Набор олигонуклеотидных праймеров и зондов для идентификации вируса клещевого энцефалита, вируса лихорадки западного нила, боррелий и риккетсий методом мультиплексной пцр в режиме реального времени

Изобретение относится к области биотехнологии и медицины. Предложен набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации вируса клещевого энцефалита, вируса лихорадки Западного Нила, боррелий и риккетсий методом мультиплексной ПЦР в режиме реального времени. Изобретение обеспечивает набор праймеров и зондов для мультиплексной идентификации генетического материала четырех инфекционных патогенов, передающихся клещами. 4 ил., 4 табл., 2 пр.

 

Изобретение относится к набору диагностических праймеров и зондов для одновременного выявления генетического материала вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий и может быть использовано в биотехнологии, в частности в генетической инженерии, в медицине для выявления генетического материала вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий в образцах клещей, в клинических или секционных пробах с целью постановки диагноза или коррекции лечения, а также для решения научно-исследовательских задач по изучению клещевых инфекций, созданию диагностических, профилактических или лечебных препаратов.

На территории России широко распространены сочетанные очаги клещевых инфекций вирусной, бактериальной, риккетсиозной и протозойной природы. Имеются данные об инфицированности клещей одновременно несколькими патогенами, что ведет к возникновению микст-инфекций. Все это создает новую эпидемиологическую ситуацию, когда без решения вопросов дифференциальной диагностики невозможен успех в борьбе с этой большой группой заболеваний человека.

Клещевые инфекции поражают центральную нервную систему, различные органы и ткани. Неадекватная и запоздалая терапия может привести к развитию хронических заболеваний или инвалидности.

В настоящее время известны коммерческие наборы реагентов (аналоги) для обнаружения генетического материала возбудителей клещевых инфекций в исследуемых образцах:

- «АмплиСенс Borrelia burgdorferi sensu lato-FL». Набор предназначен для выявления 16S рРНК Borrelia burgdorferi sensu lato (B.burgdorferi sensu stricto, B.afzelii, B.garinii) в биологическом материале методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией по конечной точке;

- «АмплиСенс TBE-FL». Набор реагентов для проведения реакции обратной транскрипции РНК и ПЦР-амплификации кДНК участка генома вируса клещевого энцефалита (ВКЭ) с гибридизационно-флуоресцентной детекцией в режиме реального времени;

- «АмплиСенс WNV-FL». Набор реагентов для выявления PНК вируса Западного Нила в биологическом материале методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией;

- «РеалБест РНК ВКЭ», РУ № ФСР 2010/07633. Набор реагентов для выявления РНК вируса клещевого энцефалита методом ОТ-ПЦР в режиме реального времени;

- «РеалБест ДНК Borrelia burgdorferi s.l.», РУ №ФСР2010/06780. Набор реагентов для выявления ДНК боррелий комплекса Borrelia burgdorferi sensu lato (Borrelia afzelii, Borrelia garinii, Borrelia burgdorferi sensu strictо) методом ПЦР в режиме реального времени.

Данные наборы реагентов обладают достаточной чувствительностью и специфичностью, и с их помощью возможно выявление генетического материала боррелий, вирусов клещевого энцефалита и лихорадки Западного Нила. Однако все указанные наборы имеют в своем составе праймеры и зонды, позволяющие идентифицировать генетический материал инфекционных патогенов, передающихся иксодовыми клещами, только в моноплексном варианте, что требует четырех отдельных постановок ПЦР для идентификации четырех инфекционных патогенов. Использование разработанного набора олигонуклеотидных праймеров и зондов позволяет одновременно в одной реакционной ПЦР-смеси выявлять генетический материал вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий, что сокращает время проведения диагностики и делает исследование более полным, поскольку иксодовые клещи могут являться переносчиками одновременно нескольких инфекций.

Известны методы обнаружения генетического материала клещевых инфекций, предложенные в работах:

- [Hanaoka N, Matsutani M, Kawabata H, Yamamoto S, Fujita H, Sakata A, Azuma Y, Ogawa M, Takano A, Watanabe H, Kishimoto T, Shirai M, Kurane I, Ando S. Diagnostic assay for Rickettsia japonica // Emerg Infect Dis. 2009 Dec; 15(12):1994-7], где представлен набор олигонуклеотидов для диагностики риккетсиозов;

- [Yeh JY, Lee JH, Seo HJ, Park JY, Moon JS, Cho IS, Lee JB, Park SY, Song CS, Choi IS. Fast duplex one-step reverse transcriptase PCR for rapid differential detection of West Nile and Japanese encephalitis viruses // J Clin Microbiol. 2010 Nov; 48(11):4010-4], где предлагается набор праймеров для мультиплексной идентификации вируса лихорадки Западного Нила и вируса Японского энцефалита, методом ПЦР с детекцией продуктов амплификации методом гель-электрофореза;

- [Schwaiger M, Cassinotti P. Development of a quantitative real-time RT-PCR assay with internal control for the laboratory detection of tick borne encephalitis virus (TBEV) RNA // J Clin Virol. 2003 Jul; 27(2):136-45], в которой представлен набор олигонуклеотидов для детекции РНК вируса клещевого энцефалита;

- [Courtney JW, Kostelnik LM, Zeidner NS, Massung RF. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi // J Clin Microbiol. 2004 Jul; 42(7):3164-8], где представлен метод идентификации клещевых бактериальных инфекций, основанный на мультиплексной ПЦР с гибридизационно-флуоресцентной детекцией результатов в режиме реального времени.

Однако описанные в этих работах методы диагностики клещевых инфекций подразумевают либо моноплексный формат проведения ПЦР, либо применение набора праймеров и зондов для детекции только двух инфекций, либо применение гель-электрофоретической детекции продуктов амплификации, что делает метод более трудоемким и повышает риск контаминации продуктами амплификации ДНК.

Результаты патентного поиска по выявлению генетического материала вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий позволили определить несколько зарубежных аналогов, которые все же значительно отличаются от предлагаемого изобретения.

Известна патентная заявка США №20100278866, касающаяся метода ELISA клещевого энцефалита (КЭ), а не ПЦР диагностике,  не позволяет проводить экспресс диагностику КЭ на ранних стадиях заболевания и является более затратным по времени постановки реакции и уступает методу ПЦР по чувствительности.

Известна патентная заявка США №20110143358, касается метода сравнения нуклеотидных последовательностей клещевых инфекций масс-спектрометрией и не может быть использована в практической лабораторной диагностике ввиду высокой стоимости.

Известна патентная заявка США №20120171679, касается использования мультиплексных биочипов в составе роботизированного комплекса для экспресс-диагностики инфекционных агентов, в том числе во время биотеррористических актов. Данный комплекс предусматривает использование дорогостоящего оборудования и не может быть доступен при выполнении простых диагностических задач.

Патенты Китая №CN101967513 и №CN101886113 касаются современного метода LAMP-PCR. Однако данный метод не может быть использован в лабораторной диагностике в настоящее время, поскольку предназначен для использования только в полевых условиях, не является количественным, и, кроме того, до настоящего времени ни одна LAMP-PCR тест-система не получила разрешения для использования в клинической лабораторной практике. Кроме того, метод LAMP-PCR является более дорогостоящим по сравнению с традиционным ПЦР и не может быть использован в формате мультиплексного ПЦР.

Изобретения по патенту Испании №ES2264642 и международной заявке №WO2004005479 касаются выявлению возбудителей трансмиссивных инфекций методом ПЦР, но не позволяет проводить выявления вирусов клещевого энцефалита и Западного Нила. Кроме того, данный набор не зарегистрирован и недоступен на территории Российской Федерации. Стоимость диагностических тест-систем, произведенных за рубежом, значительно выше российских, что делает их недоступными в лабораторной практике.

Патент Китая №CN101629215 касается тест-системы для выявления вируса Западного Нила методом ПЦР в формате мультиплекс с инфекционными агентами, передающимися не клещами, а комарами, не являющимися эндемичными на территории России. Кроме того, стоимость диагностических тест-систем, произведенных за рубежом, значительно выше российских, что делает их недоступными в лабораторной практике.

Наиболее близким аналогом (прототипом), по мнению заявителя, является коммерческий набор реагентов для выявления РНК/ДНК возбудителей инфекций, передающихся иксодовыми клещами: TBEV, Borellia burgdorferi sl, Anaplasma phagocytophilum, Ehrlichia chaffeensis / Ehrlichia muris, в биологическом материале методом ПЦР с гибридизационно-флуоресцентной детекцией - «АмплиСенс TBEV, B.burgdorferi sl, A.phagocytophilum, E.chaffeensis / E.muris-FL». Применением данного набора реагентов возможно проведение мультиплексной ПЦР для идентификации нескольких инфекций (http://www.interlabservice.ru/upload/ iblock/44c/tbev_-b.-burgdoferi-sl_-a.-phagocytophilum_-e.-chaffeensis_e.-muris-_zaregistr_-_new_pm_010416.pdf).

Однако конструкция данного набора реагентов исключает возможность определения генетического материала вируса лихорадки Западного Нила и бактерий семейства Rickettsiae, являющихся возбудителями большой группы трансмиссивных острых лихорадочных заболеваний.

Техническим результатом заявляемого изобретения являлась разработка неизвесного ранее набора олигонуклеотидных праймеров и зондов для мультиплексной идентификации генетического материала четырех инфекционных патогенов, передающихся клещами: вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий в образцах клещей, в клинических и секционных образцах и вируссодержащих пробах (культуральная вируссодержащая жидкость и т.д.), методом ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени.

Указанный технический результат достигается тем, что создан набор олигонуклеотидных праймеров и флуоресцентно меченых зондов для идентификации вируса клещевого энцефалита, вируса лихорадки Западного Нила, боррелий и риккетсий методом мультиплексной ПЦР в режиме реального времени, включающий:

- последовательности, видоспецифичные для вируса клещевого энцефалита:

Праймеры:

Зонд:

- последовательности, видоспецифичные для вируса лихорадки Западного Нила:

Праймеры:

Зонд:

- последовательности, родоспецифичные для боррелий:

Праймеры:

Зонд:

- последовательности, родоспецифичные для риккетсий:

Праймеры:

Зонд:

где присутствие в нуклеотидной последовательности:

N=A или С или G или Т,

FAM, ROX, R6G или Су5 - флюоресцентный краситель,

Гс - флюоресцентный гаситель BHQ1 или BHQ2.

Изобретение иллюстрируется графиками на фиг. 1, представляющими собой кривые флуоресценции на четырех оптических каналах амплификатора Rotor Gene 6000 (Corbett Research, Австралия). Флуоресценция десятикратных последовательных разведений (1-8) в образцах, содержащих: генетический материал: фиг. 1, А - вируса клещевого энцефалита (FAM/Green), фиг. 1, Б - вируса лихорадки Западного Нила (R6G/Yellow), фиг. 1, В - боррелий (RED/Cy5) и фиг. 1, Г - риккетсий (ROX/Orange).

На начальном этапе для каждого из детектируемых инфекционных патогенов были подобраны и синтезированы пары специфических олигонуклеотидных праймеров и зонды. Для этого в базе данных NCBI (http://www.ncbi.nlm.nih.gov/) были выбраны консервативные участки геномов каждого из агентов: для каждого из детектируемых инфекционных патогенов подбирались олигонуклеотидные праймеры и флуоресцентно-меченые зонды на консервативные области геномов возбудителей (для вируса клещевого энцефалита - 5′-концевой участок гена, кодирующего белок С; для вируса Западного Нила - участок гена, кодирующего полимеразу; для боррелий - 23S рРНК; для риккетсий - 16S рРНК и оптимизацией условий проведения ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени.

Подбор и анализ свойств олигонуклеотидных праймеров и зондов проводился с использованием программного обеспечения Vector NTI 9.0.0 (InforMax).

Причем при разработке представленных в настоящей заявке на изобретение диагностических праймеров было синтезировано несколько пар праймеров с различной первичной структурой, с каждой из которых были проведены соответствующие исследования. Эмпирическим путем была определена наиболее подходящая пара праймеров, обладающая наибольшей аналитической чувствительностью и 100%-ной специфичностью на панели заявленных образцов. Надо отметить, что структура данных праймеров отличалась от наиболее оптимальной структуры, рассчитанной с использованием программы (VectorNTI).

Поскольку одна часть праймеров видоспецифична (вирус клещевого энцефалита, вирус лихорадки Западного Нила), а другая - родоспецифична (риккетсии и боррелии) и предназначены для идентификации генетического материала патогенов, относящихся к различным родам и видам, то вместо известных нуклеотидных последовательностей были использованы последовательности генов, полученных путем множественного выравнивания с использованием различных алгоритмов, что требует квалифицированных научных исследований, что подтверждает новизну и изобретательский уровень предлагаемого технического решения.

В работе, помимо дизайна структуры праймеров и олигонуклеотидного зонда, получены положительные контрольные образцы, представляющие собой рекомбинантные плазмиды со встройкой целевого гена-мишени (рекомбинантную плазмиду, несущую фрагмент гена, являющийся матрицей для амплификации спецефических ДНК-фрагментов). С использованием положительного контроля эмпирическим путем подобрана оптимальная температура отжига диагностических праймеров, которая отличается от теоретической, рассчитанной с использованием компьютерных программ. Также эмпирическим путем установлена аналитическая чувствительность данных пар праймеров/зонд для идентификации детектируемых патогенов (вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий), что также подтверждает новизну и изобретательский уровень предлагаемого технического решения.

Последовательности праймеров и зондов, полученные в результате научных и экспериментальных исследований, представлены в таблице 1 и в приложении к заявке.

Таблица 1

Праймеры и зонды для детекции вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий

Агент Праймеры и зонды Структура олигонуклеотидной последовательности
Вирус клещевого энцефалита
(TBE)
F69 GTGTTGAGAAAAAAGACAGCTTAGGAGA
R249 TCAACACNAGNCCATTTGGCAT
Z162 Кр*-TCTTTCGACACTCGTCTAGGTGGACCGC- Гс**
Вирус лихорадки Западного Нила (WNV) F1 AATCCTGGAGAGTTCGGNAATGC
R237 TCCCATCCNGCNGTGTCATC
Z28 Кр*-CAGCAGTGCCATCTGGTTCATGTG- Гс**
Боррелии
(Borrelia sp.)
F666 CGAGTCTTAAANGGGCGATTTAGT
R787 GCTTCAGCCTGGCCATAAATAG
Z763 Кр*-AGATGTGGTAGACCTGAAGCCGAGTG- Гс**
Рикктесии
(Rickettsia sp.)
F380 TCTCATCCTATGGCTATTATGCTT
R639 ATAAATATNTTATTAAGAGCATTTTTTATT
Z470 Кр*-AACTTATTGCTATTAGAATGATTGCTAAGATACC- Гс**

Примечание: Кр*- краситель; Гс**-гаситель.

Пример 1. Создание положительных контрольных образцов и проверка аналитической чувствительности набора

Для контроля амплификации были получены синтетические положительные контрольные образцы, представляющие собой рекомбинантные плазмиды, несущие вирусспецифические ДНК фрагменты, являющиеся матрицей для амплификации со специфических праймеров.

Рекомбинантная плазмидная ДНК pCR2.1® (Invitrogen, США), обеспечивающая в ПЦР синтез ДНК-ампликонов, соответствующих участкам геномов вируса клещевого энцефалита, вируса лихорадки Западного Нила, боррелий и риккетсий, характеризуется следующими признаками:

- имеет молекулярную массу 2878,3 kDa;

- имеет размер 4435 пар оснований (п.о.);

- состоит из плазмиды pCR2.1® (Invitrogen, США) размером 3931 п.о. с фрагментом LacZα, полилинкером, T7 промотером, участками f1 ori и pUC ori, генами устойчивости к канамицину и ампицилину [Invitrogen. TOPO TA Cloning® Five-minut cloning of Taq polymerase-amplified PCR products. User Manual. Version U. 10 April 2006];

- содержит фрагмент ДНК, специфичный для одного из детектируемых патогенов (вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий).

Фрагменты ДНК размером 180, 236, 121, 259 п.о., комплиментарные участкам детектируемых патогенов получали в ПЦР c праймерами (таблица 1) и кДНК вируса клещевого энцефалита, вируса лихорадки западного Нила, боррелий, риккетсий. Результат реакции учитывали методом электрофореза в 3%-агарозном геле. Полученные в ПЦР ДНК-фрагменты очищали из агарозного геля и использовали для получения рекомбинантных плазмид. Подготовку pCR2.1® Vector и проведение ТА-клонирования осуществляли с использованием набора TOPO TA Cloning Kit (Invitrogen, США) в соответствии с инструкцией производителя [Invitrogen. TOPO TA Cloning® Five-minut cloning of Taq polymerase-amplified PCR products. User Manual. Version U. 10 April 2006]. Рекомбинантные плазмиды использовали для трансформации клеток Е.coli штамма Top 10 (Invitrogen, США). Плазмидную ДНК выделяли из ампицилин-устойчивых колоний. Методом ПЦР осуществляли анализ эффективности молекулярной трансформации.

Для проведения ПЦР в режиме реального времени в качестве анализируемых образцов использовали рекомбинантные плазмидные ДНК, полученные выделением из компетентных бактериальных клеток E. coli, включающие вставки ДНК, соответствующие детектируемым участкам геномов.

Условия проведения амплификации оптимизировались по следующим параметрам: концентрация ионов магния в реакционной смеси; концентрация праймеров и зондов в реакционной смеси; температура отжига праймеров.

Для определения аналитической чувствительности метода из концентрированного раствора плазмидной ДНК для каждого детектируемого патогена были приготовлены последовательные 10-кратные разведения. Определение концентрации ДНК в разведениях при исследовании чувствительности осуществляли при помощи флуориметра QUBIT (Invitrogen, США) и наборов реагентов производителя Quant-iT dsDNA HS Assay Kit.

ПЦР в режиме реального времени и регистрацию результатов проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия) по каналам FAM /Green (470 nm /510 nm), R6G/Yellow (530nm/555nm), RED/Cy5 (625-660), ROX/Orange (558-610) и в приборе CFX96 (Bio-Rad, США).

Минимальное количество ДНК-матриц, детектируемое с применением полученных праймеров и зондов, после оптимизации условий проведения реакции, выраженное в ГЭ (геномных эквивалентах) в 30 мкл реакционной смеси, представлено в таблице 2.

Таблица 2

Аналитическая чувствительность ПЦР в режиме реального времени

Название агента Геномные эквиваленты (ГЭ)
ВКЭ 3×102
ВЗН 2×102
Боррелии 3×102
Риккетсии 2×102

Пример 2. Определение генетического материала вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий в образцах клещей

Оценку эффективности выявления генетического материала вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий проводили на образцах клещей (сывороток крови, спинномозговой жидкости от больных, или КВЖ), из коллекции ФБУН ГНЦ ВБ «Вектор».

Предварительную инактивацию образцов и выделение ДНК/РНК проводили в условиях, регламентированных Методическими указаниями МУ 1.3.2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности».

Процедуру выделения ДНК/РНК из исследуемого материала проводили с использованием набора «Комплект реагентов для выделения ДНК/РНК из сыворотки или плазмы крови» (НПФ Литех, Россия) в соответствии с инструкцией по применению.

Реакцию обратной транскрипции проводили с использованием набора реагентов «Реверта-L» (ЦНИИЭ, Россия) или набора для обратной транскрипции MMLV RT Kit (Евроген, Россия) в соответствии с инструкцией по применению.

Мультиплексную ПЦР в режиме реального времени проводили в реакционной смеси следующего состава (на 1 исследование):

кДНК 5 мкл
10×Taq буфер без Mg2+(Медиген) 3 мкл
100 mM раствор MgCl2 1 мкл
5 mM раствор dNTP 1 мкл
Смесь праймеров
(концентрация каждого 10-15 мкмол/л) 8 мкл
Зонды (концентрация 5-10 мкмол/л) 4 мкл
SmartTaq ДНК-полимераза (Медиген) 0,3 мкл
Вода для ПЦР 7,7 мкл

____________________________________________

Общий объем 30 мкл

В качестве отрицательного контрольного образца в реакционную смесь добавляли ТЕ-буфер.

ПЦР в режиме реального времени и регистрацию результатов проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия) по следующей программе:

Температура (°С) Время (минуты:секунды) Количество циклов
95 05:00 1
95 00:10 45
54 00:20 (Flu)
72 00:20

Детекцию сигнала флуоресценции осуществляли при шаге циклирования 54°С, для вируса клещевого энцефалита – по каналу FAM/Green; для вируса лихорадки Западного Нила - по каналу RED/Cy5; для риккетсий - по каналу ROX/Orange; для боррелий - по каналу R6G/Yellow.

Результаты интерпретировали на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией, что соответствует наличию (или отсутствию) значения порогового цикла Ct в соответствующей графе в таблице результатов. Результат считали положительным в случае, если кривая накопления флуоресценции для соответствующего образца имела характерную «сигмовидную» форму и пересекала пороговую линию. При этом значение Ct для данного образца было не больше 40 (фиг. 1).

Таким образом, вышеприведенное описание подтверждает достижение заявляемого технического результата, а именно: разработан неизвесный ранее набор олигонуклеотидных праймеров и зондов для мультиплексной идентификации генетического материала четырех инфекционных патогенов, передающихся клещами: вируса клещевого энцефалита, вируса лихорадки Западного Нила, риккетсий и боррелий в образцах клещей, в клинических и секционных образцах и вируссодержащих пробах (культуральная вируссодержащая жидкость и т.д.), методом ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени.

Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации вируса клещевого энцефалита, вируса лихорадки Западного Нила, боррелий и риккетсий методом мультиплексной ПЦР в режиме реального времени, включающий:

- последовательности, видоспецифичные для вируса клещевого энцефалита:

Праймеры:

5' GTGTTGAGAAAAAAGACAGCTTAGGAGA 3'

5' TCAACACNAGNCCATTTGGCAT 3'

Зонд:

FAM-TCTTTCGACACTCGTCTAGGTGGACCGC-Гс

- последовательности, видоспецифичные для вируса лихорадки Западного Нила:

Праймеры:

5' AATCCTGGAGAGTTCGGNAATGC 3'

5' TCCCATCCNGCNGTGTCATC 3'

Зонд:

Cy5-CAGCAGTGCCATCTGGTTCATGTG-Гс

- последовательности, родоспецифичные для боррелий:

Праймеры:

5' CGAGTCTTAAANGGGCGATTTAGT 3'

5' GCTTCAGCCTGGCCATAAATAG 3'

Зонд:

R6G-AGATGTGGTAGACCTGAAGCCGAGTG-Гс

- последовательности, родоспецифичные для риккетсий:

Праймеры:

5' TCTCATCCTATGGCTATTATGCTT 3'

5' ATAAATATNTTATTAAGAGCATTTTTTATT 3'

Зонд:

ROX-AACTTATTGCTATTAGAATGATTGCTAAGATACC-Гс,

где присутствие в нуклеотидной последовательности:

N=A, или С, или G, или Т,

FAM, ROX, R6G или Су5 - флюоресцентный краситель,

Гс - флюоресцентный гаситель BHQ1 или BHQ2.



 

Похожие патенты:

Настоящее изобретение касается способа предварительной оценки, будет ли терапевтическое средство, выбранное из группы полипептид, антитело или иммуноадгезин, иметь необходимую скорость выведения у яванского макака, человека.

Изобретение относится к области биотехнологии и производству противоящурных вакцин и предназначено для определения концентрации 146S-компонента вируса ящура в сырье.

Изобретение относится к области медицины и предназначено для определения риска развития артериальной гипертензии. Осуществляют забор венозной крови, выделение генетического материала, проведение полимеразной цепной реакции (ПЦР) в режиме реального времени и определение инсерции/делеции (I- и D-аллели) Alu-фрагмента гена ангиотензинпревращающего фермента.

Изобретение относится к области медицины, а именно к способу диагностики острого лимфобластного лейкоза у пациента, включающий выявление признаков лейкоза, тестирование клеток крови на лейкоз, инкубирование клеток крови фактором, идуцирующим лейкоз, с тем, чтобы индуцировать экспрессию клеточных поверхностных маркеров, которые являются признаком лейкоза, где фактор, индуцирующий лейкоз - это супернатант Aspergillus flavus, EBV-инфицированный CCL87 супернатант, очищенная EBV культура или их комбинации.

Изобретение относится к биологи и медицине, а именно к иммуноанализу, в частности к электрохимическим способам определения содержания вирусов/антигенов вирусов кори.

Изобретение относится к медицине и описывает способ идентификации модуляторов активности фермента катехол-O-метилтрансферазы (СОМТ), включающий а) получение 4-нитрокатехола, ковалентно связанного с Alexa Fluor® 488, б) приведение в контакт молекулы из этапа а) с ферментом катехол-O-метилтрансферазой (COMT), S-аденозилметионином (SAM) и соединением-кандидатом и в) измерение показателей флуоресценции смеси из этапа б), в котором измененные показатели флуоресценции в присутствии соединения-кандидата по сравнению с контролем являются признаком наличия модулятора фермента катехол-O-метилтрансферазы (COMT).

Изобретение относится к области молекулярной биологии и медицины и предназначено для обнаружения модифицированных нуклеотидов в составе РНК. Осуществляют подбор подходящей для исследуемой области РНК пары олигонуклеотидных зондов, подбор пары донора и тушителя флуоресценции с подходящими оптическими свойствами.

Изобретение относится к способам определения эффективности лиганда ионного канала. Ex vivo способ определения эффективности лиганда ионного канала in vivo в зависимости от присутствия плазмы, включает стадии: a) приведение клетки, экспрессирующей ионный канал, в контакт с i) плазмой животного и ii) лигандом ионного канала и b) определение эффекта лиганда ионного канала на клетку, или a) приведение клетки, экспрессирующей ионный канал, в контакт с i) плазмой животного и ii) соединением, которое определяют как лиганд ионного канала, и b) определение эффекта соединения на клетку, или a) приведение клетки, экспрессирующей ионный канал, в контакт с плазмой животного, которому был введен лиганд ионного канала, и b) определение эффекта лиганда ионного канала на клетку.

Изобретение относится к способу маркировки парных спиральных филаментов (PHF), включающему взаимодействие PHF с соединением и детектирование присутствия указанного соединения, где соединение имеет формулу , в которой -R- означает , -Q- выбран из: -NHC(O)-, -N=N-, -CH=CH-; -P выбран из: ; -T выбран из: ; X представляет собой N или CH; -W1-6, -G1-4, -Р1-5 являются такими, как указано в формуле изобретения.

Изобретение относится к области молекулярной биологии и медицинской диагностики. Предложен способ детекции белков в амилоидном состоянии, в котором получают образец лизата культуры дрожжей или ткани млекопитающего, добавляют к образцу ионный детергент, концентрируют белки в амилоидной форме на ацетатцеллюлозной мембране и детектируют их с использованием аптамеров, их конъюгатов или антител, специфичных к амилоидной форме белков.

Изобретение относится к области биомедицины и касается способа диагностирования острого повреждения почек и применения in vitro набора, содержащего праймеры, необходимые для выполнения способа.

Изобретение относится к области ветеринарии. Предложен способ профилактики африканской чумы свиней, включающий выявление животных с инфекционным заболеванием на начальной стадии развития, убой больных и дальнейшее обследование остальных животных.

Изобретение относится к области биохимии. Описана группа изобретений, включающая способ выявления РНК и ДНК из сухих биологических образцов и набор для выделения РНК и ДНК из сухих биологических образцов.

Предложенная группа изобретений относится к области медицины. Предложен способ неинвазивной пренатальной диагностики анеуплоидий плода, включающий выделение внеклеточной ДНК (вкДНК) из образца крови, полученной у беременной женщины, выбор регионов генома для проведения амплификации, приготовление геномных библиотек, картирование полученных последовательностей на референсный геном или части генома человека с определением их координат, определение значения покрытия для каждого региона генома, характеризующегося открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%, и получение регионов генома с указанной открытостью хроматина, после чего делается вывод о наличии анеуплоидий плода.

Изобретение относится к области медицины и касается способа прогнозирования повышенного риска субарахноидального кровоизлияния вследствие разрыва аневризмы сосудов головного мозга у лиц азиатской расы.

Изобретение относится к области молекулярной биологии и медицины и предназначено для диагностики наличия мутации L576P гена c-KIT в тканях меланомы. Оценку наличия мутации проводят по соотношениям значений пороговых циклов Ct в трех реакциях ПЦР в реальном времени с аллель-специфичными праймерами.

Изобретение относится к области биотехнологии. Предложена тест-система для мультиплексного количественного анализа экспрессии генов интерферона лямбда, противовирусного белка МхА и интерлейкина 23 на основе обратной транскрипции в сочетании с полимеразной цепной реакцией в реальном времени, включающая специфические праймеры и соответствующие им флуоресцентные гидролизуемые зонды, а также отрицательный и положительные контрольные образцы.

Настоящее изобретение относится к области молекулярной биологии и биотехнологии. Изобретение обеспечивает способ генетической паспортизации штаммов Bacillus thuringiensis с помощью проведения мультиплексного экспресс-анализа референтных последовательностей ДНК.

Изобретение относится к области биотехнологии, а именно к способу определения биологической активности дефибротида. Приводят в контакт дефибротид, эуглобулин млекопитающего и субстрат, специфичный для плазмина, который в результате реакции с плазмином дает измеряемый продукт.

Изобретение относится к области биотехнологии и медицины. Предложен способ одновременной диагностики наследственных заболеваний на основе использования биочипа с иммобилизованными на его поверхности олигонуклеотидными мишенями, включающий детекцию точковых мутаций в генах CUL7, NBAS, DIA1, FAH и GJB2, вызывающих 3М синдром, SOPH синдром, наследственную энзимопеническую метгемоглобинемию 1 типа, тирозинемию 1 типа и наследственную несиндромальную глухоту 1А типа, соответственно.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для ранней диагностики цервикальных интраэпителиальных неоплазий (ЦИН). Выявляют патологию шейки матки. Определяют уровень экспрессии маркеров-предикторов с помощью вестерн-блот анализа с детекцией хемилюминисценции и ПЦР в реальном времени. При значениях уровней экспрессии HIF1alpha 0,029, GLUT1 782,9±156,5, IGFBP-3 0,038±0,0076, HK2 36,4, VDAC1 70 диагностируют ЦИН1 (LSIL). При значениях уровней экспрессии HIF1alpha 0,03, GLUT1 1154,2±88,7, IGFBP-3 0,02±0,005, HK2 44,9, VDAC1 87 диагностируют ЦИН2-3 (HSIL). Изобретение обеспечивает эффективную диагностику ЦИН на более ранних этапах. 5 ил., 1 табл., 3 пр.

Изобретение относится к области биотехнологии и медицины. Предложен набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации вируса клещевого энцефалита, вируса лихорадки Западного Нила, боррелий и риккетсий методом мультиплексной ПЦР в режиме реального времени. Изобретение обеспечивает набор праймеров и зондов для мультиплексной идентификации генетического материала четырех инфекционных патогенов, передающихся клещами. 4 ил., 4 табл., 2 пр.

Наверх