Апоптоз-индуцирующее средство

Группа изобретений относится к области фармакологии и медицины и касается фармацевтической композиции для индукции апоптоза в клетке, имеющей мутированный KRAS, содержащей эффективное количество лекарственного средства, которое подавляет GST-π; и эффективное количество лекарственного средства, которое подавляет аутофагию. Заявлен также способ индукции апоптоза в клетке, имеющей мутированный KRAS, в частности в раковой клетке с мутацией KRAS. Группа изобретений обеспечивает повышение эффективности апоптоза в клетке. 2 н. и 6 з.п. ф-лы, 18 ил., 6 пр.

 

Область техники

Настоящее изобретение относится к новому применению GST-π и средству его подавления новым, апоптоз-индуцирующим средством, фармацевтической композицией, содержащей апоптоз-индуцирующий средство, и новый терапевтический способ для заболевания, связанного с аномальным апоптозом.

Уровень техники

Рак является одним из самых важных и проблемных заболеваний, с которыми сталкивается человечество, и ведется огромное количество научно-исследовательских работ в области его лечения. Рак является заболеванием, при котором клетки растут бесконтрольно из-за генной мутации, эпигенетической аномалии и т. д. Что касается генетических аномалий при раке, большое количество уже сообщалось (например, Futreal et al., Nat Rev Cancer. 2004; 4 (3): 177-83, etc.), и считается, что многие из них так или иначе связаны с сигнальной трансдукцией, связанной с клеточной пролиферацией, дифференцировкой и выживанием. Кроме того, вследствие таких генетических аномалий, аномалии возникают в сигнальной трансдукции в клетках, состоящих из нормальных молекул, и это приводит к активации или инактивации конкретного сигнального каскада и может в конце концов стать одним из факторов, вызывающих аномальную клеточную пролиферацию. Раннее лечение рака было сосредоточено на подавлении собственно клеточной пролиферации, но так как такое лечение также подавляет пролиферацию клеток с физиологически нормальной пролиферацией, оно сопровождается побочными эффектами, такими как выпадение волос, желудочно-кишечная дисфункция, или подавлением деятельности костного мозга. Для того чтобы уменьшить такие побочные эффекты, предпринимается разработка лекарственных средств для лечения рака на основе новой концепции, такой как молекулярно нацеливаемые лекарственные средства, которые нацеливаются на опухоль-специфические аномалии или аномалии в передаче сигнала.

В качестве рак-специфической генетической аномалии хорошо известна аномалия KRAS (V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog). KRAS представляет собой низкомолекулярный GTP-связывающий белок (называемый также низкомолекулярный G-белок), расположенный ниже по течению от рецептора тирозинкиназы, такого как EGFR или PDGFR, и отвечает за передачу сигнала, связанную с пролиферацией или дифференцировкой от этих рецепторов к расположенному далее МАРK-каскаду. Нормальный KRAS активируется через Grb2 и SOS посредством активации рецептора тирозинкиназы, активированного связыванием лиганда, и фосфорилирует МАРK, такой как Raf, таким образом, чтобы запустить каскад МАРK, но мутированный KRAS постоянно активируется без стимуляции от рецептора и продолжает передавать сигнал к пролиферации. Считается, что из-за этого происходит аномальная клеточная пролиферация.

С одной стороны, экспрессия глутатион-8-трансферазы (GST), которая является одним из ферментов, которые катализируют конъюгацию глутатиона, в особенности GST-π (глутатион S-трансферазу пи, также называемую GSTP1), возрастает в различных раковых клетках, и было отмечено, что существует вероятность, что это является одним из факторов устойчивости к некоторым противоопухолевым агентам. На самом деле, известно, что когда антисмысловая ДНК GST-π или ингибитор GST-π изготовлены, чтобы действовать на раковую клеточную линию, которая сверхэкспрессирует GST-π, и проявляет лекарственную устойчивость, устойчивость к лекарственному средству подавляется (Takahashi and Niitsu, Gan To Kagaku Ryoho. 1994; 21 (7): 945-51, Ban et al., Cancer Res. 1996; 56 (15): 3577-82, Nakajima et al., J Pharmacol Exp Ther. 2003; 306 (3): 861-9). Кроме того, в недавнем сообщении, когда миРНК GST-π изготовленные, чтобы действовать на клеточную линию андроген-независимого рака простаты, которая сверхэкспрессирует GST-π, их пролиферация подавляется и усиливается апоптоз (Hokaiwado et al., Carcinogenesis. 2008; 29 (6): 1134-8). Кроме того, было высказано предположение, что при раке толстого кишечника человека, мутация KRAS, по-видимому, индуцирует сверхэкспрессию GST-π через активацию АР-1 (Miyanishi et al., Gastroenterology. 2001; 121 (4): 865-74).

Тем не менее, до сих пор почти не выяснены отношения между GST-π и клеточной пролиферацией или апоптозом, молекулярный механизм GST-π, а также роль и т. д. GST-π в различных типах внутриклеточной передачи сигнала. Внутриклеточная передача сигнала является очень сложной, одна молекула может влиять на эффект множества молекул, или, наоборот, одна молекула может зависеть от множества молекул, когда эффект определенной молекулы ингибируется, другой сигнальный каскад может активироваться, и часто не может быть получен ожидаемый эффект. Таким образом, необходимо выяснить сложный механизм сигнальной трансдукции клетки для разработки лучших молекулярно нацеливаемых лекарственных средств, но только очень небольшая часть механизма была выяснена в многолетних исследованиях, и для этого требуются дальнейшие исследовательские усилия.

Сущность изобретения

Проблемы, решаемые с помощью изобретения

Задачей настоящего изобретения является обеспечение нового применения GST-π и средства его подавления, композиции для эффективного индукции апоптоза в клетках, и способ их применения.

Средства для решения проблем

При проведении интенсивных исследований с целью выяснения молекулярного механизма GST-π авторы настоящего изобретения обнаружили, что когда экспрессия GST-π ингибируется, активация Raf-1, MEK и ERK значительно ингибируется, и похожим образом в сигнальном каскаде PI3K (фосфоинозитид-3-киназы), который активируется посредством активации рецептора, связанного с G-белком, или рецептором тирозин-киназы, имеет место подавление передачи сигнала, и было выяснено, что хотя апоптоз вызывается ингибированием экспрессии GST-π, аутофагия индуцируется быстрее, чем апоптоз. В результате дальнейших исследований также было обнаружено, что путем подавления аутофагии в то же время, когда происходит ингибирование GST-π, клетки могут быть индуцированы к апоптозу с высокой эффективностью, и таким образом было осуществлено настоящее изобретение.

То есть, настоящее изобретение имеет отношение к следующему.

(1) Средство для индукции апоптоза, средство, содержащее в качестве активных ингредиентов лекарственное средство, которое подавляет GST-π, и лекарственное средство, которое подавляет аутофагию.

(2) Средство для индукции апоптоза в клетке, в которой подавляется GST-π, средство, содержащее в качестве активного ингредиента лекарственное средство, которое подавляет аутофагию.

(3) Средство по (1) или (2), приведенные выше, средство предназначенное для индукции апоптоза в клетке, обладающей мутированным KRAS.

(4) Средство по любому из пунктов с (1) по (3), приведенные выше, в котором активный ингредиент выбирается из группы, состоящей из молекулы RNAi, рибозима, антисмысловой нуклеиновой кислоты, ДНК/РНК химерного полинуклеотида и вектора, экспрессирующего вышеперечисленное.

(5) Фармацевтическая композиция, содержащая средство по любому из пунктов с (1) по (4), приведенных выше.

(6) Фармацевтическая композиция по п. (5), приведенного выше, композиция, предназначенная для использования для лечения заболеваний, вызванных аномальной клеточной пролиферацией.

(7) Фармацевтическая композиция по п. (5), приведенного выше, композиция предназначенная для использования для лечения заболевания, вызванного мутацией KRAS.

(8) Фармацевтическая композиция по п. (5), приведенного выше, композиция предназначенная для применения в лечении рака.

(9) Средство для стимуляции сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, средство, содержащее в качестве активного ингредиента GST-π и/или его функциональный вариант.

(10) Средство для подавления сигнального каскада PI3 K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, средство, содержащее в качестве активного ингредиента лекарственное средство, которое подавляет GST-π.

(11) Средство для подавления убиквитинирования, средство, содержащее в качестве активного ингредиента GST-π и/или его функциональный вариант.

(12) Средство для стимуляции убиквитинирования, средство, содержащее в качестве активного ингредиента лекарственное средство, которое подавляет GST-π.

(13) Средство для подавления аутофагии, средство, содержащее в качестве активного ингредиента GST-π и/или его функциональный вариант.

(14) Средство для стимуляции аутофагии, средство, содержащее в качестве активного ингредиента лекарственное средство, которое подавляет GST-π.

Эффекты изобретения

Поскольку апоптоз-индуцирующее средство по настоящему изобретению может эффективно индуцировать апоптоз по сравнению с обычным средством, его эффективность в качестве фармацевтической композиции также высока. При лечении рака, в частности, так как раковые клетки могут быть убиты посредством апоптоза, возможно не только ингибирование прогрессии рака, но можно ожидать эффект, который приводит к регрессу рака. Кроме того, поскольку тот же самый уровень эффекта, что и от обычной рецептуры могут демонстрироваться при более низкой дозе, чем у обычной рецептуры, становится возможным уменьшить побочные эффекты.

Кроме того, в соответствии с настоящим изобретением стал ясен молекулярный механизм GST-π, и было обнаружено новое применение GST-π или средство для его подавления. Это обеспечивает новые возможности для лечения болезни, экспериментальных методик и т.д., и можно ожидать огромный вклад не только в медицине и ветеринарии, но и в области биологии, биохимии, молекулярной биологии и т. д.

Краткое описание чертежей

Фиг. 1а) представляет собой результат вестерн-блоттинга, показывающего состояние, в котором экспрессия GST-π специфически подавляется посредством миРНК GST-π. Фиг. 1b) является схемой, показывающей изменение числа клеток и уровень экспрессии GST-π на 1-ый - на 4-й день после трансфекции миРНК GST-π.

Фиг. 2 представляет собой результат вестерн-блоттинга, показывающего состояние экспрессии белка, участвующего в сигнальном каскаде RAS/Raf/MAPK на второй день после трансфекции миРНК GST-π. Можно видеть, что сопровождающий подавление экспрессии GST-π, уровень экспрессии белка Raf уменьшается, и кроме того, подавляется фосфорилирование МАРК, таких как МЕК или ERK.

Фиг. 3 показывает результат эксперимента по иммунопреципитации белка Raf. Можно видеть, что в группе, обработанной миРНК GST-π, экспрессия белка Raf и белка Raf, фосфорилированного по Ser621 (π-Raf-l (S621)) слегка уменьшается, в то время как в отличие от этого убиквитинированный белок Raf увеличивается.

Фиг. 4 представляет собой схему сравнения представленности белка Raf, когда трансфектант миРНК GST-π и скремблированный трансфектант миРНК обрабатывали протеасомным ингибитором MG132 и ДМСО, что представлял собой негативный контроль. Было отмечено, что для трансфектанта миРНК GST-π обработка протеасомным ингибитором увеличило представленность фосфорилированного белка Raf (p-Raf-1 (S338)), но никаких изменений не наблюдалось для скремблированной миРНК. То есть, это говорит о том, что за счет подавления экспрессии GST-π фосфорилированный белок Raf подвергается деградации посредством протеасомы, и это соответствует увеличению убиквитинированного белка Raf на Фиг. 3.

Фиг. 5 показывает результаты эксперимента по коиммунопреципитации белка Raf и GST-π. Вследствие реакции с антителом анти-GST-π, показываемой для белка, преципитируемого посредством антитела анти-π-Raf-1, предполагается, что p-Raf-1 и GST-π образуют комплекс.

Фиг. 6 показывает изображение иммунофлюоресцентного окрашивания клеток с нокдауном по GST-π. Верхние ряды представляют собой изображения, окрашенные антителами анти-LC3, и нижние ряды представляют собой изображения, окрашенные DAPI. Слева наверху находятся окрашенные изображения 1-го дня, 2-ого дня и 3-его дня после трансфекции, а слева в нижней части 4-ого дня и 5-ого дня после трансфекции, соответственно. В клетках, отмеченных стрелками на чертеже, точечный сигнал, который можно считать наблюдением аутофагосом, что приводит к выводу, что индуцируется аутофагия.

Фиг. 7 показывает электронно-микроскопические изображения клеток с нокдауном по GST-π в момент времени, когда прошли 2 дня после трансфекции миРНК GST-π. В левой фигуре N обозначает ядро, а правая фигура представляет собой увеличенное изображение фрагмента А, выделенного квадратом. На правой фигуре M обозначает митохондрии, иа L обозначает лизосомы. Было отмечено, что аутофагосомы образовывались таким образом, чтобы окружать митохондрии в местах, показанных стрелками.

Фиг. 8 показывает результаты вестерн-блоттинга экстракта клеток с нокдауном (KD) по GST-π с помощью анти-LC3 антитела. Было отмечено, что в клетках KD по GST-π (миРНК GST-π), экспрессия LC3 заметно возросла по сравнению с контролем (скремблированная миРНК). Поскольку тип LC3-II (LC3-II), в частности, значительно увеличился, это свидетельствует об индукции аутофагосомы.

Фиг. 9 показывает результаты TUNEL-окрашивания. Верхний ряд показывает изображения контрольной группы, а нижний ряд показывает изображения группы KD клеток GST-π. Они показывают слева направо окрашенные изображения на 3-й день, на 4-й день и на 5-й день после трансфекции. В группе KD клеток GST-π наблюдались TUNEL-положительные клетки.

Фиг. 10 представляет собой график (сверху), показывающий изменение с течением времени пропорций аутофагия-положительных клеток и апоптоз-положительных клеток в группе клеток KD GST-π и в контрольной группе клеток в момент времени, когда прошло от 1 до 4 дней после миРНК-трансфекции, и схему (внизу), показывающую уровень экспрессии GST-π в KD клетках GST-π. Это показывает, что в контрольной группе едва ли наблюдались аутофагия или апоптоз, тогда как в группе KD GST-π аутофагия-положительные клетки сначала быстро возрастали с пиком на 2-й день, а затем индуцировался апоптоз.

Фиг. 11 показывает результаты вестерн-блоттинга белков, участвующих в передаче сигналов EGFR/PI3K/Akt/mTOR в KD клетках GST-π. Можно видеть, что в группе KD клеток GST-π фосфорилирование EGFR, PI3K и Akt было в значительной степени подавлено.

Фиг. 12 показывает результаты вестерн-блоттинга, показывающие изменение экспрессии фосфорилированного EGFR (p-EGFR), когда KD клетки GST-π обрабатывали протеасомным ингибитором MG132. Так как снижение уровня экспрессии p-EGFR в KD клетках GST-π было восстановлено посредством обработки протеасомным ингибитором, был сделан вывод о том, что снижение экспрессии p-EGFR произошло вследствие деградации посредством протеасомы.

Фиг. 13 показывает результат вестерн-блоттинга белка, коиммунопреципитированного с использованием анти-p-EGFR. Поскольку сигнал наблюдался для антитела анти-GST-π, был сделан вывод, что p-EGFR и GST-π взаимодействовали друг с другом.

Фиг. 14 показывает результаты при исследовании изменения уровня экспрессии белка Raf и EGFR в зависимости от концентрации ингибитора при использовании ингибитора GST-π С16С2. Было отмечено, что как и в случае с нокдауном GST-π, фосфорилирование EGFR или белка Raf также было подавлено при использовании ингибитора GST-π.

Фиг. 15 представляет собой график, показьшающий изменение числа клеток при добавлении ингибитора GST-π С16С2. Можно видеть, что при добавлении ингибитора GST-π почти не было увеличения числа клеток.

Фиг. 16 представляет собой график, показывающий долю аутофагия-положительных клеток в группе обработанной скремблированной миРНК, группы GST-π KD и группы GST-π KD + 3МА. Можно видеть, что аутофагия, которая была увеличена посредством нокдауна GST-π, подавлялась посредством 3-МА.

Фиг. 17 показывает TUNEL-окрашенные изображения, когда добавляли 3-МА к KD клеткам GST-π. Верхний ряд представляет собой случай, когда 3-МА добавляли в концентрации 1 мМ, а нижний ряд представляет собой случай, когда 3-МА добавляли в концентрации 5 мМ. Он показывает слева направо окрашенные изображений на 2-й день, на 3-й день и на 4-й день после трансфекции. Чем большее количество 3-МА добавляли, тем больше наблюдали апоптотических клеток.

Фиг. 18 представляет собой график, показывающий результаты, когда исследовали процент апоптоза с течением времени в контрольной группе клеток (скремблированная миРНК), в группе KD клеток GST-π (миРНК GST-π), в группе KD клеток GST-π + 1 мМ 3-МА (миРНК GST-π + 1 мМ 3-МА), и в группе KD клеток GST-π + 5 мМ 3-МА (миРНК GST-π + 5 мМ 3-МА). Было обнаружено, что происходило дальнейшее зависимое от дозы 3-МА индуцирование апоптоза.

Варианты выполнения изобретения

Настоящее изобретение относится к средству или композиции для индуцирования апоптоза (далее также называется «апоптоз-индуцирующее средство» или «апоптоз-индуцирующая композиция»), которые содержат в качестве активных ингредиентов лекарственное средство, которое подавляют GST-π и лекарственное средство, которое подавляет аутофагию.

При использовании в настоящем изобретении GST-π обозначает фермент, кодируемый геном GSTP1, который катализирует конъюгацию глутатиона. GST-π присутствует в различных животных, включая человека, и информация о его последовательности известна (например, человеческая: NP_000843 (NM 000852), крысиная: NP 036709 (NM_012577), мышиная: NP_038569 (NM_013541) и др. Числа обозначают номера доступа базы данных NCBI; числа вне скобок представляет собой номера аминокислотной последовательности, а числа внутри скобок представляют собой номера последовательности оснований).

Поскольку существует возможность возникновения мутации в генной последовательности или аминокислотной последовательности между биологическими индивидуумами, которые не ухудшает физиологическую функцию белка, GST-π и ген GSTP1 в настоящем изобретении, не ограничиваются белком или нуклеиновой кислотой, имеющей ту же последовательность, что и выше названные последовательности, а могут включать последовательности, которые имеют последовательность, которая отличается от приведенной выше последовательности одной или более аминокислотами или основаниями, как правило, одной или несколькими, например одной, двумя, тремя, четырьмя, пятью, шестью, семью, восемью, девятью или десятью аминокислотами или основаниями, но обладают функциями, аналогичными тем, что и известные GST-π. Конкретные функции GST-π описываются ниже.

В настоящем описании выражения, такие как «при использовании в настоящем изобретении», «использован в настоящем изобретении», «в настоящем описании» и «описано в настоящем изобретении» означает, если не указано иное, что описание, следующее за ними, относится ко всем изобретениям, описанным в настоящем описании. Кроме того, если иное не определено, все технические термины и научные термины, используемые в настоящем изобретении, имеют то же значение, которое обычно понимается специалистом в данной области техники. Все патенты, патентные публикации и других публикации, указанные в настоящем изобретении, включены в настоящем изобретении в качестве ссылки во всех полноте.

Примеры «лекарственного средства, которое подавляет GST-π», используемого в настоящем изобретении, включают, но не ограничиваются этим, лекарственное средство, которое подавляет продукцию и/или активность GST-π, и лекарственное средство, которое способствует деградации GST-π и/или инактивации. Примеры лекарственного средства, которое подавляет продукцию GST-π, включают, но не ограничиваются этим, молекулы RNAi, рибозим, антисмысловую нуклеиновую кислоту, или ДНК/РНК химерный полинуклеотид для ДНК, кодирующей GST-π, или же вектор, экспрессирующий вышеуказанное.

Примеры лекарственного средства, которое подавляет активность GST-π, включают, но не ограничиваясь этим, вещество, которое связывается с GST-π, такое как, например, глутатион, аналог глутатиона (например, такие, которые описаны в WO 95/08563, WO 96/40205, WO 99/54346, Nakajima et al., 2003, см. выше и т.д.), кетопрофен (Takahashi and Niitsu, 1994, см. выше), индометацин (Hall et al., Cancer Res. 1989; 49 (22): 6265-8), этакриновая кислота, Piloprost (Tew et al., Cancer Res. 1988; 48 (13): 3622-5), антитело анти-GST-π, и доминантный негативный мутант GST-π. Эти лекарственные средства являются либо коммерчески доступными, либо могут быть получены соответствующим образом на основе известных методик.

Лекарственное средство, которое подавляет продукцию или активность GST-π, предпочтительно представляет собой молекулу RNAi, рибозим, антисмысловую нуклеиновую кислоту или ДНК/РНК химерный полинуклеотид для ДНК, кодирующей GST-π, или вектор, экспрессирующий вышеперечисленное, с точки зрения высокой специфичности и низкой вероятности побочных эффектов.

Подавление GST-π может быть определено посредством экспрессии или активности GST-π в клетках, в которых они подавляются по сравнению со случаем, в котором средство, подавляющее GST-π, не используется. Экспрессия GST-π может быть оценена любой известной методикой; примеры включают, но не ограничиваются этим, метод иммунопреципитации с использованием антитела анти-GST-π, EIA, ELISA, IRA, IRMA, метод вестерн-блотинга, иммуногистохимический метод, иммуноцитохимический метод, метод проточной цитометрии, различные методы гибридизации, использующие нуклеиновые кислоты, которые специфически гибридизуются с нуклеиновой кислотой, кодирующей GST-π, или его уникальный фрагмент, или продуктом транскрипции (например, мРНК) или продуктом сплайсинга указанной нуклеиновой кислотой, метод Нозерн-блотинга, метод Саузерн-блотинга, а также различные методы ПЦР.

Кроме того, активность GST-π может быть оценена посредством анализа известной активности GST-π, включая, но не ограничиваясь этим, связывание с белком, таким как, например, Raf-1 (в частности фосфорилированным Raf-1) или EGFR (в частности фосфорилированным EGFR) с помощью любого известного способа, такого как, например, метод иммунопреципитации, метод вестерн-блотинга, метод анализа масс, метод пул-даун, или метод поверхностного плазмонного резонанса (SPR).

При использовании в настоящем изобретении, молекула RNAi обозначает любую молекулу, которая вызывает интерференцию РНК, включая, но не ограничиваясь этим, дуплексную РНК, такую как миРНК (малую интерферирующую РНК), микроРНК (micro RNA), кшРНК (короткошпилечную РНК), ddRNA (ДНК-направляемая РНК), пиРНК (РНК, взаимодействующие по piwi-типу), или rasiRNA (ассоциированная с повторами миРНК) и их модифицированные формы. Эти молекулы RNAi могут быть коммерчески доступными или могут быть сконструированы и получены на основе известной информации о последовательности, и т. д.

Кроме того, при использовании в настоящем изобретении, антисмысловая нуклеиновая кислота включает РНК, ДНК, ПНК, или их комплекс.

При использовании в настоящем изобретении, ДНК/РНК химерный полинуклеотид включает, но не ограничиваясь этим, двухцепочечный полинуклеотид, состоящий из ДНК и РНК, который ингибирует экспрессию гена-мишени, описанный, например, в JP, А, 2003-219893.

При использовании в настоящем изобретении аутофагия может включать в себя макроаутофагию, микроаутофаги, шаперон-опосредованную аутофагию и т. д., но обычно означает макроаутофагию. Таким образом, термин «аутофагия» в настоящем изобретении относится к «макроаутофагии», если не указано иное.

Аутофагия, означающая «самопожирание», является одним из внутриклеточных механизмов деградации белков и отвечает за деградацию и утилизации белков в клетке. Аутофагию можно наблюдать в различных биологических видах, включая дрожжи и млекопитающих и, как правило, сопровождается рядом процессов в том числе: (а) образованием PAS (сайта сборки фагофора), (b) удлинением и расширением фагофора, окружающего белок, предназначенного для деградации (мембранная изоляция) и формированием аутофагосом-инкапсулированного белка, предназначенного для деградации, (с) формированием аутолизосомы путем слияния с аутофагосомы и лизосомы, и (d) деградацией белка внутри аутолизосомы.

Указанные процессы от (а) до (с) включают факторы, специфически связанные с аутофагией. Что касается факторов, связанных с аутофагией, первое исследование было проведено с дрожжами, и большое количество, включая от ATG1 до ATG27, идентифицированы к настоящему моменту (Klionsky et al., Dev Cell. 2003; 5 (4): 539-45); исследования с млекопитающими также продвинулись, были идентифицированы множество гомологов, и основной молекулярный механизм аутофагии становится понятным (Yang and Klionsky, Curr Opin Cell Biol. 2010; 22 (2): 124-31).

Примеры факторов, связанных с аутофагией, участвующих в центральном молекулярном механизме аутофагии у млекопитающих, включают факторы, участвующие в формировании PAS, таких как VMP1, ΤΡ53IΝΡ2, mAtg9, комплекса ULK (состоящий из ULK1, ULK2, mAtgl3 и FIP200), PI3K комплекс (комплекс Atg14L, состоящий из Beclinl, hVPS34, р150, Ambrai и Atg14L, и UVRAG комплекс, состоящий из Beclinl, hVPS34, p 150, Bif-1 и UVRAG) и факторов, участвующих в удлинении фагофора таких как LC3-II и Atg12-Atg5-Atgl6L комплекс.

Таким образом, примеры лекарственного средства, которое подавляет аутофагию, включают, но не ограничиваясь этим, лекарственное средство, которое подавляет образование и/или активность фактора, связанного с аутофагией, такие как описанные выше, и лекарственное средство для содействия деградации и/или инактивации фактора, связанного с аутофагией. Примеры лекарственного средства, которое подавляет выработку фактора, связанного с аутофагией, включают молекулу RNAi, рибозим, антисмысловую нуклеиновую кислоту, или ДНК/РНК химерный полинуклеотид для ДНК, кодирующей фактор, связанный с аутофагией, или вектор, экспрессирующий вышеперечисленное.

Примеры лекарственного средства, которое подавляет активность фактора, связанного с аутофагией, включают, но не ограничиваются этим, ингибитор PI3K (например, вортманнин и т. д.), в частности ингибитор PI3K класса III (например, 3-МА (3-метиладенин) и т. д.), вещество, которое ингибирует слияние с аутофагосомой и лизосомой (например, бафиломицин A1 и т. д.), вещество, которое ингибирует деградацию белков в аутолизосомах (например, хлорохин, лейпептин и т. д.), вещество, которое связывается с фактором, связанным с аутофагией, (например, антитело для фактора, связанного с аутофагией, и т. д.), и доминантно-негативного мутанта фактора, связанного с аутофагией. Эти лекарственные средства являются коммерчески доступными или могут быть получены соответствующим образом на основе известных методик. В одном варианте выполнения настоящего изобретения лекарственное средство, которое подавляет аутофагию, не содержит GST-π и/или его функциональный вариант.

С точки зрения высокой специфичности и редких побочных эффектов лекарственного средства, которое подавляет аутофагию, предпочтительны молекула RNAi, рибозим, антисмысловая нуклеиновая кислота или ДНК/РНК химерный полинуклеотид для ДНК, кодирующей фактор, связанный с аутофагией, или вектор, экспрессирующий вышеперечисленное.

Подавление аутофагии может быть определено посредством наблюдения, что аутофагия подавляется в клетках по сравнению со случаем, в котором не используется агент, подавляющий аутофагию по настоящему изобретению. Ингибирование аутофагии может быть оценено на основе любой известной методики, примеры которых включают, но не ограничиваются этим, обнаружение аутофагосом методом электронной микроскопии и обнаружении маркера аутофагии (например, Atg5, Atg12, LC3, в частности LC3-II и др.). LC3-II может быть обнаружен, например, но не ограничивается этим, посредством использования специфических антител против LC3-II, или может быть обнаружен посредством разделения образца электрофорезом и т. д., и затем детектированием LC3-II, разделенного в виде полосы, которая отличается от LC3-I, с помощью метода вестерн-блотинга и т. д. с использованием антитела, которое реагирует с LC3-II или как с LC3-I, так и с LC3-II. Кроме того, поскольку LC3-I распределен в цитоплазме, в то время LC3-II локализован в аутофагия-специфичной структуре, такой как изолированная мембрана, аутофагосома или аутолизосомы, наличие ряда сигналов в виде пятна, показывающих эти структуры, которые проявляются иммунноокрашиванием и т. д., с антителом, которое вступает в реакцию с LC3-II (включая антитело, которое реагирует как с LC3-I, так и LC3-II), могут быть использованы в качестве индикатора аутофагии.

Лекарственное средство, которое подавляет GST-π, и лекарственное средство, которое подавляет аутофагию, может содержаться в единой композиции или может содержаться отдельно в двух или более составах. В последнем случае каждое лекарственное средство можно вводить одновременно или они могут быть введены с временным интервалом между ними. При введении с временным интервалом между ними, состав, содержащий лекарственное средство, которое подавляет GST-π, можно вводить до композиции, содержащей лекарственное средство, которое подавляет аутофагию или можно вводить после нее.

Настоящее изобретение также относится к средству или композиции для индуцирования апоптоза (далее также называемой «апоптоз-индуцирующее средство» или «апоптоз-индуцирующая композиция») в клетках, в которых подавляется GST-π, средство или композиция, содержащая в качестве активного ингредиента лекарственное средство, которое подавляет аутофагию.

При использовании в настоящем изобретении «подавляется GST-π» включает, например, состояние, при котором подавляется GST-π в клетках, экспрессирующих GST-π. Примеры такого состояния включают в себя состояние, в котором лекарственное средство, которое подавляет GST-π (например, такие, которые описаны выше и т. д.), вводится в клетки, экспрессирующие GST-π.

Экспрессируется ли GST-π в определенных клетках или нет, он известен из литературы или может быть определен посредством обнаружения экспрессии GST-π в клетках. Экспрессия GST-π может быть обнаружена любой известной методикой, включая методики, которые описаны выше.

Средство или композиция по настоящему изобретению может быть средством или композицией для индукции апоптоза в клетках, имеющих мутантный KRAS.

При использовании в настоящем изобретении примеры мутантного KRAS включают, но не ограничиваются этим, такие, которые имеют мутацию, которая вызывает постоянную активацию KRAS, такие как мутация, которая ингибирует эндогенную GTPase, или мутация, которая увеличивает скорость обмена гуанинового нуклеотида. Конкретные примеры такой мутации включают, но не ограничиваются этим, например мутации в аминокислотах 12, 13 и/или 61 в человеческом KRAS (ингибирование эндогенную GTPase) и мутации в аминокислотах 116 и/или 119 в человеческого KRAS (увеличение скорости обмена гуанинового нуклеотида) (Bos, Cancer Res. 1989; 49 (17): 4682-9, Levi et al., Cancer Res. 1991; 51 (13): 3497-502). Таким образом, в одном варианте выполнения настоящего изобретения, мутантный KRAS может быть KRAS, имеющим мутацию по меньшей мере одной из аминокислот 12, 13, 61, 116 и 119 человеческого KRAS. В одном варианте выполнения настоящего изобретения мутантный KRAS имеет мутацию в аминокислоте 12 человеческого KRAS. Кроме того, в одном варианте выполнения настоящего изобретения мутантный KRAS может быть таким, который вызывает сверхэкспрессию GST-π. Таким образом, клетки, имеющие мутированный KRAS, могут проявлять сверхэкспрессию GST-π.

Обнаружение мутантного KRAS может быть осуществлено с использованием любой известной методики. Примеры такой методики включают, но не ограничиваются этим, селективная гибридизация с помощью зонда нуклеиновой кислоты, специфичного к известной мутированной последовательности, способ неспецифического ферментативного расщепления, секвенирование (Bos, 1989, см. выше), и способ ПЦР-ПДРФ (Miyanishi et al., 2001, см. выше).

Кроме того, обнаружение экспрессии GST-π может быть осуществлено с использованием любой известной методики, в том числе методик, которые описаны выше. Сверхэкспрессируется GST-π или нет может быть оценено, например, посредством сравнения степени экспрессии GST-π в клетках, имеющих мутированный KRAS, со степенью экспрессии GST-π в том же типе клеток, имеющих нормальный KRAS. В этом случае можно сказать, что GST-π сверхэкспрессируется, если степень экспрессии GST-π в клетках, имеющих мутантный KRAS, превышает степень экспрессии GST-π в том же типе клеток, имеющих нормальный KRAS.

Количество активного ингредиента, включенного в средство или композицию по настоящему изобретению, может быть таким количеством, которое индуцирует апоптоз, когда вводится средство или композиция. Кроме того, предпочтительно количество, которое не вызывает побочного эффекта, который превышает пользу введения. Такое количество известно или может быть определено надлежащим образом с помощью исследований in vitro с использованием культивируемых клеток и т. д., или посредством исследования на животной модели, такой как мышь, крыса, собака или свиньи, и такие методы исследования хорошо известны специалисту в данной области техники. Индукция апоптоза может быть оценена различными известными методиками, например, посредством обнаружении апоптоз-специфического явления такого как фрагментации ДНК, связывание аннексина V на клеточной мембране, изменение мембранного потенциала митохондрий, или активация каспазы или TUNEL-окрашивание. Количество входящего в состав активного ингредиента может варьироваться в зависимости от способа, которым вводится средство или композиция. Например, когда множество единиц композиции используется для одного введения, количество активного ингредиента, которое должно быть включено в одну единицу композиции, может быть определено посредством деления количества активного ингредиента, необходимого для одного введения посредством указанного множества единиц. Корректировка такого количества композиции может быть осуществлено соответствующим образом специалистом в данной области техники.

Настоящее изобретение также относится к способу для изготовления средства или композиции для индукции апоптоза, включающего введение в качестве активного ингредиента лекарственного средства, которое подавляет GST-π, и лекарственного средства, которое подавляет аутофагию; применение лекарственного средства, которое подавляет GST-π, и лекарственного средства, которое подавляет аутофагию в продуцировании средства или композиции для индукции апоптоза; комбинация лекарственного средства, которое подавляет GST-π, и лекарственного средства, которое подавляет аутофагию, для использования для индукции апоптоза, и способ индукции апоптоза, включающий введение эффективных количеств лекарственного средства, которое подавляет GST-π и лекарственного средства, которое подавляет аутофагию.

Настоящее изобретение также относится к способу для изготовления средства или композиции для индукции апоптоза в клетках, в которых GST-π подавляется, при этом способ содержит включение в состав в качестве активного ингредиента лекарственного средства, которое подавляет аутофагию; использование лекарственного средства, которое подавляет аутофагию в производстве средства или композиции для индукции апоптоза в клетках, в которых GST-π подавляется; лекарственного средства, которое подавляет аутофагию для использования для индукции апоптоза в клетках, в которых GST-π подавляется, и способ индукции апоптоза в клетках, в которой подавляется GST-π, причем способ включает введение эффективного количества препарата, который подавляет аутофагию.

Лекарственное средство или его количество в композиции в вышеупомянутом способе производства или применение описаны выше. Приготовление лекарственной формы каждого лекарственного средства может быть осуществлено в соответствии с любой известной методикой.

Все вышеперечисленные методы индукции апоптоза могут быть либо методом in vitro или методом in vivo. Кроме того, лекарственные средства в этих способах используются такие, как описано выше, и эффективное количество лекарственного средства может быть таким количеством, которое индуцирует апоптоз в клетках, в которые оно вводится. Также предпочтительно количество, которое не вызывает неблагоприятное воздействие, которое превышает положительный эффект введения. Такое количество известно или может быть определено надлежащим образом с помощью исследований in vitro с использованием культивируемых клеток и т. д., и такой метод исследования хорошо известен специалисту в данной области техники. Индукция апоптоза может быть оценена различными известными методиками, в том числе теми, которые описаны выше. Эффективное количество, описанное выше, не обязательно должны быть таким, которое индуцирует апоптоз во всех клетках клеточной популяции, в которые вводится лекарственное средство. Например, эффективное количество, описанное выше, может быть таким количеством, которое индуцирует апоптоз в клеточной популяции по меньшей мере в 1% клеток, по меньшей мере в 2%, по меньшей мере в 3%, по меньшей мере в 4%, по меньшей мере в 5%, по меньшей мере в 6%, по меньшей мере в 8%, по меньшей мере в 10%, по меньшей мере в 12%, по меньшей мере в 15%, по меньшей мере в 20%, по меньшей мере в 25% и т. д.

Апоптоз-индуцирующее средство по настоящему изобретению может эффективно индуцировать апоптоз даже в клетках, имеющих нарушения в пролиферации клеток и т. д., и является эффективным в качестве компонента фармацевтической композиции. Таким образом, один аспект настоящего изобретения включает фармацевтическую композицию, содержащую апоптоз-индуцирующее средство в соответствии с настоящим изобретением.

Фармацевтическая композиция по настоящему изобретению является эффективной для лечении заболевания, в котором существует, в частности, аномальный апоптоз. Таким образом, один вариант выполнения настоящего изобретения относится к фармацевтической композиции для лечения заболевания, в котором существует аномальный апоптоз, фармацевтическая композиция, содержащая апоптоз-индуцирующее средство. При использовании в настоящем изобретении примеры заболевания, при котором существует аномальный апоптоз, включают, но не ограничиваются этим, заболевания вследствие нарушений в клеточной пролиферации, болезни вследствие мутации KRAS, и заболеваний, обусловленных сверхэкспрессией GST-π. Примеры заболевания вследствие нарушений в клеточной пролиферации включают, но не ограничиваются этим, доброкачественную или злокачественную опухоль, гиперплазию, келоид, синдром Кушинга, первичный альдостеронизм, эритроплакию, истинную полицитемию, лейкоплакию, гиперплазированный шрам, красный плоский лишай и лентигиноз. Примеры заболеваний, обусловленных мутацией KRAS, включают, но не ограничиваются этим, доброкачественную или злокачественную опухоль (также называемую раком или злокачественным новообразованием). Примеры заболеваний, обусловленных сверхэкспрессией GST-π, включают, но не ограничиваются этим, доброкачественную или злокачественную опухоль, в частности злокачественную опухоль с лекарственной устойчивостью (например, устойчивостью к алкилирующим агентам, таким как мелфалан или циклофосфамид, противоопухолевым антибиотикам на основе антрациклина, таким как адриамицин, платиновый комплекс, такой как цисплатин, этопозид и т. д.). В одном варианте выполнения настоящего изобретения заболевание, при котором наблюдается аномальный апоптоз, представляет собой рак.

Примеры рака в настоящем изобретении включают, но не ограничиваются этим, саркому, такую как фибросаркома, злокачественную фиброзную гистиоцитому, липосаркому, рабдомиосаркому, лейомиосаркому, ангиосаркому, саркому Калоши, лимфангиосаркому, синовиальную саркому, хондросаркому и остеосаркому, карциному, такую как опухоль головного мозга, рак головы и шеи, рак молочной железы, рак легкого, рак пищевода, рак желудка, карцинома двенадцатиперстной кишки, рак аппендикса, карцинома толстой кишки, карцинома прямой кишки, рак печени, рак поджелудочной железы, рак желчного пузыря, рак желчных протоков, рак анального отверстия, карциному почек, карциному мочеточника, рак мочевого пузыря, рак предстательной железы, с полового члена, рак яичек, рак матки, рак яичника, рак вульвы, вагинальный рак и рак кожи и, кроме того, лейкоз и злокачественную лимфому. В настоящем изобретении «рак» включает эпителиальные новообразования и неэпителиальные новообразования. Рак в настоящем изобретении может присутствовать в любом месте тела, например, в головном мозге, на головы и шеи, в груди, на конечностей, в легких, в сердце, в тимусе, в пищеводе, в желудке, в тонкой кишке (двенадцатиперстной кишке, тощей кишке, подвздошной кишке), в толстой кишке (ободочной кишке, слепой кишке, аппендиксе, прямой кишке), в печени, в поджелудочной железе, в желчном пузыре, в анусе, в почках, в мочевом канале, в мочевом пузыре, в предстательной железе, в половом члене, в яичках, в матке, в яичниках, в вульве, во влагалище, на коже, в поперечно-полосатых мышцах, в гладких мышцах, в синовиальной мембране, в хряще, в кости, в щитовидной железе, в надпочечниках, в брюшине, в брыжейке, в костном мозге, в крови, в сосудистой системе, в лимфатической системе, например в лимфатическом узле, в лимфатической жидкости и т.д.

В одном варианте выполнения настоящего изобретения, рак включает раковые клетки, имеющие мутированный KRAS, определенный выше. В одном варианте выполнения настоящего изобретения рак включает раковые клетки, которые демонстрируют пролиферацию, независимую от гормонов или факторов роста. В одном варианте выполнения настоящего изобретения, рак включает раковые клетки, проявляющие сверхэкспрессию GST-π. В одном варианте выполнения настоящего изобретения рак обладает лекарственной устойчивостью. В одном варианте выполнения настоящего изобретения рак обладает устойчивостью к лекарственному средству, выбранному из группы, состоящей из алкилирующих агентов, таких как мелфалан или циклофосфамид, противоопухолевого антибиотика основе антрациклина, такого как адриамицин, комплекса платины, такого как цисплатин, и этопозид. В одном варианте выполнения настоящего изобретения, рак имеет устойчивость к лекарственному средству, выбранному из группы, состоящей из мелфалана, циклофосфамида, адриамицина, цисплатина и этопозида.

Настоящее изобретение также относится к фармацевтической композиции для лечения заболевания, в котором существует аномальный апоптоз, композиция, содержащая в качестве активных ингредиентов лекарственное средство, которое подавляет GST-π, и лекарственное средство, которое подавляет аутофагию; способ получения фармацевтической композиции для лечения заболевания, при котором наблюдается анормальный апоптоз, включающий разработку в качестве активных ингредиентов лекарственное средство, которое подавляет GST-π, и лекарственное средство, которое подавляет аутофагию, применение лекарственного средства, которое подавляет GST-π, и лекарственного средства, которое подавляет аутофагию, для производства фармацевтической композиция для лечения заболевания, при котором существует аномальный апоптоз; комбинация лекарственного средства, которое подавляет GST-π, и лекарственного средства, которое подавляет аутофагию, для применения при лечении заболевания, в котором существует аномальный апоптоз; и способ лечения заболевания при котором существует аномальный апоптоз, способ включающий введение эффективного количества фармацевтической композиции субъекту, который требует такое лечение.

Лекарственное средство, количество лекарственной формы и болезнь, при которой наблюдается аномальный апоптоз, в процессе производства или применения, описаны выше. Изготовление лекарственной формы каждого лекарственного средства может быть осуществлено в соответствии с любой известной методикой.

Авторам настоящего изобретения в настоящее время стало очевидно, что GST-π связывается с рецептором тирозин-киназы, который находится в верхней части сигнального каскада PI3K/Akt/mTOR, в частности к его фосфорилированной форме, а также к Raf, который является составной частью молекулы сигнального каскада RAS/Raf/MAPK, в частности к его фосфорилированной форме, чтобы, таким образом, ингибировать убиквитинирование этих молекул, тем самым стимулируя эти сигнальные каскады. Таким образом, настоящее изобретение также относится к средству или композиции для стимулирования сигнального каскада PI3 K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK (также называемого «стимулятором сигнального каскада» или «композицией, стимулирующей сигнальный каскад»), средству или композиции, содержащими в качестве активного ингредиента GST-π и/или его функциональный вариант. В частности, средство или композиция по настоящему изобретению может стимулировать как сигнальный каскад PI3K/Akt/mTOR, так и сигнальный каскад RAS/Raf/MAPK одновременно.

Примеры «GST-π функционального варианта», используемого в настоящем изобретении, включают, но не ограничиваются этим, (i) вариант, который имеет одну или больше мутаций, как правило, одно или несколько в аминокислотной последовательности GST-π, но все еще имеет функцию, эквивалентную GST-π, (ii) вариант, который кодируется нуклеиновой кислотой, имеющей последовательность оснований, кодирующую ген GST-π, или нуклеиновую кислоту, содержащую одну или больше мутаций, как правило, одну или несколько, в последовательности оснований нуклеиновой кислоты, кодирующей тот же полипептид, что и кодируемый нуклеиновой кислотой, упомянутой выше, и имеет функцию эквивалентную GST-π, (iii) вариант, который кодируется нуклеиновой кислотой, которая гибридизуется при строгих условиях с комплементарной цепью нуклеиновой кислоты, имеющей последовательность оснований гена, кодирующего GST-π, нуклеиновую кислоту, кодирующую тот же полипептид, что и кодируемый нуклеиновой кислотой, упомянутой выше, или нуклеиновую кислоту, кодирующую вариант (ii), или фрагмент комплементарной цепи, и имеет функцию, эквивалентную GST-π, (iv) вариант, который имеет аминокислотную последовательность, имеющую гомологию по меньшей мере на 60%, предпочтительно по меньшей мере на 70%, более предпочтительно по меньшей мере на 80%, еще более предпочтительно по меньшей мере на 90%, и особенно предпочтительно по меньшей мере на 95% с аминокислотной последовательностью GST-π, и имеет функцию, эквивалентную GST-π, и (v) вариант, который кодируется нуклеиновой кислотой, имеющей гомологию по меньшей мере на 60%, предпочтительно по меньшей мере на 70%, более предпочтительно по меньшей мере на 80%, еще более предпочтительно по меньшей мере на 90 % и особенно предпочтительно по меньшей мере на 95% с последовательностью оснований гена, кодирующего GST-π, и имеет функцию эквивалентную GST-π.

Аминокислотная последовательность GST-π и нуклеотидная последовательность гена, кодирующего GST-π, известны для различных видов животных, как описано выше, и специалист в данной области техники может надлежащим образом получить вышеуказанные функциональные варианты, основанные на информация об этих последовательностях любой известной методикой, например химическим синтезом, расщеплением или вставкой нуклеиновой кислоты с помощью рестрикционного фермента, сайт-направленным мутагенезом, применением радиации или ультрафиолетовых лучей и т. д.

Будет ли или не будет данный вариант иметь функцию, эквивалентную GST-π, может быть оценено посредством анализа известной функции GST-π, включая, например, но не ограничиваясь этим, связывание с белком, таким как Raf-1 (в частности, фосфорилированным Raf-1) или EGFR (в частности, фосфорилированным EGFR), любым известным способом, таким как, например, метод иммунопреципитации, метод вестерн-блоттинга, метод анализа масс, метод пулдаун, или метод поверхностного плазмонного резонанса (SPR) и, сравнивая ее с соответствующим отрицательным контролем или с GST-π качестве положительного контроля. Например, когда функция данного варианта превосходит отрицательный контроль, например, когда она превосходит по меньшей мере на 10%, по меньшей мере на 25%, по меньшей мере на 50%, по меньшей мере на 75 % или по меньшей мере на 100% и/или когда функция составляет не менее 1/100 от GST-π, по меньшей мере 1/50, по меньшей мере 1/25, по меньшей мере 1/10, по меньшей мере 1/5 или по меньшей мере 1/2, этот вариант включается в функциональные варианты GST-π.

Термин «жесткие условия», используемый в настоящем изобретении, является известным параметром в данной области техники и описан в стандартном протоколе, таком как, например, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press (2001) или Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992).

Строгие условия в настоящем изобретении означает, например, гибридизацию при 65°С с помощью гибридизационного буфера, содержащего 3,5 × SSC (0,15 M хлорида натрия/0,15 M цитрата натрий pH 7, Ficoll 0,02%, поливинилпирролидон 0,02%, бычий сывороточный альбумин 0,02%, 25 мМ NaH2PO4 (pH 7), 0,05% SDS, и 2 мМ ЭДТА. После гибридизации мембрана, на которую перенесли ДНК промывали 2 × SSC при комнатной температуре, а затем от 0,1 до 0,5 × SSC/0,1 × ДСН при температуре до 68°C. Альтернативно, жесткая гибридизация может осуществляться с использованием коммерческого гибридизационного буфера, такого как ExpressHyb(R) Hybridization Solution (Clontech) при условиях гибридизации и промывки, описанных производителем.

Существуют и другие применимые условия, реагенты и т. д., которые могут привести к той же степенью жесткости, но, поскольку можно ожидать, что специалист в данной области техники должен быть знаком с такими условиями, они конкретно не упоминаются в настоящем изобретении. Тем не менее, можно манипулировать условиями для того, чтобы четко идентифицировать нуклеиновую кислоту, кодирующую вариант GST-π.

GST-π и/или его функциональный вариант в настоящем изобретении, включают, в дополнение к GST-π и его функциональному варианту, в качестве белков, нуклеиновую кислоту, кодирующую GST-π, и нуклеиновую кислоту, кодирующую функциональный вариант GST-π.

При использовании в настоящем изобретении «сигнальный каскадный» означает сигнальную трансдукцию, через которую множество сигнальных молекул передают сигнал в последовательность. Например, в случае «сигнального каскада PI3K/Akt/mTOR», сигнал передается таким образом, что сначала активируется PI3K, что затем приводит к активации Akt, и это затем приводит к активации mTOR. Это также применимо к обозначениям других сигнальных каскадов. Что касается взаимосвязи между до и после сигнализации, цепь активации может вызываться непосредственно или косвенно. Например, известно, что активация Akt, вызванная посредством PI3K, опосредуется молекулами, такими как PIP3 (Фосфатидилинозитол (3,4,5) трифосфат) и PDK1 (Фосфатидилинозитид-зависимая протеинкиназа 1, также называемая PDPK1).

Сигнальный каскад PI3K/Akt/mTOR является сигнальным каскадом, который приводится в действие посредством активации PI3K и, как известно, участвует в сигнализации выживаемости клеток и т. д. Примеры того, каким образом происходит активация PI3K, включают, но не ограничиваются этим, связывание лиганда с рецептором, связанный с G-белком или рецептором тирозин-киназы, и активированная PI3K фосфорилирует инозитольный фосфолипид, таким образом продуцируя фосфатидилинозитол, такой как PIP3. Он связывается с PDK1 или Akt в РН домене, тем самым стимулируя локализацию этих белков в мембране. PDK1 связывается с PIP3, чтобы таким образом быть активированным в мембране, и активированная PDK1 фосфорилирует Τ на 308-м положении Akt. Серии в 473-ом положении Akt фосфорилируется посредством mTORC2, который является одним из mTOR-комплексов, и Akt полностью активируется в результате фосфорилирования аминокислот в этих двух позициях.

Хотя путь для активации Акт mTOR не до конца выяснен, считается, что участвует PRAS40 (богатый пролином субстрат Akt/PKB 40 кДа). PRAS40 является субстратом Akt, как следует из названия, и является молекулой, которая, как полагают, связывается с mTOR-комплексом, таким образом подавляя его активацию, и считается, что когда Akt активируется, PRAS40 фосфорилируется, тем самым вызывая высвобождение PRAS40 из mTOR-комплекса для активирования mTOR. Когда mTOR активирован, ULK1 и ULK2 (unc-51-подобная киназа) и mAtg13 (млекопитающих связанная с аутофагией 13) фосфорилируются, ингибируя таким образом инициацию сигнализации аутофагии, таким образом подавляя аутофагию.

С другой стороны, сигнальный каскад RAS/Raf/MAPK является сигнальным каскадом, который связан с клеточной пролиферацией и т. д. Когда лиганд, такой как например, фактор роста связывается с рецептором, связанным с G-белком, или рецептором тирозин-киназы, KRAS, который представляет собой низкомолекулярный G-белок, активируется, и активированный KRAS фосфорилирует Raf (своего рода MAPKKK), таким образом активируя его. Активированный Раф активирует MEK (MAPK/ERK киназу, вид MAP2K), и активированный MEK активирует ERK (внеклеточную сигнал-регулируемую киназу, вид МАРК). Активированный ERK транслоцируется в ядро и стимулирует транскрипцию различных мРНК в ядре, таким образом вызывает клеточную пролиферацию.

В настоящем изобретении стимуляция сигнального каскада, означает не только усиление активации сигнального каскада, но также подавление инактивации сигнального каскада. Будет ли сигнальный каскад стимулироваться или нет, может быть определено посредством активации сигнального каскада по сравнению со случаем, в котором агент или композиция по настоящему изобретению не используется. Активация сигнального каскада может быть оценена путем обнаружения, например, но не ограничиваясь этим, клеточного явления в результате активации молекулы, составляющей сигнального каскада (например, фосфорилирование и т. п. ) или активации сигнального каскада, такого как, например, как подавление аутофагии и т. д., в случае сигнального каскада PI3K/Akt/mTOR, или пролиферации клеток и т. д. в случае сигнального каскада RAS/Raf/MAPK.

Настоящее изобретение также относится к способу для изготовления средства или композиции для стимуляции сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, причем способ включает в себя стадию изготовления лекарственной формы GST-π и/или его функционального варианта, применение GST-π и/или его функционального варианта в производстве агента или композиции для стимуляции сигнального каскада, PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK; GST-π и/или его функционального варианта для применения в стимуляции сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK и способ для стимуляции сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, причем способ включает введение эффективного количества GST-π и/или его функционального варианта.

Средство или композиция для стимуляции сигнального каскада в соответствии с настоящим изобретением является полезным для лечения заболевания, связанного с аномалией сигнального каскада PBK/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, в частности с подавление этих сигнальных каскадов. Примеры таких заболеваний включают, но не ограничиваются этим, болезнь, сопровождаемая подавлением экспрессии или активности и/или увеличением деградации или инактивации молекулы, входящей в состав этих сигнальных каскадов (например, вследствие генетических аномалий этих молекул, подавления экспрессии или активности GST-π и т. д.).

Таким образом, настоящее изобретение также относится к фармацевтической композиции для лечения заболевания, связанного с подавлением сигнального каскада PBK/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, фармацевтической композиции, содержащей в качестве активного ингредиента GST-π и/или его функциональный вариант; способ получения фармацевтической композиции для лечения заболевания, связанного с подавлением сигнального каскада PBK/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, способ, включающий стадию изготовления лекарственной формы GST-π и/или его функционального варианта; применения GST-π и/или его функционального варианта в производстве фармацевтической композиции для лечения заболевания, связанного с подавлением сигнального каскада PBK/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK; GST-π и/или его функционального варианта для применения в лечении заболевания, связанного с подавлением сигнального каскада PBK/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK; и способ лечения заболевания, связанного с подавлением сигнального каскада PBK/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, включающий введение эффективного количества GST-π и/или его функционального варианта.

Настоящее изобретение также относится к средству или композиции для подавления сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK (также называемого «средство, подавляющее сигнальный каскад» или «композиция, подавляющая сигнальный каскад»), средству или композиции, содержащим в качестве активного ингредиента лекарственное средство, которое подавляет GST-π.

В настоящем изобретении подавление сигнального каскада, означает не только индуцирование инактивации сигнального каскада, но и подавление активации сигнального каскада. Будет или не будет подавляется сигнальный каскад, можно определить посредством подавления сигнального каскада по сравнению со случаем, в котором средство или композиция по настоящему изобретению не используются. Подавление сигнального каскада может быть оценено посредством обнаружения, например, но не ограничиваясь этим, снижения активации (например, фосфорилирования и т. п. ) молекулы составляющей сигнального каскада или клеточного феномена, в результате подавления сигнального каскада, такого как, например, увеличение аутофагии и т. д. в случае сигнального каскада PI3K/Akt/mTOR или подавление пролиферации клеток и т. д. в случае сигнального каскада RAS/Raf/MAPK.

Настоящее изобретение также относится к способу изготовления средства или композиции для подавления сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, включающий стадию изготовления лекарственной формы лекарственного средства, которое подавляет GST-π, применение лекарственного средства, которое подавляет GST-π, в производстве средства или композиции для подавления сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK; лекарственное средство, которое подавляет GST-π, для применения в подавлении сигнала каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK и способ для подавления сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, включающий введение эффективного количества препарата, который подавляет GST-π.

Средство или композиция для подавления сигнального каскада, согласно настоящему изобретению является полезным для лечения заболевания, связанного с аномалией сигнального каскада PI3 K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, в особенности с активацией из этих сигнальных каскадов. Примеры таких заболеваний включают, но не ограничиваются этим, заболевание, связанное с увеличением экспрессии или активности и/или подавлением деградации или инактивации активации молекулы, являющейся составной частью этих сигнальных каскадов (например, из-за генетических аномалий этих молекул, увеличения экспрессии или активности GST-π), и заболевание, связанное с активацией сигнального каскада посредством фактора, отличного от молекулы, являющейся составной частью этих сигнальных каскадов (например, активация рецептора тирозинкиназы и т. д.).

Таким образом, настоящее изобретение также относится к фармацевтической композиции для лечения заболевания, связанного с активацией сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, фармацевтической композиции, содержащей в качестве активного ингредиента лекарственное средство, которое подавляет GST-π; способ получения фармацевтической композиции для лечения заболевания, связанного с активацией сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/Raf/MAPK, включающий в себя стадию изготовления лекарственной формы, которое подавляет GST-π, применение лекарственного средства, которое подавляет GST-π, в производстве фармацевтической композиции для лечения заболевания, связанного с активацией сигнального каскада PI3 К/Akt/mTOR и/или сигнального каскада RAS/RafTMAPK; лекарственное средство, которое подавляет GST-π, для применения для лечения заболевания, связанного с активацией сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/RafTMAPK; и к способу лечения заболевания, связанного с активацией сигнального каскада PI3K/Akt/mTOR и/или сигнального каскада RAS/RafTMAPK, причем способ включает введение эффективного количества лекарственного средства, которое подавляет GST-π.

Настоящее изобретение также относится к средству или композиции для подавления убиквитинирования (также называемого «средство, подавляющее убиквитинирование» или «композиция, подавляющая убиквитинирование»), средство или композиция, содержащая в качестве активного ингредиента GST-π и/или его функциональный вариант.

Убиквитинирование означает, что убиквитин связывается с белком и участвует в процессе удаления белка, который становится ненужным в клетке. Убиквитинированный белок деградирует в протеасоме.

В одном варианте выполнения настоящего изобретения белок, для которого подавляется убиквитинирование, представляет собой белок, с которым GST-π может связываться. Кроме того, в одном варианте выполнения настоящего изобретения, белок, для которого подавляется убиквитинирование, выбирается из группы, состоящей из белка, входящего в состав сигнального каскада RAS/Raf/MAPK, белка, входящего в состав сигнального каскада PBK/Akt/mTOR, и рецептора тирозинкиназы. В предпочтительном варианте выполнения настоящего изобретения белок, для которого подавляется убиквитинирование, выбирают из группы, состоящей из EGFR и Raf-1, в особенности его фосфорилированная форма.

В настоящем изобретении подавление убиквитинирования может быть определено посредством сравнения подавления убиквитинирования по сравнению со случаем, в котором средство или композиция по настоящему изобретению не используется. Подавление убиквитинирования может быть оценено любым известным способом, например, но не ограничиваясь этим, методом иммунопреципитации, методом вестерн-блоттинга, методом анализа масса, методом пулдаун и т. д.

Настоящее изобретение также относится к способу для изготовления средства или композиции для подавления убиквитинирования, включающий в себя стадию разработки рецептуры GST-π и/или его функционального варианта; применение GST-π и/или его функционального варианта в производстве средства или композиции для подавления убиквитинирования; GST-π и/или его функциональный вариант для применения для подавления убиквитинирования и способ для подавления убиквитинирования, причем способ включает введение эффективного количества GST-π и/или его функционального варианта.

Средство или композиция для подавления убиквитинирования в соответствии с настоящим изобретением является полезным для лечения заболевания, связанного с гиперубиквитилированием. Примеры таких заболеваний включают, но не ограничиваются этим, болезнь, сопровождающаяся увеличением экспрессии или активности, и/или подавлением деградации или инактивации убиквитин-лигазы (например, вследствие генетических аномалий убиквитин-лигазы, подавление экспрессии или активности GST-π и т. д.).

Таким образом, настоящее изобретение также относится к фармацевтической композиции для лечения заболевания, связанного с гиперубиквитилированием, фармацевтическая композиция, содержащая в качестве активного ингредиента GST-π и/или его функциональный вариант; способ получения фармацевтической композиции для лечения заболевания, связанного с гиперубиквитилированием, при этом способ включает в себя стадию разработки рецептуры GST-π и/или его функционального варианта; применение GST-π и/или его функционального варианта для производства фармацевтической композиции для лечения заболевания, связанного с гиперубиквитилированием; GST-π и/или его функциональный вариант для применения в лечении заболевания, связанного с гиперубиквитилированием; и способ лечения заболевания, связанного с гиперубиквитилированием, причем способ включает введение эффективного количества GST-π и/или его функционального варианта.

Настоящее изобретение также относится к средству или композиции для стимуляции убиквитинирования (также называемого «средство, стимулирующее убиквитинирование» или «композиция, стимулирующая убиквитинирование»), средство или композиция, содержащая в качестве активного ингредиента лекарственное средство, которое подавляет GST-π.

В одном варианте выполнения настоящего изобретения белок, для которого убиквитинирование стимулируется, представляет собой белок, с которым GST-π может связываться. Кроме того, в одном варианте выполнения настоящего изобретения, белок, для которого убиквитинирование стимулируется, выбирается из группы, состоящей из белка, входящего в состав сигнального каскада RAS/Raf/MAPK, белка, входящего в состав сигнального каскада PBK/Akt/mTOR, и рецептора тирозинкиназы. В предпочтительном варианте выполнения настоящего изобретения белок, для которого убиквитинирование стимулируется, выбирают из группы, состоящей из EGFR и Raf-1, в особенности его фосфорилированная форма.

В настоящем изобретении стимулирование убиквитинирования может быть определено посредством сравнения стимулирования убиквитинирования по сравнению со случаем, в котором средство или композиция по настоящему изобретению не используется. Стимулирование убиквитинирования может быть оценено любым известным способом, например, но не ограничиваясь этим, методом иммунопреципитации, методом вестерн-блоттинга, методом анализа масс, методом пулдаун и т. п.

Настоящее изобретение также относится к способу для изготовления средства или композиции для стимулирования убиквитинирования, при этом способ включает в себя стадию разработки рецептуры лекарственного средства, которое подавляет GST-π, применение лекарственного средства, которое подавляет GST-π, для производства средства или композиции для стимулирования убиквитинирования; лекарственного средства, которое подавляет GST-π, для использования для стимулирования убиквитинирования и способ для стимулирования убиквитинирования, причем способ включает введение эффективного количества лекарственного средства, которое подавляет GST-π.

Средство или композиция для стимуляции убиквитинирования в соответствии с настоящим изобретением является полезным в лечении заболевания, связанного с подавлением убиквитинирования. Примеры таких заболеваний включают, но не ограничиваются этим, заболевание, связанное с подавлением экспрессии или активности и/или увеличением деградации или инактивации убиквитин-лигазы (например, вследствие генетических аномалий убиквитин-лигазы, увеличением экспрессии или активности GST-π и т. д.).

Таким образом, настоящее изобретение также относится к фармацевтической композиции для лечения заболевания, связанного с подавлением убиквитинирования, фармацевтической композиции, содержащей в качестве активного ингредиента лекарственное средство, которое подавляет GST-π; к способу получения фармацевтической композиции для лечения заболевания, связанного с подавлением убиквитинирования, при этом способ включает в себя стадию разработки рецептуры лекарственного средства, которое подавляет GST-π, применение лекарственного средства, которое подавляет GST-π, при производстве фармацевтической композиции для лечения заболевания, связанного с подавлением убиквитинирования; лекарственного средства, которое подавляет GST-π, для применения в лечении заболевания, связанного с подавлением убиквитинирования; и к способу лечения заболевания, связанного с подавлением убиквитинирования, причем способ включает введение эффективного количества препарата, который подавляет GST-π.

Настоящее изобретение также относится к средству или композиции для подавления аутофагии (также называемого «средство, подавляющее аутофагию» или «композиция, подавляющая аутофагию»), средству или композиции, содержащей в качестве активного ингредиента GST-π и/или его функциональный вариант. Авторам настоящего изобретения в настоящий момент стало очевидным, что GST-π связывается с рецептором тирозин-киназы, в особенности в своей фосфорилированной форме, которая находится на верхней части сигнального каскада PI3K/Akt/mTOR, чтобы таким образом ингибировать его убиквитинирование, тем самым стимулируя сигнальный каскад; известно, что активация сигнального каскада PI3K/Akt/mTOR подавляет аутофагию (например, Yang and Klionsky, 2010, см. выше).

В настоящем изобретении подавление аутофагии может быть определено посредством сравнения подавления аутофагии в клетках по сравнению со случаем, в котором средство или композиция по настоящему изобретению не используется. Методика для оценки аутофагии описана выше.

Настоящее изобретение также относится к способу изготовления средства или композиции для подавления аутофагии, включающий в себя стадию разработки рецептуры GST-π и/или его функционального варианта; применение GST-π и/или его функционального варианта в производстве средства или композиции для подавления аутофагии; GST-π и/или его функциональный вариант для использования в подавлении аутофагии и способ для подавления аутофагии, причем способ включает введение эффективного количества GST-π и/или его функционального варианта.

Средство или композиция для подавления аутофагии по настоящему изобретению является полезным для лечения заболевания, связанного с повышенной аутофагией. Примеры таких заболеваний включают, но не ограничиваются этим, заболевание, связанное с подавлением сигнального каскада PBK/Akt/mTOR (например, из-за генетической аномалии молекулы, входящей в сигнальный каскад PDK/Akt/mTOR, и/или молекула выше по потоку, подавление экспрессии или активности GST-π и т. д.), миопатию, поражение печени, реперфузионное повреждение и т. д.

Таким образом, настоящее изобретение также относится к фармацевтической композиции для лечения заболевания, связанного с повышенной аутофагией, фармацевтическая композиция, содержащая в качестве активного ингредиента GST-π и/или его функциональный вариант; способ получения фармацевтической композиции для лечения заболевания, связанного с повышенной аутофагией, причем способ включает в себя стадию разработки рецептуры GST-π и/или его функционального варианта; применение GST-π и/или его функционального варианта в производстве фармацевтической композиции для лечения заболевания, связанного с повышенной аутофагией; GST-π и/или его функциональный вариант для применения в лечении заболевания, связанного с повышенной аутофагией; и способ лечения заболевания, связанного с повышенной аутофагией, причем способ включает введение эффективного количества GST-π и/или его функционального варианта субъекту, для которого требуется такое лечение.

Кроме того, авторам настоящего изобретения в настоящее время стало очевидно, что аутофагия способствует подавлению GST-π. Таким образом, настоящее изобретение также относится к средству или композиции для стимуляции аутофагии (также называемого «средство, стимулирующее аутофагию» или «композиция, стимулирующая аутофагию»), содержащие в качестве активного ингредиента лекарственное средство, которое подавляет GST-π. Настоящее изобретение также относится к способу для изготовления средства или композиции для стимуляции аутофагии, при этом способ включает в себя стадию разработки рецептуры лекарственного средства, которое подавляет GST-π, применение лекарственного средства, которое подавляет GST-π, для производства средства или композиции для стимуляции аутофагии; лекарственное средство, которое подавляет GST-π, для применения для стимуляции аутофагии и способ для стимуляции аутофагии, причем способ включает введение эффективного количества лекарственного средства, которое подавляет GST-π.

Средство или композиция для стимуляции аутофагии по настоящему изобретению является полезным для лечения заболевания, связанного с подавлением аутофагии и т. д. Примеры таких заболеваний включают, но не ограничиваются этим, заболевание, связанное с активацией сигнального каскада PBK/AKT/mTOR (например, из-за генетической аномалии молекулы, входящей в сигнальный каскад PI3K/Akt/mTOR, и/или молекулы выше по течению, увеличение экспрессии или активности GST-π и т. д.), старение и ишемическую болезнь.

Таким образом, настоящее изобретение также относится к фармацевтической композиции для лечения заболевания, связанного с подавлением аутофагии, фармацевтическая композиция, содержащая в качестве активного ингредиента лекарственное средство, которое подавляет GST-π; способ получения фармацевтической композиции для лечения заболевания, связанного с подавлением аутофагии, причем способ включает в себя стадию разработки рецептуры лекарственного средства, которое подавляет GST-π, применение лекарственного средства, которое подавляет GST-π, при производстве фармацевтической композиции для лечения заболевания, связанного с подавлением аутофагии; лекарственное средство, которое подавляет GST-π для применения для лечения заболевания, связанного с подавлением аутофагии; и способ лечения заболевания, связанного с подавлением аутофагии, причем способ включает введение эффективного количества лекарственного средства, которое подавляет GST-π субъекту, для которого требуется такое лечение.

Количество композиции активного ингредиента различных типов средства или композиции в соответствии с настоящим изобретением, относящегося к подавлению/стимуляции сигнального каскада, убиквитинированию или аутофагии, может быть таким количеством, которое обеспечивает желаемый эффект (т.е. подавление/стимуляцию сигнального каскада, убиквитинирование или аутофагию), при введении средства или композиции. Кроме того, предпочтительно, такое количество, которое не вызывало неблагоприятное воздействие, которое превышает пользу от введения. Такое количество известно или может быть определено надлежащим образом с помощью исследования in vitro с использованием культивируемых клеток и т. д., или с помощью исследования на животной модели, такой как мышь, крыса, собака или свинья, и такой способ исследования хорошо известен специалистам в данной области техники. Ингибирование/стимуляция сигнального каскада, убиквитинирования или аутофагии может быть оценено посредством различных известных методов, в том числе тех, которые описаны выше. Количество композиции активного ингредиента может варьироваться в зависимости от способа введения средства или композиции. Например, когда используется множество единиц композиции для одного введения, количество активного ингредиента, которое должно быть содержаться в одной единице композиции, может быть получено путем деления количества активного ингредиента, необходимого для одного введения, посредством указанного множества единиц. Корректировка такого количества композиции может быть осуществлено надлежащим образом специалистом в данной области техники.

Лекарственное средство и количество его композиции в способе производства или применения различных видов средства или композиции, связанных с подавлением/стимуляцией сигнального каскада, убиквитинированием или аутофагией являются такими, как описано выше. Разработка рецептуры каждого препарата может быть осуществлена в соответствии с любой известной методикой.

Все различные типы способов, связанных с подавлением/стимуляцией сигнального каскада, убиквитинированием или аутофагией, могут быть методом in vitro или методом in vivo. Кроме того, эффективное количество лекарственного средства в указанных выше способах может быть количеством, которая достигает желаемого эффекта (т.е. подавление/стимуляцию сигнального каскада, убиквитинирования или аутофагии) в клетках, в которые оно вводится. Кроме того, предпочтительным является количество, которое не вызывает неблагоприятное воздействие, которое превышает пользу от введения. Такое количество известно или может быть определено надлежащим образом с помощью исследования in vitro и т. д., с использованием культивируемых клеток и т. д., и такой метод исследования хорошо известен специалисту в данной области техники. Достижение желаемого эффекта может быть оценено с помощью различных известных методов, в том числе тех, которые описаны выше. Эффективное количество, описанное выше, не обязательно должно быть таким, которое вызывает нужный эффект во всех клетках клеточной популяции, в которые вводится препарат. Например, эффективное количество, описанное выше, может быть таким количеством, которое индуцирует желаемый эффект по меньшей мере в 1% клеток, по меньшей мере в 2%, по меньшей мере в 3%, по меньшей мере в 4%, по меньшей мере в 5%, по меньшей мере в 6%, по меньшей мере в 8%, по меньшей мере в 10%, по меньшей мере в 12%, по меньшей мере в 15%, по меньшей мере в 20%, по меньшей мере 25% и т.д. из клеточной популяции.

Когда активный ингредиент в различных средствах или композициях, способах лечения и т. д., в соответствии с настоящим изобретением, описанными в настоящем документе, представляет собой нуклеиновую кислоту, например, молекулу RNAi, рибозим, антисмысловую нуклеиновую кислоту, химерный полинуклеотид ДНК/РНК, и т. д., они могут быть использованы в качестве голой нуклеиновой кислоты, как они есть, но также могут переноситься с помощью различных векторов. В качестве вектора может быть использован любой известный вектор, такой как плазмидный вектор, вектор на основе фага, фагемидный вектор, космидный вектор или вирусный вектор. Вектор предпочтительно содержит по меньшей мере промотор, который усиливает экспрессию переносимой нуклеиновой кислоты, и в этом случае нуклеиновая кислота предпочтительно функционально связана с таким промотором. Нуклеиновая кислота функционально связана с промотором, как упоминается в настоящем изобретении, означает, что нуклеиновая кислота и промотор расположены так, что белок, кодируемый нуклеиновой кислотой, соответствующим образом производится под действием промотора. Вектор может быть или не быть реплицируемым в клетке-хозяине, и транскрипция гена может осуществляться либо вне ядра, либо в ядре клетки-хозяина. В последнем случае нуклеиновая кислота может быть введена в геном клетки-хозяина.

Кроме того, активный ингредиент может переноситься различными невирусными липидными или белковыми носителями. Примеры таких носителей включают, но не ограничиваются этим, холестерин, липосомы, протомер антител, циклодекстриновые наночастицы, пептид слияния, аптамер, биоразлагаемый сополимер и полимер полимолочной кислоты; эффективность включения в клетки может быть повышена (см., например, Pirollo and Chang, Cancer Res. 2008; 68 (5): 1247-50, etc.). В частности, катионная липосома или полимер (например, полиэтиленимин и т. д.) является полезным. Другие примеры полезных полимеров в качестве такого носителя включают такие, которые описаны в патентах США 2008/0207553, 2008/0312174 и т. д.

Что касается различных фармацевтических композиций настоящего изобретения, описанного в настоящем документе, активный ингредиент может комбинироваться с другим дополнительным компонентом до тех пор, пока эффект активного ингредиента не нарушается. Примеры такого дополнительного компонента включают другое химическое терапевтическое средство, фармакологически приемлемый носитель, вспомогательное вещество, разбавитель и т. д. Кроме того, в зависимости от способа введения, способа высвобождения лекарственного средства и т. д., композиция может быть покрыта соответствующим материалом, таким как, например, кишечнорастворимым покрытием или материалом с дезинтеграцией, зависящей от времени, или могут быть включены в соответствующую систему высвобождения лекарственного средства.

Различные средства и композиции (в том числе различные фармацевтические композиции) по настоящему изобретению, описанные в настоящем документе, могут быть введены различными способами, включая как пероральные, так и парентеральных способы, например, без ограничения, пероральный, внутривенный, внутримышечный, подкожный, местный, внутриопухолевый, ректальный, внутриартериальный, внутрипортальный, внутрижелудочковый, трансмукозальный, трансдермальный, интраназальный, внутрибрюшинный, внутрилегочный и внутриматочный способы, и могут быть приготовлены в дозированной форме, подходящей для каждого способа введения. Что касается таких лекарственных форм и способов разработки рецептуры, любая известная форма или способ могут быть использованы соответствующим образом (см., например Hyojun yakuzaigaku (Standard Pharmaceutical Science), Ed. by Yoshiteru Watanabe et al., Nankodo, 2003, etc.).

Примеры лекарственной формы, подходящей для перорального введения включают, но не ограничиваются этим, порошок, гранулы, таблетки, капсулы, жидкости, суспензии, эмульсии, гель и сироп, и примеры лекарственной формы, подходящие для парентерального введения, включают инъекции, такие как инъекции раствора, инъекции суспензии, инъекции эмульсии, инъекции или в форме, которую получают во время использования. Композиция для парентерального введения может быть в форме водного или неводного изотонического стерильного раствора или суспензии.

Различные средства или композиции (в том числе различные фармацевтические композиции) настоящего изобретения, описанные в настоящем документе, могут быть нацелены на определенную ткань или клетки. Нацеливание может быть достигнуто любым известным способом. Если доставку в злокачественную опухоль пытаются осуществить, например, без ограничения, может использоваться методика, такая как пассивное нацеливание, в которой композиция изготавливается с размерами от 50 до 200 мкм в диаметре, в частности от 75 до 150 мкм, и т. д., который подходит для демонстрации EPR (повышенной проницаемости и удерживания) эффекта, или активного нацеливания, при котором лиганд CD 19, HER2, рецептор трансферрина, рецептор фолиевой кислоты, VIP рецептор, EGFR (Torchilin, AAPS J. 2007; 9 (2): E128-47), RAAG10 (JP, A(PCT) 2005-532050), PIPA (JP, A (PCT) 2006-506071) или KJD3 (JP, A (PCT) 2007-529197) и т. д., пептид, имеющий RGD-мотив или NGR-мотив, F3, LyP-1 (Ruoslahti et al., J Cell Biol. 2010; 188 (6): 759-68), и т. д., используются в качестве нацеливающего агента. Такие носители описаны в вышеуказанной литературе, а также в WO 2009/036368, WO 2010/014117 и т. д.

Различные средства или композиции (в том числе различные фармацевтические композиции) настоящего изобретения, описанные в настоящем документе, могут быть поставлены в любой форме, и с точки зрения стабильности при хранении, могут быть обеспечены в форме, которая может быть получена в момент использования, например, форма, которая позволяет врачу и/или фармацевту, медсестре, другому среднему медперсоналу и т. д., получить его в медицинском учреждении или поблизости. Такая форма особенно полезна в том случае, когда средство или композиция по настоящему изобретению содержат компонент, стабильное хранение которого затруднительно, такой как липид, белок или нуклеиновая кислота. В этом случае средство или композиция по настоящему изобретению обеспечиваются в одном или более контейнерах, содержащих по меньшей мере одну из основных составляющих, и получение осуществляется перед использованием, например, в течение 24 часов, предпочтительно в течение 3 часов и более предпочтительно непосредственно перед использованием. При осуществлении получения могут быть использованы в случае необходимости реагент, растворитель, оборудование для получения и т. д., которые обычно доступны в месте приготовления.

Таким образом, настоящее изобретение также относится к набору для получения композиции, набору, содержащему один или несколько контейнеров, контейнер отдельно или в комбинации, содержащие активные ингредиенты, которые должны содержаться в различных средствах или композициях по настоящему изобретению, и основные составляющие различных средств или композиции, обеспечиваемые в виде такого набора. Набор по настоящему изобретению может включать в себя в дополнение к вышесказанному инструкции, такие как письменное объяснение или в виде записи на электронном носителе, таком как компакт-диск или DVD, описывающие способ получения, способ введения и т. д., для различных средств или композиций настоящего изобретения. Кроме того, набор по настоящему изобретению может содержать все составляющие для комплектования различных средств или композиций по настоящему изобретению, но не обязательно содержать все компоненты. Таким образом, набор по настоящему изобретению не обязательно должен содержать реагент или растворитель, который обычно доступен в медицинском учреждении, экспериментальной лаборатории и т. п., например стерильную воду, физиологический раствор или раствор глюкозы.

Эффективное количество в соответствии с различными способами лечения по настоящему изобретению, описанными в настоящем документе, представляет например такое количество, которое уменьшает симптомы заболевания или задерживает или останавливает прогрессирование заболевания, и предпочтительно такое количество, которое подавляет или лечит болезнь. Также предпочтительно количество, которое не вызывает неблагоприятное воздействие, которое превышает пользу введения. Такое количество может быть определено соответствующим образом с помощью исследований in vitro с использованием культивируемых клеток и т. д., или исследованием на животной модели, такой как мышь, крыса, собака или свинья, и такие методы исследований хорошо известны специалисту в данной области техники. Кроме того, доза лекарственного средства, используемого в способе лечения по настоящему изобретению, является известной специалисту в данной области техники или может быть определена соответствующим образом с помощью описанных выше исследований и т. д.

Конкретная доза активного ингредиента может вводиться в способе лечения в соответствии с настоящим изобретением, описанным в настоящем документе, может быть определена с учетом различных условий, связанных с субъектом, которому необходимо лечение, таких как, например, серьезность симптомов, общее состояние здоровья субъекта, возраст, масса тела, пол субъекта, диета, режим и частота введения, сопутствующих лекарственных средств, восприимчивость к лечению, лекарственной формы и соблюдения режима лечения.

Примеры способов введения включают в себя различные способы, в том числе и пероральные и парентеральные способы, такие как пероральный, внутривенный, внутримышечный, подкожный, местный, внутриопухолевый, ректальный, внутриартериальный, внутрипортальный, внутрижелудочковый, трансмукозальный, трансдермальный, интраназальный, внутрибрюшинный, внутрилегочный и внутриматочный способы.

Частота введения зависит от свойств используемых средств или композиции и состояния субъекта, в том числе таких, которые описаны выше, и может быть многократно раз в день (то есть, два, три, четыре, пять или более раз в день), один раз в день, раз в несколько дней (то есть, каждые два, три, четыре, пять, шесть, семь дней и т. д.), каждую неделю, каждые несколько недель (то есть, каждые две, три, четыре недели и т. д.), и т. д.

При использовании в настоящем изобретении термин «субъект» означает любой биологический индивидуум и, предпочтительно, животное, более предпочтительно млекопитающее, и еще более предпочтительно человеческий индивид. В настоящем изобретении субъект может быть либо здоровым или страдающим от некоторого заболевания, но когда делается попытка для лечения конкретного заболевания, это обычно означает субъекта, страдающего таким заболеванием или имеющего риск быть затронутым заболеванием.

Кроме того, при использовании в настоящем изобретении термин «лечение» включает все виды профилактических и/или терапевтических вмешательств, разрешенных с медицинской точки с целью лечения, временной ремиссии, профилактики и т. д. болезни. Например, термин «лечение» включает допустимые с точки зрения медицины вмешательства для различных типов целей, включая задержку или остановку прогрессирования заболевания, приводя к регрессу повреждений или их исчезновению, предупреждению возникновения или ингибированию рецидива.

Примеры

Настоящее изобретение далее поясняется ниже на основе примеров, но эти примеры являются только иллюстрациями настоящего изобретения и не должны рассматриваться как ограничивающие настоящее изобретение.

Пример 1: Влияние нокаута GST-π на сигнальный каскад RAS/Raf/MAPK

(1) Культивирование клеток

Клеточную линию рака толстой кишки М7609 положительную по K-RAS мутации культивировали в среде RPMI-1640, содержащей 10% фетальную телячью сыворотку (FBS) при 37°С в атмосфере, содержащей 5% CO2. Дополнительно добавили в среду 100 ед./мл пенициллина и 100 мкг/мл стрептомицина в качестве антибиотиков.

(2) Трансфекция миРНК GST-π

За день до трансфекции клетки М7609 высевали на 100 мм пластиковой чашке для культивирования тканей с использованием 10% FBS, содержащей RPMI-1640, не содержащей антибиотик, чтобы получить 1×106 клеток/10 мл. 600 пмоль миРНК GST-π (SEQ ID No: 1: GGGAGGCAAGACCUUCAUUTT, миРНК ID#2385, Ambion) добавляли к 1 мл Opti-MEM I среды с пониженным содержанием сыворотки (Gibco) и осторожно перемешивали. Затем 35 мкл липофектамина RNAiMAX (Invitrogen) разбавляли в 1 мл Opti-MEM I среды с пониженным содержанием сыворотки, и осторожно перемешали. Разбавленную миРНК GST-π и разбавленный Липофектамин RNAiMAX объединяли и осторожно перемешали и затем инкубировали при комнатной температуре в течение 10 мин. В течение этого времени среду заменяли на 10 мл Opti-MEM I среды с пониженным содержанием сыворотки. После 10 мин инкубации комплекс между миРНК GST-π и липофектамином RNAiMAX добавляли к клеткам и инкубировали при 37°С в атмосфере, содержащей 5% СО2. После 5 ч инкубации ее заменяли на 10 мл 10% FBS, содержащей RPMI-1640 среды, не содержащей антибиотик. В контрольном эксперименте, такую же процедуру повторяли с использованием скремблированной миРНК (SEQ ID No: 2: CGAUUCGCUAGACCGGCUUCAUUGCAG, Hokkaido System Science Co., Ltd.). По состоянию на 1, 2, 3 и 4-й дни после трансфекции миРНК GST-π, подсчитывали число клеток, и проверяли нокдаун GST-π. Нокдаун GST-π анализировали с помощью метода вестерн-блотинга, описанного ниже.

(3) вестерн-блотинг нокдаун GST-π

вестерн-блотинг нокдаун GST-π проводили с использованием клеток, полученных в вышеупомянутом каждый момент времени после трансфекции миРНК GST-π. Собранные клетки культивировали в течение 16 часов в бессывороточной среде. После того, как клетки промывали холодным PBS, добавляли к ним холодный буфер для лизиса (1% NP-40, 50 мМ Трис-HCl, 150 мМ NaCl, 1 мМ ЭДТА, полный Mini EDTA-free (Roche), PhosSTOP (Roche), pH 7,5), и солюбилизацию осуществляли посредством инкубации в течение 30 мин при охлаждении льдом. Центрифугирование проводили при 4°C и 15000 оборотов в минуту в течение 15 мин, таким образом получая клеточный экстракт. Полученный таким образом клеточный экстракт подвергали количественному анализу на белок с использованием Micro ВСА Protein Assay Kit (Thermo Scientific) (миРНК GST-π трансфектант: 4,35 мкг/мкл, скремблированная миРНК трансфектант: 4,56 мкг/мкл). Затем 20 мкг клеточного экстракта денатурировали при восстанавливающих условиях, и белок отделяли посредством проведения SDS-PAGE с использованием нескольких гель II Mini 4/20 (13W) (Cosmo Bio Co., Ltd.). После того как SDS-PAGE была завершена, осуществляли перенос на PVDF мембрану электрически с использованием системы блоттинга tank-type. Мембрану переноса блокировали путем инкубации с 5% обезжиренным молоком/0,05 % Твина 20 в PBS (сокращенно PBS-T) при 4°С в течение 16 часов. Затем проводили реакции с aHTH-GST-π антителом, разбавленным PBS-T, (MBL) при 4°С в течение 16 часов. Реакцию со вторичным антителом проводили с использованием антитела кролика, меченного пероксидазой хрена (HRP), при комнатной температуре в течение 1 часа. Реакцию с хемилюминесцентным субстратом затем проводили при комнатной температуре в течение 1 мин, а затем эту хемилюминесценцию было детектировали с помощью рентгеновской пленки. Промывания между операциями осуществляли трижды путем встряхивания в течение 5 мин, используя PBS-T. Кроме того, после трансфекции миРНК, осуществляли покрытие на 60 мм пластиковой чашке для культивирования тканей с получением 1,0×105 клеток/5 мл, и общее количество клеток в чашке измеряли с помощью гемоцитометра до 4-ого дня.

(4) вестерн-блотинг белка, участвующего в сигнальном каскаде RAS/Raf/MAPK

вестерн-блотинг для основного белка, участвующего в сигнальном каскаде RAS/Raf/MAPK, проводили таким же образом, как и для п. (3), описанного выше, с использованием клеток, полученных на второй день после трансфекции миРНК GST-π. В качестве антител использовали, кроме того, aHTH-GST-π антитело, анти-p-Raf-l (Ser338) антитело (Millipore), анти-Raf-l антитело (Santa Cruz), анти-р-МЕК1/2 (Ser217/221) антитело (Cell Signaling), анти-MEK1/2 антитело (Cell Signaling), анти-p-ERK 1/2 (Thr202/Tyr204) антитело (Cell Signaling), анти-ERK антитело (Cell Signaling) и анти-GAPDH антитело (Abeam).

Результаты показаны на Фиг. 1 и 2. На Фиг. 1а), можно наблюдать, что экспрессия GST-π была подавлена посредством миРНК GST-π, но не подавлялась скремблированной миРНК. На Фиг. 1b) было установлено, что даже в момент времени, когда прошло 4 дней после трансфекции, экспрессия GST-π прежнему стабильно подавлялась посредством миРНК GST-π и, кроме того, в случае подавления экспрессии GST-π число клеток после культивирования в течение 4 дней было заметно меньше, чем в случае отсутствия подавления. Кроме того, было также очевидно из Фиг. 2, что в группе, обработанной миРНК GST-π, фосфорилирование всех белков, участвующих в сигнальном каскаде RAS/Raf/MAPK, снизилась по сравнению с группой, обработанной скремблированной миРНК. Таким образом, очевидно, что за счет подавления экспрессии GST-π, сигнальный каскад RAS/Raf/MAPK и аномальная пролиферация клеток были подавлены.

Пример 2: Влияние нокаута GST-π на убиквитинирования (1) Влияние нокдауна GST-π на убиквитинирование Raf-1

Культивирование клеток М7609 и трансфекция с миРНК GST-π осуществляли в соответствии с процедурами, описанными в примере 1 (1) и (2).

Таким же образом, как в примере 1 (3), на 2-й день после трансфекции миРНК проводили культивирование в течение 16 часов в бессывороточной среде и собирали клеточный экстракт. Полученный таким образом клеточный экстракт подвергали количественному анализу на белок с использованием Micro ВСА Protein Assay Kit (скремблированная миРНК: 8,88 мкг/мкл, миРНК GST-π: 7,18 мкг/мл). 0,5 мкг клеточного экстракта смешивали с анти-Raf-1 антителом, конъюгированным с парамагнитными микрочастицами Dynabeads с белком G (Invitrogen), инкубацию проводили при 4°С в течение 2 часов при осторожном перемешивании на шейкере, таким образом выделяя белок Raf-1, и затем проводили вестерн-блотинг таким же образом, как в примере 1 (3) с использованием анти-убиквитинового антитела (Santa Cruz). Модификацию фосфорилированием Ser621, который участвует в ингибировании протеасомной деградации Raf-1, исследовали таким же образом с использованием анти-p-Raf-l (Ser621) антитела (MILLIPORE).

(2) Влияние ингибитора протеасом на экспрессию Raf-1 при нокдауне GST-π

Культивирование клеток М7609 и трансфекцию с миРНК GST-π осуществляли в соответствии с процедурами, описанными в примере 1 (1) и (2). На 2-й день после трансфекции миРНК GST-π культивирование проводили в течение 16 часов в бессывороточной среде. После обработки 5 мкМ MG132 в течение 4 часов клеточный экстракт собирали. В качестве контроля для обработки MG132 проводили таким же образом обработку с 0,05 % ДМСО. Полученный таким образом клеточный экстракт подвергали количественному анализу на белок с использованием Micro ВСА Protein Assay Kit (группа, обработанная скремблированной миРНК-ДМСО: 3,36 мкг/мкл, группа, обработанная скремблированной мuPHK-MG132: 3,16 мкг/мкл, группа, обработанная миРНК GST-π-ДМСО: 3,12 мкг/мкл, группа, обработанная миРНК GST-π-MG132: 3,16 мкг/мкл). 20 мкг клеточного экстракта подвергали SDS-PAGE, а затем проводили вестерн-блотинг таким же образом, как в примере 1 (3), используя анти-p-Raf-1 (Ser338) антитело и анти-Raf-1 антитело.

(3) Коиммунопреципитация p-Raf-1 и GST-π

Культивирование клеток М7609 проводили в соответствии с процедурой, описанной в примере 1 (1). Затем, после того, как нокдаун клетки GST-π, полученные в соответствии с процедурой примера 1 (2), промывали холодным PBS, добавляли холодный буфер для коиммунопреципитации (0,5% NP-40, 50 мМ HEPES, 150 мМ NaCl, 1 мМ EGTA, 1,5 мМ MgCl2, полный Mini EDTA-free, PhosSTOP, pH 7,5), и солюбилизацию проводили путем инкубации в течение 30 мин при охлаждении льдом. Центрифугирование проводили при 4°С и 15000 оборотах в минуту в течение 15 мин, что давало клеточный экстракт. Полученный таким образом клеточный экстракт подвергали количественному анализу на белок с использованием Micro ВС A Protein Assay Kit (12,1 мкг/мкл). 1 мг клеточного экстракта смешивали с анти-p-Raf-1 (Ser338) антитела (US Biological), конъюгированного с с Dynabeads с белком G, и инкубацию проводили при 4°С в течение 16 часов при осторожном перемешивании на шейкере, таким образом осуществляя совместную иммунопреципитацию. Затем проводили вестерн-блотинг с использованием aHTH-GST-π антитела.

Результаты показаны на Фиг. с 3 до 5. Из Фиг. 3 очевидно, что в группе, обработанной миРНК GST-π, количество убиквитина, соосажденного с Raf-1 было больше по сравнению с группой, обработанной скремблированной миРНК, и убиквитинирование Raf-1 было увеличено. Кроме того, можно видеть из Фиг. 4, что протеасома была вовлечена в уменьшение экспрессии p-Raf-1 посредством миРНК GST-π, и из Фиг. 5 можно видеть, что GST-π был связан с p-Raf-1. Приведенные выше результаты показывают, что GST-π связывается с p-Raf-1 таким образом, что ингибирует их убиквитинирование, и за счет подавления GST-π убиквитинирование p-Raf-1 стимулируется и относительное содержание p-Raf-1 уменьшается.

Пример 3: Анализ индукции аутофагии и апоптоза посредством нокдауна GST-π

(1) Анализ индукции аутофагии посредством иммунофлуоресцентного окрашивания

Индукция аутофагии нокдаун GST-π анализировали с помощью иммунофлуоресцентного окрашивания LC3, который является аутофагия-специфичным маркерным белком. Нокдаун GST-π клетки, полученные по методике примера 1 (2), высевали на покровном стекле, помещенном в 35 мм пластиковую чашку для культивирования тканей таким образом, чтобы получилось 1×105 клеток/2 мл. После того, как среду отсасывали, добавляли 4% параформальдегид в PB S и инкубацию проводили при комнатной температуре в течение 10 мин, таким образом фиксируя клетки. Пермеабилизацию клеток проводили с использованием 0,5 % Тритон Х-100 в PBS на льду в течение 5 мин. После промывки холодным PBS в течение 10 мин реакцию с анти-LC3B антителом (Invitrogen), разбавленным PBS, содержащим 1% BSA, проводили во влажной камере при 37°C в течение 1 часа. Реакцию со вторичным антителом проводили с использованием Alexa Р1иог488-меченого кроличьего антитела (Invitrogen) при 37°С в течение 1 часа. Монтировку препарата на предметное стекло проводили с использованием Prolong Gold antifade reagent with DAPI, и инкубацию проводили при 4°C в течение 16 часов. Промывание после реакции с антителом проводили три раза с использованием PBS при 37°C в течение 5 мин. Аутофагия-положительные клетки в момент обследования с помощью флуоресцентного микроскопа определяли как клетки, имеющие сигнал LC3 в виде пятна, присутствующий в цитоплазме.

(2) Анализ индукции аутофагии с помощью вестерн-блоттинга

Индукция аутофагии в нокдаун GST-π клетках далее анализировали с помощью вестерн-блотинга LC3. Нокдаун GST-π клетки, полученные по методике примера 1

(2), высевали на покровном стекле, помещенном в 35 мм пластиковую чашку для культивирования тканей таким образом, чтобы получить 1×105 клеток/2 мл. После инкубации в течение заданного времени клеточный экстракт собирали и подвергали вестерн-блотингу. Реакцию с мембраной переноса проводили при 4°C в течение 16 часов с использованием анти-LC3B антитела (Sigma) в качестве первичного антитела. Обнаружение молекул LC3 проводили с использованием хемилюминесцентного реагента после реакции со вторичным антителом, меченым HRP. Будет или не будет вызываться аутофагия, оценивали по сдвигу LC3 от типа I (18 кДа) к типу II (16 кДа).

(3) Анализ индукции аутофагии посредством исследования с помощью электронного микроскопа

На первый день после трансфекции миРНК в примере 1 (2) клетки высевали на 8-луночный планшет для культивирования для тканевой культуры таким образом, чтобы получить 0,4×105 клеток/0,5 мл. Фиксацию проводили с использованием 2,5% глутарового альдегида в 0,1 M буфере какодиловой кислоты (pH 7,4) в течение 1 часа, и после ополаскивания 0,1 M буфером какодиловой кислоты проводили постфиксацию с использованием 1% OsO4 и 1,5% ферроцианида калия в течение 2 часов. После проведения трехразовой дегидратации этанолом в течение 10 мин, заключали в эпоксидную смолу (ТААВ Laboratories Equipment). Ультратонкий срез получали с использованием алмазного ножа, контрастирование проводили с использованием уранил-ацетата и цитрата свинца, и срез исследовали с помощью электронного микроскопа (Hitachi Transmission Electron Microscope H-7500, Hitachi High-Technologies Corporation).

(4) Анализ индукции апоптоза окрашиванием TUNEL

Метод TUNEL осуществляли следующим образом с использованием In Situ Cell Death Detection Kit, POD (Roche). Нокдаун GST-π клетки, полученные по методике примера 1 (2), высевали на покровном стекле, помещенном в 35 мм пластиковую чашку для культивирования тканей таким образом, чтобы получить 1×105 клеток/2 мл. После того, как среду отсасывали, добавляли 4% параформальдегид в PBS, и инкубацию проводили при комнатной температуре в течение 60 мин, таким образом фиксируя клетки. Для того чтобы осуществить блокирование эндогенной пероксидазы, инкубацию проводили с использованием 3% Н2О2 в метаноле при комнатной температуре в течение 10 мин. Затем пермеабилизацию клеток проводили путем обработки 0,1 %-ным Triton Х-100 в 0,1 % цитрата натрия на льду в течение 2 мин. TUNEL-реакцию проводили во влажной камере при 37°C в течение 60 мин. Обнаружение TUNEL-положительных клеток проводили посредством реакции окрашивания с использованием субстрата DAB после реакции меченного пероксидазой анти-флуоресцеинового антитела при 37°C в течение 30 мин. Контрастное окрашивание проводили с использованием гематоксилина, окрашенные клетки исследовали под оптическим микроскопом, и TUNEL-положительных клетки оценивались как апоптотические клетки.

Промывания между операциями проводили посредством ополаскивания PBS.

Результаты показаны на Фиг. с 6 до 10. Фиг. 6 представляет собой изображение иммунофлуоресцентного окрашивания с помощью анти-LC3 антитела, и в клетках, показанных стрелками, наблюдался сигнал в виде пятна, показывающий, что наблюдается LC3. Так как этот сигнал LC3b виде пятна должен быть аутофагосомой, можно видеть, что в нокдаун GST-π клетках индуцирована аутофагия.

Фиг. 7 показывает изображения электронно-микроскопического исследования КД клеток GST-π через 2 дня после трансфекции миРНК GST-π. Правое изображение представляет собой в увеличенном масштабе фрагмента А, ограниченного квадратом в левом изображении. В правом изображении можно видеть, что в частях, показанных стрелками, аутофагосома была сформирована так, чтобы окружать митохондрии.

Фиг. 8 показывает результаты вестерн-блоттинга LC3. Есть два типа LC3 белка, которые распознаются анти-LC3 антителами. Когда происходит аутофагия и LC3 инкопорируется в двойную липидную мембраны, LC3 изменяется от типа I к типу II. Таким образом, можно подтвердить, была ли индуцирована аутофагия или нет по изменению обнаруженного количества LC3-типа II. Из результата Фиг. 8 можно видеть, что в группе, обработанной миРНК GST-π, индуцировалась экспрессия как тип I, так и тип LC3-II, и тип II заметно возрастал, в то время как в группе, обработанной скремблированной миРНК, экспрессия была низкой как для типа I и, так и типа II и уровень экспрессии типа I был ниже, чем у типа П.

Из этих результатов можно видеть, что аутофагия индуцируется посредством подавления экспрессии GST-π.

Фиг. 9 показывает результат TUNEL-окрашивания. Верхний ряд показывает изображения группы, обработанной скремблированной миРНК, в нижнем ряду показаны изображения группы, обработанной миРНК GST-π; в клетках, в которых был нокдаун GST-π, наблюдались TUNEL-положительные клетки, то есть, апоптоз.

Фиг. 10 представляет собой график, показьгвающий изменение с течением времени отношения аутофагии-положительных клеток и апоптоз-положительных клеток в группе, обработанной миРНК GST-π, и в группе, обработанной скремблированной миРНК. Доля аутофагия-положительных клеток обозначает долю клеток, имеющих сигнал LC3 в виде пятна на 500 клеток в эксперименте иммунофлуоресцентного окрашивания с использованием анти-LC3 антитела в п. (1), приведенного выше, и доля апоптоз-положительных клеток обозначает долю TUNEL-положительных клеток на 1000 клеток в эксперименте TUNEL-окрашивания в п. (4), приведенного выше. Можно видеть из этого, что доля аутофагия-положительных клеток резко возросла после обработки, достигла максимума на 2-й день, а затем уменьшалась, в то время как доля апоптоз-положительных клеток постепенно, но постоянно увеличивалась до 4-й дня.

Пример 4: Влияние нокаута GST-π на сигнальный каскад EGFRTPPK/Akt/mTOR (1) Вестерн-блотинг сигнала EGFR/PI3K/Akt/mTOR

Экспрессия каждого белка, составляющего сигнальный каскад EGFR/PI3K/Akt/mTOR анализировали таким же образом, как в примере 1 (1), (2) и (4), за исключением того, в качестве первичных антител использовали анти-p-EGFR (Tyr1068) антитело (Cell Signaling), анти-EGFR антитело (Santa Cruz), анти-р-P13K р85 (Tyr458)/р55 (Tyr199) антитело (Cell Signaling), анти-PI3K, р85 антитело (MILLIPORE), анти-p-Akt (Ser473) антитело (Cell Signaling), анти-Akt антитело (Cell Signaling), анти-p-p70S6K (Thr389) антитело (Cell Signaling), aHTH-p-p70S6K (Thr421/Ser424) антитело (Cell Signaling) и анти-p7086K антитело (Cell Signaling).

(2) Влияние ингибитора протеасом на экспрессию p-EGFR при нокауте GST-π

Культивирование клеток М7609 и трансфекцию с миРНК GST-π осуществляли в соответствии с процедурами, описанными в примере 1 (1) и (2). На 2-й день после трансфекции миРНК GST-π клетки культивировали в бессывороточной среде в течение 16 часов. После обработки 5 мкМ MG132 в течение 2 часов собирали клеточный экстракт. В качестве контроля для обработки MG132 проводили обработку с 0,05% ДМСО таким же образом. Полученный таким образом клеточный экстракт подвергали количественному анализу на белок с использованием Micro ВСА Protein Assay Kit (группа, обработанная скремблированной миРНК-ДМСО: 11,98 мкг/мкл, группа, обработанная скремблированной мuPHK-MG132: 12,29 мкг/мкл, группа, обработанная миРНК GST-π-ДМСО: 8,91 мкг/мкл, группа, обработанная миРНК GST-π-MG132: 9,24 мкг/мкл). После того как 80 мкг клеточного экстракта подвергали SDS-PAGE, проводили вестерн-блотинг с использованием анти-p-EGFR (Tyr1068) антитела и анти-EGFR антитела.

(3) Ко-иммунопреципитация p-EGFR и GST-π

Культивирование М7609 клеток проводили в соответствии с процедурой, описанной в примере 1 (1). Впоследствии, после того как клетки промывали холодным PBS, добавляли холодный буфер ко-иммунопреципитации (1,0% Тритон Х-100, 50 мМ Трис-HCl,150 мМ NaCl, полный мини-ЭДТА свободный, PhosSTOP, pH 7,5), и растворение проводили путем инкубации в течение 30 мин при охлаждении льдом. Центрифугирование проводили при 4°С и 12000 оборотов в минуту в течение 10 мин, что приводило к клеточному экстракту. Полученный таким образом клеточный экстракт подвергали количественному анализу на белок с использованием Micro ВСА Protein Assay Kit (9,08 мкг/мкл). 1 мг клеточного экстракта смешивали с анти-p-EGFR (Туг1068) антителом (Calbiochem), конъюгированного с Dynabeads с белком G, и ко-иммунопреципитацию проводили путем инкубации в орбитальном шейкере при 4°С в течение 16 часов при осторожном перемешивании. Затем проводили вестерн-блотинг с использованием анти-GST-π антитела.

Результаты показаны на Фиг. 11-13. Фиг. 11 показывает, что в группе, обработанной миРНК GST-π, фосфорилирование каждого белка, составляющего сигнальный каскад EGFR/PI3K/Akt/mTOR было снижено по сравнению с группой, обработанной скремблированной миРНК, Фиг. 12 показывает, что протеасомы участвуют в уменьшении экспрессии p-EGFR посредством миРНК GST-π, и Фиг. 13 показывает, что GST-π связана с p-EGFR. Приведенные выше результаты показывают, что GST-π связывается с p-EGFR, чтобы таким образом способствовать их стабилизации, убиквитинирование p-EGFR стимулирует подавление GST-π, и относительное содержание p-EGFR уменьшается.

Пример 5: Влияние ингибитора GST-π на пролиферацию клеток и т. д.

(1) Влияние ингибитора GST-π на фосфорилирование EGFR и Raf-1

Культивирование клеток М7609 проводили в соответствии с процедурой, описанной в примере 1 (1). Клетки высевали на 60 мм пластиковую чашку для культивирования тканей таким образом, чтобы получить 4,0×105 клеток/5 мл. Добавляли ингибитор GST-π С16С2 (полученный в Teijin Pharma Limited согласно запросу) таким образом, чтобы получить 10, 50 и 100 мкМ, и после 24 часов клеточный экстракт собирали. Полученный таким образом клеточный экстракт подвергали количественному анализу на белок с использованием Micro ВСА Protein Assay Kit (необработанные: 8,5 мкг/мкл, 10 мкл: 8,49 мкг/мкл, 50 мкМ: 7,68 мкг/мкл, 100 мкМ: 6,4 мкг/мкл). 50 мкг клеточного экстракта подвергали SDS-PAGE и экспрессию каждого белка затем анализировали с помощью вестерн-блоттинга.

(2) Эффект ингибитора GST-π на пролиферацию клеток и т. д.

Культивирование клеток М7609 проводили в соответствии с процедурой, описанной в примере 1 (1). Клетки высевали на 60 мм пластиковой чашке для культивирования тканей таким образом, чтобы получить 1,0×105 клеток/5 мл. Через 16 часов ингибитор GST-π добавляли так, чтобы получить 50 мкм. Общее количество клеток в чашке измеряли с помощью гемоцитометра до второго дня. В качестве контроля для ингибитора GST-π, проводили обработку с 0,05% ДМСО.

Результаты показаны на Фиг. 14 и 15. Стало ясно из этих результатов, что ингибитор GST-π также может подавлять фосфорилирование EGFR и Raf-1 (рис. 14) и пролиферацию клеток (рис. 15) так же, как с нокдаун GST-π.

Пример 6: Влияние ингибитора аутофагии на клетки с нокдауном по GST-π

(1) Культивирование клеток

Трансфекцию миРНК GST-π проводили в соответствии с процедурой, описанной в примере 1 (2), среду заменяли на среду без антибиотиков, и инкубацию проводили в течение 3 часов. Клетки высевали на покровном стекле, помещенном в пластиковую 35 мм чашку для культивирования ткани, ингибитор аутофагии 3-метиладенин (3-МА, SIGMA) добавляли таким образом, чтобы получить 1 или 5 мМ, а после этого культивирование проводили в течение заданного времени.

(2) Оценка аутофагия-положительных клеток

Клетки, культивированные в п. (1), подвергали иммунофлуоресцентному окрашиванию с использованием анти-LC3 антитела таким же образом, как в примере 3 (1).

(3) TUNEL-окрашивание

Клетки, культивированные в п. (1), подвергали TUNEL-окрашиванию таким же образом, как в примере 3 (4).

Результаты показаны на Фиг. с 16 по 18. Фиг. 16 показывает долю аутофагия-положительных клеток на 1000 клеток в каждой группе, и можно видеть, что доля аутофагия-положительных клеток заметно снизились посредством ингибитора аутофагии. На Фиг. 17 верхний ряд показывает группу, обработанную миРНК GST-π + 1 мМ 3-МА, а нижний ряд показывает группу, обработанную миРНК GST-π + 5 мМ 3-МА. Можно видеть из Фиг. 9 и Фиг. 17, что апоптоз-положительные клетки заметно возрастали вследствие использования ингибитора аутофагии в комбинации. Фиг. 18 представляет собой график, показывающий, что апоптоз, дополнительно индуцировали посредством ингибитора аутофагии дозозависимым образом. Апоптоз индуцировали добавлением миРНК GST-π, но когда 3-МА, который является ингибитором аутофагии, дополнительно добавляли, апоптоз дополнительно индуцировался в зависимости от дополнительной дозы 3-МА. Таким образом, стало очевидно, что апоптоз может быть вызван более эффективно посредством комбинирования лекарственного средства, которое подавляет GST-π, и лекарственного средства, которое подавляет аутофагию.

1. Фармацевтическая композиция для индукции апоптоза в клетке, имеющей мутированный KRAS, содержащая эффективное количество лекарственного средства, которое подавляет GST-π, и эффективное количество лекарственного средства, которое подавляет аутофагию.

2. Фармацевтическая композиция по п. 1, в которой активный ингредиент выбирается из группы, состоящей из молекулы RNAi, рибозима, антисмысловой нуклеиновой кислоты, ДНК/РНК химерного полинуклеотида и вектора, экспрессирующего вышеперечисленное.

3. Фармацевтическая композиция по п. 1 или 2, где апоптоз индуцируется в клетках с аномальной клеточной пролиферацией.

4. Фармацевтическая композиция по п. 1 или 2, где апоптоз индуцируется в клетках с мутацией KRAS.

5. Фармацевтическая композиция по п. 1 или 2, где апоптоз индуцируется в раковых клетках.

6. Фармацевтическая композиция по п. 5, где рак вызван мутацией KRAS.

7. Способ индукции апоптоза в клетке, имеющей мутированный KRAS, где способ включает введение в клетку фармацевтической композиции по п.1 или 2.

8. Способ по п.7, где клетка представляет собой раковую клетку с мутацией KRAS.



 

Похожие патенты:

Группа изобретений относится к медицине, а именно к онкологии, и может быть использовано для лечения рака кожи. Лекарственное средство содержит рекомбинантный лектин омелы, содержащий аминокислотные последовательности ID SEQ №1 и ID SEQ №4.

Изобретение относится к области органической химии, а именно к производному оксотиоимидазолина формулы (I) или к его мезомеру, рацемату, энантиомеру, диастереомеру, или их смеси, где А представляет собой -CR' или N; R' представляет собой водород или галоген; Z1 и Z2 каждый независимо представляет собой метил; R1 и R2 каждый независимо выбирают из группы, состоящей из S или О; R3 выбирают из группы, состоящей из C1-С3-алкила, гетероциклила, выбранного из тетрагидрофурана, тетрагидропирана, пиперидина, диоксо-тетрагидротиопирана, азетидина, пирролидина, оксетана; С6-арила и -S(O)mR6; когда R3 выбирают из гетероциклила, выбранного из тетрагидрофурана, тетрагидропирана, пиперидина, диоксо-тетрагидротиопирана, азетидина, пирролидина, оксетана; или С6-арила, каждый из гетероциклила и арила необязательно замещен одной или более группой, выбранной из группы, состоящей из C1-алкила, -OR6, -C(O)NR7R8, -S(O)mR6 и -C(O)R6; когда R3 представляет собой C1-С3-алкил, алкил замещен одной или более группой, выбранной из группы, состоящей из галогена, циано, амино, С3-циклоалкила, тетрагидрофурана, -OR6, -C(O)NR7R8, -S(O)mR6 и -C(O)OR6, при этом циклоалкил необязательно замещен одной группой, выбранной из циано, амино, -OR6, -C(O)NR7R8 и -C(O)OR6; R4 и R5 каждый независимо выбирают из группы, состоящей из циано, C1-алкила, галогена и -CF3; R6 представляет собой водород, C1-алкил или -CF3; R7 и R8 каждый независимо выбирают из группы, состоящей из водорода и C1-алкила, и m представляет собой 2.

Изобретение относится к производному индазола, имеющему приведенную ниже формулу, или к его фармацевтически приемлемой соли, а также к фармацевтической композиции, его содержащей.

Изобретение относится к области органической химии, а именно к новому гетероциклическому соединению [RD93], которая может быть полезно для лечения невосприимчивого к гормонам рака простаты, доброкачественной гиперплазии простаты, рака молочной железы и рака яичников.

Изобретение относится к медицине и касается способа выявления человеческих или гуманизированных антител, включающего стадии обработки содержащего человеческое или гуманизированное антитело биологического образца расщепляющим ферментом с образованием образца расщепленного антитела, причем биологическим образцом является сыворотка, плазма крови, ткань или клетки от животного, которое было обработано человеческим или гуманизированным антителом; и анализа образца расщепленного антитела с помощью масс-спектрометрии с выявлением одного или нескольких человеческих каркасных пептидов.

Изобретение относится к медицине и предназначено для лечения рака. Используется новый фармацевтический продукт, включающий соединение А в дозе от 800 до 3000 мг в сутки ежедневно в течение 5 дней в дни 1-5 цикла лечения с последующим перерывом в течение 23 дней.

Изобретение относится к медицине, онкологии и может быть использовано для лечения анального рака с переходом на кожу. Способ включает проведение двух индукционных курсов полихимиотерапии (ПХТ) по схеме: митомицин С 10 мг/м2 внутривенно струйно в 1 и 29 дни и 5-фторурацил 1000 мг/м2 в сутки непрерывной инфузией в 1-4 дни и 29-32 дни.

Изобретение относится к пиразол-4-ил-гетероциклил-карбоксамидным соединениям Формулы I, включая их стереоизомеры, таутомеры и фармацевтически приемлемые соли, где X представляет собой тиазолильную, пиразинильную, пиридинильную или пиримидинильную группу, R1 и R2 имеют значения, указанные в формуле изобретения.

Изобретение относится к новому соединению формулы (II) или его фармацевтически приемлемой соли, ингибирующим ДНК-зависимую протеинкиназу (ДНК-ПК). Соединения могут найти применение для лечения онкологических заболеваний.

Группа изобретений относится к области биотехнологии, а именно биохимии и медицине, и касается антител для лечения онкологических заболеваний. Антитела по изобретению специфически связывают и блокируют рецептор 1 типа фактора роста фибробластов (FGFR1) и характеризуются аминокислотными последовательностями H-CDR1, H-CDR2, H-CDR3, L-CDR1, L-CDR2 и L-CDR3.

Группа изобретений относится к фармакологии и медицине. Предложен способ лечения парциальных припадков у пациента, страдающего абсансами или восприимчивого к абсансам, включающий введение безопасного и эффективного количества эсликарбазепина ацетата (или введение включающей его фармацевтической композиции – вариант), где парциальные припадки сопровождаются или не сопровождаются вторичной генерализацией, где пациентом, восприимчивым к абсансам, является ребенок или подросток (варианты).

Группа изобретений относится к медицине и может быть использована для лечения или профилактики синдрома WHIM у человека, у которого диагностирован синдром WHIM. Для этого указанному человеку вводят антагонист CXCR4 в количестве, эффективном для лечения или профилактики синдрома WHIM.

Изобретение относится к пиразол-4-ил-гетероциклил-карбоксамидным соединениям Формулы I, включая их стереоизомеры, таутомеры и фармацевтически приемлемые соли, где X представляет собой тиазолильную, пиразинильную, пиридинильную или пиримидинильную группу, R1 и R2 имеют значения, указанные в формуле изобретения.

Группа изобретений относится к фармакологии и медицине. Предложено применение композиции, включающей эйкозапентаеновую кислоту в количестве от 1 до 3000 мг/100 мл и/или докозапентаеновую кислоту в количестве более 50 мг/100 мл, которая имеет содержание белка больше чем 10 en% и содержание лейцина больше чем 5 масс.

Настоящее изобретение касается лечения женской сексуальной дисфункции. Предложено применение комбинации ингибитора ФДЭ5 и дигидротестостерона для изготовления лекарственного средства для лечения женского сексуального расстройства, где указанный ингибитор ФДЭ5 (силденафил, тадалафил или варденафил) применяется за 1-2 часа до сексуальной активности и дигидротестостерон обеспечивается в форме сублингвальной препаративной формы и используется за 3,5-5,5 часов до сексуальной активности.

Предложено новое соединение бензолполикарбоновых кислот, которое получают путем окисления гидролизованного лигнина в щелочной среде. При этом водорастворимое полимерное соединение бензолполикарбоновых кислот характеризуется тем, что имеет следующий элементный состав: 62-67% С, 3,8-4,2% Н, 29-34% О и менее чем 0,2% N по весу в сухом состоянии, при этом суммарное содержание других элементов составляет не более чем 1% по весу в сухом состоянии.

Группа изобретений относится к медицине и может быть использована для стимулирования мышечной массы и/или мышечной функции у пожилых пациентов в возрасте 60 лет или старше.

Настоящее изобретение относится к носителю для доставки вещества в продуцирующие внеклеточный матрикс клетки в почке, причем носитель состоит из липидной структуры, содержащей ретиноид в качестве нацеливающего агента, где носитель имеет форму липосомы.

Изобретение относится к медицине, а именно к гинекологии, и предназначено для консервативного лечения миомы матки. Комплексное консервативное лечение миомы матки осуществляют в два этапа: проводят предгормональную подготовку и назначают гормональные препараты.

Группа изобретений относится к медицине. Описаны композиции интенсивного проникновения (КИП) исходного соединения, способные пересекать биологические барьеры с высокой эффективностью проникновения.

Изобретение относится к области фармацевтической промышленности, а именно к антисептическому препарату в форме геля, который содержит хлоргексидина глюконат - 0,01-0,5 г, метил-4-гидроксибензоат - 0,01-0,1 г, этил-4-гидроксибензоат - 0,01-0,1 г, пропил-4-гидроксибензоат - 0,01-0,1 г, пропиленгликоль - 5-70 г, гидроксиэтилцеллюлозу - 1,5-5 г и воду - до 100 г.

Группа изобретений относится к области фармакологии и медицины и касается фармацевтической композиции для индукции апоптоза в клетке, имеющей мутированный KRAS, содержащей эффективное количество лекарственного средства, которое подавляет GST-π; и эффективное количество лекарственного средства, которое подавляет аутофагию. Заявлен также способ индукции апоптоза в клетке, имеющей мутированный KRAS, в частности в раковой клетке с мутацией KRAS. Группа изобретений обеспечивает повышение эффективности апоптоза в клетке. 2 н. и 6 з.п. ф-лы, 18 ил., 6 пр.

Наверх