Штамм "шевченко-2014" вируса геморрагической болезни кроликов для изготовления вакцинных, диагностических и лечебных препаратов

Изобретение относится к области ветеринарной вирусологии и биотехнологии и касается штамма вируса геморрагической болезни кроликов, семейства Caliciviridae, род Lagovirus. Представленный штамм депонирован под номером 55 в Автономной некоммерческой организации «Научно-исследовательский институт диагностики и профилактики болезней человека и животных». Регистрационное наименование штамма «Шевченко-2014». Изобретение может быть использовано для изготовления вакцинных, диагностических и лечебных препаратов при вирусной геморрагической болезни кроликов. 5 табл.

 

Изобретение относится к области ветеринарной вирусологии, биотехнологии и может быть использовано для изготовления вакцинных, диагностических и лечебных препаратов.

Вирусная геморрагическая болезнь кроликов - ВГБК (геморрагическая пневмония кроликов, некротический гепатит) - высококонтагиозная, остропротекающая инфекционная болезнь, характеризующаяся явлениями геморрагического синдрома во всех органах, в особенности в легких и печени, вызываемая вирусом семейства Caliciviridae, род Lagovirus, наносящая значительный экономический ущерб кролиководству. Болеют ВГБК кролики разных возрастных групп, но чаще старше 1,5-месячного возраста. Другие виды животных и человек не болеют. При ВГБК заболеваемость достигает 70-80%, а летальность - 90-100%. Болезнь широко распространена в мире среди европейских кроликов (Oryctolagus cuniculus), могут болеть и зайцы.

Экономический ущерб от ВГБК значительный, который складывается из-за массовой заболеваемости и гибели кроликов всех возрастных групп.

Самой надежной защитой кроликов против ВГБК является профилактическая вакцинация, которая занимает основное место при выполнении противоэпизоотических мероприятий. Для специфической профилактики вирусной геморрагической болезни кроликов применяют инактивированные моно- и ассоциированные вакцины, ранее разработанные нами [1, 2]. Рекомбинантные вакцины против ВГБК в настоящее время коммерческого применения пока не нашли.

Исследованиями зарубежных и отечественных ученых за последнее десятилетие установлено, что все выделенные изоляты вируса ВГБК в период эпизоотии принадлежат к одному серотипу. При секвенировании выделенных изолятов вируса ВГБК установлено, что в консервативных областях генома они имеют отличия по аминокислотному составу в пределах от 2 до 7%. Зарубежные исследователи установили, что выделенные в последние годы температурозависимые изоляты вируса ВГБК в Германии, Италии значительно отличаются по гемагглютинирующим свойствам при более низкой температуре +4°C и по аминокислотному составу от ранее известных вирусов ВГБК в области Е генома, где у представителей семейства Caliciviridae представлены основные антигенные детерминанты [3, 4].

Известны штаммы «Воронежский-87», «Белгородский-03» и «Манихино-09», официально депонированные в коллекциях ФГУ «ВГНКИ» и ГНУ ВНИИВВИМ для изготовления инактивированных вакцин против ВГБК [5, 6, 7].

Однако кролики, привитые вакциной, изготовленной из ранее выделенных изолятов вируса, не имеют специфической защиты против выделяемых изолятов вируса ВГБК в последние годы. Поэтому необходимо вести эпизоотологический, вирусологический, генетический мониторинг и сравнение гемагглютинирующих и иммунологических свойств вновь выделяемых изолятов вируса ВГБК в очагах инфекции, иметь в музейных коллекциях штаммы вируса геморрагической болезни кроликов, что позволит изготавливать из них специфические диагностические, лечебные препараты и высокоэффективные вакцины для защиты кроликов против ВГБК.

Целью настоящего изобретения явилось получение нового производственного штамма вируса геморрагической болезни кроликов, сохраняющего свои иммунологические свойства после инактивации и пригодного для изготовления высокоиммуногенных вакцин, диагностических и лечебных препаратов.

Технический результат от использования предлагаемого изобретения заключается в расширении арсенала штаммов вируса геморрагической болезни кроликов, отличающихся геномом и иммунологическими свойствами, обладающих высокой биологической, антигенной и иммуногенной активностью, сохраняющих свои иммунобиологические свойства после инактивации, пригодных для изготовления высокоэффективных вакцин, диагностических и лечебных препаратов.

Данный технический результат достигнут получением штамма «Шевченко-2014» вируса геморрагической болезни кроликов. Штамм «Шевченко-2014» является новым и ранее неизвестным.

Полученный штамм депонирован под номером 55 в Автономной некоммерческой организации «Научно-исследовательский институт диагностики и профилактики болезней человека и животных» г. Москва и хранится в ФГУП «Армавирская биофабрика». Штамм «Шевченко-2014» отличается от ранее депонированных штаммов ВГБК «Воронежский-87», «Белгородский-03» и «Манихино-09» на 5-7% по нуклеотидным последовательностям консервативной области гена VP-60. Штаммы, указанные выше, основываясь на результатах филогенетического анализа, относятся к разным геногруппам.

Штамм «Шевченко-2014» обеспечивает проведение серологической диагностики вирусной геморрагической болезни кроликов и производство высокоэффективной инактивированной вакцины против ВГБК, создающей надежную защиту диких и домашних европейских кроликов против ВГБК.

Штамм «Шевченко-2014» вируса геморрагической болезни кроликов характеризуется следующими признаками и свойствами.

Таксономическая характеристика заключается в том, что штамм «Шевченко-2014» имеет форму и размеры, типичные для семейства Caliciviridae. В серологических реакциях (РЗГА, РСК, ИФА, РДП) выявляются антигены, общие для всех штаммов вируса геморрагической болезни кроликов. Основные маркерные характеристики штамма «Шевченко-2014» вируса геморрагической болезни кроликов приведены в таблице 1.

Сущность предлагаемого изобретения поясняется примерами его исполнения.

Пример 1

Для получения вируса геморрагической болезни кроликов штамм «Шевченко-2014» используют три ампулы с вирусом, на уровне первого пассажа на кроликах, павших от введения им 10% суспензии печени от кроликов, павших в фермерском хозяйстве Краснодарского края в январе 2014 года (инфекционная активность не ниже 104,0 ЛД50/см3). В каждую ампулу вносят стерильный растворитель (дистиллированная вода или физиологический раствор, рН 7,0-7,4) до объема, указанного на этикетке. Затем содержимое ампул объединяют и из общей пробы готовят разведение вируса на физиологическом растворе таким образом, чтобы в конечном разведении содержалось 100 ЛД50/см3. Указанное разведение вируса вводят внутримышечно 5 кроликам в объеме 1,0 см3. Инфицированных кроликов содержат в оборудованном инфекционном виварии в индивидуальных клетках.

У зараженных кроликов вирусом ВГБК через 14-24 ч отмечают характерные клинические признаки болезни: угнетение, отказ от корма, повышение температуры тела до 40,7°C, носовое кровотечение и гибель в течение 24-96 ч. Трупы животных во вскрывочной комнате инфекционного вивария подвешивают на вешалки, снимают шкурки, обрабатывают брюшную полость раствором марганцевокислого калия (1:10000), разрезают брюшные мышцы по белой линии, извлекают печень, отделяют желчный пузырь. Печень используют только от трупов, при вскрытии которых обнаружены специфические патологоморфологические изменения, характерные для ВГБК: кровоизлияния в трахее, под капсулой почек, селезенки, геморрагическая пневмония, печень дряблой консистенции, легко рвется и имеет желто-коричневый цвет, местами с красноватым оттенком. Отмечают некроз печени и увеличение селезенки. Наблюдают инфаркты почти во всех органах, почки имеют темно-коричневый цвет.

Печень помещают в стерильные флаконы, плотно укупоривают, снаружи дезинфицируют 5%-ным раствором хлорамина, помещают в термос со льдом и доставляют в стерильный бокс.

Каждый образец печени готовят отдельно, используя отдельную стерильную посуду. Образец печени измельчают ножницами, добавляют стерильный ФСБ (соотношение 1:10 - вес/объем), гомогенизируют в блендере при охлаждении в течение 10 мин. Отбирают в отдельную стерильную пробирку типа «Eppendorf» для идентификации в ПЦР. Затем суспензию печени центрифугируют в течение 1 ч при 6000 g при 4°C. Супернатант ультрацентрифугируют при 80000 g в течение 2 ч при 4°C, через 20%-ный раствор сахарозы. Осадок ресуспендируют в ФСБ 1/100 от начального объема.

Для получения результатов молекулярно-генетической характеристики штамма «Шевченко-2014» вируса геморрагической болезни кроликов было проведено нуклеотидное секвенирование консервативной области гена VP-60, длиной 510 пар нуклеотидов.

РНК из образца выделяли с использованием сорбента (Silica). Полученная РНК была использована для проведения обратной транскрипции-амплификации (ОТ-ПЦР). Обратная транскрипция проводилась совместно в одной пробирке. Реакционная смесь содержала: 16 mM TrisHCl, 82 mM KCl, 2,4 mM MgCl2, Triton ×100 1%, праймеры - по 10 пмоль каждого, по 0,25 mMdNTPs, 5 ед. taq-полимеразы, 25 ед. M-MLV Reverse Transcriptase.

Обратная транскрипция проводилась 50 мин. при 50°C. ПЦР включала 35 циклов (94°C × 20 с, 50°C × 20 с, 72°C × 30 с). Использовавшиеся праймеры, амплифицируют участок гена, кодирующего структурный белок VP60 ВГБК длиной 510 пар оснований (позиции 5182-5692 в геноме вируса). Амплифицируемый фрагмент гена кодирует N-концевой регион белка. Праймеры имеют следующий состав:

P1 (sense) 5'gagctcgagcgacaacaggc3'
P2 (antisense) 5'caaacacctgacccggcaac3'

Электрофорез полученного в ходе ПЦР амплификата показал наличие фрагмента специфического размера. ПЦР-фрагмент, после очистки из агарозного геля с помощью коммерческого набора Silica Bead DNA Gel Extraction kit (Fermentas, Латвия), использовали для секвенирования. Использовался 4-канальный капиллярный секвенатор Applied Biosystems 3130 Genetic Analyzer (США). Полученная последовательность далее была проанализирована с использованием программы BLAST (http://blast.bemd.ncbi.nlm.nih.gov). Результаты позволяют однозначно говорить о соответствии исследовавшегося фрагмента нуклеотидной последовательности гена VP60 ВГБК. Наиболее близкими оказались соответствующие участки геномов следующих штаммов ВГБК: изолят HYD (JF412629), изолят NJ-2009 (НМ623309), штамм Erfurt (EF558581)

Последовательность гена, кодирующего структурный белок VP60 ВГБК

Вируссодержащий материал исследуют в соответствии с рекомендациями МЭБ по стандартным диагностическим методам и вакцинам (2004) на отсутствие контаминации микоплазмами, бактериями и грибами путем посева на чувствительные питательные среды. Отсутствие контаминации посторонними вирусами и идентификацию вируса геморрагической болезни кроликов определяют методом негативного контрастирования электронной микроскопией. Определяют инфекционную активность на кроликах, гемагглютинирующую активность в РГА, антигенную активность в ТФ ИФА, специфичность в ТФ ИФА и РЗГА и на уровне 2 пассажа на кроликах вирус был расфасован, лиофилизирован и запаян в ампулы под вакуумом и заложен на хранение при температуре не выше минус 40°C в качестве Master seed (M.s.) с титром инфекционной активности не ниже 5,0 lg LD50/см3. Полученному штамму вируса геморрагической болезни кроликов присвоено авторское название «Шевченко-2014».

Пример 2

С целью определения биологической, антигенной и иммуногенной активности вируса геморрагической болезни кроликов штамма «Шевченко-2014» проводят гипериммунизацию клинически здоровых кроликов из благополучных по инфекционным и инвазионным болезням хозяйств, живой массой не менее 2,0 кг, согласно 2-ой схеме получения специфической сыворотки для лечения, диагностики и профилактики ВГБК (патент №2077340 от 06.08.93 г., авторы: Шевченко А.А. и др.). Для гипериммунизации кроликов используют тканевую инактивированную вакцину, изготовленную из штамма «Шевченко-2014» вируса геморрагической болезни кроликов в дозе 0,5 мл на голову путем внутримышечного двукратного введения с интервалом 14 дней. Через 14 дней после второй иммунизации от гипериммунизированных кроликов получают сыворотку крови. Специфическую сыворотку проверяют на активность и специфичность в реакции задержки гемагглютинации. Результаты исследований приведены в таблице 2.

Данные таблицы 2 показывают, что уже после первой вакцинации кроликов штаммом «Шевченко-2014» вируса ВГБК у кроликов образуются специфические задерживающие гемагглютинацию антитела в титре от 5 до 8 log2, в дальнейшем уровень антител увеличивается до 10-12 log2. Это подтверждает высокую биологическую, антигенную и иммуногенную активность штамма «Шевченко-2014» вируса.

Пример 3

Для изучения лечебного действия специфической иммунной сыворотки против ВГБК брали взрослых кроликов, свободных от антител к вирусу ВГБК, заражали вирулентным вирусом в дозе 1000 ЛД50/см3 и через 24-30 часов, в период развития первичных клинических признаков (угнетение, взъерошенность, отказ от корма, опускание ушей), вводили специфическую иммунную сыворотку по 0,5 см3 подкожно однократно, контрольным кроликам вводили нормальную кроличью сыворотку. Результаты представлены в таблице 3.

Из данных таблицы 3 видно, что однократное введение кроликам нативной иммунной сыворотки с активностью в РЗГА от 6 до 8 log2 через 24-30 часов после заражения их вирулентным вирусом ВГБК позволяет вылечить всех кроликов при полной гибели животных в контроле.

Для получения вируса, используемого при изготовлении тканевой инактивированной гидроокисьалюминиевой вакцины против ВГБК из штамма «Шевченко-2014», используют полученную и охарактеризованную матровую расплодку Master seed (M.s.) вируса геморрагической болезни кроликов из вышеуказанного штамма. Вначале приготавливают разведение вируса на физиологическом растворе таким образом, чтобы в конечном разведении содержалось 100 ЛД50/см3. Указанное разведение вируса вводят внутримышечно кроликам в объеме 1,0 см3. Предварительно сыворотку крови кроликов исследуют на наличие антител к вирусу ВГБК «Шевченко-2014» в РЗГА при +(4±2)°C и при +(20±2)°C с эритроцитами крови человека 0(I) группы. При наличии специфических антител к указанному вирусу в титре 1:4 и выше кроликов в опыт не берут. Инфицированных кроликов содержат в оборудованном инфекционном виварии в индивидуальных металлических клетках.

Из полученной от павших кроликов печени готовят 10%-ную вирусную суспензию на забуференном физрастворе (рН 7,0-7,4). Для осветления в приготовленную суспензию печени вносят хлороформ (конечная концентрация 2%) и помещают в холодильник при 4°C на 18 часов. Затем суспензию печени центрифугируют в течение 1 ч при 6000 g при 4°C. Вирусная суспензия, используемая для изготовления тканевой инактивированной вакцины, должна иметь активность в РГА при +(4±2)°C не менее 1:1280 ГАЕ.

Инактивацию вируса проводят с помощью 4%-ного раствора формалина. Исходя из концентрации формальдегида готовят 4%-ный раствор формалина (т.е. 1,1-1,4% раствор формальдегида) на стерильной дистиллированной воде. Раствор формалина готовят в стеклянных бутылях в день составления сырья для вакцины и вносят в вирусную суспензию до конечной концентрации не менее 0,1% формальдегида.

Инактивируют вирус при температуре 37±1°C в течение 3-х суток с периодическим перемешиванием (1 раз в час в течение 5 мин).

Началом инактивации считают время после доведения температуры в емкости до 37±1°C и добавления формалина. Из инактивированного материала брали пробу для проверки стерильности, активности, полноты инактивации и безвредности. Для проверки полноты инактивации и безвредности двум кроликам массой не менее 2,0 кг, не имеющих специфических антител к вирусу ВГБК, вводят по 3,0 см3 внутримышечно инактивированный материал. Животные в течение 10 суток наблюдения оставались здоровыми.

После окончания инактивации вируссодержащей суспензии в емкость с вирусной суспензией добавляют гель гидрата окиси алюминия (ГОА) с 3% сухого остатка после размола из расчета на 1000 см3 суспензии 150 см3 ГОА (20%) при рН 7,2-7,4 и температуре 4-8°C (патент РФ №2039570 от 20.07.95 г., авторы: Шевченко А.А. и др.). Сорбцию проводят в течение 1-2 часов с периодическим перемешиванием. Вакцину хранят при 10±2°C до получения результатов контроля препарата. Затем вакцину перемешивают при температуре 10±2°C в течение 1 часа и фасуют в стерильные флаконы емкостью 20 или 50 см3.

Содержание антигена при +(4±2)°C в дозе вакцины не менее 640 ГАЕ является его оптимальным количеством в препарате, обеспечивающим достижение технического результата.

Полученную вакцину проверяют на внешний вид, стерильность, уровень рН, полноту инактивации вируса, иммуногенность и безвредность.

Вакцина представляет собой прозрачную жидкость серо-коричневого цвета с рыхлым осадком, образующимся при хранении, который при встряхивании легко разбивается в гомогенную взвесь.

Стерильность вакцины определяют в соответствии с ГОСТ 28085-89. Безвредность препарата определяют путем его введения четырем кроликам внутримышечно по 3 см3. Вакцина считается безвредной, если она не вызывает гибель или заболевания кроликов, а также изменений некротического характера на месте введения в течение 14 суток наблюдения.

Полноту инактивации вируса в вакцине проверяют на 4 кроликах, которым вводят внутримышечно в область средней трети бедра по 3,0 см3. За кроликами ведут наблюдение в течение 10 дней. Вакцину считают не содержащей инфекционного вируса, если она не вызывает гибели кроликов от вирусной геморрагической болезни в течение 10 суток после введения препарата.

В используемых флаконах с вакциной определяют рН, средняя величина показателей должна быть в пределах 7,2-7,4. Гемагглютинирующую активность антигена каждой серии вакцины определяют в реакции гемагглютинации (РГА) при +(4±2)°C, с эритроцитами человека 0(I) группы и выражают в гемагглютинирующих единицах. Гемагглютинирующий титр в вакцине должен быть не ниже 8,0 log2, что соответствует разведению 1:256 ГАЕ.

Данные таблицы 4 свидетельствуют о том, что тканевая инактивированная гидроокисьалюминиевая вакцина против ВГБК из штамма «Шевченко 2014» обладает высокой гемагглютинирующей активностью.

При изучении иммуногенной активности тканевой инактивированной гидроокисьалюминиевой вакцины против ВГБК из штамма «Шевченко-2014» установлено, что у кроликов старше 1,5-2 мес. возраста, привитых однократно внутримышечно в дозе 0,5 см3, уже на 5 день после введения препарата формируется иммунный ответ, т.е. образуются специфические антитела, позволяющие обеспечить защиту вакцинированных кроликов против ВГБК. Экспериментально показано, что одна прививочная доза в объеме 0,5 см3 содержит не менее 640 ГАЕ. Результаты исследований иммуногенной активности представлены в таблице 5.

Данные таблицы 5 подтверждают высокую иммуногенную активность и эффективность инактивированной вакцины против ВГБК из штамма «Шевченко-2014».

Таким образом, штамм «Шевченко-2014» вируса геморрагической болезни кроликов, полученный в соответствии с предлагаемым изобретением, обладает высокой инфекционной, антигенной и иммуногенной активностью и пригоден для изготовления вакцинных, диагностических и лечебных препаратов против ВГБК.

Источники информации

1. Шевченко А.А. Специфическая профилактика инфекционных болезней кроликов: вирусной геморрагической болезни, миксоматоза и пастереллеза: дис. …д-ра. ветер. наук: 16.00.03 / Шевченко Александр Алексеевич. - Покров, 1995. - 233 с.

2. Шевченко А.А. Новая ассоциированная вакцина / А.А. Шевченко // Кролиководство и звероводство. - 1994. - №2.

3. Molecular epidemiology of Rabbit haemorrhagic disease virus. Moss S.R., Turner S.L., Trout R.C., White P.J., Hudson P.J., Desai A., Armesto M., Forrester N.L., Gould E.A.; J. Gen. Virol. - 2002. - Vol. 83. - P. 2461-2467.

4. Manual of standards Diagnostic Tests and Vaccines 2004; PART 2; SECTION 2.8.; CHAPTER 2.8.3. RABBIT HAEMORRHAGIC DISEASE.

5. Бурмакина Г.С. Разработка средств молекулярно-генетической идентификации вируса геморрагической болезни кроликов: дисс. …канд. биол. наук: 03.01.06 / Бурмакина Галина Сергеевна. - Покров, 2012. - 150 с.

6. Патент РФ №2077340 «Способ получения специфической сыворотки для лечения, диагностики и профилактики вирусной геморрагической болезни кроликов и набор для диагностики болезни», авторы: Шевченко А.А. и др. приоритет от 06.08.1993 г. заявка №93039551 зарегистрировано в государственном реестре изобретений 20.04.1997 г.

7. Патент РФ №2039570 «Способ изготовления инактивированной вакцины против вирусной геморрагической болезни», авторы: Шевченко А.А. и др., приоритет от 26.05.1992 г. заявка №5043431 зарегистрировано в государственном реестре изобретений 20 июля 1995 г.

Штамм вируса геморрагической болезни кроликов, семейства Caliciviridae, род Lagovirus, депонирован под номером 55 в Автономной некоммерческой организации «Научно-исследовательский институт диагностики и профилактики болезней человека и животных», регистрационное наименование «Шевченко-2014» для изготовления вакцинных, диагностических и лечебных препаратов при вирусной геморрагической болезни кроликов.



 

Похожие патенты:

Предложены композиция вакцины для предотвращения репродуктивно-респираторного синдрома свиней корейского типа, содержащая вирус репродуктивно-респираторного синдрома свиней (РРСС) корейского типа (номер доступа в КСТС 12096 ВР) в количестве от 2×105 до 2×107 БОЕ/мл в качестве эффективного ингредиента, способ предотвращения РРСС корейского типа, использующий такую вакцину, набор для диагностики вируса РРСС корейского типа и способ обнаружения вируса РРСС корейского типа.

Изобретение относится к области ветеринарной вирусологии. Получен штамм Эшли вируса калицивироза кошек, депонированный в ФБУН ГНЦ ВБ «Вектор» под номером V-697, обладающий стабильной инфекционной активностью, адаптированный к перевиваемым культурам клеток.

Изобретение относится к области биотехнологии, в частности к клинической лабораторной диагностики вирусных инфекций, и может быть использовано для генотипирования вируса герпеса 6-го типа (ВГЧ-6).

Предлагаемое изобретение относится к области медицинской вирусологии. Представленный штамм A/17/Южная Африка/2013/01 (H1N1)pdm09 - реассортант, полученный путем скрещивания «дикого» вируса А/Южная Африка/3626/2013 (H1N1)pdm09 с вирусом А/Ленинград/134/17/57 (H2N2) - донором аттенуации, безвредным для людей.

Изобретение относится к области биотехнологии, вирусологии и медицины. Диагностический штамм вируса гриппа RN2/66-human A(H7N2) получен путем скрещивания вируса гриппа лошади А/лошадь/Прага/1/1956(Н7N7) с холодоадаптированным вакцинным штаммом А/17/Калифорния/66/395(Н2N2) на основе донора аттенуации А/Ленинград/134/17/57(Н2N2).

Изобретение относится к биотехнологии. Предложен рекомбинантный штамм VACΔ6 вируса осповакцины с нарушенными генами C3L, N1L, J2R, A35R, A56R, B8R на основе клонированного вируса осповакцины (штамм Л-ИВП).

Изобретение относится к медицине, а именно к биотехнологии и иммунологии, и может быть использовано для получения микрокапсулированной формы живой гриппозной культуральной вакцины против гриппа для интраназального применения.

Группа изобретений относится к медицине, а именно к биотехнологии и иммунологии, и может быть использована для получения вакцины против ящура. Вакцина включает вирусный антиген ящура, гидроокись алюминия, сапонин и в качестве адъюванта дополнительно используют натриевую соль сукцината хитозана при следующем соотношении компонентов, мас.%: сапонин 0,25-0,75, натриевая соль сукцината хитозана 05,-1,5, гидроокись алюминия в гликолевом буфере с рН 7,-8,6 15,0-25,0 и вирусный антиген ящура – остальное.
Изобретение относится к биохимии. Описан способ выявления контаминации вирусами культуры клеток иммунопероксидазным методом, включающий взаимодействие антигена с мечеными антителами в неинфицированной культуре клеток и учет результатов реакции по интенсивности окрашивания образовавшегося комплекса под микроскопом.

Изобретение относится к области биотехнологии и вирусологии. Описан бактериофаг F510/08, имеющий геном, который содержит последовательность нуклеиновой кислоты SEQ ID NO:4.

Группа изобретений относится к области биотехнологии. Представлены рекомбинантные дрожжи штамма Kluyveromyces lactis DSM 25405, Kluyveromyces lactis DSM 25406 или Kluyveromyces lactis DSM 25407, несущие в качестве чужеродного гена ген для VP2-антигена вируса инфекционного бурсита (IBDV), интегрированный в геном дрожжей и обеспечивающий экспрессию VP2-антигена IBDV в качестве чужеродного белка.

Предложены композиция вакцины для предотвращения репродуктивно-респираторного синдрома свиней корейского типа, содержащая вирус репродуктивно-респираторного синдрома свиней (РРСС) корейского типа (номер доступа в КСТС 12096 ВР) в количестве от 2×105 до 2×107 БОЕ/мл в качестве эффективного ингредиента, способ предотвращения РРСС корейского типа, использующий такую вакцину, набор для диагностики вируса РРСС корейского типа и способ обнаружения вируса РРСС корейского типа.

Группа изобретений относится к области биотехнологии. Представлен рекомбинантный ген, кодирующий белок L1 вируса папилломы человека 16 типа, с кодонами, оптимизированными для гетерологичной экспрессии в штаммах Е.

Изобретения касаются вакцинных композиций, содержащих вакцину против PRRSV (вирус репродуктивного и респираторного синдрома свиней) и вторую вакцину против вируса свиней, которые, по существу, не оказывают иммуноингибирования в отношении друг друга.

Изобретение относится к области ветеринарной вирусологии. Получен штамм Эшли вируса калицивироза кошек, депонированный в ФБУН ГНЦ ВБ «Вектор» под номером V-697, обладающий стабильной инфекционной активностью, адаптированный к перевиваемым культурам клеток.

Изобретение относится к области биотехнологии. Предложены способ индукции иммунного ответа против цирковируса свиней типа 2 (PCV2), уменьшения тяжести клинических симптомов, связанных с инфекцией PCV2, или профилактики инфекции PCV2 и иммуногенная композиция для осуществления перечисленных способов.
Изобретение относится к области медицины, а именно к средствам для профилактики заболеваний, вызываемых цитомегаловирусной инфекцией. Композиция для профилактики заболеваний, вызываемых цитомегаловирусной инфекцией, содержащая инактивированную суспензию Human herpesvirus 5 АТСС® VR-1788™, полиоксидоний, гиалуроновую кислоту, глицирризиновую кислоту в эффективном количестве.

Изобретение относится к медицине, а именно к иммунологии, и может быть использовано для специфической профилактики кори, эпидемического паротита, краснухи у ВИЧ-инфицированных детей.

Настоящее изобретение относится к биотехнологии. Предложен иммуностимулирующий неметилированный CpG-олигодезоксинуклеотид, вектор экспрессии, его содержащий, вакцина для предотвращения или борьбы с инфекционным заболеванием у птиц, содержащая указанные олигодезоксинуклеотид и/или вектор экспрессии и иммунологическое количество антигенного компонента, выделенного из патогенного для птичьих вируса или микроорганизма, а также применение олигодезоксинуклеотида в качестве лекарственного средства и для предотвращения инфекции у птичьих.

Настоящее изобретение относится к биотехнологии. Предложены поливалентная иммуногенная композиция, содержащая комбинацию растворимой части цельноклеточного препарата Mycoplasma hyopneumoniae (M.

Настоящее изобретение относится к вирусологии и медицине. Предложен штамм вируса гриппа птиц A/black-headed gull/Kamchatka/123/2013 H11N8-субтипа, выделенный от озерной чайки (Larus ridibundus) и депонированный в Государственной коллекции вирусов на базе Института вирусологии им. Д.И. Ивановского ФГБУ "ФНИЦЭМ им. Н.Ф. Гамалеи" Минздрава России под регистрационным номером 2783. Предложенный штамм может быть использован для приготовления антигенсодержащего препарата и сыворотки для серодиагностики гриппа H11-субтипа в реакции торможения гемагглютинации (РТГА), а также может быть применен в качестве контрольного референс-штамма H11 при проведении диагностических работ методом ПЦР. С помощью предложенного штамма возможно проводить оценку эффективности лечебных и профилактических препаратов против гриппа. 4 табл., 4 пр.
Наверх