Способ дифференциации коммерчески значимых клещей рода amblyseius на основе рестрикционного анализа


 


Владельцы патента RU 2631933:

Федеральное государственное бюджетное образовательное учреждение высшего образования "Воронежский государственный университет" (ФГБОУ ВО "ВГУ") (RU)

Изобретение относится к области биохимии. Описан способ дифференциации коммерчески значимых клещей рода Amblyseius на основе рестрикционного анализа. Данный способ включает выделение ДНК из предварительно собранного биологического материала, последующее проведение ПЦР участка цитохромоксидазы митохондриальной ДНК, рестрикционного анализа ампликона, проведение электрофореза в агарозном геле. При проведении ПЦР используют праймеры: прямой ITS1 GAATATGAGCСGGAATAGTAGGA, обратный ITS4 ATGTGTTGAAGTTACGGTCA, а для рестрикционного анализа используют рестриктазы AccB1 I, AspLE, Ssp I; наличие фрагментов ДНК длиной 509 и 129 п.н. при обработке рестриктазой AccB1 I указывает на принадлежность к виду A. cucumeris, наличие фрагментов ДНК длиной 381 и 260 п.н. при обработке рестриктазой Ssp I указывает на принадлежность к виду A. barkeri, а наличие фрагментов ДНК длиной 405 и 227 п.н. при обработке рестриктазой AspLE указывает на принадлежность к виду A. swirskii, в то время как две другие рестриктазы не имеют сайты рестрикции. Изобретение расширяет арсенал способов дифференциации коммерчески значимых клещей при помощи рестрикционного анализа. 2 ил., 1 пр.

 

Изобретение относится к области микробиологии, а именно к молекулярно-генетическим методам идентификации организмов - клещей рода Amblyseius, и может быть использовано для правильной маркировки выращиваемых клещей, а также оценки чистоты и заявленного таксона приобретаемой продукции.

Клещи рода амблисейюс (нейоселиюс) - Amblyseius swirskii, Amblyseius cucumeris и Amblyseius barkeri - являются важнейшими коммерчески значимыми энтомофагами. Эти виды являются наиболее распространенными и трудно дифференцируемыми друг от друга видами. Важность дифференциации этих клещей обусловлена тем, что они выращиваются на схожих питательных субстратах, имея практически идентичные морфологические черты, в отличие от других клещей того же рода, и высока вероятность неправильного определения вида. Между тем это является важным вопросом, т.к. эти виды имеют различную коммерческую ценность. A. swirskii высокоэффективен против белокрылки и трипсов (Bolckmans K.; Houten Y. van; Hoogerbrugge Н. Biological control of whiteflies and western flower thrips in greenhouse sweet peppers with the phytoseiid predatory mite Amblyseius swirskii Athiashenriot (Acari: Phytoseiidae). Second International Symposium on Biological Control of Arthropods, Davos, Switzerland, 12-16 September, p 555-565), в то время как A. cucumeris и А. barkeri только против трипса. Поэтому A. swirskii является самым дорогостоящим агентом, A. cucumeris менее дорогостоящий, а на A. barkeri спрос практически отсутствует, т.к. использование A. cucumeris против трипса считается более эффективным, чем использование A. barkeri (Brdsgaard Н.F., Stengaard Hansen L. Effect of Amblyseius cucumeris and Amblyseius barkeri as Biological Control Agents of Thrips tabaci on Glasshouse Cucumbers. Biocontrol Science and Technology. 1992, 2(3): 215-223).

Дифференциация клещей рода Amblyseius на данный момент возможна только по морфологическим признакам, что является сложной задачей, которую способен решить только высококвалифицированный специалист. Зачастую необходимо быстро идентифицировать вид, чтобы оценить партию приобретаемой продукции, а также видовую принадлежность выращиваемых энтомофагов на предмет замещения культуры клещами другого вида или рода, не имеющих полезных признаков. Также, зачастую, важно идентифицировать проживающих в теплицах клещей, чтобы скорректировать нормы внесения хищника. (Анисимов А.И., Доброхотов С.А. МОРФОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ХИЩНЫХ КЛЕЩЕЙ AMBLYSEIUS MCKENZIEI И А. CUCUMERIS. Защита и карантин растений. №1 / 2008).

Данные виды клещей отличаются нуклеотидной последовательность участка ДНК, включающего гены 18S рРНК, ITS1, 5.8S рРНК, ITS2,28S рРНК. Таким образом, чтобы идентифицировать вид, нужно амплифицировать этот регион и секвенировать полученный продукт ПЦР с целью получения информации о нуклеотидной последовательности. Недостатком данного подхода является длительность проведения анализа, цена и трудоемкость. Решением является использование рестрикционного анализа, который позволяет быстро идентифицировать данные виды клещей. Существенным преимуществом молекулярно-генетического метода дифференциации клещей является возможность их определения на любой стадии развития вне зависимости от пола.

Известен способ проведения ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и K гена DGAT1 (патент RU 2013103980 А, МПК C12N 15/06, C12Q 1/68), взятый за прототип, включающий проведение ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и K гена DGAT1, отличающийся тем, что на этапе ПЦР используются другие последовательности олигонуклеотидных праймеров: DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3' (SEQ ID NO: 1), DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' (SEQ ID NO: 2), DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO: 3), а на этапе рестрикции применяется другая рестриктаза - TaqI, с генерацией генотип-специфичных фрагментов: генотип АА=82/18 bp, генотип КК=100 bp и генотип АК=100/82/18 bp.

Недостатком данного способа является малая длина рестрикционных фрагментов, которая не позволяет применять электрофорез в агарозном геле, более простой и дешевый в исполнении, чем электрофорез в полиакриламидном геле.

Нами предварительно проведен анализ нуклеотидной последовательности участка ДНК, включающего следующие гены: 18S рРНК, ITS1, 5.8S рРНК, ITS2,28S рРНК. Установлены отличия в нуклеотидной последовательности между тремя видами хищный клещей (A. swirskii, A. cucumeris и A. barkeri), которые позволяют разработать метод экспресс-идентификации перечисленных видов клещей на основе рестрикционного анализ (ПЦР-ПДРФ).

Технический результат заключается в возможности проведения дифференциации клещей на любой стадии развития вне зависимости от пола, а также в возможности проведения идентификационных процедур без привлечения узкоспециализированного специалиста в течение нескольких часов.

Технический результат достигается тем, что в способе дифференциации коммерчески значимых клещей рода Amblyseius на основе рестрикционного анализа, включающем выделение ДНК из предварительно собранного биологического материала, последующее проведение ПЦР участка цитохромоксидазы митохондриальной ДНК, рестрикционного анализа ампликона, проведение электрофореза в агарозном геле, согласно изобретению при проведении ПЦР используют праймеры: прямой ITS1 GAATATGAGCСGGAATAGTAGGА, обратный ITS4 ATGTGTTGAAGTTACGGTCA, а для рестрикционного анализа используют рестриктазы AccB1 I, AspLE, Ssp I, причем наличие фрагментов ДНК длиной 509 и 129 п.н. при обработке рестриктазой AccB1 I указывает на принадлежность к виду A. cucumeris, наличие фрагментов ДНК длиной 381 и 260 п.н.. при обработке рестриктазой Ssp I указывает на принадлежность к виду A. barkeri, а наличие фрагментов ДНК длиной 405 и 227 п.н. при обработке рестриктазой AspLE указывает на принадлежность к виду A. swirskii, в то время как две другие рестриктазы не имеют сайты рестрикции.

На фиг. 1 приведена таблица 1 длин ожидаемых фрагментов при расщеплении предварительно амплифицированной праймерами ITS1 и ITS4 последовательности ДНК у клещей.

На фиг. 2 приведена электрофореграмма рестрикции продуктов ПЦР, где 1 - рестриктаза AccB1 I; 2 - рестриктаза AspLE; 3 - рестриктаза Ssp I; М - маркер длин фрагментов ДНК, значения выражены в пар нуклеотидов.

Пример

Способ дифференциация клещей на основе рестрикционного анализа предварительно амплифицированного участка ДНК, включающего гены 18S рРНК, ITS1, 5.8S рРНК, ITS2,28S рРНК, реализуется следующим образом:

1. Производится сбор биологического материала (взрослые клещи, яйца, личинки) из субстрата для выращивания клещей либо с растений. Если анализ производится не в тот же день, то образцы помещают в 70% спиртовой раствор.

2. Производится выделение ДНК из полученных образцов, выделение ДНК можно проводить как с помощью коммерческих наборов отечественных и зарубежных производителей ("ДНК-технологии", "Праймтех", "Zymo research", БиоСилика и др.), так и общепринятыми методами (фенол-хлороформная экстракция, ЦТАБ-метод).

3. Проводят ПЦР. Используют следующие температурные циклы: 94°С 4 мин, 35°С 30 сек, 54°С 35 сек, 72°С 45 сек, конечная элонгация 72°С 8 мин. В качестве праймеров используют следующие: прямой: ITS1 GAATATGAGCCGGAATAGTAGGA, обратный: ITS4 ATGTGTTGAAGTTACGGTCA, данные праймеры амплифицируют продукт длиной 638 п.н. у A. cucumeris, 641 п.н. у A. barkeri и 632 п.н. у A. swirskii.

4. Продукты ПЦР подвергают рестрикции по следующей схеме: берут 10 мкл ПЦР продукта, добавляют 1,5 мкл 10X реакционного буфера, индивидуального для каждой рестриктазы, и 10 ед. рестриктазы. Объем доводят до 15 мкл деионизированной водой. Инкубируют смесь в течение 1,5 часов при 37°С, фермент инактивируют нагревом до 75°С в течение 15 минут. Визуализацию продуктов рестрикции проводят с помощью электрофореза в 2% агарозном геле. В качестве рестриктаз используют следующие: AccB1 I, AspLE, Ssp I. Каждый из рестрикционных ферментов образует уникальные фрагменты для каждого вида клеща (таблица 1).

Предлагаемый способ дифференциации хищных клещей является высокочувствительным, хорошо воспроизводимым и экономичным. В зависимости от способа выделения ДНК из биологических образцов анализ занимает от 4,5 до 6 часов. Анализ можно проводить в лабораториях, имеющих термоциклер, центрифугу, камеру для электрофореза и сопутствующие реактивы и расходные материалы.

При обработке рестриктазой AccB1 I продукта ПЦР образца ДНК A. cucumeris образовались фрагменты ДНК длиной 509 и 129 п.н., рестриктазы AspLE и Ssp не имели сайты рестрикции. При обработке рестриктазой Ssp I продукта ПЦР образца ДНК A. barkeri образовались фрагменты ДНК длиной 381 и 260 п.н., рестриктазы AccB1 I и AspLE не имели сайты рестрикции. При обработке рестриктазой AspLE продукта ПЦР образца ДНК A. swirskii образовались фрагменты ДНК длиной 405 и 227 п.н., рестриктазы AccB1 I и Ssp I не имели сайты рестрикции.

Способ дифференциации коммерчески значимых клещей рода Amblyseius на основе рестрикционного анализа, включающий выделение ДНК из предварительно собранного биологического материала, последующее проведение ПЦР участка цитохромоксидазы митохондриальной ДНК, рестрикционного анализа ампликона, проведение электрофореза в агарозном геле, отличающийся тем, что при проведении ПЦР используют праймеры: прямой ITS1 GAATATGAGCCGGAATAGTAGGA, обратный ITS4 ATGTGTTGAAGTTACGGTCA, а для рестрикционного анализа используют рестриктазы AccB1 I, AspLE, Ssp I, причем наличие фрагментов ДНК длиной 509 и 129 п.н. при обработке рестриктазой AccB1 I указывает на принадлежность к виду A. cucumeris, наличие фрагментов ДНК длиной 381 и 260 п.н. при обработке рестриктазой Ssp I указывает на принадлежность к виду A. barkeri, а наличие фрагментов ДНК длиной 405 и 227 п.н. при обработке рестриктазой AspLE указывает на принадлежность к виду A. swirskii, в то время как две другие рестриктазы не имеют сайты рестрикции.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к антителу или его функциональному фрагменту, которые способны связывается с cMet. Также раскрыты мышиная гибридома, способная секретировать указное антитело, нуклеиновая кислота, которая экспрессирует указанное антитело и набор для прогнозирования эффективности лечения онкогенного расстройства, включающий указанное антитело.

Изобретение относится к области биохимии, в частности к антигенсвязывающей молекуле (АСМ), которая специфически связывает связанный с мембраной человеческий карциноэмбриональный антиген (CEA).

Изобретение относится к биотехнологии и генетической инженерии. Предложен экспрессионный плазмидный вектор для моноцистронной гетерологичной экспрессии рекомбинантных белков в клетках яичника китайского хомячка (СНО), обладающий свойством высокочастотной интеграции экспрессионной кассеты в указанных клетках, в следующей последовательности содержащий область начала репликации плазмиды pUC с функциональным геном устойчивости к ампициллину; участок терминального повтора вируса Эпштейн-Барр человека (EBVTR); функциональный промотор гена фактора элонгации 1 альфа китайского хомячка, фланкированный 5′ нетранслируемой областью этого гена; участок для клонирования открытой рамки считывания рекомбинантного белка (полилинкер); функциональный терминатор гена фактора элонгации 1 альфа китайского хомячка, фланкированный 3′ нетранслируемой областью этого гена; промотор, функционирующий в клетках млекопитающих; ген устойчивости к антибиотику; и функциональный терминатор гена устойчивости к антибиотику.

Цель изобретения - разработка эффективного способа генотипирования крупного рогатого скота по DGAT1-гену на основе ПЦР-ПДРФ-анализа. Разработанный способ проведения ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1, отличающийся от ближайшего прототипа [1] тем, что на этапе ПЦР используются другие последовательности олигонуклеотидных праймеров: DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3' (SEQ ID NO:1) DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' (SEQ ID NO:2) DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO:3), а на этапе ПДРФ применяется другая эндонуклеаза рестрикции - TaqI, с генерацией генотип-специфичных фрагментов: генотип АА=82/18 bp, генотип КК=100 bp и генотип АК=100/82/18 bp (фиг.1 и 2).

Изобретение относится к области биотехнологии, конкретно к клеточным технологиям, и может быть использовано для селекции генетически модифицированных клеток. .

Изобретение относится к клеточной инженерии, медицине, в частности к способам преодоления барьера гистонесовместимости при клеточной терапии. .

Изобретение относится к медицине, точнее к нейроиммунологии, а именно к тесту на антигены, ассоциированные с рассеянным склерозом. .

Изобретение относится к молекулярной биологии, в частности к способам продуцирования высоких уровней функционального рекомбинантного протеина C в клеточных линиях млекопитающих.
Наверх