Мышиная гибридома amacr, клон g8 - продуцент моноклонального антитела, обладающего специфичностью к альфа-метилацил-коэнзим a рацемазе (amacr) человека



Мышиная гибридома amacr, клон g8 - продуцент моноклонального антитела, обладающего специфичностью к альфа-метилацил-коэнзим a рацемазе (amacr) человека
Мышиная гибридома amacr, клон g8 - продуцент моноклонального антитела, обладающего специфичностью к альфа-метилацил-коэнзим a рацемазе (amacr) человека

 


Владельцы патента RU 2636042:

Общество с ограниченной ответственностью "ПРАЙМБИОМЕД" (RU)

Изобретение относится к области биохимии, в частности к мышиной гибридоме AMACR с регистрационным номером ВКПМ H-166, которая является продуцентом моноклонального антитела, выявляющего цитоплазматический белок человека альфа-метилацил-коэнзим А рацемазу AMACR в клетках аденокарциномы простаты и в клетках других органов, содержащих данный антиген. Изобретение позволяет эффективно получать антитела, специфически выявляющие альфа-метилацил-коэнзимА рацемазу человека (AMACR) методами иммуноцитохимии, иммуногистохимии, иммуноблотирования и иммунофлуоресценции. 4 ил., 3 пр.

 

Изобретение относится к биотехнологии, биологии и медицине и предназначено для выявления цитоплазматического белка человека альфа-метилацил-коэнзим А рацемазы AMACR, также известного как P504S, в неопластических клетках аденокарциномы простаты, ткани нормальной печени, клеточных линиях аденокарциномы простаты иммуноцитохимическим, иммуногистохимическим и иммунофлуоресцентным методами, а также методом иммуноблоттинга для научно-исследовательских и клинико-лабораторных целей.

На сегодняшний день антитела являются мощным инструментом для изучения фундаментальных вопросов, направленных на выяснение функций белков человека в норме и при патологиях.

Как известно, иммуноцитохимические методы анализа, с использованием антител к известным белкам-маркерам биоптата опухоли позволяют классифицировать тип новообразований и оценить степень злокачественности (М.А. Пальцев, Н.М. Аничков. Патологическая анатомия. - М.: Медицина, 2001). Иммуногистохимическая окраска моноклональными антителами высокоспецифичных клеточных белков в сочетании с иммунопероксидазным методом позволяет не только оценивать опухоли низкой степени дифференцировки, опухоли неизвестного происхождения, более точно различать опухоли различного тканевого происхождения (Клиническая онкология: учебное пособие / под ред. П.Г. Брюсова, П.Н. Зубаревой. - СПб.: СпецЛит, 2012. - 455 с.: ил.), но и позволяет выбрать соответствующие методы лечения. Антитела к белкам, служащим специфическими онкомаркерами клеток, повсеместно применяются для клинической оценки прогноза опухолевой прогрессии (Lea P., Ling М. "New molecular assays for cancer diagnosis and targeted therapy". Curr. Opin. Mol. Ther. 2008, 10: 251-259).

AMACR (альфа-метилацил-КоА-рацемаза) рассматривается как онкомаркер с 2000 г., когда было выявлено повышение экспрессии данного гена в клетках аденокарциномы простаты при помощи ДНК-микроматриц по сравнению с нормальными эпителиальными клетками простаты и доброкачественной гиперплазией простаты (Xu J., Stolk J.A., Zhang X., Silva S.J., Houghton R.L., Matsumura M., Vedvick T.S., Leslie K.В., Badaro R., Reed S.G. Identification of differentially expressed genes in human prostate cancer using subtraction and microarray. Cancer Res., 60: 1677-1682, 2000; Luo J., Duggan D.J., Chen Y., Sauvageot J., Ewing С.M., Bittner M.L., Trent J.M., Isaacs W.B. Human prostate cancer and benign prostatic hyperplasia: molecular dissection by gene expression profiling. Cancer Res., 61:4683-4688, 2001).

Повышенная экспрессия AMACR в аденокарциноме простаты была подтверждена и иммуногистохимическими методами (Jiang Z., Fanger G.R., Woda В.A. et al. Expression of alpha-methylacyl-CoA racemase (P504s) in various malignant neoplasms and normal tissues: a study of 761cases. Hum. Pathol. 2003; 34(8); 792-6). Большинство опухолевых клеток аденокарциномы простаты и метастазов простаты во многих случаях имели интенсивное положительное окрашивание AMACR. Положительно, но менее интенсивно AMACR выявлялся в клетках интраэпителиальной гиперплазии простаты высокой степени (HGPIN). В нормальных эпителиальных клетках простаты и доброкачественной гиперплазии простаты окрашивание AMACR было отрицательно или слабоположительно (Jun Luo, Shan Zha, Wesley R. Gage, Thomas A. Dunn, Jessica L. Hicks, Christina J. Bennett, Charles M. Ewing, Elizabeth A. Platz et. al. alpha-Methylacyl-CoA Racemase: A New Molecular Marker for Prostate Cancer. CANCER RESEARCH 62, 2220-2226, April 15, 2002).

Функционально рацемаза относится к ферментам, катализирующим переход ветвящихся жирных кислот из R в S-стереоизомеры, что, в свою очередь, усиливает связанные со свободными радикалами процессы, вызывающие повреждение ДНК клетки. Скорее всего это объясняет повышенный риск развития рака предстательной железы, особенно при высоком уровне поступления разветвленных жирных кислот с пищей (например, с молочными продуктами или говядиной) (Evans A.J. Alpha-methylacyl СоА racemase (P504S): overview and potential uses in diagnostic pathology as applied to prostate needle biopsies // J. Clin. Pathol. 2003. Vol. 56. P. 892-897). Выявление AMACR в физиологических жидкостях организма имеет существенные ограничения из-за его невысокой специфичности, так как данный маркер экспрессируется злокачественными новообразованиями и при других локализациях (например, молочной железы), а также некоторыми нормальными тканями (печень, почки) (Witkiewicz AK. Alpha-methylacyl-CoA racemase protein expression is associated with the degree of differentiation in breast cancer using quantitative image analysis. Cancer Epidemiol Biomarkers Prev. 2005; 14:1418-1423.; Jiang Z., Fanger G.R., Woda B.A. et al. Expression of alpha-methylacyl-CoA racemase (P504s) in various malignant neoplasms and normal tissues: a study of 761cases. Hum. Pathol. 2003; 34(8); 792-6). В то же время AMACR, как маркер, высокоэффективен при иммуногистохимическом исследовании и позволяет дифференцировать опухолевые клетки от других патологических процессов, а также более точно определить стадию заболевания, в том числе и по биопсийному материалу. (Nassar A., Amin М.В., Sexton D.G., Cohen С.Utility of alpha-methylacyl coen-zyme A racemase (p504s antibody) as a diagnostic immunohistochemical marker for cancer // Appl Immunohistochem Mol Morphol. 2005. Vol. 13. №3. P. 252-255., Rubin M.A., Bismar T.A., Andren O., Mucci L., Kim R., Shen R., Ghosh D., Wei J.T., Chinnaiyan A.M., Adami H.O., Kantoff P.W., Johansson J.E. Decreased alpha-methylacyl CoA racemase expression in localized prostate cancer is associated with an increased rate of biochemical recurrence and cancer-specific death // Cancer Epidemiol Biomarkers Prev. 2005. Vol. 14. №6. P. 1424-1432.). Этот маркер считается позитивным в 80-100% случаев малых очагов рака. Также белок AMACR оказался высокочувствительным и высокоспецифичным маркером не только клеток аденокарциномы, но и предшествующих ей изменений - простатической интраэпителиальной неоплазии (PIN) высокой степени. У человека AMACR локализован в двух клеточных компартментах: в пероксисомах (активность выше) и в митохондриях. (Ferdinandusse S., Denis S., Ijlst L., Dacremont G., Waterham H.R., Wanders R.J. Subcellular localization and physiological role of α-methylacyl-CoA racemase. J. Lipid Res., 41: 1890-1896, 2000). Поэтому этот маркер можно использовать в комбинации с другими иммуногистохимическими маркерами. Например, использование совместно с маркерами базальных клеток эпителия простаты (34βЕ12, р6З) позволит улучшить морфологическую диагностику рака простаты, особенно по материалам игольных биопсий, являющихся в настоящее время основным средством выявления этой патологии (Boran С, et al. Reliability of the 34betaE12, keratin 5/6, p63, bcl-2, and AMACR in the diagnosis of prostate carcinoma. Urologic oncology. 2011; 29(6):614-23). В частности, такой комбинированный подход дает возможность идентифицировать онкологическую сущность таких неопределенных изменений, как атипическая мелкоацинарная пролиферация, и дифференцировать резидуальные клетки аденокарциномы от атипизма клеток доброкачественных желез, обусловленного облучением предстательной железы для лечения рака. Антитела к белку AMACR также широко используются и для решения многих фундаментальных проблем, связанных с выяснением механизмов возникновения и прогрессии рака простаты (Evans AJ. Alpha-methylacyl СоА racemase (P504S): overview and potential uses in diagnostic pathology as applied to prostate needle biopsies. J Clin Pathol. 2003; 56:892-897).

Для выявления белка AMACR у человека на сегодняшний день существует несколько доступных коммерческих как поликлональных, так и моноклональных антител. Известные мышиные гибридомы, продуцирующие моноклональные антитела к цитоплазматическому антигену эпителиальных клеток простаты человека AMACR, были получены при иммунизации мышей полноразмерным рекомбинантным белком AMACR человека (коммерчески доступные клоны 13Н4, 1D8, OTI2A11, 2Н9В5, 5F10, 2А10); различными рекомбинантными полипептидными участками белка AMACR человека (коммерчески доступные клоны 2A10F3).

К недостаткам описанных клонов относятся дороговизна моноклональных антител, продуцируемых данными гибридомами, ввиду их зарубежного происхождения, а также отсутствие для некоторых из них данных о тестировании в реакциях иммуногистохимии, иммунофлуоресценции, использующихся в ежедневной клинико-диагностической практике, а также иммуноблоттинге.

Задачей изобретения является расширение ассортимента моноклональных антител, обладающих специфичностью к белку AMACR человека, использующихся для иммунодиагностики и прогностической оценки течения рака простаты у человека.

Поставленная задача решается за счет мышиной гибридомы AMACR, клон G8 - продуцента моноклонального антитела, выявляющего альфа-метилацил-коэнзим А рацемазу AMACR методами иммуноцитохимии, иммуногистохимии, иммунофлуоресценции и иммуноблоттинга, полученной путем иммунизации мышей линии Balb/c синтетическим пептидом, и слиянием сенсибилизированных лимфоцитов иммунизированных мышей с клетками мышиной миеломы линии sp2/0 с помощью полиэтиленгликоля с молекулярной массой 4000.

Продуцируемые гибридомой G8 моноклональные антитела к белку AMACR человека обладают селективной способностью связывать белок AMACR человека на иммуноблотах (Фиг. 4), на клеточном (Фиг. 2, Фиг. 3) и тканевом уровнях (на парафиновых срезах) (Фиг. 1), и расширяют существующий доступный ассортимент моноклональных антител к белку AMACR. Также следует отметить, что каждая вновь полученная гибридома уникальна. Моноклональные антитела, продуцируемые разными гибридомами, различаются по своей первичной структуре, по специфичности к различным антигенным детерминантам, аффинности и другим свойствам. Поэтому получение как можно большего количества моноклональных антител к белку AMACR человека важно с научной и практической точки зрения.

Технический результат изобретения заключается в получении линии гибридных культивируемых клеток мыши G8, продуцирующей доступные для отечественных клинико-диагностических лабораторий моноклональные антитела к цитоплазматическому антигену AMACR человека для иммуноцитохимии, иммуногистохимии, иммуноблотирования и иммунофлуоресценции, позволяющие использоваться для диагностики рака простаты.

Мышиную гибридому AMACR G8 получали следующим образом:

Пептид конъюгировали с рекомбинантным шаперонным белком hsp70 из M. tuberculosis, используя глютаровый альдегид. Конъюгат диализовали против фосфатно-солевого буфера рН7,2 (PBS). Далее проводили иммунизацию мышей линии Balb/c, самок с массой тела 16-18 граммов. Раствор конъюгата AMACR-hsp70 в PBS эмульгировали с равными объемами полного адъюванта Фройнда до получения устойчивой эмульсии и вводили в подушечки задних лап мышей из расчета 50 мкг конъюгата на мышь. Иммунизацию повторяли теми же дозами антигена, используя неполный адъювант Фройнда.

Сыворотки мышей тестировали при помощи непрямого иммуноферментного анализа по следующей схеме: пептид сорбировали в PBS в концентрации 5 мкг/мл в течение 12 ч. Сыворотки титровали в PBS-AT (PBS-0,2% альбумин-0,05% Tween20), начиная с разведения 1:500 с шагом 2. В качестве контроля брали сыворотку неиммунной мыши.

Иммунные лимфоциты получали из подколенных лимфоузлов мышей. Гибридизовали с клетками мышиной миеломы линии sp2/0 по стандартной методике с использованием ПЭГ 4000. Клетки высевали в 96-луночные культуральные планшеты в полной ростовой среде с HAT. Для приготовления среды брали сухую среду DMEM (HyClone), разводили в деионизованной воде в концентрациях, рекомендованных производителем, фильтровали через бактериальный фильтр 0,22 мкм. Добавляли телячью сыворотку до концентрации 4%, глутамин, гентамицин, пируват натрия, HAT. На 4-5 день наблюдали рост гибридомных клонов. Супернатанты гибридом тестировали на 7-ой день после гибридизации по схеме, описанной для сывороток. Супернатанты разводили 1:1 в PBS-AT.

Позитивные клоны были клонированы 2-4 раза методом предельных разведений до получения стабильных продуцентов антител. Были определены субклассы антител иммуноферментным анализом при помощи коммерческих наборов. Клетки наращивали в полной среде и внутрибрюшинно вводили мышам линии Balb/c, предварительно праймированных минеральным маслом. Рост асцитных опухолей наблюдали на 8-12 дни после ввода клеток. Асцитные жидкости тестировали по той же схеме, что и для сывороток.

Антитела из асцитов выделяли при помощи метода преципитации 50%-ым сульфатом аммония. Диализовали против PBS. Концентрации антител измеряли спектрофотометрическим методом при длине волны 280 нм. Выделенные антитела тестировали в ИФА по вышеописанной схеме. А затем отобранные по ИФА антитела тестировали методами иммуногистохимии на срезах аденокарциномы простаты и нормальной печени. В результате был отобран клон G8, секретирующий моноклональное антитело, выявляющее белок AMACR в неопластических клетках аденокарциномы простаты (Фиг. 1). Дополнительно проводили тестирование полученного клона G8 антитела к AMACR методами непрямой иммунофлуоресценции (Фиг. 2) и иммуноцитохимии на клетках человека РС3 (Фиг. 3), иммуноблоттинга на лизатах клеточной линии HEK293T, экспрессирующей рекомбинантный AMACR (Фиг. 4).

Мышиная гибридома AMACR, клон G8 принята на депонирование по форме «Национальное патентное депонирование» 14 января 2016 года Всероссийской коллекцией промышленных микроорганизмов ФГУПГосНИИГенетика с коллекционным номером ВКПМ Н-166.

Мышиная гибридома AMACR, клон G8 - продуцент моноклонального антитела AMACR - имеет следующие характеристики:

Морфологические признаки: Культура имеет вид суспензии, где клетки собраны в конгломераты и слабо прикрепляются к субстрату.

Условия рутинного культивирования клеток гибридомы AMACR, клон G8: Среда для культивирования - ДМЕМ («ПанЭко», Россия), 10% эмбриональной телячьей сыворотки FetalClone 1 («HyClone», США), 2 мМ L-глутамина, 80 мкл тилозина (50 мг/мл), 2,5 мл гентамицина (50 мг/мл), 100 мМ пируват натрия. Условия культивирования: 37°С, абсолютная влажность и 5% СО2 в атмосфере. Частота пассирования - каждые 3-4 суток, кратность рассева 1:5-1:10.

Способ криоконсервирования клеток гибридомы AMACR, клон G8. Криозащитная среда: 70% сыворотки FetalClone 1 («HyClone», США), 20% DMEM («ПанЭко», Россия), 10% ДМСО («ПанЭко», Россия). Криопробирки с суспензией клеток помещают на сутки в холодильник на -80°С, затем переносят в жидкий азот для длительного хранения. Жизнеспособность клеток после размораживания 80%. После размораживания клетки культивируют при плотности 0.2-0.3⋅106 кл/мл.

Бактерии, грибы, дрожжи и микоплазма в культуре не обнаружены.

Изотип моноклонального антитела AMACR, клон G8: моноклональное антитело, секретируемое гибридомой G8, относится к иммуноглобулинам класса IgG2a.

Специфичность моноклонального антитела AMACR, клон G8. Моноклональное антитело выявляет белок AMACR в неопластических тканях аденокарциномы простаты человека (Фиг. 1), в ряде клеточных линий разного тканевого происхождения, например, в линии РС3 (карцинома предстательной железы) (Фиг. 2, 3). Антитело G8 также узнает рекомбинантный AMACR в суммарных клеточных лизатах линии HEK293T-AMACR на иммуноблотах (Фиг. 4).

Оптимальные титры антител AMACR, клон G8, определяемые в асцитической жидкости методом иммуногистохимии - 1:2000, методом непрямой иммунофлуоресценции - 1:200, методом иммуноблотов - 1:20000.

Продуцируемое гибридомой G8 моноклональное антитело рекомендуется для специфического выявления антигена AMACR в цитоплазме неопластических клеток аденокарциномы простаты человека методами иммуногистохимии, иммуноцитохимии, иммунофлуоресценции, иммуноблоттинга.

Изобретение иллюстрируют следующие фотографии:

Фиг. 1. Специфичность антитела AMACR, клон G8, продуцируемого гибридомой G8, к белку AMACR в неопластических клетках аденокарциномы простаты, выявляемая методом иммуногистохимии. Для детекции связавшихся с антигеном антител, были использованы вторичные антитела к иммуноглобулинам мыши, конъюгированные с полимерной пероксидазой хрена (ПраймБиоМед, Россия) и субстрат ДАБ, как описано в Примере 1. Специфическая гранулярная окраска цитоплазмы клеток на парафиновом срезе ткани, фиксированном формалином, свидетельствует о наличии опухолевых клеток, экспрессирующих AMACR.

Фиг. 2. Специфичность антитела, продуцируемого гибридомой G8, к белку AMACR в клетках человека линии РС3, выявляемая методом иммунофлуоресценции. Стрелками обозначен окрашенный антителом G8 AMACR, располагающийся в пероксисомах и митохондриях эпителиальных клеток линии РС3. Для выявления связавшихся с антигеном антител использовались вторичные антитела к иммуноглобулинам мыши, конъюгированные с флуорохромом Alexa Fluor 488 (Molecular Probes, США), как описано в Примере 2.

Фиг. 3. Специфичность антитела, продуцируемого гибридомой AMACR, клон G8, к белку AMACR в клетках человека линии РС3, выявляемая методом иммуноцитохимии. Темные точки представляют собой окрашенный антителом антиген AMACR, располагающийся в пероксисомах и митохондриях клеток линии РС3. Для выявления связавшихся с антигеном антител использовались вторичные антитела к иммуноглобулинам мыши, конъюгированные с полимерной пероксидазой хрена (ПраймБиоМед, Россия) и субстрат ДАБ как описано в Примере 2.

Фиг. 4. Специфичность антитела, продуцируемого гибридомой AMACR, клон G8, к белку AMACR на лизатах линии HEK293T, экспрессирующей рекомбинантный AMACR, выявляется на иммуноблотах. Связывание белка AMACR антителом G8 после переноса белков на мембрану. Клеточные лизаты приготовлены, а мембрана проявлена, как описано в Примере 3. Электрофоретическая подвижность белка соответствует расчетной.

Изобретение иллюстрируют следующие примеры:

Пример 1. Приготовление срезов для иммуногистохимического выявления белка AMACR.

Иммуногистохимическое исследование проводят на операционном материале, фиксированном 10%-ным нейтральным формалином, забуференным фосфатным буфером, в течение 24 часов. После гистологической проводки материал заливают в парафин и затем готовят срезы толщиной 2-4 мкм. Срезы монтируют на специальные высокоадгезивные стекла (SuperFrost Plus, ApexLab) и высушивают в течение 18 часов при температуре 37°С.

Парафин далее удаляют со срезов в трех сменах ксилола, по 10 мин в каждой смене. Проводят срезы через спирты с объемной долей изопропанола 100% (абс), 100% (абс), 70%, 50% по 5 мин в каждом и промывают в дистиллированной воде. Блокировка эндогенной пероксидазы проводится в 3% перекиси водорода 10 минут. Срезы инкубируют с антителами AMACR, клон G8, разведенными в PBST буфере (ПраймБиоМед, Россия) а затем с антителами к иммуноглобулинам мыши, конъюгированными с полимерной пероксидазой хрена (ПраймБиоМед, Россия). Окрашивание проявляется при добавлении субстрата ДАБ хромогена на 5-10 минут (ПраймБиоМед, Россия). Результат представлен на Фиг. 1.

Пример 2. Способы фиксации клеток для выявления белка AMACR в реакции непрямой иммунофлуоресценции и иммуноцитохимии.

Культуру РС3 выращивают на покровных стеклах до достижения 70% конфлуентности. Клетки фиксируют, помещая в 3,7% параформальдегид на 15 мин, с последующей промывкой в PBS (ПанЭко, Россия) на 10 мин. После фиксации клетки инкубируют с антителом AMACR, клон G8 1 ч при комнатной температуре, а затем с козьими антителами к иммуноглобулинам мыши, конъюгированными с флуорохромом Cy3 (ПраймБиоМед, Россия), или полимерной пероксидазой хрена (ПраймБиоМед, Россия) 30 или 15 мин, соответственно, при комнатной температуре. Для визуализации окрашивания добавляют субстрат ДАБ хромоген на 5-10 минут (ПраймБиоМед, Россия) Препараты заключают в среду для заключения на водной основе и изучают в микроскоп Olympus ВХ53 (Cheminst, Германия), сопряженный с 2 мп камерой Infinity 2 (Lumenera, США), используя объективы U PlanFL N ×40/ЧА 0.75 и U PlanFL N ×100/ЧА 1.30. Для иммунофлуоресценции используются фильтры, U-FUNA и U-FGNA (Olympus, Япония). Результаты представлены на Фиг. 2 и 3.

Пример 3. Способ получения суммарных клеточных лизатов и выявления рекомбинантного белка AMACR методом иммуноблоттинга.

Для получения клеточной линии HEK293T, экспрессирующей рекомбинантный AMACR, его кодирующая последовательность была заклонирована в вектор pcDNA3.1(-)MycHis с последующей транзиентной трансфекцией клеток HEK293T. Ген AMACR человека (нуклеотидная последовательность кДНК AMACR человека доступны в базе данных GeneBank по адресу http://www.ncbi.nlm.nih.gov/genbank/ с порядковым номером NM 014324.5) амплифицируют на матрице кДНК, полученной из мРНК клеток линии РС3 с использованием ген-специфических праймеров (AMACR F2006 NotI TCGAGCGGCCGCGCCATGGCACTGCAG, AMACR R2006 KpnI GCTTGGTACCGAGACTAGCTTTTAC, встроенные сайты эндонуклеаз рестрикции NotI/KpnI). Амплифицированные фрагменты ДНК очищают и клонируют в вектор pcDNA3.1(-)MycHis по сайтам, созданным эндонуклеазами рестрикции KpnI и NotI. В результате получают плазмиду, несущую ген белка AMACR человека. Плазмиду тестируют на наличие нуклеотидных замен методом автоматического секвенирования ДНК. Компетентные клетки E.coli химически трансформируют полученной плазмидой pcDNA3.1(-)MycHis-AMACR, высевают на чашки с LB-агаром, содержащим 100 мкг/мл ампициллина, и инкубируют при 37°С в течение 16 ч. Далее в 50 мл среды LB переносят единичную колонию и наращивают при 37°С в течение 16 ч при постоянном перемешивании. Далее из ночной культуры выделяют плазмиду с помощью коммерческого набора реактивов (Promega) согласно протоколу производителя. Далее 2.5 мкг плазмиды используют для транзиентной трансфекции клеток с помощью реактива Lipofectamine 2000 (Thermofisher Scientific) согласно протоколу производителя. По истечении 48 часов 5×105 клеток лизируют на льду в буфере, содержащем 50 тМ Трис-(гидроксиметил)-аминометана (рН 7.5), 150 mM NaCl, 10% глицерина, 0.5% Тритона Х-100 и коктейль протеазных ингибиторов (Roche, США). Суммарную концентрацию белков в лизатах определяют по методу Бредфорд с помощью Protein Assay Kit (Bio-Rad, США), следуя рекомендациям производителя.

Перед электрофоретическим разделением к приготовленным лизатам добавляют 5×-ный буфер Лэммли, содержащий 250 мМ Трис-(гидроксиметил)-аминометана (рН 6.8), 50% глицерина, 10% додецилсульфата натрия (ДСН), 500 мМ бета-меркаптоэтанола, 0.5% бромфенолового синего. Образцы подвергают термической обработке при 95°С 5 мин. В каждую лунку 10% полиакриламидного геля с ДСН (ПААГ-ДСН) наносят лизаты, содержащие не менее 15 мкг суммарного белка. Электрофоретическое разделение белков в ПААГ-ДСН проводят 30 мин при 60 В и 60 мин при 160 В для дальнейшего разделения в электрофорезной камере. Далее гель инкубируют в буфере для проведения блоттинга, содержащем 50 мМ Трис-(гидроксиметил)-аминометана, 38 мМ глицина, 0.1% ДСН и 20% метанола. Перенос белков на нитроцеллюлозную мембрану (0.22 мкм, Millipore, США) проводят при постоянной силе тока 250 мА 60 мин. Мембрану инкубируют с антителами AMACR, клон G8 (разведение 1:20000 в 5% молоке), а затем с антителами к иммуноглобулинам мыши, конъюгированными с пероксидазой хрена (разведение 1:4000, Abeam, США). Сухое молоко (Bio-Rad, США) и антитела разводят в буфере TBST, содержащем 20 мМ Трис-(гидроксиметил)-аминометана (рН 7.6), 150 мМ NaCl, 0.05% Твина-20. Мембрану проявляют методом хемилюминесценции, используя набор ECL+Plus (Millipore, Великобритания) согласно инструкции производителя. Хемилюминесцентную реакцию регистрируют на приборе ChemiDoc MP (Bio-Rad, UK) с последующей обработкой с помощью программы ChemiDoc XRS+ imaging systems. Результаты представлены на Фиг. 4.

Мышиная гибридома AMACR, клон G8, коллекционный номер ВКПМ Н-166 - продуцент моноклонального антитела, выявляющего альфа-метилацил-коэнзим А рацемазу в неопластических клетках аденокарциномы простаты и в клетках других органов, содержащих данный антиген, методами иммуноцитохимии, иммуногистохимии, иммуноблотирования и иммунофлуоресценции, полученная путем иммунизации мышей линии Balb/c синтетическим пептидом С-концевого участка белка AMACR человека и слиянием сенсибилизированных лимфоцитов иммунизированных мышей с клетками мышиной миеломы линии sp2/0 с помощью 50%-ного раствора полиэтиленгликоля с молекулярной массой 4000.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к антителу, которое специфически связывается с белком CAPRIN-1. Также раскрыты моноклональное антитело, которое обладает иммунологической реактивностью по отношению к белку CAPRIN-1, антитела, которые специфически связываются с белком CAPRIN-1, лекарственное средство, содержащее указанные антитела, для лечения или профилактики CAPRIN-1 экспрессирующего рака.

Изобретение относится к области биохимии, в частности к лекарственному средству для лечения или профилактики CAPRIN-1 экспрессирующего рака. Также раскрыты антитела, обладающие иммунологической активностью по отношению к белку CAPRIN-1, лекарственное средство и лекарственная комбинация, содержащие указанные антитела, и моноклональное антитело, которое специфически связывается с белком CAPRIN-1.

Изобретение относится к области биохимии, в частности к лекарственному средству для лечения или профилактики CAPRIN-1 экспрессирующего рака. Также раскрыты антитела, обладающие иммунологической активностью по отношению к белку CAPRIN-1, лекарственное средство, содержащее указанные антитела, и моноклональное антитело, которое специфически связывается с белком CAPRIN-1.

Изобретение относится к биохимии. Описано моноклональное антитело, которое специфически связывается с липоарабиноманнаном кислотоустойчивых бацилл, в частности с липоарабиноманнаном туберкулезной бациллы.

Изобретение относится к области биохимии, в частности к антителу или его функциональному фрагменту, направленным против эпитопа стафилококка золотистого, а также к их применению для обнаружения стафилококка золотистого.

Изобретение относится к области медицины, генетической инженерии и биотехнологии. Предложен способ обеспечения безопухолевой тканезаместительной терапии на основе получаемых из взрослых соматических клеток индуцированных плюрипотентных стволовых клеток (иПСК), где последние генетически модифицируют при помощи искусственной хромосомы (ИХ), несущей бицистронную кассету с геном-самоубийцей и геном чувствительности к антибиотику под контролем регуляторного элемента, специфичного для плюрипотентных стволовых клеток, при этом модифицированные иПСК отбирают в присутствии соответствующего антибиотика, подтверждают отсутствие интеграции ИХ в геном иПСК, вводят в организм реципиента напрямую, без предварительной дифференцировки in vitro, через 1-14 дней реципиентам проводят 5-10-дневный курс терапии индуктором токсичности продукта гена-самоубийцы.

Изобретение относится к области биотехнологии и медицины. Предложен штамм гибридных культивируемых клеток животных mus musculus α-продуцент моноклональных антител, специфичных к гранулоцитарному колониестимулирующему фактору (GCSF) человека, депонированный в Специализированной коллекции клеточных культур Института цитологии РАН под номером РККК (П) 662 Д.

Изобретение относится к области биохимии, в частности к полипептиду, несущему эпитоп BNP(1-32) человека, для получения лигандов, направленных против BNP(1-32) человека или proBNP(1-108) человека, где указанный полипептид имеет формулу a 1 − R 1 − X 1 − F G R K M D R − X 2 − R 2 − a 2 .

Изобретение относится к медицине, в частности к онкологии и иммунологии, и касается лечения В-клеточной лимфомы. .

Изобретение относится к физико-химическим методам определения сшивок ДНК-белок под влиянием физико-химических агентов и может найти применение при поиске препаратов, избирательно действующих на генетический аппарат клетки.
Наверх