Зонд и способ детекции полиморфизма, используя таковой

Авторы патента:


Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой
Зонд и способ детекции полиморфизма, используя таковой

 


Владельцы патента RU 2633506:

АРКРЭЙ, Инк. (JP)

Изобретение относится к зонду для детекции полиморфизма V600 в гене BRAF. Изобретение представляет собой флуоресцентно меченый олигонуклеотид (Р1), который, по меньшей мере, на 80% идентичен последовательности оснований длиной от 10 до 50 оснований, включающей основания 228-237 последовательности оснований, указанной в SEQ ID NO:1, в котором основание, соответствующее основанию 237, представляет собой цитозин, меченный флуоресцентным красителем, причем олигонуклеотид распознает полиморфизм, по меньшей мере, в одном из оснований 228-230 последовательности оснований, указанной в SEQ ID NO:1, при условии, что олигонуклеотид отличается от олигонуклеотида, указанного в SEQ ID NO:7 или 19. 5 н. и 6 з.п. ф-лы, 4 ил., 7 табл., 2 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННУЮ ЗАЯВКУ

По настоящей заявке испрашивается приоритет в соответствии с 35 USC 119 японской патентной заявки № 2012-096558, поданной 20 апреля 2012 года, и японской патентной заявки № 2013-081858, поданной 10 апреля 2013 года. Содержание этих заявок приводится в настоящем документе в качестве ссылки в полном объеме. Все публикации, патентные заявки и технические стандарты, указанные в настоящем описании, приводятся в настоящем документе в качестве ссылки в той же мере, как если бы каждая отдельная публикация, патентная заявка или технический стандарт конкретно и отдельно указывались как приведенные в качестве ссылки.

УРОВЕНЬ ТЕХНИКИ

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Настоящее изобретение относится к зонду для детекции полиморфизма, способу детекции полиморфизма, способу оценки эффективности лекарственного средства и набору реагентов для детекции полиморфизма.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Ген BRAF кодирует белок BRAF, который участвует в передаче сигнала внутри клетки и клеточном росте. Известно, что внутриклеточная передача сигнала становится постоянно активированной при мутировании гена BRAF, когда 600ая аминокислота белка BRAF мутирует из валина (V) в глутаминовую кислоту (Е). Такой мутант с активированным геном BRAF называют «V600E» и обнаруживают в около 7% злокачественных опухолей человека и около 60% злокачественных меланом (смотри, например, статью Nature. (2010) Dec 16; 468(7326): 973-7). Кроме того, также было сообщено, что прогрессирующая меланома с мутацией V600E эффективно лечится с помощью, например, ингибитора киназы BRAF вемурафениба. При введении ингибитора киназы BRAF вемурафениба из соображений эффективности и безопасности необходимо предварительно определить наличие или отсутствие мутации V600E.

Были разработаны способы, с помощью которых в короткое время недорогим и простым путем точно определяют мутацию V600E (смотри, например, патент WO2011/071046 и выложенную японскую патентную заявку (JP-A) 2009-77712). Кроме того, также известны способы определения мутации в гене BRAF, используя способ PCR-RFLP, способ прямого секвенирования и способ HRMA или подобные (смотри, например, статьи Endocr J. (2007) Jun 54(3): p.399-405; Yonsei Med. J. (2009) Apr 30, 50(2): p.266-72; Am. J. Clin. Pathol. (2008) Aug, 130(2): p247-53).

На сегодняшний день помимо мутации V600E известны мутации V600K, V600R и V600D, в которых 600ая аминокислота мутирует из валина в лизин (К), аргинин (R) и аспарагиновую кислоту (D), соответственно (смотри, например, статью J. Transl. Med. (2010) Jul 14, 8: p67). Кроме того, также известны мутации V600G и V600M, в которых 600ая аминокислота мутирует в глицин (G) и метионин (М), соответственно.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

ПРОБЛЕМЫ, РЕШАЕМЫЕ ИЗОБРЕТЕНИЕМ

До настоящего времени не был известен способ, который был бы способен одновременно идентифицировать две или больше мутаций, отличных от V600E, представляющих собой V600K, V600R и V600D.

Поэтому желательна дальнейшая технологическая разработка для создания способа упрощенной детекции мутации V600E наряду с другими мутациями (V600K, V600R и/или V600D) с высокой чувствительностью.

Целью настоящего изобретения является создание зонда для детекции полиморфизма, который позволяет без труда с высокой чувствительностью определять полиморфизм V600 в гене BRAF. Другой целью настоящего изобретения является создание способа детекции полиморфизма, используя зонд по изобретению.

СРЕДСТВА РЕШЕНИЯ ДАННЫХ ПРОБЛЕМ

Настоящее изобретение заключается в следующем.

<1> Зонд для детекции полиморфизма V600 в гене BRAF, который представляет собой следующий флуоресцентно меченый олигонуклеотид Р1:

(Р1) олигонуклеотид, который, по меньшей мере, на 80% идентичен последовательности оснований длиной от 10 до 50 оснований, включающей основания 228-237 последовательности оснований, указанной в SEQ ID NO:1, где основание, соответствующее основанию 237, представляет собой цитозин, меченный флуоресцентным красителем, причем олигонуклеотид распознает полиморфизм, по меньшей мере, в одном из оснований 228-230 последовательности оснований, указанной в SEQ ID NO:1, при условии, что олигонуклеотид отличается от олигонуклеотида, указанного в SEQ ID NO:7 или 19.

<2> Зонд по п.<1>, где вышеописанный флуоресцентно меченый олигонуклеотид представляет собой следующий флуоресцентно меченый олигонуклеотид Р1’:

(P1’) олигонуклеотид, который, по меньшей мере, на 80% идентичен последовательности оснований длиной от 10 до 50 оснований, включающей основания 228-237 последовательности оснований, указанной в SEQ ID NO:1, где основание, соответствующее основанию 237, представляет собой цитозин; по меньшей мере, два из оснований 228-230 последовательности оснований, указанной в SEQ ID NO:1, отличаются от указанных в SEQ ID NO:1; и описанный выше цитозин, соответствующий основанию 237 метят флуоресцентным красителем.

<3> Зонд по п.<1> или <2>, в котором вышеописанный флуоресцентно меченый олигонуклеотид имеет основание, меченное флуоресцентным красителем по любой из позиций с первой по третью от 3’-конца.

<4> Зонд по одному из пп.<1>-<3>, где вышеописанный флуоресцентно меченый олигонуклеотид имеет основание, меченное флуоресцентным красителем на 3’-конце.

<5> Зонд по одному из пп.<1>-<4>, где интенсивность флуоресценции вышеописанного флуоресцентно меченого олигонуклеотида при гибридизации с последовательностью-мишенью снижается или возрастает по сравнению с отсутствием гибридизации с последовательностью-мишенью.

<6> Зонд по одному из пп.<1>-<5>, где интенсивность флуоресценции вышеописанного флуоресцентно меченого олигонуклеотида при гибридизации с последовательностью-мишенью падает по сравнению с отсутствием гибридизации с последовательностью-мишенью.

<7> Зонд по одному из пп.<1>-<6>, где длина вышеописанного флуоресцентно меченого олигонуклеотида составляет 10-40 оснований.

<8> Зонд по одному из пп.<1>-<7>, где длина вышеописанного флуоресцентно меченого олигонуклеотида составляет 10-30 оснований.

<9> Зонд по одному из пп.<1>-<8>, который представляет собой зонд для анализа кривой плавления. Это можно альтернативно выразить как применение зонда по одному из пп.<1>-<8> для анализа кривой плавления.

<10> Зонд по одному из пп.<1>-<9>, где основание, соответствующее основанию 228 последовательности оснований, указанной в SEQ ID NO:1, представляет собой гуанин или аденин; основание, соответствующее 229 последовательности оснований, указанной в SEQ ID NO:1, представляет собой аденин или гуанин; и основание, соответствующее 230 последовательности оснований, указанной в SEQ ID NO:1, представляет собой гуанин или тимин.

<11> Способ определения полиморфизма в локусе V600 гена BRAF, который включает применение зонда по какому-либо из пп.<1>-<10>.

<12> Способ по п.<11>, который включает стадии:

(I) приведения зонда по одному из пп.<1>-<10> в контакт с одноцепочечной нуклеиновой кислотой, содержащейся в образце, для гибридизации вышеописанного флуоресцентно меченого олигонуклеотида с вышеописанной одноцепочечной нуклеиновой кислотой, таким образом, получая гибрид;

(II) диссоциации вышеописанного гибрида посредством изменения температуры образца, содержащего гибрид, для оценки изменения флуоресцентного сигнала, вызванного диссоциацией гибрида;

(III) определения величины Tm, которая представляет собой температуру диссоциации гибрида, на основе вышеописанного изменения флуоресцентного сигнала; и

(IV) определения, исходя из вышеописанной величины Tm, наличия мутации в локусе V600 гена BRAF.

<13> Способ по п.<1> или <12>, который дополнительно включает стадию амплификации нуклеиновой кислоты перед или одновременно с вышеописанной стадией (I) получения гибрида.

<14> Способ оценки эффективности лекарственного средства, который включает стадии:

определения мутации в локусе V600 гена BRAF с помощью способа по одному из пп.<11>-<13>; и

определения (или прогноза) толерантности в отношении лекарственного средства или эффективности лекарственного средства на основе наличия или отсутствия идентифицированной мутации. Указанный способ может быть осуществлен на образце от индивидуума (например, человека) в отношении которого должна быть проведена оценка. Образец (использованный в настоящем документе) содержит нуклеиновую кислоту (например, ДНК), которая может содержать указанную мутацию/полиморфизм.

<15> Реагент для определения полиморфизма, который включает зонд по одному из пп.<1>-<10>.

<16> Набор для определения полиморфизма, который включает:

зонд по одному из пп.<1>-<10>; и

праймер, способный осуществить амплификацию, используя в качестве матрицы область последовательности оснований, указанной в SEQ ID NO:1, содержащую последовательность, с которой гибридизуется вышеописанный зонд.

<17> Набор по п.<16>, где дополнительно включает праймер, способный осуществить амплификацию, используя в качестве матрицы область длиной 50-1000 оснований, включающую основания 228-230 последовательности оснований, указанной в SEQ ID NO:1. Изобретение также относится к применению реагента или набор по пп.<15>-<17> или зонда по пп.<1>-<10> для детекции указанного полиморфизма в гене BRAF.

ЭФФЕКТЫ ИЗОБРЕТЕНИЯ

Настоящее изобретение предоставляет зонд для детекции полиморфизма, который дает возможность без труда с высокой чувствительностью детектировать полиморфизм V600 в гене BRAF, и способ детекции полиморфизма, используя зонд.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг.1А представлен пример графика плавления смеси нуклеиновых кислот, и на фиг.1В представлен пример дифференциальной кривой плавления смеси нуклеиновых кислот.

На фиг.2А-2J представлены дифференциальные кривые плавления образцов согласно примеру 1 и сравнительному примеру 1 настоящего изобретения.

На фиг.3А-3J представлены дифференциальные кривые плавления образцов согласно примеру 2 и сравнительному примеру 1 настоящего изобретения.

На фиг.4А-4О представлены дифференциальные кривые плавления образцов согласно сравнительному примеру 2 настоящего изобретения.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Зонд для детекции полиморфизма V600 в гене BRAF по настоящему изобретению (далее в настоящем документе для краткости обозначаемый как «зонд для детекции полиморфизма») представляет собой зонд для детекции полиморфизма V600 в гене BRAF, который представляет собой следующий флуоресцентно меченый олигонуклеотид Р1:

(Р1) олигонуклеотид, который, по меньшей мере, на 80% гомологичен последовательности оснований длиной от 10 до 50 оснований, включающей основания 228-237 последовательности оснований, указанной в SEQ ID NO:1, где основание, соответствующее основанию 237, представляет собой цитозин, меченный флуоресцентным красителем, причем олигонуклеотид распознает полиморфизм, по меньшей мере, в одном из оснований 228-230 последовательности оснований, указанной в SEQ ID NO:1 при условии, что олигонуклеотид отличается от указанного в SEQ ID NO:7 или 19.

Способ определения полиморфизма V600 в гене BRAF по настоящему изобретению представляет собой способ, который включает детекцию полиморфизма в гене BRAF, используя, по меньшей мере, один зонд для детекции полиморфизма V600 в гене BRAF, описанный выше.

Способ оценки эффективности лекарственного средства по настоящему изобретению представляет собой способ, который включает детекцию полиморфизма V600 в гене BRAF с помощью вышеописанного способа детекции полиморфизма V600 в гене BRAF и оценку (например, определение или прогноз) толерантности в отношении лекарственного средства или эффективности лекарственного средства, исходя из детектированного наличия или отсутствия полиморфизма.

Набор реагентов для определения полиморфизма по настоящему изобретению представляет собой набор, который включает зонд для детекции полиморфизма V600 в гене BRAF.

«Ген BRAF» в настоящем изобретении уже известен, и его последовательность оснований доступна под номером доступа NCBI № NG007873.

В настоящем изобретении последовательность оснований SEQ ID NO:1 соответствует основаниям 176201-176700 последовательности под номером доступа NCBI NG007873, и она составлена номерами оснований 1-500, таким образом, что номер оснований 1 соответствует 176201 последовательности оснований под номером доступа NCBI NG007873.

В настоящем изобретении, если не указано другого, описание последовательностей оснований, детектируемой нуклеиновой кислоты образца в образце и зонда или праймера для детекции полиморфизма также должно применяться для комплементарных им последовательностей оснований, соответственно. Кроме того, при использовании описания определенной последовательности оснований для комплементарной ей последовательности оснований по настоящему изобретению должны быть использованы описания последовательностей оснований, распознаваемых определенной последовательностью оснований, при условии, что распознавание определенной последовательностью оснований заменяют на распознавание комплементарной последовательностью оснований определенной последовательности оснований в диапазоне общеизвестных технических сведений специалистов в данной области.

По настоящему изобретению термин «величина Tm» определяется как температура, при которой двухцепочечная нуклеиновая кислота диссоциирует (температура диссоциации: Tm), и, как правило, определяется как температура, при которой оптическая плотность при 260 нм повысилась на 50% от общего повышения оптической плотности, получаемого при полной диссоциации двухцепочечной нуклеиновой кислоты. Конкретнее, при нагреве раствора, содержащего двухцепочечную нуклеиновую кислоту, такую как двухцепочечная ДНК, оптическая плотность при 260 нм двухцепочечной нуклеиновой кислоты постепенно возрастает. Это происходит потому, что при нагреве разрываются водородные связи между обеими цепями двухцепочечной ДНК, таким образом, разделяя двухцепочечную ДНК на одноцепочечные ДНК (плавление ДНК). При полной диссоциации двухцепочечной ДНК до одноцепочечной ДНК у одноцепочечной ДНК наблюдается оптическая плотность, которая в около 1,5 раз выше оптической плотности при начале нагрева (т.е. оптической плотности, когда вся ДНК существует в форме двухцепочечной ДНК), что служит индикатором завершения плавления. Величина Tm определяется, исходя из этого явления.

В настоящем описании рамки термина «процесс» или «стадия» включают не только отдельный процесс/стадию, но также процесс/стадию, которые не могут быть четко отграничены от другого процесса/стадии при условии достижения ожидаемого эффекта интересующего процесса/стадии.

В настоящем описании любой числовой диапазон, выраженный, используя «до» относится к диапазону, включающему численные значения до и после «до» как минимальные и максимальные величины, соответственно.

При указании в настоящем изобретении количества компонента, который может быть включен в композицию, когда существует большое число веществ, соответствующих компоненту в композиции, если другое не оговорено, указанное количество означает общее количество большого числа веществ, присутствующих в композиции.

В настоящем изобретении при использовании фразы «основания 1-3 с 3’-конца» в сочетании с олигонуклеотидной последовательностью полагают, что основание на 3’-конце олигонуклеотидной цепи представляет собой первое основание с 3’-конца.

Настоящее изобретение описывается ниже.

<Зонд для детекции полиморфизма V600 в гене BRAF>

Зонд для детекции полиморфизма V600 в гене BRAF по настоящему изобретению (далее в настоящем документе для краткости обозначаемый как «зонд для детекции полиморфизма») представляет собой зонд для детекции полиморфизма V600 в гене BRAF, который представляет собой следующий флуоресцентно меченый олигонуклеотид Р1:

(Р1) олигонуклеотид, который, по меньшей мере, на 80% гомологичен последовательности оснований длиной от 10 до 50 оснований, включающей основания 228-237 последовательности оснований, указанной в SEQ ID NO:1, где основание, соответствующее основанию 237, представляет собой цитозин, меченый флуоресцентным красителем, причем олигонуклеотид распознает полиморфизм, по меньшей мере, в одном из оснований 228-230 последовательности оснований, указанной в SEQ ID NO:1, при условии, что олигонуклеотид отличается от указанного в SEQ ID NO:7 или 19.

Вышеописанный флуоресцентно меченый олигонуклеотид Р1 по настоящему изобретению представляет собой зонд, способный идентифицировать полиморфизм, по меньшей мере, одного основания, выбранного из группы, состоящего из оснований 228-230 последовательности оснований, указанной в SEQ ID NO:1.

Конкретнее, вышеописанный флуоресцентно меченый олигонуклеотид Р1 по настоящему изобретению представляет собой последовательность, которая включает основания, соответствующие основаниям 228-237 последовательности оснований, указанной в SEQ ID NO:1.

Помимо условия, что основание, соответствующее основанию 237 последовательности оснований, указанной в SEQ ID NO:1, представляет собой цитозин (С), флуоресцентно меченый олигонуклеотид Р1 по настоящему изобретению должен быть, по меньшей мере, на 80% гомологичен последовательности оснований длиной от 10 до 50 оснований, включающей основания 228-237 последовательности оснований, указанной в SEQ ID NO:1. Здесь отмечается, что «последовательность оснований длиной от 10 до 50 оснований, включающая основания 228-237 последовательности оснований, указанной в SEQ ID NO:1» далее в настоящем документе может обозначаться как «специфическая определенная последовательность оснований» и указанные от 10 до 50 оснований представляют собой непрерывные основания SEQ ID NO:1, которые включают основания 228-237 последовательности оснований.

Из соображений чувствительности детекции, у такого флуоресцентно меченного олигонуклеотида также может наблюдаться гомология не меньше чем 85%, не меньше чем 90%, не меньше чем 95%, не меньше чем 96%, не меньше чем 97%, не меньше чем 98% или не меньше чем 99%.

При гомологии между вышеописанным флуоресцентно меченым олигонуклеотидом Р1 по настоящему изобретению и последовательностью оснований с такими же основаниями как в SEQ ID NO:1, за исключением того, что основание, соответствующее основанию 237, представляет собой С (цитозин), меньше чем 80% чувствительность детекции нуклеиновой кислоты образца, содержащей ген BRAF мутантного типа, становится низкой.

Альтернативно, вышеописанный флуоресцентно меченый олигонуклеотид Р1 по настоящему изобретению также может представлять собой олигонуклеотид (Р1’), по меньшей мере, на 80% гомологичный вышеописанной специфической определенной последовательности оснований, в котором основание, соответствующее основанию 237, представляет собой цитозин; по меньшей мере, два основания, соответствующих основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1, отличаются от указанных в SEQ ID NO:1; и вышеописанный цитозин, соответствующий основанию 237, метят флуоресцентным красителем.

При условии, что в олигонуклеотиде, по меньшей мере, два из оснований 228-230 последовательности оснований, указанной в SEQ ID NO:1, отличаются от указанных в SEQ ID NO:1, флуоресцентно меченый олигонуклеотид Р1’ имеет тенденцию к повышенной чувствительности детекции нуклеиновой кислоты образца, содержащей ген BRAF мутантного типа.

Если, по меньшей мере, два основания, соответствующие основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1, отличаются от оснований в SEQ ID NO:1, то, по меньшей мере, два основания могут представлять собой, например, два или больше оснований, выбранных из группы, состоящей из следующего списка:

(1) основание, соответствующее основанию 228 последовательности оснований, указанной в SEQ ID NO:1, который представляет собой гуанин или аденин;

(2) основание, соответствующее 229 последовательности оснований, указанной в SEQ ID NO:1, который представляет собой аденин или гуанин; и

(3) основание, соответствующее 230 последовательности оснований, указанной в SEQ ID NO:1, который представляет собой гуанин или тимин.

Далее, в качестве конкретной комбинации, по меньшей мере, двух оснований, к примерам этого относятся случаи, когда основания, соответствующие основаниям 228, 229 и 230, представляют собой, соответственно, аденин, аденин и гуанин; аденин, аденин и тимин; аденин, гуанин и тимин; аденин, гуанин и гуанин; гуанин, аденин и тимин; и гуанин, гуанин и тимин.

Из соображений одновременной детекции двух или больше оснований, в качестве комбинации, по меньшей мере, двух оснований, соответствующие основаниям 228, 229 и 230 могут представлять собой, соответственно, аденин, аденин и гуанин; аденин, гуанин и гуанин; или гуанин, аденин и тимин.

Далее, вышеописанный флуоресцентно меченый олигонуклеотид Р1 или Р1’ по настоящему изобретению также может представлять собой флуоресцентно меченый олигонуклеотид, где основание, соответствующее основанию 228 последовательности оснований, указанной в SEQ ID NO:1, представляет собой гуанин или аденин; основание, соответствующее основанию 229 последовательности оснований, указанной в SEQ ID NO:1, представляет собой аденин или гуанин; и основание, соответствующее основанию 230 последовательности оснований, указанной в SEQ ID NO:1, представляет собой гуанин или тимин.

У такого флуоресцентно меченого олигонуклеотида наблюдается заметное отличие в величине Tm между диким типом и мутантным типом; поэтому тест с использованием флуоресцентно меченого олигонуклеотида будет точно идентифицировать мутацию и, таким образом, является высоконадежным и может определять мутацию в образце с высокой чувствительностью.

По настоящему изобретению вышеописанный флуоресцентно меченый олигонуклеотид Р1 или Р1’ также охватывает флуоресцентно меченый олигонуклеотид, который гибридизуется в жестких условиях с комплементарной цепью последовательности оснований с такими же основаниями, как вышеописанная специфическая определенная последовательность оснований, за исключением того, что основание, соответствующее основанию 237, представляет собой С (цитозин).

Гибридизация может быть осуществлена (в жестких условиях) согласно известному способу или способу, соответствующему таковому, такому как способ, описанный в руководстве Molecular Cloning 3rd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 2001). Этот документ приводится в настоящем документе в качестве ссылки.

Под термином «жесткие условия» понимают условия, при которых образуются специфические гибриды, а неспецифические гибриды не образуются. К характерным примерам жестких условий относятся, например, условия, при которых гибридизацию осуществляют при концентрации калия от около 25 мМ (например, 25 мМ) до около 50 мМ (например, 50 мМ) и концентрации магния от около 1,0 мМ (например, 1,0 мМ) до около 5,0 мМ (например, 5,0 мМ). Одним из примеров условий по настоящему изобретению являются условия, при которых гибридизацию осуществляют в растворе трис-HCl (pH 8,6), 25 мМ KCl и 1,5 мМ MgCl2, но примеры условий по настоящему изобретению этими не ограничиваются. Другие примеры жестких условий описаны в руководстве Molecular Cloning 3rd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 2001). Этот документ приводится в настоящем документе в качестве ссылки. Специалист в данной области может без труда выбрать такие условия, изменяя реакцию гибридизации и/или концентрацию солей раствора для проведения реакции гибридизации.

Более того, флуоресцентно меченые олигонуклеотиды Р1 и Р1’ по настоящему изобретению охватывают флуоресцентно меченый олигонуклеотид с последовательностью, в которой основание(я) вставлено(ы), удалено(ы) и/или замещено(ы) в флуоресцентно меченых олигонуклеотидах Р1 или Р1’.

Флуоресцентно меченый олигонуклеотид с последовательностью, в которой основание(я) вставлено(ы), удалено(ы) и/или замещено(ы), не ограничивается особым образом при условии, что у олигонуклеотида наблюдается эффект, аналогичный таковому у флуоресцентно меченных олигонуклеотидов Р1 или Р1’; и в случаях вставки, делеции и/или замены основания(ий) позиция(и) вставки(ок), делеции(й) и/или замены(н) не ограничивает(ют)ся особым образом. Количество оснований, которые вставили, удалили и/или заместили, может составлять, например, 1 основание или 2 или больше оснований, как например, от 1 основания до 10 оснований и от 1 основания до 5 оснований, хотя это может меняться в зависимости от полной длины флуоресцентно меченного олигонуклеотида.

Среди этих флуоресцентно меченых олигонуклеотидов, имеющих последовательность, в которой основание(я) вставлено(ы), удалено(ы) и/или замещено(ы), описанное выше флуоресцентно меченый олигонуклеотид Р1 или Р1’ по настоящему изобретению может представлять собой, например, олигонуклеотид, имеющий последовательность, в которой основание(я) замещено(ы). Позиция замены не ограничивается особым образом. Из соображений чувствительности детекции, например, может быть замещено основание, которое отличается от оснований 231-237 последовательности, указанной в SEQ ID NO:1. Количество оснований, которые замещаются, может составлять, например, 1 основание или 2 или больше оснований. Несмотря на то, что количество оснований, которые замещаются, изменяется в зависимости от полной длины флуоресцентно меченого олигонуклеотида, оно составляет, например, от 1 до 5 оснований или от 1 до 3 оснований.

Олигонуклеотиды в вышеописанных флуоресцентно меченых олигонуклеотидах также охватывают олигонуклеотиды, а также модифицированные олигонуклеотиды.

К примерам структурной единицы вышеописанного олигонуклеотида относятся рибонуклеотиды, дезоксирибонуклеотиды и искусственные нуклеиновые кислоты. К примерам искусственных нуклеиновых кислот относятся ДНК, РНК, LNA (замкнутые нуклеиновые кислоты), которые представляют собой аналоги РНК, PNA (пептидные нуклеиновые кислоты), которые представляют собой пептидные нуклеиновые кислоты, BNA (мостиковые нуклеиновые кислоты), которые представляют собой перекрестно-связанные нуклеиновые кислоты и подобное.

Вышеописанные олигонуклеотиды могут быть составлены одним или большим числом типов структурных единиц, описанных выше.

Необходимо, чтобы вышеописанные флуоресцентно меченые олигонуклеотиды Р1 и Р1’ по настоящему изобретению были в длину 10-50-мерами. При длине флуоресцентно меченых олигонуклеотидов Р1 и Р1’ короче, чем 10 или длиннее, чем 50 оснований чувствительность детекции полиморфизма с гене BRAF снижается.

Далее, флуоресцентно меченые олигонуклеотиды Р1 и Р1’ по настоящему изобретению могут быть в длину 10-50-мерными, 10-40-мерными или 10-30-мерными. При длине в диапазоне от 10-мера до 50-мера, например, чувствительность детекции будет увеличиваться.

При изменении длины оснований флуоресцентно меченых олигонуклеотидов Р1 и Р1’ величина Tm, которая представляет собой температуру диссоциации гибрида, образованного между флуоресцентно мечеными олигонуклеотидами и соответствующими им комплементарными цепями (последовательностями-мишенями), может быть доведена до желаемой величины.

Примеры последовательности оснований флуоресцентно меченого олигонуклеотида Р1 или Р1’ по настоящему изобретению представлены в таблице 1 ниже, но настоящее изобретение ими не ограничивается.

В настоящем документе отмечается, что в таблице 1 каждый из оснований, соответствующих основаниям 228-230 последовательности оснований, представленной в SEQ ID NO:1, указан с большой буквы. Кроме того, в таблице 1 также представлены величины Tm гибридов, которые образуются между каждым флуоресцентно меченным олигонуклеотидом и олигонуклеотидом, в котором основания, соответствующие основаниям 228, 229 и 230 SEQ ID NO:1, представляют собой, соответственно, аденин, аденин и гуанин; аденин, гуанин и гуанин; или гуанин, аденин и тимин.

Величины Tm рассчитывали, используя программное обеспечение MeltCalc© 99 FREE (http://www.meltcalc.com/), и при сочетании условий: концентрация олигонуклеотидов в [мкМ] 0,2 и равновесная концентрация Na в [мМ] 50.

По настоящему изобретению разница между величиной Tm, измеренной при гибридизации вышеописанного флуоресцентно меченного олигонуклеотида Р1 или Р1’ с ДНК, имеющей последовательность оснований, комплементарную таковому, (Tm (V600K, V600R или V600D) в таблице 1) и величиной Tm, измеренной при гибридизации последовательности оснований, соответствующей основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1, с ДНК, имеющей последовательность, комплементарную таковой, (Tm (WT) в таблице 1) составляет, например, не меньше чем 3°С. Если вышеописанная разница в величине Tm составляет 3°С или больше, например, мутация в основаниях 228-230 последовательности оснований, указанной в SEQ ID NO:1, может быть идентифицирована с более высокой чувствительностью.

Кроме того, вышеописанная разница в величине Tm может составлять, например, не меньше чем 3°С, не меньше чем 5°С или не меньше чем 7°С.

К примерам способа увеличения разницы в величине Tm относится способ, в котором зонд содержит основание, которое не комплементарно последовательности оснований, соответствующей области, с которым зонд гибридизуется. К конкретным примерам относятся способы, описанные в статье Nature Biotech (1997) vol. 15, pp. 331-335 и подобные.

Кроме того, флуоресцентно меченный олигонуклеотид Р1 или Р1’ по настоящему изобретению необходимо пометить флуоресцентным красителем на его основании, соответствующем основанию 237 (цитозину).

В флуоресцентно меченном олигонуклеотиде Р1 или Р1’ флуоресцентно меченое основание, соответствующий основанию 237, может находиться в любой из положений 1-3 с 3’-конца флуоресцентно меченного олигонуклеотида Р1 или Р1’. Альтернативно, флуоресцентно меченое основание может находиться на 3’-конце флуоресцентно меченного олигонуклеотида Р1 или Р1’. Таким образом, например, чувствительность детекции полиморфизма дополнительно улучшается. Кроме того, флуоресцентно меченный олигонуклеотид Р1 или Р1’ может быть получен с хорошей производительностью (или эффективностью).

Вышеописанный флуоресцентно меченый олигонуклеотид по настоящему изобретению может представлять собой флуоресцентно меченый олигонуклеотид, в котором интенсивность флуоресценции во время гибридизации олигонуклеотида с последовательностью, включающей основания 228-230 последовательности оснований, указанной в SEQ ID NO:1, (последовательностью-мишенью) снижается (гасится) или возрастает по сравнению с интенсивностью флуоресценции при отсутствии гибридизации олигонуклеотида с последовательностью-мишенью. В частности, флуоресцентно меченый олигонуклеотид по настоящему изобретению может представлять собой флуоресцентно меченный олигонуклеотид, в котором интенсивность флуоресценции во время гибридизации олигонуклеотида со своей последовательностью-мишенью снижается по сравнению с интенсивностью флуоресценции при отсутствии гибридизации олигонуклеотида со своей последовательностью-мишенью.

Зонд, в котором используется «явление гашения флуоресценции», описанное выше, как правило, обозначают как гуаниновый зонд гашения и он известен как ЗОНД Q®. Среди таких зондов особенно предпочтителен олигонуклеотид, который создали так, чтобы его 3’ или 5’-конец представлял собой цитозин (С) и который пометили флуоресцентным красителем так, чтобы снизить излучение флуоресценции, когда С на 3’ или 5’-конце приближается к гуанину (G). При использовании такого зонда гибридизация и диссоциация зонда может быть без труда зарегистрирована за счет изменения его сигнала.

Также может быть применен известный способ детекции, отличный от способа детекции с использованием ЗОНДА Q®. К примерам такого способа детекции относятся способ с зондом TAQ-MAN, способ с зондом для гибридизации, способ с молекулярным маяком и способ с зондом MGB.

Флуоресцентный краситель не ограничивается особым образом, и к примерам флуоресцентного красителя относятся флуоресцеин, фосфор, родамин и полиметиновые красители. К примерам коммерчески доступных продуктов таких флуоресцентных красителей относятся Pacific Blue, BODIPY FL, FluorePrime, Fluoredite, FAM, Cy3 и Cy5 и TAMRA.

Условия детекции флуоресцентно меченого олигонуклеотида особо не ограничиваются и могут быть выбраны должным образом в соответствии с используемым флуоресцентным красителем. Например, Pacific Blue может быть определен при длине волны для детекции от 445 нм до 480 нм, TAMRA может быть определен при длине волны для детекции от 585 нм до 700 нм, и BODIPY FL может быть определен при длине волны для детекции от 520 нм до 555 нм.

При использовании зонда, имеющего такой флуоресцентный краситель, гибридизация и диссоциация зонда может быть без труда подтверждена, исходя из изменения его флуоресцентного сигнала. Присоединение флуоресцентного красителя к олигонуклеотиду может быть осуществлено согласно принятому способу, такому как способ, описанный в JP-A № 2002-119291.

Необходимо отметить, что по настоящему изобретению для мечения одного или нескольких олигонуклеотидов может быть использован один и тот же флуоресцентный краситель или альтернативно могут быть использованы различные флуоресцентные красители.

Кроме того, флуоресцентно меченый олигонуклеотид может иметь, например, фосфатную группу, добавленную к его 3’-концу. Добавление фосфатной группы к 3’-концу флуоресцентно меченного олигонуклеотида супрессирует элонгацию самого зонда при реакции амплификации гена. Как описано ниже, ДНК, в которой необходимо определить наличие или отсутствие мутации, (ДНК-мишень) может быть получена, используя способ генной амплификации, такой как ПЦР. При использовании флуоресцентно меченого олигонуклеотида, который имеет фосфатную группу, добавленную к его 3’-концу, реакция амплификации может быть осуществлена даже при наличии олигонуклеотида в реакционном растворе для проведения реакции амплификации.

Подобный эффект может быть получен также путем добавления к 3’-концу вещества-метки (флуоресцентного красителя), описанного выше.

Ниже представлены конкретные примеры олигонуклеотида, имеющего описанную выше последовательность оснований, в которой С на 3’-конце метят флуоресцентным красителем (Основания, указанные с большой буквы, представляют позиции мутации, и “(PB)”, “(FL)” и “(TAMRA)” соответствуют соответствующим флуоресцентным красителям, описанным выше). Тем не менее, флуоресцентно меченый олигонуклеотид по настоящему изобретению не ограничивается следующими олигонуклеотидами.

Описанные выше флуоресцентно меченные олигонуклеотиды Р1 и Р1’ могут быть использованы в качестве зонда для детекции полиморфизма V600 в гене BRAF.

Кроме того, описанные выше флуоресцентно меченные олигонуклеотиды Р1 и Р1’ могут быть использованы в качестве зонда для анализа графика плавления.

Кроме того, описанные выше флуоресцентно меченные олигонуклеотиды Р1 и Р1’ также могут быть использованы в реагенте для детекции полиморфизма. При этом реагент для детекции полиморфизма по настоящему изобретению способен без труда с высокой чувствительностью идентифицировать полиморфизм в основаниях, соответствующих основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1.

Флуоресцентно меченный олигонуклеотид Р1 и Р1’ по настоящему изобретению может быть получен согласно принятому способу, известному как способ синтеза олигонуклеотида, такому как способ, описанный в JP-A № 2002-119291, за исключением того, что основания используют таким образом, чтобы основание, соответствующее основанию 237 в последовательности оснований, указанной в SEQ ID NO:1, представлял собой цитозин и основание, соответствующее основанию 237, метят флуоресцентным красителем.

<Праймер>

В описанном ниже способе детекции полиморфизма в гене BRAF для амплификации последовательности, имеющей полиморфизм в гене BRAF, определяемый способом ПЦР, используют праймеры.

Праймеры, которые могут быть использованы по настоящему изобретению, особо не ограничиваются при условии, что они способны амплифицировать нуклеиновую кислоту, содержащую основания, соответствующие основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1, которая представляет собой сайт детектируемого полиморфизма в гене BRAF.

Праймер, используемый в способе ПЦР, особо не ограничивается при условии, что он способен амплифицировать область, с которым может быть гибридизован зонд по настоящему изобретению. Такой праймер может быть создан специалистом в данной области на основе последовательностей оснований, указанных в SEQ ID NO:1. Длина и величина Tm праймера могут составлять длину от 12-мерного до 40-мерного и величину от 40°С до 70°С или длину от 16-мерного до 30-мерного и величину от 55°С до 60°С.

Длины отдельных праймеров в наборе праймеров не обязательно должны быть одинаковыми, хотя величины Tm этих праймеров предпочтительно приблизительно равны (или различие между величинами Tm этих праймеров предпочтительно находится в пределах 5°С).

Ниже представлены примеры праймеров, которые могут быть использованы для амплификации последовательности оснований, содержащей область, с которой гибридизуется зонд для детекции полиморфизма по настоящему изобретению, использованный в способе детекции полиморфизма по настоящему изобретению. Здесь необходимо отметить, что следующие примеры предлагаются лишь с целью иллюстрации и что поэтому настоящее изобретение ими не ограничивается.

Описанный выше праймер может представлять собой олигонуклеотид (Р2), который, по меньшей мере, на 80% идентичен последовательности оснований длиной от 30 до 40 оснований, включающей основания 115-144 последовательности оснований, указанной в SEQ ID NO:1, и амплифицирует область, содержащую основания, соответствующие основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1. Кроме того, описанный выше олигонуклеотид Р2 также может представлять собой олигонуклеотид, который гибридизуется в жестких условиях с комплементарной цепью последовательности оснований длиной от 30 до 40 оснований, включающей основания 115-144 последовательности оснований, указанной в SEQ ID NO:1. Описанный выше олигонуклеотид Р2 также может представлять собой олигонуклеотид, имеющий последовательность, в которой основание(я) вставлено(ы), удалено(ы) и/или замещено(ы) в олигонуклеотиде Р2.

Альтернативно, описанный выше праймер может представлять собой следующий праймер. То есть описанный выше праймер также может представлять собой олигонуклеотид (Р3), по меньшей мере, на 80% гомологичный комплементарной цепи последовательности оснований длиной от 22 до 40 оснований, включающей основания 239-260 последовательности оснований, указанной в SEQ ID NO:1, и амплифицирует область, содержащую основания, соответствующие основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1. Кроме того, описанный выше олигонуклеотид Р3 также может представлять собой олигонуклеотид, который гибридизуется в жестких условиях с последовательностью оснований длиной от 22 до 40 оснований, включающей основания 239-260 последовательности оснований, указанной в SEQ ID NO:1. Описанный выше олигонуклеотид Р3 также может представлять собой олигонуклеотид, имеющий последовательность, в которой основание(я) вставлено(ы), удалено(ы) и/или замещено(ы) в олигонуклеотиде Р2.

В отношении способа осуществления гибридизации, гибридизация может быть осуществлена в соответствии со способом, описанным выше в разделе зондов, и в отношении «жестких условий», применяются те же условия, что и описанные выше в разделе зондов. Кроме того, также в отношении диапазона идентичности и условий вставки, делеции и/или замены, применяются те же диапазон/условия, что и описанные выше в разделе зондов.

Ниже представлены примеры праймеров, которые могут быть использованы в способе детекции полиморфизма по настоящему изобретению для амплификации области, содержащей основания, соответствующие основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1.

Таблица 3
Название Последовательность(5’→ 3’) Число оснований SEQ ID NO:
BRAF-F3 tgcttgctctgataggaaaatgagatctac 30 17
BRAF-R5 aaactgatgggacccactccat 22 18

Для детекции полиморфизма в основаниях, соответствующих основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1, например, в качестве набора парных праймеров могут быть использованы описанные выше олигонуклеотиды Р2 и Р3.

Способ детекции полиморфизма особо не ограничивается при условии, что он представляет собой способ, в котором в качестве зонда используют флуоресцентно меченный олигонуклеотид, описанный выше. В качестве примера способа детекции полиморфизма, в котором в качестве зонда используют флуоресцентно меченный олигонуклеотид, описанный выше, ниже описан способ детекции полиморфизма, используя анализ величины Tm.

<Способ детекции полиморфизма>

Способ детекции полиморфизма V600 в гене BRAF по настоящему изобретению представляет собой способ детекции полиморфизма V600 в гене BRAF, который включает детекцию полиморфизма V600 в гене BRAF, используя, по меньшей мере, один зонд для детекции полиморфизма V600 в гене BRAF, описанный выше.

Способ детекции полиморфизма по настоящему изобретению может включать, по меньшей мере, один зонд для детекции полиморфизма, описанный выше, и это может позволить идентифицировать полиморфизм(ы) V600 в гене BRAF без труда и с высокой чувствительностью.

Кроме того, способ детекции полиморфизма V600 по настоящему изобретению может быть использован в качестве способа детекции полиморфизма V600 в гене BRAF и может включать описанные ниже процессы или стадии (I)-(IV) и может включать описанную ниже стадию (V). Способ детекции полиморфизма по настоящему изобретению имеет особенность применения описанного выше зонда, и другие формы, условия и подобное особо не ограничиваются описанием ниже.

Стадия (I): приведение флуоресцентно меченого зонда в контакт с одноцепочечной нуклеиновой кислотой в образце для получения гибрида.

Стадия (II): диссоциация гибрида за счет изменения температуры образца, содержащего гибрид, и определение изменения флуоресцентного сигнала вследствие диссоциации гибрида.

Стадия (III): определение величины Tm, которая представляет собой температуру диссоциации гибрида, исходя из изменения флуоресцентного сигнала.

Стадия (IV): детекция наличия полиморфизма V600 в гене BRAF в одноцепочечной нуклеиновой кислоте в образце, исходя из величины Tm.

Стадия (V): определение относительного содержания одноцепочечной нуклеиновой кислоты, имеющей полиморфизм, среди всех одноцепочечных нуклеиновых кислот, содержавшихся в образце, исходя из наличия полиморфизма(ов).

Более того, способ по настоящему изобретению может дополнительно включать амплификацию нуклеиновой кислоты перед получением гибрида на стадии (I) или одновременно с получением гибрида на стадии (I), помимо стадий (I)-(IV) или помимо стадий (I)-(V).

Измерение величины Tm на стадии (III) может включать не только измерение температуры диссоциации гибрида, но также измерение различающихся величин флуоресцентного сигнала, который изменяется в соответствии с температурой плавления гибрида.

По настоящему изобретению нуклеиновая кислота в образце может представлять собой одноцепочечную нуклеиновую кислоты или двухцепочечную нуклеиновую кислоту. В случае, когда нуклеиновая кислота представляет собой двухцепочечную нуклеиновую кислоту, способ может включать, например, плавление (диссоциацию) двухцепочечной нуклеиновой кислотой в образце до одноцепочечных нуклеиновых кислот путем нагрева перед гибридизацией с флуоресцентно меченым зондом. Диссоциация двухцепочечной нуклеиновой кислоты до одноцепочечных нуклеиновых кислот дает возможность гибридизации с флуоресцентно меченым зондом.

По настоящему изобретению нуклеиновая кислота, содержавшаяся в детектируемом образце, может представлять собой, например, нуклеиновую кислоту, исходно содержавшуюся в биологическом образце, или продукт амплификации, полученный при амплификации области интересующего гена, который содержит мутантный(е) сайт(ы) гена BRAF, путем ПЦР или подобного, используя нуклеиновую кислоту, исходно содержавшуюся в биологическом образце, в качестве матрицы с целью улучшения точности детекции. Длина продукта амплификации особо не ограничивается и может составлять, например, от 50-мера до 1000-мера или от 80-мера до 200-мера. Более того, нуклеиновая кислота в образце может представлять собой, например, кДНК, которую синтезировали с РНК, полученных из биологического образца (например, всех РНК, мРНК и т.д.) посредством ОТ-ПЦР (ПЦР с обратной транскрипцией).

В настоящем изобретении соотношение (молярное соотношение) добавленного зонда по настоящему изобретению к нуклеиновым кислотам в образце особо не ограничивается. Количество добавляемого зонда может составлять, например, не больше чем 1-кратное (по молям) от количества ДНК в образце. С точки зрения достижения достаточного детектируемого сигнала соотношение добавляемого зонда по настоящему изобретению к нуклеиновым кислотам в образце (в молярном соотношении) может составлять 0,1 или меньше.

«Нуклеиновые кислоты в образце» могут представлять собой, например, суммарные детектируемые нуклеиновые кислоты, которые обладают идентифицируемым полиморфизмом, и нуклеиновые кислоты, отличающиеся от детектируемых нуклеиновых кислот, которые не обладают полиморфизмом, или суммарные продукты амплификации, содержащие детектируемую последовательность-мишень, обладающую идентифицируемым полиморфизмом, и продукты амплификации, содержащие последовательность, отличную от детектируемой последовательности-мишени, которая не обладает полиморфизмом. Несмотря на то, что соотношение идентифицируемых нуклеиновых кислот к нуклеиновым кислотам в образце обычно не известно заранее, получаемое соотношение добавки зонда относительно идентифицируемых нуклеиновых кислот (или продуктов амплификации, содержащих идентифицируемую последовательность) (в молярном соотношении) может составлять 10 или меньше. Соотношение добавки зонда относительно идентифицируемых нуклеиновых кислот (или продуктов амплификации, содержащих идентифицируемую последовательность) (в молярном соотношении) может составлять 5 или меньше или 3 или меньше. Низший предел соотношения особо не ограничен и может составлять, например, 0,001 или больше, 0,01 или больше или 0,1 или больше.

Описанное выше соотношение добавки флуоресцентно меченого зонда по настоящему изобретению относительно ДНК может представлять собой, например, молярное соотношение относительно двухцепочечных нуклеиновых кислот или молярное соотношение относительно одноцепочечных нуклеиновых кислот.

В настоящем изобретении определение изменения сигнала, вызванного изменением температуры, для определения величины Tm может быть осуществлено путем измерения оптической плотности при 260 нм на основе принципа, описанного выше. Тем не менее измерение может быть осуществлено путем определения сигнала, который основан на сигнале от метки, прикрепленной к флуоресцентно меченому зонду, и который изменяется в соответствии со степенью формирования гибрида одноцепочечной ДНК и зонда. Поэтому в качестве флуоресцентно меченого зонда может быть использован вышеописанный флуоресцентно меченый олигонуклеотид. К примерам флуоресцентно меченого олигонуклеотида (далее в настоящем документе иногда обобщенно обозначаемого как «флуоресцентно меченый олигонуклеотид») относятся флуоресцентно меченый олигонуклеотид, для которого интенсивность флуоресценции при гибридизации олигонуклеотида со своей последовательностью-мишенью падает (гасится) по сравнению с интенсивностью флуоресценции при отсутствии гибридизации олигонуклеотида со своей последовательностью-мишенью, и флуоресцентно меченый олигонуклеотид, для которого интенсивность флуоресценции при гибридизации олигонуклеотида со своей последовательностью-мишенью возрастает по сравнению с интенсивностью флуоресценции при отсутствии гибридизации олигонуклеотида со своей последовательностью-мишенью.

У первого флуоресцентно меченого олигонуклеотида при образовании флуоресцентно меченым олигонуклеотидом гибрида (двухцепочечной ДНК) с идентифицируемой последовательностью флуоресцентный сигнал не наблюдается или наблюдается лишь слабый флуоресцентный сигнал; тем не менее при диссоциации флуоресцентно меченого олигонуклеотида при нагревании у флуоресцентно меченого олигонуклеотида наблюдается флуоресцентный сигнал или наблюдается повышенный флуоресцентный сигнал.

У последнего флуоресцентно меченого олигонуклеотида наблюдается флуоресцентный сигнал при образовании флуоресцентно меченным олигонуклеотидом гибрида (двуцепочечной ДНК) с идентифицируемой последовательностью; тем не менее при диссоциации флуоресцентно меченого олигонуклеотида при нагревании у флуоресцентно меченого олигонуклеотида наблюдается сниженный флуоресцентный сигнал или флуоресцентный сигнал перестает наблюдаться. Поэтому подобно измерению оптической плотности при 260 нм, описанному выше, проведение плавления может быть мониторировано, и величина Tm может быть определена путем определения изменения флуоресцентного сигнала от флуоресцентной метки при условиях, специфичных для флуоресцентной метки (например, длине волны ее флуоресценции).

Способ определения изменения сигнала, исходя из сигнала флуоресцентного красителя, в способе детекции полиморфизма по настоящему изобретению описан ниже путем конкретных примеров. Способ детекции полиморфизма по настоящему изобретению имеет особенность - применение флуоресцентно меченого зонда для детекции полиморфизма, а другие процессы и условия способа каким-либо образом не ограничиваются.

Образец, содержащий нуклеиновую кислоту, которая служит в качестве матрицы для амплификации нуклеиновой кислоты, особо не ограничивается при условии, что образец содержит нуклеиновую кислоту, в частности ген BRAF. К примерам такого образца относится образец, который получают или который может быть получен из любого биологического источника, к его примерам относятся: ткань, такая как ткань толстого кишечника или легкого; гемоцит, такой как лейкоцитарная клетка; цельная кровь; плазма; мокрота; суспензия слизистой ротовой полости; соматическая клетка ногтя, волоса или подобное; стволовая клетка; молоко; асцитическая жидкость; залитая в парафин ткань; желудочный сок; промывная жидкость желудка; моча; перитонеальная жидкость; амниотическая жидкость; и культура клеток. Способ получения образца, способ получения образца, содержащего нуклеиновую кислоту, и подобное не ограничиваются, и для этого могут быть использованы принятые способы, известные в данной области. Нуклеиновая кислота, полученная из такого биологического источника, может быть непосредственно использована в качестве матрицы или может быть использована после предварительной обработки образца, которая модифицирует свойства образца.

Например, в случае использования в качестве образца цельной крови выделение геномной ДНК из цельной крови может быть осуществлено принятым способом, известным в данной области. Например, может быть использован коммерчески доступный набор для выделения геномной ДНК (торговое наименование: НАБОР ДЛЯ ОЧИСТКИ ГЕНОМНОЙ ДНК ИЗ КРОВИ GFX, продукция фирмы GE Healthcare Biosciences) и т.д.

Затем к образцу, содержащему выделенную геномную ДНК, добавляют флуоресцентно меченый зонд для детекции полиморфизма, включающий флуоресцентно меченный олигонуклеотид.

Флуоресцентно меченый зонд может быть добавлен к жидкому образцу, содержащему выделенную геномную ДНК, или может быть смешан с геномной ДНК в подходящем растворителе. Растворитель особо не ограничивается, и к примерам растворителя относятся принятые растворители, известные в данной области, такие как: буферный раствор, такой как трис-HCl; растворитель, содержащий, по меньшей мере, одну из солей KCl, MgCl2, MgSO4 или глицерин; и раствор для проведения реакции ПЦР.

Время добавления флуоресцентно меченого зонда особо не ограничивается. Например, в случае осуществления процесса амплификации, такого как ПЦР, описанная ниже, флуоресцентно меченый зонд может быть добавлен к продуктам ПЦР-амплификации после осуществления процесса амплификации или может быть добавлен перед осуществлением процесса амплификации.

В случае добавления флуоресцентно меченого зонда перед осуществлением процесса амплификации, такого как ПЦР, например, флуоресцентный краситель или фосфатная группа может быть добавлена к 3’-концу зонда, как описано выше.

Способ амплификации нуклеиновой кислоты может представлять собой, например, способ с использованием полимеразы. К их примерам относятся способ ПЦР, способ ICAN, способ LAMP и способ NASBA. При осуществлении амплификации способом с использованием полимеразы амплификация может быть осуществлена при наличии флуоресцентно меченого зонда по настоящему изобретению. Специалист в данной области без труда смог бы привести условия реакции амплификации и подобное в соответствие с флуоресцентно меченым зондом и используемой полимеразой. При осуществлении амплификации при наличии флуоресцентно меченого зонда по настоящему изобретению полиморфизм может быть идентифицирован путем анализа величины Tm флуоресцентно меченого зонда лишь после осуществления амплификации нуклеиновой кислоты, и поэтому нет необходимости отделять продукт амплификации после завершения реакции. Таким образом, контаминации продуктом (или продукта) амплификации не происходит. Кроме того, поскольку детекция может быть осуществлена на том же устройстве, которое необходимо для амплификации, нет необходимости переносить пробирку, и облегчается автоматизация процесса.

ДНК-полимераза, используемая в способе ПЦР, может быть выбрана без особого ограничения из ДНК-полимераз, которые обычно используются для ПЦР. К примерам ДНК-полимеразы относятся GENE TAQ (торговое наименование, продукция фирмы NIPPON GENE CO., LTD.), ДНК-ПОЛИМЕРАЗА PRIMESTAR MAX (торговое наименование, продукция фирмы Takara Bio Inc.) и Taq-полимераза.

Количество используемой полимеразы особо не ограничивается при условии достижения обычно используемой концентрации полимеразы. Например, при использовании полимеразы Taq концентрация полимеразы Taq может составлять, например, от 0,01 Ед до 100 Ед для 50 мкл реакционного раствора. В этом диапазоне, например, чувствительность детекции полиморфизма V600 в гене BRAF будет повышаться.

Способ ПЦР может быть осуществлен при условиях, подходящим образом выбранных из обычно используемых условий.

При осуществлении амплификации амплификацию можно отслеживать, используя ПЦР в режиме реального времени, так что количество копий ДНК (идентифицируемой последовательности), содержавшейся в образце, может быть измерено. Другими словами, пропорция зондов, образующих гибриды, возрастает по мере прохождения амплификации ДНК (идентифицируемой последовательности) посредством ПЦР, таким образом, изменяя интенсивность флуоресценции. При мониторинге изменения интенсивности флуоресценции может быть получено число копий и/или относительное количество идентифицируемой последовательности (либо нормальной ДНК, либо мутантной ДНК), содержавшейся в образце.

В способе детекции полиморфизма по настоящему изобретению флуоресцентно меченый олигонуклеотид и одноцепочечную нуклеиновую кислоту в образце приводят в контакт друг с другом, таким образом, осуществляя гибридизацию. Одноцепочечная нуклеиновая кислота в образце может быть получена, например, путем диссоциации продуктов ПЦР-амплификации, полученных вышеописанным путем.

Температура нагрева, использованная для диссоциации продуктов ПЦР-амплификации, (температура нагрева в процессе диссоциации) особо не ограничивается при условии, что она представляет собой температуру, при которой продукты амплификации могут быть диссоциированы. Например, температура нагрева может находиться в диапазоне от 85°С до 95°С. Время нагрева тоже особо не ограничивается. Время нагрева может находиться в диапазоне, например, от 1 секунды до 10 минут или от 1 секунды до 5 минут.

Гибридизация диссоциированной одноцепочечной ДНК и флуоресцентно меченого олигонуклеотида может быть осуществлена, например, путем уменьшения после процесса диссоциации температуры ниже температуры нагрева, использованной в процессе диссоциации. Температурные условия гибридизации могут, например, находиться в диапазоне от 40°С до 50°С.

Объем и концентрация каждого компонента в реакционном растворе в процессе гибридизации особо не ограничиваются. В отношении их конкретных примеров, концентрация ДНК в реакционном растворе может составлять, например, от 0,01 мкМ до 1 мкМ или от 0,1 мкМ до 0,5 мкМ. Концентрация флуоресцентно меченого олигонуклеотида может находиться, например, в диапазоне, в котором вышеописанная добавляемая концентрация относительно ДНК является приемлемой, и может составлять, например, концентрацию от 0,001 мкМ до 10 мкМ или от 0,001 мкМ до 1 мкМ.

Полученный гибрид одноцепочечной ДНК и флуоресцентно меченого олигонуклеотида постепенно нагревают и определяют изменение флуоресцентного сигнала, вызванное повышением температуры. Например, при применении ЗОНДА Q® интенсивность флуоресценции при гибридизации зонда с одноцепочечной ДНК снижается (или гасится) по сравнению с интенсивностью флуоресценции в диссоциированном состоянии. Поэтому, например, гибрид, испускающий сниженную флуоресценцию, или гашеный гибрид может быть постепенно нагрет и повышение интенсивности флуоресценции, вызванное увеличением температуры, может быть измерено.

Диапазон температуры, в котором измеряют интенсивность флуоресценции, особо не ограничивается, и исходная температура может представлять собой, например, температуру от комнатной до 85°С или температуру от 25°С до 70°С. Конечная температура может представлять собой, например, температуру от 40°С до 105°С. Скорость повышения температуры также особо не ограничивается и может находиться в диапазоне, например, от 0,1°С/сек до 20°С/сек или в диапазоне от 0,3°С/сек до 5°С/сек.

Далее, изменение сигнала анализируют для определения величины Tm. Конкретно, величина Tm может быть определена путем расчета дифференциальной величины при каждой температуре (-d(интенсивность флуоресценции)/dt) из полученной интенсивности флуоресценции, взяв в качестве величины Tm температуру, при которой дифференциальная величина имеет наименьшее значение. Величина Tm альтернативно может быть определена как точка, при которой повышение интенсивности флуоресценции на единицу времени ((повышение интенсивности флуоресценции)/t) имеет наибольшее значение. Напротив, если в качестве флуоресцентно меченого зонда используют зонд, для которого интенсивность сигнала возрастает при образовании гибрида, а не гасящий зонд, то анализ сигнала и определение величины Tm могут быть осуществлены путем измерения снижения интенсивности флуоресценции.

По настоящему изобретению изменение флуоресцентного сигнала, вызванное повышением температуры (предпочтительно повышение интенсивности флуоресценции), может быть измерено при нагреве гибрида, как описано выше. Тем не менее, вместо этого способа оценка изменения сигнала альтернативно может быть осуществлена, например, в процессе образования гибрида. Другими словами, температура образца, к которому добавили зонд, может быть снижена, и изменение флуоресцентного сигнала, вызванное снижением температуры, может быть измерено в процессе образования гибрида.

Например, при применении ЗОНДА Q®, когда зонд добавляют к образцу, интенсивность флуоресценции высокая, поскольку зонд находится в диссоциированном состоянии. Однако при образовании гибрида за счет снижения температуры флуоресценция падает (или гасится). Поэтому, например, снижение интенсивности флуоресценции, обусловленное понижением температуры, может быть измерено при постепенном снижении температуры нагретого образца.

С другой стороны, при применении зонда, сигнал от которого возрастает при образовании гибрида, при добавлении зонда к образцу интенсивность флуоресценции низкая (или гасится), поскольку зонд находится в диссоциированном состоянии. Однако при образовании гибрида за счет снижения температуры интенсивность флуоресценции повышается. Поэтому, например, повышение интенсивности флуоресценции, обусловленное снижением температуры, может быть измерено при постепенном снижении температуры образца.

<Способ оценки эффективности лекарственного средства>

Способ оценки эффективности лекарственного средства по настоящему изобретению включает детекцию полиморфизма в гене BRAF посредством вышеописанного способа детекции полиморфизма; и оценку получения ответа на терапевтический агент или эффективности терапевтического агента на основе результатов детекции.

В описанном выше способе детекции полиморфизма V600 полиморфизм в гене BRAF без труда идентифицируют с высокой чувствительностью, используя зонд для детекции полиморфизма по настоящему изобретению; поэтому, исходя из этого полиморфизма в гене BRAF, терапевтический агент может быть без труда оценен с высокой чувствительностью.

Кроме того, вероятность получения ответа на терапевтический агент и его эффективность могут быть оценены, исходя из наличия или отсутствия полиморфизма и относительного содержания мутантной последовательности и/или нормальной последовательности. Более того, способ оценки эффективности терапевтического агента по настоящему изобретению можно использовать в определении, требуется ли изменить терапевтическую стратегию, например, повысив дозу терапевтического агента или использовав отличный терапевтический агент, исходя из наличия или отсутствия мутации и относительного содержания мутантной последовательности.

В данном случае к примерам оцениваемого лекарственного средства относятся молекулярно нацеленные терапевтические агенты, лекарственные средства против злокачественной меланомы и противораковые агенты, и в частности оцениваемое лекарственное средство может представлять собой молекулярно нацеленный терапевтический агент или лекарственное средство против злокачественной меланомы.

<Набор реагентов для детекции полиморфизма>

Набор реагентов (также обозначаемый в настоящем документе как набор) для детекции полиморфизма V600 в гене BRAF по настоящему изобретению включает вышеописанный(е) зонд(ы) для детекции полиморфизма.

Этот набор реагентов для детекции полиморфизма включает, по меньшей мере, один из вышеописанных зондов для детекции полиморфизма, способный без труда с высокой чувствительностью идентифицировать в гене BRAF полиморфизм в основаниях, соответствующих основаниям 228-230 последовательности оснований, указанной в SEQ ID NO:1; поэтому, например, набор реагентов способен более легко идентифицировать полиморфизм V600 в гене BRAF.

Кроме того, набор реагентов для детекции полиморфизма по настоящему изобретению также может включать праймер для амплификации последовательности оснований, содержащей вышеописанный(е) идентифицируемый(е) полиморфизм(ы) гена BRAF. Это дает возможность набору реагентов для детекции полиморфизма V600 по настоящему изобретению идентифицировать полиморфизм в гене BRAF с хорошей точностью.

Кроме того, набор реагентов для детекции полиморфизма по настоящему изобретению может дополнительно содержать праймер, который способен осуществлять амплификацию, используя в качестве матрицы область длиной от 50 до 1000 оснований, включающий основания 228-230 последовательности оснований, указанной в SEQ ID NO:1.

Что касается зонда и праймера, которые могут быть включены в набор реагентов для детекции полиморфизма, эти вещества, описанные выше, могут быть применены, как есть.

Если в качестве зондов содержатся два или больше типов флуоресцентно меченого олигонуклеотида, олигонуклеотиды могут содержаться в виде смеси или могут содержаться отдельно.

Кроме того, если набор реагентов для детекции полиморфизма по настоящему изобретению содержит смесь двух или больше типов зондов по настоящему изобретению или если набор реагентов для детекции полиморфизма включает зонды в виде отдельных реагентов, но, например, эти зонды используются в одной и той же реакционной системе для осуществления анализа Tm с соответствующими флуоресцентно мечеными олигонуклеотидами и идентифицируемыми последовательностями, то предпочтительно, чтобы каждый из двух или больше типов зондов метили флуоресцентным красителем с отличной длиной волны излучения.

При применении зондов, меченных соответственно различными флуоресцентными красителями, детекция сигнала от каждого флуоресцентно меченого олигонуклеотида может быть осуществлена одновременно даже в одной реакционной системе.

Помимо зонда набор реагентов по настоящему изобретению может дополнительно включать реагенты, необходимые для осуществления амплификации нуклеиновых кислот в способе детекции по настоящему изобретению. Зонд, праймеры и другие реагенты могут содержаться отдельно или некоторые из них могут содержаться в виде смеси.

Термин «содержаться отдельно» может относиться к состоянию, при котором отдельные реагенты отделяются друг от друга так, чтобы между ними сохранялось состояние отсутствия контакта, и необязательно, чтобы отдельные реагенты содержались в отдельных контейнерах, которые можно взять независимо.

При включении в набор реагентов набора праймеров для амплификации последовательности оснований, включающей основание в сайте полиморфизма (области, с которой может гибридизоваться зонд), может быть достигнута детекция полиморфизма с более высокой чувствительностью, например.

Набор реагентов по настоящему изобретению может дополнительно включать инструкцию, которая предоставляет инструкции по получению дифференциальной кривой плавления образца, содержащего идентифицируемую нуклеиновую кислоту, используя зонд, и по детекции полиморфизма V600 в гене BRAF посредством анализа величины Tm на основе дифференциальной кривой плавления, или инструкции, которые описывают большое число реагентов, которые содержаться или могут содержаться дополнительно в наборе реагентов.

ПРИМЕРЫ

Настоящее изобретение далее будет описано подробно путем примеров. Тем не менее настоящее изобретение никоим образом не ограничивается этими примерами.

[Пример 1, пример 2 и сравнительный пример 1]

Используя полностью автоматизированный анализатор SNP (торговое название: I-DENSY (торговая марка); продукция фирмы ARKRAY, Inc), образец, представленный в таблице 4 ниже, (1 мкл смеси искусственных нуклеиновых кислот/реакционный раствор) и раствор для проведения ПЦР, представленный в таблице 5 ниже, подвергали ПЦР и анализу Tm. В каждом из образцов, представленных в таблице 4, использовали плазмиду дикого типа, указанную в SEQ ID NO:2, плазмиду V600E, указанную в SEQ ID NO:3; плазмиду V600K, указанную в SEQ ID NO:4; плазмиду V600R, указанную в SEQ ID NO:5, и плазмиду V600D, указанную в SEQ ID NO:6.

Таблица 4
Образец:
Число копий каждой плазмиды в 1 мкл смеси нуклеиновых кислот:
Содержание мутаций Образец WT Образец mt
WT
mt 10%
mt 5%
10000
9000
9500
0
1000
500

Таблица 5
Раствор для проведения ПЦР
В 50 мкл раствора для проведения ПЦР:
Taq-полимераза
Трис-HCl
BSA
Глицерин
KCl
MgCl2
dNTP
BRAF-F3
BRAF-R5
Зонд
1,88 Ед
25 ммоль/л
0,20%
4,50%
45 ммоль/л
1,5 ммоль/л
0,2 ммоль/л
0,3 мкмоль/л
1,5 мкмоль/л
0,1 мкмоль/л

Подробное описание зондов и праймеров, которые использовались в таблице 5 выше, представлено в таблицах 6 и 7, соответственно. В скобках на 3’-конце каждого зонда указывается тип флуоресцентного красителя.

ПЦР осуществляли путем обработки реакционного раствора при 95°С в течение 60 секунд и затем 50 циклов повтора при 95°С в течение 1 секунды и 58°С в течение 15 секунд.

Анализ Tm осуществляли после ПЦР путем обработки реакционного раствора при 95°С в течение 1 секунды и затем при 40°С в течение 60 секунд с последующим измерением изменения интенсивности флуоресценции с течением времени за период, в котором температура раствора повышалась от 40°С до 75°С со скоростью 1°С/3 секунды.

Здесь необходимо отметить, что флуоресцентный краситель PACIFIC BLUE имеет длину волны возбуждения 365-415 нм и детектируемую длину волны 445-480 нм. Флуоресцентный краситель BODIPY FL имеет длину волны возбуждения 420-485 нм и детектируемую длину волны 520-555 нм, и флуоресцентный краситель TAMRA имеет длину волны возбуждения 520-555 нм и детектируемую длину волны 585-700 нм. Исходя из этих длин волн, определяли изменения интенсивности флуоресценции, исходящей от соответствующих флуоресцентно меченых зондов.

Анализ Tm предложен на фиг.2 и фиг.3, показывающих изменения величины флуоресценции соответствующих зондов.

На фиг.2, графики (А)-(Е), показаны результаты, полученные, используя зонд, указанный в SEQ ID NO:8, и на графиках (F)-(J) показаны результаты, полученные, используя зонд, указанный в SEQ ID NO:7.

На фиг.2, графики (А)-(F), показаны результаты, полученные, используя в качестве образца плазмиду дикого типа, на графиках (В)-(G) показаны результаты, полученные, используя в качестве образца плазмиду V600E (mt 5%), на графиках (С)-(Н) показаны результаты, полученные, используя в качестве образца плазмиду V600K (mt 5%), на графики (D)-(I) показаны результаты, полученные, используя в качестве образца плазмиду V600R (mt 5%), и на графиках (E)-(J) показаны результаты, полученные, используя в качестве образца плазмиду V600D (mt 5%).

На фиг.3 графики (А)-(Е), показаны результаты, полученные, используя зонд, указанный в SEQ ID NO:9, и на графиках (F)-(J) показаны результаты, полученные, используя зонд, указанный в SEQ ID NO:7.

На фиг.3 графики (А)-(F), показаны результаты, полученные, используя в качестве образца плазмиду дикого типа, на графиках (В)-(G) показаны результаты, полученные, используя в качестве образца плазмиду V600E (mt 10%), на графиках (С)-(Н) показаны результаты, полученные, используя в качестве образца плазмиду V600K (mt 10%), на графиках (D)-(I) показаны результаты, полученные, используя в качестве образца плазмиду V600R (mt 10%), и на графиках (E)-(J) показаны результаты, полученные, используя в качестве образца плазмиду V600D (mt 10%).

На фиг.2 и 3 ордината указывает изменение интенсивности флуоресценции за единицу времени (повышение d-интенсивность флуоресценции/t), и абсцисса указывает температуру (°С).

На фиг.2(С) помимо пика на около 43°С, который наблюдали у образца дикого типа на фиг.2(А), существовал также другой пик, обнаруженный при 51°С. Кроме того, на фиг.2(Е) помимо пика на около 43°С существовал также другой пик, обнаруженный при 49°С.

Исходя из этих результатов, было продемонстрировано, что две мутации V600K и V600D могут быть идентифицированы одновременно, используя зонд, указанный в SEQ ID NO:8, который представляет собой зонд для детекции полиморфизма по настоящему изобретению.

При этом, как ясно видно из результатов на фиг.2(F)-(J), при использовании зонда, указанного в SEQ ID NO:7, идентифицировалась лишь мутация V600E.

На фиг.3(С) помимо пика на около 45°С, который наблюдали у образца дикого типа на фиг.3(А), существовал также другой пик, обнаруженный при 49°С. Кроме того, на фиг.3(D) помимо пика на около 45°С существовал также другой пик, обнаруженный при 57°С.

Исходя из этих результатов, было продемонстрировано, что две мутации V600K и V600R могут быть идентифицированы одновременно, используя зонд, указанный в SEQ ID NO:9, который представляет собой зонд для детекции полиморфизма по настоящему изобретению.

При этом, как ясно видно из результатов на фиг.3(F)-(J), при использовании зонда, указанного в SEQ ID NO:7, идентифицировалась лишь мутация V600E.

[Сравнительный пример 2]

Анализ Tm осуществляли таким же образом как в примере 1, за исключением того, что зонд для детекции полиморфизма заменяли на зонды SEQ ID NO:14-16, представленные в таблице 8 ниже.

В результате получали показанные фиг.4 изменения величины флуоресценции соответствующих зондов. На фиг.4 ордината указывает изменение интенсивности флуоресценции за единицу времени (повышение d-интенсивность флуоресценции/t), и абсцисса указывает температуру (°С).

На фиг.4, графики (А)-(Е), показаны результаты, полученные, используя зонд, указанный в SEQ ID NO:10, и на графиках (F)-(J) показаны результаты, полученные, используя зонд, указанный в SEQ ID NO:11, и на графиках (K)-(О) показаны результаты, полученные, используя зонд, указанный в SEQ ID NO:12.

На фиг.4, графики (А),(F) и (K), показаны результаты, полученные, используя в качестве образца плазмиду дикого типа, на графиках (В), (G) и (L) показаны результаты, полученные, используя в качестве образца плазмиду V600E (mt 10%), на графиках (С), (Н) и (М) показаны результаты, полученные, используя в качестве образца плазмиду V600K (mt 10%), на графиках (D), (I) и (N) показаны результаты, полученные, используя в качестве образца плазмиду V600R (mt 10%), и на графиках (E), (J) и (О) показаны результаты, полученные, используя в качестве образца плазмиду V600D (mt 10%).

Как видно из результатов, представленных на фиг.4(А)-(О), было продемонстрировано, что при использовании зондов, указанных в SEQ ID NO:14-16, мутация V600 в гене BRAF не может быть идентифицирована.

Исходя из описанных выше результатов, было продемонстрировано, что по настоящему изобретению полиморфизм V600 в гене BRAF может быть идентифицирован без труда и с высокой чувствительностью.

1. Зонд для детекции полиморфизма V600 в гене BRAF, выбранного из V600K, V600R и V600D, причем зонд состоит из нуклеотидной последовательности, приведенной в SEQ ID NO: 8 или 9, где основание на 3'-конце является меченным флуоресцентным красителем.

2. Зонд по п. 1, где интенсивность флуоресценции флуоресцентно меченого олигонуклеотида при гибридизации с последовательностью-мишенью снижается или возрастает по сравнению с отсутствием гибридизации с последовательностью-мишенью.

3. Зонд по п. 1, где интенсивность флуоресценции флуоресцентно меченого олигонуклеотида при гибридизации с последовательностью-мишенью снижается по сравнению с отсутствием гибридизации с последовательностью-мишенью.

4. Зонд по п. 1, который представляет собой зонд для анализа графика плавления.

5. Способ определения полиморфизма в локусе V600 гена BRAF, выбранного из V600K, V600R и V600D, который включает:

(I) приведение зонда по п. 1 в контакт с одноцепочечной нуклеиновой кислотой, содержащейся в образце, для гибридизации указанного флуоресцентно меченого олигонуклеотида с одноцепочечной нуклеиновой кислотой, таким образом, получая гибрид;

(II) диссоциацию гибрида путем изменения температуры образца, содержащего гибрид, для измерения изменения флуоресцентного сигнала, вызванного диссоциацией гибрида;

(III) определение величины Tm, которая представляет собой температуру диссоциации гибрида исходя из изменения флуоресцентного сигнала; и

(IV) определение, исходя из величины Tm, наличия мутации в локусе V600 гена BRAF.

6. Способ по п. 5, где стадия (IV) включает определение двух мутаций в локусе V600 гена BRAF, и

где, когда зонд состоит из нуклеотидной последовательности, приведенной в SEQ ID NO: 8, указанными двумя мутациями являются V600K и V600D, а когда зонд состоит из нуклеотидной последовательности, приведенной в SEQ ID NO: 9, указанными двумя мутациями являются V600K и V600R.

7. Способ по п. 5, дополнительно включающий амплификацию нуклеиновой кислоты перед или одновременно с получением гибрида.

8. Реагент для определения полиморфизма в гене BRAF, выбранного из V600K, V600R и V600D, причем реагент содержит зонд по п. 1.

9. Набор для определения полиморфизма в гене BRAF, выбранного из V600K, V600R и V600D, причем набор содержит:

зонд по п. 1; и

праймер, способный осуществить амплификацию, используя в качестве матрицы область последовательности оснований, указанную в SEQ ID NO: 1, содержащий последовательность, с которой указанный зонд гибридизуется.

10. Набор по п. 9, где указанный праймер способен осуществить амплификацию, используя в качестве матрицы область длиной 50-1000 оснований, включающую основания 228-230 последовательности оснований, указанной в SEQ ID NO: 1.

11. Применение реагента по п. 8 или набора по п. 9 для детекции полиморфизма в гене BRAF, выбранного из V600K, V600R и V600D.



 

Похожие патенты:

Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования риска лимфогенного метастазирования при раке молочной железы.

Настоящее изобретение относится к биохимии, биотехнологии, молекулярной биологии, в частности к набору олигонуклеотидных праймеров для идентификации медицински значимых микромицетов методом секвенирования ДНК путём амплификации и последующего определения нуклеотидной последовательности фрагмента гена 28S рРНК.
Изобретение относится к области медицины и биотехнологии. Заявлен набор для оценки полиморфизма генов фолатного цикла методом ПЦР, включающий компоненты для выделения ДНК, видоспецифичные олигонуклеотидные пары праймеров для проведения одностадийной экспресс-идентификации нескольких однонуклеотидных замен в аллелях генов MTHFR, MTR, MTRR и компоненты для детекции результатов гель-электрофорезом.

Изобретение относится к области биотехнологии и медицины. Описан способ химической модификации антитромбинового аптамера и к получения нового антитромбинового аптамера, обладающего антикоагулянтными свойствами и пролонгированной антитромботической активностью.

Изобретение относится к области медицины, а именно к генетике и онкологии, и касается способа выявления генных мутаций BRAF в опухолях человека. Осуществляют амплификацию исследуемого фрагмента гена BRAF посредством асимметричной ПЦР в реальном времени с двумя зондами TaqMan: BRAF-15-sense – 5'-ROX-aggtgattttggtctagctacagtgaaatc-BHQ2 и BRAF-15-antisense – 5'-Су5-acccactccatcgagatttcactgta-BHQ2 и праймерами: прямой – 5'-gagatctactgttttcctttactt, обратный – 5'-ggccaaaaatttaatcagt.

Изобретение относится к биотехнологии. Описана композиция для стандартизации эффективности амплификации набора олигонуклеотидных праймеров для амплификации перестроенных последовательностей нуклеиновых кислот, кодирующих один или более рецепторов адаптивной иммунной системы в биологическом образце, полученном из лимфоидных клеток субъекта-млекопитающего, причем каждый рецептор адаптивной иммунной системы содержит вариабельный участок и соединительный участок, причем композиция содержит: множество синтетических матричных олигонуклеотидов, причем каждый синтетический матричный олигонуклеотид имеет известную концентрацию до амплификации и олигонуклеотидную последовательность общей формулы: , причем: (а) V представляет собой олигонуклеотидную последовательность, содержащую по меньшей мере 20 и не более 1000 последовательных нуклеотидов генной последовательности, кодирующей вариабельный (V) участок рецептора адаптивной иммунной системы или его комплемент, и каждый V содержит уникальную олигонуклеотидную последовательность V-участка; (b) J представляет собой олигонуклеотидную последовательность, содержащую по меньшей мере 15 и не более 600 последовательных нуклеотидов генной последовательности, кодирующей соединительный (J) участок рецептора адаптивной иммунной системы или его комплемент, и каждый J содержит уникальную олигонуклеотидную последовательность J-участка; (с) U1 либо отсутствует, либо содержит олигонуклеотидную последовательность, выбранную из (i) первой универсальной последовательности олигонуклеотида-адаптера и (ii) первой специфической для секвенирующей платформы олигонуклеотидной последовательности, которая связана с положением 5' и находится в нем относительно первой универсальной последовательности олигонуклеотида-адаптера; (d) U2 либо отсутствует, либо содержит олигонуклеотидную последовательность, выбранную из (i) второй универсальной последовательности олигонуклеотида-адаптера и (ii) второй специфической для секвенирующей платформы олигонуклеотидной последовательности, которая связана с положением 5' и находится в нем относительно второй универсальной последовательности олигонуклеотида-адаптера; (e) присутствует по меньшей мере один из B1, В2, В3 и В4 и каждый из B1, В2, В3 и В4 содержит олигонуклеотид В, содержащий последовательность штрихкода из 3-25 последовательных нуклеотидов, которая уникальным образом идентифицирует в качестве спаренной комбинации, (i) уникальную олигонуклеотидную последовательность V-участка из (а) и (ii) уникальную олигонуклеотидную последовательность J-участка из (b); (f) R либо отсутствует, либо содержит сайт распознавания рестрикционного фермента, который содержит олигонуклеотидную последовательность, отсутствующую в (а)-(е); и причем: (g) множество синтетических матричных олигонуклеотидов содержит количество по меньшей мере а или по меньшей мере b уникальных олигонуклеотидных последовательностей в зависимости от того, какое значение больше, причем а представляет собой количество уникальных сегментов гена, кодирующего V-участок рецептора адаптивной иммунной системы у субъекта, а b представляет собой количество уникальных сегментов гена, кодирующего J-участок рецептора адаптивной иммунной системы у субъекта, и композиция содержит по меньшей мере один синтетический матричный олигонуклеотид для каждой уникальной олигонуклеотидной последовательности V-участка и по меньшей мере один синтетический матричный олигонуклеотид для каждой уникальной олигонуклеотидной последовательности J-участка.

Предложенная группа изобретений относится к области медицины, в частности к неврологии и молекулярной биологии. Предложены способ и набор реагентов для выявления генетического полиморфизма в полиморфных точках rs9652490 LINGO1 (A>G), rs11856808 LINGO1 (C>Т), rs10968280 LINGO2 (А>Т), rs7033345 LINGO2 (C>Т), rs1412229 LINGO2 (А>Т), rs10812774 LINGO2 (C>Т) и rs3794087 SLC1A2 (А>С), определяющих генетическую ассоциацию с эссенциальным тремором.

Изобретение относится к области биохимии. Описана группа изобретений, включающая композицию для реакции обратной транскрипции с горячим стартом, способ подготовки вышеуказанной композиции, композицию для ПЦР с обратной транскрипцией и горячим стартом, способ подготовки вышеуказанной композиции, набор для реакции обратной транскрипции с горячим стартом, который включает в себя композицию для реакции обратной транскрипции с горячим стартом и реакционную пробирку, набор для ПЦР с обратной транскрипцией и горячим стартом, способ обратной транскрипции РНК-матрицы, способ амплификации нуклеиновой кислоты, композицию ПЦР с обратной транскрипцией для диагностики злокачественного новообразования.

Изобретение относится к области биохимии, в частности к способу определения зиготности гена fad-3c в растении канолы. Также раскрыт набор для осуществления указанного способа.

Изобретение относится к области биохимии. Описана группа изобретений, включающая набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метелирования сайтов RCGY в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР и способ идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов RCGY в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР.

Группа изобретений относится к биотехнологии и медицине. Предложены способ определения устойчивости микобактерий туберкулеза к противотуберкулезным препаратам второго ряда - фторхинолонам, аминогликозидам и капреомицину, наборы зондов детекции и праймеров амплификации и применение способа для подтверждения клинического диагноза туберкулеза с широкой лекарственной устойчивостью. Способ включает одновременную детекцию мутаций в ДНК микобактерий туберкулеза биологического образца, приводящих к устойчивости микроорганизмов к противотуберкулезным препаратам второго ряда в участках гена gyrA (кодоны 89, 90, 91, 94), гена gyrB (кодоны 538, 539, 540), гена rrs (позиции 1401, 514, 517) и промоторной области eis (позиции -10, -12, -37), посредством МПЦР в режиме реального времени с использованием праймеров для амплификации и зондов детекции, комплементарных указанным участкам генов. Способ обеспечивает одновременное и быстрое определение устойчивости микобактерий туберкулеза к препаратам второго ряда и может быть использован в диагностике туберкулеза с широкой лекарственной устойчивостью. 4 н. и 7 з.п. ф-лы, 5 табл., 3 пр.

Настоящее изобретение относится к области биотехнологии. Предложен суспензионный микрочип для мультиплексного выявления патогенов, передающихся клещами, содержащий набор праймеров для выявления Francisella tularensis, Rickettsia австралийской лихорадки Q, Borrelia burgdorferi, Bartonella, вируса энцефалита, вируса синьцзянской геморрагической лихорадки, Rickettsiae группы пятнистой лихорадки, бабезиоза и эрлихиоза. Также рассмотрены способы мультиплексного выявления патогенов, передающихся клещами, с применением суспензионного микрочипа. Данное изобретение может быть использовано для обнаружения основных патогенов, передающихся клещами, с целью профилактики заболеваний. 3 н. и 5 з.п. ф-лы, 2 ил., 4 табл.

Изобретение относится к области диагностической медицины. Образец цельной крови, собранный в антисвертывающий раствор, центрифугируют. Отбирают плазму. Из плазмы выделяют внДНК, которые модифицируют при помощи бисульфита натрия. Проводят МС-ПЦР с использованием специально подобранных праймеров и зондов для контрольного гена FDPS и аберрантно-метилированных маркерных генов RARbeta2, RASSF1A и TCF21. Далее проводят сравнительный анализ результатов ПЦР с учетом полученного Ct для выявляемых генов. Если значение Ct≤35,1 для гена FDPS и Ct≤41 для генов RARbeta2 и/или RASSF1A и/или Ct≤42,5 для гена TCF 21, то делают заключение о наличии рака легкого у пациента. Технический результат заключается в упрощении известного способа, повышении его чувствительности и специфичности. 2 з.п. ф-лы, 5 табл., 1 ил., 3 пр.

Изобретение относится к области медицины и предназначено для выявления патогенных мутаций митохондриальной ДНК. Проводят реакцию просеквенирования с системой, состоящей из прямого праймера, обратного праймера, меченного биотином, и секвенирующего праймера. Всего разработаны четыре системы праймеров для четырех типов мутаций мтДНК m.11778G>A, m.8993T>G, m.3243A>G, m.8344A>G, ассоциированных с наследственными митохондриальными заболеваниями, представленные в виде лиофилизированных веществ. Изобретение обеспечивает молекулярно-генетическую детекцию патогенных мутаций митохондриальной ДНК, ассоциированных с наследственными митохондриальными патологиями, и определение уровня гетероплазмии по данным мутациям. 1 з. п. ф-лы, 2 ил., 1 табл.

Изобретение относится к молекулярной генетике. Описан способ определения полиморфизма генов, ассоциированных с летальным рецессивным генетическим дефектом крупного рогатого скота. Конкретно гена аполипротеина В (АРОВ), ассоциированного с гаплотипом HCD. Определяют полиморфизм гена АРОВ, ассоциированного с гаплотипом HCD, с помощью специфичного однопробирочного метода полимеразной цепной реакции. При этом продукты амплификации аллелей А и N различаются по длине - фрагмент длиной 215 п.о. соответствует аллелю А, фрагмент длиной 327 п.о. соответствует аллелю N, а идентификация генотипов животных осуществляется по результатам электрофореза продуктов ПЦР в агарозном геле. Способ может быть использован в генетике сельскохозяйственных животных для выявления полиморфизма в гене АРОВ крупного рогатого скота, ассоциированного с гаплотипом фертильности HCD, с целью последующего использования полученных результатов в разведении и селекции крупного рогатого скота. 1 ил., 1 пр.

Изобретение относится к сельскохозяйственной области биотехнологии и животноводству и касается способа оценки плодовитости свиней пород ландрас и крупная белая. Способ включает выделение ДНК, амплификацию фрагмента гена LIF с использованием праймеров 5'-ATGTGGATGTGGCCTACGG-3' и 5'GGGAACAAGGTGGTGATGG-3', рестрикцию амплифицированного фрагмента гена LIF эндонуклеазой рестрикции DraIII, определение генотипов и отбор животных с генотипом AA/LIF, причем один фрагмент размером 407 п. н. соответствует генотипу АА, два фрагмента размером 266- и 144 н.п. - генотипу ВВ, три фрагмента 407-, 266- и 144 н.п. - генотипу АВ. Животные с генотипом AA/LIF обладают высокими показателями плодовитости. Изобретение позволяет эффективнее проводить оценку плодовитости свиноматок пород ландрас и крупная белая и отбирать свиней, генетически предрасположенных к более высоким показателям плодовитости. 2 ил., 2 табл., 2 пр.
Наверх