Анализ респираторной инфекции

Изобретения относятся к способу скрининга биологического образца на присутствие вызывающих респираторную инфекцию микроорганизмов, выбранных из (i) респираторно-синцитиального вируса (RSV А & В), (ii) риновируса, (iii) метапневмовируса человека (hMPV), (iv) гриппа В (Flu В Quad), (v) гриппа A (Flu A CDC DC) и (vi) подтипа Н5 гриппа А (Н5 FRET), с использованием ПЦР реального времени и тест-карты, имеющей обнаруживающие пробы в отдельных лунках. Изобретения позволяют обнаруживать с высоким уровнем чувствительности и специфичности целевые микроорганизмы. 2 н. и 26 з.п.ф-лы, 1 ил., 2 табл., 6 пр.

 

Настоящее изобретение относится к продуктам нуклеиновых кислот и к соответствующим способам скрининга биологического образца на присутствие вызывающего инфекцию микроорганизма.

Респираторные инфекции являются одними из наиболее частых случаев заболеваний во всем мире (см. Murray and Lopez (1997) - Lancet, 349, страницы 1269-1276). Индивидуумы с нарушениями (сердечная, легочная, иммунная системы), пожилые люди и дети имеют риск развития серьезных осложнений. В течение длительного времени в прошлом быструю лабораторную диагностику респираторных инфекций проводили с помощью набора анализов для multiplex ПЦР в реальном времени (RT) Taqman. Однако существенной проблемой, связанной с мультиплексным подходом, является необходимость параллельного получения, проведения и мониторинга анализов скрининга. Это дает нежелательную финансовую нагрузку, так как каждый проводимый анализ приводит к удвоению потребляемых затрат по сравнению с одиночным анализом и создает дополнительные рабочие расходы в виде износа дорогостоящего оборудования, используемого для проведения этих анализов. Указанный мультиплексный подход также требует дополнительного времени и рабочей силы, связанных с проведением мультиплексных анализов.

Таким образом, существует необходимость в более эффективной системе скрининга.

Настоящее изобретение решает одну или несколько указанных выше проблем благодаря простому одноступенчатому анализу (т.е. формата singleplex) для выявления присутствия или отсутствия множества вызывающих респираторную инфекцию микроорганизмов в общем выделенном образце.

Более подробно, настоящее изобретение относится к способу обнаружения присутствия одного или нескольких по меньшей мере из шести вызывающих респираторную инфекцию микроорганизмов в образце или обнаружения отсутствия указанных микроорганизмов в указанном образце, где способ предусматривает:

A) нанесение образца на тест-карту, где указанная тест-карта содержит шесть отдельных лунок:

1) первую лунку, которая включает первую пробу, где первая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GGCAATGCWG (SEQ ID NO:1);

2) вторую лунку, которая включает вторую пробу, где вторая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GAYGGGACCR (SEQ ID NO:2);

3) третью лунку, которая включает третью пробу, где третья проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CACCAGACAC (SEQ ID NO:3);

4) четвертую лунку, которая включает четвертую пробу, где четвертая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GGTCATTGGR (SEQ ID NO:4);

5) пятую лунку, которая включает пятую пробу, где пятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CACTGGGCAC (SEQ ID NO:5);

6) шестую лунку, которая включает шестую пробу, где шестая проба содержит последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты RGTGTTCATT (SEQ ID NO:6);

B) приведение нуклеиновой кислоты, присутствующей в образце, в контакт с пробами в указанных лунках;

C) обнаружение присутствия комплекса связанных нуклеиновых кислот, где образец нуклеиновой кислоты связан с одной или несколькими из указанных проб;

D) где присутствие комплекса связанных нуклеиновых кислот подтверждает, что нуклеиновая кислота одной или нескольких из указанных шести вызывающих респираторную инфекцию микроорганизмов присутствует в этом образце, и где отсутствие комплекса связанных нуклеиновых кислот подтверждает, что нуклеиновая кислота всех указанных шести вызывающих респираторную инфекцию микроорганизмов отсутствует в образце.

Одной ключевой проблемой известного уровня техники, которая рассматривалась заявителем, является получение надежного набора проб, которые являются взаимосовместимыми (т.е. сохраняют точную специфичность связывания), в условиях одного набора для анализа (т.е. формата singleplex). Одним конкретным преимуществом, связанным со способом настоящего изобретения, является скорость. В качестве примера, способ по изобретению обычно длится 2,5 часа, предпочтительно, 2 или 1,5 часа. В отличие от этого, существующие анализы multiplex обычно занимают по меньшей мере 4-5 часов, обычно, по меньшей мере 5 часов.

Другим преимуществом, связанным с анализом uniplex (aka singleplex) способом по настоящему изобретению является повышенная чувствительность, которая позволяет проводить количественное обнаружение микроорганизмов (например, вирусной и/или бактериальной нагрузки) в образце, наряду с просто определением присутствия или отсутствия конкретного патогенна в образце.

Микроорганизмы (например, вирусы и бактерии) в этом образце могут быть подвергнуты точному измерению нагрузки для каждого мишеневого микроорганизма. Это позволяет проводить количественное определение конкретной нагрузки каждого микроорганизма в образце. Преимущественно, этот признак по изобретению позволяет определять преобладающий микроорганизм(ы) в образцах, в которых присутствуют множество микроорганизмов. Например, способ анализа unipex позволяет специалисту определить преобладающий вирус в образцах, в которых присутствует множество вирусов. Кроме того, способ по изобретению обеспечивает количественное обнаружение вирусов в образцах на протяжении времени, который, в частности, может использоваться при наличии флуктуации в вирусной нагрузке конкретных вирусов.

Кроме того, в то время как в существующих системах используется гибридизация на мембране, способ анализа по изобретению проводят в закрытой (например, в стерильной) системе, таким образом уменьшая вероятность загрязнения, что дает дополнительное преимущество.

Пробы 1-6, соответственно, обеспечивают чувствительное обнаружение:

1) Респираторно-синцитиального вируса (RSV A & B);

2) Риновирусов;

3) Метапневмовируса человека (hMPV);

4) Гриппа В (Flu B Quad);

5) Гриппа A (Flu A CDC DC); и

6) Подтипа Н5 гриппа A (H5 FRET)

Таким образом, указанный выше способ обеспечивает быстрый анализ для обнаружения любого одного или нескольких указанных вызывающих респираторную инфекцию микроорганизмов в формате анализа uniplex (aka singleplex). Аналогично, указанный способ обеспечивает быстрый анализ для подтверждения, что все из указанных вызывающих респираторную инфекцию микроорганизмов отсутствуют в пробе в общем анализе (uniplex). Анализ uniplex обозначает, что каждый из анализов множественных индивидуальных лунок проводят при одинаковых условиях анализа и/или по существу в одно и то же время. При использовании, единственный образец наносят на тест-карту, и этот образец затем засевается в каждую тест-лунку.

В одном из вариантов осуществления в способе используют тест-карту, содержащую одну или несколько дополнительных лунок, и соответствующие одну или несколько дополнительных проб, выбранных из:

7) седьмой лунки, которая включает седьмую пробу, где седьмая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TTTCCAGGGG (SEQ ID NO:7);

8) восьмой лунки, которая включает восьмую пробу, где восьмая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CCGCAAGTCA (SEQ ID NO:8);

9) девятой лунки, которая включает девятую пробу, где девятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TTGCCTGGTG (SEQ ID NO:9);

10) десятой лунки, которая включает десятую пробу, где десятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TAARGTAGGT (SEQ ID NO:10);

11) одиннадцатой лунки, которая включает одиннадцатую пробу, где одиннадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CGGCRTCATY (SEQ ID NO:11);

12) двенадцатой лунки, которая включает двенадцатую пробу, где двенадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты ATARTGRTAA (SEQ ID NO:12);

13) тринадцатой лунки, которая включает тринадцатую пробу, где тринадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты ATAGTAATAA (SEQ ID NO:13); где используют те же самые стадии способа, которые описаны в настоящем документе выше.

В одном из вариантов осуществления, тест-карта может включать две или более, три или более, четыре или более, пять или более, шесть или более или все семь из указанных от седьмой до тринадцатой лунок (плюс соответствующие пробы).

Пробы 7-13 обеспечивают чувствительное обнаружение:

7) Вируса парагриппа типа 1 человека (HPIV 1);

8) Вируса парагриппа типа 2 человека (HPIV 2);

9) Вируса парагриппа типа 3 человека (HPIV 3);

10) Вируса парагриппа типа 4 человека (HPIV 4);

11) Human Adenoviruses #2;

12) Вируса A H1 2009, Tamiflu чувствительного; и

13) Вируса A H1 2009, Tamiflu устойчивого.

Таким образом, вышеуказанный способ обеспечивает быстрый анализ для обнаружения любого одного или нескольких указанных вызывающих респираторную инфекцию микроорганизмов в анализе формата uniplex. Аналогично, указанный способ обеспечивает быстрый анализ для подтверждения, что все из указанных вызывающих респираторную инфекцию микроорганизмов отсутствуют в образце из анализа формата uniplex.

В одном из вариантов осуществления, в способе используют тест-карту, содержащую одну или нескольких дополнительных лунок, и соответствующие одну или несколько дополнительных проб, выбранных из:

14) четырнадцатой лунки, которая включает четырнадцатую пробу, где четырнадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TACTGTGACA (SEQ ID NO:14);

15) пятнадцатой лунки, которая включает пятнадцатую пробу, где пятнадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты YRGCGGAACC (SEQ ID NO:15);

16) шестнадцатой лунки, которая включает шестнадцатую пробу, где шестнадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TAACGAGTGT (SEQ ID NO:16);

17) семнадцатой лунки, которая включает семнадцатую пробу, где семнадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CGAATGAATG (SEQ ID NO:17);

18) восемнадцатой лунки, которая включает восемнадцатую пробу, где восемнадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты YTCTAAGCAT (SEQ ID NO:18);

19) девятнадцатой лунки, которая включает девятнадцатую пробу, где девятнадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TTCTAAGCAT (SEQ ID NO:19);

20) двадцатой лунки, которая включает двадцатую пробу, где двадцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GAGTAYCTSA (SEQ ID NO:20);

21) двадцать первой лунки, которая включает двадцать первую пробу, где двадцать первая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты ACTGCATCCG (SEQ ID NO:21);

22) двадцать второй лунки, которая включает двадцать вторую пробу, где двадцать вторая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TGTCACCTCT (SEQ ID NO:22);

23) двадцать третьей лунки, которая включает двадцать третью пробу, где двадцать третья проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты AGTGTGTYAC (SEQ ID NO:23);

24) двадцать четвертой лунки, которая включает двадцать четвертую пробу, где двадцать четвертая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GAATTTCTGG (SEQ ID NO:24);

25) двадцать пятой лунки, которая включает двадцать пятую пробу, где двадцать пятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TTGCCGGATG (SEQ ID NO:25);

26) двадцать шестой лунки, которая включает двадцать шестую пробу, где двадцать шестая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CAGCAACTGT (SEQ ID NO:26);

27) двадцать седьмой лунки, которая включает двадцать седьмую пробу, где двадцать седьмая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TGCTCCAGAA (SEQ ID NO:27);

28) двадцать восьмой лунки, которая включает двадцать восьмую пробу, где двадцать восьмая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты TNGCCATTGY (SEQ ID NO:28);

29) двадцать девятой лунки, которая включает двадцать девятую пробу, где двадцать девятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GTYCCGTGRA (SEQ ID NO:29);

30) тридцатой лунки, которая включает тридцатую пробу, где тридцатая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CTGGARTCTG (SEQ ID NO:30);

31) тридцать первой лунки, которая включает тридцать первую пробу, где тридцать первая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CRACTGTGTC (SEQ ID NO:31);

32) тридцать второй лунки, которая включает тридцать вторую пробу, где тридцать вторая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GTGTCACCGC (SEQ ID NO:32);

33) тридцать третьей лунки, которая включает тридцать третью пробу, где тридцать третья проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GAYGGRACCR (SEQ ID NO:33);

где используют те же самые стадии способа, какие описаны в настоящем документе выше.

В одном из вариантов осуществления, эта тест-карта может включать две или более, три или более, четыре или более, пять или более, шесть или более, семь или более, восемь или более, девять или более, десять или более, одиннадцать или более, двенадцать или более, тринадцать или более, четырнадцать или более, пятнадцать или более, шестнадцать или более, семнадцать или более, восемнадцать или более, девятнадцать или более или все двадцать из указанных от четырнадцати до тридцати лунок (плюс соответствующие пробы). Указанные одна или более от четырнадцати до тридцати лунок (плюс соответствующие пробы) могут быть использованы в комбинации или альтернативно с указанными одной или более от семи до тринадцати лунок (плюс соответствующие пробы).

Пробы 14-30, соответственно, делают возможным чувствительное обнаружение:

14) Респираторно-синцитиального вируса (RSV №2); (RSV №3);

15) Энтеровирусов;

16) Коронавируса тяжелого острого респираторного синдрома (ТОРС) (SARS);

17) Коронавируса Группы 2 OC43 и HKU1 (GP2 OC43/HKU1);

18) Коронавируса Группы 1 NL63 (GP1 NL63);

19) Коронавируса Группы 1 229E (GP1 229E);

20) Аденовирусов человека;

21) Бокавируса;

22) Гриппа А (Flu A Quad);

23) Гриппа А H1 2009 (H1 sw 2009);

24) Гриппа А N1 2009 (N1 CFI);

25) Гриппа А H1 сезонного (H1 сезонного CFI);

26) Гриппа A H3 сезонного (H3 сезонного CFI);

27) Гриппа A H5 (H5 CFI);

28) Гриппа A H7 (H7);

29) Гриппа A H9 (H9 a);

30) Гриппа A H9 (H9 b);

31) Паравируса типа 1 человека (HPIV 1 №2);

32) Паравируса типа 3 человека (HPIV 1 №3); и

33) Риновирусов №2.

Таким образом, вышеуказанный способ обеспечивает быстрый анализ одного или нескольких из указанных вызывающих респираторную инфекцию микроорганизмов в анализе с форматом uniplex. Аналогично, указанный способ обеспечивает быстрый анализ для подтверждения того, что все из указанных вызывающих респираторную инфекцию микроорганизмов отсутствуют в образце в анализе формата uniplex.

В одном из вариантов осуществления, в способе используют тест-карту, содержащую одну или несколько дополнительных лунок, и соответствующие одну или несколько дополнительных проб, где указанные дополнительные пробы связываются с этиологическими факторами и (таким образом, обнаруживают) этиологические факторы, атипичной пневмонии. Пациенты, инфицированные атипичными бактериальными респираторными инфекциями, не отвечают на обычные антибиотики, что зачастую обостряют их состояния и дренируя источники медико-санитарной помощи. Общепринятая лабораторная идентификация этих организмов, связанная с атипичной бактериальной пневмонией, может быть трудной, медленной и дорогостоящей, и, таким образом, настоящее изобретение обеспечивает разительное улучшение в этом смысле. Таким образом, в этом варианте осуществления, одну или несколько дополнительных проб используют для обнаружения одного или нескольких из: Chlamydophila pneumoniae, Chlamydophila psittaci, Legionella pneumophila, Mycoplasma pneumonia и Coxiella burnettii. Таким образом, в одном из вариантов осуществления, способ по изобретению использует тест-карту, содержащую одну или несколько дополнительных лунок, и соответствующие одну или несколько дополнительных проб, выбранных из:

34) тридцать четвертой лунки, которая включает тридцать четвертую пробу, где тридцать четвертая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты AATTGGCTTT (SEQ ID NO:34);

35) тридцать пятой лунки, которая включает тридцать пятую пробу, где тридцать пятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GGAGAGTGTG (SEQ ID NO:35);

36) тридцать шестой лунки, которая включает тридцать шестую пробу, где тридцать шестая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CAGACGCTGG (SEQ ID NO:36);

37) тридцать седьмой лунки, которая включает тридцать седьмую пробу, где тридцать седьмая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CGGCGTTTAT (SEQ ID NO:37);

38) тридцать восьмой лунки, которая включает тридцать восьмую пробу, где тридцать восьмая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CTTGGTGTGA (SEQ ID NO:38);

39) тридцать девятой лунки, которая включает тридцать девятую пробу, где тридцать девятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CTTGGTGTGA (SEQ ID NO:39);

где используют те же самые стадии способа, которые описаны в описании выше.

В одном из вариантов осуществления, тест-карта может включать две или более, три или более, четыре или более, пять или более или все шесть из указанных от тридцать четвертой до тридцать девятой лунок (плюс соответствующие пробы). Указанные одна или несколько от тридцать четвертой до тридцать девятой лунок (плюс соответствующие пробы) могут быть использованы в комбинации или альтернативно от четырнадцатой до тридцать третьей лунок (плюс соответствующие пробы) и/или в комбинации или альтернативно с указанными одной или несколькими от седьмой до тринадцатой лунок (плюс соответствующими пробами).

Пробы 34-39 делают возможным чувствительное обнаружение:

34) Legionella pneumophilia;

35) Mycoplasma pneumoniae;

36) Chlamydiophilia pneumoniae;

37) Coxiella burnetii;

38) Chlamydiophilia psittaci и

39) Chlamydiophilia abortus.

Таким образом, вышеуказанный способ обеспечивает быстрый анализ для обнаружения любых одного или нескольких из указанных вызывающих респираторную инфекцию микроорганизмов в анализе с форматом uniplex. Аналогично, указанный способ обеспечивает быстрый анализ для подтверждения того, что все из указанных вызывающих респираторную инфекцию микроорганизмов отсутствуют в образце в анализе формата uniplex.

В одном из вариантов осуществления, способ по настоящему изобретению использует тест-карту, содержащую одну или несколько дополнительных ‘контрольных’ лунок, и соответствующие одну или несколько ‘контрольных’ проб, выбранных из:

40) сороковой лунки, которая включает сороковую пробу, где сороковая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты AGATCAAGGT (SEQ ID NO:40);

41) сорок первой лунки, которая включает сорок первую пробу, где сорок первая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты ACCTGAAGGC (SEQ ID NO:41),

где используют такие же стадии способа, какие описаны в настоящем документе выше.

В одном из вариантов осуществления, тест-карта может включать одну или обе из указанных сороковой или сорок первой лунок (плюс соответствующих проб). Могут быть использованы альтернативные ‘контрольная’ проба/пробы-мишени. Указанные ‘контрольные’ пробы могут быть использованы в комбинации с любыми из описанных в настоящем документе выше вариантов осуществления.

Контрольные пробы 40-41, соответственно, делают возможным чувствительное обнаружение:

40) Бактериофага MS2 (MS2 IC) Escherichia coli и

41) Гена рибонуклеазы P человека (RNAse P).

Присутствие одной или нескольких ‘контрольных’ проб делает возможным (по существу одновременно) подтверждение того, что этот анализ выполняется нормально. Например, в образец вводят бактериофаг MS2 Escherichia coli (MS2 IC) перед экстракцией нуклеиновых кислот. Обнаружение нуклеиновой кислоты бактериофага MS2 в образце с использованием зонда-бактериофага MS2 позволяет подтверждать различные стадии, участвующие в этом анализе uniplex, выполняемые успешно. Бактериофаг MS2 просто обеспечивает один пример внутреннего контроля, хотя со способом по настоящему изобретению может быть использована любая подходящая альтернатива.

В одном из вариантов осуществления тест-карта включает пробу, которая позволяет обнаружение гена рибонуклеазы Р (RNAse P) человека. Присутствие нуклеиновой кислоты РНКазы P человека в образце указывает на то, что был собран биологический материал человека. Альтернативно, могут быть использованы другие маркеры генома человека в качестве проб-мишеней, и их соответствующие пробы могут быть включены на тест-карте.

Способ анализа по настоящему изобретению может включать стадию амплификации нуклеиновой кислоты, и в этом случае каждую пробу по настоящему изобретению используют в комбинации с парой (прямого и обратного) праймеров - указанную пару праймеров кооперируют для амплификации участка нуклеиновой кислоты-мишени, который затем распознается этой пробой (связыванием с ним) во время стадии обнаружения. В качестве примера, праймеры 1f (прямой) и 1r (обратный) кооперируют с первой пробой, и с использованием всех трех последовательностей нуклеиновой кислоты включают в первую лунку. То же самое выполняют с праймерами 2f и 2r в комбинации со второй пробой (во второй лунке) - праймерами 41f и 41r в комбинации с сорок первой пробой (в сорок первой лунке).

В одном из вариантов осуществления, этот способ использует тест-карту, содержащую одну или несколько дополнительных лунок и соответствующие одну или несколько дополнительных проб, выбранных из:

42) сорок второй лунки, которая включает сорок вторую пробу, где сорок вторая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GTGCARTTYG (SEQ ID NO:338);

43) сорок третьей лунки, которая включает сорок третью пробу, где сорок третья проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты YGCYTCGGAR (SEQ ID NO:339);

44) сорок четвертой лунки, которая включает сорок четвертую пробу, где сорок четвертая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CTTGTGGANC (SEQ ID NO:340);

45) сорок пятой лунки, которая включает сорок пятую пробу, где сорок пятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты CATTCCATTC (SEQ ID NO:341);

46) сорок шестой лунки, которая включает сорок шестую пробу, где сорок шестая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты WGTGTTTGCA (SEQ ID NO:342);

47) сорок седьмой лунки, которая включает сорок седьмую пробу, где сорок седьмая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты ACCACGGGAT (SEQ ID NO:343);

48) сорок восьмой лунки, которая включает сорок восьмую пробу, где сорок восьмая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GTCCTCGCTG (SEQ ID NO:344);

49) сорок девятой лунки, которая включает сорок девятую пробу, где сорок девятая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности нуклеиновой кислоты GCCCGCGACG (SEQ ID NO:345);

где используют такие же стадии способа, какие описаны в настоящем документе выше.

Пробы 42-49, соответственно, делают возможным чувствительное обнаружение:

42) Аденовируса;

43) Аденовируса ADP17;

44) Парапоксвируса;

45) Вируса гриппа B;

46) Вируса гриппа B;

47) Mycobacterium tuberculosis;

48) Mycobacterium tuberculosis;

49) Микобактерий (в целом).

Таким образом, вышеописанный способ обеспечивает быстрый анализ для обнаружения любых одного или нескольких из указанных вызывающих респираторную инфекцию микроорганизмов в анализе с форматом uniplex. Аналогично, указанный способ обеспечивает быстрый анализ для подтверждения того, что все из указанных вызывающих респираторную инфекцию микроорганизмов отсутствуют в образце в анализе формата uniplex.

Праймер 1f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AAGCWGGATTCTACC (SEQ ID NO:42), и праймер 1r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCCCATTATGCCTAG (SEQ ID NO:43).

Праймер 2f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTGAATGYGGCTAA (SEQ ID NO:44), и праймер 2r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGGACACCCAAAGTA (SEQ ID NO:45).

Праймер 3f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATCCCACAAAAYCAG (SEQ ID NO:46), и праймер 3r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTACACATAATAARA (SEQ ID NO:47).

Праймер 4f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GATGTCCATCAAGCT (SEQ ID NO:48), и праймер 4r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TARAGCAATAGGTCT (SEQ ID NO:49).

Праймер 5f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTGTCACCTCTGAC (SEQ ID NO:50), и праймер 5r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGGACAAAKCGTCTA (SEQ ID NO:51).

Праймер 6f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGRTACGCTGCAGAC (SEQ ID NO:52), и праймер 6r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGTCCAGACATCTAG (SEQ ID NO:53).

Праймер 7f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATACTCAGAGACCCA (SEQ ID NO:54), и праймер 7r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATAYTGTTGCATAGC (SEQ ID NO:55).

Праймер 8f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGCTCCTGATCARCC (SEQ ID NO:56), и праймер 8r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCCCACCATRGCATA (SEQ ID NO:57).

Праймер 9f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TATCCTCAGAGATCC (SEQ ID NO:58), и праймер 9r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ACATACTGTTGCATG (SEQ ID NO:59).

Праймер 10f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTTGTACAGGARATG (SEQ ID NO:60) и праймер 6r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCCCACCATRGCATA (SEQ ID NO:61).

Праймер 11f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности RGTSGAYCCCATGGA (SEQ ID NO:62), и праймер 11r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности SGGYGTRCGSAGGTA (SEQ ID NO:63).

Праймер 12f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGTCAAATCAGTCGA (SEQ ID NO:64), и праймер 12r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCCTGCAYACACATG (SEQ ID NO:65).

Праймер 13f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGTCAAATCAGTCGA (SEQ ID NO:66), и праймер 13r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCCTGCAYACACATG (SEQ ID NO:67).

Праймер 14f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CATCTGYTTAACAAG (SEQ ID NO:68) или GGARACATACGTGAA (SEQ ID NO:260), и праймер 14r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AAGAIACTGATCCTG (SEQ ID NO:69) или ATTGTAYTGAACAGC (SEQ ID NO:261).

Праймер 15f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTGAATGYGGCTAA (SEQ ID NO:70), и праймер 15r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGGACACCCAAAGTA (SEQ ID NO:71).

Праймер 16f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTATCCAAAATGTGA (SEQ ID NO:72), и праймер 16r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCATCACCGGATGAT (SEQ ID NO:73).

Праймер 17f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTATCCTAARTGTGA (SEQ ID NO:74), и праймер 17r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATCACCACTRCTAGT (SEQ ID NO:75).

Праймер 18f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTATCCCAAATGTGA (SEQ ID NO:76), и праймер 18r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGCRTCACCAGAAGT (SEQ ID NO:77).

Праймер 19f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTATCCTAAGTGTGA (SEQ ID NO:78), и праймер 19r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGCATCACCAGAAGT (SEQ ID NO:79).

Праймер 20f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности KCNTACATGCACATC (SEQ ID NO:80), и праймер 20r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGGRTTYCTRAACTT (SEQ ID NO:81).

Праймер 21f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAGGAARTGACGTAT (SEQ ID NO:82) и 21r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGTTCACTCGCCGGA (SEQ ID NO:83).

Праймер 22f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности MGAGGTCGAAACGTA (SEQ ID NO:84), и праймер 22r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CACGGTGAGCGTRAA (SEQ ID NO:85).

Праймер 23f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGTAGACACAGTACT (SEQ ID NO:86) и праймер 23r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGCTTGTCTTCTAG (SEQ ID NO:87).

Праймер 24f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATCAGTTGGCTAACA (SEQ ID NO:88), и праймер 24r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGCCACTGCCCCATT (SEQ ID NO:89).

Праймер 25f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCCCCCCTACAATTG (SEQ ID NO:90), и праймер 25r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATTCTGGGTTTCCTA (SEQ ID NO:91).

Праймер 26f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGTTGAACGCAGCAA (SEQ ID NO:92), и праймер 26r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCAACTAGTGACCTA (SEQ ID NO:93).

Праймер 27f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGATGCMATMAAYT (SEQ ID NO:94), и праймер 27r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCATTGGAGTTTGAC (SEQ ID NO:95).

Праймер 28f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTTCGGGGCRTCATG (SEQ ID NO:96) или YAGYGGITACAARGA (SEQ ID NO:262), и праймер 28r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CYGCATGTTTCCRTT (SEQ ID NO:97) или AIRAARCATGAYGCC (SEQ ID NO:263).

Праймер 29f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности IGGYYACCARTCAAC (SEQ ID NO:98), и праймер 29r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности YARCATYCCATTGTG (SEQ ID NO:99).

Праймер 30f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности YGAYCARTGCATGGA (SEQ ID NO:100), и праймер 30r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGCRACAGTIGAATA (SEQ ID NO:101).

Праймер 31f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGATGGAACCGTYAA (SEQ ID NO:102), и праймер 31r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTGTTGTGACCTCAT (SEQ ID NO:103).

Праймер 32f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности RGCTTTCAGACAAGA (SEQ ID NO:104), и праймер 32r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GACCGCATGATTGAC (SEQ ID NO:105).

Праймер 33f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTGAATGYGGCTAA (SEQ ID NO:106), и праймер 33r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGGACACCCAAAGTA (SEQ ID NO:107).

Праймер 34f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGCAAGACGCTATG (SEQ ID NO:108), и праймер 34r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTCTTTCATTTGCTG (SEQ ID NO:109).

Праймер 35f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTGGCAGTTGGGTCA (SEQ ID NO:110), и праймер 35r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTTGATCCGCCCACA (SEQ ID NO:111).

Праймер 36f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TATAAAGGCGTTGCT (SEQ ID NO:112), и праймер 36r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GATGGTCGCAGACTT (SEQ ID NO:113).

Праймер 37f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CATCGTTCCCGGCAG (SEQ ID NO:114), и праймер 37r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTTTACTAATCCCCA (SEQ ID NO:115).

Праймер 38f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGGGAAGGTGCTTCA (SEQ ID NO:116), и праймер 38r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGCGGATGCTAATGG (SEQ ID NO:117).

Праймер 39f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGGGAAGGTGCTTCA (SEQ ID NO:118), и праймер 39r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCCTGCGCGGATGCT (SEQ ID NO:119).

Праймер 40f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTCTCCGTATTCACG (SEQ ID NO:120) и праймер 40r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GACCCCACGATGAC (SEQ ID NO:121).

Праймер 41f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTGGACCTGCGAGCG (SEQ ID NO:122), и праймер 41r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCTGTCTCCACAAGT (SEQ ID NO:123).

Праймер 42f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности KCNTACATGCACATC (SEQ ID NO:80), и праймер 42r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGGRTTYCTRAACTT (SEQ ID NO:81).

Праймер 43f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ITACATGCAYATCKC (SEQ ID NO:267), и праймер 43r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGCRAAYTGCACCAG (SEQ ID NO:268) или GGCAAACTGCACGAG (SEQ ID NO:269).

Праймер 44f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGATGGCGTRCCATA (SEQ ID NO:272), и праймер 44r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ACTAGAGGATGGCTG (SEQ ID NO:273).

Праймер 45f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCTATGAACACAGCA (SEQ ID NO:276), и праймер 45r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTGGACGTCTTCTCC (SEQ ID NO:277).

Праймер 46f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GATGTCCATCAAGCT (SEQ ID NO:48), и праймер 46r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TARAGCAATAGGTCT (SEQ ID NO:49).

Праймер 47f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTAACACGTGGGTGA (SEQ ID NO:280), и праймер 47r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ACCGCTAAAGCGCTT (SEQ ID NO:281).

Праймер 48f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTCGTCRTACGCAAT (SEQ ID NO:284), и праймер 48r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGTCGGGACGGTGAG (SEQ ID NO:285).

Праймер 49f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTCGTCRTACGCAAT (SEQ ID NO:284), и праймер 49r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGTCGGGACGGTGAG (SEQ ID NO:285).

Биологический образец обычно является образцом, который получен у пациента (т.е. ex vivo и/или выделенный образец). В одном из вариантов осуществления стадию экстракции нуклеиновой кислоты можно проводить на образце - общепринятые протоколы экстракции нуклеиновых кислот хорошо известны в данной области. Затем экстрагированный образец нуклеиновой кислоты наносят в тест-карту таким образом, чтобы он контактировал с каждой из этих лунок (и, следовательно, с каждой из проб в указанных лунках).

Стадию ‘реакции гибридизации’ нуклеиновой кислоты (содержащей пробу и праймеры, работающие вместе) по настоящему изобретению обычно проводят при температуре 50-70°C (например, 55-65°C, или 56-64°C, или 57-63°C, или 58-62°C, или 59-61°C, или приблизительно 60°C). Указанную температуру обычно поддерживают в течение периода времени 10-30 секунд (например, 15-25 секунд или 17-23 секунд или 19-21 секунд или приблизительно 20 секунд). Если в способе по настоящему изобретению имеется стадия амплификации нуклеиновых кислот, то указанную стадию ‘реакции гибридизации’ (содержащую пробу и праймеры, добавленные в избытке вначале), предпочтительно, включают в каждом цикле стадии амплификации.

При использовании стадии амплификации нуклеиновых кислот, стадию обычно проводят при температуре 90-100°C (например, 92-98°C или 94-96°C или приблизительно 95°C градусов) в течение типичного периода 0,1-10 секунд (например, 0,5-5 секунд или 0,7-2 секунд или приблизительно 1 секунды) с последующей уменьшенной температурой 50-70°C (например, 55-65°C или 57-63°C или 59-61°C или приблизительно 60°C) в течение периода 10-30 секунд (например, 15-25 секунд или 17-23 секунд или 19-21 секунд или приблизительно 20 секунд). При использовании стадии амплификации нуклеиновых кислот, указанная стадия обычно включает 35-55 циклов (например, 40-50 циклов или 44-46 циклов, или приблизительно 45 циклов). Стадию обратной транскрипции обычно проводят в самом начале при температуре 40-60°C (например, 45-55°C, или 48-52°C, или приблизительно 50°C) в течение периода времени 3-7 минут (например, 4-6 минут или приблизительно 5 минут).

В одном из вариантов осуществления способ может быть осуществлен в (высокопроизводительном) приборе Applied Biosystems 7900HT. В качестве примера, указанный прибор может использовать платформу ОТ-ПЦР (aka плату) тест-карты с 384 лунками, которая позволяет, например, анализировать 8 различных образцов параллельно через 8 различных колонок, присутствующих на единственной тест-карте – см. фиг. 1. Каждая колонка может содержать 48 индивидуальных лунок-мишеней, позволяя посредством этого (по существу одновременно) скрининг каждого образца для 48 различных вызывающих респираторную инфекцию микроорганизмов (эффективно использовали 46 вызывающих респираторную инфекцию микроорганизмов двух ‘контрольных’ лунок). Альтернативные аппараты и системы (включающие соответствующие тест-карты) являются коммерчески доступными и имеют равное применение в контексте по настоящему изобретению.

В одном из вариантов осуществления способ использует ПЦР, такую как ОТ-ПЦР.

При использовании, образец (обычно образцы экстрагированных нуклеиновых кислот) смешивают с 2-кратно - 5-кратно концентрированным буфером (например, ПЦР-буфером, также называемым реакционной смесью). Например, Χ мкл образца смешивают с тем же самым объемом (Χ мкл) 2-кратно концентрированного буфера. Затем образец (включающий буфер), наносят на тест-карту (и в каждую лунку) - обычно объем в диапазоне 0,1-50 мкл, или 0,5-30 мкл, или 0,5-20 мкл, или 0,5-10 мкл, или 1-5 мкл в каждую лунку. Предпочтительно, в каждую лунку доставляют приблизительно 0,5 мкл, 1 мкл, 2 мкл, 3 мкл, 4 мкл или 5 мкл образца (включающего буфер).

В случае тест-карты, содержащей колоночное расположение лунок (например, см. фиг. 1), образец (включающий буфер) может быть просто нанесен в резервуар на верхней части каждой колонки, и затем, тест-карту откручивают в центрифуге для доставки образца плюс смеси реагентов (в диапазоне объемов, указанных выше) в каждую из лунок, образующихся в каждой колонке. В случае системы AB7900HT, каждая лунка обычно содержит 48 лунок, так что образец наносится центрифужной доставкой в каждую из указанных 48 лунок. Более подробно, вплоть до 8 образцов могут быть добавлены, соответственно, в эти 8 резервуаров на верхней части каждой колонки (например, пипеткой с тонким концом). На фигуре 1, маленькие контейнеры (pod) показывают отдельные лунки анализа, которые в свою очередь включают соответствующие пробы (и необязательно соответствующие праймеры). Эта иллюстрированная тест-карта показывает установку, в которой присутствуют 48 лунок (также называемых pod) на один канал - при использовании, каждая лунка обычно получает конечный объем реакции 1 мкл центрифужной доставкой в нижнюю часть колоночного канала.

Каждая лунка включает один специфический тип пробы по настоящему изобретению (и, необязательно, соответствующую пару праймеров). В одном из вариантов осуществления, указанная проба присутствует в ее лунке в лиофилизированной форме. Таким образом, как только жидкий образец нанесен на поверхность лунки, лиофилизированная проба (необязательно, включающая соответствующую пару праймеров) становится повторно гидратируемой, что позволяет стадии обнаружения протекать в жидкой среде.

Лунка по настоящему изобретению предназначена для удерживания, слегка большего, чем релевантного, объема жидкости (образец плюс буфер/реакционная смесь) анализа, который должен выполняться в указанной лунке. Каждая лунка является дискретной, чтобы сделать возможным размещение типа отдельной пробы в единственной лунке, разрешая посредством этого обнаружить присутствие или отсутствие конкретных мишеневых микроорганизмов. После нанесения образца на тест-карту, все из этих лунок, содержащие пробу (пробы), могут быть герметично изолированы с использованием одной или нескольких пленок/полосок с предотвращением посредством этого случайной миграции жидкости (и, потенциально, проб) между лункамии. Лунка по настоящему изобретению может быть расположена в той же самой горизонтальной плоскости, что и тест-карта, хотя равным образом может быть размещена выше или ниже указанной плоскости.

В сравнении со стандартной батареей установок мультиплексных реакций, настоящее изобретение обеспечивает экономию времени и ресурсов в манипуляциях обеих установленных реакций и позволяет сопоставлять данные из множественных приборов.

Настоящее изобретение относится также к тест-карте для применения в описанных выше способах. В одном из вариантов осуществления тест-карта получена из пластикового материала. Для помощи пользователю тест-карта должна иметь жесткость для удерживания массы этой карты (в том числе нанесенного образца), например, по существу в горизонтальном положении, в котором она обычно удерживается пользователем во время нормального применения.

Тест-карта содержит множество лунок (необязательно, расположенных в колоночном формате для возможности нанесения образца центрифужной доставкой), где обеспечены по меньшей мере шесть лунок и где первая лунка включает первую пробу, вторая лунка включает вторую пробу, третья лунка включает третью пробу, четвертая лунка включает четвертую пробу, пятая лунка включает пятую пробу и шестая лунка включает шестую пробу по изобретению, как описано в настоящем описании. Каждая лунка обычно включает только (множество) одну конкретную пробу по настоящему изобретению. В качестве примера, в одном из вариантов осуществления, первая проба присутствует в первой лунке (хотя обычно отсутствует в любой из других лунок) и вторая проба присутствует во второй лунке (хотя обычно отсутствует в любой из других лунок) и т.д.

Каждая проба может быть необязательно связана с соответствующей парой праймеров. Таким образом, кроме этой первой пробы, первая лунка может включать первую пару соответствующих прямого и обратного праймеров. Каждая лунка обычно включает (множество) одну специфическую пару праймеров по настоящему изобретению. В качестве примера, в одном из вариантов осуществления, первая пара праймеров (и первая проба) присутствует в первой лунке, но обычно отсутствует в любой из других лунок, и вторая пара праймеров (и вторая проба) присутствует во второй лунке, но обычно отсутствует в любой из других лунок, и т.д. Альтернативно, более чем одна проба (и необязательно ее соответствующая пара праймеров) может присутствовать в единственной лунке.

Каждая проба может быть иммобилизована в ее соответствующей лунке - указанная иммобилизация может быть перманентной (например, через ковалентную связь, необязательно вводимую любым коммерчески доступным химическим сшивающим реагентом) или временной (например, через не-ковалентную связь, такую как водородная связь, или через ионную связь). Например, первая проба может быть иммобилизована в первой лунке и вторая проба может быть иммобилизована во второй лунке, и т.д. Иммобилизация соответствующих проб облегчает манипулирование тест-картами, улучшает стабильность при хранении и минимизирует риск миграции пробы между лунками. Пробы, предпочтительно, иммобилизуют в этих лунках простой адсорбцией на поверхности, присутствующей в лунках, например, на стенке лунки. Таким образом, в одном из вариантов осуществления, получают содержащий пробу раствор, наносят его на поверхность лунки и затем дают высыхать на поверхности этой лунки. Обычные стабилизирующие соединения (например, сахара) могут быть добавлены к содержащему пробу раствору перед нанесением на поверхность лунки.

Тест-карта может включать одну или несколько дополнительных лунок, выбранных от седьмой лунки до тринадцатой лунки (включающих, соответственно, от седьмой до тринадцатой пробы), описанных в настоящем документе. Например, карта может включать каждую от седьмой лунки до тринадцатой лунки (включающих, соответственно, от седьмой до тринадцатой пробы).

Тест-карта может альтернативно или дополнительно включать одну или несколько дополнительных лунок, выбранных от четырнадцатой лунки до тридцать третьей лунки, (включающих, соответственно, от четырнадцатой до тридцать третьей пробы), описанных в настоящем документе. Например, карта может включать каждую от четырнадцатой лунки до тридцать третьей лунки (включающих, соответственно, от четырнадцатой до тридцать третьей пробы).

Каждая из вышеописанных вариантов осуществления тест-карт может дополнительно включать одну или несколько лунок для обнаружения атипичных микробных (например, бактериальных) вызывающих респираторную инфекцию агентов. В этом варианте осуществления, тест-карта может дополнительно включать одну или несколько дополнительных лунок, выбранных от тридцать четвертой лунки до тридцать девятой лунки (включающих, соответственно, от тридцать четвертой до тридцать девятой пробы), описанные в настоящем документе. Например, эта карта может включать каждую от тридцать четвертой лунки до тридцать девятой лунки (включающих, соответственно, от тридцать четвертой до тридцать девятой пробы).

Каждый из вышеописанных вариантов тест-карты может дополнительно включать одну или несколько ‘контрольных’ лунок. В этом варианте осуществления, тест-карта может дополнительно включать одну или несколько из сороковых и сорок первых лунок (включающих, соответственно, сороковые и/или сорок первые пробы) описанные в настоящем документе.

РАЗДЕЛ ОПРЕДЕЛЕНИЙ ТЕРМИНОВ

Ссылка на по меньшей мере 80% идентичность включает по меньшей мере 82%, по меньшей мере 84%, по меньшей мере 86%, по меньшей мере 88%, по меньшей мере 90%, по меньшей мере 91%, по меньшей мере 92%, по меньшей мере 93%, по меньшей мере 94%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99% и 100% идентичность последовательности (относительно каждой и любой последовательности нуклеиновой кислоты, представленной в настоящем документе, и/или относительно каждой и любой SEQ ID NO, представленной в настоящем документе.

Однобуквенный ссылочный код для нуклеотидов, используемых в настоящем описании, обозначает:

A аденин
C цитозин
G гуанин
T тимин
U урацил
I инозин
X инозин
R гуанин или аденин
Y тимин или цитозин
K гуанин или тимин
M аденин или цитозин
S гуанин или цитозин
W аденин или тимин
B не аденин
D не цитозин
H не гуанин
V не тимин
N любое основание нуклеиновой кислоты

Все последовательности нуклеиновых кислот, представленные в настоящем документе, представлены в ориентации 5’-к-3’ (слева-направо).

Пробы по изобретению предназначены для гибридизации с их последовательностью нуклеиновой кислоты-мишени, присутствующей на рассматриваемом вызывающем респираторную инфекцию мишеневом микроорганизме. Предпочтительно, условия связывания являются такими, которые обеспечивают высокий уровень специфичности - т.е. гибридизация пробы осуществляется при "жестких условиях". Обычно, выбирают жесткие условия, которыми являются приблизительно на 5°C более низкими, чем термическая точка плавления (Tm) для специфической последовательности при определенных ионной силе и рН. Tm является температурой (при определенных ионной силе и рН), при которой 50% последовательности-мишени (или комплемента) гибридизуются с превосходно совместимой пробой. В этом отношении, Tm проб по настоящему изобретению, при концентрации соли приблизительно 0,02 M или менее при рН 7, равна, например, более 60°C, например, приблизительно 70°C.

Предварительно смешанные буферные растворы являются коммерчески доступными (например, раствор для гибридизации EXPRESSHYB из CLONTECH Laboratories, Inc.), и гибридизация может проводиться в соответствии с инструкциями изготовителя.

Пробы по настоящему изобретению подвергают скринингу для минимизации самокомплементарности и образования димеров (связывания проба-проба) и отбирают таким образом, чтобы иметь минимальную гомологию с ДНК человека. Процесс отбора обычно включает сравнение кандидатной последовательности пробы с ДНК человека и отвергание пробы, если гомология больше, чем 50%. Целью этого процесса селекции (отбора) является уменьшение гибридизации (отжига) пробы с загрязняющими ДНК-последовательностями человека и, следовательно, получения улучшенной специфичности этого анализа.

Любая из описанных в настоящем документе проб может содержать таг и/или метку. Таг и/или метка могут быть локализованы, например, (независимо друг от друга) в направлении к середине или на 5’- или 3’-конце описанных в настоящем документе проб, например, на 5’-конце.

Таким образом, после гибридизации маркированной/меченой пробы с нуклеиновой кислотой-мишенью, таг (маркер)/метку ассоциируются с нуклеиновой кислотой-мишенью. Альтернативно, если используют стадию амплификации, эти пробы могут действовать в качестве праймеров во время способа этого изобретения, и таг (маркер) может, следовательно, становиться включенным в продукт амплификации по мере удлинения праймера.

Примеры подходящих меток включают детектируемые метки, такие как радиоактивные изотопы или флуоресцентные или окрашенные молекулы, ферментативные маркеры или хромогенные маркеры - например, красители, которые продуцируют видимое изменение окраски после гибридизации пробы. В качестве примера, меткой может быть дигоксигенин, флуоресцеин-изотиоцианат (FITC), R-фикоэритрин, Alexa 532 или Cy3. Пробы, предпочтительно, содержат Fam-метку (например, 5’-Fam-метку) и/или связывающий агент малой бороздки (MGB). Метка может быть репортерной молекулой, которая детектируется непосредственно, например, экспонированием на фотографической или X-ray (рентгеновской) пленке. Альтернативно, метка не является непосредственно детектируемой, но может быть обнаружена непосредственно, например, в двухфазной системе. Примером непосредственного обнаружения метки является связывание антитела с этой меткой.

Примеры подходящих тагов (маркеров) включают "пары комплемент/антикомплемент". Термин "пары комплемент/антикомплемент" обозначает не-идентичные части молекул, которые образуют нековалентно связанную, стабильную пару при подходящих условиях. Примеры подходящих маркеров включают биотин и стрептавидин (или авидин). В качестве примера, биотиновый маркер может быть захвачен с использованием стрептавидина, который может быть нанесен на субстрат или носитель, такой как гранула (например, магнитная гранула) или мембрана. Аналогично, стрептавидиновый маркер может быть захвачен с использованием биотина, который может быть нанесен на субстрат или носитель, такой как гранула (например, магнитная гранула) или мембрана. Другие примерные пары комплемент/антикомплемент включают пары рецептор-лиганд, антитело/антиген (или гаптен или эпитоп) и т.п. Другим примером является маркер в виде последовательности нуклеиновой кислоты, который связывается с комплементарной последовательностью. Последний, сам, может быть предварительно меченым или может быть присоединен к поверхности (например, гранулы), которую метят отдельно. Одним примером этого последнего варианта является хорошо известная система LuminexR гранул. Другие примерные пары тагов (маркеров) и захватывающих молекул включают пары рецептор/лиганд и антитело/антиген (или гаптен или эпитоп). Когда желательной является последующая диссоциация этой пары комплемент/антикомплемент, пара комплемент/антикомплемент имеет аффинность связывания, например, менее чем 109 M-1.

Пробы по изобретению могут быть помечены различными метками или тагами, что позволяет раздельную идентификацию каждой пробы при использовании в способе по настоящему изобретению.

Любой общепринятый способ может быть использован для присоединения тегов нуклеиновых кислот к пробе по настоящему изобретению (например, к 5’-концу определенной области связывания пробы). Альтернативно, пробы нуклеиновых кислот по изобретению (с предварительно присоединенными тагами нуклеиновых кислот) могут быть сконструированы коммерческими поставщиками.

Образец является, например, клиническим образцом (или полученным из клинического образца), таким как: фекалии или кровь, мокрота, мазки из носа и горла, бронхоальвеолярный лаваж, трахеальный аспират, носоглоточные аспираты, образцы ткани легких, цереброспинальная жидкость, археологические образцы. Образец является, предпочтительно, тканью/образцом человека или является образцом, полученным из них (например, образцом экстрагированной нуклеиновой кислоты).

Если используют стадию амплификации, стадия может проводиться с использованием способов и платформ, известных в данной области, например, ПЦР (например, с использованием "Fast DNA Polymerase", Life Technologies), таких как ПЦР реального времени, block-based ПЦР, лигазная цепная реакция, способы амплификации с использованием стеклянных капилляров, изометрические способы амплификации, включая опосредованная петлей изотермическая амплификация, опосредованная транскрипцией амплификация по модели катящегося кольца, амплификация на основе последовательности нуклеиновой кислоты, опосредуемая сигналом амплификация РНК-технологии, амплификация с вытеснением цепи, изотермическая амплификация множественного вытеснения, зависимая от геликазы амплификация, изотермическая амплификация с единственным праймером и кольцевая зависимая от геликазы амплификация.

При использовании амплификации, она может проводиться с использованием любой платформы амплификации - как таковое, преимущество этого варианта данного анализа заключается в том, что он не зависит от платформы и не привязан к какому-либо конкретному прибору.

В одном из вариантов осуществления, обычная стадия амплификации (например, предварительное обнаружение) может быть использована для увеличения количества нуклеиновой кислоты-мишени, присутствующей в образце. В этом варианте осуществления, праймеры ПЦР обычно используют для амплификации приблизительно 100-400 областей пар оснований мишени/комплементарной нуклеиновой кислоты, которые содержат нуклеотидные мишени по настоящему изобретению. В присутствии подходящих полимеразы и предшественников ДНК (dATP, dCTP, dGTP и dTTP), прямые и обратные праймеры удлиняются в направлении 5’ к 3’, инициируя синтез новых цепей нуклеиновой кислоты, которые являются комплементарными индивидуальным цепям нуклеиновой кислоты-мишени. Посредством этого праймеры запускают амплификацию последовательностей нуклеиновых кислот-мишеней, генерируя посредством этого продукты амплификации, содержащие указанные последовательности нуклеиновой кислоты-мишени.

В одном из вариантов осуществления, может быть выполнена стадия амплификации, в которой пробы по изобретению действуют в качестве праймеров. В этом варианте осуществления, пробы (действующие, как праймеры) удлиняются от их 3’-концов (т.е. в направлении 5’-к-3’). Полученные продукты амплификации обычно содержат области 100-400 пар оснований мишени/комплементарной нуклеиновой кислоты. Этот вариант осуществления может быть использован вместе с обычной стадией амплификации, такой как стадия амплификации, описанная выше.

Стадия обнаружения может проводиться любыми известными способами. В этом отношении, проба или продукт амплификации могут быть маркированы и/или помечены, и, следовательно, этот способ обнаружения может включать обнаружение указанного маркера и/или метки.

В одном из вариантов осуществления, проба (пробы) могут содержать таг и/или метку. Таким образом, в одном из вариантов осуществления, после гибридизации тегированной/меченой пробы с нуклеиновой кислотой-мишенью, таг/метка становится связанной с нуклеиновой кислотой-мишенью. Таким образом, в одном из вариантов осуществления, анализ может предусматривать обнаружение тега/метки и корреляцию присутствия тега/метки с присутствием нуклеиновой кислоты инфекционного микроорганизма.

В одном из вариантов осуществления, таг и/или метка могут быть включены во время удлинения пробы(проб). Тем самым, продукт (продукты) амплификации становятся маркированными/мечеными, и анализ, следовательно, предусматривает обнаружение тага/метки и корреляцию присутствия тага/метки продукта амплификации, и, следовательно, присутствия нуклеиновой кислоты инфекционного микроорганизма.

В качестве примера, в одном из вариантов осуществления, этот продукт амплификации может включать тег/метку (например, через тегированный/меченый dNTP, такой как биотин-dNTP) в виде части процесса амплификации, и этот анализ может дополнительно включать использование партнера связывания, комплементарного указанному тегу (например, стрептавидин), который включает детектируемые тег/метку (например, флуоресцентную метку, такую как R-фикоэритрин). Таким путем, амплифицированный продукт включает детектируемые тег/метку (например, флуоресцентную метку, такую как R-фикоэритрин).

В одном из вариантов осуществления, проба (пробы) и/или продукт (продукты) амплификации могут включать дополнительные тег/метку (в качестве комплементарного компонента) для возможности захвата продукта (продуктов) амплификации.

В качестве примера, может быть использовано спаривание "комплемент/антикомплемент", в котором компонент захвата антикомплемента связывается с указанными дополнительными тагом/меткой (компонентом комплемента) и тем самым делает возможным захват пробы (проб) и/или продукта (продуктов) амплификации. Примеры подходящих партнеров "комплемента/антикомплемента" были описаны выше в настоящем описании, такие как комплементарная пара последовательностей нуклеиновых кислот, комплементарная пара антитело-антиген, и т.д. Этот компонент захвата антикомплемента может быть присоединен (например, нанесен) на субстрат или твердый носитель - примеры подходящих субстратов/носителей включают мембраны и/или гранулы (например, магнитную или флуоресцентную гранулу). Способы захвата хорошо известны в данной области. Например, могут быть использованы гранулы LuminexR. Альтернативно, применение магнитных гранул может быть выгодным, так как гранулы (плюс захваченный, тегированный/меченый продукт амплификации) могут быть легко сконцентрированы и выделены из пробы, с использованием общепринятых способов, известных в данной области.

Иммобилизация обеспечивает физическое местоположение для компонента захвата антикомплемента (или проб), и может служить для фиксации компонента захвата/пробы в желаемом местоположении и/или облегчения извлечения или выделения пробы. Носитель может быть жестким носителем, изготовленным, например, из стекла или пластика, таким как гранула (например, флуоресцентная или магнитная гранула). Альтернативно, носитель может быть мембраной, такой как найлоновая или нитроцеллюлозная мембрана. 3D-матриксы также являются подходящими носителями для применения с данным изобретением - например, полиакриламидные или ПЭГ-гели. Иммобилизация на носитель/платформу может быть достигнута различными общепринятыми способами. В качестве примера, иммобилизация на носитель, такой как найлоновая мембрана, может быть достигнута УФ-сшиванием. Альтернативно, биотин-меченые молекулы могут быть связаны с покрытыми стрептавидином субстратами (и vice-versa), и молекулы, полученные с амино-линкерами, могут быть иммобилизованы на силанизированных поверхностях. Другим средством иммобилизации является поли-Т-хвост или поли-С-хвост, например, на 3’- или 5’-конце. Указанные способы иммобилизации применяют равным образом к компоненту пробы (и компоненту пары праймеров, в случае его присутствия) по настоящему изобретению.

В одном из вариантов осуществления, пробы по изобретению содержат тег/метку нуклеиновой кислоты (например, присоединенную к каждой пробе на 5’-конце определенной последовательности пробы, которая связывается с мишенью/комплементом нуклеиновой кислоты). Более подробно, каждая из этих проб обеспечена различными тегом/меткой последовательности нуклеиновой кислоты, где каждая из указанных тегов/меток (специфически) связывается с комплементарной последовательностью нуклеиновой кислоты, присутствующей на поверхности гранулы. Каждые из различных тегов/меток связываются с их комплементарной копией последовательности (и не связываются с любой из комплементарных копий последовательности других тегов), которая локализована на уникально идентифицируемой грануле. В этой связи, гранулы являются уникально идентифицируемыми, например, посредством флуоресценции при конкретной длине волны. Таким образом, при применении, пробы этого изобретения связываются с нуклеиновой кислотой-мишенью (если присутствуют в образце) (в 3’-направлении) в присутствии одного или нескольких меченых dNTP (например, меченых биотином dNTP, таких как биотин-dCTP). В дальнейшем связанные пробы могут быть удлиненными.

Удлиненные праймеры могут быть приведены в контакт с копией партнера связывания с мечеными dNTP (например, меченым стрептавидином флуорофором, таким как меченый стрептавидином R-фикоэритрин), который связывается с этими мечеными dNTP, которые стали включенными в удлиненные праймеры. После этого, эти меченые удлиненные праймеры могут быть идентифицированы позволением им связываться с их нуклеиново-кислотными копиями, присутствующими на этих уникально идентифицируемых гранулах. Затем последние могут быть "вызваны" (например, для определения типа присутствующих гранул, посредством эмиссии длины волны) и может быть определена природа удлинения праймера (и, следовательно, тип мишени/комплемента нуклеиновой кислоты).

Предпочтительные варианты осуществления настоящего изобретения

Первая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TAGGCAATGCWGC (SEQ ID NO:124).

Вторая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCYGGGAYGGGACCRACTA (SEQ ID NO:125).

Третья проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCAGCACCAGACACACC (SEQ ID NO:126).

Четвертая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCTGGTCATTGGRGCC (SEQ ID NO:127).

Пятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGCTCACTGGGCACGGT (SEQ ID NO:128).

Шестая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AACTGRGTGTTCATTTTGT (SEQ ID NO:129).

Седьмая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATARTTTCCAGGGGCAAA (SEQ ID NO:130).

Восьмая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCATCCGCAAGTCAATG (SEQ ID NO:131).

Девятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATAGTTGCCTGGTGCGAA (SEQ ID NO:132).

Десятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTGATAARGTAGGTGCTT (SEQ ID NO:133).

Одиннадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGCGGCRTCATYGA (SEQ ID NO:134).

Двенадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTCATARTGRTAATTAG (SEQ ID NO:135).

Тринадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTCATAGTAATAATTAG (SEQ ID NO:136).

Четырнадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGGTACTGTGACAATGC (SEQ ID NO:137) или CACGARGGCTCCACRTAC (SEQ ID NO:286).

Пятнадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCTGYRGCGGAACCGACT (SEQ ID NO:138).

Шестнадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGCTAACGAGTGTGCG (SEQ ID NO:139).

Семнадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTTGCGAATGAATGYGC (SEQ ID NO:140).

Восемнадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTGGGYTCTAAGCATGTTA (SEQ ID NO:141).

Девятнадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTAGGTTCTAAGCATGTCA (SEQ ID NO:142).

Двадцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CYTCGGAGTAYCTSAGYCC (SEQ ID NO:143).

Двадцать первая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCAGACTGCATCCGGTCT (SEQ ID NO:144).

Двадцать вторая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCYTGTCACCTCTGAC (SEQ ID NO:145).

Двадцать третья проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ACAGAGTGTGTYACTGT (SEQ ID NO:146).

Двадцать четвертая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTGGAATTTCTGGCCC (SEQ ID NO:147).

Двадцать пятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGTTGCCGGATGGA (SEQ ID NO:148).

Двадцать шестая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTACAGCAACTGTTACC (SEQ ID NO:149).

Двадцать седьмая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CATTGCTCCAGAAWAT (SEQ ID NO:150).

Двадцать восьмая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTCTNGCCATTGYAA (SEQ ID NO:151) или TGGTTTAGCTTCGGG (SEQ ID NO:255).

Двадцать девятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAATGTYCCTGTRACACA (SEQ ID NO:152).

Тридцатая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AARCTGGARTCTGARG (SEQ ID NO:153).

Тридцать первая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTTCRACTGTGTCTCC (SEQ ID NO:154).

Тридцать вторая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CACTGTGTCACCGCTCA (SEQ ID NO:155).

Тридцать третья проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCYGGGAYGGRACCRACTA (SEQ ID NO:156).

Тридцать четвертая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGCTCAATTGGCTTTAACC (SEQ ID NO:157).

Тридцать пятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGTGGAGAGTGTGTG (SEQ ID NO:158).

Тридцать шестая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAACAGACGCTGGCG (SEQ ID NO:159).

Тридцать седьмая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGTCGGCGTTTATTGG (SEQ ID NO:160).

Тридцать восьмая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTACTTGGTGTGAYGC (SEQ ID NO:161).

Тридцать девятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTACTTGGTGTGAYGC (SEQ ID NO:162).

Сороковая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCGATAGATCAAGGTGCCT (SEQ ID NO:163).

Сорок первая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTCTGACCTGAAGGCTCTG (SEQ ID NO:164).

Сорок вторая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTGGTGCARTTYGCCCG (SEQ ID NO:247).

Сорок третья проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAGGAYGCYTCGGARTACCT (SEQ ID NO:248).

Сорок четвертая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCAYGCTTGTGGANCTTATGC (SEQ ID NO:249).

Сорок пятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTYCCCATTCCATTCATTGT (SEQ ID NO:250).

Сорок шестая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCCWGTGTTTGCAGTRGA (SEQ ID NO:251).

Сорок седьмая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TAGGACCACGGGATGCA (SEQ ID NO:252).

Сорок восьмая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AAGTTGTCCTCGCTGCCACTC (SEQ ID NO:253).

Сорок девятая проба содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAGTGCCCGCGACGGACG (SEQ ID NO:254).

Праймер 1f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGGWGGWGAAGCWGGATTCTACC (SEQ ID NO:165), и праймер 1r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ACCTCTRTACTCTCCCATTATGCCTAG (SEQ ID NO:166).

Праймер 2f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGGCCCCTGAATGYGGCTAA (SEQ ID NO:167), и праймер 1r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAAACACGGACACCCAAAGTA (SEQ ID NO:168).

Праймер 3f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CATCAGGTAAYATCCCACAAAAYCAG (SEQ ID NO:169), и праймер 3r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTGAATATTAARGCACCTACACATAATAARA (SEQ ID NO:170).

Праймер 4f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCAGCTCTGATGTCCATCAAGCT (SEQ ID NO:171), и праймер 4r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAGCTTGCTTGCTTARAGCAATAGGTCT (SEQ ID NO:172).

Праймер 5f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GACCRATCCTGTCACCTCTGAC (SEQ ID NO:173), и праймер 5r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGGGCATTYTGGACAAAKCGTCTA (SEQ ID NO:174).

Праймер 6f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGTGGRTACGCTGCAGAC (SEQ ID NO:175), и праймер 6r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTTCAGCATTATAAGTCCAGACATCTAG (SEQ ID NO:176).

Праймер 7f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCYCCTTTYATATGTATACTCAGAGACCCA (SEQ ID NO:177), и праймер 7r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGTTCTTCCAGTTACATAYTGTTGCATAGC (SEQ ID NO:178).

Праймер 8f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AAGTGYATGACTGCTCCTGATCARCC (SEQ ID NO:179), и праймер 8r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTGCCAATRTCTCCCACCATRGCATA (SEQ ID NO:180).

Праймер 9f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCTCCTTTYATCTGTATCCTCAGAGATCC (SEQ ID NO:181), и праймер 9r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGATCTTCCCGTCACATACTGTTGCATG (SEQ ID NO:182).

Праймер 10f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGTTATAAGACAATTTCTTGTACAGGARATG (SEQ ID NO:183), и праймер 10r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TTTGCAATRTCTCCCACCATRGCATA (SEQ ID NO:184).

Праймер 11f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGACTTTTGARGTSGAYCCCATGGA (SEQ ID NO:185), и праймер 11r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCCGAGAASGGYGTRCGSAGGTA (SEQ ID NO:186).

Праймер 12f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGGGAAARATAGTCAAATCAGTCGA (SEQ ID NO:187), и праймер 12r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAGTTATCCCTGCAYACACATG (SEQ ID NO:188).

Праймер 13f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGGGAAARATAGTCAAATCAGTCGA (SEQ ID NO:189), и праймер 13r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAGTTATCCCTGCAYACACATG (SEQ ID NO:190).

Праймер 14f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAAGGGTCMAACATCTGYTTAACAAG (SEQ ID NO:191) или GGGCAAATATGGARACATACGTGAA (SEQ ID NO:256), и праймер 14r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCTWGTGGGAARAAAGAIACTGATCCTG (SEQ ID NO:192) или TCTTTTTCTARGACATTGTAYTGAACAGC (SEQ ID NO:257).

Праймер 15f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGGCCCCTGAATGYGGCTAA (SEQ ID NO:193), и праймер 15r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAAACACGGACACCCAAAGTA (SEQ ID NO:194).

Праймер 16f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGGGTTGGGATTATCCAAAATGTGA (SEQ ID NO:195), и праймер 16r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGCAGTTGTAGCATCACCGGATGAT (SEQ ID NO:196).

Пример 17f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGGGTTGGGATTATCCTAARTGTGA (SEQ ID NO:197), и праймер 17r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCAGTAGTTGCATCACCACTRCTAGT (SEQ ID NO:198).

Праймер 18f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGGGTTGGGATTATCCCAAATGTGA (SEQ ID NO:199), и праймер 18r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCTGTACTAGCRTCACCAGAAGT (SEQ ID NO:200).

Праймер 19f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGGGATGGGACTATCCTAAGTGTGA (SEQ ID NO:201), и праймер 19r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCTGTAGTTGCATCACCAGAAGT (SEQ ID NO:202).

Праймер 20f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCCCCARTGGKCNTACATGCACATC (SEQ ID NO:203), и праймер 20r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCCACIGTGGGRTTYCTRAACTT (SEQ ID NO:204).

Праймер 21f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CACKCCCAGGAARTGACGTAT (SEQ ID NO:205), и праймер 21r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCAGAGATGTTCACTCGCCGGA (SEQ ID NO:206).

Праймер 22f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAGTCTTCTAACMGAGGTCGAAACGTA (SEQ ID NO:207), и праймер 22r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGGCACGGTGAGCGTRAA (SEQ ID NO:208).

Праймер 23f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCAACAGACACTGTAGACACAGTACT (SEQ ID NO:209), и праймер 23r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTTTCCCGTTATGCTTGTCTTCTAG (SEQ ID NO:210).

Праймер 24f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGGCATCAGTTGGCTAACA (SEQ ID NO:211), и праймер 24r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ACAGCCACTGCCCCATT (SEQ ID NO:212).

Праймер 25f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGAATAGCCCCCCTACAATTG (SEQ ID NO:213), и праймер 25r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AATTCGCATTCTGGGTTTCCTA (SEQ ID NO:214).

Праймер 26f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTTTTTGTTGAACGCAGCAA (SEQ ID NO:215), и праймер 26r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGGATGAGGCAACTAGTGACCTA (SEQ ID NO:216).

Праймер 27f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCCGAATGATGCMATMAAYT (SEQ ID NO:217), и праймер 27r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGCACCCATTGGAGTTTGAC (SEQ ID NO:218).

Праймер 28f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGGTTTAGCTTCGGGGCRTCATG (SEQ ID NO:219) или GTNAAACTGAGYAGYGGITACAARGA (SEQ ID NO:258), и праймер 28r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AATRGTGCACYGCATGTTTCCRTT (SEQ ID NO:220) или GGCIAGAAGIAIRAARCATGAYGCC (SEQ ID NO:259).

Праймер 29f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGCATIGGYYACCARTCAAC (SEQ ID NO:221), и праймер 29r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTTGCACAYARCATYCCATTGTG (SEQ ID NO:222).

Праймер 30f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AATGTGAYGAYCARTGCATGGA (SEQ ID NO:223), и праймер 30r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAGATGAGGCRACAGTIGAATA (SEQ ID NO:224).

Праймер 31f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATTCAGACAGGATGGAACCGTYAA (SEQ ID NO:225), и праймер 31r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GATACTAAGCTTTGTTGTGACCTCAT (SEQ ID NO:226).

Праймер 32f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ACCCGATTRGARGCTTTCAGACAAGA (SEQ ID NO:227), и праймер 32r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTGTTGRGACCGCATGATTGAC (SEQ ID NO:228).

Праймер 33f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGGCCCCTGAATGYGGCTAA (SEQ ID NO:229), и праймер 33r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAAACACGGACACCCAAAGTA (SEQ ID NO:230).

Праймер 34f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AAAGGCATGCAAGACGCTATG (SEQ ID NO:231), и праймер 34r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGTTAAGAACGTCTTTCATTTGCTG (SEQ ID NO:232).

Праймер 35f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CCTTTCGTGGCAGTTGGGTCA (SEQ ID NO:233), и праймер 35r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ACTGAGCTTGATCCGCCCACA (SEQ ID NO:234).

Праймер 36f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAAGGGCTATAAAGGCGTTGCT (SEQ ID NO:235), и праймер 36r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CATGATAATTGATGGTCGCAGACTT (SEQ ID NO:236).

Праймер 37f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AATTTCATCGTTCCCGGCAG (SEQ ID NO:237), и праймер 37r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCCGCGTTTACTAATCCCCA (SEQ ID NO:238).

Праймер 38f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCACTATGTGGGAAGGTGCTTCA (SEQ ID NO:239), и праймер 38r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTGCGCGGATGCTAATGG (SEQ ID NO:240).

Праймер 39f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCACTATGTGGGAAGGTGCTTCA (SEQ ID NO:241), и праймер 39r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTAGTATCCTGCGCGGATGCT (SEQ ID NO:242).

Праймер 40f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGGCACTACCCCTCTCCGTATTCACG (SEQ ID NO:243), и праймер 40r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GTACGGGCGACCCCACGATGAC (SEQ ID NO:244).

Праймер 41f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности AGATTTGGACCTGCGAGCG (SEQ ID NO:245), и праймер 41r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAGCGGCTGTCTCCACAAGT (SEQ ID NO:246).

Праймер 42f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCCCCARTGGKCNTACATGCACATC (SEQ ID NO:203), и праймер 42r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCCACIGTGGGRTTYCTRAACTT (SEQ ID NO:204).

Праймер 43f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CARTGGKCITACATGCAYATCKC (SEQ ID NO:264), и праймер 43r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCRCGGGCRAAYTGCACCAG (SEQ ID NO:265) или GCGCGGGCAAACTGCACGAG (SEQ ID NO:266).

Праймер 44f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GGTGGYAGATGGCGTRCCATA (SEQ ID NO:270), и праймер 44r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TCTRACAAACTTACTAGAGGATGGCTG (SEQ ID NO:271).

Праймер 45f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности ATGGTYTCAGCTATGAACACAGCA (SEQ ID NO:274), и праймер 45r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности TGCCAGYTTTTGGACGTCTTCTCC (SEQ ID NO:275).

Праймер 46f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GCAGCTCTGATGTCCATCAAGCT (SEQ ID NO:171), и праймер 46r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CAGCTTGCTTGCTTARAGCAATAGGTCT (SEQ ID NO:172).

Праймер 47f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CGAACGGGTGAGTAACACGTGGGTGA (SEQ ID NO:278), и праймер 47r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности CTCATCCCACACCGCTAAAGCGCTT (SEQ ID NO:279).

Праймер 48f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GACGGGCCTCTTCGTCRTACGCAAT (SEQ ID NO:282), и праймер 48r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAGTGCTAGGTCGGGACGGTGAG (SEQ ID NO:283).

Праймер 49f содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GACGGGCCTCTTCGTCRTACGCAAT (SEQ ID NO:282), и праймер 49r содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 80% идентична последовательности GAGTGCTAGGTCGGGACGGTGAG (SEQ ID NO:283).

Гомология/идентичность последовательности

Любой из различных способов сопоставления последовательностей может быть использован для определения процентной идентичности, в том числе, без ограничения, глобальные способы, локальные способы и гибридные способы, такие как, например, способы сегментного подхода. Протоколы для определения процентной идентичности являются рутинными процедурами квалифицированных в этой области специалистов. Глобальные способы сопоставляют последовательности от начала до конца молекулы и определяют наилучшее сопоставление добавлением баллов индивидуальных пар остатков и введением штрафов за пропуски (гэпы) в последовательности. Неограничивающие способы включают, например, CLUSTAL W, см., например, Julie D. Thompson et al., CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice, 22 (22) Nucleic Acids Research 4673-4680 (1994); и итеративное усовершенствование, см., например, Osamu Gotoh, Significant Improvement in Accuracy of Multiple Protein. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments, 264(4) J. Mol. Biol, 823-838 (1996). Локальные способы сопоставляют последовательности идентификацией одного или нескольких консервативных мотивов, общих для всех введенных последовательностей. Неограничивающие способы включают, например, Match-box, см., например, Eric Depiereux and Ernest Feytmans, Match-Box: A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences, 8(5) CABIOS 501-509 (1992); Gibbs sampling, смотри, например, C. E. Lawrence et al., Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment 262 (5131) Science 208-214 (1993); Align-M, см., например, Ivo Van Walle et al., A New Algorithm for Multiple Alignment of Highly Divergent Sequences, 20 (9) Bioinformatics: 1428-1435 (2004). Таким образом, процентную идентичность последовательности определяют общепринятыми способами. См., например, Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 и Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915-19, 1992.

Варианты специфических последовательностей, обеспеченных выше, могут быть альтернативно определены подсчетом количества нуклеотидов, которые различаются между вариантными последовательностями, представленными выше. Так, в одном из вариантов осуществления, эта последовательность может содержать нуклеотидную последовательность (или состоять из нуклеотидной последовательности), которая отличается от обеспеченных выше специфических последовательностей не более чем 2 положениями нуклеотидов, например, не более, чем 1 положением нуклеотида. Консервативные замены являются предпочтительными.

В качестве примера, вариантные последовательности проб могут содержать последовательности нуклеиновых кислот, выбранные из: GGCAATGCIG (SEQ ID NO:287); GGCAATGCAG (SEQ ID NO:288); GGCAATGCTG (SEQ ID NO:289); AGGCAATGCW (SEQ ID NO:290) или GCAATGCWGCWCC (SEQ ID NO:291) для определенной первой пробы (GGCAATGCWG; SEQ ID NO:1).

Дополнительные вариантные последовательности проб включают: GAYGGRACCR (SEQ ID NO:292); GAYRGGACCR (SEQ ID NO:293); GATGGGACCR (SEQ ID NO:294); GACGGGACCR (SEQ ID NO:295); GAYGGGACCG (SEQ ID NO:296); GAYGGGACCA (SEQ ID NO:297); AYGGGACCRA (SEQ ID NO:298); GGAYGGGACC (SEQ ID NO:299); GAYGGGACCI (SEQ ID NO:300); или GAIGGGACCR (SEQ ID NO:301) для определенной второй пробы (GAYGGGACCR; SEQ ID NO:2).

Примеры вариантных последовательностей включают также: ACCAGACACA (SEQ ID NO:302); GCACCAGACA (SEQ ID NO:303); CACIAGACAC (SEQ ID NO:304); CACCAGAIAC (SEQ ID NO:305); CACCWGACAC (SEQ ID NO:306); CACCAGACWC (SEQ ID NO:307); или CACCARACAC (SEQ ID NO:308) для третьей пробы, определенной как содержащая определенную последовательность нуклеиновой кислоты (CACCAGACAC; SEQ ID NO:3).

Другие примеры вариантов включают: GGTCATYGGR (SEQ ID NO:309); GGTCATTGGG (SEQ ID NO:310); GGTCATTGGA (SEQ ID NO:311); GTCATTGGRG (SEQ ID NO:312); TGGTCATTGG (SEQ ID NO:313); GGTCATCGGR (SEQ ID NO:314); RGTCATTGGR (SEQ ID NO:315); AGTCATTGGR (SEQ ID NO:316); GGTIATTGGR (SEQ ID NO:317); или GGTCATTIGR (SEQ ID NO:318) для четвертой пробы, содержащей определенную последовательность нуклеиновой кислоты (GGTCATTGGR; SEQ ID NO:4).

Дополнительные примеры вариантных последовательностей проб включают также: ACTGGGCACG (SEQ ID NO:319); TCACTGGGCA (SEQ ID NO:320); CRCTGGGCAC (SEQ ID NO:321); CGCTGGGCAC (SEQ ID NO:322); CACTGGGIAC (SEQ ID NO:323); CAITGGGCAC (SEQ ID NO:324); CACTGGRCAC (SEQ ID NO:325); CACTRGGCAC (SEQ ID NO:326); или CACYGGGCAC (SEQ ID NO:327) для пятой пробы с последовательностью нуклеиновой кислоты, которая была определена (CACTGGGCAC:SEQ ID NO:5).

Примеры вариантных последовательностей проб для определенной шестой пробы (RGTGTTCATT; SEQ ID NO:6) включают: GRGTGTTCAT (SEQ ID NO:328); GTGTTCATTT (SEQ ID NO:329); AGTGTTCATT (SEQ ID NO:330); GGTGTTCATT (SEQ ID NO:331); RGTGTTIATT (SEQ ID NO:332); RGTRTTCATT (SEQ ID NO:333); RGTGTTCAWT (SEQ ID NO:334); RGTGTWCATT (SEQ ID NO:335); RGTGTTCWTT (SEQ ID NO:336); или RGIGTTCATT (SEQ ID NO:337).

Фрагменты вышеупомянутых последовательностей (и их варианты, определенные выше) могут быть также использованы, например, фрагменты, содержащие 10, 9, 8, 7, 6, 5 пар, 4, 3, 2 пары или 1 пару оснований описанных в настоящем документе определенных последовательностей.

Пример 1 - панель заражения Н5

Для подтверждения точности анализа авторов готовили тест-карту, содержащую 41 лунку - эти лунки загружали соответствующими от первой до сорок первой пробами, соответственно.

Авторы настоящего изобретения заразили тест-карту известной специально подготовленной панелью вирусов гриппа Н5. Используемый протокол включает следующие стадии: 50°C в течение 5 минут (RT); 95°C в течение 20 секунд; 95°C в течение 1 секунды х 45; и 60°C в течение 20 секунд.

Согласно Таблице 1 (см. ниже) ожидаемые результаты Ct показаны в левых столбцах, и результаты тест-карты показаны в крайнем правом столбце. В анализе ПЦР реального времени, положительная реакция детектируется посредством накапливания флуоресцентного сигнала. Количество Ct (порога циклов) определяется как количество циклов, требующееся для пересечения этим флуоресцентным сигналом этого порога (т.е. превышения уровня фона).

Эти результаты для данной тест-карты корректно запрашивались всеми этими образцами. Заметно, что пробы тест-карты, корректно запрошенные tamiflu-устойчивой/чувствительной смесью в образце G*, и два H5N1-изолята корректно запрашивались всеми тремя релевантными пробами. Пробы тест-карты также корректно порождали подтипы, H1/H3 сезонный и H1v2009. Результаты всех других проб были отрицательными.

Пример 2 - Панель заражения А/В

Для подтверждения точности анализа авторы готовили тест карту, как в Примере 1, содержащую 41 лунку - эти лунки загружали соответствующими от первой до сорок первой пробами, соответственно.

Авторы настоящего изобретения заразили эту тест-карту известной специально подготовленной панелью вирусов flu A/B. Согласно Таблице 2 (см. ниже), ожидаемые результаты Сt показаны в левых столбцах, и эти результаты тест-карты показаны в крайнем правом столбце. Опять этот анализ корректно запрашивал каждый из образцов в этой панели.

Пример 3 - Образец пациента с предположительным Птичьим гриппом Н5 анализировали в соответствии с данным изобретением параллельно с общепринятыми мультиплексными тестами

60-летний вышедший на пенсию учитель из Тасмании, Австралии, путешествовал со своей женой в Гонконг 26 августа 2011 года. Этот человек оставался в Гонконге в течение 5 дней перед продолжением пути в Англию и достиг Англии 31 августа 2011 года. Этот человек обратился в больницу 4 сентября 2011 года, но был отправлен домой, так как его не сочли больным. Этот человек повторно обратился 8 сентября 2011 года, так как он почувствовал себя еще хуже. Респираторные образцы (мокрота и мазок из носа и горла) были взяты 8 сентября 2011 года.

В субботу 10 сентября 2011 эти образцы протестировали в соответствии с данным изобретением (анализ выполняли в целом в течение 2 часов) и результаты этой тест-карты показаны ниже.

Проба 22 (Flu A Quad) = 26,3.

Проба 5 (Flu A CDC) = 23,7.

Проба 26 (H3) = 22,7.

Положительные контроли: проба 40 (фаг MS2) = 32,0; проба 41 (RNКаза P) = 22,6.

Все другие пробы на этой тест-карте были явно отрицательными.

Результат тест-карты: H5 отрицательный, импортированный сезонный грипп H3N2.

Параллельно, выполняли общепринятый мультиплексный анализ (анализы выполняли в целом в течение 4-5 часов) и эти результаты приведены ниже:

Flu A Quad = 26,4.

Flu A CDC = 17,9.

H3 Cfl = 19,7.

Рутинный мультиплексный результат: Н5 отрицательный, импортированный сезонный грипп H3N2.

Эти данные подтверждают, что анализ singleplex тест-карты настоящего изобретения был более быстрым (более чем в 2 раза быстрым) и даже более точным (более высокие величины Ct) в доставке результатов анализа. Кроме того, подход с картой анализа singleplex по настоящему изобретению позволяет существенно более понятный скрининг (в виде количества различных тестированных патогенов), чем общепринятые мультиплексные подходы (все в сильно уменьшенном периоде времени).

Пример 4 - Второй предположительный случай Птичьего гриппа Н5 анализировали в соответствии с данным изобретением параллельно с общепринятыми мультиплексными тестами

50-летняя женщина, которая недавно ездила в Северный Сомали, Джибути и Дубаи, обратилась в больницу в Лондоне с острым случаем двусторонней пневмонии (требующей интубации) 10/11/11. Образцы (мазки из носа/горла) (общее время анализа = 2 часа), и результаты этой тест-карты показаны ниже.

Проба 3 (hMPV) = 31,0 - обнаружилась только одна форма вируса в этом образце.

Положительные контроли: проба 40 (фаг MS2) = 31,0: проба 41 (РНКаза P) = 29,4.

Все другие пробы на этой карте были явно отрицательными.

Результат: Птичий H5 вирус отрицательный, пациентка имела инфекцию hMPV.

Параллельные мультиплексные результаты (время анализа = 4-5 часам).

hMPV = 25,0.

Результат: Птичий H5 вирус отрицательный, подтверждена инфекция hMPV.

Эти данные подтверждают, что подход тест-карты singleplex по настоящему изобретению подтверждал превосходящие (более высокие величины Ct) и обеспечивал более быстрые результаты, чем общепринятые мультиплексные тесты, доставляя эти результаты на несколько часов ранее и позволяя обследовать пациента на дополнительные вирусные и бактериальные патогены.

Пример 5 - Производительность по настоящему изобретению оценивали с использованием Контроля Качества для панелей молекулярной диагностики.

Для полного оценивания производительности этой тест-карты, коммерчески доступные наружные панели Контроля качества для молекулярной диагностики (QCMD) (www.qcmd.org) для диапазона различных патогенов тестировали, обеспечивая посредством этого международный эталонный тест (бенчмарк), на качество, производительность и надежность результатов этой тест-карты.

Программа QCMD 2011 Legionella pneumophila DNA EQA - 100% -корректная.

Программа QCMD 2010 Parainfluenzavirus RNA EQA - 100% -корректная.

Программа QCMD 2010 Rhinovirus & Coronavirus RNA EQA - 100% - корректная.

Программа QCMD 2011 Enterovirus RNA EQA - 11/12-корректная.

Программа QCMD 2010 Adenovirus DNA EQA - 6/8-корректная.

QCMD 2010 Метапневмовирус и респираторно-синцитиальный вирус -10/12-корректная.

QCMD 2011 C. pneumoniae и Mycoplasma pneumoniae - 9/1-корректная.

Эти данные подтверждают, что подход с тест-картой singleplex по настоящему изобретению предоставлял как чувствительность, так и производительность, которые были сравнимы с общепринятыми мультиплексными анализами, хотя и включали гораздо более короткий период времени (2 часа против 4-5 часов).

Пример 6 - Сравнительное head-to-head (головка к головке) оценивание по настоящему изобретению с общепринятыми мультиплексными респираторными анализами с использованием 216 клинических образцов, положительных в отношении различных вирусов.

Результаты карты для испытаний (тест-карты) представлены ниже.

30 RSV-положительных образцов 100% соответствие с рутинными мультиплексными анализами
14 Flu B-положительных образцов 100% соответствие с рутинными мультиплексными анализами (эти образцы включали две ко-инфекции, hMPV & RSV)

54 Flu A-положительных образца 100% соответствие с рутинными мультиплексными анализами (эти образцы включали Tamiflu-устойчивый изолят и Flu B-ко-инфекцию)
10 Бокавирус-положительных образцов 100% соответствие с рутинными мультиплексными анализами (посредством этой тест-карты обнаружено, что 8/10 являются ко-инфекциями, высокие вирусные нагрузки бокавируса - величины Ct в диапазоне 15-26)
31 Вирус парагриппа человека-положительный образец (типы 1-4) 100% соответствие с рутинными мультиплексными анализами
17 Аденовирус-положительных образцов 100% соответствие с рутинными мультиплексными анализами
22 Риновирус-положительных образца 100% соответствие с рутинными мультиплексными анализами
11 Энтеровирус-положительных образцов 100% соответствие с рутинными мультиплексными анализами
11 Коронавирус-положительных образцов 100% соответствие с рутинными мультиплексными анализами
16 Метапневмовирус человека 100% соответствие с рутинными мультиплексными анализами

Эти данные подтверждают, что подход с тест-картой singleplex по настоящему изобретению опять оказался высокоспецифическим и чувствительным, а также надежным, детектирующим только правильные (корректные) патогены. В частности, с этой тест-картой не наблюдали ложноположительных результатов. Единственным ложноотрицательным результатом был единственный образец коронавируса, который имел Ct>32 в рутинном мультиплексном анализе реального времени авторов и не обнаружился на карте массива. Ко-инфекции также корректно идентифицировались с использованием тест-карт. 31 известный отрицательный образец также процессировался посредством этих карт, и для любых из этих мишеней не наблюдали ложноположительных результатов.

1. Количественный способ Uniplex для обнаружения присутствия одного или нескольких из по меньшей мере шести микроорганизмов, вызывающих респираторную инфекцию, выбранных из (i) респираторно-синцитиального вируса (RSV А & В), (ii) риновируса, (iii) метапневмовируса человека (hMPV), (iv) гриппа В (Flu В Quad), (v) гриппа A (Flu A CDC DC) и (vi) подтипа Н5 гриппа А (Н5 FRET) в образце или для обнаружения отсутствия указанных микроорганизмов, вызывающих респираторную инфекцию, в указанном образце, где способ включает:

А) нанесение образца на тест-карту, где указанная тест-карта содержит шесть отдельных лунок:

1) первую лунку, в которой находится первая проба для обнаружения присутствия или отсутствия респираторно-синцитиального вируса (RSV А & В), где первая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты GGCAATGCWG (SEQ ID NO: 1);

2) вторую лунку, в которой находится вторая проба для обнаружения присутствия или отсутствия риновируса, где вторая проба имеет последовательность нуклеиновой кислоты GAYGGGACCR (SEQ ID NO: 2);

3) третью лунку, в которой находится третья проба для обнаружения присутствия или отсутствия метапневмовируса человека (hMPV), где третья проба имеет последовательность нуклеиновой кислоты CACCAGACAC (SEQ ID NO: 3);

4) четвертую лунку, в которой находится четвертая проба для обнаружения присутствия или отсутствия гриппа В (Flu В Quad), где четвертая проба имеет последовательность нуклеиновой кислоты GGTCATTGGR (SEQ ID NO: 4);

5) пятую лунку, в которой находится пятая проба для обнаружения присутствия или отсутствия гриппа A (Flu A CDC DC), где пятая проба имеет последовательность нуклеиновой кислоты CACTGGGCAC (SEQ ID NO: 5);

6) шестую лунку, в которой находится шестая проба для обнаружения присутствия или отсутствия подтипа Н5 гриппа А (Н5 FRET), где шестая проба имеет последовательность нуклеиновой кислоты RGTGTTCATT (SEQ ID NO: 6);

B) приведение нуклеиновой кислоты, присутствующей в образце, в контакт с пробами указанных лунок;

C) обнаружение присутствия комплекса связанной нуклеиновой кислоты, в котором образец нуклеиновой кислоты связан с одной или несколькими указанными пробами;

где присутствие комплекса связанной нуклеиновой кислоты подтверждает, что нуклеиновая кислота одной или нескольких указанных шести микроорганизмов, вызывающих респираторную инфекцию, присутствует в образце, и где отсутствие комплекса связанной нуклеиновой кислоты подтверждает, что нуклеиновая кислота всех указанных шести микроорганизмов, вызывающих респираторную инфекцию, отсутствует в образце.

2. Количественный способ по п. 1, где тест-карта содержит одну или несколько дополнительных лунок, и соответствующие одну или несколько дополнительных проб, выбранных из:

7) седьмой лунки, в которой находится седьмая проба для обнаружения присутствия или отсутствия вируса парагриппа типа 1 человека (HPIV 1), где седьмая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 7;

8) восьмой лунки, в которой находится восьмая проба для обнаружения присутствия или отсутствия вируса парагриппа типа 2 человека (HPIV 2), где восьмая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 8;

9) девятой лунки, в которой находится девятая проба для обнаружения присутствия или отсутствия вируса парагриппа типа 3 человека (HPIV 3), где девятая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 9;

10) десятой лунки, в которой находится десятая проба для обнаружения присутствия или отсутствия вируса парагриппа типа 4 человека (HPIV 4), где десятая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 10;

11) одиннадцатой лунки, в которой находится одиннадцатая проба для обнаружения присутствия или отсутствия аденовирусов человека #2, где одиннадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 11;

12) двенадцатой лунки, в которой находится двенадцатая проба для обнаружения присутствия или отсутствия вируса А HI 2009, Tamiflu чувствительного, где двенадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 12;

13) тринадцатой лунки, в которой находится тринадцатая проба для обнаружения присутствия или отсутствия вируса А Hi 2009, Tamiflu устойчивого, где тринадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 13.

3. Количественный способ по п. 2, где тест-карта содержит каждую из дополнительных от седьмой до тринадцатой лунок и соответствующих от седьмой до тринадцатой дополнительных проб.

4. Количественный способ по любому из предыдущих пунктов, где тест-карта содержит одну или несколько дополнительных лунок и соответствующие одну или несколько проб, выбранных из:

14) четырнадцатой лунки, в которой находится четырнадцатая проба для обнаружения присутствия или отсутствия респираторно-синцитиального вируса (RSV #2), (RSV #3), где четырнадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 14;

15) пятнадцатой лунки, в которой находится пятнадцатая проба для обнаружения присутствия или отсутствия энтеровируса, где пятнадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 15;

16) шестнадцатой лунки, в которой находится шестнадцатая проба для обнаружения присутствия или отсутствия коронавируса тяжелого острого респираторного синдрома (SARS), где шестнадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 16;

17) семнадцатой лунки, в которой находится семнадцатая проба для обнаружения присутствия или отсутствия коронавируса группы 2 OC43 и HKU1 (GP2 OC43/HKU1), где семнадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 17;

18) восемнадцатой лунки, в которой находится восемнадцатая проба для обнаружения присутствия или отсутствия коронавируса группы 1 NL63 (GP1 NL63), где восемнадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 18;

19) девятнадцатой лунки, в которой находится девятнадцатая проба для обнаружения присутствия или отсутствия коронавируса группы 1 229Е (GP1 229Е), где девятнадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 19;

20) двадцатой лунки, в которой находится двадцатая проба для обнаружения присутствия или отсутствия аденовирусов человека, где двадцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 20;

21) двадцать первой лунки, в которой находится двадцать первая проба для обнаружения присутствия или отсутствия бокавируса, где двадцать первая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 21;

22) двадцать второй лунки, в которой находится двадцать вторая проба для обнаружения присутствия или отсутствия гриппа А (Flu A Quad), где двадцать вторая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 22;

23) двадцать третьей лунки, в которой находится двадцать третья проба для обнаружения присутствия или отсутствия гриппа А H1 2009 (H1 sw 2009), где двадцать третья проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 23;

24) двадцать четвертой лунки, в которой находится двадцать четвертая проба для обнаружения присутствия или отсутствия гриппа А N1 2009 (N1 CFI), где двадцать четвертая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 24;

25) двадцать пятой лунки, в которой находится двадцать пятая проба для обнаружения присутствия или отсутствия гриппа А H1 сезонного (H1 сезонного CFI), где двадцать пятая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 25;

26) двадцать шестой лунки, в которой находится двадцать шестая проба для обнаружения присутствия или отсутствия гриппа А Н3 сезонного (Н3 сезонного CFI), где двадцать шестая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 26;

27) двадцать седьмой лунки, в которой находится двадцать седьмая проба для обнаружения присутствия или отсутствия гриппа А Н5 (Н5 CFI), где двадцать седьмая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 27;

28) двадцать восьмой лунки, в которой находится двадцать восьмая проба для обнаружения присутствия или отсутствия гриппа А Н7 (Н7), где двадцать восьмая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 28;

29) двадцать девятой лунки, в которой находится двадцать девятая проба для обнаружения присутствия или отсутствия гриппа А Н9 (Н9 а), где двадцать девятая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 29;

30) тридцатой лунки, в которой находится тридцатая проба для обнаружения присутствия или отсутствия гриппа А Н9 (Н9 b), где тридцатая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 30;

31) тридцать первой лунки, в которой находится тридцать первая проба для обнаружения присутствия или отсутствия паравируса типа 1 человека (HPIV 1 #2), где тридцать первая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 31;

32) тридцать второй лунки, в которой находится тридцать вторая проба для обнаружения присутствия или отсутствия паравируса типа 3 человека (HPIV 1 #3), где тридцать вторая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 32;

33) тридцать третьей лунки, в которой находится тридцать третья проба для обнаружения присутствия или отсутствия риновирусов #2, где тридцать третья проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 33.

5. Количественный способ по п. 4, где тест-карта содержит каждую из дополнительных от четырнадцатой до тридцать третьей лунок и соответствующих от четырнадцатой до тридцать третьей дополнительных проб.

6. Количественный способ по любому из предыдущих пунктов, где тест-карта содержит одну или несколько дополнительных лунок и соответствующие одну или несколько дополнительных проб, выбранных из:

34) тридцать четвертой лунки, в которой находится тридцать четвертая проба для обнаружения присутствия или отсутствия Legionella pneumophilia, где тридцать четвертая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 34;

35) тридцать пятой лунки, в которой находится тридцать пятая проба для обнаружения присутствия или отсутствия Mycoplasma pneumoniae, где тридцать пятая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 35;

36) тридцать шестой лунки, в которой находится тридцать шестая проба для обнаружения присутствия или отсутствия Chlamydiophilia pneumoniae, где тридцать шестая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 36;

37) тридцать седьмой лунки, в которой находится тридцать седьмая проба для обнаружения присутствия или отсутствия Coxiella burnetti, где тридцать седьмая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 37;

38) тридцать восьмой лунки, в которой находится тридцать восьмая проба для обнаружения присутствия или отсутствия Chlamydiophilia psittaci, где тридцать восьмая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 38;

39) тридцать девятой лунки, в которой находится тридцать девятая проба для обнаружения присутствия или отсутствия Chlamydiophilia abortus, где тридцать девятая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 39.

7. Количественный способ по п. 4, где тест-карта содержит одну или несколько дополнительных лунок и соответствующие одну или несколько дополнительных проб, выбранных из:

34) тридцать четвертой лунки, в которой находится тридцать четвертая проба для обнаружения присутствия или отсутствия Legionella pneumophilia, где тридцать четвертая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 34;

35) тридцать пятой лунки, в которой находится тридцать пятая проба для обнаружения присутствия или отсутствия Mycoplasma pneumoniae, где тридцать пятая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 35;

36) тридцать шестой лунки, в которой находится тридцать шестая проба для обнаружения присутствия или отсутствия Chlamydiophilia pneumoniae, где тридцать шестая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 36;

37) тридцать седьмой лунки, в которой находится тридцать седьмая проба для обнаружения присутствия или отсутствия Coxiella burnetti, где тридцать седьмая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 37;

38) тридцать восьмой лунки, в которой находится тридцать восьмая проба для обнаружения присутствия или отсутствия Chlamydiophilia psittaci, где тридцать восьмая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 38;

39) тридцать девятой лунки, в которой находится тридцать девятая проба для обнаружения присутствия или отсутствия Chlamydiophilia abortus, где тридцать девятая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 39.

8. Количественный способ по п. 6, где тест-карта содержит каждую из дополнительных от тридцать третьей до тридцать девятой лунок и соответствующих от тридцать третьей до тридцать девятой дополнительных проб.

9. Количественный способ по любому из пп. 1-3, 5 или 7 или 8, где тест-карта содержит одну или несколько дополнительных контрольных лунок и соответствующие одну или несколько дополнительных контрольных проб, выбранных из:

40) сороковой лунки, в которой находится сороковая проба для обнаружения присутствия или отсутствия бактериофага MS2 (MS2 IC) Escherichia coli, где сороковая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 40;

41) сорок первой лунки, в которой находится сорок первая проба для обнаружения присутствия или отсутствия гена рибонуклеазы Р человека (RNAse Р), где сорок первая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 41.

10. Количественный способ по п. 4, где тест-карта содержит одну или несколько дополнительных контрольных лунок и соответствующие одну или несколько дополнительных контрольных проб, выбранных из:

40) сороковой лунки, в которой находится сороковая проба для обнаружения присутствия или отсутствия бактериофага MS2 (MS2 IC) Escherichia coli, где сороковая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 40;

41) сорок первой лунки, в которой находится сорок первая проба для обнаружения присутствия или отсутствия гена рибонуклеазы Р человека (RNAse Р), где сорок первая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 41.

11. Количественный способ по п. 6, где тест-карта содержит одну или несколько дополнительных контрольных лунок и соответствующие одну или несколько дополнительных контрольных проб, выбранных из:

40) сороковой лунки, в которой находится сороковая проба для обнаружения присутствия или отсутствия бактериофага MS2 (MS2 IC) Escherichia coli, где сороковая проба имеет последовательность нуклеиновой кислоты SEQ ID NO: 40;

41) сорок первой лунки, в которой находится сорок первая проба для обнаружения присутствия или отсутствия гена рибонуклеазы Р человека (RNAse Р), где сорок первая проба имеет последовательность нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, которая по меньшей мере на 90% идентична последовательности нуклеиновой кислоты SEQ ID NO: 41.

12. Количественный способ по п. 9, где тест-карта содержит одну или обе дополнительные сороковую и сорок первую лунки и соответствующие сороковую и сорок первую дополнительные пробы.

13. Количественный способ по любому из пп. 1-3, 5, 7, 8 или 10-12, где указанный способ включает стадию амплификации нуклеиновой кислоты до обнаружения.

14. Количественный способ по п. 4, где указанный способ включает стадию амплификации нуклеиновой кислоты до обнаружения.

15. Количественный способ по п. 6, где указанный способ включает стадию амплификации нуклеиновой кислоты до обнаружения.

16. Количественный способ по п. 9, где указанный способ включает стадию амплификации нуклеиновой кислоты до обнаружения.

17. Тест-карта для применения в количественном способе по любому из предыдущих пунктов, где указанная тест-карта содержит множество лунок, где предусмотрены по меньшей мере шесть лунок, и где первая лунка включает первую пробу, вторая лунка включает вторую пробу, третья лунка включает третью пробу, четвертая лунка включает четвертую пробу, пятая лунка включает пятую пробу и шестая лунка включает шестую пробу по настоящему изобретению, как определено в предыдущих пунктах.

18. Тест-карта по п. 17, дополнительно содержащая одну или несколько (предпочтительно, все) дополнительных от седьмой до тринадцатой лунок, где указанные лунки содержат соответствующие от седьмой до тринадцатой пробы.

19. Тест-карта по п. 17 или 18, дополнительно содержащая одну или несколько (предпочтительно, все) дополнительных от четырнадцатой до тридцать третьей лунок, где указанные лунки содержат соответствующие от четырнадцатой до тридцать третьей пробы.

20. Тест-карта по п. 17 или 18, дополнительно содержащая одну или несколько (предпочтительно, все) дополнительных от тридцать четвертой до тридцать девятой лунок, где указанные лунки содержат соответствующие от тридцать четвертой до тридцать девятой пробы.

21. Тест-карта по п. 19, дополнительно содержащая одну или несколько (предпочтительно, все) дополнительных от тридцать четвертой до тридцать девятой лунок, где указанные лунки содержат соответствующие от тридцать четвертой до тридцать девятой пробы.

22. Тест-карта по п. 17 или 18, дополнительно содержащая одну или обе (предпочтительно, все) дополнительных от сороковой до сорок первой лунок, где указанные лунки содержат соответствующие от сороковой до сорок первой пробы.

23. Тест-карта по п. 19, дополнительно содержащая одну или обе (предпочтительно, все) дополнительных от сороковой до сорок первой лунок, где указанные лунки содержат соответствующие от сороковой до сорок первой пробы.

24. Тест-карта по п. 20, дополнительно содержащая одну или обе (предпочтительно, все) дополнительных от сороковой до сорок первой лунок, где указанные лунки содержат соответствующие от сороковой до сорок первой пробы.

25. Тест-карта по любому из пп. 17, или 18, или 21, где пробы иммобилизованы на поверхности соответствующих лунок;

предпочтительно, где пробы присутствуют в лиофилизированной форме, адсорбированной на поверхности соответствующих лунок.

26. Тест-карта по п. 19, где пробы иммобилизованы на поверхности соответствующих лунок; предпочтительно, где пробы присутствуют в лиофилизированной форме, адсорбированной на поверхности соответствующих лунок.

27. Тест-карта по п. 20, где пробы иммобилизованы на поверхности соответствующих лунок; предпочтительно, где пробы присутствуют в лиофилизированной форме, адсорбированной на поверхности соответствующих лунок.

28. Тест-карта по п. 22, где пробы иммобилизованы на поверхности соответствующих лунок; предпочтительно, где пробы присутствуют в лиофилизированной форме, адсорбированной на поверхности соответствующих лунок.



 

Похожие патенты:

Изобретение относится к биотехнологии. Предложен способ in vitro определения наличия в образце рыбьего жира активности n-3 полиненасыщенной жирной кислоты (PUFA).

Изобретение относится к области биохимии. Описан способ дифференциации штаммов Yersinia pestis на основной и неосновные подвиды методом ПЦР в режиме реального времени.

Изобретение относится к области медицины, в частности к педиатрии. Предложен способ определения показаний к проведению противогерпетической терапии при инфекции ВГЧ-6 у детей с острыми респираторными заболеваниями.
Изобретение относится к области медицины и предназначено для определения генетической предрасположенности к атеросклерозу, ишемической болезни сердца и инфаркту миокарда.

Изобретение относится к биохимии. Описан способ дифференциальной и подтверждающей молекулярно-генетической диагностики врожденной аниридии и WAGR-синдрома.

Изобретение относится к области медицины и предназначено для идентификации Mycobacterium leprae. ДНК выделяют из соскоба со слизистой оболочки полости носа в 5% растворе сывороточного бычьего альбумина.

Изобретение относится к области медицины, в частности к медицинской генетике и сердечно-сосудистой хирургии. Предложен способ прогнозирования риска развития синдрома полиорганной недостаточности у пациентов после коронарного шунтирования.

Изобретение относится к области биотехнологии и касается способа определения, имеется ли у пациента с гепатитом В (HBV) повышенная вероятность положительного результата лечения гепатита В по сравнению со средней вероятностью в популяции пациентов с гепатитом В.

Предложенная группа изобретений относится к области медицины. Предложены фармацевтическая композиция для предупреждения или лечения бокового амиотрофического склероза, содержащая изоформы фактора роста гепатоцитов (HGF) или полинуклеотид, кодирующий изоформы, и способ предупреждения или лечения бокового амиотрофического склероза, включающий введение млекопитающему указанной композиции.

Изобретение относится к биохимии, в частности к способу скрининга противоопухолевых препаратов - ингибиторов PARP1. Для осуществления указанного способа проводят сборку нуклеосом из очищенных гистонов на ДНК-матрицах, затем лигирование с РНК-полимеразой и внесение в полученный комплекс молекулярной мишени - белка PARP1, с последующим внесением буфера транскрипции, а также тестируемых химических соединений.

Изобретение относится к медицине и, в частности, к вирусологии и инфекционным заболеваниям. Предложен способ выявления вируса гепатита В при низкой вирусной нагрузке путем определения в биопробе ДНК вируса методом ПЦР с дальнейшим секвенированием фрагментов.

Изобретение касается способа оценки вирусной контаминации воздуха РНК-содержащими вирусами, возбудителями острых респираторных вирусных инфекций в помещении. Представленный способ включает отбор проб воздуха с помощью пробоотборника «Флора - 100», который размещают по определенной схеме, и идентификацию микроорганизмов, при этом дополнительно устанавливают мембранный фильтр в пробоотборник, в чашку с отобранной пробой помещают 10 мл среды для сохранения и стабилизации РНК вирусов, а идентификацию вирусов проводят путем определения содержания нуклеиновых кислот возбудителей острых респираторных вирусных инфекций человека методом мультиплексной ПЦР с детекцией в режиме реального времени.

Изобретение относится к биохимии. Описан способ прогнозирования восприимчивости человека, инфицированного вирусом гепатита С (HCV), к терапии пэгинтерфероном альфа-2a, рибавирином и противовирусным агентом прямого действия.

Изобретение относится к биохимии. Описан набор для выявления ДНК провируса иммунодефицита крупного рогатого скота (BIV (bovine immunodeficiency virus)), содержащий пару специфичных праймеров и ДНК-зонд, методом ПЦР в режиме реального времени.

Способ относится к микробиологии и может применяться для определения чувствительности микроорганизмов к бактериофагам. Способ количественной оценки литической активности бактериофагов предусматривает приготовление бактериальной суспензии суточной культуры микроорганизма, выращенной при заданных условиях и соединенной с мясо-пептонным бульоном и специфическим бактериофагом.

Представленные решения касаются способа генерирования заквасочной культуры, заквасочной культуры и способа ферментации с использованием такой заквасочной культуры.

Изобретение относится к области медицины, в частности к применению молекулярных маркеров ВПЧ ВКР и их качественных и количественных характеристик для прогнозирования течения гиперпролиферативных заболеваний ШМ.
Изобретение относится к области биотехнологии. .

Изобретение относится к биотехнологии. Предложен способ in vitro определения наличия в образце рыбьего жира активности n-3 полиненасыщенной жирной кислоты (PUFA).

Изобретения относятся к способу скрининга биологического образца на присутствие вызывающих респираторную инфекцию микроорганизмов, выбранных из респираторно-синцитиального вируса, риновируса, метапневмовируса человека, гриппа В, гриппа A и подтипа Н5 гриппа А, с использованием ПЦР реального времени и тест-карты, имеющей обнаруживающие пробы в отдельных лунках. Изобретения позволяют обнаруживать с высоким уровнем чувствительности и специфичности целевые микроорганизмы. 2 н. и 26 з.п.ф-лы, 1 ил., 2 табл., 6 пр.

Наверх