Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница



Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
Встроенная с образованием сообщения по текучей среде вращательная шариковая мельница
G01N1/38 - Исследование или анализ материалов путем определения их химических или физических свойств (разделение материалов вообще B01D,B01J,B03,B07; аппараты, полностью охватываемые каким-либо подклассом, см. в соответствующем подклассе, например B01L; измерение или испытание с помощью ферментов или микроорганизмов C12M,C12Q; исследование грунта основания на стройплощадке E02D 1/00;мониторинговые или диагностические устройства для оборудования для обработки выхлопных газов F01N 11/00; определение изменений влажности при компенсационных измерениях других переменных величин или для коррекции показаний приборов при изменении влажности, см. G01D или соответствующий подкласс, относящийся к измеряемой величине; испытание

Владельцы патента RU 2638854:

СТАТ-ДИАГНОСТИКА ЭНД ИННОВЭЙШН, С.Л. (ES)

Группа изобретений относится к автоматизированному молекулярному тестированию и методам иммуноанализа для клинического использования при лечении пациентов. Системы для гомогенизации и/или лизиса образца содержат одноразовую кассету или кожух, выполненную с возможностью присоединения к приспособлению для анализа и отсоединения от него. Одноразовая кассета содержит первую емкость; вторую емкость; одну или более стенок, образующих закрытую камеру, содержащую впускное отверстие и множество соединений по текучей среде; первую сеть для текучей среды; вторую сеть для текучей среды; вращательный элемент, расположенный в закрытой камере; привод. Причем по меньшей мере одна из указанных одной или более стенок закрытой камеры содержит поверхность с терморегулировкой. Первая сеть для текучей среды соединена по меньшей мере с одним из множества соединений по текучей среде и выполнена с возможностью введения по меньшей мере образца в камеру из первой емкости. Вторая сеть для текучей среды соединена по меньшей мере с одним из множества соединений по текучей среде и выполнена с возможностью извлечения по меньшей мере образца из камеры во вторую емкость. Привод соединен с вращательным элементом одноразовой кассеты и выполнен с возможностью вращения вращательного элемента вокруг оси, проходящей вдоль длины вращательного элемента. Способы лизирования или гомогенизации образца осуществляют следующим образом. Вводят по меньшей мере образец в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или более другими камерами. Вращают вращательный элемент, расположенный в закрытой камере, вдоль оси, проходящей вдоль длины вращательного элемента. Возбуждают множество шариков, расположенных в закрытой камере, посредством перемещения вращательного элемента и проводят лизирование или гомогенизацию образца в закрытой камере посредством перемещения вращательного элемента и множества шариков. Обеспечивается повышение эффективности процесса гомогенизации и/или лизиса исследуемого биологического образца. 6 н. и 53 з.п. ф-лы, 26 ил., 3 табл.

 

УРОВЕНЬ ТЕХНИКИ

Область техники

[0001] Варианты реализации настоящего изобретения относятся к шариковым мельницам.

Уровень техники

[0002] Ввиду сложности автоматизации молекулярного тестирования и методов иммуноанализа, существует недостаток изделий, которые обеспечивают соответствующую производительность для клинического использования в установках для тестирования на месте лечения пациента. Обычное молекулярное тестирование включает различные процессы, охватывающие правильную дозировку реагента, введение образца, гомогенизацию образца, лизис клеток для извлечения ДНК или РНК, этапы очистки и улучшение для их последующего обнаружения. Несмотря на то, что существуют центральные лабораторные роботизированные платформы, которые автоматизируют некоторые из этих процессов, для многих тестов необходимо малое оборотное время, а центральные лаборатории не могут выдавать результаты в необходимые временные сроки.

[0003] Гомогенизация и/или лизис биологического образца обычно представляет собой начальный этап в процессе тестирования, так что соответствующим образом очищенное анализируемое вещество или вещества могут быть получены для молекулярного тестирования. В общем, существует три основных подхода к лизису клеток: химический, ферментативный и физический. Данные процессы могут быть использованы по одному или в комбинации, один за другим или одиночными этапами, для достижения наиболее оптимального процесса. Использование химического и ферментативного процессов может вызывать проблемы, так как некоторые химикаты, используемые для разрыва клеточной стенки, могут изменить естественные свойства любого присутствующего фермента и вызвать проблемы в последующих процессах.

[0004] Физические способы разрыва клеток включают разрушение ультразвуком, нагрев (обычно между 90°C и 100°C), повторяемое замораживание и оттаивание, создание быстрых и обширных изменений давления и механические способы. Механические способы включают физический разрыв клеточной стенки посредством физических усилий, таких как большие сдвиговые усилия, измельчение и бомбардировка клетки малыми частицами, обычно состоящими из шариков. Механические способы разрушения имеют множество преимуществ. Они часто используют одноэтапный процесс, в целом очень быстрые, поддаются автоматизации и имеют возможность разрушать твердые образцы, такие как кость, там, где интересующее анализируемое вещество (вещества) не могут быть получены без механической гомогенизации.

Раскрытие изобретения

[0005] Обеспечены механические системы и способы шариковых мельниц, которые могут быть встроены в систему для тестирования на месте лечения пациента.

[0006] В одном из вариантов реализации, система для гомогенизации и/или лизиса образца включает одну или более стенок, образующих закрытую камеру, имеющую впускное отверстие и множество соединений по текучей среде. Первая сеть для текучей среды соединена по меньшей мере с одним из множества соединений по текучей среде и вторая сеть для текучей среды соединена по меньшей мере с одним из множества соединений по текучей среде. Система также содержит вращательный элемент в камере и привод, выполненный с возможностью вращения вращательного элемента. Первая сеть для текучей среды выполнена с возможностью введения по меньшей мере образца в камеру из по меньшей мере одной первой емкости. Вторая сеть для текучей выполнена с возможностью извлечения по меньшей мере образца из камеры по меньшей мере в одну вторую емкость. Вращательный элемент вращают посредством привода вокруг оси, проходящей вдоль длины вращательного элемента.

[0007] В одном из вариантов реализации, система для выполнения молекулярного тестирования содержит кожух с одной или более камерой для текучей среды и сетью для текучей среды, шариковую мельницу, расположенную в кожухе, и привод. Сеть с текучей средой соединяет по меньшей мере одну или более камеру для текучей среды с подвижной центральной камерой. Шариковая мельница также содержит одну или более стенку, образующую закрытую камеру с впускным отверстием и множество соединений по текучей среде, и вращательный элемент в закрытой камере. По мере часть из множества соединений по текучей среде соединены с сетью для текучей среды кожуха. Вращательный элемент вращают посредством привода вокруг оси, проходящей вдоль длины вращательного элемента.

[0008] Описан приведенный в качестве примера способ лизирования образца. Способ включает введение образца в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или большим количеством других камер. Способ также включает вращение вращательного элемента в закрытой камере вдоль оси, проходящей вдоль длины вращательного элемента. Способ также включает лизирование образца в закрытой камере посредством перемещения вращательного элемента.

[0009] Описан другой приведенный в качестве примера способ лизирования образца. Способ включает введение образца в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или большим количеством других камер. Способ также включает вращение вращательного элемента в закрытой камере вдоль оси, проходящей вдоль длины вращательного элемента. Способ также включает возбуждение множества шариков в закрытой камере посредством перемещения вращательного элемента. Способ также включает лизирование образца в закрытой камере посредством перемещения вращательного элемента и множества шариков.

[0010] Описан приведенный в качестве примера способ гомогенизации образца. Способ включает введение образца в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или большим количеством других камер. Способ также включает вращение вращательного элемента в закрытой камере вдоль оси, проходящей вдоль длины вращательного элемента. Способ также включает гомогенизацию образца в закрытой камере посредством перемещения вращательного элемента.

[0011] Описан другой приведенный в качестве примера способ гомогенизации образца. Способ включает введение образца в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или большим количеством других камер. Способ также включает вращение вращательного элемента в закрытой камере вдоль оси, проходящей вдоль длины вращательного элемента. Способ также включает возбуждение множества шариков в закрытой камере посредством перемещения вращательного элемента. Способ также включает гомогенизацию образца в закрытой камере посредством перемещения вращательного элемента и множества шариков.

Краткое описание чертежей/фигур

[0012] На прилагаемых чертежах, которые включены в настоящее описание и составляют часть материалов заявки, показаны варианты реализации настоящего изобретения и, вместе с описанием, также служат для объяснения принципов изобретения и для обеспечения выполнения и использования изобретения специалистом в уровне техники.

[0013] На фиг. 1 графически показана платформа кассеты для тестирования, в соответствии с одним из вариантов реализации.

[0014] На фиг. 2A-2B показана система шариковой мельницы, в соответствии с вариантами реализации.

[0015] На фиг. 3A-3B показаны другие виды системы шариковой мельницы, в соответствии с вариантами реализации.

[0016] На фиг. 4 показан разобранный вид системы шариковой мельницы, в соответствии с одним из вариантов реализации.

[0017] На фиг. 5 показан вид внутренней части системы шариковой мельницы, в соответствии с одним из вариантов реализации.

[0018] На фиг. 6A-6B показаны виды в разрезе системы шариковой мельницы, в соответствии с вариантами реализации.

[0019] На фиг. 7A-7B показаны виды вращательного элемента, в соответствии с вариантами реализации.

[0020] На фиг. 8-11 показаны схемы, иллюстрирующие способы, исполняемые системой шариковой мельницы, в соответствии с вариантами реализации.

[0021] На фиг. 12 показан график измеренной концентрации ДНК из спор сенной палочки.

[0022] На фиг. 13 показан график измеренной концентрации ДНК из вегетативных клеток сенной палочки.

[0023] На фиг. 14 показан график восстановленной ДНК из вегетативных клеток сенной палочки.

[0024] На фиг. 15 показан график измеренной концентрации ДНК и РНК из вегетативных клеток сенной палочки.

[0025] На фиг. 16 показан график восстановления РНК из вегетативных клеток сенной палочки.

[0026] На фиг. 17A-17C показаны профили биоанализатора рРНК из сенной палочки.

[0027] Варианты реализации настоящего изобретения будут описаны со ссылкой на прилагаемые чертежи.

Осуществление изобретения

[0028] Хотя рассмотрены конкретные конфигурации и конструкции, следует понимать, что это сделано только в целях иллюстрации. Специалисту в уровне техники будут очевидно, что могут быть использованы и другие конфигурации и конструкции без выхода за пределы сущности и объема настоящего изобретения. Специалисту в данной области техники будет понятно, что настоящее изобретение также может быть использовано во множестве других сфер применения.

[0029] Следует отметить, что в материалах заявки словосочетания "один вариант реализации", "вариант реализации", "примерный вариант реализации" и т.д. означают, что описанный вариант реализации может включать конкретный признак, конструкцию или характеристику, но каждый из вариантов реализации не обязательно включает данный конкретный признак, конструкцию или характеристику. Более того, такие фразы не обязательно относятся к одному и тому же варианту реализации. Кроме того, когда конкретный признак, конструкция или характеристика описаны в отношении варианта реализации, специалисту в уровне техники будет ясно, что данный признак, конструкция или характеристика могут быть применены в соответствии с другими вариантами реализации, хотя это явно не описано.

[0030] Описанные в настоящем описании варианты реализации относятся к системе шариковой мельницы для гомогенизации и/или лизирования образца. Образец может быть жидкостью, твердым материалом, полутвердым материалом или их комбинацией. В одном из вариантов реализации, система шариковой мельницы встроена в платформу кассеты для тестирования. Платформа кассеты для тестирования содержит сеть каналов для текучей среды, часть из которых может соединяться со встроенной шариковой мельницей. Каналы для текучей среды могут доставлять образец в камеру шариковой мельницы, извлекать образец из камеры шариковой мельницы и/или использоваться для нагнетания давления в камере шариковой мельницы.

[0031] Система шариковой мельницы выполнена с возможностью использования физического разрушения образцов посредством вращения, например вращательного элемента в камере шариковой мельницы. Физическому разрушению, в свою очередь, может способствовать присутствие шариков (например, инертных шариков, выполненных из стекла и/или других материалов). В одном из примеров процесс лизиса и/или гомогенизации также оптимизирован посредством использования буфера для лизиса в камере шариковой мельницы. В другом примере ферментативный лизис выполняют путем приложения тепла к образцу. В некоторых примерах нагрев образца может быть выполнен до измельчения образца шариками. В одном из вариантов реализации все необходимые реагенты и компоненты шариковой мельницы содержатся в платформе кассеты для тестирования.

[0032] В некоторых вариантах реализации и платформа кассеты для тестирования, и встроенная шариковая мельница выполнены таким образом, что их можно утилизировать после использования. После того как реагенты или образец размещены в кассете для тестирования, они больше не входят в контакт с внешней средой или с любой частью внешнего измерительного приспособления. Данная особенность важна для многих лабораторий и больниц для безопасного удаления изделий после их использования.

[0033] Сама камера шариковой мельницы выполнена с возможностью обработки широкого разнообразия образцов и разрушения широкого разнообразия типов клеток. Это, в частности, достигается доступностью различных платформ кассет для тестирования, которые являются особенными для каждой конкретной комбинации образца/типа клеток. В другом примере изменяемые условия, которые управляются приспособлением для анализа, такие как скорость и длительность вращения вращательного элемента, обеспечивают возможность обработки широкого разнообразия типов образцов.

[0034] Другие подробности относительно компонентов системы шариковой мельницы описаны в настоящем описании со ссылками на фигуры. Следует понимать, что изображения каждого из физических компонентов не является ограничением и специалист в данной области техники, имея настоящее описание, сможет понять пути перегруппировки или других изменений любого из компонентов без выхода из объема или сущности изобретения.

[0035] На фиг. 1 показан пример системы кассеты для тестирования, в которую может быть встроена шариковая мельница, в соответствии с одним из вариантов реализации. Хотя в настоящем описании будет сделана ссылка на конструкцию примера системы кассеты для тестирования, специалисту в данной области техники будет очевидно, что варианты реализации шариковой мельницы, описанные в настоящем описании, могут быть использованы с любым количеством типов и конфигураций системы для тестирования.

[0036] Система кассеты для тестирования содержит кожух 102 кассеты и передаточный модуль 104. Другие компоненты также могут быть включены в систему кассеты для тестирования, такие как анализирующий модуль или различные активные компоненты, такие как насосы или нагреватели. Передаточный модуль 104 содержит внутренний кожух 110, чехол 108 и крышку 106. Чехол 108 выполнен с возможностью посадки вокруг внутреннего кожуха 110 в соответствии с одним из вариантов реализации. Крышка 106 выполнена с возможностью уплотнения конца передаточного модуля 104 для предотвращения утечек. Передаточный модуль 104 выполнен с возможностью вставки в кожух 102 кассеты посредством кассетного отсека 120.

[0037] Кожух 102 кассеты содержит различные каналы, камеры и резервуары для текучей среды. Например, кожух 102 кассеты может содержать множество камер 116 для хранения, которые могут содержать различные буферные растворы или другие реагенты для использования во время анализа или протокола полимеразной цепной реакции. Камеры 116 для хранения могут быть предварительно наполнены различными жидкостями, так что конечному пользователю не нужно будет наполнять камеры 116 для хранения перед размещением системы кассеты для тестирования в приспособлении для анализа. Кожух 102 кассеты может также содержать одну или более обрабатывающих камер 124a-b, соединенных с каналами для текучей среды вдоль стороны кожуха 102 кассеты. Обрабатывающие камеры 124a-b могут быть использованы в различных случаях применения, связанных с обработкой и/или утилизацией. В одном из примеров камера 124a представляет собой камеру для отходов, а камера 124b представляет собой камеру, имеющие размеры для приема длины тампона на стержне, на котором имеется образец.

[0038] Образцы вводят в кожух 102 кассеты посредством прохода 114 для образца в соответствии с одним из вариантов реализации. Пользователь может разместить тампона на стержне полностью в проходе 114 для образца и соответствующей ему камере 124b, а затем уплотнить проход крышкой 112 прохода. В другом примере проход 114 для образца принимает твердые, полутвердые или жидкие образцы. В одном из вариантов реализации, кожух 102 кассеты содержит более чем одно впускное отверстие для ввода образцов.

[0039] Различные камеры и каналы вокруг кожуха 102 кассеты могут быть уплотнены посредством использования закрывающих приспособлений 118, 126, 127 и 128. Закрывающие приспособления могут представлять собой пленки, выполненные с возможностью уплотнения текучей среды внутри кожуха 102 кассеты. В другом примере, закрывающие приспособления могут представлять собой пластиковые панели. В одном из примеров одно или более из закрывающих приспособлений выполнены прозрачными. В дополнение, одно или более из закрывающих приспособлений могут быть выполнены с терморегулированием для нагрева частей кожуха 102.

[0040] Интегрированная система кассеты для тестирования позволяет пользователю разместить образец, например, в проходе 114 для образца, а затем разместить систему кассеты для тестирования в приспособлении для анализа. В вариантах реализации этапы реакции, которые необходимо выполнить, включая, например, очистку, лизирование, смешивание, связывание, маркирование и/или обнаружение, могут все быть выполнены в системе кассеты для тестирования посредством взаимодействия с приспособлением для анализа без необходимости вмешательства конечного пользователя. В дополнение, так как все жидкости остаются уплотненными в системе кассеты для тестирования, после того как тест окончен, система кассеты для тестирования может быть удалена из приспособления для анализа и утилизирована безопасным образом без загрязнения приспособления для анализа.

[0041] Система кассеты для тестирования может также содержать каналы для текучей среды, которые ведут во внутреннюю обрабатывающую камеру, имеющую отверстие 132. В одном из вариантов реализации, внутренняя обрабатывающая камера представляет собой камеру встроенной шариковой мельницы, расположенную в кожухе 102 кассеты. Хотя сама камера не видна на фиг. 1, различные другие компоненты системы показаны на разобранном виде. Например, система шариковой мельницы содержит обрабатывающую крышку 134, которая посажена на отверстие 132. Внутри самой камеры расположен вращательный элемент 136, в соответствии с одним из вариантов реализации. В одном из вариантов реализации, вращательный элемент 136 соединен с приводом (не показан) посредством уплотнения 138 и втулки 139. Уплотнение 138 и втулка 139 могут удерживаться на месте опорой 140. В одном из примеров уплотнение 138 представляет собой манжетное уплотнение. Могут быть использованы другие типы уплотняющих компонентов. Опора 140 также может быть посажена в конец внутренней обрабатывающей камеры и уплотнять ее от утечек. Каждый из компонентов системы шариковой мельницы будут описаны более подробно в настоящем описании.

[0042] На фиг. 2A и 2B показаны приведенные в качестве примера варианты реализации системы вращательной шариковой мельницы. В обоих вариантах реализации одинаковые признаки представлены под одинаковыми ссылочными номерами. Описание каждого варианта реализации приведено ниже для описания особенностей, которые могут присутствовать на системе шариковой мельницы или в ней, но не является ограничением в отношении расположения или пространственных свойств указанных особенностей.

[0043] На фиг. 2A и 2B показан вид в перспективе шариковой мельницы 201, которая может быть встроена в систему кассеты для тестирования, в соответствии с вариантами реализации. Вид снаружи шариковой мельницы 201, который показан на фиг. 2B, иллюстрирует обрабатывающее впускное отверстие 132 на верхней поверхности шариковой мельницы 201, в соответствии одним из вариантов реализации. В варианте реализации шариковой мельницы, показанном на фиг. 2A, обрабатывающее впускное отверстие находится сбоку шариковой мельницы 201 и обращено от страницы и, таким образом, не показано. Обрабатывающее впускное отверстие 132 выполнено с возможностью размещения любого типа образцов, включая жидкие, твердые, полутвердые или любую их комбинацию. Обрабатывающее впускное отверстие 132 ведет в закрытую камеру, в которой происходит процесс перемалывания шариками. В другом примере образцы, входящие в обрабатывающее впускное отверстие 132 ведут в первую камеру, а затем передаются из первой камеры во вторую камеру, где происходит процесс измельчения шариками.

[0044] На одной стороне шариковой мельницы 201 выполнены впускные отверстия для текучей среды для соединения с сетью для текучей среды. Вариант реализации шариковой мельницы, показанный на фиг. 2A, имеет три впускных отверстия 203a-c для текучей среды, а вариант реализации шариковой мельницы, показанный на фиг. 2B имеет два впускных отверстия 203a и 203b для текучей среды. Например, впускные отверстия 203a-c для текучей среды могут соединяться с любой из камер 116 для хранения кожуха 102 кассеты. В одном из вариантов реализации, впускные отверстия 203 для текучей среды ведут в камеру, где происходит измельчение шариками. В связи с этим, впускные отверстия 203a-c для текучей среды могут быть использованы для введения любой жидкости в камеру для измельчения шариками, извлечения любой жидкости из камеры для измельчения шариками или для приложения перепада давления в камере для измельчения шариками, или их комбинации. Следует понимать, что в камеру для измельчения шариками может вести любое число соединений по текучей среде. Кроме того, любое из множества соединений по текучей среде может вести в одну или более камер кожуха 102 кассеты. В одном из вариантов реализации, первая сеть для текучей среды соединена с впускными отверстиями для текучей среды и вводит по меньшей мере образец в камеру из первой емкости, а вторая сеть для текучей среды соединена с соединениями по текучей среде и используется для извлечения по меньшей мере образца из камеры во вторую емкость. В одном из вариантов реализации, сети для текучей среды, шариковая мельница и емкости образуют закрытую систему.

[0045] Снаружи шариковой мельницы 201 приводная система 202 прикреплена к вращательному элементу 136 (не показан), расположенному в камере шариковой мельницы, в соответствии с одним из вариантов реализации. В одном из примеров приводная система 202 представляет собой вращательный привод. Приводная система 202 может принимать различные сигналы через соединение 204. Например, сигналы могут включать сигналы мощности или управляющие сигналы. Соединение 204 может представлять провода, радиочастотные сигналы или оптические сигналы. Приводная система 202 может вращать вращательный элемент 136 с любой скоростью в рамках возможностей приводной системы 202. В одном из примеров приводная система 202 вращает вращательный элемент 136 со скоростями от 50 оборотов в минуту до 30000 оборотов в минуту.

[0046] Вариант реализации шариковой мельницы 201, показанный на фиг. 2A, также содержит полость 205, расположенную на боковой стенке шариковой мельницы 201. Полость 205 может быть закрыта термопроводящим материалом, таким как, например, алюминиевая фольга. Посредством нагрева термопроводящего материала, содержимое во внутренней обрабатывающей камере шариковой мельницы 201 может быть нагрето при помощи полости 205. Следует понимать, что расположение полости 205 не ограничено стороной шариковой мельницы 201. Полость может быть также расположена в верхней части шариковой мельницы 201 или на задней поверхности шариковой мельницы 201. В другом примере одна или более из стенок внутренней обрабатывающей камеры может представлять собой поверхность с терморегулировкой для нагрева содержимого внутренней обрабатывающей камеры без необходимости в полости. Одна или более из стенок внутренней обрабатывающей камеры может быть выполнена из металлов, имеющих высокую термопроводимость, таких как алюминий, медь и т.д. Введение тепла во внутреннюю обрабатывающую камеру может обеспечить возможность проведения ферментативного лизиса образца. В одном из примеров ферментативный лизис может быть выполнен с использованием приложенного тепла к образцу до начала самого измельчения образца с помощью шариков.

[0047] На фиг. 3A показан другой вид шариковой мельницы 201 с приводом 202, отсоединенным от основного корпуса шариковой мельницы 201. Соединительный элемент 302 обеспечен для прикрепления привода 202 к вращательному элементу 136 (не показан) в камере шариковой мельницы. Соединительный элемент 302 может представлять собой, например, вал, винт или углубление для приема другого элемента. Привод 202 выполнен с возможностью ручного или автоматического отсоединения от вращательного элемента 136 в камере шариковой мельницы при том, что от пользователя требуется мало усилий. Соединительный элемент 302 может иметь подходящую форму для посадки в принимающей части вращательного элемента 136, или сам может принимать часть вращательного элемента 136. В соответствии с одним из вариантов реализации, вращение соединительного элемента 302 вызывает вращение вращательного элемента 136.

[0048] На фиг. 3B показан другой вид шариковой мельницы 201, в соответствии с одним из вариантов реализации. На фиг. 3B показан вид под другим углом шариковой мельницы 201, показанной на фиг. 2A с удаленным приводом 202. Опора 140 показана вставленной в отверстие на стороне шариковой мельницы 201, в соответствии с одним из вариантов реализации. Наружная часть опоры 140 содержит углубление 304. В углублении 304 часть вращательного элемента 136 проходит наружу от закрытой камеры, в соответствии с одним из вариантов реализации. Данный участок вращательного элемента 136 содержит конструкцию 306. Конструкция 306 может быть выполнена с возможностью посадки с натягом в соединительный элемент 302 из привода 202. В одном из примеров, Вращение соединительного элемента 302 приводом 202 вызывает по существу такое же вращение конструкции 306 на конце вращательного элемента 136.

[0049] На фиг. 4 показан разобранный вид различных компонентов вращательного элемента 136 и привода 202, в соответствии с одним из вариантов реализации. Отверстие 401 шариковой мельницы 201 принимает опору 140, которая облегчает соединение привода 202 с вращательным элементом 136, в соответствии с одним из вариантов реализации. Могут содержаться также дополнительные элементы для соединения вращательного элемента 136 с приводом 202, такие как, например, уплотнительный элемент 138 и втулка 139. Данные элементы могут также обеспечивать преграду для удержания образцов в камере шариковой мельницы от утечки из области вокруг места, где вращательный элемент 136 проходит наружу из камеры.

[0050] Вал 402 соединяет конструкцию 306 на конце вращательного элемента 136 с вращающимся корпусом 404, в соответствии с одним из вариантов реализации. Вращающийся корпус 404 может иметь различные формы и размеры. Длина вала 402 может быть регулируемой для различных размеров камер шариковой мельницы. Следует отметить, что, в некоторых вариантах реализации, предполагается, что все из показанных компонентов шариковой мельницы 201, за исключением привода 202, выполнены с возможностью утилизации после одного использования или последовательного использования во время одного тестирования.

[0051] Множество фритт 406 также показаны на стороне шариковой мельницы 201. Каждая фритта 406 может содержать различные материалы, выполненные с возможностью фильтрации или захвата частиц различных размеров. В одном из примеров фритта 406 представляет собой пластиковый материал, имеющий тонкую сетку, размеры ячеек которой можно выбрать, и размеры которых могут лежать в диапазоне от 5 до 500 микрон. В одном из вариантов реализации, фритта 406 имеет размер ячеек приблизительно 20 микрон. Текучая среда, извлеченная из камеры шариковой мельницы, может проходить по меньшей мере через одну из фритт 406 для ее фильтрации.

[0052] На фиг. 5 показан вид внутри камеры шариковой мельницы шариковой мельницы 201. Закрытая камера 502 образует область, где происходит гомогенизация и/или лизирование. В одном из вариантов реализации, закрытая камера 502 имеет по существу цилиндрическую форму. Цилиндрическая форма обеспечивает эффективное перемещение текучей среды вокруг вращательного элемента при его вращении. Закрытая камера 502 также может иметь квадратное сечение. Также могут рассматриваться и другие формы закрытой камеры 502 для усиления перемешивания, например, множества шариков, расположенных в закрытой камере 502. Использование множества шариков для улучшения гомогенизации и/или лизиса более подробно описано со ссылкой на фиг. 6B.

[0053] Различные соединения по текучей среде содержатся в закрытой камере 502, в соответствии с одним из вариантов реализации. Впускные отверстия 203a-c для текучей среды показаны вдоль стороны, как описано выше. В одном из примеров образец и/или другие жидкости могут быть введены в закрытую камеру 502 через впускные отверстия 203a или 203b для текучей среды. В другом примере полученная в результате смесь после лизирования или гомогенизации могут извлекать из закрытой камеры 502 через впускное отверстие 203 для текучей среды. Различные соединения по текучей среде могут быть расположены в любом месте вокруг закрытой камеры 502 под любым углом. Обрабатывающее впускное отверстие 132 и нагревательная полость 205 также показаны на сторонах закрытой камеры 502. Поверхность с терморегулировкой может уплотнять нагревательную полость 205 и нагревать содержимое закрытой камеры 502. В одном из примеров нагрев содержимого закрытой камеры 502 вызывает ферментативное лизирование. В другом примере вал 402 может вращаться для перемешивания образца и гомогенизирования температуры в закрытой камере 502 во время процесса нагрева.

[0054] На фиг. 6A показан вид сбоку шариковой мельницы 201 при наблюдении через обрабатывающее впускное отверстие 132 при удаленном приспособлении для закрывания, в соответствии с одним из вариантов реализации. В одном из примеров вращающийся корпус 404 можно наблюдать по существу центрированным в закрытой камере 502.

[0055] На фиг. 6C показан вид в разрезе внутренней части закрытой камеры 502, включая опору 140, в соответствии с одним из вариантов реализации. Вал 140 проходит через опору 140 и соединяется с вращающимся корпусом 404 в закрытой камере 502. Один конец вала 402 выполнен с возможностью посадки в прорезь 602 закрытой камеры 402, в соответствии с одним из вариантов реализации. Прорезь 602 может быть использована для стабилизации положения вала 402 в закрытой камере 502, в то же время обеспечивая вращение вращающегося корпуса 404. Закрытая камера 502 также может содержать множества шариков 604. Шарики могут присутствовать для способствования процессу гомогенизации и/или лизирования образца в закрытой камере 502. Вращение вращающегося корпуса 404 также возбуждает перемещение множества шариков 604. Отдельные шарики в множестве шариков 604 могут иметь размеры в диапазоне от одного микрона в диаметре до 3000 микрон в диаметре. В дополнение, множество шариков 604 может быть выполнено из различных материалов, включая пластик, стекло, керамику и кремний.

[0056] На фиг. 7A-7E показаны различные варианты реализации вращательного элемента 136. Данные варианты реализации приведены в качестве примеров и следует понимать, что другие конструкции также могут быть использованы специалистом в данной области техники на основании приведенного в настоящем документе описания. Вращательный элемент 136 в каждом варианте реализации содержит вал 402 с конструкцией 306 на одном конце, как описано выше. Показаны различные конструкции корпуса 702 и элементов 704. Корпус 702 может представлять собой любой материал, достаточно твердый для выполнения гомогенизации жестких типов образцов, таких как кость и ткань. В дополнение, корпус 702 может представлять собой биосовместимый материал. Элементы 704 выполнены для придания корпусу 702 узорчатой формы. Вращение элементов 704 в закрытой камере 502 вызывает быстрое перемещение образца и любого другого материала вокруг камеры. В другом примере вращение элементов 704 вызывает возбуждение и перемещение множества шариков 604. Каждая показанная конструкция также содержит штифт 706 на одном конце вращательного элемента 136, в соответствии с некоторыми вариантами реализации. Штифт 706 может быть выполнен с возможностью в прорези 602 закрытой камеры 502. Следует понимать, что штифт 706 не является необходимым элементом вращательного элемента 136, но может быть использован для увеличения стабильности в закрытой камере 502.

[0057] На фиг. 8-11 описаны приведенные в качестве примера способы, которые выполняют для гомогенизации или лизирования образца при помощи шариков или без них, в соответствии с вариантами реализации. Следует понимать, что способы 800, 900, 1000 и 1100 описывают приведенные в качестве примеров последовательности работы, которые могут быть выполнены с помощью шариковой мельницы 201, и не должны рассматриваться в качестве ограничительных. Любой из способов 800, 900, 1000 и 1100 может также включать этап нагрева содержимого в шариковой мельнице 201 для выполнения ферментативного лизиса. В одном из примеров ферментативный лизис выполняют до того, как происходит измельчение шариками.

[0058] На фиг. 8 показана блок-схема приведенного в качестве примера способа 800 лизирования образца с использованием шариковой мельницы 201. Задача лизиса клеток заключается в высвобождении клеточного содержимого, которое необходимо для анализа. Примеры клеточного содержимого включают, не ограничиваясь, ДНК, РНК, полипептиды, ферменты, прионы, белки, антитела, антигены, аллергены и вироны (virons).

[0059] В блоке 802 по меньшей мере образец вводят в закрытую камеру через впускной проход, соединенный с сетью для текучей среды. Образец может быть введен, например, через впускные отверстия 203a-c для текучей среды.

[0060] В блоке 804 вращательный элемент вращают в закрытой камере. Вращательный элемент выполнен с возможностью вращения по оси, проходящей вдоль длины вращательного элемента, при помощи внешнего привода.

[0061] В блоке 806 образец подвергают лизису в закрытой камере посредством перемещения вращательного элемента. Лизат могут передавать из закрытой камеры во вторую камеру через одно из впускных отверстий 203a-c для текучей среды.

[0062] На фиг. 9 показана блок-схема приведенного в качестве примера способа 800 лизирования образца с использованием шариковой мельницы 201, содержащей множество шариков. Задача лизиса клеток заключается в высвобождении клеточного содержимого, которое необходимо для анализа. Примеры клеточного содержимого включают, не ограничиваясь, ДНК, РНК, полипептиды, ферменты, прионы, белки, антитела, антигены, аллергены и вироны (virons). Присутствующие шарики используют для ускорения процесса разрыва стенок клеток для высвобождения клеточного содержимого.

[0063] В блоке 902 по меньшей мере образец вводят в закрытую камеру через впускной проход, соединенный с сетью для текучей среды. Образец может быть введен, например, через впускные отверстия 203a-c для текучей среды.

[0064] В блоке 904 вращательный элемент вращают в закрытой камере. Вращательный элемент выполнен с возможностью вращения по оси, проходящей вдоль длины вращательного элемента, при помощи внешнего привода.

[0065] В блоке 906 посредством перемещения вращательного элемента возбуждают движение множество шариков в закрытой камере. Шарики могут различаться по форме, размеру и/или материалу, как описано выше. Добавочное перемещение шариков в закрытой камере обеспечивает дополнительное измельчение клеток и ведет к более эффективному процессу лизирования.

[0066] В блоке 908 образец подвергают лизису в закрытой камере посредством перемещения вращательного элемента и множества шариков. Лизат могут передавать из закрытой камеры во вторую камеру через одно из впускных отверстий 203a-c для текучей среды.

[0067] На фиг. 10 показана блок-схема приведенного в качестве примера способа 1000 гомогенизации образца с использованием шариковой мельницы 201.

[0068] В блоке 1002 по меньшей мере образец вводят в закрытую камеру через впускной проход, соединенный с сетью для текучей среды. Образец может быть введен, например, через впускные отверстия 203a-c для текучей среды или через любой другой подходящий проход. В одном из вариантов реализации, твердый, полутвердый или жидкий образец может быть взят для гомогенизации. Например, образцы с высокой вязкостью (например, мокрота, ткань, кость) хорошо подходят для гомогенизации для разрушения сложного межклеточного материала, который удерживает клеточные компоненты образца вместе.

[0069] В блоке 1004 вращательный элемент вращают в закрытой камере. Вращательный элемент выполнен с возможностью вращения по оси, проходящей вдоль длины вращательного элемента, при помощи внешнего привода.

[0070] В блоке 1006 образец гомогенизируют в закрытой камере посредством перемещения вращательного элемента. Гомогенизированный образец могут подвергать лизису с использованием шариковой мельницы 201 или передавать в другую камеру для дальнейшей обработки.

[0071] На фиг. 11 показана блок-схема приведенного в качестве примера способа 1000 гомогенизации образца с использованием шариковой мельницы 201, содержащей множество шариков.

[0072] В блоке 1102 по меньшей мере образец вводят в закрытую камеру через впускной проход, соединенный с сетью для текучей среды. Образец может быть введен, например, через впускные отверстия 203a-c для текучей среды или через любой другой подходящий проход. В одном из вариантов реализации, твердый, полутвердый или жидкий образец может быть взят для гомогенизации. Например, образцы с высокой вязкостью (например, мокрота, ткань, кость) хорошо подходят для гомогенизации для разрушения сложного межклеточного материала, который удерживает клеточные компоненты образца вместе.

[0073] В блоке 1104 вращательный элемент вращают в закрытой камере. Вращательный элемент выполнен с возможностью вращения по оси, проходящей вдоль длины вращательного элемента, при помощи внешнего привода.

[0074] В блоке 1106 посредством перемещения вращательного элемента возбуждают движение множество шариков в закрытой камере. Шарики могут различаться по форме, размеру и/или материалу, как описано выше. Добавочное перемещение шариков в камере обеспечивает дополнительное измельчение образца и более эффективный процесс гомогенизации.

[0075] В блоке 1108 образец гомогенизируют в закрытой камере посредством перемещения вращательного элемента и множества шариков. Гомогенизированный образец могут подвергать лизису с использованием шариковой мельницы 201 или передавать в другую камеру для дальнейшей обработки.

Примеры

[0076] Сейчас обсуждаются типичные протоколы, выполненные с использованием вариантов реализации шариковой мельницы 201. Такие протоколы представляют собой только примеры и не накладывают ограничения на варианты реализации настоящего изобретения. В случае типичных протоколов анализировали выделенные ДНК и РНК из разных образцов и сравнивали с контролями для определения эффективности шариковой мельницы. Следует понимать, что стадии, перечисленные в настоящей заявке, соответствуют только нескольким возможным примерам применения системы.

[0077] Пример 1: Выделение ДНК из эндоспор Bacillus subtilis

[0078] Bacillus subtilis, известная также как сенная палочка, представляет собой грамположительную, каталаза-позитивную бактерию. Член рода Bacillus, В. subtilis является палочковидной и обладает способностью образовывать жесткую, защитную эндоспору, позволяя организму выдерживать экстремальные условия окружающей среды. Эндоспоры разных видов Bacillus образуются во время спорообразования, процесса, который обычно индуцируется пониженными уровнями питательных веществ в окружающей среде. Эндоспоры содержат внешнюю споровую оболочку, которая чрезвычайно устойчива к жестким физическим и химическим обработкам, делая проблематичным подборе способа лизиса спор, который можно осуществить за несколько минут.

[0079] Пример протокола для лизирования клеток Bacillus subtilis основан на публикации W. Nicholson and P. Setlow, Molecular Biological Methods for Bacillus, New York, John Wiley, pp. 391-450, 1990. В данном примере протокола 100 мл культуры Bacillus subtilis subsp. spizizenii (АТСС 6633), выращенной в среде для спорообразования (SM), перемешивают на вихревой мешалке, затем разделяют на два объема по 50 мл. После центрифугирования при 3750 g в течение 15 минут осадки промывают три-пять раз 50 мл стерильной холодной дистиллированной воды, при этом при каждой промывке осуществляют центрифугирование при 3750 g в течение 15 минут. Полученные в результате осадки ресуспендируют в 50 мл стерильной холодной дистиллированной воды. Суспензии со спорами обрабатывают ДНКазой для удаления внешней остаточной ДНК, подсчитывают и разводят до конечной концентрации 5×109 эндоспор/мл. Готовят серию 10-кратных разведений (5×109, 5×107, 5×105, 5×103 и 50 эндоспор/мл) в буфере Tris-EDTA (трис(гидроксиметил)аминометан-этилендиаминтетрауксусная кислота) для применения в качестве исходного материала в струйной интегрированной роторной шариковой мельнице.

[0080] Сначала 400 мг стерильных, промытых кислотой стеклянных шариков с диаметром 150-212 мкм (SIGMA G1145-100G) помещают в камеру шариковой мельницы. Затем, 200 мкл разведения эндоспор ресуспендируют в 200 мкл 1х буфера Tris-EDTA и переносят в камеру шариковой мельницы через технологическое входное отверстие. Шариковую мельницу используют при скорости вращения 10000 об/мин в течение примерно 2 минут. Нуклеиновые кислоты бактерий высвобождаются при разрушении спор в результате механического действия шариковой мельницы. Экстракты нуклеиновых кислот остаются стабильными в течение нескольких месяцев при хранении в замороженном виде при -80°C или -20°C, и их можно замораживать и оттаивать несколько раз без какой-либо значительной потери аналитической чувствительности при осуществлении ПЦР (полимеразная цепная реакция).

[0081] Амплификацию и детекцию ДНК из эндоспор Bacillus subtilis проводят в системе ПЦР в реальном времени StepOnePlus™ из Applied Biosystems с PremixExTaq (зонд для количественной ПЦР) из Takara (кат. RR390A), согласно инструкциям производителя. Полученный лизат в количестве 1,5 мкл добавляют непосредственно к реакционной смеси для количественной ПЦР, состоящей из 1x Premix Ex Taq (содержит TaKaRa Ex Taq HS, смесь dNTP (дезоксинуклеозидтрифосфаты), Mg2+ и Tli РНКазу H), 1x красителя ROX в качестве стандарта, 0,50 мкМ каждого праймера, специфичного для SpoA Bacillus subtilis-, 0,20 мкМ зонда SpoOA TaqMan® и 0,2 мг/мл БСА (бычий сывороточный альбумин); в конечном объеме 15 мкл. Параллельно, тестировали споры без обработки в качестве необработанных контролей (в таких же концентрациях). К реакционной смеси для количественной ПЦР также добавляют 1,5 мкл дистиллированной воды в качестве отрицательного контроля. Оптимальными условиями повторения циклов для максимальной чувствительности и специфичности являются следующие: 10 секунд при 95°C для исходной денатурации, затем пятьдесят циклов из двух этапов, состоящих из 1 секунды при 95°C и 10 секунд при 60°C. За амплификацией следят во время каждого цикла элонгации путем измерения уровня флуоресценции. Концентрации ДНК также рассчитывают путем интерполяции значений Ct (число циклов ПЦР, необходимое для получения положительного сигнала) на калибровочной кривой. В Таблице 1 ниже приведены праймеры специфичные для генов SpoOA Bacillus subtilis и последовательность зонда, используемые в реакционной смеси для количественной ПЦР TaqMan®.

Таблица 1
Праймер Последовательность (5'->3') Длина (п.н.) Размер продукта (п.н.)
SpoOA F ccatcatcgcaaagcagtatt 21 70
SpoOA R tgggacgccgatttcatg 18
зонд SpoOA ctcgacgcgagcatcacaagcatt 24

[0082] Согласно Фиг. 12 предложен график результатов для указанного протокола выделения ДНК для Bacillus subtilis. Результаты показаны в отношении концентрации выделенной ДНК, по сравнению с исходной концентрацией спор Bacillus subtilis. Результаты представляют собой среднее 15 повторений при каждой концентрации. Согласно наблюдениям, эндоспоры, лизированные с помощью струйной интегрированной роторной шариковой мельницы, давали более высокие концентрации ДНК, чем необработанные эндоспоры для каждой исходной концентрации спор Bacillus subtilis.

[0083] Пример 2: Выделение ДНК из вегетативных клеток Bacillus subtilis

[0084] В данном примере шариковую мельницу сначала загружают 400 мг стерильных, промытых кислотой стеклянных шариков с диаметром 150-212 мкм (SIGMA G1145-100G). Объем 3 мл бульонной культуры вегетативных клеток Bacillus subtilis subsp. spizizenii (АТСС 6633) в середине фазы логарифмического роста (OD (оптическая плотность) 550=0,60-0,70) центрифугируют, и осадок ресуспендируют в буфере Tris-EDTA с получением конечной концентрации Bacillus subtilis примерно 5×108 КОЕ (колониеобразующая единица)/мл. Получают серию 10-кратных разведений (5×108, 5×106, 5×104, 5×102 и 5 КОЕ/мл) в буфере Tris-EDTA. 200 мкл разведения вегетативных клеток ресуспендируют в 200 мкл 1ч буфера Tris-EDTA, и полученную смесь переносят в устройство шариковой мельницы с помощью технологического входного отверстия. Шариковую мельницу используют при скорости вращения 10000 об/мин в течение примерно 2 минут.

[0085] Амплификацию и детекцию добавленной ДНК из вегетативных клеток Bacillus subtilis проводят в системе ПЦР в реальном времени StepOnePlus™ из Applied Biosystems с PremixExTaq (зонд для количественной ПЦР) из Takara (кат. RR390A), согласно инструкциям производителя. Полученный лизат в количестве 1,5 мкл добавляют непосредственно к реакционной смеси для количественной ПЦР, состоящей из 1x Premix Ex Taq (содержит TaKaRa Ex Taq HS, смесь dNTP, Mg2+ и Tli РНКазу H), 1x красителя ROX в качестве стандарта, 0,50 мкМ каждого праймера специфичного для SpoA Bacillus subtilis, 0,20 мкМ зонда SpoOA TaqMan® и 0,2 мг/мл БСА; в конечном объеме 15 мкл. Параллельно, тестировали вегетативные клетки без обработки в качестве необработанных контролей (в таких же концентрациях). К реакционной смеси для количественной ПЦР также добавляют 1,5 мкл дистиллированной воды в качестве отрицательного контроля. Оптимальными условиями повторения циклов для максимальной чувствительности и специфичности являются: 10 секунд при 95°C для первой денатурации, затем пятьдесят циклов двух этапов, состоящих из 1 секунды при 95°C и 10 секунд при 60°C. Амплификацию отслеживают во время каждого цикла элонгации путем измерения уровня флуоресценции. Концентрации ДНК также рассчитывают путем интерполяции значений Ct на калибровочной кривой.

[0086] На Фиг. 13 приведен график результатов протокола выделения ДНК для вегетативных клеток Bacillus subtilis. Результаты показаны в отношении концентрации выделенной ДНК, по сравнению с исходной концентрацией клеток. Результаты представляют собой среднее значение 15 повторений при каждой концентрации. Детекция лизата, полученного из вегетативных клеток В. subtilis с помощью струйной интегрированной роторной шариковой мельницы составляла приблизительно между 50 и 500 КОЕ/мл (10-100 КОЕ на реакцию). В необработанных вегетативных клетках Bacillus subtilis сигнал после реакции амплификации не обнаруживался вплоть до концентрации 5,0×104 КОЕ/мл.

[0087] Пример 3: Сравнение протоколов выделения ДНК для вегетативных клеток Bacillus subtilis

[0088] В данном примере ДНК-контроль выделяют из вегетативных клеток В. subtilis subsp. spizizenii (АТСС 6633) с применением набора для очистки РНК/ДНК/белков Norgen. Для каждого образца 1,6 нг ДНК вводят в 800 мкл забуференного раствора, который также включает хелатирующий агент (1x буфер Tris-EDTA, приготовленный из 100x концентрированного буфера Tris-EDTA SIGMA).

[0088] Параллельно протокол лизиса осуществляют на вегетативных клетках Bacillus subtilis, полученных по существу таким же путем и с применением шариковой мельницы, имеющей по существу такие же стеклянные шарики, как описано в предыдущих примерах. Шариковую мельницу используют при скорости вращения 20000 об/мин в течение примерно 3 минут для лизирования образца.

[0090] В данном примере амплификацию и детекцию введенной ДНК проводят в системе ПЦР в реальном времени StepOnePlus™ из Applied Biosystems с PremixExTaq (зонд для количественной ПЦР) из TaKaRa (кат. RR390A), согласно инструкциям производителя. Полученный лизат в количестве 1,5 мкл добавляют непосредственно к реакционной смеси для количественной ПЦР, состоящей из 1x Premix Ex Taq (содержит TaKaRa Ex Taq HS, смесь dNTP, Mg2+ и Tli РНКазу H), 1x красителя ROX в качестве контроля, 0,50 мкМ каждого праймера специфичного для SpoA Bacillus subtilis-, 0,20 мкМ зонда SpoOA TaqMan® (см. таблицу 1, пример 1) и 0,2 мг/мл БСА; в конечном объеме 15 мкл. Параллельно, тестируют ДНК без обработки в качестве положительного контроля (в той же концентрации). К реакционной смеси для количественной ПЦР также добавляют 1,5 мкл дистиллированной воды в качестве отрицательного контроля.

[0091] В Таблице 2 представлены данные по концентрации выделенной ДНК в результате лизирования с помощью шариковой мельницы, по сравнению с положительным контролем. Образцы отрицательного контроля показали, что ДНК отсутствовала. Для обоих способов лизирования также приведены значения Ct. На Фиг. 14 показан график средней концентрации выделенной ДНК с применением шариковой мельницы, по сравнению с положительным контролем. Выделение ДНК после механического лизиса с помощью струйной интегрированной роторной шариковой мельницы сравнимо с положительным контролем (разница составляет примерно 7,6%). Разрушения ДНК после процесса использования струйной интегрированной роторной шариковой мельницы не наблюдали.

[0092] Пример 4: Выделение ДНК и РНК из вегетативных клеток Bacillus subtilis

[0093] Данный типичный эксперимент показывает, что из бактериальных клеток с применением струйной интегрированной роторной шариковой мельницы можно выделять РНК, подходящую для синтеза кДНК и амплификации с помощью количественной ОТ-ПЦР (полимеразная цепная реакция с обратной транскрипцией),. Объем 3 мл бульонной культуры вегетативных клеток Bacillus subtilis subsp. spizizenii (АТСС 6633) в середине фазы логарифмического роста (OD550=0,60-0,70) центрифугируют, и осадок ресуспендируют в буфере Tris-EDTA с получением конечной концентрации Bacillus subtilis, составляющей 1,5×108 КОЕ/мл. В буфере Tris-EDTA получают разведение 5×104 КОЕ/мл для использования в качестве исходного материала в струйной интегрированной роторной шариковой мельнице.

[0094] Шариковую мельницу подготавливают с помощью по существу таких же стеклянных шариков, как описано в предыдущих примерах, и в нее загружают 200 мкл разведения вегетативных клеток, резуспендированных в 200 мкл 1x буфера Tris-EDTA. Шариковую мельницу используют при скорости вращения 20000 об/мин в течение примерно 3 минут для лизирования образца.

[0095] Выделение лизатов Bacillus subtilis в данном примере проводят с помощью двух разных коммерческих наборов для очистки от Norgen (набор для очистки РНК/ДНК/белков) и Fermentas (набор для очистки вирусной ДНК/РНК GeneJET). Амплификацию и детекцию РНК и ДНК из вегетативных клеток Bacillus subtilis проводят в системе ПЦР в реальном времени StepOnePlus™ из Applied Biosystems с набором для ОТ-ПЦР One Step PrimeScript™ (Perfect Real Time) из Takara (кат. RR064A), согласно инструкциям производителя. Полученный лизат в количестве 2,0 мкл добавляют непосредственно в две смеси для количественной ОТ-ПЦР, с ферментом обратной транскриптазы или без него (ферментативная смесь II PrimeScript RT), для детекции РНК и ДНК. Итоговые смеси состоят из 1x буфера III One Step RT-PCR (включает смесь dNTP, Mg2+), 0,1 U/мкл TaKaRa exTaq HS, 1x ферментативной смеси II PrimeScript RT (в смеси RT+), 1x красителя ROX в качестве контроля, 0,38 мкМ каждого праймера, специфичного для SpoA Bacillus subtilis- и 0,15 мкМ зонда SpoOA TaqMan® (см. таблицу 1 согласно примеру 1); в конечном объеме 20 мкл. Параллельно тестируют вегетативные клетки без обработки в качестве необработанных контролей (в таких же концентрациях). 2,0 мкл дистиллированной воды также добавляют к реакционным смесям для количественной ОТ-ПЦР (± фермент RT) в качестве отрицательного контроля. Первый этап длиться 5 мин при 42°C для обратной транскрипции (синтез кДНК). Оптимальными условиями повторения циклов для максимальной чувствительности и специфичности являются: 10 секунд при 95°C для исходной денатурации, затем сорок циклов двух этапов, состоящих из 1 секунды при 95°C и 10 секунд при 60°C. За амплификацией следили во время каждого цикла элонгации путем измерения уровня флуоресценции. Концентрации ДНК и РНК также рассчитывают путем интерполяции значений Ct на своих соответствующих калибровочных кривых.

[0096] На Фиг. 15 приведен график средних концентраций выделенных РНК и ДНК (нг/мкл) в разных тестируемых условиях: из лизата НК (нуклеиновых кислот) после использования струйной интегрированной роторной шариковой мельницы, из лизата НК после струйной интегрированной роторной шариковой мельницы и очистки с помощью набора для очистки Norogen, из лизата НК после струйной интегрированной роторной шариковой мельницы и очистки с помощью набора для очистки Fermentas и из необработанной повторной суспензии В. subtilis. Результаты представляют собой среднее значение 15 повторений при каждой концентрации. Выделение нуклеиновых кислот в отношении концентраций ДНК и РНК увеличилось после механического лизиса с помощью струйной интегрированной роторной шариковой мельницы, по сравнению с условием отсутствия обработки, особенно в отношении выделения РНК. После очистки нуклеиновых кислот % выделения НК снизился (25-30%, по сравнению с условием без очистки) из-за процесса мембранной очистки.

[0097] Пример 5: Сравнение выделения РНК для вегетативных клеток Bacillus subtilis

[0098] В данном примере РНК-контроль выделяют из вегетативных клеток В. subtilis subsp. spizizenii (АТСС 6633) с использованием набора для очистки РНК/ДНК/белков Norgen. Для каждого образца 9,00 нг РНК вводят в 800 мкл забуференного раствора, который также включает хелатирующий агент (1x буфер Tris-EDTA, не содержащий нуклеаз, из SIGMA).

[0099] Параллельно протокол лизиса осуществляют на вегетативных клетках Bacillus subtilis, полученных по существу тем же путем и с применением шариковой мельницы, имеющей по существу такие же стеклянные шарики, как описано в предыдущих примерах. Шариковую мельницу используют при скорости вращения 20000 об/мин в течение примерно 3 минут для лизирования образца.

[0100] В данном примере амплификацию и детекцию введенной РНК проводят в системе ПЦР в реальном времени StepOnePlus™ из Applied Biosystems с набором для ОТ-ПЦР One Step PrimeScript™ (Perfect Real Time) из Takara (кат. RR064A), согласно инструкциям производителя. Полученный лизат в количестве 2,0 мкл добавляют непосредственно в реакционную смесь для количественной ОТ-ПЦР, состоящую из 1x буфера III One Step RT-PCR (включает смесь dNTP, Mg2+), 0,1 U/мкл TaKaRa exTaq HS, 1x ферментативной смеси II PrimeScript RT, 1x красителя ROX в качестве контроля, 0,38 мкМ каждого праймера, специфичного для SpoA Bacillus subtilis- и 0,15 мкМ зонда SpoOA TaqMan® (см. таблицу 1 согласно примеру 1); в конечном объеме 20 мкл. Параллельно тестируют РНК без обработки в качестве положительного контроля (в той же концентрации). 2,0 мкл дистиллированной воды также добавляют к реакционной смеси для количественной ОТ-ПЦР в качестве отрицательного контроля.

[0101] В Таблице 3 приведены данные по концентрации выделенной РНК в результате лизирования с помощью шариковой мельницы, по сравнению с положительным контролем. Образцы отрицательного контроля показали, что РНК отсутствовала. Значения Ct (число циклов ПЦР, необходимое для получения положительного сигнала) также даны для обоих способов лизирования. На фиг. 16 проиллюстрирован график средней концентрации РНК, выделенной с применением шариковой мельницы, по сравнению с положительным контролем. Выделение РНК после механического лизиса с помощью струйной интегрированной роторной шариковой мельницы сравнимо с положительным контролем (разница примерно 5,3%). Разрушения РНК после процесса использования струйной интегрированной роторной шариковой мельницы не наблюдали.

[0102] Пример 6: Анализ целостности РНК

[0103] В данном примере биоанализатор Agilent с соответствующим набором LabChip® обеспечивает особенно эффективный способ оценки целостности общей РНК. Биоанализатор Agilent 2100 представляет собой платформу на основе микроструйной техники для определения размера, определения количества и контроля качества ДНК, РНК, белков и клеток. Его можно использовать для того, чтобы посмотреть на качество общей РНК путем наблюдения за пиками 16S и 23S рибосомальной РНК прокариот и их отношением. Отношение областей под пиками 23S:16S представляет собой меру чистоты РНК, и оно должно попадать в диапазон 1,5-2,0.

[0104] Образцы РНК (1 мкл) из необработанной РНК и лизатов нуклеиновой кислоты, полученных с помощью струйной интегрированной роторной шариковой мельницы, прогоняют на биоанализаторе Agilent 2100 с использованием набора Agilent RNA 6000 Pico (кат. #5067-1513) и набора Agilent RNA 6000 Nano (кат. #5067-1511) для анализа образцов общей РНК (эукариотической и прокариотической) и мРНК (матричная РНК). На фиг. 16A предложен профиль рРНК (рибосомальной РНК), полученный на биоанализаторе, для контроля в виде необработанной РНК (эталон), в то время как на фиг. 16Б и 16В предложены профили рРНК, полученные на биоанализаторе, для двух разных образцов, лизированных с помощью роторной шариковой мельницы. Согласно наблюдениям соотношения рРНК в двух примерах образцов нуклеиновых кислот, обработанных в струйной интегрированной роторной шариковой мельнице, находятся в нормативных пределах (1,5-2,0), указывая на то, что целостность РНК является надлежащей. Пики 23S и 16S из образцов, полученных при использовании шариковой мельницы, заметно меньше, чем у контрольного образца. Это обусловлено тем, что лизаты представляют собой смесь РНК и ДНК и наличие ДНК в образцах, полученных с помощью шариковой мельницы, влияет на разрешение электрофореграмм биоанализатора Agilent.

[0105] Приведенное выше описание конкретных вариантов реализации и примеров полностью раскрывают основную сущность изобретения, так что специалисты, применяя знания из уровня техники, легко смогут выполнить модификации в данных вариантах реализации и/или адаптировать данные варианты реализации для различных применений данных конкретных вариантов реализации без выполнения лишних экспериментом и без выхода за пределы общей концепции настоящего изобретения. Таким образом, подразумевается, что такие адаптации и модификации попадают в область значений и диапазона эквивалентов раскрытых вариантов реализации на основании раскрытия и руководства, приведенного в настоящем описании. Следует понимать, что фразеология или терминология использованы для описания и не предназначены для ограничения таким образом, что терминология или фразеология настоящей заявки должна быть интерпретирована специалистом в свете раскрытия и руководства.

[0106] Примеры реализации настоящего изобретения были описаны выше при помощи функциональных строительных блоков, иллюстрирующих варианты исполнения конкретных функций и их взаимоотношений. Пределы данных функциональных блоков были произвольно определены в настоящем раскрытии для удобства описания. Альтернативные пределы могут быть определены до тех пор, пока конкретные функции и их взаимосвязи выполняются соответствующим образом.

[0107] Разделы "Раскрытие изобретения" и "Реферат" могут раскрывать один или более, но не все примерные варианты реализации настоящего изобретения, как предусмотрено изобретателем (изобретателями), и, следовательно, не предназначены для ограничения объема настоящего изобретения и прилагаемых пунктов формулы каким-либо образом.

[0108] Ширина и объем настоящего изобретения не должны ограничиваться любым из раскрытых выше вариантов реализации, а должны быть заданы только в соответствии с приведенными ниже пунктами формулы изобретения и их эквивалентами.

1. Система для гомогенизации и/или лизиса образца, содержащая:

одноразовую кассету, выполненную с возможностью присоединения к приспособлению для анализа и отсоединения от него и содержащую:

первую емкость;

вторую емкость;

одну или более стенок, образующих закрытую камеру, содержащую впускное отверстие и множество соединений по текучей среде, причем по меньшей мере одна из указанной одной или более стенок закрытой камеры содержит поверхность с терморегулировкой;

первую сеть для текучей среды, соединенную по меньшей мере с одним из множества соединений по текучей среде и выполненную с возможностью введения по меньшей мере образца в камеру из первой емкости;

вторую сеть для текучей среды, соединенную по меньшей мере с одним из множества соединений по текучей среде и выполненную с возможностью извлечения по меньшей мере образца из камеры во вторую емкость; и

вращательный элемент, расположенный в закрытой камере; и

привод, соединенный с вращательным элементом одноразовой кассеты и выполненный с возможностью вращения вращательного элемента вокруг оси, проходящей вдоль длины вращательного элемента.

2. Система по п. 1, в которой одна или более стенок образуют по существу цилиндрическую закрытую камеру.

3. Система по п. 1, в которой одна или более стенок образуют закрытую камеру, имеющую прямоугольное сечение.

4. Система по п. 1, в которой впускное отверстие выполнено с возможностью введения твердых, полутвердых или жидких образцов из внешней среды.

5. Система по п. 1, в которой впускное отверстие расположено в верхней части закрытой камеры.

6. Система по п. 1, в которой впускное отверстие расположено на стороне закрытой камеры.

7. Система по п. 1, дополнительно содержащая крышку, выполненную с возможностью посадки на впускное отверстие и предотвращения утечки.

8. Система по п. 1, в которой по меньшей мере часть первой сети для текучей среды или второй сети для текучей среды выполнена с возможностью нагнетания давления или сброса давления в камере.

9. Система по п. 1, дополнительно содержащая третью сеть для текучей среды, соединенную с закрытой камерой и выполненную с возможностью нагнетания давления или сброса давления в камере.

10. Система по п. 1, дополнительно содержащая множество шариков, расположенных в камере.

11. Система по п. 10, в которой множество шариков содержит материалы, выбранные из группы, состоящей из пластика, стекла, керамики и кремнезема.

12. Система по п. 10, в которой диапазон диаметров множества шариков составляет от 1 микрона до приблизительно 3000 микронов.

13. Система по п. 10, в которой вращательный элемент выполнен с возможностью возбуждения множества шариков.

14. Система по п. 1, в которой привод соединен с возможностью отсоединения с вращательным элементом посредством соединительного приспособления.

15. Система по п. 14, дополнительно содержащая опору, расположенную по существу в соединительном приспособлении и выполненную с возможностью предотвращения утечки.

16. Система по п. 1, дополнительно содержащая полость, расположенную на стороне закрытой камеры таким образом, что нагреваемая поверхность, размещенная рядом с полостью, по существу поднимает температуру в закрытой камере.

17. Система для выполнения молекулярного тестирования, содержащая:

одноразовый кожух, выполненный с возможностью присоединения к приспособлению для анализа и отсоединения от него и содержащий:

одну или более камер для текучей среды;

сеть для текучей среды, соединяющую по меньшей мере одну или более камер для текучей среды с подвижной центральной камерой и

устройство, содержащее:

одну или более стенок, образующих закрытую камеру, имеющую впускное отверстие и множество соединений по текучей среде, по меньшей мере часть которых соединены с сетью для текучей среды, причем по меньшей мере одна из указанной одной или более стенок закрытой камеры содержит поверхность с терморегулировкой, и

вращательный элемент, расположенный в закрытой камере; и

привод, соединенный с вращательным элементом и выполненный с возможностью вращения вращательного элемента вокруг оси, проходящей вдоль длины вращательного элемента.

18. Система по п. 17, в которой одна или более стенок образуют по существу цилиндрическую закрытую камеру.

19. Система по п. 17, в которой одна или более стенок образуют закрытую камеру, имеющую прямоугольное сечение.

20. Система по п. 17, в которой впускное отверстие выполнено с возможностью введения твердых, полутвердых или жидких образцов из внешней среды.

21. Система по п. 17, в которой впускное отверстие расположено в верхней части закрытой камеры.

22. Система по п. 17, в которой впускное отверстие расположено на стороне закрытой камеры.

23. Система по п. 17, дополнительно содержащая крышку, выполненную с возможностью посадки на впускное отверстие и предотвращения утечки.

24. Система по п. 17, в которой по меньшей мере часть сети для текучей среды выполнена с возможностью нагнетания давления или сброса давления в закрытой камере.

25. Система по п. 17, дополнительно содержащая множество шариков, расположенных в закрытой камере.

26. Система по п. 25, в которой множество шариков содержит материалы, выбранные из группы, состоящей из пластика, стекла, керамики и кремнезема.

27. Система по п. 25, в которой диапазон диаметров множества шариков составляет от 1 микрона до приблизительно 3000 микронов.

28. Система по п. 25, в которой вращательный элемент выполнен с возможностью возбуждения множества шариков.

29. Система по п. 17, в которой привод соединен с возможностью отсоединения с вращательным элементом посредством соединительного приспособления.

30. Система по п. 29, в которой устройство также содержит опору, расположенную по существу в соединительном приспособлении и выполненную с возможностью предотвращения утечки.

31. Система по п. 17, дополнительно содержащая полость, расположенную на стороне закрытой камеры таким образом, что нагреваемая поверхность, размещенная рядом с полостью, по существу поднимает температуру в закрытой камере.

32. Способ лизирования образца, включающий:

введение по меньшей мере образца в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или большим количеством других камер, причем одна или более стенок закрытой камеры содержат поверхность с терморегулировкой, причем закрытая камера, соединение по текучей среде, сеть для текучей среды и одна или большее количество других камер расположены внутри одноразового кожуха, соединенного с возможностью отсоединения с приспособлением для анализа;

вращение вращательного элемента, расположенного в закрытой камере, вдоль оси, проходящей вдоль длины вращательного элемента; и

лизирование образца в закрытой камере посредством перемещения вращательного элемента.

33. Способ по п. 32, дополнительно включающий извлечение по меньшей мере образца из закрытой камеры через другое соединение по текучей среде, соединенное с сетью для текучей среды.

34. Способ по п. 32, дополнительно включающий нагнетание давления или сброс давления в закрытой камере с использованием сети для текучей среды.

35. Способ по п. 32, дополнительно включающий прикрепление привода к вращательному элементу посредством соединительного приспособления.

36. Способ по п. 32, дополнительно включающий введение по меньшей мере образца в закрытую камеру через впускное отверстие, выполненное с возможностью введения образцов из внешней среды.

37. Способ по п. 36, в котором введение по меньшей мере образца через впускное отверстие включает введение твердых, полутвердых или жидких образцов.

38. Способ по п. 32, дополнительно включающий нагрев образца при помощи полости, расположенной на стороне закрытой камеры.

39. Способ лизирования образца, включающий:

введение по меньшей мере образца в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или более другими камерами, причем одна или более стенок закрытой камеры содержат поверхность с терморегулировкой, причем закрытая камера, соединение по текучей среде, сеть для текучей среды и одна или большее количество других камер расположены внутри одноразового кожуха, соединенного с возможностью отсоединения с приспособлением для анализа;

вращение вращательного элемента, расположенного в закрытой камере, вдоль оси, проходящей вдоль длины вращательного элемента;

возбуждение множества шариков, расположенных в закрытой камере, посредством перемещения вращательного элемента и

лизирование образца в закрытой камере посредством перемещения вращательного элемента и множества шариков.

40. Способ по п. 39, дополнительно включающий извлечение по меньшей мере образца из закрытой камеры через другое соединение по текучей среде, соединенное с сетью для текучей среды.

41. Способ по п. 39, дополнительно включающий нагнетание давления или сброс давления в закрытой камере с использованием сети для текучей среды.

42. Способ по п. 39, дополнительно включающий прикрепление привода к вращательному элементу посредством соединительного приспособления.

43. Способ по п. 39, дополнительно включающий введение по меньшей мере образца в закрытую камеру через впускное отверстие, выполненное с возможностью введения образцов из внешней среды.

44. Способ по п. 43, в котором введение по меньшей мере образца через впускное отверстие включает введение твердых, полутвердых или жидких образцов.

45. Способ по п. 39, дополнительно включающий нагрев образца при помощи полости, расположенной на стороне закрытой камеры.

46. Способ гомогенизации образца, включающий:

введение по меньшей мере образца в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или большим количеством других камер, причем одна или более стенок закрытой камеры содержат поверхность с терморегулировкой, причем закрытая камера, соединение по текучей среде, сеть для текучей среды и одна или большее количество других камер расположены внутри одноразового кожуха, соединенного с возможностью отсоединения с приспособлением для анализа;

вращение вращательного элемента, расположенного в закрытой камере, вдоль оси, проходящей вдоль длины вращательного элемента, и

гомогенизацию образца в закрытой камере посредством перемещения вращательного элемента.

47. Способ по п. 46, дополнительно включающий извлечение по меньшей мере образца из закрытой камеры через другое соединение по текучей среде, соединенное с сетью для текучей среды.

48. Способ по п. 46, дополнительно включающий нагнетание давления или сброс давления в закрытой камере с использованием сети для текучей среды.

49. Способ по п. 46, дополнительно включающий прикрепление привода к вращательному элементу посредством соединительного приспособления.

50. Способ по п. 46, дополнительно включающий введение по меньшей мере образца в закрытую камеру через впускное отверстие, выполненное с возможностью введения образцов из внешней среды.

51. Способ по п. 50, в котором введение по меньшей мере образца через впускное отверстие включает введение твердых, полутвердых или жидких образцов.

52. Способ по п. 46, дополнительно включающий нагрев образца при помощи полости, расположенной на стороне закрытой камеры.

53. Способ гомогенизации образца, включающий:

введение по меньшей мере образца в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или большим количеством других камер, причем одна или более стенок закрытой камеры содержат поверхность с терморегулировкой, причем закрытая камера, соединение по текучей среде, сеть для текучей среды и одна или большее количество других камер расположены внутри одноразового кожуха, соединенного с возможностью отсоединения с приспособлением для анализа;

вращение вращательного элемента, расположенного в закрытой камере, вдоль оси, проходящей вдоль длины вращательного элемента;

возбуждение множества шариков, расположенных в закрытой камере, посредством перемещения вращательного элемента и

гомогенизацию образца в закрытой камере посредством перемещения вращательного элемента и множества шариков.

54. Способ по п. 53, дополнительно включающий извлечение по меньшей мере образца из закрытой камеры через другое соединение по текучей среде, соединенное с сетью для текучей среды.

55. Способ по п. 53, дополнительно включающий нагнетание давления или сброс давления в закрытой камере с использованием сети для текучей среды.

56. Способ по п. 53, дополнительно включающий прикрепление привода к вращательному элементу посредством соединительного приспособления.

57. Способ по п. 53, дополнительно включающий введение по меньшей мере образца в закрытую камеру через впускное отверстие, выполненное с возможностью введения образцов из внешней среды.

58. Способ по п. 57, в котором введение по меньшей мере образца через впускное отверстие включает введение твердых, полутвердых или жидких образцов.

59. Способ по п. 53, дополнительно включающий нагрев образца при помощи полости, расположенной на стороне закрытой камеры.



 

Похожие патенты:

Изобретение относится к области аналитической химии, в частности к масс-спектрометрическим способам измерения концентрации частиц в биологических тканях, и раскрывает способ регистрации органических нано- или микрочастиц в биологических тканях методом ускорительной масс-спектрометрии (УМС).

Изобретение относится к области клинической медицины, более конкретно к работам по определению паразитологических агентов в клиническом материале – кале адаптированным методом иммуномагнитной сепарации с последующим иммунофлюоресцентным мечением.

Изобретение относится к медицинской технике, используемой в общей хирургии, травматологии, ортопедии и гнойной хирургии, и может быть использовано для взятия проб биоматериала для исследований.

Группа изобретений относится к устройствам и способу разделения компонентов биологических жидкостей и может быть использовано в биотехнологии, для препаративных целей в промышленности, в лабораторной или исследовательской практике, в частности для отделения осадка при центрифугировании с непрерывной подачей биологической жидкости для разделения.

Группа изобретений относится к отбору пробы жидкости, в частности топливной, на определение уровня содержания серы в топливе. Пробоотборник (100; 300; 400; 500; 610; 620; 630) приспособлен для установки в систему с вариациями температуры, которая содержит в себе или транспортирует жидкость.

Изобретение относится к устройству для формирования образцов из тампонажных растворов, применяемых при цементировании нефтяных и газовых скважин, полученных в условиях, имитирующих скважинные по температуре до 200°C и давлению до 100 МПа, для последующих прочностных испытаний образцов на сжатие и может быть использовано на скважинах, в лабораториях тампонажных контор, управлений буровых работ и нефтедобывающих объединений, в лабораториях научно-исследовательских организаций.

Группа изобретений относится к формированию и анализу составной пробы текучей среды. Устройство содержит входное отверстие, выполненное с возможностью приема части текучей среды, протекающей по трубопроводу; клапан, подсоединенный к входному отверстию; насос, соединенный с клапаном; резервуар, соединенный с клапаном; и газовый хроматограф, соединенный с клапаном.

Изобретение относится к технике отбора проб газонасыщенных конденсатов, нефти, продуктов их промысловой подготовки и других жидкостей. Устройство для отбора проб жидкости из трубопровода включает установленные последовательно на ответвление 1 трубопровода 2 через переходник 3 поворотный клапан 4 с отводным проходным каналом.
Изобретение относится к медицине, а именно к фармакологии, фармации, дерматологии, косметологии и судебной медицине, и может быть использовано при разработке новых лекарственных средств, предназначено для поиска и оценки эффективности средств, обесцвечивающих кожу в области «красных» и «синих», свежих и старых кровоподтеков, при разработке косметических технологий, предназначенных для удаления кровоподтеков, а также при судебной медицинской экспертизе давности кровоподтеков и ушибов мягких тканей.

Изобретение относится к исследованию прочностных свойств материалов и может применяться при аттестации сотовых структур при изготовлении трехслойных конструкций кораблестроения, авиастроения и космической техники.

Группа изобретений относится к биотехнологии. Предложены способ и установка для очистки сточных вод от аммония и органического вещества в микроаэробных условиях.

Группа изобретений относится к области биохимии. Предложен способ получения топлива из органического материала в подземном реакторе (варианты) и подземный реактор для применения в вышеуказанном способе (варианты).

Изобретение относится к области биохимии. Предложен биореактор для проведения биохимических процессов.

Изобретение относится к области биохимии. Предложен биореактор для выращивания метанутилизирующих микроорганизмов с возможностью использования метансодержащего газа и кислородсодержащего газа в качестве субстратов для роста клеток.

Изобретение относится к области биохимии. Предложен теплообменный модуль для использования в системе химического, фармацевтического или биологического реактора.

Группа изобретений относятся к области биохимии. Предложен способ получения полипептида и способ получения сниженного количества гликоформы G(0) и/или повышенного количества гликоформы G(1) полипептида.

Изобретение относится к области молекулярной биологии. Предложен способ автоматизированного выделения с одновременной очисткой нуклеиновых кислот из двух и более биологических образцов.

Группа изобретений относится к области производства низина. Предложен способ и технологическая линия микробиологического производства низина.

Изобретение относится к области биохимии. Предложена ферментационная установка для метанассимилирующих микроорганизмов.

Изобретение относится к области биохимии. Предложен аппарат для культивирования микроорганизмов.

Изобретение относится к технологии получения высокомодульного жидкого натриевого стекла (ВМЖС), которое может быть использовано как связующее в антикоррозионных цинксиликатных составах в строительной, химической, нефтехимической промышленности, в сельском хозяйстве, энергетике, добыче полезных ископаемых, а также в объектах военного и космического назначения.

Группа изобретений относится к автоматизированному молекулярному тестированию и методам иммуноанализа для клинического использования при лечении пациентов. Системы для гомогенизации иили лизиса образца содержат одноразовую кассету или кожух, выполненную с возможностью присоединения к приспособлению для анализа и отсоединения от него. Одноразовая кассета содержит первую емкость; вторую емкость; одну или более стенок, образующих закрытую камеру, содержащую впускное отверстие и множество соединений по текучей среде; первую сеть для текучей среды; вторую сеть для текучей среды; вращательный элемент, расположенный в закрытой камере; привод. Причем по меньшей мере одна из указанных одной или более стенок закрытой камеры содержит поверхность с терморегулировкой. Первая сеть для текучей среды соединена по меньшей мере с одним из множества соединений по текучей среде и выполнена с возможностью введения по меньшей мере образца в камеру из первой емкости. Вторая сеть для текучей среды соединена по меньшей мере с одним из множества соединений по текучей среде и выполнена с возможностью извлечения по меньшей мере образца из камеры во вторую емкость. Привод соединен с вращательным элементом одноразовой кассеты и выполнен с возможностью вращения вращательного элемента вокруг оси, проходящей вдоль длины вращательного элемента. Способы лизирования или гомогенизации образца осуществляют следующим образом. Вводят по меньшей мере образец в закрытую камеру через соединение по текучей среде, соединенное с сетью для текучей среды, которая далее соединена с одной или более другими камерами. Вращают вращательный элемент, расположенный в закрытой камере, вдоль оси, проходящей вдоль длины вращательного элемента. Возбуждают множество шариков, расположенных в закрытой камере, посредством перемещения вращательного элемента и проводят лизирование или гомогенизацию образца в закрытой камере посредством перемещения вращательного элемента и множества шариков. Обеспечивается повышение эффективности процесса гомогенизации иили лизиса исследуемого биологического образца. 6 н. и 53 з.п. ф-лы, 26 ил., 3 табл.

Наверх