Комбинация синбиотиков для улучшения мозговой деятельности

Изобретение относится к питательным композициям для младенцев и маленьких детей. Предложено применение глутамина, Bifidobacterium breve и по меньшей мере одного неусваиваемого олигосахарида для изготовления питательной композиции для улучшения когнитивных или поведенческих характеристик, когнитивного или поведенческого развития, социального взаимодействия и/или нейровоспаления у младенцев или детей, начинающих ходить. При этом младенец или ребенок, начинающий ходить. страдает от аллергии или находится под риском аллергии, либо страдает от кишечного воспаления. При этом неусваиваемый олигосахарид выбран из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты. Глутамин находится в форме свободных аминокислот, дипептидов, и/или трипептида. Предложена питательная композиция, содержащая белок, жир, усваиваемый углевод и дополнительно содержащая: Bifidobacterium breve в количестве от 102 до 1013 КОЕ на г сухой массы питательной композиции, по меньшей мере один неусваиваемый олигосахарид, выбранный из фруктоолигосахаридов и галактоолигосахаридов, в количестве от 0,5 до 20 мас. % в расчете на сухую массу питательной композиции, по меньшей мере 4 мас. % глутамина (в форме свободных аминокислот, дипептидов, и/или трипептида) в расчете на сухую массу питательной композиции и LC-PUFA в виде или арахидоновой кислоты, и/или докозагексаеновой кислоты. Также заявлен набор компонентов, включающий первый контейнер, содержащий глутамин и неусваиваемый олигосахарид, и второй контейнер, содержащий Bifidobacterium breve. Изобретение позволяет улучшить мозговую деятельность и когнитивные функции у младенцев и детей младшего возраста, страдающих от аллергии, воспаления или атопического заболевания. 4 н. и 12 з.п. ф-лы, 6 табл., 9 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение касается питательных композиций, содержащих синбиотики, для применения с целью улучшения мозговой деятельности и когнитивных функций, в частности, характеристик социального взаимодействия и пространственной памяти. Изобретение особенно подходит для младенцев в возрасте 6 месяцев или менее, недоношенных младенцев и младенцев или детей младшего возраста, страдающих от воспаления, аллергии или атопического заболевания.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Повышенное внимание вызывает связь кишечника и головного мозга и роль, которую играет питание в этой связи. Существует сложная двусторонняя система связи между кишечником и головным мозгом, которая обеспечивает желудочно-кишечный гомеостаз и поддерживает пищеварение и которая в обратном направлении может влиять на когнитивную и психологическую функцию и поведение. У некоторых субъектов эта связь между кишечником и головным мозгом нарушена, в результате чего появляется сопутствующая патология между воспалением кишечника и повышенной тревожностью, депрессией, измененной чувствительностью к боли и/или пониженными когнитивными функциями.

Такие сопутствующие патологии являются нежелательными особенно у младенцев и детей, начинающих ходить, поскольку в период младенчества когнитивная система еще развивается, и нарушение этого развития может иметь длительные последствия. Перинатальная пластичность головного мозга повышает уязвимость в отношении ранних стрессовых состояний, таких как повторяющаяся боль или воспаление, что может приводить к нарушениям когнитивного развития и поведения.

Грудное вскармливание является предпочтительным способом кормления грудных младенцев. Однако есть обстоятельства, которые делают грудное вскармливание невозможным или менее желательным. В этих случаях хорошей альтернативой являются детские смеси. Состав современных смесей для детского питания адаптирован таким образом, что он соответствует многим специальным требованиям по питанию быстро растущего и развивающегося младенца. Кроме того, можно сделать дополнительные усовершенствования. Настоящее изобретение касается питательных композиций для младенцев, в частности, детских смесей, которые содержат конкретные ингредиенты для улучшения когнитивных функций и поведения.

В WO 2012/092160 и US2012/0171165 раскрыты питательные композиции, включающие олигосахариды человеческого грудного молока, которые можно вводить индивидуумам, в том числе недоношенным младенцам, младенцам, детям, начинающим ходить, и детям для улучшения функции желудочно-кишечного тракта и переносимости, а также для развития полезных бактерий. Раскрыты также дополнительные подходящие способы применения питательных композиций, включающих олигосахариды человеческого грудного молока. В WO 2011/051482 раскрыты питательные композиции для младенцев и/или детей, включающие лактоферрин и пробиотики. В WO 2008/111832 раскрыта терапия, направленная на развитие лингвистических и/или социальных навыков у младенцев посредством введения компонентов, стимулирующих развитие здоровой кишечной флоры.

В WO 20011/047107 и заявке США 2011/086809 раскрыт способ поддержки развития сетчатки, кишечной и/или нервной системы у новорожденных, обеспечивающий дипептид аргинин-глутамин. Многочисленные другие ингредиенты указаны как компоненты детских смесей, которые можно использовать для введения дипептида. Эффекты, подтверждаемые в примерах, представляют профилактику ретинопатии у недоношенных на мышиной модели кислород-индуцированной ретинопатии и защиту от поражения кишечника и головного мозга, индуцированного гипероксией, на мышиной модели при мониторинге активности каспазы-3 и «показателя поражения кишечника».

В заявке США 2007/207132 раскрыт препарат, содержащий Bifidobacterium breve и смесь неусваиваемых углеводов, для младенцев без грудного вскармливания или на частичном грудном вскармливании, а также его применение для обработки с целью профилактики иммунных нарушений у младенцев без грудного вскармливания или на частичном грудном вскармливании.

В JP19950099779, согласно реферату, раскрыта композиция, улучшающая способность к обучению, включающая производное олигосахарида, содержащее сиаловую кислоту.

В работе Olubukunola и др. "Перфорация кишечника у младенцев с очень низкой массой тела при рождении: рост и нейроразвитие в возрасте 1 года" J. Perinatology vol. 25, №9 (2005) 583-589 [XP002704986] сравнивается рост и нейроразвитие у выживших младенцев с очень низкой массой тела при перфорации кишечника, вызванной некротическим энтероколитом, и при спонтанной перфорации кишечника. Вмешательство не раскрывается.

В работе Field и др. "Сравнение симптомов, используемых матерями и медсестрами, для идентификации колик у младенца" Int. J. Nursing Studies vol. 31, №2 (1994) 201-215 [XP022870583] рассматриваются способы, по которым родители предполагают идентифицировать колики с различными факторами, включающими пищевое поведение, тревожность матери, пищу ребенка и матери и стресс ребенка. Вмешательство не раскрывается.

В заявке США 2011/208153 описаны составы и способы доставки водорастворимых и липидорастворимых питательных веществ для профилактики или коррекции недостатка питательных веществ у субъектов, нуждающихся в обеспечении питательными веществами при малом объеме, таких как недоношенные дети. Питательная композиция, содержащая жирные кислоты, такие как DHA и/или ARA, аминокислоты, такие как аргинин и глутамин, и других питательные вещества, подходит для доставки через назогастральный зонд, внутрижелудочного кормления и транспилорического введения. Среди многих других компонентов пребиотики упоминаются только в качестве дополнительного ингредиента. B. breve не упоминается среди различных ингредиентов, и согласно описанию предпосылок, глутамин может быть ингредиентом в качестве основного топлива для быстро делящихся клеток, таких как кишечные энтероциты и лимфоциты.

В работе De Kieviet и др. "Влияние глутамина на развитие мозга у сильно недоношенных детей в школьном возрасте", Pediatrics vol. 130, №5 (2012) 1121-1127 [SP009168039] изучается эффект краткосрочного введения глутамина сильно недоношенным детям в первый месяц после рождения на развитие головного мозга в дальнейшей жизни, в школьном возрасте. О подобном исследовании сообщается в работе De Kieviet и др. "Эффекты энтерального снабжения глутамином новорожденных сильно недоношенных детей и/или детей с очень низкой массой при рождении на когнитивные, двигательные и поведенческие результаты в школьном возрасте" British J. Nutrition, vol. 108, №12 (2012) 2215-2220. На основании результатов применяемых поведенческих тестов сделан вывод, что добавка глутамина между 3 и 30 днями жизни сильно недоношенных и/или VLBW-детей не оказывает ни полезных, ни вредных эффектов на долгосрочные когнитивные, двигательные и поведенческие результаты в школьном возрасте, хотя визиомотрные способности хуже, у детей, которые получают глутамин.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Заявители неожиданно обнаружили, что при использовании животных моделей пищевая добавка с Bifidobacterium breve в комбинации с неусваиваемыми олигосахаридами, предпочтительно также в сочетании с глутамином, дает в результате улучшенные когнитивные и поведенческие характеристики. В частности, обнаружено, что снижаются уровни беспокойства и улучшается пространственная память. В предпочтительном варианте осуществления, в частности, сильно и/или в значительной степени улучшается пространственная память. В другом предпочтительном варианте осуществления также сильно и/или в значительной степени улучшается социальное взаимодействие.

Кроме того, заявители обнаружили, что мыши, сенсибилизированные к овальбумину (OVA) в качестве модели пищевой аллергии или атопии, мыши, ранее подвергшиеся воздействию аллергена, демонстрируют более высокие уровни тревоги и нарушение пространственной памяти по сравнению с контрольными мышами, хотя в момент тестирования не применяется воздействие аллергена. Кроме того, экспрессия матричной РНК (мРНК) нейротрофического фактора головного мозга (BDNF) и p-гликопротеина в гиппокампе повышается у мышей, предварительно подвергаемых действию аллергена. FACS-анализ гомогенизированных клеток гиппокампа этих животных выявляет повышение OVA-индуцированных CD11c+F4/80+CD68- макрофагов. Повышенные уровни макрофагов, наблюдаемые в головном мозге OVA-аллергических мышей, происходят в результате циркуляции, что в комбинации с наблюдаемым снижением гематоэнцефалического барьера подразумевает роль приносимых с периферии моноцитов в индуцировании снижения функции головного мозга, наблюдаемого у аллергических мышей. Имеющиеся данные показывают, что зависимое от аллергии или атопии периферическое воспаление модифицирует воспалительный статус и гасит когнитивные способности животных, указывая, что аллергия играет некоторую роль в развитии и/или прогрессировании неврологических расстройств, таких как когнитивные и поведенческие нарушения и нейровоспаление. Таким образом, насколько известно заявителям, впервые было показано, что субъекты, страдающие от аллергии или атопии, имеют симптомы, аналогичные нарушению оси кишечник-головной мозг.

Обнаружено, что OVA-индуцированные аберрантные когнитивные, поведенческие и молекулярные изменения возвращаются к уровням, наблюдаемым у неаллергических контрольных мышей, при добавке к пище Bifidobacterium breve в комбинации с неусваиваемыми олигосахаридами (синбиотиками), показывая, что у аллергических мышей это диетическое вмешательство приводит к еще более заметному улучшению когнитивных и поведенческих характеристик. Кроме того, повышенное количество OVA-индуцированных CD11c+F4/80+CD68- макрофагов уменьшается при лечении синбиотиком. Лечение синбиотиком дает повышенный уровень клеток CD11bCD68+F4/80low.

Используя мышиную модель с декстрансульфатом натрия (DSS) для индуцирования воспаления кишечника, обнаружили, что DSS-обработанные мыши демонстрируют более высокие уровни беспокойства и нарушения пространственной памяти, тогда как двигательная активность не затрагивается. Воздействие синбиотиков ослабляет эти эффекты в значительно большей степени, чем можно было бы ожидать, основываясь на противовоспалительном эффекте одних синбиотиков. Более того, данные показывают, что композиция синбиотиков является более эффективной, чем отдельно используемые B. breve или неусваиваемые олигосахариды.

Поэтому использование B. breve вместе с неусваиваемыми олигосахаридами особенно подходит для улучшения когнитивных и поведенческих характеристик у младенцев и маленьких детей, в частности, у младенцев в возрасте 6 месяцев или менее, недоношенных детей, маленьких для гестационного возраста (SGA) младенцев, младенцев, родившихся с помощью кесарева сечения, младенцев и детей младшего возраста, страдающих или находящихся под риском аллергии, и младенцев и маленьких детей, страдающих от воспаления кишечника.

Кроме того, заявители обнаружили, что модель аллергии на коровье молоко (СМА) связана с нарушением социального взаимодействия и нарушением пространственной памяти, мыши, ранее сенсибилизированные к белку молочной сыворотки, демонстрируют меньшее социальное взаимодействие и худшую пространственную память по сравнению с неаллергическими контрольными мышами. Эти наблюдения подчеркивают эффекты аллергии на когнитивные и поведенческие характеристики, как рассмотрено в указанных выше моделях. У мышей, которым дополнительно давали Bifidobacterium breve, неусваиваемые олигосахариды (синбиотики) и глутамин, уровни социального взаимодействия и альтерационной или пространственной памяти улучшаются до уровней, сравнимых с данными для неаллергических мышей. Поэтому использование B. breve вместе с неусваиваемыми олигосахаридами и глутамином особенно подходит для улучшения когнитивных и поведенческих характеристик, особенно для улучшения пространственной памяти и/или социального взаимодействия у младенцев и детей младшего возраста, в частности, у детей в возрасте 6 месяцев или менее, недоношенных младенцев, маленьких для гестационного возраста (SGA) младенцев, младенцев, родившихся с помощью кесарева сечения, младенцев и детей младшего возраста, страдающих или находящихся под риском аллергии, и младенцев и маленьких детей, страдающих от воспаления кишечника.

Здесь также представлены интересные данные, которые показывают, что добавление в корм обычных неаллергических мышей питательных добавок, содержащих Bifidobacterium breve, неусваиваемые олигосахариды (синбиотики) с глутамином или без оного, приводит к улучшению социального взаимодействия, и что добавка в корм Bifidobacterium breve, неперевариваемых олигосахаридов (синбиотиков) и глутамина приводит к значительному улучшению характеристик пространственной памяти.

Настоящее изобретение также касается набора компонентов, пригодного для кормления недоношенных младенцев, содержащего или состоящего из двух, трех, четырех или пяти различных контейнеров и инструкций по применению, это означает, что указанный набор компонентов содержит или состоит из первого контейнера, содержащего глутамин, фруктоолигосахариды (FOS) и галактоолигосахариды (GOS), и второго контейнера, содержащего Bifidobacterium breve. Предпочтительно указанный набор компонентов включает также один или более дополнительных контейнеров, содержащих белковую добавку, обогатитель грудного молока и/или смесь для недоношенных младенцев. Комплект предпочтительно включает инструкции по применению набора компонентов для кормления недоношенных младенцев.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Таким образом, настоящее изобретение касается способа улучшения когнитивных функций, когнитивного развития, поведенческих характеристик, поведенческого развития и/или социального взаимодействия младенца или ребенка, начинающего ходить, включающего введение младенцу или ребенку, начинающему ходить, питательной композиции, содержащей Bifidobacterium breve и содержащей по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты.

Изобретение также можно сформулировать как применение Bifidobacterium breve и по меньшей мере одного неусваиваемого олигосахарида, выбранного из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, или композиции, содержащей Bifidobacterium breve и по меньшей мере один неусваиваемый олигосахарид, для изготовления питательной композиции для улучшения когнитивных функций, когнитивного развития, поведенческих характеристик, поведенческого развития и/или социального взаимодействия младенца или ребенка, начинающего ходить. В одном аспекте изобретение, в частности, касается улучшения когнитивных функций, предпочтительно включающих характеристики памяти, предпочтительно характеристики пространственной памяти. Также изобретение, в частности, касается улучшения социального взаимодействия.

Изобретение также можно сформулировать следующим образом: питательная композиция, содержащая Bifidobacterium breve и содержащая по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, олигосахариды, арабиноманнанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, для применения с целью улучшения когнитивных функций, когнитивного развития, поведенческих характеристик, поведенческого развития и/или социального взаимодействия младенца или ребенка, начинающего ходить. В одном аспекте изобретение, в частности, касается улучшения когнитивных функций, предпочтительно включающих характеристики памяти, предпочтительно характеристики пространственной памяти. Также изобретение, в частности, касается улучшения социального взаимодействия.

В предпочтительном варианте осуществления настоящего способа или применения младенец или ребенок, начинающий ходить, выбран из группы, включающей младенцев в возрасте 6 месяцев или менее, недоношенных младенцев, маленьких для гестационного возраста (SGA) младенцев, детей, родившихся с помощью кесарева сечения, младенцев или детей, начинающих ходить, страдающих от аллергии, или младенцев или детей, начинающих ходить, подверженных риску аллергии, и младенцев или детей, начинающих ходить, страдающих от воспаления кишечника. Предпочтительным является вариант осуществления настоящего способа или применения для обеспечения питания младенца или ребенка, начинающего ходить.

Изобретение также касается способа лечения или предупреждения ухудшенных когнитивных функций, пониженного когнитивного развития, ухудшенных поведенческих характеристик, пониженного поведенческого развития, пониженного социального взаимодействия и/или нейровоспаления, предпочтительно ухудшенных когнитивных функций, предпочтительно пониженных характеристик памяти, предпочтительно пониженных характеристик пространственной памяти и предпочтительно пониженного социального взаимодействия у младенца или ребенка, начинающего ходить, выбранного из группы, включающей младенцев или детей, начинающих ходить, страдающих от аллергии, младенцев или детей, начинающих ходить, находящихся под риском аллергии, младенцев или детей, начинающих ходить, страдающих от воспаления кишечника, и недоношенных младенцев, причем указанный способ включает введение младенцу или ребенку, начинающему ходить, питательной композиции, содержащей Bifidobacterium breve и содержащей по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты.

Изобретение также можно сформулировать как применение Bifidobacterium breve и по меньшей мере одного неусваиваемого олигосахарида, выбранного из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, или композицию, содержащую Bifidobacterium breve и по меньшей мере один неусваиваемый олигосахарид, для изготовления питательной композиции для лечения или предупреждения ухудшенных когнитивных функций, пониженного когнитивного развития, ухудшенных поведенческих характеристик, пониженного поведенческого развития, пониженного социального взаимодействия и/или нейровоспаления, предпочтительно ухудшенных когнитивных функций, предпочтительно пониженных характеристик памяти, предпочтительно пониженных характеристик пространственной памяти и предпочтительно пониженного социального взаимодействия у младенца или ребенка, начинающего ходить, выбранного из группы, включающей младенцев в возрасте 6 месяцев и менее, недоношенных младенцев, маленьких для гестационного возраста (SGA) младенцев, младенцев, родившихся с помощью кесарева сечения, младенцев или детей, начинающих ходить, страдающих от аллергии или младенцев или детей, начинающих ходить, находящихся под риском аллергии, или младенцев или детей, начинающих ходить, страдающих от воспаления кишечника.

Изобретение также можно сформулировать следующим образом: питательная композиция, содержащая Bifidobacterium breve и содержащая по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, олигосахариды, арабиноманнанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты для применения с целью лечения или предупреждения ухудшенных когнитивных функций, пониженного когнитивного развития, ухудшенных поведенческих характеристик, пониженного поведенческого развития, пониженного социального взаимодействия и/или нейровоспаления, предпочтительно ухудшенных когнитивных функций, предпочтительно пониженных характеристик памяти, предпочтительно пониженных характеристик пространственной памяти и предпочтительно пониженного социального взаимодействия у младенца или ребенка, начинающего ходить, выбранного из группы, включающей младенцев в возрасте 6 месяцев или менее, недоношенных младенцев, маленьких для гестационного возраста (SGA) младенцев, младенцев, родившихся с помощью кесарева сечения, младенцев или детей, начинающих ходить, страдающих от аллергии, или младенцев или детей, начинающих ходить, находящихся под риском аллергии, и младенцев или детей, начинающих ходить, страдающих от воспаления кишечника.

В предпочтительном варианте осуществления настоящего способа или применения для обеспечения питания младенца или ребенка, начинающего ходить, выбранного из группы, включающей младенцев в возрасте 6 месяцев или менее, недоношенных младенцев, маленьких для гестационного возраста (SGA) младенцев, младенцев, родившихся с помощью кесарева сечения, младенцев или детей, начинающих ходить, страдающих от аллергии, или младенцев или детей, начинающих ходить, находящихся под риском аллергии, и младенцев или детей, начинающих ходить, страдающих от воспаления кишечника.

Изобретение также касается способа кормления или способа обеспечения питания младенца или ребенка, начинающего ходить, выбранного из группы, включающей младенцев в возрасте 6 месяцев или менее, недоношенных младенцев, маленьких для гестационного возраста (SGA) младенцев, младенцев, родившихся с помощью кесарева сечения, младенцев или детей, начинающих ходить, страдающих от аллергии, младенцев или детей, начинающих ходить, находящихся под риском аллергии, и младенцев или детей, начинающих ходить, страдающих от воспаления кишечника, включающего введение питательной композиции, содержащей а) Bifidobacterium breve, b) по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, c) глутамин в виде свободной аминокислоты, и/или глутаминсодержащего дипептида, и/или глутаминсодержащего трипептида, и предпочтительно d) LC-PUFA в виде или арахидоновой кислоты, и/или докозагексаеновой кислоты.

Другими словами, изобретение касается применения питательной композиции, содержащей a) Bifidobacterium breve, b) по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, c) глутамин в виде свободной аминокислоты, и/или глутаминсодержащего дипептида, и/или глутаминсодержащего трипептида, и d) LC-PUFA в виде или арахидоновой кислоты, и/или докозагексаеновой кислоты, для обеспечения питания младенца или ребенка, начинающего ходить, выбранного из группы, включающей младенцев в возрасте 6 месяцев или менее, недоношенных младенцев, маленьких для гестационного возраста (SGA) младенцев, младенцев, родившихся с помощью кесарева сечения, младенцев или детей, начинающих ходить, страдающих от аллергии, или младенцев или детей, начинающих ходить, находящихся под риском аллергии, и младенцев или детей, начинающих ходить, страдающих от воспаления кишечника.

Изобретение также можно сформулировать следующим образом: питательная композиция, содержащая a) Bifidobacterium breve, b) по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, c) глутамин в виде свободной аминокислоты, и/или глутаминсодержащего дипептида, и/или глутаминсодержащего трипептида, и d) LC-PUFA в виде или арахидоновой кислоты, и/или докозагексаеновой кислоты, для применения с целью обеспечения питания младенца или ребенка, начинающего ходить, выбранного из группы, включающей младенцев в возрасте 6 месяцев или менее, недоношенных младенцев, маленьких для гестационного возраста (SGA) младенцев, младенцев, родившихся с помощью кесарева сечения, младенцев или детей, начинающих ходить, страдающих от аллергии, или младенцев или детей, начинающих ходить, находящихся под риском аллергии, и младенцев или детей, начинающих ходить, страдающих от воспаления кишечника.

Предпочтительно композиция включает:

а) Bifidobacterium breve в количестве от 102 до 1013 КОЕ на г сухой массы питательной композиции;

b) по меньшей мере один неусваиваемой олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, в количестве от 0,5 до 20% масс. в расчете на сухую массу питательной композиции;

c) глутамин в виде свободной аминокислоты, и/или глутаминсодержащего дипептида, и/или глутаминсодержащего трипептида в количестве по меньшей мере 1,5% масс. в расчете на сухую массу питательной композиции; и предпочтительно,

d) LC-PUFA в виде или арахидоновой кислоты, и/или докозагексаеновой кислоты.

Также изобретение касается питательной композиции, содержащей белок, жир и усваиваемые углеводы и дополнительно содержащей:

a) Bifidobacterium breve в количестве от 102 до 1013 КОЕ на г сухой массы питательной композиции;

b) по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, в количестве от 0,5 до 20% масс. в расчете на сухую массу питательной композиции;

c) глутамин в виде свободной аминокислоты, и/или глутаминсодержащего дипептида, и/или глутаминсодержащего трипептида в количестве по меньшей мере 1,5% масс. в расчете на сухую массу питательной композиции; и предпочтительно

d) LC-PUFA в виде или арахидоновой кислоты, и/или докозагексаеновой кислоты.

Bifidobacterium breve

Настоящая композиция содержит Bifidobacterium breve. Bifidobacterium breve представляет собой грамположительную, анаэробную, разветвленную палочковидную бактерию. B.breve предпочтительно имеет по меньшей мере 95% идентичность последовательности 16S рРНК при сравнении с типовым штаммом B. breve ATCC 15700, более предпочтительно по меньшей мере 97% идентичность (Stackebrandt & Goebel, 1994, Int. J. Syst. Bacteriol 44: 846-849). Предпочтительными являются штаммы B. breve, выделенные из фекалий здоровых младенцев, находящихся на грудном вскармливании. Как правило, они коммерчески доступны от производителей молочнокислых бактерий, но их также можно выделить непосредственно из фекалий, идентифицировать, охарактеризовать и получить. Согласно предпочтительному варианту осуществления настоящая композиция содержит по меньшей мере один штамм B. breve, выбранный из группы, включающей B. breve Bb-03 (Rhodia/Danisco), B. breve М-16V (Morinaga), B. breve R0070 (Institute Rosell, Lallemand), B. breve BR03 (Probiotical), B. breve BR92) (Cell Biotech), DSM 20091, LMG 11613, YIT4065, FERM BP-6223 и CNCM 1-2219. Наиболее предпочтительно, если B. breve выбран из группы, включающей B. breve M-16V и B. breve CNCM 1-2219, наиболее предпочтительно М-16В. B. breve 1-2219 опубликован в WO 2004/093899 и депонирован в Collection Nationale de Cultures de Microorganisms, institute Pasteur, Paris, France 31 мая 1999 компанией Compagnie Gervais Danone. B. breve M-16V депонирован как BCCM/LMG23729 и доступен коммерчески от Morinaga Milk Industry Co., Ltd.

Настоящая композиция предпочтительно содержит от 102 до 1013 колониеобразующих единиц (КОЕ) B. breve на г сухой массы данной композиции, предпочтительно от 104 до 1012, более предпочтительно от 105 до 1010, наиболее предпочтительно от 105 до 108 КОЕ B. breve на г сухой массы настоящей композиции. B. breve по настоящему изобретению предпочтительно вводят при суточной дозе от 102 до 1013, более предпочтительно от 105 до 1012, наиболее предпочтительно от 107 до 5×109 колониеобразующих единиц (КОЕ). Предпочтительно композиция содержит от 103 до 1013 КОЕ B. breve на 100 мл, более предпочтительно от 106 до 1011 КОЕ B. breve на 100 мл, наиболее предпочтительно от 107 до 109 КОЕ В. breve на 100 мл.

Настоящая композиция предпочтительно содержит жизнеспособные B. breve. Альтернативно, настоящая композиция предпочтительно содержит нежизнеспособные B. breve в количестве, эквивалентном описанному выше количеству КОЕ. Эквивалент КОЕ можно определить, выполняя 5'нуклеазный анализ с пробами B. breve и праймерами, как раскрыто в WO 2005/039319, в продукте (например, смеси для младенцев), содержащем нежизнеспособные B. Breve, и сравнивая его с калибровочной кривой, полученной для сопоставимого продукта (например, стандартной детской смеси), к которому добавлены известные количества КОЕ жизнеспособных, предпочтительно высушенных B. breve. Высушенные жизнеспособные бифидобактерии можно получить коммерчески, как описано выше. Клетки B. breve можно сделать нежизнеспособными, применяя способы, известные в данной области, в том числе стадии термообработки (включая стерилизацию, пастеризацию, СВТ-обработку), облучение (УФ), обработку кислородом, обработку бактерицидными агентами, такими как этанол, обработку ультразвуком, применение сверхвысокого давления, гомогенизацию при высоком давлении и применение клеточного дезинтегратора. Предпочтительны B. Breve, убитые термически. Присутствие нежизнеспособных B. breve благоприятным образом обеспечивает много технологических преимуществ продуктов, в том числе увеличение срока годности, снижение случаев бактериального заражения, снижение последующего скисания продукта, улучшенный контроль дозировки и повышенное удобство восстановления. Потребление инактивированных B. breve также демонстрирует благоприятные эффекты по снижению аллергии и воспаления.

Неусваиваемые олигосахариды

Настоящая композиция содержит неусваиваемые олигосахариды (NDO). Используемый в настоящем изобретении термин "олигосахарид" предпочтительно касается сахарида со степенью полимеризации (DP) от 2 до 250, предпочтительно от 2 до 100, более предпочтительно от 2 до 60. Понятно, что в контексте настоящего изобретения сахарид с DP в определенном диапазоне может включать смесь сахаридов с различными средними DP, например, если в настоящую композицию включен олигосахарид с DP от 2 до 100, то он может включать композиции, которые содержат олигосахариды со средней DP от 2 до 5, средней DP от 50 до 70 и средней DP от 7 до 60. Используемое в настоящем изобретении выражение "неусваиваемый олигосахарид" касается олигосахаридов, которые не перевариваются или только частично перевариваются в кишечнике под действием кислот или пищеварительных ферментов, присутствующих в верхней части пищеварительного тракта человека (тонкий кишечник и желудок), но которые ферментируются кишечной флорой человека. Например, сахароза, лактоза, мальтоза и мальтодекстрины считаются усваиваемыми. Например, галактоолигосахариды, фруктоолигосахариды считаются неусваиваемыми олигосахаридами.

Неусваиваемый олигосахарид выбран из группы, включающей фруктоолигосахариды (например, инулин), галактоолигосахариды (например, трансгалактоолигосахариды или бета-галактоолигосахариды), глюкоолигосахариды (например, гентио-, нигеро- и циклодекстрин-олигосахариды), арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты. В одном варианте осуществления настоящая питательная композиция содержит от 0,5 до 20% масс. неусваиваемых олигосахаридов на г сухой массы питательной композиции.

Предпочтительно настоящая композиция содержит фруктоолигосахариды и/или галактоолигосахариды, более предпочтительно галактоолигосахариды, наиболее предпочтительно трансгалактоолигосахариды. В предпочтительном варианте осуществления композиция содержит смесь трансгалактоолигосахаридов и фруктоолигосахаридов. Предпочтительно настоящая композиция включает галактоолигосахариды с DP 2-10, предпочтительно со средней DP от 2 до 10 и/или фруктоолигосахариды с DP 2-60, предпочтительно со средней DP от 2 до 60, предпочтительно со средней DP от 10 до 60, предпочтительно со средней DP от 20 до 60. В одном варианте осуществления настоящая композиция содержит галактоолигосахариды с DP 2-10, предпочтительно со средней DP от 2 до 10 и/или фруктоолигосахариды с DP 2-10, предпочтительно со средней DP от 2 до 10. Предпочтительно композиция содержит галактоолигосахариды и фруктоолигосахариды при массовом соотношении от 20 до 0,5, более предпочтительно от 20 до 1, наиболее предпочтительно от 12 до 2.

Галактоолигосахариды предпочтительно выбраны из группы, включающей трансгалактоолигосахариды, лакто-N-тетраозу (LNT), лакто-N-неотетраозу (нео-LNT), фукозиллактозу, фукозилированную LNT и фукозилированную нео-LNT. В особо предпочтительном варианте осуществления настоящий способ включает введение трансгалактоолигосахаридов ([галактоза]n-глюкоза, где n равно целому числу от 1 до 60, т.е. 2, 3, 4, 5, 6, …, 59, 60, предпочтительно n выбрано из 2, 3, 4, 5, 6, 7, 8, 9 или 10). Трансгалактоолигосахариды (TOS) продаются, например, под торговой маркой Vivinal™ (Borculo Domo Ingredients, Netherlands). Предпочтительно трансгалактоолигосахариды являются β-связанными.

В одном варианте осуществления настоящая композиция предпочтительно содержит фруктоолигосахарид. Используемый здесь термин "фруктоолигосахарид" касается неусваиваемого полисахарида, содержащего цепочку по меньшей мере из 2 β-связанных звеньев фруктозы с DP от 2 до 250, предпочтительно от 7 до 100, более предпочтительно от 20 до 60. В одном из вариантов осуществления предпочтительно используют инулин. Инулин доступен, например, под торговой маркой "Raftilin HP®"(Orafti). Средняя DP настоящего фруктоолигосахарида предпочтительно составляет по меньшей мере 7, более предпочтительно по меньшей мере 10, предпочтительно менее 100. Используемый фруктоолигосахарид предпочтительно имеет (большинство) звенья фруктозы, связанные β-связями (2→1). Другие термины для фруктоолигосахаридов включают инулин, фруктополисахарид, полифруктозу, фруктаны и олигофруктозу. Настоящая композиция предпочтительно содержит фруктоолигосахариды с DP от 2 до 200, предпочтительно от 7 до 100, более предпочтительно от 20 до 60. В одном варианте осуществления настоящая питательная композиция предпочтительно содержит две различных фракции фруктоолигосахаридов: одну фракцию со средней DP от 2 до 20 и вторую фракцию со средней DP от 20 до 60 или одну фракцию со средней DP от 2 до 10 и вторую фракцию со средней DP от 10 до 60.

Предпочтительно композиция содержит от 80 мг до 2 г неусваиваемых олигосахаридов на 100 мл, более предпочтительно от 150 мг до 1,50 г, еще более предпочтительно от 300 мг до 1 г на 100 мл. В расчете на сухую массу композиция предпочтительно содержит от 0,25% масс. до 20% масс., более предпочтительно от 0,5% масс. до 10% масс., еще более предпочтительно от 1,5% масс. до 7,5% масс. неусваиваемых олигосахаридов. Предпочтительно композиция содержит от 102 до 1013 КОЕ B. breve на грамм и от 0,25% масс. до 20% масс. неусваиваемых олигосахаридов в расчете на сухую массу, более предпочтительно от 105 до 1010 КОЕ B. breve на грамм и от 0,5% масс. до 10% масс. неусваиваемых олигосахаридов в расчете на сухую массу. Предпочтительно композиция содержит от 103 до 1013 КОЕ B. breve и от 80 мг до 2 г неусваиваемых олигосахаридов на 100 мл, более предпочтительно от 106 до 1011 КОЕ B. breve и от 300 мг до 1 г неусваиваемых олигосахаридов на 100 мл.

Предпочтительно питательная композиция содержит i) от 1×105 КОЕ до 1×1010 КОЕ В. breve на г сухой массы, более предпочтительно от 1×106 КОЕ до 1×1010 КОЕ; или ii) от 0,5 до 20% масс. галактоолигосахаридов в расчете на сухую массу, более предпочтительно от 0,5 до 10% масс. галактоолигосахаридов, или iii) от 0,05 до 2% фруктоолигосахаридов в расчете на сухую массу, более предпочтительно от 0,1 до 1% масс. фруктоолигосахаридов, или ii) и iii).

Глутамин

Питательная композиция по настоящему изобретению предпочтительно содержит глутамин. В данном описании ее также называют питательной композицией, содержащей глутамин, или глутамин-обогащенной питательной композицией. Термин «глутамин» в настоящем изобретении касается L-глутамина. Глутамин является одной из самых распространенных аминокислот в плазме и грудном молоке и считается условно основной для недоношенных младенцев. Глутамин используется в качестве источника энергии и для синтеза нуклеотидов во всех быстро делящихся клетках, таких как клетки слизистой оболочки кишечника и некоторые иммунные клетки. В головном мозге глутамин представляет собой субстрат для нейротрансмиттеров и важный источник энергии для нервной системы. Глутамин вместе с Bifidobacterium breve и неусваиваемыми олигосахаридами благоприятным образом оказывает дополнительно улучшенный или синергический эффект на когнитивные функции, поведение, аллергию, профилактику нейровоспаления и/или воспаления кишечника. Младенцы в возрасте 6 месяцев или менее, недоношенные младенцы, маленькие для гестационного возраста (SGA) младенцы, младенцы, родившиеся с помощью кесарева сечения, младенцы или дети, начинающие ходить, страдающие от аллергии, или младенцы или дети, начинающие ходить, находящихся под риском аллергии, и младенцы или дети, начинающие ходить, страдающие от кишечного воспаления, могут быть особо восприимчивы к уменьшению запасов глутамина, так как снабжение пищи глутамином ограничено в первые недели после рождения. Кроме того, эндогенная способность к синтезу глутамина из глутамата может быть нарушена у этих младенцев, и в частности, не в полной мере развита у недоношенных и SGA детей.

Глутамин предпочтительно присутствует в виде легко абсорбируемой формы. Из-за незрелости желудочно-кишечного тракта у SGA и/или недоношенного младенца глутамин, присутствующий в интактном белке, не так легко абсорбируется. Поэтому глутамин предпочтительно присутствует в виде свободной аминокислоты,, и/или ди- и трипептидов, содержащих глутамин, наиболее предпочтительно глутаминсодержащего дипептида и/или свободного глутамина. Свободный глутамин, и глутаминсодержащий дипептид, и глутаминсодержащий трипептид являются коммерчески доступными, например, от Ajinomoto, США. В одном варианте осуществления питательная композиция по настоящему изобретению содержит менее 0,3 г/л дипептида аргинин-глутамин, если композиция находится в жидком виде, или менее 2,5% масс., предпочтительно менее 1,5% масс., более предпочтительно менее 1% масс., еще более предпочтительно менее 0,5% масс. дипептида аргинин-глутамин в расчете на сухую массу композиции. В одном варианте осуществления питательная композиция по настоящему изобретению не содержит дипептида аргинин-глутамин.

Питательная композиция по настоящему изобретению предпочтительно имеет уровни глутамина выше уровней, обычно имеющихся в молочном белке человека или стандартной смеси для недоношенных младенцев на основе коровьего молочного белка. Предпочтительно питательная композиция по настоящему изобретению содержит по меньшей мере 12% масс., более предпочтительно по меньшей мере 15% масс., еще более предпочтительно по меньшей мере 30% масс. глутамина, считая от общего белка. Предпочтительно питательная композиция по настоящему изобретению содержит по меньшей мере 1,5% масс., более предпочтительно по меньшей мере 2% масс., еще более предпочтительно по меньшей мере 4% масс. глутамина, в расчете на сухую массу питательной композиции. Предпочтительно питательная композиция по настоящему изобретению содержит по меньшей мере 0,3 г, более предпочтительно по меньшей мере 0,5 г, еще более предпочтительно по меньшей мере 1 г глутамина на 100 ккал. Предпочтительно композиция по настоящему изобретению содержит по меньшей мере 0,4 г, более предпочтительно по меньшей мере 0,6 г, еще более предпочтительно по меньшей мере 1,25 г глутамина на 100 мл. Предпочтительно питательная композиция по настоящему изобретению содержит по меньшей мере 12% масс., более предпочтительно по меньшей мере 15% масс., еще более предпочтительно по меньшей мере 30% масс. глутамина в виде свободной аминокислоты, глутаминсодержащего дипептида и глутаминсодержащего трипептида, если таковые присутствуют, считая от общего белка. Предпочтительно питательная композиция по настоящему изобретению содержит по меньшей мере 1,5% масс., более предпочтительно по меньшей мере 2% масс., еще более предпочтительно по меньшей мере 4% масс. глутамина в виде свободной аминокислоты, и глутаминсодержащего дипептида, и глутаминсодержащего трипептида, если таковые присутствуют, в расчете на сухую массу питательной композиции. Предпочтительно питательная композиция по настоящему изобретению содержит по меньшей мере 0,3 г, более предпочтительно по меньшей мере 0,5 г, еще более предпочтительно по меньшей мере 1 г глутамина в виде свободной аминокислоты, и глутаминсодержащего дипептида, и глутаминсодержащего трипептида, если таковые присутствуют, на 100 ккал.

Предпочтительно настоящая питательная композиция, содержащая глутамин, находится в сухом виде, предпочтительно в виде порошка. Этот порошок подходит для восстановления в воде или другой водной фазе. Если глутамин находится в виде порошка, то он предпочтительно имеет больший срок годности. Глутамин, в частности, свободный глутамин и дипептид глутамина, является более стабильным при хранении в сухом виде.

LC-PUFA

Предпочтительно настоящая композиция содержит длинноцепочечные полиненасыщенные жирные кислоты (LC-PUFA), более предпочтительно n-3 и n-6 LC-PUFA, еще более предпочтительно арахидоновую кислоту (ARA) и докозагексаеновую кислоту (DHA). LC-PUFA является важной частью состава мембран головного мозга, содержащих жирные ацильные цепи, и, следовательно, благоприятным образом улучшает когнитивные и поведенческие характеристики или их развитие и предупреждает нейровоспаление. Присутствие LC-PUFA, в частности, ARA и DHA, оказывает дополнительно улучшенный или даже синергический благоприятный эффект вместе с B. breve и неусваиваемыми олигосахаридами n-3 LC-PUFA, в частности, докозагексаеновая кислота (DHA) является важной частью состава мембран головного мозга, содержащих жирные ацильные цепи, и благоприятным образом улучшает когнитивные и поведенческие характеристики или их развитие. Более предпочтительно, если настоящая композиция содержит n-3 LC-PUFA, еще более предпочтительно DHA. Поскольку низкая концентрация DHA уже является эффективной, содержание n-3 LC-PUFA в настоящей композиции предпочтительно не превышает 15% масс. от общего количества жирных кислот, предпочтительно не превышает 10% масс., еще более предпочтительно не превышает 5% масс. Предпочтительно настоящая композиция содержит по меньшей мере 0,2% масс., предпочтительно по меньшей мере 0,5% масс., более предпочтительно по меньшей мере 0,75% масс. n-3 LC-PUFA от общего количества жирных кислот. Содержание DHA предпочтительно не превышает 5% масс., более предпочтительно не превышает 1% масс., но предпочтительно составляет по меньшей мере 0,1% масс. от общего количества жирных кислот. Предпочтительно в качестве источника n-3 LC-PUFA использовать масло одноклеточных организмов, предпочтительно масло водорослей, масло грибов и/или микробное масло, так как эти источники масел имеют низкое соотношение EPA/DHA, что дает в результате улучшенный эффект на головной мозг. Более предпочтительно, если настоящая композиция содержит рыбий жир, более предпочтительно жир тунца.

n-6 LC-PUFA, в частности, арахидоновая кислота (ARA), является важной частью состава мембран головного мозга, содержащих жирные ацильные цепи, и благоприятным образом улучшает когнитивные и поведенческие характеристики или их развитие. Настоящая композиция предпочтительно содержит относительно небольшие количества ARA. Содержание n-6 LC-PUFA предпочтительно не превышает 5% масс., более предпочтительно не превышает 0,8% масс., более предпочтительно не превышает 0,75% масс., еще более предпочтительно не превышает 0,5% масс. в расчете на общее количество жирных кислот. Так как ARA важна для оптимальных функциональных мембран младенцев, особенно для мембран нейрологических тканей, количество n-6 LC-PUFA предпочтительно составляет по меньшей мере 0,02% масс., более предпочтительно по меньшей мере 0,05% масс., еще более предпочтительно по меньшей мере 0,1% масс. от общего количества жирных кислот, более предпочтительно по меньшей мере 0,25% масс.

Массовое соотношение n-6 LC-PUFA/n-3 LC-PUFA, в частности, массовое соотношение ARA/DHA в настоящей питательной смеси для младенцев, предпочтительно составляет от 3 до 0,5, более предпочтительно от 2 до 1. Предпочтительно массовое соотношение составляет более 1. Эти соотношения гарантируют оптимальное функционирование головного мозга.

LC-PUFA предпочтительно обеспечивают в виде свободных жирных кислот, триглицеридов, диглицеридов, моноглицеридов, фосфолипидов или в виде смеси одного или нескольких из указанных выше веществ. Предпочтительно настоящая композиция содержит LC-PUFA в виде триглицеридов и/или фосфолипидов, более предпочтительно в виде фосфолипидов, поскольку LC-PUFA в виде фосфолипидов лучше встраиваются в мембраны. Поэтому пищевой источник LC-PUFA в виде фосфолипидов будет оказывать дополнительный улучшенный эффект на головной мозг по сравнению с введением формы триглицеридов. Таким образом, предпочтительным источником LC-PUFA является яичный фосфолипид. Известны коммерческие источники яичного масла, богатого фосфолипидами и имеющегое арахидоновые и докозагексаеновые жирные ацильные цепи в фосфолипидных молекулах.

Композиции

Настоящее изобретение предпочтительно касается композиции, в которой липид обеспечивает от 5 до 50% общего количества калорий, белок обеспечивает от 5 до 50% общего количества калорий, и углевод обеспечивает от 15 до 90% общего количества калорий. Предпочтительно в настоящей композиции липид обеспечивает от 35 до 50% общего количества калорий, белок обеспечивает от 7,5 до 12,5% общего количества калорий, и углевод обеспечивает от 40 до 55% общего количества калорий. Для расчета % белкового компонента от общего количества калорий следует принимать во внимание общую энергию, обеспечиваемую белками, пептидами и аминокислотами.

Настоящая композиция предпочтительно содержит по меньшей мере один липид, выбранный из группы, включающей животные липиды (за исключением липидов человека) и растительные липиды. Предпочтительно настоящая композиция содержит комбинацию растительных липидов и по меньшей мере одного масла, выбранного из группы, включающей рыбий жир, животное масло, масло морских водорослей, масло грибов и бактериальное масло. Из настоящей композиции, содержащей неусваиваемые олигосахариды и B. Breve, исключено грудное молоко.

Настоящая композиция предпочтительно содержит белок. Белковый компонент, используемый в питательной смеси, предпочтительно выбран из группы, включающей животные белки, отличные от белков человека (предпочтительно молочные белки, предпочтительно белки из коровьего молока), растительные белки (предпочтительно соевый белок и/или рисовый белок), свободные аминокислоты и их смеси. Настоящая композиция предпочтительно содержит казеин, сыворотку, гидролизованный казеин и/или гидролизованный белок молочной сыворотки. Предпочтительно белок включает интактные белки, более предпочтительно интактные белки коровьей сыворотки и/или интактные белки коровьего казеина. Так как настоящая композиция предпочтительно подходит для использования младенцами, страдающими или подверженными риску аллергии, белок предпочтительно выбран из группы, включающей гидролизованный молочный белок, более предпочтительно гидролизованный белок сыворотки. Так как настоящая композиция предпочтительно подходит для использования недоношенными или SGA-младенцами, белок предпочтительно выбран из группы, включающей гидролизованный молочный белок, более предпочтительно из группы, включающей гидролизованный белок сыворотки и гидролизованный казеин.

Настоящая композиция предпочтительно содержит усваиваемые углеводы. Настоящая композиция предпочтительно содержит усваиваемый углеводный компонент, в котором по меньшей мере 35% масс., более предпочтительно по меньшей мере 50% масс., более предпочтительно по меньшей мере 75% масс., еще более предпочтительно по меньшей мере 90% масс., наиболее предпочтительно по меньшей мере 95% масс. составляет лактоза. Настоящая композиция предпочтительно содержит по меньшей мере 25 г лактозы на 100 г сухой массы настоящей композиции, предпочтительно по меньшей мере 40 г лактозы/100 г.

Жидкая питательная композиция предпочтительно имеет калорийность от 0,1 до 2,5 ккал/мл, еще более предпочтительно калорийность от 0,5 до 1,5 ккал/мл, наиболее предпочтительно от 0,6 до 0,8 ккал/мл. Количество питательной композиции, вводимой за день, предпочтительно составляет от 50 до 2000 мл, более предпочтительно от 200 до 1500, наиболее предпочтительно от 400 до 1000 мл.

В одном варианте осуществления питательная композиция по настоящему изобретению представляет собой смесь для недоношенных младенцев. Смесь для недоношенных младенцев содержит все макро- и микроэлементы, необходимые для недоношенных или SGA младенцев, чтобы они достигали роста, соответствующего росту плода в сочетании с удовлетворительным функциональным развитием.

В предпочтительном варианте осуществления смесь для недоношенных младенцев содержит от 5 до 25% масс. белка, предпочтительно от 9 до 20% масс., более предпочтительно от 13 до 18% масс. белка в расчете на сухую массу смеси для недоношенных младенцев. В предпочтительном варианте осуществления смесь для недоношенных младенцев содержит от 1,8 до 3,0 г белка, предпочтительно от 2,0 до 3,0 г, предпочтительно от 2,5 г до 2,6 г белка на 100 мл.

Предпочтительно смесь для недоношенных младенцев по настоящему изобретению содержит по меньшей мере 12% масс., более предпочтительно по меньшей мере 15% масс., еще более предпочтительно по меньшей мере 30% масс. глутамина от общего белка. Предпочтительно смесь для недоношенных младенцев по настоящему изобретению содержит не более 80% масс., более предпочтительно не более 50% масс. глутамина от общего белка. Предпочтительно смесь для недоношенных младенцев по настоящему изобретению содержит по меньшей мере 1,5% масс., более предпочтительно по меньшей мере 2% масс., еще более предпочтительно по меньшей мере 4% масс. глутамина в расчете на сухую массу смеси для недоношенных младенцев. Предпочтительно смесь для недоношенных младенцев по настоящему изобретению содержит не более 20% масс., более предпочтительно не более 10% масс. глутамина в расчете на сухую массу смеси для недоношенных младенцев. Предпочтительно питательная композиция по настоящему изобретению содержит по меньшей мере 0,3 г, более предпочтительно по меньшей мере 0,5 г, еще более предпочтительно по меньшей мере 1 г глутамина в расчете на 100 ккал смеси для недоношенных младенцев. Предпочтительно смесь для недоношенных младенцев по настоящему изобретению содержит не больше 5 г, еще более предпочтительно не больше 2 г глутамина в расчете на 100 ккал смеси для недоношенных младенцев.

Смесь для недоношенных младенцев по настоящему изобретению в виде готовой к употреблению формы содержит в предпочтительном варианте осуществления приблизительно от 70 до 90 ккал, предпочтительно от 75 до 85 ккал на 100 мл.

Предпочтительно смесь для недоношенных младенцев имеет осмоляльность ниже 450 мОсмоль/л, более предпочтительно ниже 400, еще более предпочтительно ниже 350. В частности, для недоношенных младенцев слишком высокая осмоляльность является недостатком.

В одном варианте осуществления настоящее изобретение касается добавки, подходящей для увеличения питательной ценности молока, чтобы повысить питательную ценность грудного молока, обогащенного стандартным обогатителем молока, или повысить питательную ценность стандартной смеси для недоношенных младенцев. В контексте настоящего изобретения добавка не содержит всех макро- и микроэлементов, необходимых для недоношенных младенцев, чтобы они достигли роста, соответствующего росту плода в сочетании с удовлетворительным функциональным развитием.

В одном варианте осуществления питательная композиция по настоящему изобретению представляет собой смесь для младенцев после выписки. Смесь для младенцев после выписки содержит все макро- и микроэлементы, необходимые для недоношенных младенцев, чтобы они достигли роста, соответствующего росту плода, в сочетании с удовлетворительным функциональным развитием.

Таким образом, в одном варианте осуществления питательная композиция по настоящему изобретению или для применения в соответствии с настоящим изобретением содержит белок, жир и/или усваиваемые углеводы и выбрана из группы, включающей начальную детскую смесь, смесь для искусственного вскармливания, молоко для детей, начинающих ходить, смесь для недоношенных младенцев, смесь для младенцев после выписки и обогатитель грудного молока.

В отдельном варианте осуществления настоящее изобретение касается набора компонентов, пригодного и предназначенного для кормления недоношенных младенцев, содержащего или состоящего из пяти различных контейнеров, каждый с различным содержанием, и инструкции по применению. Указанный набор компонентов включает или состоит из первого контейнера, содержащего глутамин, предпочтительно в виде свободной аминокислоты, дипептидов и/или трипептидов, и по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, более предпочтительно комбинацию по меньшей мере фруктоолигосахаридов (FOS) и галактоолигосахаридов (GOS), и второго контейнера, содержащего Bifidobacterium breve.

Предпочтительно указанный набор компонентов включает также один или более контейнеров, содержащих (белковую) добавку, подходящую для повышения питательной ценности молока или для повышения питательной ценности грудного молока, обогащенного стандартным обогатителем грудного молока, или белковую добавку для повышения питательной ценности стандартной смеси для недоношенных младенцев. Такие добавки не содержат все макро- и микроэлементы, необходимые для недоношенных младенцев, чтобы они достигли роста, соответствующего росту плода в сочетании с удовлетворительным функциональным развитием.

В предпочтительном варианте осуществления первый контейнер из набора компонентов содержит глутамин в виде свободной аминокислоты, дипептида глутамина, трипептида глутамина и/или дипептида глутамин-аргинин, с присутствующими также фруктоолигосахаридами (FOS или 1cFOS) и галактоолигосахаридами (GOS или scGOS). GOS и FOS можно использовать, как описано где-либо в другом месте спецификации. Массовое соотношение глутамина к сумме неусваиваемых олигосахаридов GOS и FOS предпочтительно лежит в пределах от 2:1 до 1:4, более предпочтительно от 1:1 до 1:3, наиболее предпочтительно около 1:2. Предпочтительно указанный контейнер представляет собой саше (или упаковку с 2-100 отдельными саше) или консервную банку. Предпочтительно указанная смесь глутамин/GOS/FOS присутствует в сухом виде, предпочтительно в виде порошка. В одном варианте осуществления упомянутый первый контейнер содержит глутамин/GOS/FOS в виде стерилизованной жидкой формы, более предпочтительно в концентрированном виде или в виде стандартной суточной дозы для предотвращения порчи.

В предпочтительном варианте осуществления набор компонентов включает контейнер, который содержит Bifidobacterium breve M16V, предпочтительно описанные выше под заголовком "Bifidobacterium breve". Предпочтительно указанный контейнер представляет собой саше или упаковку с 2-100 отдельными саше. Предпочтительно указанные B. breve присутствуют в сухом виде, предпочтительно в виде порошка. Указанный контейнер предпочтительно содержит B. breve в виде стандартной суточной дозы для предотвращения порчи. Контейнер предпочтительно содержит от 0,5×109 до 1×1010 КОЕ, предпочтительно в виде суточной дозы от 1×109 до 5×109 КОЕ. В одном варианте осуществления контейнер предпочтительно содержит от 0,5×109 до 1×1010 КОЕ, предпочтительно от 1×109 до 5×109 КОЕ на г порошка.

В предпочтительном варианте осуществления контейнер включен в набор компонентов, который содержит белковую добавку, которая включает по меньшей мере 50% белка от общего количества калорий белковой добавки и/или по меньшей мере 50% белка в расчете на сухую массу белковой добавки. Предпочтительно белковая добавка содержит по меньшей мере 50% масс. белка, более предпочтительно по меньшей мере 60% масс. или по меньшей мере 70% масс., еще более предпочтительно по меньшей мере 80% масс. белка в расчете на сухую массу белковой добавки или на общее количество калорий белковой добавки. Белок из белковой добавки предпочтительно содержит или состоит (в значительной степени) из гидролизованного белка сыворотки и/или гидролизованного белка казеина. Белковую добавку предпочтительно обеспечивают в сухом виде, например, в виде сухого порошка или в виде стерильной жидкости. Предпочтительно ее обеспечивают в виде стандартной суточной дозы, чтобы предотвратить порчу, или в консервной банке с содержанием от 50 до 400 г, более предпочтительно от 100 до 300 грамм. Если добавка присутствует в виде стерилизованной жидкости, то предпочтительно она находится в резервуаре с объемом от 4 до 100 мл.

Грудное молоко не всегда может обеспечить все питательные вещества, необходимые для недоношенных младенцев, так как грудное молоко предназначено для употребления доношенными младенцами, тогда как недоношенные младенцы имеют повышенные потребности в питании. Таким образом, в предпочтительном варианте осуществления контейнер включен в набор компонентов, который содержит обогатитель для использования с грудным молоком, то есть обогатитель грудного молока (HMF). Указанный HMF можно обеспечить в сухом виде, например, в виде сухого порошка. Предпочтительно HMF имеет калорийность от 250 до 425 ккал/100 г порошка, более предпочтительно от 300 до 375 ккал/100 г порошка. Предпочтительно HMF имеет содержание белка от 20 до 40% Европейской нормы, предпочтительно включая казеиновый и/или сывороточный белок, и предпочтительно содержание углеводов составляет от 50 до 80 En%, более предпочтительно от 60 до 75 En%. HMF предпочтительно обеспечивают в виде саше или упаковки из нескольких саше, например, от 2 до 100 саше или от 25 до 75 саше с содержанием от 1 до 5 г. Предпочтительно готовят HMF в виде стандартной суточной дозы, чтобы предотвратить порчу.

Необязательные инструкции по применению набора компонентов предпочтительно содержат инструкции по применению глутамина, GOS/FOS и B. breve, количества выражают либо в г/кг/день, либо г/100 мл готового к употреблению продукта, например:

a) L-глутамин от 0,05 до 0,5 г/100 мл, предпочтительно от 0,1 до 0,3 г/100 мл и GOS/FOS (предпочтительно массовое соотношение 9:1) от 0,1 до 1,0 г/100 мл, предпочтительно от 0,2 до 0,6 г/100 мл, и/или

b) L-глутамин обеспечивают при дозе от 0,1 до 0,6 г/кг/день, предпочтительно при дозе от 0,2 до 0,4 г/кг/день и GOS/FOS (предпочтительно массовое соотношение 9:1) обеспечивают при дозе от 0,2 до 1,2 г/кг/день, предпочтительно при дозе от 0,4 до 0,8 г/кг/день, и

c) B. breve обеспечивают при суточной дозе от 0,5×109 до 1×1010 КОЕ, предпочтительно при суточной дозе от 1×109 до 5×109 КОЕ. Предпочтительно следует разделить суточную дозу на отдельные равные дозы, принимаемые в течение всего дня.

В одном варианте осуществления изобретение касается применения указанного выше набора с целью обеспечения питания недоношенных младенцев, в частности, для достижения эффектов, которые рассмотренные здесь выше и подкреплены примерами.

Применение

Данный способ или применение специально предназначены для младенцев и/или детей, начинающих ходить. Младенцы имеют возраст 0-12 месяцев, дети, начинающие ходить, имеют возраст 12-36 месяцев. Настоящую композицию предпочтительно вводят энтерально, более предпочтительно перорально. Настоящая композиция предпочтительно представляет собой питательную композицию, предпочтительно детскую смесь. Настоящую композицию можно успешно применены в качестве полноценного питания для младенцев. Настоящая композиция предпочтительно содержит липид, белок и углеводы, и предпочтительно вводится в жидком виде. Настоящее изобретение включает сухие композиции, например, порошки, которые снабжены инструкциями, как смешивать указанные сухие композиции, в частности, питательную смесь, с подходящей жидкостью, например, водой.

Настоящее изобретение предпочтительно касается способа кормления младенца, выбранного из группы, включающей преждевременно родившихся (недоношенных) младенцев и сильно недоношенных младенцев. Недоношенные младенцы рождаются до окончания 37-ой недели беременности. Сильно недоношенные младенцы рождаются до окончания 32-ой недели беременности. SGA-младенцы - это дети, чья масса при рождении составляет менее 10-го процентиля для данного гестационного возраста. Они, как правило, появляются в результате внутриутробной задержки роста (IUGR). Недоношенные и/или SGA-младенцы включают младенцев с низкой массой при рождении (LBW-младенцы), младенцев с очень низкой массой при рождении (VLBW-младенцы) и младенцев с предельно низкой массой при рождении (ELBW-младенцы). LBW-младенцев определяют как младенцев с массой менее 2500 г. VLBW-младенцев определяют как младенцев с массой, которая составляет менее 1500 г, и ELBW-младенцев определяют как младенцев с массой менее 1000 г.

Настоящее изобретение касается улучшения когнитивных функций, когнитивного развития, поведенческих характеристик и/или поведенческого развития младенца или ребенка, начинающего ходить. В предпочтительном варианте осуществления когнитивные функции и когнитивное развитие представляют характеристики памяти или развитие памяти, в том числе характеристики пространственной памяти. В предпочтительном варианте осуществления настоящее изобретение касается улучшения социального взаимодействия или улучшения поведения при социальном взаимодействии. В одном аспекте указанные выше эффекты наблюдают непосредственно после введения, предпочтительно в течение 24 месяцев, более предпочтительно в течение 12 месяцев, более предпочтительно в течение 6 месяцев, наиболее предпочтительно в течение 3 месяцев. Еще в одном дополнительном варианте осуществления наблюдают эффект на когнитивные функции, и/или поведенческие характеристики, и/или нейровоспаление в более позднем возрасте, когда человек имеет возраст 36 месяцев или более. Предпочтительно в возрасте 5 лет и более. Однако в одном аспекте такие эффекты импринтинга не являются частью настоящего изобретения.

Также настоящее изобретение касается лечения или предупреждения (или уменьшения риска) ухудшенных когнитивных функций, пониженного когнитивного развития, ухудшенных поведенческих характеристик, пониженного поведенческого развития и/или нейровоспаления у младенца или ребенка, начинающего ходить, выбранного из группы, включающей младенцев или детей, начинающих ходить, страдающих от аллергии, младенцев или детей, начинающих ходить, находящихся под риском аллергии, младенцев или детей, начинающих ходить, страдающих от воспаления кишечника, и недоношенных младенцев. В особо предпочтительном варианте осуществления изобретение касается лечения или предупреждения (или снижения риска) ухудшенного социального взаимодействия, ухудшенной пространственной памяти и поведенческого развития или улучшения социального взаимодействия, пространственной памяти и/или поведенческого развития у младенца или ребенка, начинающего ходить, выбранного из группы, состоящий из младенцев или детей, начинающих ходить, страдающих от аллергии, младенцев или детей, начинающих ходить, находящихся под риском аллергии, младенцев или детей, начинающих ходить, страдающих от воспаления кишечника, и недоношенных младенцев.

Таким образом, настоящее изобретение касается способа обеспечения питания младенца или ребенка, начинающего ходить, причем указанный способ включает введение указанному младенцу или ребенку, начинающему ходить, настоящей композиции. Предпочтительно младенец или ребенок, начинающий ходить, имеет возраст от 0 до 36 месяцев, более предпочтительно от 0 до 18 месяцев, еще более предпочтительно от 0 до 12 месяцев, наиболее предпочтительно от 0 до 6 месяцев.

ПРИМЕРЫ

Пример 1: Диетическое вмешательство с применением B. breve и неусваиваемых олигосахаридов снижает беспокойство и может улучшить когнитивные функции

Мышей С57В1/6 кормят контрольной пищей, Bifidobacterium breve M-16V от Morinaga (2% масс.: масс. 2×109 КОЕ/г; пробиотик), GF (1% масс.:масс. 9:1 scGOS:1cFOS; пребиотик) или комбинацией обоих (GF/Bb), как описано. Источник GOS: Vivinal-GOS, источник 1cFOS: RaftilinHP. Мышей кормят соответствующей пищей в течение примерно 3 недель.

Оценивают двигательную активность животных в дни 19 и 20 на арене 250×250×200 мм. Интенсивность света составляет 20 люкс на уровне пола. Оценивают общую двигательную активность, чтобы удостовериться, что животные не пострадали физически от обработки DSS или OVA. Передвижение животных отслеживают автоматически (система TSE, Германия). Время пребывания в центре открытого поля считают мерой тревоги и отслеживают автоматически. Это время также можно считать мерой исследовательской активности. Каждое животное помещают в центр открытого поля и позволяют осмотреться в течение 5 мин, после чего его возвращают в собственную клетку.

Оценивают пространственную рабочую память в дни 19 и 20 с помощью системы T-лабиринта. Адаптируют процедуру от Deacon и Rawlins, 2006. Испытание состоит из двух подходов с интервалом 2 мин. После того, как мышь выпускают из стартового рукава, животное свободно выбирает между двумя целевыми рукавами. Как только животное входит в один целевой рукав, другой целевой рукав закрывают, животное попадает в заключение на 30 сек при опускании двери целевого рукава. Затем животное возвращают в свою собственную клетку. После тщательной очистки Т-лабиринта 70% этанолом мышь помещают обратно в стартовый рукав, и она свободна в выборе одного из целевых рукавов. Основной мерой является отношение вариантов, определяемое как пропорция количества испытаний, при которых имело место чередование (сначала левый рукав, а затем правый рукав или наоборот), к общему количеству испытаний. Процент спонтанных чередований рассчитывают из отношения чередований умножением на 100%. Всего проводят 4 исследования в течение одного дня.

У мышей, получающих контрольную пищу, когнитивные функции, определяемые на модели T-лабиринта (пространственная память), выраженные как средний % спонтанных чередований, составляет около 78%. У здоровых мышей, получающих GF/Bb, наблюдают небольшое повышение примерно до 80%.

Что касается поведенческих характеристик (тревога, выраженная как среднее время в секундах, проведенное в центре открытого поля), у мышей на контрольной диете, оно составляет около 95 сек. Неожиданно оказалось, что у здоровых мышей, получающих GF/Bb, наблюдается значительное увеличение по сравнению с контрольной группой (примерно до 121 сек).

Пример 2: Диетические вмешательство с применением B. breve и неусваиваемых олигосахаридов предотвращает вызываемое аллергией ухудшение когнитивных функций, беспокойства и нейровоспаления

Самок мышей BALB/C в возрасте трех-четырех недель, не имеющих специфических патогенов (Charles River Laboratories, Maastricht, Нидерланды) кормят контрольной пищей или пищей с добавлением Bifidobacterium breve M-16V (2% масс.:масс. Вт, 2×109 КОЕ/г) и scGOS/1cFOS (1% масс.:масс. 9:1 scGOS:1cFOS; GF/Bb диета) за две недели до и во время пероральной сенсибилизации к овальбумину (OVA; Sigma). Мышей сенсибилизируют, вводя 0,5 мл стерильного PBS, содержащего 20 мкг/мл холерного токсина (CT), или 0,5 мл стерильного PBS, содержащего 20 мкг/мл CT и 40 мг/мл OVA, через оральный желудочный зонд. Мышей сенсибилизируют один раз в неделю в течение пяти последовательных недель. После сенсибилизации некоторые мыши получают 10 мкг OVA/100 мкл стерильного PBS внутрикожно в ушную раковину для оценки острой аллергической кожной реакции через 1 ч после введения, дважды измеряя толщину уха с использованием цифрового микрометра (Mitutoyo, Veenendaal, Нидерланды). Размер ушной опухоли корректируют на исходную толщину уха перед инъекцией. Мышей стимулируют, вводя 100 мг OVA/0,5 мл стерильного PBS через оральный желудочный зонд. Собирают фекалии через 15-30 мин после стимулирования и оценивают содержание воды.

Тестируют когнитивные и поведенческие характеристики, используя Т-лабиринт и тест «открытое поле», как описано в примере 1. Кроме того, тестируют гнездовое поведение. Показано, что гнездовое поведение зависит от функции интактного гиппокампа. Для оценки сохранности функции гиппокампа OVA/DSS животных выполняют исследование парадигмы строительства гнезда. Оценивают эффекты OVA/DSS и соответствующих обработок (т.е. синбиотиков) на способности строительства гнезда. Вкратце, животных обеспечивают 2 бумажными полотенцами в течение ночи. На следующее утро (через 12 ч) оценивают конструкцию гнезда из бумажных полотенец по 4-балльной системе: (0) нет гнезда: нет заметного свидетельства того, что к материалу прикасались; (1) плохое гнездо: часть материала использована или распределена по клетке, но место гнезда еще не сформировано; (2) хорошее гнездо: весь материал для гнезда использован для строительства гнезда, но гнездо плоское - отсутствуют боковые стенки; (3) эффективное гнездо: гнездовая чаша сформирована, но боковые стенки не полностью подняты; (4) идеальное гнездо: место гнезда полностью сформировано с высокими и компактными стенками, окружающими углубление в гнезде.

Мышей умерщвляют через 18 ч после перорального стимулирования и собирают кровь в пробирки Minicollect® Z Serum Sep (Greiner). Кровь центрифугируют в течение 30 мин при 14000g и хранят сыворотку при -20°С.

После выделения и взвешивания гиппокампа из правого полушария выделяют из гиппокампа РНК, используя набор RNAeasy (Qiagen, Germantown, MD USA), и затем проводят обратную транскрипцию в кДНК, применяя комплект для синтеза кДНК iScript (BioRad, Hercules, CA USA). Осуществляют ПЦР в реальном времени, используя комплект суперсмешивания IQ SYBR Green (BioRad, Hercules, Калифорния, США) с системой CFX 96 Real-Time System (BioRad, Hercules, CA USA). Уровни экспрессии нормализуют относительно GAPDH и рассчитывают, применяя метод дельта-дельта Ct. Используют следующие праймеры: для GAPDH (F: GCATCCTGCACCACCAACTG, R: ACGCCACAGCTTTCCAGAGG) и для BDNF (F: GAAGGCTGCAGGGGCATAGAC; R: TACACAGGAAGTGTCTATCCTTAT). Каждый образец ставят дублями по искомому гену.

Определяют OVA-специфические иммуноглобулины сыворотки, как известно в данной области. Планшеты Microlon (Greiner) покрывают 100 мл OVA 20 мкг/мл в карбонат/бикарбонатном буфере, 0,05 М, рН=9,6. Планшеты блокируют в течение 1 ч с помощью PBS/5% BSA. Затем наносят образцы при нескольких разведениях и инкубируют в течение 2 ч, а затем инкубируют с биотинилированным крысиным анти-мышиным IgE, IgG1 или IgG2a (1 мкг/мл; BD Biosciences) в течение 90 мин. Затем планшеты инкубируют в течение 1 ч с комплексом стрептавидин-пероксидаза хрена (0,5 мкг/мл; Sanquin) и проявляют, используя о-фенилендиамин. Реакции останавливают с помощью 2М H2SO4 и измеряют оптическую плотность при 490 нм на ридере для микропланшетов (Bio-Rad).

Клетки собирают и переносят в PBS/2% FCS. Характеризуют MoDC, используя антитела CD16-PE (3G8; BD Biosciences), DC-SIGN-FITC (120507), CX3CR1-FITC (528728, оба R&D Systems), CD14-PerCP-Cy5 (61D3), CD40-FITC (5C3), CD80-PE (2D10.4), CD83-PE (HB15e), CD86-PE (1T2.2), CD103-APC (B-Ly7), HLA-DR-PE (LN3) или CD103-AlexaFluor®647 (B-Ly7) (eBioscience). CD4+ Т-клетки внеклеточно окрашивают, используя антитела CD4-PerCP-Cy5.5 (ОКТ-4) и CD25-AlexaFluor488 (BC96) с последующей фиксацией и пермеабилизацией с использованием Foxp3 окрашивающего буферного набора (eBioscience) в соответствии с протоколом производителя. Т-клетки внутриклеточно окрашивают, используя антитела Foxp3-PE (PCH101, eBioscience). Используют FITC-меченные мышиные IgG2b, PE-меченные мышиные IgG2b, PerCP-Cy5.5-меченные мышиные IgG1 и eFluor®660-меченные мышиные IgG1 антитела в качестве изотипного контроля (eBioscience). После окрашивания moDC переносят в PBS/2% FCS, фиксируют 2% параформальдегидом и измеряют среднюю интенсивность флуоресценции. Среднюю интенсивность флуоресценции корректируют относительно фонового окрашивания изотипа.

Статистистические характеристики: все результаты выражают как среднее значение ± стандартная ошибка (SEM), и различия между средними значениями считают значимыми, если величина р равна или меньше 0,05. Применяют непараметрические статистики (тест Крускала-Уоллиса) для анализа латентных времен пассивного избегания, спонтанного чередования в Т-лабиринте и оценок гнездования с последующим вторичным анализом, применяя тест множественного сравнения Данна. Общую активность в открытом поле, гистологические, молекулярные и иммуногистохимические данные анализируют, применяя двухсторонний ANOVA с последующими вторичными тестами с коррекцией Бонферрони.

Результаты

Протокол индуцирования аллергии к овальбумину является эффективным, так как его можно отследить по эффектам опухания уха и OVA-специфическим уровням IgE в сыворотке. Опухание уха составляет около 50 мкм у контрольных мышей и значительно больше, около 150 мкм, у OVA-сенсибилизированных мышей. OVA-сенсибилизированные мыши, потребляющие GF/Bb пищу, демонстрируют значительно уменьшенное опухание уха, около 100 мкм.

OVA-специфический IgE отсутствует у мышей, не сенсибилизированных к OVA. У OVA-сенсибилизированных мышей, получающих контрольную пищу, наблюдают OVA-специфический IgE (OD при 490 нм около 0,91), в то время как у мышей, потребляющих GF/Bb пищу, он значительно ниже, около 0,33.

Диарея как симптом, определяемый по воде в фекалиях, составляет около 55% у неаллергических мышей и у OVA-аллергических мышей, потребляющих GF/Bb пищу, в то время как у OVA-аллергических мышей, потребляющих контрольную диету, фекалии значительно более водянистые (около 63%).

OVA-стимулирование не оказывает никакого эффекта на латентность в Т-лабиринте или открытом поле по сравнению с контрольными мышами, предполагая, что нарушения пространственной памяти не зависят от возможного аверсивного физического дискомфорта.

Как можно заключить из результатов, представленных в таблице 1, GF/Bb обработка ослабляет OVA-индуцированную ухудшенную когнитивную функцию статистически существенным образом. Следует отметить, что тест выполняют через 1 неделю после сенсибилизации, на самом деле это делается для минимизации любых возможных неблагоприятных эффектов, когда исчезает острая аллергическая реакция. Также наблюдают очень небольшое увеличение эффекта у здоровых мышей, получающих GF/Bb пищу.

Таблица 1
Тест с T-лабиринтом, % чередований
Контроль, контрольная диета Контроль, GF/Bb диета OVA-мыши, контрольная диета OVA-мыши, GF/Bb диета
Среднее 78,25 79,75 54,20* 79,33
s.e. 5,2 5,8 3,7 3,3

Как можно заключить из результатов, представленных в таблице 2, GF/Bb обработка ослабляет OVA-индуцированный повышенный уровень тревожности за 5 испытаний статистически существенным образом. Следует отметить, что тест в открытом поле снова проводят в моменты времени через 48 ч после сенсибилизации, на самом деле это делается для минимизации любых возможных неблагоприятных эффектов, когда исчезает острая аллергическая реакция. Также наблюдают значительный повышенный эффект у здоровых мышей, получающих GF/Bb пищу.

Таблица 2
Время в центре открытого поля (сек)
Контроль, контрольная диета Контроль, GF/Bb диета OVA-мыши, контрольная диета OVA-мыши, GF/Bb диета
Среднее 68,44 84,53 46,34* 65,37
s.e. 5,1 6,1 5,1 6,3

Как можно заключить из результатов, представленных в таблице 3, GF/Bb обработка ослабляет OVA-индуцированное ухудшенное поведение при гнездовании статистически значимым образом.

Таблица 3
Оценка гнезда
Контроль, контрольная диета Контроль, GF/Bb диета OVA-мыши, контрольная диета OVA-мыши, GF/Bb диета
Среднее 3,63 3,56 1,25* 2,75

s.e. 0,16 0,18 0,16 0,13

Мыши, подвергаемые воздействию аллергена, демонстрируют более высокие уровни беспокойства, нарушенную пространственную память и нарушенное поведение при гнездовании, которое предупреждают и/или лечат посредством потребления пищи с GF/Bb.

Эти недостатки присутствуют параллельно с пониженной экспрессией матричной РНК (мРНК) нейротрофического фактора головного мозга (BDNF) и p-гликопротеина в гиппокампе. Важно, что синбиотики нормализуют OVA-индуцированные аберрантные когнитивные и молекулярные изменения, как показано в таблице 4. Пониженный уровень мРНК р-гликопротеина указывает на нарушение гематоэнцефалического барьера. Уровень Foxp3 мРНК также снижается при OVA-сенсибилизации, но этот эффект ослабляется при потреблении пищи по настоящему изобретения. Foxp3 представляет собой транскрипционный фактор для регуляторных Т-клеток, который подавляет воспалительную реакцию. BDNF играет важную роль в нормальном развитии нервной системы и является важным для синаптической пластичности, обучения и памяти. Пониженный уровень BDNF у мышей предсказывает пороки развития в головном мозге и сенсорной нервной системе.

У контрольных мышей на контрольной диете установлен уровень p-гликопротеина, соответствующий 1. У контрольных мышей, получающих GF/Bb пищу, не наблюдают значительного отличия. У OVA-аллергических мышей, получающих контрольную пищу, уровень р-гликопротеина значительно снижается примерно до 0,5. У OVA-аллергических мышей, получающих GF/Bb пищу, он составляет 0,9 (и не имеет существенного отличия от здоровых контрольных животных).

У контрольных мышей на контрольной диете установлен уровень BDNF, соответствующий 1. У контрольных мышей, получающих GF/Bb пищу, не наблюдают значительного отличия. У OVA-аллергических мышей, получающих контрольную пищу, он значительно снижается примерно до 0,45. У OVA-аллергических мышей, получающих GF/Bb пищу, он составляет 0,93 (и не имеет существенного отличия от контроля). Никаких существенных различий не наблюдают у контрольных мышей, получающих GF/Bb пищу.

У контрольных мышей на контрольной диете установлен уровень Foxp3, соответствующий 1. У контрольных мышей, получающих GF/Bb пищу, не наблюдают значительного отличия. У OVA-аллергических мышей, получающих контрольную пищу, он значительно снижается до примерно 0,44. У OVA-аллергических мышей, получающих GF/Bb пищу, он составляет 1,0 (и не отличается от контроля).

Кроме того, FACS анализ гомогенизованных клеток гиппокампа показывает значительное повышение уровня OVA-индуцированных CD11c+F4/80+CD68- макрофагов, который снижается до контрольных уровней при обработке синбиотиками. Синбиотики повышают количество клеток CD11b+CD68+F4/80low.

Мыши, подвергающиеся воздействию аллергена, демонстрируют более высокие уровни тревоги и нарушенную пространственную память. Эти недостатки присутствуют параллельно с пониженной экспрессией матричной РНК (мРНК) нейротрофического фактора головного мозга (BDNF) и p-гликопротеина в гиппокампе. Повышенные уровни макрофагов, наблюдаемые в головном мозге ОВА-аллергических мышей, вероятно, возникают в результате циркуляции, что, в комбинации с наблюдаемым снижением гематоэнцефалического барьера, вовлекает периферийные моноциты в качестве потенциальных ключевых игроков в стимулирование сильного снижения функции головного мозга, наблюдаемого у аллергических мышей. Настоящие данные подтверждают мнение, что зависимое от аллергии периферическое воспаление модифицирует воспалительный статус головного мозга и гасит когнитивные способности животных, предполагая, что аллергия может играть роль в развитии и/или прогрессировании неврологических расстройств, и что, используя пищу с GF/Bb, можно их предупреждать и/или лечить.

Важно отметить, что пища с GF/Bb нормализует все эти OVA-индуцированные аберрантные когнитивные и молекулярные изменения.

Пример 3: Диетическое вмешательство B. breve и неусваиваемых олигосахаридов улучшает когнитивные и поведенческие характеристики, и в частности, уменьшает DSS-индуцированное желудочно-кишечное воспаление и связанные когнитивные и поведенческие недостатки у мышей

С57В1/6 мышей, как в примере 1, кормят контрольной пищей, Bifidobacterium breve М-16V (2% масс.:масс. 2×109 КОЕ/г; пробиотик), GF (1% масс.:масс., 9:1 scGOS:1cFOS; пребиотик) или комбинацией того и другого (GF/Bb), как описано. Мышей кормят соответствующей пищей 2 недели до и во время индуцирования колита в течение 6 дней. Колит индуцируют, добавляя 1,5% декстрансульфат натрия (DSS) в питьевую воду. Контролируют консистенцию фекалий (оценка 0 = норма, 1 = мягкие, но имеющие форму, 2 = диарея), появление крови в фекалиях (оценка 0 = нет крови, 1 = положительный тест, 2 = видимая свежая кровь в фекалиях; набор для колоректального теста, Axon Lab AG, Stuttgart, Германия) и массу тела, начиная с момента добавления DSS к питьевой воде. В других группах животных не индуцируют колит посредством DSS.

Поведенческие и когнитивные изменения у животных из группы, получающей GF/Bb или контрольную пищу, оценивают, применяя парадигмы «Т-лабиринт» и «открытое поле» на 5 и 6 дни DSS-обработки, соответственно, посредством исследования, описанного в примере 1.

Собирают лимфоциты из пейеровых бляшек (PP) и брыжеечных лимфатических узлов (MLN) путем разрушения ткани на 100 мкм клеточном измельчителе. Клетки, выделенные из PP, MLN, собирают в PBS/2% FCS. Fcγ-рецепторы блокируют, используя 10 мкг/мл антител CD16/CD32, затем производят внеклеточное окрашивание, используя антитела CD11c-FITC, CD40-FITC, CD80-APC, CD86-APC, CD103-APC, CD4-FITC и CD69-PerCP-Су5.5 (все eBioscience). Клетки фиксируют, используя 0,5% параформальдегид, или фиксируют и проводят пермеабилизацию, используя Foxp3 окрашивающий буферный набор (eBioscience) в соответствии с протоколом производителя для внутриклеточного окрашивания. Внутриклеточное окрашивание проводят, используя антитела Foxp3-APC, ROR-γΤ-ΡΕ, T-bet-PE и GATA3-eFluor660 (все eBioscience). Проточный цитометрический анализ выполняют с использованием программного обеспечения FACSCantoII и FACSDiVa (BD Biosciences).

Результаты

Диетическое вмешательство с использованием GF или GF/Bb улучшает оценку консистенции фекалий и задерживает начало появления крови в фекалиях. На 6-ой день во всех группах, обрабатываемых DSS, оценка составляет более 1,5. По изучению общей AUC оценок фекалий на 6-й день GF, BB и GF/Bb снижают оценку анализа крови в фекалиях, при наиболее высоком эффекте в GF/Bb группе, где наблюдают оценку около 2,7 (в то время как в контрольной группе наблюдают оценку около 4,2, в группе Bb около 3,0 и в группе GF около 3,7). У животных без DSS-индуцированного колита эта оценка составляет почти 0.

У здоровых мышей диетическое вмешательство с использованием Bifidobacterium breve M-16V, GF и особенно GF/Bb повышает экспрессию CD80 и CD86 клетками CD11c+ в MLN. DSS-обработка усиливает экспрессию CD80 и CD86, но подавляет экспрессию CD40 клетками CD11c+ в MLN. У этих DSS-обработанных мышей диетическое вмешательство с использованием GF и GF/Bb подавляет экспрессию CD80 и CD86 клетками MLN CD11c+. Кроме того, DSS-обработка дает в результате более низкий процент клеток CD11c+CD103+ в MLN, тогда как диетическое вмешательство Bifidobacterium breve M-16V, GF или в особенности GF/Bb повышает концентрацию этих клеток в MLN.

Так как диетическое вмешательство повышает относительное число клеток CD11c+CD103+ в MLN, диетическое вмешательство с использованием Bifidobacterium breve M-16V, GF или GF/Bb оказывает влияние на поляризацию Т-клеток. Таким образом, фенотип CD4+ Т-клеток анализируют посредством FACS - характеризуют как активированные Т-клетки (CD4+CD69+), Th1 клетки (CD4+Т-bet+GATA-3-), Th2 клетки (CD4+Т-bet-GATA-3+), активированные Th17 клетки (CD4+Ror-γT+Foxp3-) или Treg клетки (CD4+Ror-γTFoxp3+). В MLN наблюдают тенденцию к увеличению процента активированных Т-клеток у DSS-обработанных животных по сравнению с контрольными мышами. Диетическое вмешательство с использованием Bifidobacterium breve M-16V, GF или в большей степени GF/Bb имеет тенденцию к снижению процента активированных Т-клеток в MLN. В соответствии с повышенным содержанием клеток CD11c+CD103+ в MLN у DSS-обработанных мышей, которых кормят GF/Bb, наблюдают увеличение клеток Treg в MLN. Аналогичную тенденцию наблюдают, если кормят мышей Bifidobacterium breve M-16V или GF (но в меньшей степени). Кроме того, наблюдают тенденцию к снижению клеток Th17 в MLN. Такие наблюдения неожиданно были сделаны также для здоровых мышей.

Кратко, это указывает, что диетическое вмешательство с использованием GF/Bb уменьшает DSS-индуцированной колит и воспаление в высшей степени по сравнению с использованием отдельных компонентов, но во всех группах это воспаление присутствует на 5 и 6 день в наивысшей степени.

Что касается эффектов на когнитивные и поведенческие характеристики, наблюдают, что нет никакого различия в двигательной активности между 4 группами (контрольная диета или GF/Bb, DSS или отсутствием DSS-обработки), что выражается в общей активности (m) в обоих тестах, «T-лабиринт» и «открытое поле».

У мышей, получающих контрольную пищу, вредные эффекты DSS-вмешательства на когнитивные функции, измеряемые на модели с T-лабиринтом (пространственная память, выражаемая как средний % спонтанных чередований) являются значительными; снижение от примерно 78% до примерно 50%. У DSS-обработанных мышей, получающих пищу с GF/Bb, не наблюдают этих вредных эффектов DSS-обработки, значения около 74%, что значительно выше, чем в контрольной DSS-группе. У здоровых мышей, получающих GF/Bb, можно наблюдать небольшое увеличение (около 80%).

Что касается поведенческих характеристик (тревога, выражаемая как среднее время в секундах, проводимое в центре открытого поля), у здоровых контрольных мышей оно составляет около 95 сек. У DSS-обработанных мышей, получающих контрольную пищу, оно значительно снижено примерно до 55 сек. В DSS-группе, получающей GF/Bb пищу, этого снижения не наблюдают, время составляет около 135 сек и значительно больше, чем в контрольной DSS-группе. У здоровых мышей, получающих GF/Bb пищу, наблюдают значительное увеличение по сравнению со контрольной группой здоровых животных (около 121 сек).

Сильная DSS-обработка ведет к воспалению кишечника, повышенной тревожности и нарушениям пространственной памяти. Все параметры нормализуются при вмешательстве синбиотика. Настоящие данные подтверждают мнение, что воспаление кишечника может приводить к когнитивной и поведенческой недостаточности, но также добавка синбиотика может иметь терапевтический потенциал в отношении когнитивных и поведенческих характеристик у субъектов, страдающих от воспаления кишечника.

Пример 4: Диетическое вмешательство B. breve, неусваиваемых олигосахаридов и глутамина улучшает социальное взаимодействие, когнитивную функцию и поведенческие характеристики на модели аллергии на коровье молоко у мышей

Не содержащих патогена самцов мышей C3H/HeOuJ (4 недельного возраста, Charles River Laboratories) разводят и выращивают на пище, не содержащей коровьего молочного белка (Special Diet Services, Witham, Великобритания) и помещают в клетки с 12-часовым циклом свет-темнота при доступе к пище и воде без ограничения. Все процедуры на животных проводят в соответствии с указаниями голландского комитета Dutch Committee of Animal Experiments. Мышей сенсибилизируют перорально посредством 0,5 мл гомогенизированного сывороточного белка (40 мг/мл PBS) и холерного токсина (СТ, 20 мкг/мл PBS, Quadratech Diagnostics) в качестве адъюванта; фиктивно сенсибилизируемые мыши получают только CT. Мышей перорально стимулируют один раз в неделю в течение 5 последовательных недель. Через неделю после последней сенсибилизации, мышей стимулируют перорально 0,5 мл сыворотки (100 мг/мл PBS).

Мышей кормят контрольной пищей или комбинацией Bifidobacterium breve M-16V (2% масс.:масс. 2×109 КОЕ/г; пробиотик), GF (1% масс.:масс. 9:1 scGOS:1cFOS; пребиотик) и глутамин (5% масс.) [GF/Bb/Gln]. Источник GOS: Vivinal-GOS. Источник 1cFOS: RaftilinHP. Источник глутамина: Sigma. Пищу начинают давать за 2 недели до первой сенсибилизации и сохраняют до конца эксперимента.

В конце мышей подвергают тестам на социальное взаимодействие и пространственную память. Аллергия на коровье молоко связана с нарушенным социальным взаимодействием и нарушенной пространственной памятью и, следовательно, подходит для изучения на ней эффектов диетического вмешательства.

Тесты на социальное взаимодействие

Утром следующего дня после перорального стимулирования мышей подвергают тесту на социальное взаимодействие. Мышей помещают в открытое поле 45×45 см с небольшой перфорированной клеткой из плексигласа, расположенной около одной из стен, позволяющей визуальное, обонятельное и минимальное тактильное взаимодействие. Во время фазы обучения мышам позволяют исследовать помещение в течение 5 мин. Во время фазы взаимодействия вводят в клетку соответствующую по возрасту и полу незнакомую целевую мышь еще на 5 мин. Используя программу видеозаписи (Etho Vision 3.1.16, Noldus), определяют зону взаимодействия вокруг клетки с помощью цифрового управления. Измеряют время, проведенное в зоне взаимодействия, а также частоту вхождения в зону взаимодействия за выбранный период времени.

Тест на характеристики пространственной памяти с T-лабиринтом

Спонтанное чередование в T-лабиринте является поведенческим тестом для определения исследовательского поведения и характеристик пространственной памяти у животных, в частности, на моделях грызунов для ЦНС-расстройств. Этот тест основан на желании грызунов исследовать новое окружение, т.е. на предпочтении скорее посетить новый рукав лабиринта, а не привычный рукав. Многие части головного мозга, включая гиппокамп, мембраны, базальный отдел переднего мозга и предлобную кору головного мозга, участвуют в этой задаче.

Субъекты сначала размещаются в стартовом рукаве T-лабиринта. Покидая стартовый рукав, субъекты выбирают между входом в левый или правый целевой рукав. При повторных испытаниях животные должны показать меньшую тенденцию войти в ранее посещаемый рукав. Регистрируют процент чередования (число поворотов в каждый целевой рукав) и общую продолжительность испытания. Этот тест используют для количественной оценки когнитивной недостаточности у трансгенных линий мышей и оценивают новые химические объекты на их эффекты на когнитивную способность. После оценки социального взаимодействия на следующий день после пероральной стимуляции исследуют спонтанное чередование в конструкции T-лабиринта. Каждую мышь помещают в стартовый рукав и позволяют исследовать T-лабиринт до тех пор, пока не будет выбран один из целевых рукавов. Затем животное возвращают в его собственную клетку и проводят всего 5 испытаний. Между испытаниями T-лабиринт тщательно очищают 70% этанолом. Отношение чередований определяют как количество испытаний, в которых животное меняет рукав, деленное на общее количество испытаний.

Результаты, касающиеся социального взаимодействия и Т-чередования, сравнивают с результатами, наблюдаемыми для несенсибилизированных мышей, не подвергаемых диетическому вмешательству.

Результаты

Модель аллергии на коровье молоко демонстрирует хорошую модель для изучения социальных взаимодействий различными способами. В таблице 4 время в зоне взаимодействия значительно уменьшено для сенсибилизированных мышей (контроль-сенсибилизированные мыши относительно контроль-несенсибилизированных мышей). Эффекты снижения социального взаимодействия, индуцированные сенсибилизацией, уменьшены для всех тестируемых диет, но значительно уменьшены для мышей, получающих GF/Bb. Статистические данные по упоминаемым в таблице 4 образцам получают, используя непарный t-тест относительно CMA-сенсибилизированного контроля, для расчета значения р. Данные для СМА GF/Bb значительно улучшены по сравнению с данными для контрольных CMA-мышей (р=0,05).

Таблица 4
Время, проведенное в зоне взаимодействия (сек)
Контроль, CMA-сенсибилизированные мыши CMA GF/Bb CMA GF/Bb/Gln
Среднее±s.e. 75±12,1 (n=12) 120±18,7 (n=11) 107±23,7 (n=12)

Несенсибилизированные мыши, которых кормят GF/Bb/Gln пищей, не исследованные подобным образом с применением CMA-модели, неожиданно также показывают статистически наглядную тенденцию (р<0,10) к попыткам более длительного социального взаимодействия, которое измеряют временем, проведенным в зоне взаимодействия, по сравнению с несенсибилизированными мышами, которых кормят контрольной пищей (141±23,6 сек против 199±21,7 сек, р=0,08). Эффект пищевой добавки GF/Bb/Gln также превышает эффект добавки GF/Bb для этих несенсибилизированных, неаллергических здоровых исходных животных.

Вторым параметром, используемым для определения социального взаимодействия, является частота входа животных в зону взаимодействия в течение предварительно установленного интервала времени. Неожиданно оказалось, что частота входа животных в зону взаимодействия, подразумевая, что они стремятся к взаимодействию с соответствующей по возрасту и полу незнакомой целевой мышью, для СМА-сенсибилизированных мышей, получающих GF/Bb пищу, а также GF/Bb/Gln пищу, значительно повышается (величины р для CMA-контроля относительно CMA GF/Bb и CMA-контроля относительно GF/Bb/Gln по измерениям, составляют р=0,032 и р=0,0095, соответственно). Статистистические данные по упоминаемым в таблице 5 образцам получают, используя непарный t-тест относительно CMA-сенсибилизированного контроля, для расчета значения р.

Таблица 5
Частота входа в зону взаимодействия
Контроль, CMA-сенсибилизированные мыши CMA GF/Bb CMA GF/Bb/Gln
Среднее±s.e. 8,0±0,94 (n=11) 14,7±2,76 (n=11) 12,7±1,36 (n=10)

Модель аллергии на коровье молоко также демонстрирует хорошую модель для изучения пространственной памяти при использовании поведенческих тестов на спонтанное чередование в Т-лабиринте. В таблице 6 эффекты пониженного чередования в тесте с T-лабиринтом, индуцированные сенсибилизацией, значительно улучшены для мышей, получающих пищу с добавлением GF/Bb (р=0,06), а также с добавлением GF/Bb/Gln (р=0,0005) по сравнению с ситуацией, наблюдаемой для контрольных CMA-мышей. Статистистические данные по упоминаемым в таблице 6 образцам получают с использованием непарного t-критерия относительно CMA-сенсибилизированного контроля для расчета значений р.

Таблица 6
% чередование в тесте на пространственную память
Контроль, CMA-сенсибилизированные мыши CMA GF/Bb CMA GF/Bb/Gln
Среднее±s.e. 52,7±4,3 (n=9) 64,6±3,7 (n=12) 81,3±4,5 (n=12)

Благотворные эффекты на пространственную память пищевых добавок GF/Bb, а также GF/Bb/Gln относительно контрольной пищи без добавок неожиданно наблюдают также у здоровых несенсибилизированных мышей. Характеристики пространственной памяти у неаллергенных, нестимулированных здоровых мышей, получающих пищу с добавлением GF/Bb, демонстрируют 20% повышение по сравнению с контрольной пищей (р=0,03, n=12). Для GF/Bb/Gln-мышей это увеличение демонстрирует ясную статистическую тенденцию при 17% увеличении (р=0,10, n=12).

Пример 5: Смесь для недоношенных младенцев с B. breve и неусваиваемыми олигосахаридами

Смесь для недоношенных младенцев в виде порошка, содержащего на 100 г около 474 ккал, 15,6 г белка, 49,8 г усваиваемых углеводов (главным образом, лактозы и мальтодекстрина), 22,9 г жира и 4,7 г неусваиваемых олигосахаридов. Белок содержит примерно 92,5% масс. казеина и белка сыворотки из коровьего молока от общего белка при массовом соотношении 1:1,5. Около 7,5% масс. белка составляет L-глутамин. Неусваиваемые олигосахариды представляют собой галактоолигосахариды (источник Vivinal GOS, Borculo Domo) и фруктополисахариды (источник RaftilinHP, Orafti) при массовом соотношении 9:1. По указаниям ЕС неусваиваемые дисахариды в GOS не квалифицируются как пищевое волокно. Следовательно, содержание волокна помечено как 3,3 г на 100 г порошка. Присутствует 107 КОЕ Bifidobacterium breve M-16V (Morinaga) на г порошка. Основная часть жира имеет растительное происхождение, но также в качестве источника LC-PUFA присутствует жир тунца (источник DHA), масло водорослей (источник ARA) арахидоновая кислота (ARASCO, Martek) и яичные липиды (источник DHA и ARA), что дает в результате 0,52% масс. ARA от общего количества жирных ацильных цепей и 0,40% масс. DHA от общего количества жирных ацильных цепей. Кроме того, композиция содержит минералы, следовые элементы, витамины и другие питательные микроэлементы, которые известны в данной области, и в соответствии с указаниями для недоношенных младенцев. Для приготовления смеси, готовой к употреблению, по инструкции разбавляют 16,9 г порошка (3 ложечки) водой до конечного объема 100 мл.

Пример 6: Пищевая добавка, обогащенная глутамином

Обогатитель грудного молока в виде порошка, упакованного в саше, содержащие 2,1 г. На 100 г порошка композиция содержит 25,2 г белка, 52,2 г усваиваемых углеводов (главным образом, мальтодекстрина), 2 г неусваиваемых олигосахаридов, как в примере 4, 1.109 КОЕ B.breve M16-V, остальное количество составляют минералы, микроэлементы и витамины. Белок состоит из 50% масс. гидролизата сывороточного белка и гидролизата казеина при массовом соотношении 1/1 и 50% масс. свободного L-глутамина от общего белка. Также присутствует 10 г жирового компонента с высоким содержанием ARA и DHA.

Пример 7: Смесь, используемая после выписки из больницы, для недоношенных или маленьких для гестационного возраста младенцев

Смесь после выписки продается для использования недоношенными или маленькими для гестационного возраста младенцами после выписки из больницы или по достижении ими определенного возраста до скорректированного возраста 6 месяцев. Смесь в виде порошка содержит на 100 г около 491 ккал, 13,4 г белка, 49,1 г усваиваемых углеводов (главным образом, лактозы и мальтодекстрина), 26 г жира и 5,2 г неусваиваемых олигосахаридов. Белок содержит примерно 92,5% масс. казеина и белка сыворотки из коровьего молока, считая от общего белка, при массовом соотношении 1:1,5. Около 7,5% масс. белка составляет свободный L-глутамин. Неусваиваемые олигосахариды представляют собой галактоолигосахариды (источник Vivinal GOS, Borculo Domo) и фруктополисахариды (источник RaftilinHP, Orafti) при массовом соотношении 9:1. По указаниям ЕС неусваиваемые дисахариды в GOS не квалифицируются как пищевое волокно. Следовательно, содержание волокна помечено как 3,7 г на 100 г порошка. Присутствует 5.107 КОЕ Bifidobacterium breve M-16V (Morinaga) на г порошка. Основная часть жира имеет растительное происхождение, но также в качестве источника LC-PUFA присутствует рыбий жир, масло морских водорослей и яичный липид, обеспечивая в результате 0,44% масс. ARA от общего количества жирных ацильных цепей и 0,33% масс. DHA от общего количества жирных ацильных цепей. Кроме того, композиция содержит минералы, микроэлементы, витамины, L-карнитин, холин, миоинозит, таурин и нуклеотиды, которые известны в данной области, и в соответствии с указаниями относительно недоношенных младенцев. Для приготовления смеси, готовой к употреблению, по инструкции разбавляют 15,3 г порошка (3 ложечки) водой до конечного объема 100 мл.

Пример 8: Смесь для младенцев-аллергиков

Смесь в виде порошка, содержащего на 100 г 493 ккал, 11,6 г белка, 52 г усваиваемых углеводов (главным образом, лактозы и мальтодекстрина), 25,6 г жира и 5,9 г неусваиваемых олигосахаридов. Белок содержит сильно гидролизованный белок сыворотки, и примерно 5% масс. белка добавляет свободный L-глутамин. Неусваиваемые олигосахариды представляют собой галактоолигосахариды (источник Vivinal GOS, Borculo Domo) и фруктополисахариды (источник RaftilinHP, Orafti) при массовом соотношении 9:1. По указаниям ЕС неусваиваемые дисахариды в GOS не квалифицируются как пищевое волокно. Следовательно, содержание волокна помечено как 4,1 г на 100 г порошка. Присутствует 5.108 КОЕ Bifidobacterium breve M-16V (Morinaga) на г порошка. Основная часть жира имеет растительное происхождение, но в качестве источника LC-PUFA присутствуют также другие источники липидов, что дает в результате 0,2% масс. ARA от общего количества жирных ацильных цепей и 0,2% масс. DHA от общего количества жирных ацильных цепей. Кроме того, композиция содержит минералы, микроэлементы, витамины, L-карнитин, холин, миоинозит, таурин и нуклеотиды, которые известны в данной области. Для приготовления смеси, готовой к употреблению, по инструкции разбавляют 13,6 г порошка (3 ложечки) водой до конечного объема 100 мл.

Пример 9: Набор для недоношенных младенцев

Упаковка, включающая 20 саше с порошком, содержащим глутамин в виде свободной аминокислоты и неусваиваемые олигосахариды. Неусваиваемые олигосахариды представляют собой галактоолигосахариды (источник Vivinal GOS, Borculo Domo) и фруктополисахариды (источник RaftilinHP, Orafti) при массовом соотношении 9:1. Массовое отношение глутамина к сумме неусваиваемых олигосахаридов GOS и FOS составляет примерно 1:2. Упаковка также включает второй набор из 20 саше с 3×109 КОЕ Bifidobacterium breve M-16V (Morinaga) на грамм порошка. Упаковка снабжена инструкциями по использованию саше для недоношенных младенцев, где инструкции указывают г/100 мл готового к употреблению продукта (при суточной дозе 150 мл для недоношенных младенцев): 0,2 г/100 мл глутамина, 0,4 г/100 мл GOS/FOS и 1 г B. breve.

1. Применение глутамина, Bifidobacterium breve и по меньшей мере одного неусваиваемого олигосахарида, выбранного из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, для изготовления питательной композиции для улучшения когнитивных функций, когнитивного развития, поведенческих характеристик, поведенческого развития и/или социального взаимодействия у младенца или ребенка, начинающего ходить, и/или для лечения или предупреждения ухудшенных когнитивных функций, пониженного когнитивного развития, ухудшенных поведенческих характеристик, пониженного поведенческого развития, пониженного социального взаимодействия и/или нейровоспаления у младенца или ребенка, начинающего ходить, где младенец или ребенок, начинающий ходить, страдает от аллергии или кишечного воспаления или где младенец или ребенок, начинающий ходить, такой как недоношенный младенец, маленький для гестационного возраста (SGA) младенец или младенец, родившийся с помощью кесарева сечения, находящихся под риском аллергии, и где глутамин находится в форме свободных аминокислот, дипептидов и/или трипептидов.

2. Применение по п. 1, где В. breve представляет собой В. breve М-16V.

3. Применение по любому из предыдущих пунктов, где неусваиваемый олигосахарид содержит галактоолигосахариды и/или фруктоолигосахариды.

4. Применение по п. 1 или 2, где питательная композиция содержит белок, жир и/или усваиваемые углеводы и выбрана из группы, включающей начальную смесь для младенцев, смесь для искусственного вскармливания, молоко для детей, начинающих ходить, смесь для недоношенных младенцев, смесь для младенцев после выписки и обогатитель грудного молока.

5. Применение по п. 1 или 2, где B. breve присутствует в количестве от 102 до 1013 КОЕ на г сухой массы или (если присутствует в виде нерепликативной формы) в количестве, эквивалентном этому.

6. Применение по п. 1 или 2, где питательная композиция содержит от 0,5 до 20 мас. % неусваиваемых олигосахаридов в расчете на сухую массу питательной композиции.

7. Применение по п. 1 или 2, где когнитивная функция или когнитивное развитие подразумевают характеристики памяти или развитие памяти, предпочтительно включающее пространственное представление.

8. Применение по п. 1 или 2, где питательная композиция содержит полиненасыщенные жирные кислоты с длинной цепью (LCPUFA), предпочтительно арахидоновую кислоту (ARA) и/или докозагексаеновую кислоту (DHA).

9. Применение по п. 1, где неусваиваемый олигосахарид, включает галактоолигосахариды и/или фруктоолигосахариды, где питательная композиция содержит белок, жир и/или усваиваемые углеводы и выбрана из группы, включающей начальную смесь для младенцев, смесь для искусственного вскармливания, молоко для детей, начинающих ходить, смесь для недоношенных младенцев, смесь для младенцев после выписки и обогатитель грудного молока.

10. Применение по п. 9, где когнитивная характеристика или когнитивное развитие представляет собой характеристику памяти или развитие памяти, предпочтительно включая пространственную память.

11. Применение по п. 9 или 10, где питательная композиция включает полиненасыщенные жирные кислоты с длинной цепью (LCPUFA), предпочтительно арахидоновую кислоту (ARA) и/или докозагексаеновую кислоту (DHA).

12. Набор, включающий первый контейнер, содержащий глутамин в виде свободной аминокислоты, дипептидов и/или трипептидов и по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, и второй контейнер, содержащий Bifidobacterium breve.

13. Набор по п. 12, где глутамин, и фруктоолигосахариды, и галактоолигосахариды присутствуют при массовом соотношении глутамина к сумме фруктоолигосахаридов и галактоолигосахаридов от 2:1 до 1:4, более предпочтительно от 1:1 до 1:3, наиболее предпочтительно примерно 1:2.

14. Питательная композиция, содержащая белок, жир и усваиваемый углевод, и дополнительно содержащая:

a) Bifidobacterium breve в количестве от 102 до 1013 КОЕ на г сухой массы питательной композиции,

b) по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, в количестве от 0,5 до 20 мас. % в расчете на сухую массу питательной композиции,

c) по меньшей мере 4 мас. % глутамина в расчете на сухую массу питательной композиции, где указанный глутамин находится в виде свободной аминокислоты, и/или глутаминсодержащего дипептида, и/или глутаминсодержащего трипептида, и

d) LC-PUFA в виде или арахидоновой кислоты, и/или докозагексаеновой кислоты.

15. Питательная композиция по п. 14, содержащая по меньшей мере 12 % глутамина в виде свободной аминокислоты и, если присутствует, глутаминсодержащего дипептида и глутаминсодержащего трипептида в расчете от общего белка.

16. Нетерапевтический способ улучшения когнитивных функций, когнитивного развития, поведенческих характеристик, поведенческого развития и/или социального взаимодействия младенца или ребенка, начинающего ходить, включающий введение младенцу или ребенку, начинающему ходить, питательной композиции, содержащей глутамин, Bifidobacterium breve и по меньшей мере один неусваиваемый олигосахарид, выбранный из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты, и где глутамин находится в виде свободной аминокислоты, дипептидов и/или трипептидов.



 

Похожие патенты:

Группа изобретений относится к биотехнологии, медицинской и пищевой промышленности. Предложены питательные композиции для стимулирования мукозальной иммунной системы, способ изготовления и их применения.

Группа изобретений относится к медицине и касается пищевой композиции, содержащей бактериальную композицию. Композиция содержит по меньшей мере один бактериальный штамм, принадлежащий к виду Bifidobacterium bifidum, выбранный из группы, состоящей из бактериального штамма В.

Изобретение относится к способу получения биологически активной добавки. Способ получения биологически активной добавки, включающий обработку растительного сырья культурой бактерий рода Lactobacillus, при этом инокулят готовят получением взвеси лактобактерий штаммов Lactobacillus plantarum 8Р-А3 и/или Lactobacillus fermentum 90Т-С4 с содержанием клеток не менее 1×108 КОЕ/мл, смешивание инокулята и растительного сырья (субстрат) проводят в объемном соотношении от 1:1 до 1:1,5, инкубирование смеси проводят в течение 15-24 ч при температуре 36-38°С до рН 3,5-5,2, инактивацию ферментирующей массы клеток с одновременным высушиванием ферментированного субстрата проводят при температуре 100°С и атмосферном давлении в течение 1,5-2,0 ч с последующим досушиванием продукта до остаточной влажности 10-15% при температуре 55-70°С.

Изобретение относится к ветеринарной медицине и представляет собой способ производства комбинированной антигельминтной таблетки с симбиотиком для лечения мелкого рогатого скота, содержащей первый и второй слой, включающий этапы, на которых: добавляют первую порошковую смесь на плиту пресс-формы, причем указанная первая порошковая смесь содержит фармацевтически активное вещество и связующее вещество, добавляют вторую порошковую смесь на указанную плиту пресс-формы, причем указанная вторая порошковая смесь содержит связующее вещество, а композиция указанной второй порошковой смеси отличается от композиции указанной первой порошковой смеси, прессуют первую порошковую смесь и вторую порошковую смесь на указанной плите пресс-формы для образования таблетированной формы и подвергают указанную таблетированную форму радиочастотному излучению в течение периода времени, достаточного для активации указанного связующего вещества внутри указанной таблетированной формы для сплавления указанной таблетированной формы в указанную таблетку, таким образом, чтобы плотность указанной таблетки составляла менее приблизительно 0,8 г/см3, отличающийся тем, что для получения первой порошковой смеси готовят бактериальный концентрат, включающий консорциум бифидо и лактобактерий Bifidobacterium adolescentis B-1 и Lactobacillus acidophilus ЛГ-1 с титром 108-1010 КОЕ/г, сорбированных на носителе в соотношении 1:1:12, которые концентрируют путем фильтрации или центрифугирования до получения суспензии, содержащей 5 млрд бактерий в 1 мл, с последующим смешиванием их в равных объемах, причем в качестве носителя используют муку или отруби из расчета 12 частей носителя на I часть смеси концентрированных культур, проводят контактно-сорбционную сушку биомассы, а затем полученную сухую порошкообразную массу смешивают с лактулозой, а для получения второй порошковой смеси используют ивермектин, празиквантел и, по меньшей мере, один фармацевтически приемлемый наполнитель - микрокристаллическую целлюлозу МКЦ, затем смешивают субстанции ивермектина, празиквантела и наполнителя в сухом виде, причем компоненты в таблетке находятся в определенном соотношении в мас.%.

Группа изобретений относится к полибактериальному пробиотическому препарату, включающему новые штаммы молочнокислых бактерий Lactobacillus gasseri 7/12 NBIMCC No. 8720, Lactobacillus plantarum F12 NBIMCC No 8722 и Lactobacillus helveticus A1, NBIMCC No 8721, обладающему противовоспалительной иммуномодулирующей, гипохолестеринемической, антиоксидантной и антигипертензивной активностью.

Изобретение относится к биотехнологии и может быть использовано для получения грамицидина С с помощью штамма продуцента Aneurinibacillus migulanus ВКПМВ-10212. Полученный штамм позволяет продуцировать грамицидин C с высоким выходом.

Изобретение относится к биотехнологии. Штамм бактерий Lactobacillus rhamnosus 24 дс, обладающий антагонистической активностью по отношению к патогенным и условно-патогенным микроорганизмам, в том числе по отношению к дрожжевым грибам рода Candida, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-12596 и может быть использован в производстве пробиотических бактерийных препаратов, биологически активных добавок к пище, кисломолочных ферментированных и неферментированных пищевых продуктов.

Изобретение относится к биотехнологии. Штамм бактерий Lactobacillus rhamnosus 7дс, обладающий антагонистической активностью по отношению к патогенным и условно-патогенным микроорганизмам, в том числе по отношению к дрожжевым грибам рода Candida, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-12598.

Изобретение относится к биотехнологии. Штамм бактерий Lactobacillus fermentum 11 зв, обладающий широким спектром антагонистической активности по отношению к патогенным и условно-патогенным микроорганизмам, в том числе по отношению к дрожжевым грибам рода Candida, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-12597 и может быть использован в производстве пробиотических бактерийных препаратов, биологически активных добавок к пище, кисломолочных ферментированных и неферментированных пищевых продуктов.
Изобретение относится к медицине, а именно к дерматологии, и может быть использовано для лечения очаговой склеродермии. Для этого на очаги поражения воздействуют низкоэнергетическим лазерным излучением инфракрасного диапазона частотой следования импульсов - 1500 Гц, длительностью импульса 110-160 нс, импульсной мощностью 4-6 Вт/имп, по 1-3 минут на поле.

Группа изобретений относится к композициям для грудных детей. Предложены: композиция, содержащая по меньшей мере одну длинноцепочечную полиненасыщенную жирную кислоту (LC-PUFA), по меньшей мере один пробиотик и смесь олигосахаридов, включающую по меньшей мере один N-ацетилированный олигосахарид, по меньшей мере один сиалированный олигосахарид и по меньшей мере один нейтральный олигосахарид, для стимуляции ангиогенеза в кишечнике и всасывания питательных веществ, переносимости энтерального питания грудных детей или подрастающих младенцев; её применение в качестве синтетического питательного агента по тому же назначению; композиция того же состава, применяемая при профилактике и/или лечении воспалительного поражения кишечника, представляющего собой некротизирующий энтероколит, и/или при выздоровлении после повреждения и/или хирургического вмешательства в области кишечника грудных детей или подрастающих младенцев, и её применение в качестве синтетического питательного агента по тому же назначению.

Изобретение относится к фармацевтической композиции для лечения гиперлипидемии. Фармацевтическая композиция для лечения гиперлипидемии содержит смесь глицирризинового производного, выбранного из глицирризиновой кислоты и ее фармацевтически приемлемой соли, и гиполипидимического лекарственного средства-статина, выбранного из аторвастатина, ловастатина, розувастатина, симвастатина, правастатина, питавастатина, флувастатина и их фармацевтически приемлемых солей или смесей, и вспомогательные вещества.

Группа изобретений раскрывает синтетическую питательную смесь для предупреждения и/или лечения состояний кожи и заболеваний кожи у младенцев. Предложены: синтетическая питательная смесь для младенцев для лечения состояний кожи и заболеваний кожи, включающая, пробиотик и пребиотик, белки, углеводы, липиды, витамины, минеральные вещества и не менее 5000 мг/л смеси по меньшей мере одного N-ацетиллактозамина, по меньшей мере одного сиалированного олигосахарида и по меньшей мере одного фукозилированного олигосахарида; и применение композиции вышеперечисленного состава для предупреждения и/или лечения атопического дерматита.

Изобретение относится к области инкапсуляции. Описан способ получения нанокапсул танина.
Настоящее изобретение относится к фармакологии и описывает средство для очистки ран, представляющее собой октасульфат сахарозы или его соль. Изобретение обеспечивает полное или частичное разрушение фибринозного матрикса в фазе очистки раневого процесса и может быть использовано, в частности, для изготовления повязок, предназначенных для очистки ран.

Группа изобретений относится к пищевой промышленности и касается композиции, представляющей собой искусственную питательную композицию, содержащую лакто-N-неотетраозу, 6′-сиалиллактозу и 2′-фукозиллактозу.
Группа изобретений относится к области пищевой промышленности, а именно к питательной композиции, которая не является человеческим молоком и содержит фукозиллактозу и бетагалактоолигосахариды, которые имеют структуру [галактоза]n-глюкоза, где n равно целому числу от 2 до 60, и имеют более 80% бета-1,4 и бета-1,6 связей; и к применению такой композиции для предоставления питания детям, пожилым и пациентам, болеющим раком, и/или пациентам, зараженным ВИЧ, а также для лечения и/или предотвращения развития вирусных инфекций, иммунных заболеваний и/или заболевания, которое может быть предотвращено и/или вылечено путем усиления Th1 ответа и/или Th1/Th2 баланса, и для усиления ответа на вакцинацию.

Изобретение относится к фармацевтической промышленности и медицине и представляет собой фармацевтическую композицию для лечения гиперхолестеринемии, триглицеридемии, ишемической болезни сердца (ИБС) и профилактики инфаркта миокарда, инсульта, атеросклероза и снижения риска неблагоприятного воздействия статинов на уровень глюкозы в крови, включающую, по меньшей мере, два активных компонента, при этом один компонент выбран из группы статинов: аторвастатин, ловастатин, правастатин, розувастатин, симвастатин, флувастатин, питавастатин, а второй компонент выбран из группы пребиотиков: ксилит, сорбит, лактитол, лактулоза, лактосукроза, мелибиоза, ксилобиоза, стахиоза, раффиноза, или галактоолигосахарид, мальтоолигосахарид, ксилоолигосахарид, изомальтоолигосахарид, гентиолигосахарид, или арабиногалактан, пуллулан, причем компоненты в композиции находятся в определенном соотношении, мг.
Изобретение относится к фармацевтической промышленности и представляет собой вагинальную шипучую композицию в твердой форме, содержащую лимонную кислоту, или яблочную кислоту, или винную кислоту, или фумаровую кислоту, или молочную кислоту, или их смеси, соль карбонатного и/или бикарбонатного аниона, где указанная соль присутствует в количестве, составляющем от 1 до 15% по массе относительно общей массы композиции, смесь, содержащую микрокристаллическую целлюлозу и арабиногалактан, в соотношении от 1:1 до 3:1, и по меньшей мере один пробиотический бактериальный штамм, обладающий способностью уменьшать и/или элиминировать присутствие патогенных агентов, выбранных из группы, включающей: Candida albicans, Candida glabrata, Candida parapsilosis, Candida krusei, Candida tropicalis, Gardnerella vaginalis, Trichomonas vaginalis, Neisseria gonorrhoeae, Escherichia coli, Herpex simplex и Haemophilus ducreyi, где пробиотический бактериальный штамм принадлежит к по меньшей мере одному виду, выбранному из группы, состоящей из: Lactobacillus plantarum, Lactobacillus pentosus, Lactobacillus casei, Lactobacillus casei ssp.paracasei, Lactobacillus rhamnosus, Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus delbrueckii ssp.bulgahcus, Lactobacillus delbrueckii ssp.delbrueckii, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus reuteri, Bifidobacterium longum, Bifidobacterium bifidum, Bifidobacterium breve, Bifidobacterium animalis ssp.lactis, Bifidobacterium adolescentis, Bifidobacterium pseudocatenulatum, Bifidobacterium eatenulatum или Bifidobacterium infantis и где указанная композиция предназначена для применения для лечения вагинита, вагиноза, кандидоза, гонореи, герпеса и мягкого шанкра.

Изобретение относится к фармацевтической промышленности и представляет собой композицию, включающую, по меньшей мере, один N-ацетиллактозамин, выбранный из группы, включающей лакто-N-тетраозу и лакто-N-неотетраозу, по меньшей мере, один сиалилированный олигосахарид и, по меньшей мере, один фукозилированный олигосахарид и гидролизат, включающий частично и/или сильно гидролизованные белки, у которых предпочтительно от 10% до 100% и предпочтительнее от 15% до 95%, популяции белков/пептидов имеют молекулярную массу менее 1000 дальтон, для применения при предупреждении и/или лечении атопического дерматита и экземы.

Изобретение относится к пищевой промышленности, в частности к изготовлению фруктового продукта в виде пластинок из груш, яблок и виноградного сырья. Пищевой продукт готовят путем подготовки груш и яблок.

Изобретение относится к питательным композициям для младенцев и маленьких детей. Предложено применение глутамина, Bifidobacterium breve и по меньшей мере одного неусваиваемого олигосахарида для изготовления питательной композиции для улучшения когнитивных или поведенческих характеристик, когнитивного или поведенческого развития, социального взаимодействия иили нейровоспаления у младенцев или детей, начинающих ходить. При этом младенец или ребенок, начинающий ходить. страдает от аллергии или находится под риском аллергии, либо страдает от кишечного воспаления. При этом неусваиваемый олигосахарид выбран из группы, включающей фруктоолигосахариды, галактоолигосахариды, глюкоолигосахариды, арабиноолигосахариды, маннанолигосахариды, ксилоолигосахариды, фукоолигосахариды, арабиногалактоолигосахариды, глюкоманноолигосахариды, галактоманноолигосахариды, олигосахариды, содержащие сиаловую кислоту, и олигосахариды уроновой кислоты. Глутамин находится в форме свободных аминокислот, дипептидов, иили трипептида. Предложена питательная композиция, содержащая белок, жир, усваиваемый углевод и дополнительно содержащая: Bifidobacterium breve в количестве от 102 до 1013 КОЕ на г сухой массы питательной композиции, по меньшей мере один неусваиваемый олигосахарид, выбранный из фруктоолигосахаридов и галактоолигосахаридов, в количестве от 0,5 до 20 мас. в расчете на сухую массу питательной композиции, по меньшей мере 4 мас. глутамина в расчете на сухую массу питательной композиции и LC-PUFA в виде или арахидоновой кислоты, иили докозагексаеновой кислоты. Также заявлен набор компонентов, включающий первый контейнер, содержащий глутамин и неусваиваемый олигосахарид, и второй контейнер, содержащий Bifidobacterium breve. Изобретение позволяет улучшить мозговую деятельность и когнитивные функции у младенцев и детей младшего возраста, страдающих от аллергии, воспаления или атопического заболевания. 4 н. и 12 з.п. ф-лы, 6 табл., 9 пр.

Наверх