+(5), (1.3)+(3.15)+(5), (1.3)+(3.16)+(5), (1.3)+(3.17)+(5), (1.3)+(3.18)+(5), (1.3)+(3.19)+(5), (1.3)+(3.20)+(5), (1.3)+(3.21)+(5), (1.3)+(3.22)+(5), (1.3)+(3.23)+(5), (1.3)+(3.24)+(5), (1.3)+(3.25)+(5), (1.3)+(3.26)+(5), (1.3)+(3.27)+(5), (1.3)+(3.28)+(5), (1.3)+(3.29)+(5), (1.3)+(3.30)+(5), (1.3)+(3.31)+(5), (1.3)+(3.32)+(5), (1.3)+(3.33)+(5),

(1.4)+(3.1)+(5), (1.4)+(3.2)+(5), (1.4)+(3.3)+(5), (1.4)+(3.4)+(5), (1.4)+(3.5)+(5), (1.4)+(3.6)+(5), (1.4)+(3.7)+(5), (1.4)+(3.8)+(5), (1.4)+(3.9)+(5), (1.4)+(3.10)+(5), (1.4)+(3.11)+(5), (1.4)+(3.12)+(5), (1.4)+(3.13)+(5), (1.4)+(3.14)+(5), (1.4)+(3.15)+(5), (1.4)+(3.16)+(5), (1.4)+(3.17)+(5), (1.4)+(3.18)+(5), (1.4)+(3.19)+(5), (1.4)+(3.20)+(5), (1.4)+(3.21)+(5), (1.4)+(3.22)+(5), (1.4)+(3.23)+(5), (1.4)+(3.24)+(5), (1.4)+(3.25)+(5), (1.4)+(3.26)+(5), (1.4)+(3.27)+(5), (1.4)+(3.28)+(5), (1.4)+(3.29)+(5), (1.4)+(3.30)+(5), (1.4)+(3.31)+(5), (1.4)+(3.32)+(5), (1.4)+(3.33)+(5),

(1.1)+(3.1)+(6.1), (1.1)+(3.2)+(6.1), (1.1)+(3.3)+(6.1), (1.1)+(3.4)+(6.1), (1.1)+(3.5)+(6.1), (1.1)+(3.6)+(6.1), (1.1)+(3.7)+(6.1), (1.1)+(3.8)+(6.1), (1.1)+(3.9)+(6.1), (1.1)+(3.10)+(6.1), (1.1)+(3.11)+(6.1), (1.1)+(3.12)+(6.1), (1.1)+(3.13)+(6.1), (1.1)+(3.14)+(6.1), (1.1)+(3.15)+(6.1), (1.1)+(3.16)+(6.1), (1.1)+(3.17)+(6.1), (1.1)+(3.18)+(6.1), (1.1)+(3.19)+(6.1), (1.1)+(3.20)+(6.1), (1.1)+(3.21)+(6.1), (1.1)+(3.22)+(6.1), (1.1)+(3.23)+(6.1), (1.1)+(3.24)+(6.1), (1.1)+(3.25)+(6.1), (1.1)+(3.26)+(6.1), (1.1)+(3.27)+(6.1), (1.1)+(3.28)+(6.1), (1.1)+(3.29)+(6.1), (1.1)+(3.30)+(6.1), (1.1)+(3.31)+(6.1), (1.1)+(3.32)+(6.1), (1.1)+(3.33)+(6.1),

(1.1)+(3.1)+(6.2), (1.1)+(3.2)+(6.2), (1.1)+(3.3)+(6.2), (1.1)+(3.4)+(6.2), (1.1)+(3.5)+(6.2), (1.1)+(3.6)+(6.2), (1.1)+(3.7)+(6.2), (1.1)+(3.8)+(6.2), (1.1)+(3.9)+(6.2), (1.1)+(3.10)+(6.2), (1.1)+(3.11)+(6.2), (1.1)+(3.12)+(6.2), (1.1)+(3.13)+(6.2), (1.1)+(3.14)+(6.2), (1.1)+(3.15)+(6.2), (1.1)+(3.16)+(6.2), (1.1)+(3.17)+(6.2), (1.1)+(3.18)+(6.2), (1.1)+(3.19)+(6.2), (1.1)+(3.20)+(6.2), (1.1)+(3.21)+(6.2), (1.1)+(3.22)+(6.2), (1.1)+(3.23)+(6.2), (1.1)+(3.24)+(6.2), (1.1)+(3.25)+(6.2), (1.1)+(3.26)+(6.2), (1.1)+(3.27)+(6.2), (1.1)+(3.28)+(6.2), (1.1)+(3.29)+(6.2), (1.1)+(3.30)+(6.2), (1.1)+(3.31)+(6.2), (1.1)+(3.32)+(6.2), (1.1)+(3.33)+(6.2),

(1.1)+(3.1)+(6.3), (1.1)+(3.2)+(6.3), (1.1)+(3.3)+(6.3), (1.1)+(3.4)+(6.3), (1.1)+(3.5)+(6.3), (1.1) +(3.6)+(6.3), (1.1)+(3.7)+(6.3), (1.1)+(3.8)+(6.3), (1.1)+(3.9)+(6.3), (1.1)+(3.10)+(6.3), (1.1)+(3.11)+(6.3), (1.1)+(3.12)+(6.3), (1.1)+(3.13)+(6.3), (1.1)+(3.14)+(6.3), (1.1)+(3.15)+(6.3), (1.1)+(3.16)+(6.3), (1.1)+(3.17)+(6.3), (1.1)+(3.18)+(6.3), (1.1)+(3.19)+(6.3), (1.1)+(3.20)+(6.3), (1.1)+(3.21)+(6.3), (1.1)+(3.22)+(6.3), (1.1)+(3.23)+(6.3), (1.1)+(3.24)+(6.3), (1.1)+(3.25)+(6.3), (1.1)+(3.26)+(6.3), (1.1)+(3.27)+(6.3), (1.1)+(3.28)+(6.3), (1.1)+(3.29)+(6.3), (1.1)+(3.30)+(6.3), (1.1)+(3.31)+(6.3), (1.1)+(3.32)+(6.3), (1.1)+(3.33)+(6.3),

(1.2)+(3.1)+(6.1), (1.2)+(3.2)+(6.1), (1.2)+(3.3)+(6.1), (1.2)+(3.4)+(6.1), (1.2)+(3.5)+(6.1), (1.2)+(3.6)+(6.1), (1.2)+(3.7)+(6.1), (1.2)+(3.8)+(6.1), (1.2)+(3.9)+(6.1), (1.2)+(3.10)+(6.1), (1.2)+(3.11)+(6.1), (1.2)+(3.12)+(6.1), (1.2)+(3.13)+(6.1), (1.2)+(3.14)+(6.1), (1.2)+(3.15)+(6.1), (1.2)+(3.16)+(6.1), (1.2)+(3.17)+(6.1), (1.2)+(3.18)+(6.1), (1.2)+(3.19)+(6.1), (1.2)+(3.20)+(6.1), (1.2)+(3.21)+(6.1), (1.2)+(3.22)+(6.1), (1.2)+(3.23)+(6.1), (1.2)+(3.24)+(6.1), (1.2)+(3.25)+(6.1), (1.2)+(3.26)+(6.1), (1.2)+(3.27)+(6.1), (1.2)+(3.28)+(6.1), (1.2)+(3.29)+(6.1), (1.2)+(3.30)+(6.1), (1.2)+(3.31)+(6.1), (1.2)+(3.32)+(6.1), (1.2)+(3.33)+(6.1),

(1.2)+(3.1)+(6.2), (1.2)+(3.2)+(6.2), (1.2)+(3.3)+(6.2), (1.2)+(3.4)+(6.2), (1.2)+(3.5)+(6.2), (1.2)+(3.6)+(6.2), (1.2)+(3.7)+(6.2), (1.2)+(3.8)+(6.2), (1.2)+(3.9)+(6.2), (1.2)+(3.10)+(6.2), (1.2)+(3.11)+(6.2), (1.2)+(3.12)+(6.2), (1.2)+(3.13)+(6.2), (1.2)+(3.14)+(6.2), (1.2)+(3.15)+(6.2), (1.2)+(3.16)+(6.2), (1.2)+(3.17)+(6.2), (1.2)+(3.18)+(6.2), (1.2)+(3.19)+(6.2), (1.2)+(3.20)+(6.2), (1.2)+(3.21)+(6.2), (1.2)+(3.22)+(6.2), (1.2)+(3.23)+(6.2), (1.2)+(3.24)+(6.2), (1.2)+(3.25)+(6.2), (1.2)+(3.26)+(6.2), (1.2)+(3.27)+(6.2), (1.2)+(3.28)+(6.2), (1.2)+(3.29)+(6.2), (1.2)+(3.30)+(6.2), (1.2)+(3.31)+(6.2), (1.2)+(3.32)+(6.2), (1.2)+(3.33)+(6.2),

(1.2)+(3.1)+(6.3), (1.2)+(3.2)+(6.3), (1.2)+(3.3)+(6.3), (1.2)+(3.4)+(6.3), (1.2)+(3.5)+(6.3), (1.2)+(3.6)+(6.3), (1.2)+(3.7)+(6.3), (1.2)+(3.8)+(6.3), (1.2)+(3.9)+(6.3), (1.2)+(3.10)+(6.3), (1.2)+(3.11)+(6.3), (1.2)+(3.12)+(6.3), (1.2)+(3.13)+(6.3), (1.2)+(3.14)+(6.3), (1.2)+(3.15)+(6.3), (1.2)+(3.16)+(6.3), (1.2)+(3.17)+(6.3), (1.2)+(3.18)+(6.3), (1.2)+(3.19)+(6.3), (1.2)+(3.20)+(6.3), (1.2)+(3.21)+(6.3), (1.2)+(3.22)+(6.3), (1.2)+(3.23)+(6.3), (1.2)+(3.24)+(6.3), (1.2)+(3.25)+(6.3), (1.2)+(3.26)+(6.3), (1.2)+(3.27)+(6.3), (1.2)+(3.28)+(6.3), (1.2)+(3.29)+(6.3), (1.2)+(3.30)+(6.3), (1.2)+(3.31)+(6.3), (1.2)+(3.32)+(6.3), (1.2)+(3.33)+(6.3),

(1.3)+(3.1)+(6.1), (1.3)+(3.2)+(6.1), (1.3)+(3.3)+(6.1), (1.3)+(3.4)+(6.1), (1.3)+(3.5)+(6.1), (1.3)+(3.6)+(6.1), (1.3)+(3.7)+(6.1), (1.3)+(3.8)+(6.1), (1.3)+(3.9)+(6.1), (1.3)+(3.10)+(6.1), (1.3)+(3.11)+(6.1), (1.3)+(3.12)+(6.1), (1.3)+(3.13)+(6.1), (1.3)+(3.14)+(6.1), (1.3)+(3.15)+(6.1), (1.3)+(3.16)+(6.1), (1.3)+(3.17)+(6.1), (1.3)+(3.18)+(6.1), (1.3)+(3.19)+(6.1), (1.3)+(3.20)+(6.1), (1.3)+(3.21)+(6.1), (1.3)+(3.22)+(6.1), (1.3)+(3.23)+(6.1), (1.3)+(3.24)+(6.1), (1.3)+(3.25)+(6.1), (1.3)+(3.26)+(6.1), (1.3)+(3.27)+(6.1), (1.3)+(3.28)+(6.1), (1.3)+(3.29)+(6.1), (1.3)+(3.30)+(6.1), (1.3)+(3.31)+(6.1), (1.3)+(3.32)+(6.1), (1.3)+(3.33)+(6.1),

(1.3)+(3.1)+(6.2), (1.3)+(3.2)+(6.2), (1.3)+(3.3)+(6.2), (1.3)+(3.4)+(6.2), (1.3)+(3.5)+(6.2), (1.3)+(3.6)+(6.2), (1.3)+(3.7)+(6.2), (1.3)+(3.8)+(6.2), (1.3)+(3.9)+(6.2), (1.3)+(3.10)+(6.2), (1.3)+(3.11)+(6.2), (1.3)+(3.12)+(6.2), (1.3)+(3.13)+(6.2), (1.3)+(3.14)+(6.2), (1.3)+(3.15)+(6.2), (1.3)+(3.16)+(6.2), (1.3)+(3.17)+(6.2), (1.3)+(3.18)+(6.2), (1.3)+(3.19)+(6.2), (1.3)+(3.20)+(6.2), (1.3)+(3.21)+(6.2), (1.3)+(3.22)+(6.2), (1.3)+(3.23)+(6.2), (1.3)+(3.24)+(6.2), (1.3)+(3.25)+(6.2), (1.3)+(3.26)+(6.2), (1.3)+(3.27)+(6.2), (1.3)+(3.28)+(6.2), (1.3)+(3.29)+(6.2), (1.3)+(3.30)+(6.2), (1.3)+(3.31)+(6.2), (1.3)+(3.32)+(6.2), (1.3)+(3.33)+(6.2),

(1.3)+(3.1)+(6.3), (1.3)+(3.2)+(6.3), (1.3)+(3.3)+(6.3), (1.3)+(3.4)+(6.3), (1.3)+(3.5)+(6.3), (1.3)+(3.6)+(6.3), (1.3)+(3.7)+(6.3), (1.3)+(3.8)+(6.3), (1.3)+(3.9)+(6.3), (1.3)+(3.10)+(6.3), (1.3)+(3.11)+(6.3), (1.3)+(3.12)+(6.3), (1.3)+(3.13)+(6.3), (1.3)+(3.14)+(6.3), (1.3)+(3.15)+(6.3), (1.3)+(3.16)+(6.3), (1.3)+(3.17)+(6.3), (1.3)+(3.18)+(6.3), (1.3)+(3.19)+(6.3), (1.3)+(3.20)+(6.3), (1.3)+(3.21)+(6.3), (1.3)+(3.22)+(6.3), (1.3)+(3.23)+(6.3), (1.3)+(3.24)+(6.3), (1.3)+(3.25)+(6.3), (1.3)+(3.26)+(6.3), (1.3)+(3.27)+(6.3), (1.3)+(3.28)+(6.3), (1.3)+(3.29)+(6.3), (1.3)+(3.30)+(6.3), (1.3)+(3.31)+(6.3), (1.3)+(3.32)+(6.3), (1.3)+(3.33)+(6.3),

(1.4)+(3.1)+(6.1), (1.4)+(3.2)+(6.1), (1.4)+(3.3)+(6.1), (1.4)+(3.4)+(6.1), (1.4)+(3.5)+(6.1), (1.4)+(3.6)+(6.1), (1.4)+(3.7)+(6.1), (1.4)+(3.8)+(6.1), (1.4)+(3.9)+(6.1), (1.4)+(3.10)+(6.1), (1.4)+(3.11)+(6.1), (1.4)+(3.12)+(6.1), (1.4)+(3.13)+(6.1), (1.4)+(3.14)+(6.1), (1.4)+(3.15)+(6.1), (1.4)+(3.16)+(6.1), (1.4)+(3.17)+(6.1), (1.4)+(3.18)+(6.1), (1.4)+(3.19)+(6.1), (1.4)+(3.20)+(6.1), (1.4)+(3.21)+(6.1), (1.4)+(3.22)+(6.1), (1.4)+(3.23)+(6.1), (1.4)+(3.24)+(6.1), (1.4)+(3.25)+(6.1), (1.4)+(3.26)+(6.1), (1.4)+(3.27)+(6.1), (1.4)+(3.28)+(6.1), (1.4)+(3.29)+(6.1), (1.4)+(3.30)+(6.1), (1.4)+(3.31)+(6.1), (1.4)+(3.32)+(6.1), (1.4)+(3.33)+(6.1),

(1.4)+(3.1)+(6.2), (1.4)+(3.2)+(6.2), (1.4)+(3.3)+(6.2), (1.4)+(3.4)+(6.2), (1.4)+(3.5)+(6.2), (1.4)+(3.6)+(6.2), (1.4)+(3.7)+(6.2), (1.4)+(3.8)+(6.2), (1.4)+(3.9)+(6.2), (1.4)+(3.10)+(6.2), (1.4)+(3.11)+(6.2), (1.4)+(3.12)+(6.2), (1.4)+(3.13)+(6.2), (1.4)+(3.14)+(6.2), (1.4)+(3.15)+(6.2), (1.4)+(3.16)+(6.2), (1.4)+(3.17)+(6.2), (1.4)+(3.18)+(6.2), (1.4)+(3.19)+(6.2), (1.4)+(3.20)+(6.2), (1.4)+(3.21)+(6.2), (1.4)+(3.22)+(6.2), (1.4)+(3.23)+(6.2), (1.4)+(3.24)+(6.2), (1.4)+(3.25)+(6.2), (1.4)+(3.26)+(6.2), (1.4)+(3.27)+(6.2), (1.4)+(3.28)+(6.2), (1.4)+(3.29)+(6.2), (1.4)+(3.30)+(6.2), (1.4)+(3.31)+(6.2), (1.4)+(3.32)+(6.2), (1.4)+(3.33)+(6.2),

(1.4)+(3.1)+(6.3), (1.4)+(3.2)+(6.3), (1.4)+(3.3)+(6.3), (1.4)+(3.4)+(6.3), (1.4)+(3.5)+(6.3), (1.4)+(3.6)+(6.3), (1.4)+(3.7)+(6.3), (1.4)+(3.8)+(6.3), (1.4)+(3.9)+(6.3), (1.4)+(3.10)+(6.3), (1.4)+(3.11)+(6.3), (1.4)+(3.12)+(6.3), (1.4)+(3.13)+(6.3), (1.4)+(3.14)+(6.3), (1.4)+(3.15)+(6.3), (1.4)+(3.16)+(6.3), (1.4)+(3.17)+(6.3), (1.4)+(3.18)+(6.3), (1.4)+(3.19)+(6.3), (1.4)+(3.20)+(6.3), (1.4)+(3.21)+(6.3), (1.4)+(3.22)+(6.3), (1.4)+(3.23)+(6.3), (1.4)+(3.24)+(6.3), (1.4)+(3.25)+(6.3), (1.4)+(3.26)+(6.3), (1.4)+(3.27)+(6.3), (1.4)+(3.28)+(6.3), (1.4)+(3.29)+(6.3), (1.4)+(3.30)+(6.3), (1.4)+(3.31)+(6.3), (1.4)+(3.32)+(6.3), (1.4)+(3.33)+(6.3),

(1.1)+(4.1)+(5), (1.1)+(4.2)+(5), (1.1)+(4.3)+(5), (1.1)+(4.4)+(5), (1.1)+(4.5)+(5), (1.1)+(4.6)+(5), (1.2)+(4.1)+(5), (1.2)+(4.2)+(5), (1.2)+(4.3)+(5), (1.2)+(4.4)+(5), (1.2)+(4.5)+(5), (1.2)+(4.6)+(5), (1.3)+(4.1)+(5), (1.3)+(4.2)+(5), (1.3)+(4.3)+(5), (1.3)+(4.4)+(5), (1.3)+(4.5)+(5), (1.3)+(4.6)+(5), (1.4)+(4.1)+(5), (1.4)+(4.2)+(5), (1.4)+(4.3)+(5), (1.4)+(4.4)+(5), (1.4)+(4.5)+(5), (1.4)+(4.6)+(5).

(1.1)+(4.1)+(6.1), (1.1)+(4.2)+(6.1), (1.1)+(4.3)+(6.1), (1.1)+(4.4)+(6.1), (1.1)+(4.5)+(6.1), (1.1)+(4.6)+(6.1), (1.2)+(4.1)+(6.1), (1.2)+(4.2)+(6.1), (1.2)+(4.3)+(6.1), (1.2)+(4.4)+(6.1), (1.2)+(4.5)+(6.1), (1.2)+(4.6)+(6.1), (1.3)+(4.1)+(6.1), (1.3)+(4.2)+(6.1), (1.3)+(4.3)+(6.1), (1.3)+(4.4)+(6.1), (1.3)+(4.5)+(6.1), (1.3)+(4.6)+(6.1), (1.4)+(4.1)+(6.1), (1.4)+(4.2)+(6.1), (1.4)+(4.3)+(6.1), (1.4)+(4.4)+(6.1), (1.4)+(4.5)+(6.1), (1.4)+(4.6)+(6.1).

(1.1)+(4.1)+(6.2), (1.1)+(4.2)+(6.2), (1.1)+(4.3)+(6.2), (1.1)+(4.4)+(6.2), (1.1)+(4.5)+(6.2), (1.1)+(4.6)+(6.2), (1.2)+(4.1)+(6.2), (1.2)+(4.2)+(6.2), (1.2)+(4.3)+(6.2), (1.2)+(4.4)+(6.2), (1.2)+(4.5)+(6.2), (1.2)+(4.6)+(6.2), (1.3)+(4.1)+(6.2), (1.3)+(4.2)+(6.2), (1.3)+(4.3)+(6.2), (1.3)+(4.4)+(6.2), (1.3)+(4.5)+(6.2), (1.3)+(4.6)+(6.2), (1.4)+(4.1)+(6.2), (1.4)+(4.2)+(6.2), (1.4)+(4.3)+(6.2), (1.4)+(4.4)+(6.2), (1.4)+(4.5)+(6.2), (1.4)+(4.6)+(6.2).

(1.1)+(4.1)+(6.3), (1.1)+(4.2)+(6.3), (1.1)+(4.3)+(6.3), (1.1)+(4.4)+(6.3), (1.1)+(4.5)+(6.3), (1.1)+(4.6)+(6.3), (1.2)+(4.1)+(6.3), (1.2)+(4.2)+(6.3), (1.2)+(4.3)+(6.3), (1.2)+(4.4)+(6.3), (1.2)+(4.5)+(6.3), (1.2)+(4.6)+(6.3), (1.3)+(4.1)+(6.3), (1.3)+(4.2)+(6.3), (1.3)+(4.3)+(6.3), (1.3)+(4.4)+(6.3), (1.3)+(4.5)+(6.3), (1.3)+(4.6)+(6.3), (1.4)+(4.1)+(6.3), (1.4)+(4.2)+(6.3), (1.4)+(4.3)+(6.3), (1.4)+(4.4)+(6.3), (1.4)+(4.5)+(6.3), (1.4)+(4.6)+(6.3).

Из них еще более предпочтительными являются следующие комбинации:

(1.1)+(2.1)+(3.3), (1.1)+(2.1)+(3.22), (1.2)+(2.1)+(3.3), (1.2)+(2.1)+(3.22), (1.3)+(2.1)+(3.3), (1.3)+(2.1)+(3.22), (1.4)+(2.1)+(3.3), (1.4)+(2.1)+(3.22), (1.1)+(2.1)+(4.2), (1.2)+(2.1)+(4.2), (1.3)+(2.1)+(4.2), (1.4)+(2.1)+(4.2), (1.1)+(2.1)+(5), (1.2)+(2.1)+(5), (1.3)+(2.1)+(5), (1.4)+(2.1)+(5), (1.1)+(3.3)+(4.2), (1.1)+(3.22)+(4.2), (1.1)+(3.3)+(4.3), (1.1)+(3.22)+(4.3), (1.1)+(3.3)+(4.5), (1.1)+(3.22)+(4.5), (1.2)+(3.3)+(4.2), (1.2)+(3.22)+(4.2), (1.2)+(3.3)+(4.3), (1.2)+(3.22)+(4.3), (1.2)+(3.3)+(4.5), (1.2)+(3.22)+(4.5), (1.3)+(3.3)+(4.2), (1.3)+(3.22)+(4.2), (1.3)+(3.3)+(4.3), (1.3)+(3.22)+(4.3), (1.3)+(3.3)+(4.5), (1.3)+(3.22)+(4.5), (1.4)+(3.3)+(4.2), (1.4)+(3.22)+(4.2), (1.4)+(3.3)+(4.3), (1.4)+(3.22)+(4.3), (1.4)+(3.3)+(4.5), (1.4)+(3.22)+(4.5), (1.1)+(4.2)+(5), (1.2)+(4.2)+(5), (1.3)+(4.2)+(5), (1.4)+(4.2)+(5), (1.1)+(4.3)+(5), (1.2)+(4.3)+(5), (1.3)+(4.3)+(5), (1.4)+(4.3)+(5), (1.1)+(4.5)+(5), (1.2)+(4.5)+(5), (1.3)+(4.5)+(5), (1.4)+(4.5)+(5),

(1.1)+(2.1)+(6.1), (1.1)+(2.1)+(6.2), (1.1)+(2.1)+(6.3), (1.2)+(2.1)+(6.1), (1.2)+(2.1)+(6.2), (1.2)+(2.1)+(6.3), (1.3)+(2.1)+(6.1), (1.3)+(2.1)+(6.2), (1.3)+(2.1)+(6.3), (1.4)+(2.1)+(6.1), (1.4)+(2.1)+(6.2), (1.4)+(2.1)+(6.3), (1.1)+(3.3)+(6.1), (1.1)+(3.22)+(6.1), (1.1)+(3.3)+(6.2), (1.1)+(3.22)+(6.2), (1.1)+(3.3)+(6.3), (1.1)+(3.22)+(6.3), (1.2)+(3.3)+(6.1), (1.2)+(3.22)+(6.1), (1.2)+(3.3)+(6.2), (1.2)+(3.22)+(6.2), (1.2)+(3.3)+(6.3), (1.2)+(3.22)+(6.3), (1.3)+(3.3)+(6.1), (1.3)+(3.22)+(6.1), (1.3)+(3.3)+(6.2), (1.3)+(3.22)+(6.2), (1.3)+(3.3)+(6.3), (1.3)+(3.22)+(6.3), (1.4)+(3.3)+(6.1), (1.4)+(3.22)+(6.1), (1.4)+(3.3)+(6.2), (1.4)+(3.22)+(6.2), (1.4)+(3.3)+(6.3), (1.4)+(3.22)+(6.3), (1.1)+(4.2)+(6.1), (1.1)+(4.3)+(6.1), (1.1)+(4.5)+(6.1), (1.2)+(4.2)+(6.1), (1.2)+(4.3)+(6.1), (1.2)+(4.5)+(6.1), (1.3)+(4.2)+(6.1), (1.3)+(4.3)+(6.1), (1.3)+(4.5)+(6.1), (1.4)+(4.2)+(6.1), (1.4)+(4.3)+(6.1), (1.4)+(4.5)+(6.1), (1.1)+(4.2)+(6.2), (1.1)+(4.3)+(6.2), (1.1)+(4.5)+(6.2), (1.2)+(4.2)+(6.2), (1.2)+(4.3)+(6.2), (1.2)+(4.5)+(6.2), (1.3)+(4.2)+(6.2), (1.3)+(4.3)+(6.2), (1.3)+(4.5)+(6.2), (1.4)+(4.2)+(6.2), (1.4)+(4.3)+(6.2), (1.4)+(4.5)+(6.2), (1.1)+(4.2)+(6.3), (1.1)+(4.3)+(6.3), (1.1)+(4.5)+(6.3), (1.2)+(4.2)+(6.3), (1.2)+(4.3)+(6.3), (1.2)+(4.5)+(6.3), (1.3)+(4.2)+(6.3), (1.3)+(4.3)+(6.3), (1.3)+(4.5)+(6.3), (1.4)+(4.2)+(6.3), (1.4)+(4.3)+(6.3), (1.4)+(4.5)+(6.3).

Из них еще более предпочтительными являются следующие комбинации:

(1.1)+(2.1)+(3.3), (1.1)+(2.1)+(3.22), (1.2)+(2.1)+(3.3), (1.2)+(2.1)+(3.22), (1.1)+(2.1)+(4.2), (1.2)+(2.1)+(4.2), (1.1)+(2.1)+(4.3), (1.2)+(2.1)+(4.3), (1.1)+(2.1)+(4.5), (1.2)+(2.1)+(4.5), (1.1)+(2.1)+(5), (1.2)+(2.1)+(5), (1.1)+(3.3)+(4.2), (1.1)+(3.22)+(4.2), (1.1)+(3.3)+(4.3), (1.1)+(3.22)+(4.3), (1.1)+(3.3)+(4.5), (1.1)+(3.22)+(4.5), (1.2)+(3.3)+(4.2), (1.2)+(3.22)+(4.2), (1.2)+(3.3)+(4.3), (1.2)+(3.22)+(4.3), (1.2)+(3.3)+(4.5), (1.2)+(3.22)+(4.5), (1.1)+(4.2)+(5), (1.2)+(4.2)+(5), (1.1)+(4.3)+(5), (1.2)+(4.3)+(5), (1.1)+(4.5)+(5), (1.2)+(4.5)+(5), (1.1)+(2.1)+(6.1), (1.1)+(2.1)+(6.2), (1.1)+(2.1)+(6.3), (1.2)+(2.1)+(6.1), (1.2)+(2.1)+(6.2), (1.2)+(2.1)+(6.3), (1.3)+(2.1)+(6.1), (1.1)+(3.3)+(6.1), (1.1)+(3.22)+(6.1), (1.1)+(3.3)+(6.2), (1.1)+(3.22)+(6.2), (1.1)+(3.3)+(6.3), (1.1)+(3.22)+(6.3), (1.2)+(3.3)+(6.1), (1.2)+(3.22)+(6.1), (1.2)+(3.3)+(6.2), (1.2)+(3.22)+(6.2), (1.2)+(3.3)+(6.3), (1.2)+(3.22)+(6.3), (1.1)+(4.2)+(6.1), (1.1)+(4.3)+(6.1), (1.1)+(4.5)+(6.1), (1.2)+(4.2)+(6.1), (1.2)+(4.3)+(6.1), (1.2)+(4.5)+(6.1), (1.1)+(4.2)+(6.2), (1.1)+(4.3)+(6.2), (1.1)+(4.5)+(6.2), (1.2)+(4.2)+(6.2), (1.2)+(4.3)+(6.2), (1.2)+(4.5)+(6.2), (1.1)+(4.2)+(6.3), (1.1)+(4.3)+(6.3), (1.1)+(4.5)+(6.3), (1.2)+(4.2)+(6.3), (1.2)+(4.3)+(6.3), (1.2)+(4.5)+(6.3).

Наибольшее предпочтение отдается следующим комбинациям:

(1.2)+(2.1)+(3.3), (1.2)+(2.1)+(3.22), (1.2)+(2.1)+(4.2), (1.2)+(2.1)+(4.3), (1.2)+(2.1)+(4.5), (1.2)+(2.1)+(5), (1.2)+(3.3)+(4.2), (1.2)+(3.22)+(4.2), (1.2)+(3.3)+(4.3), (1.2)+(3.22)+(4.3), (1.2)+(3.3)+(4.5), (1.2)+(3.22)+(4.5), (1.2)+(4.2)+(5), (1.2)+(4.3)+(5), (1.2)+(4.5)+(5), (1.1)+(2.1)+(6.1), (1.1)+(2.1)+(6.2), (1.1)+(2.1)+(6.3), (1.1)+(3.3)+(6.1), (1.1)+(3.22)+(6.1), (1.1)+(3.3)+(6.2), (1.1)+(3.22)+(6.2), (1.1)+(3.3)+(6.3), (1.1)+(3.22)+(6.3), (1.1)+(4.2)+(6.1), (1.1)+(4.3)+(6.1), (1.1)+(4.5)+(6.1), (1.1)+(4.2)+(6.2), (1.1)+(4.3)+(6.2), (1.1)+(4.5)+(6.2), (1.1)+(4.2)+(6.3), (1.1)+(4.3)+(6.3), (1.1)+(4.5)+(6.3).

Из них комбинация (1.2)+(2.1)+(4.5) является наиболее предпочтительной.

Все вышеупомянутые тройные комбинации могут сочетаться с как минимум еще одним известным бактерицидом, фунгицидом, акарицидом, нематицидом, гербицидом, инсектицидом, питательными микроэлементами и содержащим питательный микроэлемент соединением, антидотом, липохитоолигосахаридами (LCO), продуктом, улучшающим почву, или продуктом, снижающим стресс растений, например, Myconate, например, с целью расширения спектра действия или предотвращения развития резистентности.

В предпочтительном варианте вышеупомянутые тройные комбинации также могут сочетаться с как минимум одним соединением, выбранным из группы, к которой относятся (1.1) ацибензолар-S-метил, (1.2) изотианил, (1.3) пробеназол, (1.4) тиадинил, (2.1) Фозетил-Al, (3.3) азоксистробин, (3.22) трифлоксистробин, (4.1) медь (Cu), (4.2) гидроксид меди, (4.3) сульфат меди, (4.4) оксихлорид меди, (4.5) Пропинеб, (4.6) Манкозеб и (5) липохитоолигосахаридные соединения (LCO) (5).

Все указанные партнеры по комбинации, а также стимуляторы иммунной защиты согласно настоящему изобретению, если это позволяют их функциональные группы, необязательно могут образовывать соли с соответствующими основаниями или кислотами.

Кроме того, стимуляторы иммунной защиты согласно настоящему изобретению могут сочетаться с как минимум одним активным соединением, выбранным из группы, к которой относятся:

Уксусная кислота (например, нафталинуксусная кислота), перуксусная кислота, органические кислоты (например, лимонная кислота, молочная кислота), аминокислоты (например, 1-аргинин), гуминовые кислоты, фульвокислоты, борная кислота, оксолиновая кислота, S-метиловый сложный эфир 1,2,3-бензотиадиазол-7-тиокарбоновой кислоты, 5-гидрокси-1,4-нафталиндион, бромо-хлоро-диметилгидантоин, трихлороизоциануровая кислота, салициловая кислота, дихлорофен, канамицин, касугамицин, стрептомицин, сульфат стрептомицина, окситетрациклин, гентамицин (например, гидрат гентамицин сульфата), имидаклоприд, тебуконазол, тиабендазол, тирам, терацеп, октилинон, хиноксифен, азадирахтин, фуранофлавон, форхлорфенурон, растительные минералы (например, кальций, карбонат кальция, гипохлорит, кальциевая соль ЭДТК), ферменты (например, протеаза, амилаза, липаза), микроэлементы и хелатные микроэлементы (например, аминокислотные хелаты), витамины и растительные экстракты, производные салицилата, биофлавоноиды и органические кислоты из овощей и фруктов, природные фруктовые полифенолы, масло горького апельсина, цитрусовые экстракты, хитозан, крахмал, экстракт из морских водорослей, кремнийорганические соединения, активированный ионизированный кремниевый комплекс (Zumsil®), пчелиный воск, мочевина, Bacillus subtilis, Bacillus amyloliquefaciens, Pseudomonas fluorescens, Pseudomonas putida, Pantoea agglomerans, Trichoderma koningii, Trichoderma harzianum, хлор и соединения хлора (например, хлорированная вода, диоксид хлора, хлорит натрия, гипохлорит натрия, гипохлористая кислота, хлорид аммония, дидецилдиметиламмоний хлорид, хлорид бензалкония), кислород, перекись водорода (Н2О2) и перекисные соединения, свободный цианамид, сульфат никеля (III), персульфат натрия, фосфит, фосфат, тринатрийфосфат, фосфорная кислота, неорганический азот, серебро и серебросодержащие соединения (например, коллоидное серебро), глутаральдегид, рамнолипид (Zonix®).

Авторы изобретения отдают предпочтение комбинациям из как минимум одного из стимуляторов иммунной защиты согласно настоящему изобретению с как минимум одним другим соединением, выбранным из группы, к которой относятся:

Фозетил-Al, стробилурины, предпочтительно выбранные из азоксистробина и трифлоксистробина и питательных микроэлементов и содержащих питательные микроэлементы соединений, как определено авторами, предпочтительно выбранные из меди (Cu), гидроксида меди, сульфата меди, оксихлорида меди, Пропинеба и Манкозеба.

В этом контексте термин "комбинация" или "композиция" означает разные возможные комбинации из как минимум двух из вышеупомянутых дополнительных активных соединений, такие, как, например, готовые смеси, баковые смеси (под которыми следует понимать суспензии для разбрызгивания, приготовленные из композиций, состоящих из отдельных активных соединений, путем комбинирования и разведения перед применением) или их комбинации (например, двойную готовую смесь из двух из вышеупомянутых активных соединений рецептируют в баковую смесь путем использования композиции третьего активного вещества). Согласно изобретению, отдельные активные соединения также могут применяться последовательно, т.е., одно за другим, с соответствующим интервалом в несколько часов или дней, а в случае обработки семян - также путем нанесения нескольких слоев, содержащих различные активные соединения. В предпочтительном варианте порядок нанесения отдельных активных соединений является несущественным.

Стимуляторы иммунной защиты могут применяться по отдельности, в форме композиций или в приготовленных из них формах, таких, как готовые к применению растворы, суспензии, смачиваемые порошки, пасты, растворимые порошки, дусты и гранулы. Их наносят традиционным способом, например, путем разливания, опрыскивания, распыления, рассеивания, опыливания, ценообразования, нанесения кистью и т.п.Кроме того, возможно нанесение соединений или композиций согласно настоящему изобретению в сверхмалом объеме или введение композиции активного соединения или самого активного соединения в почву. Также обработке может подвергаться материал для вегетативного размножения растений.

Нормы внесения могут колебаться в широком диапазоне, в зависимости от типа применения. При обработке частей растений нормы внесения активного соединения обычно составляют от 0,1 до 10000 г/га, предпочтительно от 10 до 1000 г/га. При обработке материала для вегетативного размножения нормы внесения активного соединения обычно составляют от 0,001 до 50 г на килограмм материала для вегетативного размножения, предпочтительно от 0,01 до 10 г на килограмм материала для вегетативного размножения. При обработке почвы нормы внесения активного соединения обычно составляют от 0,1 до 10000 г/га, предпочтительно от 1 до 5000 г/га.

Композиции активного соединения согласно настоящему изобретению включают эффективное и нефитотоксичное количество активных ингредиентов, причем выражение "эффективное и нефитотоксичное количество" означает количество ингредиентов и активных композиций согласно изобретению, которое является достаточным для контроля и уничтожения патогенных бактериальных организмов, которые присутствуют или могут появиться на растениях, путем значительного предотвращения развития резистентных к активным ингредиентам штаммов, и ни в одном из случаев не вызывает заметных симптомов фитотоксичности для вышеупомянутых культур. Такое количество может колебаться в широком диапазоне в зависимости от патогена или бактерий, против которых оно направлено, типа культуры, климатических условий и соединений, включенных в бактерицидную композицию согласно изобретению. Это количество может определяться путем систематических полевых испытаний, находящихся в пределах компетенции специалистов в данной области.

Согласно настоящему изобретению, синергетический эффект, например, фунгицидов присутствует во всех случаях, когда фунгицидная активность комбинаций активных соединений превышает сумму показателей активности активных соединений при их отдельном применении. Ожидаемая активность данной комбинации двух активных соединений (двойной композиции) может быть рассчитана следующим образом:

где Е представляет ожидаемый процент ингибирования болезни для комбинации двух фунгицидов при определенных дозах (например, равных x и y, соответственно), х представляет наблюдаемый процент ингибирования болезни со стороны соединения (А) при определенной дозе (равной x), y представляет наблюдаемый процент ингибирования болезни со стороны соединения (В) при определенной дозе (равной y). Если процент ингибирования, наблюдаемый для комбинации, превышает значение Е, это означает наличие синергетического эффекта.

Ожидаемая активность для данной комбинации трех активных соединений (тройной композиции) может быть рассчитана следующим образом:

где

X представляет эффективность при внесении активного соединения A в норме внесения m ppm (или г/га),

Упредставляет эффективность при внесении активного соединения В в норме внесения n ppm (или г/га),

Z представляет эффективность при внесении активного соединения C в норме внесения г ppm (или г/га),

Е представляет эффективность при внесении активных соединений А, В и С в норме внесения m, n и r ppm (или г/га), соответственно.

Указывается степень эффективности, выражаемая в %. 0% означает эффективность, соответствующую контрольному показателю, а эффективность 100% означает, что болезнь не наблюдается.

Если фактическая активность превышает рассчитанное значение, активность комбинации является супераддитивной, т.е., имеет место синергетический эффект. В этом случае фактически наблюдаемая эффективность должна превышать значение ожидаемой эффективности (Е), рассчитанной по вышеуказанной формуле.

Еще одним способом демонстрации синергетического эффекта является способ Tammes (ср. "Isoboles, a graphic representation of synergism in pesticides" in Neth. J. Plant Path, 1964, 70, 73-80).

Далее настоящее изобретение поясняется на следующих примерах:

ПРИМЕРЫ:

Пример 1: Борьба с инвазией Burkholderia glumae (=Pseudomonas glumae) с применением изотианила на рисе

Этот пример иллюстрирует эффективность композиции, содержащей изотианил, против бактериальной болезни Burkholderia glumae, инфицирующей метелки риса.

Полевые испытания осуществляли в 2011 г. в Колумбии для оценки эффективности изотианила против природной инфекции Burkholderia glumae на культуре риса - местном сорте Fedearroz 473.

Применяли типичную фунгицидную композицию, содержавшую 200 г изотианила на литр в первом испытании с двумя последовательными опрыскиваниями в фазах ВВСН29 (фаза кущения) и ВВСН52 (фаза колошения) и во втором испытании только в фазе ВВСН52. Испытание осуществляли в соответствии со стандартами экспериментальной практики.

Испытание 1:

Результаты оценки распространения Burkholderia glumae на метелках через 44 дня после 2-го опрыскивания продемонстрировали эффективность композиции при применении в норме от 100 до 200 г акт. ингр./га и наряду с защитой листьев положительное влияние на урожайность во время сбора.

Результаты испытания 1 в Колумбии, 2011 г.:

Испытание 2:

Результаты оценки распространения Burkholderia glumae на метелках через 29 дней после 1-го опрыскивания продемонстрировали эффективность композиции при внесении в норме от 100 до 200 г акт. ингр./га.

Результаты испытания 2 в Колумбии, 2011 г.:

Выводы о защите риса от Burkholderia glumae:

Пример демонстрирует, что уровень защиты выше при двухкратном внесении соединения (Испытание 1) по сравнению с однократным (Испытание 2), однако в двух случаях защита, достигаемая при применении изотианила при как минимум 200 г акт. ингр./га, превосходит защиту, обеспечиваемую антибиотическим соединением касугамицином, применяемым на рисе для борьбы с бактериальными болезнями. В испытании при сборе урожая защита листьев и метелок обеспечивает конечное повышение урожайности приблизительно на 20% на обработанных изотианилом культурах.

Пример 2а: Борьба с инвазией вида Candidatus Liberibacter с применением изотианила и изотианила + Фозетила AL на цитрусовых

Этот пример иллюстрирует эффективность композиций против бактериальной болезни Candidatus Liberibacter, инфицирующей плантации цитрусовых, также известной как HLB, болезнь цитрусовых "желтый дракон" или позеленение цитрусовых. Для обеспечения решения по предотвращению инфекции новых деревьев и распространения болезни на существующие деревья это испытание выполняли для исследования композиций, содержащих изотианил (SC200) или изотианил + Фозетил AL (изотианил SC200+Aliette®).

Материалы и способы:

Испытание предусматривало шесть различных режимов обработки. Для каждого режима обработки осуществляли три реплики, и в каждой реплике использовали по 10 здоровых растений.

Продукты применяли путем внекорневого внесения (опрыскивания до стекания). Через одиннадцать дней после внекорневого внесения продуктов растения инфицировали путем инокуляции патогенных бактерий Candidatus Liberibacter asiaticus с пораженных молодых цитрусовых растений на здоровые растения путем прививания трех пораженных почек цитрусовых на каждое из здоровых растений цитрусовых.

Каждые 30 дней после инокуляции брали образцы листьев необработанных контрольных и проверяли на наличие бактериальной ДНК. Образцы листьев обработанных растений не брали до тех пор, пока патогенные бактерии не обнаруживались в необработанных контрольных образцах при помощи гнездовой ПЦР.

Растения с типичными симптомами позеленения подсчитывали и эффективность рассчитывали в соответствии с ABBOTT (% эффективности). 0% означает эффективность, соответствующую контрольному показателю, а эффективность 100% означает, что болезнь не наблюдается.

Обнаружение при помощи гнездовой ПЦР:

ДНК листьев цитрусовых извлекали при помощи комплекта E.Z.N.A.TM Plant DNA Kit (от компании OMEGA, США). Гнездовую ПЦР (Harakava et al. 2000) применяли для обнаружения ДНК Candidatus Liberibacter asiaticus' (Las) в цитрусовых растениях и куколках листоблошек. Праймер 1500R/27F (AAGGAGGTGATCCAGCCGC/ AGAGTTTGATCATGGCTCAG) использовали для первой амплификации, и OI1 / OI2с (GCGCGTATGCAATACGAGCGGCA/GCCTCGCGACTTCGCA АСССАТ) использовали для второй амплификации (Jagoueix et al. 1994). Первую систему амплификации осуществляли в конечном объеме 25 мкл. Смесь содержала 17,6 мкл ddH2O, 2,5 мкл дНТФ (2,5 ммоль/л), 0,5 мкл каждого из праймеров (10 мкмоль/л), 0,4 мкл фермента Taq (2,5 U/ мкл) и 1 мкл контрольной ДНК. Амплификацию ДНК при помощи ПЦР выполняли следующим образом: реакционные смеси предварительно нагревали до 94°C в течение 5 мин; затем выполняли 20 циклов денатурирования при 94°C в течение 30 с, ренатурации при 50°C в течение 30 с и удлинения при 72°C в течение 90 с с окончательным удлинением при 72°C в течение 4 мин. Вторую систему амплификации также осуществляли в конечном объеме 25 мкл. Смесь содержала 17,6 мкл ddH2O, 2,5 мкл дНТФ (2,5 ммоль/л), 0,5 мкл каждого из праймеров (10 мкмоль/л), 0,4 мкл фермента Taq (2,5 U/ мкл) и 1 мкл продукта ПЦР первой амплификации. Амплификацию ДНК при помощи ПЦР выполняли следующим образом: реакционные смеси предварительно нагревали до 96°C в течение 1 мин; затем выполняли 35 циклов денатурирования при 94°C в течение 30 с, ренатурации при 55°C в течение 30 с и удлинения при 72°C в течение 60 с с окончательным удлинением при 72°C в течение 4 мин.

Результаты и обсуждение:

Эффективность различных режимов обработки в подавлении симптомов позеленения показана в Таблице 3. Количество растений с типичным симптомом желтой пятнистости среди растений, обработанных только изотианилом и изотианилом + фозетилом-Аl, было меньшим, чем среди необработанных растений.

Результат обнаружения при помощи гнездовой ПЦР продемонстрировал, что в результате обработки растений только изотианилом или изотианилом + фозетилом-Al уменьшилось количество листьев, пораженных позеленением цитрусовых (см. Таблицу 4 и Фиг. 1). В Таблице 4 показан процент растений, листья которых показали положительный результат среди анализируемых путем ПЦР растений по участкам и репликам.

Выводы:

Симптомы позеленения цитрусовых, обнаруженные на листьях привитых пораженных растений и ДНК Candidatus Liberibacter asiaticus, обнаруженная при помощи гнездовой ПЦР, продемонстрировали, что только изотианил или изотианил + фозетил-Al, примененные перед бактериальной инфекцией, эффективно снижают процент инфицирования и тяжесть болезни позеленения цитрусовых. Фозетил-Al повышал эффективность изотианила в сдерживании или подавлении болезни позеленения цитрусовых.

Пример 2b: Борьба с инвазией Xanthomonas campestris pv. citri с применением изотианила на цитрусовых

Этот пример иллюстрирует эффективность композиции, содержащей изотианил, против бактериальной болезни Xanthomonas campestris pv. Citri, инфицирующей преимущественно листья цитрусовых.

Оранжерейные испытания осуществляли в 2000 г. в Японии для оценки эффективности изотианила против инфекции Xanthomonas campestris pv. citri на цитрусовых сорта Shiroyanagi Navel. Оторванные листья цитрусовых искусственно инокулировали путем надреза через 1 день после внесения бактериальным штаммом Xanthomonas campestris pv. citri.

Для получения соответствующей композиции активного соединения 1 часть по массе активного соединения смешивают с указанным количеством растворителя и эмульгатора и концентрат разбавляют водой до нужной концентрации.

- Растворитель: 28,5 частей по массе ацетона;

- Эмульгатор: 1,5 части по массе фенилового эфира полиоксиэтиленалкила.

Композицию активного соединения наносили один раз на оторванные листья цитрусовых капельным путем. Через 1 день после внесения оторванные листья инокулировали путем надреза и помещали в пластиковую коробку приблизительно при 20°C и относительной влажности атмосферы приблизительно 100% на 7 дней. Испытание осуществляли в соответствии со стандартами экспериментальной практики.

Результаты оценки распространения Xanthomonas campestris pv. citri на листьях через 8 дней после внесения продемонстрировали эффективность композиции при внесении в количестве 250 ppm.

Результаты в Японии, 2000 г.:

Выводы о защите цитрусовых от Xanthomonas campestris pv. citri:

Пример демонстрирует, что уровень защиты, достигаемый при применении изотианила в количестве 250 ppm на цитрусовых, превосходит защиту, обеспечиваемую смесью меди и антибиотического соединения, на многих культурах в борьбе с бактериальными болезнями.

Пример 2 с: Борьба с инвазией Xanthomonas campestris pv. citri с применением изотианила путем внекорневого внесения на цитрусовых (лайме) / полевые испытания

Этот пример иллюстрирует эффективность композиции, содержащей изотианил, против бактериальной болезни Xanthomonas campestris pv. citri, инфицирующей листья и плоды плантаций цитрусовых, также называемой некрозом. Испытание осуществляли с целью исследования в 2012 г. в Таиланде:

Тип цитрусовых: лайм (Citrus Aurentifolia); формат участка: сад - 1 дерево на участок (размер участка=9 м2-3×3 м) - 3 реплики; естественная инвазия

Режимы обработки:

Даты внесения: 0, 7, 15, 22, 36, 43, 51-й дни

Результаты

Выводы о защите лайма от некроза (Xanthomonas campestris pv. citri): Пример демонстрирует, что уровень защиты, достигаемый с применением изотианила в количестве 100 г и 200 г акт. ингр./га против некроза на листьях и плодах сравним с показателем защиты, обеспечиваемой соединением на основе меди, применяемым на многих культурах в борьбе с бактериальными болезнями. Норма активной дозы может колебаться в зависимости от защиты листьев или плодов.

Пример 2d: Борьба с инвазией Xanthomonas campestris pv. citri с применением изотианила при внесении в почву для цитрусовых (апельсинов) / полевые испытания

Этот пример иллюстрирует эффективность композиции, содержащей изотианил, против бактериальной болезни Xanthomonas campestris pv. citri, инфицирующей листья и плоды плантаций цитрусовых, также называемой некрозом. В настоящее время не существует решений в отношении внесения в почву для борьбы с некрозом, поэтому коммерческого стандарта для испытания не предусмотрено.

Испытание осуществляли с целью исследования в 2012 г. в США:

Тип цитрусовых: апельсин сладкий (Citrus sinensis) - сорт Hamlin; формат участка: сад - 5 деревьев на участок (4 реплики) - 124 дерева / акр; естественная инвазия.

Даты внесения: 0, 51-й дни

Результаты

2 способа оценки:

Шкала оценки от 1 до 5 (1 = отсутствие инвазии - 5 = сильная инвазия); количество опавших плодов на дерево (опадение плодов вследствие инвазии).

Выводы о защите лайма от некроза (Xanthomonas campestris pv. citri): Пример демонстрирует, что изотианил, вносимый непосредственно в почву поблизости от корневой системы, способен защитить листья и плоды апельсина от некроза. Системная эффективность является значимой от самой низкой испытанной нормы 50 г акт. ингр./га и остается устойчивой от 100 г акт. ингр./га.

Этот способ внесения путем корневой подкормки при помощи оросительной системы является альтернативой опрыскиванию листьев, обладая высокой гибкостью, и получает высокую оценку со стороны производителей в США.

Пример 3а: Сдерживание болезни Pseudomonas syringae pv. glycinea (бактериоза) с применением изотианила путем внекорневого внесения для сои

Этот пример иллюстрирует эффективность композиции согласно изобретению против болезни Pseudomonas syringae pv. glycinea на сое.

Полевые испытания осуществляли в 2011 г. на сое в Аргентине для оценки эффективности изотианила против бактериальных болезней сои.

Типичную фунгицидную композицию, содержавшую 200 г изотианила на литр, вносили путем одного опрыскивания листьев в 2011 г., начиная со стадии цветения. Полевые испытания проводили в соответствии со стандартами экспериментальной практики. Инвазия бактерий была естественной.

Результаты оценки Pseudomonas syringae на листьях через 17 дней после первого внесения и 16 дней после второго внесения продемонстрировали значительную эффективность после опрыскивания изотианилом в количестве 100 г акт. ингр./га по сравнению с необработанными участками. Одного внесения изотианила в количестве 100 г акт. ингр./га достаточно для достижения надлежащего сдерживания бактериоза независимо от времени внесения.

Результаты 1 испытания в Аргентине, 2011 г.:

Пример 3d: Эффективность изотианила против бактерий (видов Xanthomonas) на сое

Следующий пример иллюстрирует эффективность изотианила против бактерий видов Xanthomonas (Xanthomonas axonopodis pv. glycines), инфицирующих, главным образом, листья сои.

Полевые испытания осуществляли в 2011 г. в Аргентине для оценки эффективности изотианила против природной инфекции видами Xanthomonas {Xanthomonas axonopodis pv. glycines) на сое.

Испытание предусматривалось на полностью рандомизированном участке, засеянном 26.10.10. (сорт Nidera 4613), и внекорневое внесение осуществляли 7.11.11. Изотианил разбрызгивали в виде композиции 200 SC на стадии роста культуры ВВСН ЕС 64.

Испытание осуществляли в соответствии со стандартами экспериментальной практики.

Этот пример свидетельствует об эффективности изотианила, демонстрируя, что тяжесть бактериальной болезни Xanthomonas (Xanthomonas axonopodis pv. glycines) на листьях явно снижалась при внекорневом внесении изотианила по сравнению с необработанными растениями.

Пример 4а: Изотианил / Pseudomonas syringae pv tomato (бактериальная точечность) на томатах

Этот пример иллюстрирует эффективность композиции согласно изобретению против болезни Pseudomonas syringae {Pseudomonas syringae pv. tomato) на томатах (бактериальной точечности).

Стандартный эксперимент осуществляли в Испании в 2011 г. для оценки эффективности изотианила против бактериальной точечности томатов, вызванной бактериями Pseudomonas syringae pv tomato.

Растения томатов выращивали под пластиковым туннелем. Участки искусственно инокулировали суспензией бактерий и обрабатывали различными экспериментальными химическими композициями с применением традиционного распылителя. Использовали четыре химических аэрозоля в интервале 7 дней. Одну искусственную инокуляцию выполняли через день после третьего внесения.

Оценку болезни осуществляли на 3 растениях томатов на каждый участок через 11 дней после последнего нанесения. Инфицированные листочки рассортировывали на 3 класса в соответствии со шкалой тяжести (Класс 1=1 пятно/лист; Класс 2=2-5 пятна/лист; Класс 3=>5 пятен/лист). Затем результаты выражали как индекс тяжести и преобразовывали в значения эффективности с использованием формулы Abbott:

Abbott % = {(необработанные - обработанные) / необработанные} × 100.

Результаты этого эксперимента демонстрируют, что внесение типичной композиции, содержащей 200 г изотианила на литр в норме от 400 до 800 г акт. ингр./га может значительно снижать уровень бактериальной инфекции томатов по сравнению с необработанными участками и стандартной обработкой оксихлоридом меди.

Результаты испытания, проведенного в Испании в 2011 г.:

Пример 4b: Борьба с инвазией Pseudomonas syringae с применением изотианила на томатах

Этот пример иллюстрирует эффективность композиции, содержащей изотианил, против бактериальной болезни Pseudomonas syringae (Pseudomonas syringae pv. tomato), инфицирующей листья томатов.

Полевые испытания осуществляли с целью исследования в 2011 г. В Испании на экспериментальном хозяйстве Brenes под Севильей для оценки эффективности изотианила против инфекции Pseudomonas syringae {Pseudomonas syringae pv. tomato) на томатах сорта Genaros. Культуру томатов искусственно инокулировали после третьего внесения бактериального штамма Pseudomonas syringae DC3000 (из университета Малаги). Растения томатов инокулировали на стадии ВВСН51 (начиная со стадии цветения) на защищенных участках.

Типичную фунгицидную композицию, содержавшую 200 г изотианила на литр, вносили за 4 последовательных опрыскивания с 7-дневными интервалами со стадии ВВСН14 (4 листа) по стадию ВВСН52 (начиная со стадии цветения). Испытание осуществляли в соответствии со стандартами экспериментальной практики.

Результаты оценок распространения на листьях Pseudomonas syringae через 4 дня и 18 дней после 4-го опрыскивания продемонстрировали эффективность композиции при внесении в количестве 400 г акт. ингр./га на листьях по сравнению с соединениями на основе меди, традиционно используемыми против бактериальных болезней.

Результаты одного испытания, проведенного в Испании в 2011 г.:

Выводы о защите томатов от Pseudomonas syringae (Pseudomonas syringae pv. tomato): Пример демонстрирует, что уровень защиты, достигаемый при применении изотианила в количестве от 400 г акт. ингр./га, в частности, 800 г акт. ингр./га, на томатах, сравним или превосходит уровень защиты, обеспечиваемый соединениями на основе меди, применяемыми на многих культурах в борьбе с бактериальными болезнями.

Пример 5: Борьба с инвазией Xanthomonas campestris с применением изотианила на персиковых деревьях

Этот пример иллюстрирует эффективность композиции, содержащей изотианил, против бактериальной болезни Xanthomonas campestris (Xanthomonas campestris pv. pruni), инфицирующей листья и плоды персика.

Полевые испытания осуществляли в 2008 г. в Японии для оценки эффективности изотианила от природной инфекции Xanthomonas campestris (Xanthomonas campestris pv. pruni) на персиках - раннем сорте Hikawa-Hakuho.

Типичную фунгицидную композицию, содержавшую 200 г изотианила на литр, вносили за 5 последовательных опрыскиваний с интервалами в 14 дней со стадии ВВСН65 (полное цветение) по стадию ВВСН75 (плоды, достигшие 50% от их конечного размера). Испытание осуществляли в соответствии со стандартами экспериментальной практики.

Результаты оценок распространения Xanthomonas campestris (Xanthomonas campestris pv. pruni) на листьях через 12 дней после 5-го опрыскивания и распространения на плодах через 16 дней после 5-го опрыскивания продемонстрировали эффективность композиции при внесении в количестве 200 ррт на листьях и 100 ррт на плодах по сравнению со стрептомицином - традиционным соединением, применяемым для борьбы с бактериальными болезнями.

Результаты одного испытания в Японии в 2008 г.:

Выводы о защите персиков ot Xanthomonas campestris:

Пример демонстрирует, что уровень защиты, достигаемый с применением изотианила в количестве от 100 ppm и более, в частности, при 200 ppm, сравним с показателем защиты, обеспечиваемой антибиотическим соединением, стрептомицином, применяемым во фруктовых садах для борьбы с бактериальными болезнями.

Пример 6а: Борьба с инвазией Pseudomonas syringae с применением изотианила и изотианила + фозетила Al на огурцах

Этот пример иллюстрирует эффективность композиции, содержащей изотианил, против бактериальной болезни Pseudomonas syringae, инфицирующей огурцы.

Несколько полевых испытаний осуществляли в 2011 г. в Китае для оценки эффективности изотианила против инфекции Pseudomonas syringae на огурцах, приводящей к возникновению симптомов угловатой пятнистости листьев. Испытания пеоечислены ниже в таблице

Типичную фунгицидную композицию, содержавшую 200 г изотианила на литр, и баковую смесь изотианила 200SC + фозетил (Aliette®) W80 наносили тремя последовательными опрыскиваниями листьев с разными интервалами в соответствии с периодами риска инфекции со стадии ВВСН 13 (3 развившихся листка) по стадию ВВСН 72 (стадии плодоношения). Испытания проводили в соответствии со стандартами экспериментальной практики на поле и в оранжерее.

Результаты оценок инфекции листьев (тяжесть инфекции после второго опрыскивания от 14 дней до 36 дней после второго внесения) демонстрируют, что изотианил в количестве 200 г акт. ингр./га и изотианил + фозетил 200+1000 г акт. ингр./га обладают значительной эффективностью против бактериальной инфекции. Эффективность изотианила в количестве 400 г акт. ингр./га превосходит стандартные показатели и обеспечивает отличный урожай. Добавление 1000 г акт. ингр./га фозетила компенсирует более низкий уровень изотианила в смеси: в одном испытании наблюдается улучшение эффективности и устойчивости по сравнению с применением только изотианила в количестве 200 г акт. ингр./га, и при этом урожайность выше, чем на участках, обработанных контрольными соединениями.

Результаты испытаний, проведенных в Китае в 2011 г.:

DAT2: дни после второй обработки

Выводы о защите огурцов от Pseudomonas syringae:

Пример демонстрирует, что уровень защиты, достигаемый с применением изотианила в количестве от 200 г акт. ингр./га, в частности, 400 г акт. ингр./га, сравним или превосходит уровень защиты, обеспечиваемый контрольными соединениями, применяемыми в местных масштабах для борьбы с инфекциями угловой пятнистости листьев на огурцах после бактериальных инвазий Pseudomonas syringae. Применение изотианила в количестве 400 г акт. ингр./га обеспечивает для производителя лучшую защиту урожая по сравнению с ожидаемой от стандартных соединений. Смесь изотианила + фозетила 200+1000 г акт. ингр./га позволяет использовать меньшее количество изотианила без потери эффективности и устойчивости по сравнению с применением меди и изотианила, которые используются в большом количестве.

Пример 6b: Борьба с инвазией Pseudomonas syringae pv. lachrymans с применением изотианила на огурцах

Этот пример иллюстрирует эффективность композиции, содержащей изотианил, против бактериальной болезни Pseudomonas syringae pv. Lachrymans, инфицирующей, главным образом, листья огурца.

Испытание 1: внесение путем пропитывания

Оранжерейные испытания осуществляли в 1998 г. в Японии для оценки эффективности изотианила против инфекции Pseudomonas syringae pv. lachrymans на огурцах сорта Sagamihanjiro. Культуру огурцов искусственно инокулировали через 7 дней после внесения бактериальным штаммом Pseudomonas syringae pv. lachrymans. Растения огурцов инокулировали на стадии ВВСН13 (стадии полностью развернутого третьего полного листа) защищенной горшечной рассады.

Для получения подходящего препарата активного соединения 1 часть по массе активного соединения смешивают с указанным количеством растворителя и эмульгатора и концентрат разбавляют водой до нужной концентрации.

- Растворитель: 28,5 частей по массе ацетона;

- Эмульгатор: 1,5 части по массе фенилового эфира полиоксиэтиленалкила

20 мл композиции активного соединения вносили один раз на стадии ВВСН12 (стадии полностью развернутого второго полного листа) путем пропитывания. Через 7 дней после внесения растения инокулировали, а затем держали в стеклянной камере приблизительно при 25°C и относительной влажности атмосферы приблизительно 100% на 7 дней. Испытание осуществляли в соответствии со стандартами экспериментальной практики.

Испытание 2: Внекорневое внесение

Оранжерейные испытания осуществляли в 2000 г. в Японии для оценки эффективности изотианила против инфекции Pseudomonas syringae pv. lachrymans на огурцах сорта Sagamihanjiro. Культуру огурцов искусственно инокулировали через 1 день после внесения бактериальным штаммом Pseudomonas syringae pv. lachrymans. Растения огурцов инокулировали на стадии ВВСН14 (стадии полностью развернутого четвертого полного листа) защищенной горшечной рассады.

Для получения подходящего препарата активного соединения 1 часть по массе активного соединения смешивают с указанным количеством растворителя и эмульгатора и концентрат разбавляют водой до нужной концентрации.

- Растворитель: 28,5 частей по массе ацетона;

- Эмульгатор: 1,5 части по массе фенилового эфира полиоксиэтиленалкила

Композицию активного соединения вносили один раз на стадии ВВСН14 (стадии полностью развернутого четвертого полного листа) путем внекорневого внесения. Через 1 день после внесения растения инокулировали, а затем держали в стеклянной камере приблизительно при 25°C и относительной влажности атмосферы приблизительно 100% на 7 дней. Испытание осуществляли в соответствии со стандартами экспериментальной практики.

Испытание 1: Результаты оценки тяжести Pseudomonas syringae pv. lachrymans на листьях через 22 дня после внесения продемонстрировали эффективность композиции при внесении в количестве от 50 до 100 мг акт. ингр./растение.

Результаты испытания 1 в Японии, 1998 г.:

Испытание 2: Результаты оценки распространения на листьях Pseudomonas syringae pv. lachrymans через 8 дней после внесения продемонстрировали эффективность композиции при внесении в количестве 250 ppm.

Результаты испытания 2 в Японии, 2000 г.:

Выводы о защите огурцов от Pseudomonas syrineae pv. lachrymans:

Пример демонстрирует, что уровень защиты превосходит уровень, обеспечиваемый при внесении соединения путем пропитывания (Испытание 1) и внекорневом внесении (Испытание 2). Защита, достигаемая применением изотианила на огурцах, сравнима или превосходит защиту, обеспечиваемую антибиотическим соединением оксолиновой кислотой или индуктором резистентности пробеназолом, применяемыми на многих культурах в борьбе с бактериальными болезнями.

Пример 6с: Сдерживание распространения болезни, вызываемой Pseudomonas syringae pv. actinidiae на киви, с применением изотианила или изотианила + фозетила-Al

Цель экспериментов состояла в том, чтобы определить, может ли изотианил SC200, отдельно или в комбинации с фозетил-алюминием, уменьшить распространение бактериального некроза на киви, вызванного Pseudomonas syringae pv. actinidiae (Psa).

Материалы и способы

Эксперимент проводили в оранжерее на рассаде Actinidia deliciosa 'Bruno' высотой 15-20 см. Режимы обработки включали разные значения концентрации образца изотианила SC200 WW (IST) в комбинации с фозетил-алюминием (Aliette® WDG) (FEA) или отдельно, из расчета нормы 2000 литров разбрызгиваемого продукта на гектар:

Режимы обработки:

1.IST 0,1 г акт. ингр./л

2.IST 0,2 г акт. ингр./л

3.IST 0,1 г акт. ингр./л+FEA 0,5 г/л

4.IST 0,2 г акт. ингр./л+FEA 1,0 г/л

5.IST 0,1 акт. ингр., г/л+FEA 1,0 г/л

6. Вода/вода

7. Вода/Psa.

IST наносят первым, а затем через 3½ ч FEA. После этого растения оставляли в оранжерее до инокуляции Psa. Кроме того, некоторые растения, которые не были инокулированы, обрабатывали IST в количестве 0,2 г акт. ингр./л или IST в количестве 0,2 г акт. ингр./л плюс FEA в количестве 1,0 г/л, чтобы определить, приводят ли эти режимы обработки к фитотоксичности.

Растения инокулировали вирулентным штаммом Psa (штамм 10627), выделенным в Новой Зеландии. Инокулят получали в стерильной воде из свежевыращенной в планшетах среды Кинга В (King et al. 1954, Journal of Laboratory Clinical Medicine 44: 301-307), инкубированной при 28°C. Инокулят содержал 1,2 × 109 колониеобразующих единиц (cfu)/мл. Тяжесть болезни записывали на 7, 14 и 21-й дни после инокуляции (7 DAI, 14 DAI и 21 DAI, соответственно). Оценка распространения болезни основывалась на проценте пораженных некрозом листьев. Листья получали оценку от 0 до 5 в соответствии с процентом листьев, на которых был обнаружен некроз: 0% оценивали как 0,1-10% площади листа, пораженных некрозом, получали оценку 1, 11-25% некроза получали оценку 2, 26-50% некроза получали оценку 3, 51-75% некроза получали оценку 4, и 76-100% некроза получали оценку 5. Рассчитывали среднюю оценку всех листьев на одном растении. Затем оценку для режима обработки определяли как среднюю оценку всех растений, подвергавшихся одинаковой обработке.

Результаты и обсуждение

Результаты представлены в Таблице 14 и на Фигуре 2.

DAI = дней после инокуляции

При внесении IST в количестве 0,2 г/л или IST 0,2 г плюс FEA в количестве 1,0 г на растениях, не подвергнутых инокуляции, процент площади листа, пораженной некрозом, был чрезвычайно низок. Таким образом, IST или IST в комбинации с FEA не приводили к какой-либо значительной степени фитотоксичности. Отрицательный контроль с водой болезни не обнаружил (см. Фиг. 2).

Фигура 2: Распространение болезни на рассаде киви, обработанной изотианил ом SC200 (IST) или фозетил-алюминием (FEA) и инокулированной Pseudomonas syringae pv. actinidiae. Первые (левые столбики), вторые (средние столбики) и третьи (правые столбики) считывания осуществляли через 7, 14 и 21 день после инокуляции, соответственно.

Между первым и вторым считываниями (7 и 14-й дни после инокуляции) болезнь быстро прогрессировала, как видно по проценту пораженной некрозом поверхности листьев. Затем ее развитие замедлялось между вторым и третьим считываниями (14 и 21-й дни после инокуляции). Не наблюдалось значительного увеличения процента пораженных некрозом листьев, т.е., степени болезни, между вторым и третьим считываниями при любом из режимов обработки.

Через 14 и 21 день после инокуляции не наблюдалось различий в степени болезни между разными режимами обработки, хотя IST отдельно в количестве 0,2 г акт. ингр./л приводит к меньшему количеству симптомов по сравнению с другими режимами обработки. Через четырнадцать дней после инокуляции растения, получавшие только IST в количестве 0,2 г акт. ингр./л, демонстрировали значительно более низкую степень болезни по сравнению с обработанными водой растениями. Через двадцать один день после инокуляции все режимы обработки снижали тяжесть болезни по сравнению с обработанным водой контролем, причем IST в количестве 0,2 г/л является наилучшим способом обработки. В этом эксперименте FEA при добавлении к IST не снижает распространение Psa.

Пример 7: Сдерживание распространение бактериальной парши клубней картофеля, вызванной Streptomyces scabies, на картофеле с применением изотианила или изотианила + трифлоксистробина или изотианила + перфлуфена

Целью этого исследования была оценка эффективности изотианила против бактериальной парши клубней картофеля (обыкновенной парши), вызванной Streptomyces scabies, и определение эффективной экономичной нормы дозы.

Испытание проводились в Сахивале, Фейсалабаде и Лахоре в Пакистане.

Внесение

Клубни картофеля обрабатывали один раз во время сева. Количество клубней (посевного материала) определяли согласно размеру участка и взвешивали отдельно для каждого режима обработки. Затем количество продукта рассчитывали и измеряли в соответствии с массой клубней для каждого режима обработки на основе нормы дозы на 100 кг клубней. Объем воды регулировали для обеспечения надлежащего покрытия. Продукт смешивали с отрегулированным объемом воды для каждого режима обработки в отдельности. Клубни рассыпали по пластиковому листу, тщательно опрыскивали, высушивали, переворачивали на другую сторону и снова тщательно опрыскивали. Таким образом, каждый клубень был гарантированно покрыт продуктом. После высушивания клубни высевали на помеченные участки. Предпочтение для высевания отдавали клубням картофеля среднего размера. Для обеспечения инвазии болезни использовали инфицированные клубни с распространением бактериальной парши клубней картофеля приблизительно 10%.

При сборе урожая определяли процент заболевания картофеля для каждого режима обработки и эффективность рассчитывали в соответствии с ABBOTT (% эффективности). 0% означает эффективность, соответствующую контрольному показателю, а эффективность 100% означает, что болезнь не наблюдается.

Результаты:

а) % инвазии необработанных контрольных растений.

Согласно результатам, показанным в Таблице 16, эффективность изотианила 200FS+перфлуфена 240FS (2,4 г акт. ингр. / 100 кг пос. мат. каждого акт. ингр. / бак. смесь) была такой же или большей по сравнению с наивысшей дозой изотианила (4 г акт. ингр./ 100 кг пос. мат.) и большей по сравнению с двумя низшими дозами изотианила (2,4 и 3,2 г акт. ингр. / 100 кг пос. мат.) и по сравнению с 2 дозами изотианила + трифлоксистробина 280FS или с валидамицином.

1. Применение стимулятора иммунной защиты для борьбы с Burkholderia glumae на рисе, Candidates Liberibacter spec. и/или Xanthomonas axonopodis pv. citri на цитрусовых, Pseudomonas syringae pv. actinidae на киви, Xanthomonas campestris и/или Xanthomonas campestris pv. pruni на персиках, Pseudomonas syringae pv. glycinea и/или Xanthomonas axonopodis pv. glycines на сое, Pseudomonas syringae и/или Pseudomonas syringae pv. tomato на томатах, Pseudomonas syringae, Pseudomonas syringae pv. lachrymans на огурцах и/или Streptomyces scabies на картофеле, где стимулятором иммунной защиты является изотианил.

2. Применение по п. 1, отличающееся тем, что стимулятор иммунной защиты или его комбинация присутствует в композиции, включающей как минимум еще одно соединение, выбранное из группы, к которой относятся бактерициды, антибиотики, фунгициды, гербициды, питательные микроэлементы и содержащие питательные микроэлементы соединения и липохитоолигосахаридные соединения (LCO).

3. Применение по п. 2, отличающееся тем, что как минимум еще одно соединение выбирают из группы, к которой относятся фозетил-Al, перфлуфен, стробилурины, медьсодержащие соединения, пропинеб и манкозеб, липохитоолигосахаридные соединения (LCO), касугамицин, стрептомицин и окситетрациклин.

4. Применение по п. 2 или 3, отличающееся тем, что стимулятором иммунной защиты является изотианил, и как минимум еще одно соединение выбирают из группы, к которой относятся фозетил-Al, перфлуфен, азоксистробин, трифлоксистробин, гидроксид меди, сульфат меди, оксихлорид меди, медь, пропинеб, манкозеб, липохитоолигосахаридные соединения (LCO), касугамицин, стрептомицин и окситетрациклин.

5. Способ борьбы с вредными бактериальными организмами на культурных растениях по п. 1, включающий обработку растений изотианилом.

6. Способ по п. 5, отличающийся тем, что обработанные растения являются трансгенными растениями.



 

Похожие патенты:

Группа изобретений относится к биотехнологии, а именно к буферным жидким композициям, предназначенным для хранения препаратов ДНК в жидком виде, а также для пропитки пористых носителей, используемых для сбора и хранения биологического материала.

Изобретение относится к соединениям формулы I: ,в которой R выбран из группы, состоящей из галогена; алкила; циклоалкила; алкенила; алкинила; алкокси и арила, замещенного от 0 до 5 заместителями, независимо выбранными из группы, состоящей из галогена, C1-C4алкила, C1-C4галогеналкила, C1-C4алкокси и C1-C4галогеналкокси; m представляет собой 0, 1, 2 или 3 и n представляет собой 0, 1, 2, 3 или 4; в которой сумма m и n представляет собой от 1 до 4, и способам их получения.

Изобретение относится к гетероциклилпиридинилпиразолам формулы (I), в которой R1-R5, X1, U, Q, W, a, b и n имеют значения, приведенные в формуле изобретения, и их агрохимически активным солям.

Изобретение относится к новым 2,6-дигалоген-5-алкокси-4-замещенные-пиримидинам формулы (I) и 2,6-дигалоген-5-алкокси-4-пиримидинкарбальдегидам формулы (II), которые могут быть использованы в качестве промежуточных соединений для получения гербицидов с широким спектром активности в борьбе с сорняками.

Изобретения относятся к сельскому хозяйству. Сложное азотно-фосфорно-калийное удобрение (NPK) содержит нитрат аммония, моноаммонийфосфат, сульфат кальция безводный, нитрат калия, хлорид аммония, причем массовая доля общего азота от 13-15%, массовая доля общих фосфатов в пересчете на Р2О5 от 11-15%, массовая доля калия в пересчете на К2О от 7-8%.

Изобретение относится к новой соли N1,N1,N4,N4-тетраметил-2-бутин-1,4-диамина с 2,4-дихлорофеноксиацетатом структурной формулы (1), обладающей гербицидной активностью. Соединения активны особенно в отношении однолетних и многолетних двудольных сорняков.

Изобретение относится к новой соли N1,N1,N4,N4-тетраметил-2-бутин-1,4-диамина с 2-метокси-3,6-дихлоробензоатом соответствующей структурной формулы (1). Соединение проявляет высокую гербицидную активность, особенно при борьбе с однолетними и многолетними двудольными сорняками, и может найти применение в сельском хозяйстве.

Изобретение относится к сельскому хозяйству, а именно к способу защиты вегетирующих растений подсолнечника от повреждающего действия 2,4-Д. Указанные растения обрабатывают этиловым эфиром 3-(2-метоксибензоиламино)-4,6-диметилтиено[2,3-b]пиридин-2-карбоновой кислоты в количестве 40 г/га через 1 сутки после использования гербицида.

Изобретение относится к сельскому хозяйству. Проводят обработку семян раствором, содержащим стимулятор роста растений, в качестве которого используют комплексный препарат, включающий в свой состав натриевые соли гиббереллиновых кислот, гумат калия (натрия) и неочищенный автолизат пивных дрожжей, содержащий живые дрожжевые клетки, при дозе автолизата пивных дрожжей 1,5-3 кг на тонну семян, дозе натриевых солей гиббереллиновых кислот 6,4-9,6 г на тонну семян и дозе гумата калия (натрия) 50-200 г на тонну семян.

Изобретение относится к сельскому хозяйству. Проводят обработку семян раствором, содержащим стимулятор роста растений, в качестве которого используют автолизат дрожжей Saccharomyces cerevisiae при дозе препарата 0,5-4 кг на тонну семян с живыми дрожжевыми клетками пекарских дрожжей при дозе 40-80 г на тонну семян.

Изобретение относится к сельскому хозяйству. Гербицид сплошного действия содержит водные растворы аддуктов N-(фосфонометил)-глицина со смесью фуллеренов фракции С50-С92, при следующем отношении, мас.%: аддукты N-(фосфонометил)-глицина со смесью фуллеренов фракции С50-С92- 0,01-0,1; вода - остальное.

Изобретение относится к сельскому хозяйству. Осуществляют предоставление по меньшей мере одного инсектицида, по меньшей мере одной этерифицированной жирной кислоты, где этерифицированная жирная кислота представляет собой метилолеат, по меньшей мере одного поперечно-сшивающего агента и по меньшей мере одного типа мономера.

Изобретение относится к сельскому хозяйству. Фунгицидная композиция содержит: А) производное тетразолилоксима формулы (I) и где - А представляет тетразоильную группу формулы (А1): где Y представляет алкильную группу; и - Het представляет пиридильную группу формулы (Het1) где Z представляет группу формулы QC(=O)NH-, где Q представляет алкоксильную группу, имеющую от 1 до 8 атомов углерода; и В) фунгицидное соединение, выбранное из списка, состоящего из биксафена, боскалида, азоксистробина, флуоксастробина, пираклостробина, трифлоксистробина, флуазинама, флудиоксонила, ипродиона, пропамокарба, пропамокарба гидрохлорида, протиоконазола, тебуконазола, ипроваликарба, хлорталонила, манкозеба, пропинеба, N-[2-(1,3-диметилбутил)фенил]-5-фтор-1,3-диметил-1Н-пиразол-4-карбоксамида, цимоксанила, фозетил-алюминия, фозетил-кальция, фозетил-натрия и пропамокарб-фозетилата, при массовом отношении А/В в диапазоне от 1/0,01 до 1/100.

Изобретение относится к сельскому хозяйству. .

Изобретение относится к сельскому хозяйству. .

Изобретение относится к инсектицидным и акарицидным материалам. .

Изобретение относится к сельскому хозяйству. .

Изобретение относится к сельскому хозяйству. .
Изобретение относится к биоцидной композиции, содержащей перекись водорода в концентрации 0,05-50% (мас./мас.) и соединение структуры формулы 1: (OH)(2-m)(X)(O)P-[(O)p -(R')q-(CH(Y)-СН2-O)n-R] m, или его соль, где Х является Н или ОН; каждый Y независимо является Н или СН3; m равно 1 и/или 2; каждый р и q независимо равны 0 или 1 при условии, что если р равно 0, q равно 1; каждый n независимо равен 2-10; каждый R' независимо является алкиленовым радикалом, содержащим 1-18 атомов углерода; каждый R независимо является Н или алкильным радикалом, содержащим 1-18 атомов углерода; и R'+R 20; в концентрации 0,01-60% (мас./мас.), в качестве биоцидной композиции.

Изобретение относится к амидам N-(1,2,5-оксадиазол-3-ил)-, N-(1,3,4-оксадиазол-2-ил)- и N-(тетразол-5-ил)-арилкарбоновых кислот формулы (I) в которой R означает алкил с 1-6 атомами углерода, алкенил с 2-6 атомами углерода, алкинил с 2-6 атомами углерода, (алкил с 1-6 атомами углерода)-OR1, (алкил с 1-6 атомами углерода)-COOR1, (алкил с 1-6 атомами углерода)-CN или бензил, W означает CY, X и Z в каждом случае независимо друг от друга означают галоген, алкил с 1-6 атомами углерода, галогеналкил с 1-6 атомами углерода или S(O)nR2, Y означает галоген, S(O)nR2 или 5-членный, частично насыщенный гетероарил с 2 гетероатомами, выбранными из N, О, замещенный s остатками цианогруппы, V означает водород, R1 означает алкил с 1-6 атомами углерода, R2 означает алкил с 1-6 атомами углерода, n означает 0, 1 или 2, s означает 1, Q означает остаток Q1, Q3 или Q4, R6 означает алкил с 1-6 атомами углерода или алкинил с 2-6 атомами углерода, причем эти 2 указанных выше остатка в каждом случае замещены s остатками из группы, состоящей из фенила, R8 означает алкил с 1-6 атомами углерода или галоген, R9 означает алкил с 1-6 атомами углерода, s означает 0 или 1.

Изобретение относится к стимуляторам иммунной защиты для борьбы с вредными бактериальными организмами на культурных растениях. Вредные бактериальные организмы выбирают из группы, к которой относятся Burkholderia glumae на рисе, Candidates Liberibacter spec. иили Xanthomonas axonopodis pv. citri на цитрусовых, Pseudomonas syringae pv. actinidae на киви, Xanthomonas campestris иили Xanthomonas campestris pv. pruni на персиках, Pseudomonas syringae pv. glycinea иили Xanthomonas axonopodis pv. glycines на сое, Pseudomonas syringae иили Pseudomonas syringae pv. tomato на томатах, Pseudomonas syringae, Pseudomonas syringae pv. lachrymans на огурцах иили Streptomyces scabies на картофеле. Стимулятором иммунной защиты является изотианил. Изобретение позволяет реализовать указанное назначение. 2 н. и 4 з.п. ф-лы, 2 ил., 16 табл.

Наверх