Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами

Авторы патента:


Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами
Композиция и способ лечения болезни глаз, связанной с нуклеиновыми кислотами

Владельцы патента RU 2642609:

ДЗЕ БОРД ОФ ТРАСТИЗ ОФ ДЗЕ ЮНИВЕРСИТИ ОФ ИЛЛИНОЙС (US)

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для лечения синдрома сухости глаз. Композиция для лечения синдрома сухости глаз, связанного с нуклеиновыми кислотами, который развивается в результате выработки/образования нуклеиновых кислот вместе с образованием глазных мукоидных пленок и/или биопленок, содержит дезоксирибонуклеазу I (ДНКазу I) и офтальмологическое вспомогательное вещество, и не содержит антибиотик. Композицию наносят на поверхность глаза для удаления нуклеиновой кислоты с поверхности глаза. Также обеспечивается способ лечения указанного синдрома сухости глаз, предусматривающий введение указанной композиции в глаз в эффективном количестве. Использование группы изобретений позволяет повысить эффективность лечения синдрома сухости глаз, связанного с нуклеиновыми кислотами, который развивается в результате выработки/образования нуклеиновых кислот вместе с образованием глазных мукоидных пленок и/или биопленок. 2 н. и 11 з.п. ф-лы, 16 ил., 7 пр.

 

Перекрестная ссылка на родственные заявки

Настоящая заявка устанавливает приоритет согласно предварительной патентной заявке на патент США №61/600,377, поданной 17 февраля 2012 г., и предварительной патентной заявке №61/569,604, поданной 12 декабря 2011 г., содержание которых полностью включено в настоящую заявку посредством ссылки.

Краткое описание списка последовательностей

Настоящая заявка включает список последовательностей, соответствующий 37 Своду федеральных правил §§ 1.821-1.825. Список последовательностей находится в файле с названием «11738468_1.txt» (790 бит, созданный 14 августа 2012 г.), включенном в настоящую заявку посредством ссылки.

Область техники, к которой относится изобретение

Настоящее изобретение относится к композиции и способу лечения болезни глаз, связанной с нуклеиновыми кислотами.

Предшествующий уровень техники

Эпителий поверхности глаза подвергается постоянному динамическому обмену, что является частью нормального процесса отшелушивания. Данный обмен происходит более интенсивно у пациентов, страдающих различными формами болезней глаз, связанных с нуклеиновыми кислотами, такими как синдром сухих глаз (ССГ). Поверхностные клетки роговицы отшелушиваются в прекорнеальную слезную пленку. Процесс отшелушивания эпителиальных клеток роговицы, или десквамация, регулируется апоптотическими механизмами. Мертвые и умирающие клетки выделяют нуклеиновые кислоты, представляющие собой один из видов появляющихся в очаге поражения молекул, которые могут стимулировать систему врожденного иммунитета и связывают ее с системой приобретенного иммунитета. Например, внеклеточные цепи ДНК были обнаружены в корнеальных филаментах, которые часто присутствуют в роговице пациентов с ССГ. Отшелушенные клетки в прекорнеальной слезной пленке представляют собой потенциальный источник внеклеточной ДНК. Слезная жидкость содержит некоторые компоненты нейтрофильной внеклеточной ловушки (НВЛ). Нейтрофилы неактивно привлекаются к поверхности глаза, и множество нейтрофилов присутствует в слезной пленке при воспалении поверхности глаза, что играет важную роль в развитии и усилении симптомов. Эластаза нейтрофилов и гистоновые белки также были обнаружены в слезной жидкости. Эти сообщения описывают присутствие внеклеточной ДНК, гистонов, эластазы нейтрофилов и нуклеаз в слезной жидкости и предлагают возможные объяснения механизмов, обеспечивающих постоянное образование и удаление внеклеточной ДНК в слезной пленке.

Внеклеточная ДНК в слезной пленке, такой как глазной биопленке и мукоидной пленке, может играть роль в развитии патологии, ассоциированной с болезнью глаз, связанной с нуклеиновыми кислотами. Болезни глаз, связанные с нуклеиновыми кислотами, которые могут быть ассоциированы с образованием глазных мукоидных пленок и/или биопленок, представляют собой потенциально инвалидизирующие состояния, оказывающие негативное воздействие на качество жизни, связанное со зрением. Они могут приводить к развитию дискомфорта в глазах и/или к ухудшению зрительного восприятия, в том числе скорости чтения и контрастной чувствительности.

Несмотря на высокую частоту болезней глаз, связанных с нуклеиновыми кислотами, в настоящее время не существует достаточно эффективного лечения данных состояний. Так, поскольку гиперосмолярность и воспаление традиционно считаются основными причинами синдрома сухих глаз, современные способы лечения сосредоточены на применении гигиенических средств для век, местных антибиотиков, пероральных тетрациклинов, противовоспалительных препаратов и/или кортикостероидов. Такие способы лечения часто неэффективны или нестабильно эффективны. Соответственно, существует необходимость в новых терапевтических способах лечения болезней глаз, связанных с нуклеиновыми кислотами, таких как ССГ, которые развиваются, например, в результате выработки/образования нуклеиновых кислот вместе с образованием глазных мукоидных пленок и/или биопленок.

Краткое описание изобретения

В настоящем изобретении представлена композиция для лечения болезней глаз, связанных с нуклеиновыми кислотами. Данные заболевания могут быть связаны с низким качеством слезной жидкости, которое может быть обусловлено образованием биопленки нуклеиновых кислот/мукоидной пленки на поверхности глаза или внутри глаза. Нуклеиновая кислота может быть внеклеточной. Одним из таких заболеваний является синдром сухих глаз (ССГ). Композиция может включать нуклеазу и офтальмологическое вспомогательное вещество. Нуклеаза может представлять собой ДНКазу или РНКазу или их комбинацию. Нуклеаза может быть эндонуклеазой и экзонуклеазой. ДНКаза может быть дезоксирибонуклеазой I (ДНКазой I), дезоксирибонуклеазой II (ДНКазой II), дезоксирибонуклеазой III или микрококковой нуклеазой. РНКаза может быть рибонуклеазой А (РНКазой А), рибонуклеазой Н (РНКазой Н), рибонуклеазой I (РНКазой I), рибонуклеазой II (РНКазой II), рибонуклеазой III (РНКазой III), рибонуклеазой D (РНКазой D), рибонуклеазой L (РНКазой L), рибонуклеазой Р (РНКазой Р), рибонуклеазой PH (РНКазой PH), рибонуклеазой PhyM (РНКазой PhyM), рибонуклеазой R (РНКазой R), рибонуклеазой T (РНКазой T), рибонуклеазой T1 (РНКазой T1), рибонуклеазой T2 (РНКазой T2), рибонуклеазой U2 (РНКазой U2), рибонуклеазой V1 (РНКазой V1), рибонуклеазой V (РНКазой V), олигрибонуклеазой, экзорибонуклеазой I или экзорибонуклеазой II. ДНКаза или РНКаза могут быть рекомбинантными. Композиция может содержать также антагонист или ингибитор. Антагонист или ингибитор может быть выбран из группы, содержащей антибиотик, антагонист Toll-подобного рецептора, антагонист интерферона типа 1, ингибитор кателицидина, ингибитор MyD88, стероид, противоаллергическое вещество, ингибитор эластазы нейтрофилов и их комбинации.

Также в настоящем изобретении приведен способ лечения болезни глаз, связанной с нуклеазой. Способ может включать введение описанных выше композиций нуклеаз с офтальмологическим вспомогательным веществом в глаз в количестве, эффективном для лечения болезни глаз. Поверхность глаза может содержать слезную пленку, которая может быть представлена биопленкой или мукоидной пленкой. Биопленка или мукоидная пленка могут содержать нуклеиновую кислоту. Нуклеиновая кислота может быть представлена ДНК, РНК или их комбинацией. Слезная пленка может содержать менее 0,05 единиц Куница нуклеазной активности перед введением композиции. Эффективное количество композиции может содержать от 5 нг/мл до 3 мг/мл нуклеазы. Эффективное количество композиции может содержать от 100 нг/мл до 200 нг/мл нуклеазы.

Болезнь глаз, связанная с нуклеиновыми кислотами, может быть ССГ, диффузным ламеллярным кератитом, кератитом, связанным с применением контактных линз, эндофтальмитом или инфекционной кератопатией хрусталика, рубцовым пемфигоидом глаза, сухим кератоконъюнктивитом, синдромом Шегрена, сухим кератоконъюнктивитом, ассоциированным с синдромом Шегрена, сухим кератоконъюнктивитом, не связанным с синдромом Шегрена, офтальмосклерозом, сухим кератитом, ксерофтальмией, нарушением слезной пленки, пониженным уровнем слезообразования, недостаточностью слезной жидкости или дисфункцией мейбомиевых желез. ССГ может быть аутоиммунным ССГ или ССГ, ассоциированным с синдромом Шегрена, например, ССГ может быть вызван одной или несколькими перечисленными ниже причинами: старением, использованием контактных линз и применением лекарственных препаратов. Лекарственные препараты могут включать ампициллин, амоксициллин/клавуланат, метронидазол, клиндамицин, эритромицин, гентамицин, ванкомицин, ципрофлаксин, клиндамицин, тетрациклин, анксиолитик или их комбинацию. Антагонистом Toll-подобного рецептора может быть олигонуклеотид, содержащий последовательность TTAGGG. Олигонуклеотид может содержать последовательность TTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO: 1). Антагонистом интерферона типа 1 может быть соединение, которое антагонизирует или конкурентно ингибирует интерферон типа 1, связываясь с его рецептором, например с субъединицами рецептора IFNAR-1 и/или IFNR-2. Соединение может быть антителом к интерферону α (IFNα). Ингибитором кателицидина может быть бактериальный экзополисахарид. Ингибитором эластазы нейтрофилов может быть вещество, выбранное из группы, состоящей из ONO-5046, MR-889, L-694,458, CE-1037, GW-311616 TEI-8362, ONO-6818, AE-3763, FK-706, ICI-200, 880, ZD-0892 и ZD-8321.

Также в настоящем изобретении приведен способ определения наличия у пациента болезни глаз, связанной с нуклеазой. Способ может включать сбор образца слезной жидкости у пациента. Данный образец можно проинкубировать с красителем, который связывает ДНК, например, с красителем picogreen. Кроме того, образец можно проинкубировать с ДНКазой и после этого с красителем. Интенсивность окрашивания можно измерить и сравнить с интенсивностью флуоресценции красителя в нормальном контрольном образце. Повышенный по сравнению с контролем уровень интенсивности флуоресценции в образце может указывать на существование синдрома сухих глаз.

Также в настоящем изобретении приведен способ лечения бактериальной инфекции глаз. Способ включает введение композиции, содержащей нуклеазу, в глаз в количестве, которое эффективно для лечения инфекции. Композиция может быть инъецирована в глаз.

Краткое описание чертежей

Фигура 1 показывает схему биологии ССГ. Внеклеточная ДНК обнаруживается на поверхности глаз пациентов с ССГ. Данная внеклеточная ДНК может происходить из двух основных источников: из нейтрофилов и из клеток конъюнктивы и из других клеток роговицы. Внеклеточная ДНК нейтрофилов образует нейтрофильные внеклеточные ловушки (НВЛ). Данные НВЛ содержат воспалительные и ангиогенные молекулы, такие как кателицидин, эластазу нейтрофилов, ассоциированный с ними гистон. Внеклеточная ДНК из клеток конъюнктивы, также как и из НВЛ, действует как «молекулы из очага поражения». Молекулы из очага поражения запускают и поддерживают воспаление. ДНК молекул из очага поражения действует через Toll-подобный рецептор 9 (TLR9), повышая уровень интерферонов типа 1, увеличивая уровень нескольких медиаторов воспаления.

Фигура 2 показывает клетки, перенесенные на покрытые силаном адгезивные стекла, окрашенные гематоксилином и эозином. Ядра и цепи окрашены гематоксилином, что указывает на присутствие внутриклеточной и внеклеточной ДНК, соответственно, свидетельствуя о присутствии НВЛ.

Фигура 3 представляет собой конфокальное изображение (63х) непрямой флуоресценции при окрашивании красителем DAPI для выявления нуклеиновой кислоты. Краситель проникает в клеточное ядро, а также во внеклеточные цепи ДНК. Фигура 3 показывает наличие внеклеточной ДНК, которая важна для формирования НВЛ.

Фигура 4 показывает наличие нейтрофилов и нитей, выходящих из клеток в виде внеклеточной ДНК. Клетки сначала были окрашены с помощью непрямой флуоресценции. (В) показывает внеклеточные нитевидные структуры, выявляя ядерную и внеклеточную ДНК. Затем клетки отмывали и окрашивали гематоксилином и эозином, чтобы подтвердить наличие нейтрофилов и цепей, выходящих из клеток, указывающих на наличие НВЛ.

Фигура 5 представляет собой конфокальное изображение клеток, окрашенных с помощью непрямой флуоресценции первичными антителами к эластазе нейтрофилов, гистону и DAPI. Гранулярное окрашивание эластазы нейтрофилов колокализуется с гистоном и нуклеиновой кислотой.

Фигура 6 показывает наличие НВЛ на поверхности глаза (А). После обработки ДНКазой нитевидная внеклеточная ДНК исчезает, при этом целостность клетки сохраняется (В). Два образца (А) и (В) отбирали у одного и того же пациента. Образец А обрабатывали фосфатно-солевым буфером в течение 20 минут, после чего окрашивали DAPI. Образец В обрабатывали ДНКазой (100 МЕ/мл) в течение 20 минут и окрашивали DAPI.

Фигура 7 подтверждает наличие НВЛ и дифференцирует их от слизи на поверхности глаза. Образец слизи с поверхности конъюнктивы окрашивали DAPI. Окрашивалось ядро, однако слизь не окрашивалась.

Фигура 8 дополнительно подтверждает наличие слизи у того же пациента, образец которого проанализирован на фигуре 7. Данный образец окрашивали реактивом Шиффа. Окрашивание показывает наличие нитей слизи.

Фигура 9 показывает график, построенный для сухих глаз (проба Ширмера <5) по сравнению с нормальным слезообразованием (проба Ширмера >5), с указанием стандартного отклонения. Наблюдается достоверное отличие оптической плотности внеклеточной ДНК при синдроме сухих глаз по сравнению с нормальным слезообразованием. Оптическая плотность в случае синдрома сухих глаз выше (17834,14), чем в случае нормального слезообразования (12609,86). Таким образом, при синдроме сухих глаз количество внеклеточной ДНК, полученной на фильтровальной бумаге в тесте Ширмера, выше, чем при нормальном слезообразовании.

Фигура 10 показывает данные количественной ПЦР в реальном времени об уровне генов интерферона альфа 1, интерферона бета, Toll-подобного рецептора TLR-9 и Myd88 у людей с тяжелой формой синдрома сухих глаз по сравнению с людьми с нормальным слезообразованием (без синдрома сухих глаз). Уровни этих генов повышены в несколько раз в конъюнктиве пациентов с синдромом сухих глаз и угнетенным слезообразованием. Эти пути (TLR-9 и Myd88) стимулируются внеклеточной ДНК, таким образом, данными о рецепторе и транскрипции подтверждается, что воспаление поверхности глаза стимулируется внеклеточной ДНК. Уровень участвующих в последующих стадиях медиаторов воспаления (интерферонов альфа и бета) также повышен у пациентов с синдромом сухих глаз.

Фигура 11 показывает материал, полученный при получении отпечатков полосок пробы Ширмера. (А1, А2): Импрессионная цитология с использованием полосок пробы Ширмера (А1, стрелка) и покрытых силаном стекол (А2). (В): Окрашивание гематоксилином и эозином, показывающее отшелушенные поверхностные клетки. (С): Изображение, полученное с помощью широкопольной флуоресцентной микроскопии после окрашивания DAPI материала оттисков конъюнктивы, показывает наличие коротких и редких цепей внеклеточных ДНК (внДНК) (стрелки) у нормальных индивидов (С1) и многочисленные цепи внеклеточной ДНК (С2) у пациентов с ССГ (стрелки). (D): Изображение, полученное с помощью конфокальной иммунофлуоресцентной микроскопии после окрашивания DAPI, показывает наличие многочисленных нитей (стрелки) и нейтрофилов с многолопастным ядром. (Е): Изображение, полученное с помощью конфокальной иммунофлуоресцентной микроскопии, показывает, что гистоны (Е1, зеленый), эластаза нейтрофилов (Е2, красный) и внДНК (Е3, синий) являются молекулярными компонентами НВЛ (Е4, наложение). Стрелка указывает на нить НВЛ. Вставка на Е2 показывает нейтрофилы с окрашенным DAPI многолопастным ядром. Масштабная линейка: В, С1, С2 и D (50 мкм); Е1 и Е2 вставка (10 мкм).

Фигура 12 показывает внеклеточную ДНК и нейтрофильные внеклеточные ловушки (НВЛ) в мукоидных пленках. (А): Клинические фотографии глаз пациентов с тяжелой формой угнетения слезообразования при ССГ. Стрелка указывает на мукоидную пленку на роговице и бульбарной конъюнктиве (А1), и на нижнем своде (А2). На вставке показано увеличенное изображение мукоидных пленок. (В): цитологическое исследование мукоидных пленок. (В1): окрашивание гематоксилином и эозином показывает поверхностные клетки эпителия и многочисленные нейтрофилы. (В2): окрашивание DAPI показывает наличие цепей внДНК (стрелка) и многолопастного ядра нейтрофилов. (В3): Иммуноокрашивание эластазы нейтрофилов (красный) подтверждает наличие нейтрофилов. (С): Конфокальное изображение, полученное после иммунофлуоресцентного окрашивания, показывает, что эластаза нейтрофилов (С1, красный), гистоны (С2, зеленый) и внДНК (С3, синий) являются компонентами НВЛ (С4, наложение). Стрелка указывает на нить НВЛ. (D): Лазерную захватывающую микродиссекцию проводили с окрашенными DAPI нитями для подтверждения наличия ДНК в них. На D1 стрелки указывают на цепь внДНК. На D2 звездочка занимает площадь нити после лазерной захватывающей микродиссекции. (03): ПЦР-продукт глицеральдегидфосфатдегидрогеназы (ГАФДГ) на дорожке с внДНК подтверждает наличие ДНК. Масштабная линейка: В1, В2 и В3 (20 мкм); С, D1 и D2 (50 мкм).

Фигура 13 показывает нейтрофилы (А1-А4): кателицидин (зеленый) присутствует в мукоидных пленках (А1, стрелка) и цепях внДНК (А1, острие стрелки). Кателицидин колокализуется с эластазой нейтрофилов (А2, красный) и окрашенным DAPI ядром (А3, синий). (В1-В4): Кателицидин (зеленый) присутствует в нейтрофилах (В1, стрелка) и колокализуется с эластазой нейтрофилов (В2, красный) и DAPI (В3, синий). (С1-С4): Кателицидин (С1, стрелка) и окрашенный DAPI материла ядра (С3, острие стрелки) выходят из нейтрофилов, образуя НВЛ. Масштабная линейка: 10 мкм.

Фигура 14 показывает экспрессию генов у пациентов с ССГ и в контроле. (А): Средний уровень образования слезной жидкости, измеренный с помощью пробы Ширмера I, был достоверно ниже у пациентов с ССГ. (В): Длину внДНК измеряли после отпечатывания полосок пробы Ширмера на стекле. Длина внДНК была достоверно выше у пациентов с ССГ. (С): Количество внДНК на полосках пробы Ширмера измеряли с помощью окрашивания красителем picogreen. У пациентов с ССГ количество внДНК было существенно выше. (D): Гены пути передачи сигнала от внДНК экспрессировались на повышенном уровне в отшелушенных клетках конъюнктивы пациентов с ССГ. (Е): Экспрессия генов воспаления также была существенно увеличена у пациентов с ССГ. * p<0,05.

Фигура 15 показывает наличие нуклеаз и ДНКазы I в слезной жидкости (А1-А6): Изображение, полученное с помощью иммунофлуоресцентной микроскопии, показывает наличие ДНКазы I в слезных железах человека (А1-А3, красный). Специфичность окрашивания была подтверждена с помощью конкурентного пептида (А4-А6) и изотипического контроля (данные не показаны). (В): нуклеазная активность в слезах нормальных индивидов. Твердофазный иммуноферментный анализ ДНКазы I показал, что ее концентрация в нормальной слезной жидкости составляет 3,14 нг/мл. При использовании набора реактивов для определения ДНКазы нормальная слезная жидкость вызывала полную деградацию ДНК (дорожка «слезная жидкость»). Таким образом, нуклеазная активность слезной жидкости выше 0,05 единиц Куница. (С): Нуклеазную активность слезной жидкости количественно оценивали с помощью метода резонансного переноса энергии флуоресценции (FRET). Типичный график сравнения нуклеазной активности у пациентов с ССГ (синий) и здоровых индивидов (зеленый) показывает, что нуклеазная активность у пациентов с ССГ снижена. (D): Нуклеазная активность у пациентов с ССГ была достоверно ниже, чем у здоровых индивидов. * p<0,05, масштабная линейка: 20 мкм.

Фигура 16 показывает мукоидные пленки, размещенные на плашках с бактериальной культурой. У пациентов с тяжелой формой угнетенного слезообразования при синдроме сухих глаз могут образовываться мукоидные пленки на поверхности глаза. Мукоидные пленки снимали с поверхности глаза с помощью стерильной палочки с тампоном eSwab. Был обнаружен рост грамположительных кокков, идентифицированных как не обладающие коагулазной активностью виды стафилококка. (А): Рост на культуральной чашке с кровяным агаром показал наличие бактериальных колоний размером с булавочную головку. (В): Окрашивание с помощью набора реактивов Baclight live/dead мазков культивируемых колоний показало наличие живых кокков (зеленый) одновременно с мертвыми кокками (красный). Данные эксперименты подтверждают, что бактерии присутствуют в мукоидных пленках на поверхности глаза пациентов с синдромом сухих глаз.

Подробное описание изобретения

Изобретатели сделали неожиданное открытие, свидетельствующее о том, что болезни глаз связаны с нуклеиновыми кислотами, такие как ССГ и связанные с ССГ состояния, можно лечить нуклеазой и офтальмологическим вспомогательным веществом в присутствии или в отсутствие антибиотика. Основой настоящего открытия является наличие нейтрофильных внеклеточных ловушек (НВЛ) на поверхности глаз(а) пациентов, страдающих болезнью глаз, связанной с нуклеиновыми кислотами, такой как ССГ. НВЛ представляют собой внеклеточные структуры, состоящие из хроматина, который включает нуклеиновую кислоту, такую как ДНК, эластазы нейтрофилов, гистона и белков гранул. НВЛ могут создавать повышенную концентрацию антимикробной активности и, соответственно, доминируют в очагах воспаления.

1. Определения

Терминология, используемая в настоящем изобретении, применяется только с целью описания частных случаев применения изобретения и не является единственно возможной. Как применяется в спецификации и прилагаемых формулах изобретения, формы единственного числа, союз «и», определенные и неопределенные артикли включают множественные ссылки, если иное четко не следует из контекста.

а. Контроль

«Контроль» при использовании в настоящем изобретении может обозначать композицию или образец, для которого известно отсутствие синдрома сухих глаз или бактериального заражения (отрицательный контроль). Положительный контроль может обозначать образец, который относится к случаю болезни глаз, связанной с нуклеиновыми кислотами, или бактериальной инфекции. Любой контроль может содержать известное количество внеклеточной ДНК.

При указании интервалов значений в настоящем изобретении подразумевается существование всех чисел одного уровня точности внутри интервала. Например, для интервала 6-9 числа 7 и 8 подразумеваются в дополнение к 6 и 9, а для интервала 6,0-7,0 подразумеваются числа 6,0, 6,1, 6,2, 6,3, 6,4, 6,5, 6,6, 6,7, 6,8, 6,9 и 7,0.

2. Композиция на основе нуклеаз

В настоящем изобретении представлена композиция на основе нуклеаз («нуклеазная композиция»), способная удалить нуклеиновую кислоту с поверхности глаза или внутри глаза. Нуклеиновая кислота может быть внеклеточной. Нуклеазная композиция может содержать одну или несколько нуклеаз. Нуклеаза может представлять собой ДНКазу или РНКазу. Нуклеазная композиция может также содержать офтальмологическое вспомогательное вещество. Кроме того, нуклеазная композиция может содержать один или несколько антибиотиков, противовирусное соединение, противовоспалительное вещество, антагонист Toll-подобного рецептора, антагонист интерферона типа 1, ингибитор кателицидина, ингибитор MyD88, стероид, противоаллергическое вещество и/или ингибитор эластазы нейтрофилов. Кроме того, нуклеазная композиция может не содержать любой из антибиотиков, противовирусных соединений, противовоспалительных веществ, антагонист Toll-подобного рецептора, антагонист интерферона типа 1, ингибитор кателицидина, ингибитор MyD88, стероид, противоаллергическое вещество и/или ингибитор эластазы нейтрофилов, но может использоваться в сочетании с одним или несколькими антибиотиками, антагонистами Toll-подобного рецептора, антагонистами интерферона типа 1, ингибиторами кателицидина и/или ингибиторами эластазы нейтрофилов.

Уровень рН и/или осмолярности нуклеазной композиции может быть доведен до необходимого перед использованием. Уровень рН нуклеазной композиции может варьировать в интервале от 4 до 9, от 5 до 8, от 6 до 7 или от 6,5 до 7,5. Уровень рН нуклеазной композиции может быть равен 4,1, 4,2, 4,3, 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5,0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9, 6,0, 6,1, 6,2, 6,3, 6,4, 6,5, 6,6, 6,7, 6,8, 6,9, 7,0, 7,1, 7,2, 7,3, 7,4, 7,5, 7,6, 7,7, 7,8, 7,9, 8,0, 8,1, 8,2, 8,3, 8,4, 8,5, 8,6, 8,7, 8,8, 8,9 или 9,0. Уровень рН нуклеазы может быть равен 7,4.

Осмолярность нуклеазной композиции может быть гипоосмолярной и гиперосмолярной. Например, осмолярность ДНКазной композиции может быть между 100 мОсм/л и 500 мОсм/л, 150 мОсм/л и 450 мОсм/л, 200 мОсм/л и 400 мОсм/л, 250 мОсм/л и 350 мОсм/л, 275 мОсм/л и 325 мОсм/л, 100 мОсм/л и 150 мОсм/л, 150 мОсм/л и 200 мОсм/л, 150 мОсм/л и 300 мОсм/л, 200 мОсм/л и 300 мОсм/л, 0 мОсм/л и 100 мОсм/л, 25 мОсм/л и 75 мОсм/л, 50 мОсм/л и 125 мОсм/л, 0 мОсм/л и 50 мОсм/л.

а. Нуклеаза

Нуклеазы, предполагаемые настоящим изобретением, включают ДНКазы и РНКазы.

ДНКаза может быть ферментом, который катализирует гидролитическое расщепление фосфодиэфирных связей в остове ДНК. Одним из таких ферментов является дезоксирибонуклеаза. Примеры дезоксирибонуклеаз включают следующие, но не ограничиваются ими: дезоксирибонуклеазу I (ДНКазу I), дезоксирибонуклеазу II (ДНКазу II) и микрококковую нуклеазу. ДНКаза может быть рекомбинантной человеческой ДНКазой, ДНКазой животного происхождения (напр., бычьей) или микрококкового происхождения. Рекомбинантная ДНКаза I может быть дорназой альфа, доступной под торговым названием PULMOZYME® компании Genetech Inc. Вариант ДНКазы может быть получен путем модификации ее генетического состава, например, путем удаления сигнального пептида, мутации сайтов связывания субстрата или внесения аминокислотных замен для создания гиперактивных вариантов или более стабильных вариантов. Например, может быть использована ДНКаза II или ДНКаза I-, II- или III-подобные варианты, в сочетании друг с другом или по отдельности.

РНКаза может быть ферментом, который катализирует гидролитическое расщепление фосфодиэфирных связей в остове РНК. Одним из таких ферментов является рибонуклеаза. Примеры рибонуклеаз включают следующие, но не ограничиваются ими: рибонуклеазу А (РНКазу А), рибонуклеазу Н (РНКазу Н), рибонуклеазу I (РНКазу I), рибонуклеазу II (РНКазу II), рибонуклеазу III (РНКазу III), рибонуклеазу D (РНКазу D), рибонуклеазу L (РНКазу L), рибонуклеаза Р (РНКазой Р), рибонуклеазу PH (РНКазу PH), рибонуклеазу PhyM (РНКазу PhyM), рибонуклеазу R (РНКазу R), рибонуклеазу T (РНКазу T), рибонуклеазу T1 (РНКазу T1), рибонуклеазу T2 (РНКазу T2), рибонуклеазу U2 (РНКазу U2), рибонуклеазу V1 (РНКазу V1), рибонуклеазу V (РНКазу V), олигорибонуклеазу, экзорибонуклеазу I или экзорибонуклеазу II. РНКаза может быть рекомбинантной человеческой РНКазой или РНКазой животного происхождения (напр., бычьей). Вариант РНКазы может быть получен путем модификации ее генетического состава, например, путем удаления сигнального пептида, мутации сайтов связывания субстрата или внесения аминокислотных замен для создания гиперактивных вариантов или более стабильных вариантов.

Нуклеаза может отрезать основания на концах молекул нуклеиновых кислот (экзодезоксирибонуклеазы или экзорибонуклеазы, типы экзонуклеаз). Нуклеаза может быть эндонуклеазой, которая может использоваться в индивидуальном виде или в сочетании с другой нуклеазой. Примерами эндонуклеаз являются липокалин и РНКаза А. Нуклеаза может вносить разрыв в любое место цепи (экзодезоксирибонуклеазы или экзорибонуклеазы, типы экзонуклеаз). Нуклеаза может быть неспецифичной к последовательности ДНК, которую она разрезает. Нуклеаза может быть специфичной к последовательности. Нуклеаза может разрезать только двухцепочечную нуклеиновую кислоту, только одноцепочечную нуклеиновую кислоту или как двухцепочечную, так и одноцепочечную нуклеиновую кислоту.

Дозировка нуклеазы может быть определена, например, врачом без ненужного экспериментирования. Дозировка может быть скорректирована в зависимости от противопоказаний, переносимости или похожих состояний. Специалисты в данной области могут без труда оценить такие факторы и на основании имеющейся информации определить точную эффективную концентрацию нуклеазы, которую следует применять, как описано здесь. Нуклеаза может содержаться в нуклеазной композиции в интервале между 5 нг/мл и 3 мг/мл, между 1 мг/мл и 3 мг/мл, между 2 мг/мл и 3 мг/мл, между 10 нг/мл и 900 нг/мл, между 20 нг/мл и 800 нг/мл, между 30 нг/мл и 700 нг/мл, между 40 нг/мл и 600 нг/мл, между 50 нг/мл и 600 нг/мл, между 60 нг/мл и 500 нг/мл, между 70 нг/мл и 400 нг/мл, между 80 нг/мл и 300 нг/мл, между 90 нг/мл и 200 нг/мл, между 50 нг/мл и 250 нг/мл, между 100 нг/мл и 200 нг/мл, между 150 нг/мл и 250 нг/мл, между 100 нг/мл и 150 нг/мл, между 90 нг/мл и 100 нг/мл. Нуклеаза может содержаться в нуклеазной композиции в количестве 10 нг/мл, 20 нг/мл, 30 нг/мл, 40 нг/мл, 50 нг/мл, 60 нг/мл, 70 нг/мл, 80 нг/мл, 90 нг/мл, 100 нг/мл, 110 нг/мл, 150 нг/мл, 200 нг/мл, 250 нг/мл, 300 нг/мл, 350 нг/мл, 400 нг/мл, 450 нг/мл, 500 нг/мл, 550 нг/мл, 600 нг/мл, 650 нг/мл, 700 нг/мл, 750 нг/мл, 800 нг/мл, 850 нг/мл, 900 нг/мл, 950 нг/мл, 1 мг/мл, 2 мг/мл или 3 мг/мл. Как подробнее описано здесь, композиция может быть вручную введена в глаз в соответствующей дозировке, например в виде глазных капель, или введена с помощью микрокапельного или аэрозольного прибора, позволяющего ввести определенную дозу лекарственного препарата.

(1) Офтальмологическое вспомогательное вещество

Офтальмологическим вспомогательным веществом может быть любое офтальмологическое вспомогательное вещество. Офтальмологическим вспомогательным веществом может быть буфер, регулятор тоничности, увлажняющее средство и/или антиоксидант. Буфер может быть борной и/или фосфорной кислотой. Буфер может минимизировать изменения рН нуклеазной композиции. Регулятор тоничности может создавать изотоническую среду и может включать хлорид натрия, хлорид калия, хлорид магния и/или борную кислоту. Антиоксиданты включают метабисульфит натрия и ЭДТА, например, антиоксиданты можно использовать для стабилизации нуклеазной композиции. Увлажняющие средства, которые включают поливиниловый спирт и полисорбат 80, позволяют нуклеазной композиции распределяться по поверхности глаза. Другие офтальмологические вспомогательные вещества включают хлорид бензалкония, этилендиаминтетрауксусную кислоту (ЭДТА), пурит, хлорбутанол, перборат натрия и сорбиновую кислоту, перборат натрия, пурит, полиолы, глицерин, полисорбат 80, декстран 70, пропиленгликоль и полиэтиленгликоли, такие как ПЭГ-400. Офтальмологическим вспомогательным веществом может быть мазь, такая как минеральное масло, белый вазелин, белая мазь или ланолин. Также как жидкие носители, вазелин и минеральное масло могут использоваться в качестве носителей в препаратах, выпускающихся в форме мази, для увеличения времени контакта с глазом. Данные ингредиенты способствуют образованию окклюзивной пленки на поверхности глазного яблока и улучшают состав слезной пленки, укрепляя слизистый и водный слои. Офтальмологическое вспомогательное вещество может обеспечивать слизеподобные свойства и/или снижать потерю водного слоя вследствие испарения. Офтальмологическое вспомогательное вещество может работать в качестве носителя, такого так фармацевтически приемлемый носитель, как описано ниже.

(2) Антибиотик

Антибиотиком может быть любой антибиотик. Антибиотиком может быть ампициллин, амоксициллин/клавуланат, метронидазол, клиндамицин, эритромицин, гентамицин, ванкомицин, ципрофлаксин, клиндамицин, тетрациклин, анксиолитик, амикацин, канамицин, неомицин, нетилмицин, стрептомицин, тобрамицин, тейкопланин, ванкомицин, азитромицин, кларитромицин, кларитромицин, диритромицин, эритромицин, рокситромицин, тролеандомицин, амоксициллин, ампициллин, азлоциллин, карбенициллин, клозациллин, диклоксациллин, флукозациллин, мезлоциллин, нафциллин, пенициллин, пиперациллин, тикарциллин, бацитрацин, колистин, полимиксин В, ципрофлоксацин, эноксацин, гатифлоксацин, левофлоксацин, ломефлоксацин, моксифлоксацин, норфлоксацин, офлазацин, тровафлоксацин, мафенид, сульфацетамид, сульфаметизол, сульфасалазин, сульфизоксазол, триметроприм, котримоксазол, демеклоциклин, соксициклин, миноциклин, доксициклин или окситетрациклин. Антибиотик может быть офтальмологически приемлемым антибиотиком.

(3) Противовирусные соединения

Противовирусным веществом может быть любое противовирусное соединение. Противовирусным соединением может быть абакавир, ацикловир, адефовир, амантадин, ампренавир, амплиген, арбидол, атазанавир, атрипла, боцепревир, цидофовир, дарунавир, делавирдин, диданозин, докозанол, эдоксудин, эфавиренц, эмтрицитабин, энфувиртид, энтекавир, фамцикловир, фомивирсен, фозампренавир, ганцикловир, ибацитабин, имуновир, идоксуридин, имихимод, индинавир, ламивудин, лопанавир, ловирид, маравирок, мороксидин, пенцикловир, перемивир, плеконарил, рибавирин, ритонавир, саквинавир, телапревир, тенофувир, трувада, валацикловир, валганцикловир или занамивир. Противовирусное соединение может быть офтальмологически приемлемым противовирусным соединением.

(4) Противовоспалительное соединение

Противовоспалительное соединение может быть нестероидным или стероидным противовоспалительным. Противовоспалительное соединение может быть циклоспорином или циклоспорином А. Циклоспорин А может быть 0,05% циклоспорином А (например, рестазис, RESTASIS®). Противовоспалительное соединение может быть офтальмологически приемлемым противовоспалительным.

(5) Антагонист Toll-подобного рецептора-9

Toll-подобный рецептор 9 (TLR9) узнает специфические неметилированные CpG олигонуклеотидные последовательности (ОДН, олигодезоксинуклеотиды), которые отличают микробную ДНК от ДНК млекопитающих. Антагонистом Toll-подобного рецептора может быть любой олигонуклеотид, который нейтрализует стимулирующий эффект CpG ОДН. Такие олигонуклеотиды могут характеризоваться наличием трех последовательно расположенных G после С или А. Более того, добавление четвертого G (G-тетрады) может усиливать ингибирующую способность ОДН. Последовательности, обладающие наибольшей ингибирующей способностью, содержат TTAGGG, например (TTAGGG)4 (SEQ ID NO: 1). На фигуре 1 приведен пример. Антагонистический олигонуклеотид может действовать, нарушая колокализацию CpG ОДН и TLR9, например, в эндосомных везикулах. Антагонист Toll-подобного рецептора 9 может быть офтальмологически приемлемым антагонистом Toll-подобного рецептора 9.

(6) Антагонист интерферона типа 1

Интерферон типа 1 является частью защитной реакции на вирусные инфекции и некоторые внутриклеточные паразиты. В то время как данные белки применяются для терапии некоторых вирусных заболеваний, рака и множественного склероза, выработка интерферонов типа 1 может быть нарушена при некоторых заболеваниях.

Антагонистом интерферона типа 1 может быть любое соединение, которое антагонизирует или конкурентно ингибирует интерферон типа 1. Соединение может быть антителом к интерферону α, например, соединение может антагонизировать или ингибировать интерферон типа 1, связываясь с его рецептором. Соединение может антагонизировать или ингибировать интерферон типа 1, связываясь с субъединицами его рецептора, IFNAE-1 или IFNR-2. Антагонист или конкурентный ингибитор может блокировать биологическую активность нативного интерферона. Антагонист интерферона типа 1 может быть офтальмологически приемлемым антагонистом интерферона типа 1.

(7) Ингибитор кателицидина

Ингибитором кателицидина может быть любой ингибитор, способный блокировать или снижать биологическую активность кателицидина, который стабилизирует внеклеточную ДНК на поверхности глаза. Примером ингибитора кателицидина является бактериальный экзополисахарид. Ингибитор кателицидина может быть офтальмологически приемлемым ингибитором кателицидина.

(8) Ингибитор MyD88

Ингибитором MyD88 может быть любое соединение, способное ингибировать или снижать биологическую активность или экспрессию MyD88. Ингибитор MyD88 может быть пептидом или малой молекулой, которая ингибирует гомодимеризацию MyD88, такой как ST2825 (Sigma Tau, Помеция, Италия), синтетическим олигопептидом IMG2205 (Imgenex Corporation, Сан-Диего, Калифорния) и/или ингибирующим MyD88 пептидом. Ингибитор MyD88 может ингибировать связывание MyD88 с партнерами по передаче сигнала. Ингибитором MyD88 может быть доминантно-негативный белок MyD88. Ингибитором MyD88 может быть антисмысловая, киРНК (короткая интерферирующая РНК) или кшРНК (короткая шпилечная РНК), которая ингибирует экспрессию MyD88.

(9) Ингибитор эластазы нейтрофилов

Ингибитором эластазы нейтрофилов может быть любое соединение, способное ингибировать или снижать биологическую активность эластазы нейтрофилов, представляющей собой сериновую протеазу, секретируемую нейтрофилами во время воспаления. Так ингибитор может быть синтетическим, естественным, обратимым или необратимым. Например, ингибитором эластазы нейтрофилом может быть ONO-5046, MR-889, L-694,458, CE-1037, GW-311616 или TEI-8362. Ингибитором эластазы нейтрофилом может быть ONO-6818, AE-3763, FK-706, ICI-200,880, ZD-0892 или ZD-8321. См. примеры в Expert Opinion on Investigational Drugs, July 2002, Vol. 11, No. 7: Pages 965-980 (Neutrophil elastase inhibitors as treatment for COPD, by Hiroyuki Ohbayashi). Ингибитор эластазы нейтрофилов может быть офтальмологически приемлемым ингибитором эластазы нейтрофилов.

б. Фармацевтически приемлемый носитель

Нуклеаза может быть включена в фармацевтические составы, подходящие для введения индивиду (например, пациенту, который может быть человеком или нет). Обычно нуклеазная композиция содержит фармацевтически приемлемый носитель, подходящий для офтальмологического введения. Подходящие офтальмологические носители известны специалистам в данной области техники, и все традиционные носители можно применять в настоящем изобретении. Подходящие носители, которые можно применять для ускоренного трансдермального введения местных композиций в глаз или в ткани придаточных органов, включают следующие, но не ограничиваются ими: спирт (этанол, пропанол нонанол), жирный спирт (лауриловый спирт), жирную кислоту (валериановую кислоту, капроновую кислоту и каприновую кислоту), эфир жирной кислоты (изопропилмиристат и изопропил-н-гексаноат), алкиловый эфир (этилацетат и бутилацетат), полиол (пропиленгликоль, пропандион и гексантриол), сульфоксид (диметилсульфоксид и децилметилсульфоксид), амид (мочевина, диметилацетамид и производные пирролидона), сурфактант (лаурилсульфат натрия, бромид цетилтриметиламмония, полоксамеры, спены, твины, соли желчных кислот и лецитин), терпен (d-лимолен, альфа-терпенеол, 1,8-цинеол и ментон) и алканон (N-гептан, N-нонан). Более того, композиции для местного применения содержат вещества, регулирующие молекулы поверхностной адгезии, которые включают следующие, но не ограничиваются ими: антагонист кадхерина, антагонист селектина и антагонист интегрина. Дополнительно композиция может также содержать вещество из группы, включающей физиологически приемлемую соль, аналог полоксамера с карбополом, карбополом/гидроксипропилметилцеллюлозой, карбопол-метилцелюлозой, карбоксиметилцеллюлозой, гиалуроновую кислоту, циклодекстрин и углеводороды. Более того, композиции для местного применения могут содержать вещества, регулирующие молекулы поверхностной адгезии, которые включают следующие, но не ограничиваются ими: антагонист кадхерина, антагонист селектина и антагонист интегрина. Таким образом, применяемый носитель может быть в форме стерильной офтальмологической мази, крема, геля, раствора или дисперсии. Также к офтальмологически приемлемым носителям относятся медленно высвобождающиеся полимеры, например полимеры Ocusert, Hydron и пр.

Также можно применять стабилизаторы, например хелатирующие агенты, такие как ЭДТА. Можно применять антиоксиданты, например бисульфит натрия, тиосульфит натрия, 8-гидроксихинолин или аскорбиновую кислоту. Стерильность обычно поддерживается традиционными офтальмологическими консервантами, например хлорбутанолом, хлоридом бензалкония, хлоридом цетилпиридина, солями фенилртути, тимеросалом и пр. для водных форм выпуска, которые применяют в нетоксичном количестве, обычно варьирующим в пределах от 0,001 до 0,1% по весу от водного раствора. Традиционные консерванты для мазей включают метил- и пропилпарабены. Типичные основы мази включают белый вазелин и минеральное масло или жидкий вазелин. Однако предпочтительно применение водных носителей с консервантами. Растворы могут быть введены в глаз вручную в соответствующей дозировке, например в виде глазных капель, или с помощью микрокапельного или аэрозольного прибора, позволяющего ввести определенную дозу лекарственного препарата. Примеры подходящих офтальмологических носителей включают стерильные в основном изотонические водные растворы, содержащие небольшие количества, т.е. менее 5% по весу, гидроксипропилметилцеллюлозы, поливинилового спирта, карбоксиметилцеллюлозы, гидроксиэтилцеллюлозы, глицерина и ЭДТА. Предпочтительно, чтобы у растворов поддерживался в основном нейтральный рН и изотоничность с помощью традиционных буферов, например фосфата, бората, ацетата, триса.

Фармацевтически приемлемые офтальмологические носители могут также содержать вспомогательные вещества, такие как увлажнители или эмульгаторы, консерванты или буферы, которые могут увеличивать продолжительность хранения препарата или эффективность нуклеазы, антибиотиков, противовирусных соединений, антагонистов Toll-подобного рецептора, антагонистов интерферона типа 1, ингибиторов кателицидина и/или ингибиторов эластазы нейтрофилов.

Известны различные системы доставки, которые можно применять для введения описанных в настоящем изобретении композиций для лечения или улучшения состояния при болезни глаз, связанной с нуклеиновыми кислотами, ее одного или нескольких симптомов, например энкапсулирование в липосомы, микрочастицы, микрокапсулы. Композицию можно вводить в виде инъекции. Так, композицию можно вводить путем инъекции в глаз. Нуклеазная композиция может быть в форме жидки глазных капель, геля или мази, которые можно наносить в соответствии с инструкциями врача и/или в соответствии с рекомендуемой дозировкой. Например, одну каплю композиции, содержащую от 100 нг/мл до 200 нг/мл нуклеазы, можно вводить от 1 до 10 раз в сутки ежедневно, от 1 до 7 раз в сутки ежедневно, от 1 до 4 раз в сутки ежедневно или от 1 до 3 раз в сутки ежедневно.

Описанная в настоящем изобретении нуклеазная композиция может быть введена в глаз с помощью контактных линз. Например, композиция может входить в состав или покрывать указанные линзы. Композиция химически связывается или физически удерживается полимером контактных линз. Также добавляют цветной краситель, который показывает изменение количества или дозы лекарственного препарата, оставшегося или удерживающегося внутри полимера. Кроме того, или в дополнение к этому, поглотитель ультрафиолетового излучения (УФ) можно химически связать или физически присоединить к полимеру контактных линз. Применяют гидрофобные или гидрофильные контактные линзы.

Примеры материалов, применяемых для производства гидрофобных линз, предназначенных для доставки композиций, являющихся предметом настоящего изобретения, включают следующие, но не ограничиваются ими: амефокон А, амсилфокон А, аквилафокон А, арфокон А, кабуфокон А, кабуфокон В, карбозилфокон А, крилфокон А, крилфокон В, димефокон А, энфлуфокон А, энфлофокон В, эрифокон А, фторфокон А, флузилфокон А, флузилфокон В, флузилфокон С, флузилфокон D, флузилфокон Е, гексафокон А, гофокон А, гибуфокон А, итабисфторфокон А, итафторфокон А, итафокон А, итафокон В, колфокон А, колфокон В, колфокон С, колфокон D, лотифокон А, лотифокон В, лотифокон С, мелафокон А, мигафокон А, нефокон А, нефокон В, нефокон С, онзифокон А, оприфокон А, оксифлуфокон А, пафлуфокон В, пафлуфокон С, пафлуфокон D, пафлуфокон Е, пафлуфокон F, пасифокон А, пасифокон В, пасифокон С, пасифокон D, пасифокон Е, пемуфокон А, порофокон А, порофокон В, рофлуфокон А, рофлуфокон В, рофлуфокон C, рофлуфокон D, рофлуфокон Е, розилфокон А, сатафокон А, сифлуфокон А, силафокон А, стерафокон А, сульфокон А, сульфокон В, телафокон А, тизилфокон А, толофокон А, трифокон А, юнифокон А, винафокон А и уилофокон А.

Примеры материалов, применяемых для производства гидрофильных линз, предназначенных для доставки композиций, являющихся предметом настоящего изобретения, включают следующие, но не ограничиваются ими: абафилкон А, акофилкон А, акофилкон В, аквафилкон А, алофилкон А, альфафилкон А, амфилкон А, астифилкон А, атлафилкон А, балафилкон А, бисфилкон А, бифилкон А, комфилкон А, крофилкон А, циклофилкон А, дарфилкон А, дельтафилкон А, дельтафилкон В, димефилкон А, дроксфилкон А, эластофилкон А, эпсилфилкон А, эстерифилкон А, этафилкон А, фокофилкон А, галифилкон А, генфилкон А, говафилкон А, хефилкон А, хефилкон В, хефилкон С, хилафилкон А, хилафилкон В, хиоксифилкон А, хиоксифилкон В, хиоксифилкон С, гидрофилкон А, ленефилкон А, ликрифилкон А, ликрифилкон В, лидофилкон А, лидофилкон В, лотрафилкон А, лотрафилкон В, мафилкон А, мезафилкон А, метафилкон А, мипафилкон А, неофилкон А, нетрафилкон А, окуфилкон А, окуфилкон В, С, окуфилкон D, окуфилкон Е, офилкон А, омафилкон А, оксифилкон А, пентафилкон А, перфилкон А, евафилкон А, фемфилкон А, полимакон, сенофилкон А, силафилкон А, силоксифилкон А, сурфилкон А, тефилкон А, тетрафилкон А, трилфилкон А, вифилкон А, вифилкон В и ксилофилкон А.

Композиция может быть введена в твердом виде, в виде пасты, мази, геля, жидкости, аэрозоля, мелкодисперсных капель, полимера, пленки, эмульсии или суспензии. Кроме того, композиция может быть введена в состав или может покрывать контактные линзы или приспособление для доставки препарата, из которых диффундирует одна или несколько молекул или высвобождение препарата происходит с течением времени. Композиция контактных линз может либо оставаться на поверхности глаза, например, если линзы используются для коррекции зрения, либо контактные линзы могут растворяться с течением времени, одновременно высвобождая композицию в расположенные поблизости ткани. Аналогично, приспособление для доставки препарата может быть биодеградируемым или постоянным в разных вариантах осуществления данного изобретения.

В частности, одна или несколько нуклеазных композиций может быть упакована в герметично закрытый контейнер, например в ампулу или саше, с указанием количества нуклеазы. В одном из вариантов осуществления данного изобретения одна или несколько нуклеазных композиций может поставляться в виде сухого стерилизованного лиофилизованного порошка или безводного концентрата в герметично закрытом контейнере и может быть растворена (например, водой или буфером) до концентрации, необходимой для введения пациенту. В одном из вариантов осуществления данного изобретения одна или несколько нуклеазных композиций может поставляться в виде сухого стерилизованного лиофилизованного порошка в герметично закрытом контейнере в дозировке не менее 0,01 мг, 0,05 мг, 0,1 мг, 0,25 мг, 0,5 мг, 1 мг, 1,5 мг, 2,0 мг, 5 мг, или, например, не менее 10 мг, не менее 15 мг, не менее 25 мг, не менее 35 мг, не менее 45 мг, не менее 50 мг, не менее 75 мг или не менее 100 мг. Лиофилизованные композиции следует хранить при температуре от 2°С до 8°С в оригинальном контейнере, и композиции следует использовать в течение 1 недели, например в течение 5 дней, в течение 72 часов, в течение 48 часов, в течение 24 часов, в течение 12 часов, в течение 6 часов, в течение 5 часов, в течение 3 часов или в течение 1 часа после растворения. В последующем варианте осуществления данного изобретения вводимая смесь в жидкой форме поставляется в герметично закрытом контейнере с концентрацией не менее 0,25 мг/мл, например, не менее 0,5 мг/мл, не менее 1 мг/мл, не менее 2,5 мг/мл, не менее 5 мг/мл, не менее 8 мг/мл, не менее 10 мг/мл, не менее 15 мг/кг, не менее 25 мг/мл, не менее 50 мг/мл, не менее 75 мг/мл или не менее 100 мг/мл. Жидкую форму следует хранить при температуре от 2°С до 8°С в оригинальном контейнере.

Фармацевтические композиции могут включать «терапевтически эффективное количество» или «профилактически эффективное количество» нуклеазы. «Терапевтически эффективное количество» соответствует эффективному количеству, которое позволяет при применении в необходимой дозировке и в течение необходимого периода достичь желаемого терапевтического результата. Терапевтически эффективное количество композиции может быть определено специалистом в данной области техники и может различаться в зависимости от таких факторов, как течение заболевания, возраст, пол и вес пациента, и от способности композиции вызывать желаемый ответ у пациента. Терапевтически эффективное количество также является таким количеством, при применении которого терапевтическая польза превышает любые токсические или неблагоприятные воздействия нуклеазы. «Профилактически эффективное количество» соответствует эффективному количеству, которое позволяет при применении в необходимой дозировке и в течение необходимого периода достичь желаемого профилактического результата. Поскольку профилактическую дозу обычно применяют для пациентов до наступления болезни или на ранней стадии болезни, профилактически эффективное количество меньше терапевтически эффективного количества.

в. Объект

Объектом может быть млекопитающее, которое может быть представлено человеком или нет. Объект может нуждаться в проведении лечения болезни глаз, связанной с нуклеиновыми кислотами.

3. Способ лечения болезни глаз, связанной с нуклеиновыми кислотами

В настоящем изобретении приведен способ лечения болезни глаз, связанной с нуклеиновыми кислотами, такой как ССГ. Нуклеазная композиция может контактировать с глазом (глазами) пациента, страдающего болезнью глаз, связанной с нуклеиновыми кислотами, такой как ССГ.

а. Контакт нуклеазной композиции с глазом (глазами)

Нуклеазная композиция может контактировать с глазом (глазами) любыми способами. Форма контакта композиции с глазом может подразумевать местное введение или инъекцию в глаз. Как описано в настоящем изобретении, для местного нанесения или инъекции можно применять композицию в разных формах, хорошо известных специалистам в данной области техники. См. Remington’s Pharmaceutical Sciences and Introduction to Pharmaceutical Dosage Forms, 19th ed., Mack Pub. Co., Easton, Pa. (1995). Нуклеазная композиция может выпускаться в виде фармацевтически приемлемого носителя, как описано в настоящем изобретении. См. Раздел 3(б), например.

Дозировки, эффективные количества и другие способы введения, предназначенные для доставки ДНКазной композиции в глаз (глаза) также описаны выше в разделе «Фармацевтически приемлемый носитель».

б. Болезнь глаз, связанная с нуклеиновыми кислотами

Болезнь глаз, связанная с нуклеиновыми кислотами, может быть вызвана аутоиммунными состояниями, уменьшением слезообразования, микробной инфекцией, изменением состава слезной жидкости и/или внешними условиями. Данные состояния могут снижать скорость моргания и/или приводить, например, к несоответствующему увлажнению глаза. Болезнь глаз, связанная с нуклеиновыми кислотами, или похожее расстройство может быть обнаружено у пациента при появлении признака или симптома, выбранного из группы, включающей сухость, чувство колкости, чувство стянутости, зуд, жжение или чувство сдавливания, раздражение, боль, покраснение, воспаление, выделения и чрезмерное увлажнение глаз. Состав слезной жидкости пациента может быть недостаточным для увлажнения тканей глаза. Болезнь глаз, связанная с нуклеиновыми кислотами, может создавать среду на поверхности, внутри и вокруг глаза для воспаления, роста бактерий и/или бактериальной инфекции. Болезнь глаз, связанная с нуклеиновыми кислотами, может быть вызвана слезной пленкой, такой как биопленка или мукоидная пленка, или может возникнуть внутри глаза. Слезная пленка может образовываться на материалах, которые контактируют с глазом, например на контактных линзах или материалах, имплантированных в глаз, таких как склеральные зажимы, искусственные хрусталики и импланты для дренирования глаукомы.

Болезнь глаз, связанная с нуклеиновыми кислотами, может возникнуть в результате нарушения регуляции образования нуклеиновых кислот и механизмов их удаления, при пониженном уровне нуклеаз в слезной жидкости и пленке и/или сниженной активности, которая способствует, например, накоплению внеклеточной ДНК и нейтрофильных внеклеточных ловушек (НВЛ) в слезной пленке и развитию поверхностного воспаления. Болезнь глаз, связанная с нуклеиновыми кислотами, может быть вызвана снижением нуклеазной активности или снижением уровня нуклеаз в слезной жидкости больных по сравнению с нормой.

Болезнь глаз, связанная с нуклеиновыми кислотами, может быть представлена рубцовым пемфигоидом глаза, сухим кератоконъюнктивитом, синдромом Шегрена, сухим кератоконъюнктивитом, ассоциированным с синдромом Шегрена, сухим кератоконъюнктивитом, не связанным с синдромом Шегрена, сухим кератитом, синдромом сухого глаза, ксерофтальмией, нарушением слезной пленки, пониженным уровнем слезообразования, недостаточностью слезной жидкости, дисфункцией мейбомиевых желез, потерей влаги при испарении, диффузным ламеллярным кератитом, кератитом, связанным с применением контактных линз, эндофтальмитом или инфекционной кератопатией хрусталика. Болезнь глаз, связанная с нуклеиновыми кислотами, может быть аллергической болезнью глаз. Аллергическая болезнь глаз может быть вызвана наличием НВЛ или эозинофильных внеклеточных ловушек.

Уровень нуклеазы в слезной жидкости или слезной пленке пациента с болезнью глаз, связанной с нуклеиновыми кислотами, может быть менее 3,14 нг/мл. Например, уровень нуклеазы в слезной жидкости пациента с болезнью глаз, связанной с нуклеиновыми кислотами, может быть менее 3,00 нг/мл нуклеазы, менее 2,50 нг/мл нуклеазы, менее 2,00 нг/мл нуклеазы, менее 1,50 нг/мл нуклеазы, менее 1,00 нг/мл нуклеазы, менее 3,00 нг/мл нуклеазы, менее 0,50 нг/мл нуклеазы, менее 0,25 нг/мл нуклеазы. Уровень нуклеазной активности в слезной жидкости или слезной пленке пациента с болезнью глаз, связанной с нуклеиновыми кислотами, может быть равен или ниже 0,05 единиц Куница. Уровень нуклеазной активности в слезной жидкости пациента с болезнью глаз, связанной с нуклеиновыми кислотами, может быть менее 0,04 единиц Куница, менее 0,03 единиц Куница, менее 0,02 единиц Куница, менее 0,01 единиц Куница или менее 0,05 единиц Куница. Одна единица Куница соответствует количеству фермента нуклеазы, которое вызывает увеличение поглощения при 260 нм на 0,001 на мл, действуя на высоко полимеризованную ДНК при 25°С и рН 5,0 в указанных условиях.

(1) Слезная пленка

Слезная пленка, которая может содержать скопление нуклеиновой кислоты и НВЛ, может представлять собой биопленку или мукоидную пленку. Биопленка может быть образована бактериями. Мукоидная пленка может быть образована конъюнктивой глаза. Мукоидная пленка или биопленка может обнаруживаться при аллергических болезнях глаза. Биопленка и мукоидная пленка на поверхности глаза или внутри глаза пациента с болезнью глаз, связанной с нуклеиновыми кислотами, может содержать внеклеточную ДНК, НВЛ и/или нейтрофилы. НВЛ могут содержать внеклеточную ДНК, гистоны, кателицидин и/или эластазу нейтрофилов.

(а) Синдром сухих глаз (ССГ)

ССГ может быть любым заболеванием или нарушением глаза, которое может быть отнесено к любому из нескольких факторов. В некоторых вариантах ССГ, подлежащий лечению, представляет собой ССГ, вызванный любым состоянием, отличным от аллоиммунного ответа. Аллоиммунные ответы могут, например, привести к трансплантации роговицы у пациентов. В частности, в некоторых вариантах ССГ, подлежащий лечению, представляет собой аутоиммунный ССГ или ССГ, связанный с синдромом Шегрена. ССГ может быть вызван наличием внеклеточной ДНК на поверхности глаза, слишком быстрым испарением слезной жидкости (сухость глаз вследствие испарения) и/или нарушенным слезообразованием. Также см. фигуру 1 и описание к ней. В некоторых вариантах синдром сухих глаз обусловлен одной или несколькими причинами из следующих: старение, применение контактных линз и применение лекарственных препаратов. В некоторых вариантах, ССГ возникает у пациентов, которым никогда не делали никаких операций на глаза, например, речь идет о лечении пациентов, ССГ у которых не был вызван лазерной кератопластикой in situ, операцией по пересадке роговицы или иными операциями на глаза.

Внеклеточная ДНК, НВЛ и нейтрофилы могут присутствовать на поверхности глаза пациента с ССГ и в избыточном количестве присутствуют в мукоидных пленках и/или биопленках. НВЛ могут содержать внеклеточную ДНК, гистоны, кателицидин и эластазу нейтрофилов. Нуклеазная активность слезной жидкости может быть существенно снижена у пациентов с ССГ, в то время как количество внеклеточной ДНК на поверхности глаза может быть повышено. Экспрессия генов следующих стадий пути передачи сигнала после внеклеточной ДНК, например генов TLR9, MyD88 и интерферона типа 1, а также воспалительных цитокинов интерлейкина-6 и фактора некроза опухоли α, также может быть повышена у пациентов с ССГ. Недостаток нуклеазной активности может способствовать накоплению внеклеточной ДНК и НВЛ в слезной пленке, например в прекорнеальной слезной пленке, мукоидной слезной пленке или биопленке, и может приводить к развитию воспаления на поверхности глаза.

4. Способ лечения инфекции глаз

Внеклеточная нуклеиновая кислота является компонентом слезной пленки. Нуклеазная композиция, описанная в настоящем изобретении, может использоваться для лечения бактериальных инфекций и воспаления, связанного с образованием биопленки на поверхности глаза или внутри глаза (интраокулярно).

Представленный в настоящем изобретении способ является способом лечения инфекции глаз и/или воспаления глаз. Нуклеазная композиция может контактировать с глазом (глазами) пациента, страдающего от инфекции. Инфекция может быть бактериальной инфекцией или вирусной инфекцией. Композиция может контактировать с глазом, как описано выше (см. Раздел 3(а)), например, посредством местного нанесения на поверхность глаза или посредством инъекции в глаз. Соответственно, композицию можно применять интраокулярно.

5. Набор

Представленный в настоящем изобретении набор является набором для лечения или диагностики болезни глаз, связанной с нуклеиновыми кислотами. Набор может содержать нуклеазу. Нуклеаза может быть нуклеазной композицией, содержащей офтальмологическое вспомогательное вещество. Композиция может содержать один или несколько антибиотиков, противовирусных соединений, антагонистов Toll-подобного рецептора, антагонистов интерферона типа 1, ингибиторов кателицидина и/или ингибиторов эластазы нейтрофилов в контейнере для лечения пораженного глаза (глаз). Набор может содержать нуклеазную композицию и один или несколько антибиотиков, антагонистов Toll-подобного рецептора, антагонистов интерферона типа 1, ингибиторов кателицидина и/или ингибиторов эластазы нейтрофилов в двух или более контейнерах для лечения пораженного глаза (глаз). Набор может содержать пипетку или фильтровальную бумагу для сбора образцов. Пипетка или фильтровальная бумага могут быть использованы для сбора слезной жидкости с поверхности глаза. Два или более контейнеров могут быть упакованы вместе, например, в картонную коробку. Набор может также включать набор инструкций по применению, которые относятся к нуклеазной композиции и, в случае наличия, к антибиотикам, противовирусным соединениям, антагонистам Toll-подобного рецептора, антагонистам интерферона типа 1, ингибиторам кателицидина и/или ингибиторам эластазы нейтрофилов. Инструкция может описывать, как следует применять и/или контролировать способ, описанный в настоящем изобретении.

6. Способ диагностики

Представленный в настоящем изобретении способ диагностики является способом диагностики для определения наличия у пациента болезни глаз, связанной с нуклеиновыми кислотами. Способ может включать сбор образца слезной жидкости у пациента. Образец может быть получен при помощи набора, описанного выше. Данный образец можно проинкубировать с красителем, который связывается с нуклеиновой кислотой, например с красителем picogreen. Также образец можно проинкубировать с нуклеиновой кислотой, а затем с красителем. Интенсивность окрашивания можно измерить и сравнить с интенсивностью флуоресценции красителя в нормальном контрольном образце. Повышенный уровень интенсивности флуоресценции красителя в образце по сравнению с контролем может указывать на наличие синдрома сухих глаз. Интенсивность красителя и, следовательно, количество внеклеточной нуклеиновой кислоты может отражать степень тяжести заболевания. Например, при использовании красителя picogreen высокий уровень интенсивности зеленого цвета, особенно по сравнению с контролем (напр., с отрицательным контролем), может указывать на тяжелую форму синдрома сухих глаз у пациента. В зависимости от типа применяемого красителя можно определить уровень нуклеаз на поверхности глаза, применяя данный метод.

У настоящего изобретения есть множество аспектов, которые иллюстрируются, но не ограничиваются следующими примерами.

ПРИМЕРЫ

Пример 1

Способы определения внеклеточной ДНК на поверхности глаза (см. также фигуры 2-9 и описания к ним)

Образцы собирали у пациентов с синдромом сухих глаз с помощью полосок бумаги пробы Ширмера. Проба Ширмера представляет собой стандартный тест, проводимый при осмотре глаз. Проба Ширмера состоит из тонкой полоски фильтровальной бумаги, которая помещается под нижнее боковое веко на 5 минут. Затем полоску вынимают и измеряют уровень увлажнения бумаги. Уровень измеряют в миллиметрах. Если полученное значение менее 5, это является диагностическим признаком заболевания. Обычно после проведения пробы полоску бумаги выбрасывают. Однако в настоящем исследовании эту полоску применяли дальше, а не выбрасывали.

Поскольку бумага касается пальпебральной и бульбарной конъюнктивы, клетки из этих зон связываются с бумагой. Клетки с бумаги собирали на покрытые силаном адгезивные стекла производства Tekdon Corporation. Во время этой процедуры получали четыре стекла от каждого пациента. Стекла инкубировали в 10% формальдегиде в течение по меньшей мере получаса перед окрашиванием. Эти стекла затем окрашивали гематоксилином и эозином, проводили иммуноокрашивание антителами к эластазе нейтрофилов, гистону и миелопероксидазе для выявления НВЛ. Затем стекла окрашивали антителами к каспазе 3 для выявления апоптоза.

При окрашивании гематоксилином и эозином клетки фиксировали в 10% формальдегиде в течение по меньшей мере получаса. Стекло погружали в гематоксилин на 7 мин, затем промывали. После этого стекло погружали 4 раза в кислоту, затем промывали и погружали в синий краситель на 2 мин. Стекло кратко промывали, затем погружали в эозин на 2 мин. После промывки стекло высушивали на воздухе при комнатной температуре, покрывали покровным стеклом и анализировали с помощью микроскопа.

Двойное иммуноокрашиванием проводили с помощью антител (а) к эластазе нейтрофилов (Dakocytomation - моноклональные антитела к человеческой эластазе нейтрофилов) и гистонам (Santa Cruz Biotechnology, Санта-Круз, Калифорния) вместе с 4ʹ,6-диамидин-2-фенилиндолом (DAPI) (Vector Labs, Берлингейм, Калифорния), (б) к миелопероксидазе и гистонам (Santa Cruz Biotechnology, Санта-Круз, Калифорния) вместе с DAPI для выявления наличия НВЛ на поверхности глаза. Клетки на покрытых силаном стеклах фиксировали 10% формальдегидом в течение по меньшей мере получаса. Затем стекла промывали дважды фосфатно-солевым буфером +0,025% Тритоном Х-100 в течение 5 мин при перемешивании. Затем клетки блокировали 10% нормальной сывороткой +1% БСА в фосфатно-солевом буфере в течение 2 часов при комнатной температуре. Первичные антитела разводили в фосфатно-солевом буфере в соотношении 1:400 для эластазы нейтрофилов и 1:200 для гистонов. Стекла инкубировали в первичных антителах в течение ночи при 4°С. После ночной инкубации клетки промывали дважды фосфатно-солевым буфером +0,025% Тритоном Х-100 в течение 5 мин при перемешивании. На следующей стадии добавляли вторичные антитела к эластазе нейтрофилов (красные) и гистонам (зеленые), разведенные фосфатно-солевым буфером +1% БСА, и инкубировали при комнатной температуре в течение 1 часа. Через 1 час стекла споласкивали в фосфатно-солевом буфере три раза по 5 минут и окрашивали DAPI (Vector Labs, Берлингейм, Калифорния). Затем стекла анализировали в инвертированном микроскопе (Carl Zeiss Meditech GmbH, Гамбург, Германия).

Для количественного определения внеклеточной ДНК фильтровальную бумагу, содержащую внеклеточную ДНК и клетки, инкубировали с 100 ед/мл ДНКазы I (Fermentas Life Sciences, Гановер, Мериленд). Затем добавляли 0,5М ЭДТА для остановки нуклеазной активности и собирали супернатанты. Добавляли picogreen (Invitrogen, Карлсбад, Калифорния), флуоресцентный краситель для ДНК, и оценивали количественное содержание ДНК с помощью флуоресцентной спектрометрии.

Обработка ДНКазой: у каждого пациента собирали по четыре образца из конъюнктивы и обрабатывали их: образец 1 - окрашивали DAPI (контроль); образец 2 - обрабатывали ДНКазой (100 МЕ/мл в течение 20 минут) и окрашивали DAPI; образец 3 - обрабатывали ДНКазой, инактивированной нагреванием (100 МЕ/мл в течение 20 минут), и окрашивали DAPI; образец 4 - инкубировали в фосфатно-солевом буфере и окрашивали DAPI.

Затем визуализировали образцы в инвертированном микроскопе (Carl Zeiss Meditech GmbH, Гамбург, Германия). Количественное определение проводили после получения изображений в программах Axiovision и Neurolucida. Расчет значений и построение графиков проводили в программе Microsoft Excel. См. фигуру 9 и описание к ней.

Пример 2

Способ, применяемый в примерах 3 и 4

Исследуемая популяция: пациенты с ССГ с симптомами недостаточного слезообразования и здоровые индивиды без симптомов заболевания с нормальным уровнем слезообразования привлекались для участия в исследовании и подписывали информированное согласие в соответствии с Хельсинской декларацией в рамках протокола, одобренного Экспертным советом организации. Пациентов включали в исследование, если у них были жалобы хотя бы на один симптом ССГ (сухость, раздражение, ощущение покалывания, чувствительность к свету, ощущение инородного тела) и дополнительно наблюдалась тяжелая форма недостаточности слезной жидкости, определенная с помощью пробы Ширмера I значением ≤5 мм за 5 минут (без анестезии). В контрольную группу включали людей, у которых не было симптомов болезни глаз и в пробе Ширмера I значение ≥12 мм за 5 минут (без анестезии).

Анализ отшелушенных клеток конъюнктивы и мукоидных пленок: проводили пробу Ширмера I без применения местной анестезии, помещая тестовые полоски Ширмера (Haag-Steit, Эссекс, Великобритания) на границу нижнего века, в место соединения боковой и средней третей, на 5 минут. Степень увлажнения полоски оценивали в миллиметрах. Поскольку бумага касается пальпебральной и бульбарной конъюнктивы, клетки из этих зон отшелушиваются при удалении бумаги. Клетки, прикрепившиеся к бумаге, переносили на покрытые силаном адгезивные стекла. Стекла сразу фиксировали в течение 30 минут в 10% формальдегиде на нейтральном буфере (Sigma-Aldrich, Сент-Луис, Миссури) перед дальнейшим анализом. Мукоидные пленки собирали с помощью одноразовых микрокапиллярных стеклянных трубочек (объемом 5 мкл; Sigma-Aldrich) с бульбарной конъюнктивы или с нижнего свода конъюнктивы. Мукоидные ленки распределяли по покрытым силаном стеклам и обрабатывали.

Окрашивание гематоксилином и эозином: стекла с отшелушенными клетками конъюнктивы (n=15) или мукоидными пленками (n=10) окрашивали гематоксилином (H-3401, Vector Labs, Берлингейм, Калифорния), споласкивали в кислоте, погружали в синий краситель и докрашивали эозином (Thermo Scientific, Уолтем, Массачусетс). Стекла анализировали с помощью прямого микроскопа Axioscope 100 (Carl Zeiss Meditech GmbH, Гамбург, Германия), получали изображения с помощью цветной камеры Zeiss MRc и анализировали их с помощью Zeiss Axiovision.

Иммуноокрашивание и конфокальная микроскопия: иммунофлуоресцентное окрашивание и конфокальную микроскопию применяли для определения расположения молекулярных компонентов НВЛ и внеклеточной ДНК, как описано ранее. Стекла пермеабилизовали в течение 5 минут в 0,025% Тритоне Х-100 и блокировали в течение 2 часов при комнатной температуре в 1% бычьем сывороточном альбумине (БСА) и 10% нормальной ослиной сыворотке в фосфатно-солевом буфере. Стекла инкубировали в течение ночи при 4°С с первичными антителами, разведенными в блокирующем растворе (1:200). Стекла промывали четыре раза фосфатно-солевым буфером (каждый раз по 15 минут) и инкубировали в течение 1 часа с вторичными антителами, разведенными в блокирующем растворе (1:200). Среду для заключения Vectashield с 4ʹ,6-диамидин-2-фенилиндолом (DAPI; каталожный номер Н-1200, Vector Labs) наносили на стекла и накрывали покровным стеклом. Применяли следующие первичные антитела: (1) мышиные моноклональные антитела к человеческой эластазе нейтрофилов (клон NP57, DAKO, Глострап, Дания); (2) козьи поликлональные антитела к гистону Н2В (каталожный номер SC-8650, Santa Cruz Biotechnology, Санта-Круз, Калифорния); и (3) кроличьи поликлональные антитела к кателицидину (каталожный номер ab64892, Abcam, Кембридж, Массачусетс). Применяли следующие вторичные антитела: Dylight 594-конъюгированные антитела к мышиным IgG для эластазы нейтрофилов (1:1000, Jackson Immunoresearch Laboratories, Вест Гров, Филадельфия) и FITC 480-конъюгированные антитела к козьим IgG для гистона и кателицидина (1:200, Jackson Immunoresearch Laboratories). Образцы анализировали с помощью конфокального микроскопа LSM 710 META (Carl Zeiss Meditech GmbH, Гамбург, Германия). Сначала получали изображение образцов пациентов, чтобы оптимизировать флуоресцентные сигналы, и сразу после этого получали изображения стекол с отрицательным контролем (без первичных антител), применяя идентичные настройки. Специфичность первичных антител к эластазе нейтрофилов и кателицидину оценивали ранее.

Иммуноокрашивание ДНКазы I слезных желез: срезы слезных желез (6-8 мкм) получали из архивных биопсий слезных желез без признаков воспаления и малигнизации (n=5). Срезы депарафинировали при 56°C в течение 30 минут, затем обрабатывали серией спиртов разной концентрации. Проводили окрашивание срезов, как описано выше. В качестве первичного антитела применяли кроличье поликлональное антитело к ДНКазе I (1:50, каталожный номер HPA010703, Sigma Prestige, Сент-Луис, Миссури). Вторичным антителом было Dylight 594-конъюгированное антитело к кроличьим IgG. Отрицательными контролями были: (1) контроль без первичных антител, (2) изотипический контроль кроличьих поликлональных IgG (каталожный номер ab27427, Abcam) и (3) предварительная инкубация первичных антител с пептидом (каталожный номер HPA010703, Atlas Antibodies AB, Стокгольм, Швеция). Получение изображений и анализ проводили, как описано выше.

Лазерная захватывающая микродиссекция цепей внеклеточной ДНК: отпечатки тестовых полосок Ширмера получали на мембранах (каталожный номер 11505158, Leica, Солмс, Германия), как описано выше. Мембраны фиксировали в 10% формальдегиде в течение 30 минут и промывали 1х фосфатно-солевым буфером. Мембраны окрашивали DAPI, кратко промывали в фосфатно-солевом буфере, высушивали в течение 30 минут при 37°С. Окрашенные DAPI цепи внеклеточной ДНК визуализировали, вырезали и захватывали с помощью лазерного захватывающего микродиссекционного микроскопа с технологией PALM (positioning and ablation with laser microbeams, позиционирование и отделение лазерными лучами) (Carl Zeiss, Торнвуд, Нью-Йорк). Захваченные цепи собирали в адгезивной крышке, ДНК экстрагировали с помощью DNAzol (каталожный номер 1-0503-027, Invitrogen, Карлсбад, Калифорния) в соответствии с протоколом производителя. ПЦР проводили с помощью набора реактивов GoTaq PCR (каталожный номер М7122, Promega, Мэдисон, Висконсин) в соответствии с протоколом производителя. Человеческий ген ГАФДГ (глицеральдегидфосфатдегидрогеназы) (каталожный номер PPH00150F, SA Biosciences, Фредерик, Мериленд) амплифицировали, применяя геноспецифичные праймеры. Продукты ПЦР разделяли электрофорезом и визуализировали в 2% агарозном геле, окрашенном бромистым этидием.

Количественное определение внеклеточной ДНК поверхности глаза: мы применяли две стратегии расчета количества внеклеточной ДНК на поверхности глаза. Во-первых, общую длину цепей внеклеточной ДНК определяли в отшелушенном материале, полученном на отпечатках полосок пробы Ширмера на стеклах. Во-вторых, внеклеточную ДНК экстрагировали с полосок пробы Ширмера, используя ДНКазу I, и определяли интенсивность флуоресценции, применяя флуоресцентный краситель для ДНК picogreen.

Длина внеклеточной ДНК: стекла с отпечатками полосок Ширмера фиксировали и окрашивали DAPI. Получали изображения пяти произвольно выбранных оптических полей при 20-кратном увеличении объектива инвертированного микроскопа (Axio Observer, Zeiss) и анализировали, применяя программу Neurolucida (MBF Bioscience, Уиллистон, Виктория). Прослеживали за ходом нитей внДНК и рассчитывали длину с помощью Neuroexplorer (MBF Bioscience), как описано ранее для зрительных нервов. Среднюю общую длину внДНК у пациентов с синдромом сухих глаз (n=10) сравнивали с нормальным контролем (n=10).

Окрашивание красителем picogreen: окрашивание красителем picogreen проводили, как описано ранее. Свернутый конец полоски пробы Ширмера, который контактировал с конъюнктивой, собирали в микропробирку eppendorf и добавляли 200 мкл ДНКазы I 100 ед/мл (каталожный номер EN0521, Fermentas Life Sciences, Гановер, Мериленд). Через 20 минут ингибировали нуклеазную активность, добавляя 0,5 мМ ЭДТА, и удаляли полоску пробы Ширмера. Добавляли флуоресцентный краситель для ДНК picogreen (каталожный номер Р5789, Invitrogen Detection Technologies), определяли интенсивность флуоресценции на микропланшетном спектрофотометре (Synergy H1, BioTech, Винууски, Виктория). Значения усредняли и проводили сравнение пациентов с ССГ (n=10) с нормальным контролем (n=10).

Экспрессия генов в отшелушенных клетках конъюнктивы: РНК экстрагировали из отшелушенных клеток полосок пробы Ширмера, взятой у пациентов с ССГ (n=20) и в группе нормального контроля (n=16). Свернутые концы полосок пробы Ширмера помещали в раствор тризола (Invitrogen) для экстракции РНК, которую проводили в соответствии с протоколом производителя. Реакцию обратной транскрипции проводили с 1000 нг общей РНК, применяя набор реактивов RT2 First Strand eDNA Synthesis (SABiosciences). Полученную внДНК предварительно амплифицировали, применяя набор реактивов RT2 Nano PreAMP, в соответствии с инструкциями производителя. Количественную ПЦР в реальном времени проводили с SYBR на приборе 7900HT ABI для ПЦР в реальном времени. Экспрессию генов внДНК и воспалительных цитокинов анализировали с помощью количественной ПЦР в реальном времени.

Все праймеры и реагенты покупали в SABiosciences, если иное не оговорено. Применяли следующие праймеры: к Toll-подобному рецептору 9 (TLR9; каталожный номер PPH01809A), интерферону-α (INFA; каталожный номер PPH01321A), MyD88 (каталожный номер PPH00911A), интерферону-β (INFB; каталожный номер PPH00384E), IL-6 (каталожный номер PPH00560B), TNF-α (каталожный номер PPH00341E) и к глицеральдегид-3-фосфатдегидрогеназе (каталожный номер PPH00150F). Образцы анализировали в двух повторах в общем объеме 25 мкл в следующих условиях: 10 минут при 95°С, 40 циклов 95°С в течение 15 секунд и 60°С в течение 60 секунд. Контроль наличия примеси человеческой геномной ДНК применяли, чтобы подтвердить, что реагенты для амплификации не были загрязнены геномной ДНК. Для анализа данных пороговый цикл (CT) каждого гена пациентов с ССГ нормализовали к соответствующему значению нормальных индивидов и применяли для расчета кратности изменения с помощью способа 2-ΔΔCT.

Нуклеазная активность и ДНКаза I в слезной жидкости: слезную жидкость собирали с помощью одноразовых микрокапиллярных стеклянных трубочек, применяя микроскопию с щелевой лампой. Трубочки помещали на нижний свод конъюнктивы, слезную жидкость собирали за счет капиллярной силы. Слезную жидкость переносили в микропробирки eppendorf, не содержащие ДНКаз, для дальнейшего анализа.

Нуклеазная активность в нормальной слезной жидкости: нуклеазную активность слезной пленки количественно определяли у пациентов с ССГ (n=5) и в нормальном контроле (n=5), проводя тест с расщеплением ДНК (набор реактивов для определения ДНК, MO-BIO Laboratories, Карсбад, Калифорния) в соответствии с инструкциями производителя. Образцы слезной жидкости и стандарты ДНК (набор маркерных фрагментов ДНК 1 т.п.о.) разделяли электрофорезом в 2% агарозном геле, окрашенном бромистым этидием, и фотографировали, применяя УФ-трансиллюминатор. ДНКазную активность оценивали, сравнивая интенсивность полос и распределение стандартных фрагментов ДНК с таковыми в образцах слезной жидкости. Если нуклеазы присутствовали в слезной жидкости, наблюдалось размазывание полос и снижение их интенсивности в дорожках с образцами. Если маркер ДНК полностью деградирует, нуклеазная активность превышает 0,05 единиц Куница, что является верхним пределом определения для данного способа.

Нуклеазная активность в слезной жидкости: исследование методом резонансного переноса энергии (FRET, fluorescence resonance energy transfer) проводили для сравнения нуклеазной активность в слезной жидкости пациентов с ССГ (n=17) и в нормальном контроле (n=15). Проводили FRET-исследование нуклеаз. Субстрат для FRET, пробу для количественного ПЦР PRIMETIME™, покупали в Integrated DNA Technologies (Кораллвиль, Индиана). Он состоял из короткого (15-мерного) одноцепочечного олигонуклеотида, модифицированного на 5ʹ-конце флуорофором Cy3 и на 3ʹ-конце - гасителем BQH2 (Black hole quencher 2). Последовательность олигонуклеотидного субстрата следующая: 5ʹ CCC CGG ATC CAC CCC 3ʹ (SEQ ID NO: 2). В интактном олигонуклеотиде Cy3 и BQH2 располагаются достаточно близко, чтобы происходило гашение флуоресценции. При разрезании олигонуклеотида флуоресценция Су3 пропорциональна количеству разрезов и может применяться для количественного анализа нуклеазной активности. Значительное отличие выхода субстрата для FRET, очищенного ВЭЖХ, наблюдали в трех заказах (21,1 и 35,8 нмоль при заказе на синтез 250 нмоль и 124,5 нмоль при заказе на синтез 1 мкмоль), поэтому мы не смогли обобщить данные и сообщили об анализе нуклеазной активности, проведенном с заказом на синтез 1 мкмоль. Вариация выхода обусловлена процессом ВЭЖХ очистки и обратно пропорциональна чистоте субстрата для FRET. Образцы слезной жидкости собирали, как описано выше. Образцы инкубировали на льду до проведения исследования. Исследование проводили в течение 3 часов после сбора образцов. Образцы слезной жидкости (5 мкл) наносили на плашку для микротитрования. Субстрат для FRET (2,5 нмоль в 50 мкл буферного раствора) добавляли в лунки, содержащие образцы слезной жидкости. Испускаемую флуоресценцию (в относительных единицах флуоресценции) и скорость изменения флуоресценции измеряли с помощью микропланшетного спектрофотометра (Synergy H1, BioTek) при 37°С, длине волны возбуждения 552 нм и испускания - 580 нм. Содержимое плашек перемешивали в течение 5 минут перед считыванием показаний, показания считывали с интервалом 3 секунды в течение 30 минут. Для анализа кинетические измерения относительные единицы флуоресценции для каждого пациента усредняли в 30-минутном интервале.

Количественное определение ДНКазы I в слезной жидкости: мы использовали коммерческий набор реактивов для твердофазного иммуноферментного анализа человеческой ДНКазы I (каталожный номер Е0100214, Life Sciences Advanced Tech, Сент-Петербург, Флорида) для определения количества ДНКазы I в слезной жидкости. Двадцать пять микролитров слезной жидкости (n=5) и 0,5 мл слюны (n=5) отбирали у здоровых индивидов. Слюну центрифугировали при 15000 об/мин в течение 5 мин при 4°С и анализировали 25 мкл супернатанта. Стандарты или образцы (25 мкл) добавляли в соответствующие лунки плашки для микротитрования, предварительно покрытые антителами, и проводили исследование в соответствии с инструкциями производителя. Чувствительность исследования составляет 0,1 нг/мл.

Статистический анализ: средние значения и стандартные ошибки среднего рассчитывали для пациентов с ССГ и нормальных индивидов и анализировали, применяя критерий Стьюдента. Статистический пакет программного обеспечения Microsoft Excel использовали для анализа и построение графиков. p≤0,05 считали статистически значимым.

Пример 3

внДНК и нейтрофильные внеклеточные ловушки (НВЛ) присутствуют на поверхности глаза

Исследуемая популяция включала пациентов с ССГ (n=37 пациентов, 73 глаза) со средним уровнем образования слезной жидкости 2,76±0,35 мм. У нормальных индивидов (n=18 человек, 36 глаз) средний уровень образования слезной жидкости составлял 19,1±1,25 мм, что было существенно выше, чем у пациентов с ССГ (p<0,001). У пациентов была сухость глаз, не связанная с синдромом Шегрена (n=33), этиология которой была идиопатической, связанной с последствиями лазерной кератопластики in situ, нейтрофильным или рубцовым пемфигоидом глаза и синдромом Шегрена (n=4).

внДНК и нейтрофильные внеклеточные ловушки (НВЛ) присутствуют на поверхности глаза: окрашивание гематоксилином и эозином, а также иммунофлуоресцентное окрашивание проводили на клетках конъюнктивы пациентов с тяжелой формой ССГ. Клетки получали с отпечатков тестовых полосок на стекле после проведения пробы Ширмера I (Фигура 11, А1, А2). Окрашивание гематоксилином и эозином показало присутствие отшелушенных клеток конъюнктивы в одиночном виде или в виде скоплений. Клетки были округлой или овальной формы с эозинофильной цитоплазмой и равномерно округлым базофильным ядром (Фигура 11, В). Окрашивание ядра DAPI выявило несколько редко расположенных цепей внДНК у нормальных индивидов (Фигура 11, С1) и множество длинных цепей внДНК у пациентов с ССГ (Фигура 11, С2). Конфокальная микроскопия выявила наличие нейтрофилов в цепях внДНК (Фигура 11, D). Гистон (Фигура 11, Е1) и эластаза нейтрофилов (Фигура 11, Е2) колокализовались с окрашенными DAPI цепями внДНК, доказывая, что это были НВЛ (Фигура 11, Е4). Чтобы проверить, не была ли внДНК артефактом, полученным в результате применения импрессионной цитологии, анализ проводили на отшелушенных клетках ротовой полости, полученных таким же способом. внДНК не обнаруживалась (данные не показаны).

Окрашивание гематоксилином и эозином проводили на слезных пленках, присутствующих на бульбарной конъюнктиве/роговице (Фигура 12, А1) или на нижнем своде (Фигура 12, А2). Мукоидные пленки выглядели как пенистые скопления белой слизи, которые иногда исчезали при моргании. Для анализа эти мукоидные пленки снимали с помощью микрокапиллярных трубочек. Однако анализ дал похожие результаты. Окрашивание гематоксилином и эозином выявило наличие многочисленных нейтрофилов и отшелушенных клеток в мукоидных пленках (Фигура 12, В1). Окрашивание DAPI показало наличие внДНК (Фигура 12, В2) и многочисленных нейтрофилов, содержащих эластазу (Фигура 12, В3). Эластаза нейтрофилов (Фигура 12, С1) и гистон (Фигура 12, С2) колокализовались с окрашенными DAPI цепями внДНК, доказывая, что это были НВЛ (Фигура 12, С4).

Чтобы подтвердить, что окрашенные DAPI цепи содержали ДНК, окрашенные DAPI цепи снимали с мембраны с помощью лазерного захватывающего микродиссекционного микроскопа (Фигура 12, D1 и D2). Внеклеточные окрашенные DAPI цепи содержали ДНК, о чем свидетельствует ПЦР-амплификация продукта гена ГАФДГ (Фигура 12, D3).

Исследовали наличие кателицидина в НВЛ: кателицидин присутствовал в мукоидных пленках (Фигура 13, А1) и колокализовался с эластазой нейтрофилов и окрашенным DAPI материалом ядра (Фигура 13, А4). Кателицидин также присутствовал внутри нейтрофилов (Фигура 13, В4). Кателицидин, материал ядра и эластаза нейтрофилов выходят из нейтрофилов для образования НВЛ (Фигура 13, С1-4).

По количеству внДНК на поверхности глаза у пациентов с ССГ было значительно снижено образование слезной жидкости по сравнению с нормальными индивидами (Фигура 14, А). Длина цепи внДНК была существенно больше (p=0,002) у пациентов с ССГ (15,0±4,2 мм) по сравнению с нормальными индивидами (1,58±0,47 мм) (Фигура 14, В). Количество внДНК на поверхности глаза, измеренное в тесте с красителем picogreen, также было существенно выше (p=0,006) у пациентов с ССГ (20137,2±1507,3 отн. ед. фл.) по сравнению с контролем (Фигура 14, В).

Пример 4

Экспрессия генов пути передачи сигнала от внДНК

Количественную ПЦР с отшелушенными клетками конъюнктивы проводили для определения кратности изменения экспрессии генов, расположенных на следующих стадиях пути передачи сигнала после ДНК (Фигура 14, D). Экспрессия TLR9, Myd88 и IFN 1 (IFNA и IFNB), а также генов воспаления IL-6 и TNF-a была существенно повышена в клетках конъюнктивы пациентов с ССГ. Кратность увеличения экспрессии генов у пациентов с ССГ была следующей: TLR9 (5,57±1,6, p=0,003), Myd88 (4,20±0,6, p<0,0001), IFNA (3,09±0,5, p=0,0003), INFB (4,18±0,6, p<0,0001), TNF-a (20,6±10,0, p=0,003) и IL-6 (17,3±3,1, p<0,0001).

Пример 5

Недостаточность нуклеазы у пациентов с ССГ

Нуклеазы и ДНКаза I присутствуют в слезной жидкости. Специфичные антитела к ДНКазе I применяли для иммуноокрашивания срезов слезных желез. ДНКаза I локализовалась в эпителиальных клетках, выстилающих доли слезных желез (Фигура 15, А). Твердофазный иммуноферментный анализ проводили для определения количества ДНКазы I в слезной жидкости и слюне (Фигура 15, В1). Концентрация ДНКазы I в слезной жидкости составляла 3,14±0,49 нг/мл, а в слюне – 4,21±1,14 нг/мл. Нуклеазную активность в слезной жидкости количественно оценивали с помощью набора реактивов для определения ДНКазы (Фигура 15, В2). Нуклеазная активность в слезах нормальных индивидов и пациентов с ССГ была выше 0,05 единиц Куница. Данный вид исследования не мог применяться для количественного определения и сравнения нуклеазной активности слезной жидкости у пациентов с ССГ и нормальных индивидов, поскольку значение 0,05 единиц Куница является верхним пределом определения при данном способе. Поэтому проводили FRET-исследование нуклеазной активности для сравнения общего уровня нуклеазной активности у пациентов с ССГ и нормальных индивидов (Фигура 15, С1). Общий уровень нуклеазной активности был существенно ниже у пациентов с ССГ (36749,2±3898,6 отн. ед. фл., p=0,003) по сравнению с контролем (52843,6±724,4 отн. ед. фл) (Фигура 15, С2).

Пример 6

Растворение НВЛ под действием нуклеаз

Чтобы показать терапевтическое значение обработки нуклеазами для удаления цепей внДНК, связанных с ССГ, отшелушенный материал с отпечатков полосок пробы Ширмера, взятой у пациентов с ССГ, обрабатывали ДНКазой I. Как показано на фигуре 6(А), цепи внДНК в избыточном количестве присутствовали в необработанном отшелушенном материале, взятом с поверхности глаз пациентов с ССГ. Однако после инкубации образца с таким же материалом, как показан на фигуре 6А, с ДНКазой I в течение 20 минут, не осталось видимых цепей внДНК (Фигура 6(В)). Данный результат показывает, что внДНК с поверхности глаза можно удалить при обработке ДНКазой I.

Пример 7

Бактерии в слезной пленке

У пациентов с тяжелой формой слезной недостаточности при синдроме сухих глаз на поверхности глаза могут присутствовать мукоидные пленки. Мукоидные пленки снимали с поверхности глаза с помощью стерильной палочки с тампоном eSwab. Был обнаружен рост грамположительных кокков, идентифицированных как не обладающие коагулазной активностью виды стафилококка. См. фигуру 16А и В.

1. Композиция для лечения синдрома сухости глаз, связанного с нуклеиновыми кислотами, которые развиваются, в результате выработки/образования нуклеиновых кислот вместе с образованием глазных мукоидных пленок и/или биопленок, где композицию наносят на поверхность глаза для удаления нуклеиновой кислоты с поверхности глаза, где композиция содержит дезоксирибонуклеазу I (ДНКазу I) и офтальмологическое вспомогательное вещество, и где композиция не содержит антибиотик.

2. Композиция по п. 1, в которой ДНКаза I представлена дорназой альфа (PULMOZYME®).

3. Композиция по п. 1, в которой офтальмологическое вспомогательное вещество выбирается из группы, состоящей из буфера, регулятора тоничности, увлажняющего средства, антиоксиданта и их комбинации.

4. Композиция по п. 1, дополнительно содержащая антагонист или ингибитор из группы, состоящей из антагониста Toll-подобного рецептора, антагониста интерферона типа 1, ингибитора кателицидина, ингибитора MyD88, стероида, противоаллергического соединения, ингибитора эластазы нейтрофилов и их комбинации.

5. Композиция по п. 1 в твердой форме, в форме мази, геля, жидкости, аэрозоля, мелкодисперсных капель, полимера, пленки, эмульсии или суспензии.

6. Способ лечения синдрома сухости глаз, предусматривающий введение композиции по п. 1 в глаз в количестве, эффективном для лечения синдрома сухости глаз.

7. Способ по п. 6, в котором на поверхности глаза присутствует слезная пленка.

8. Способ по п. 7, в котором слезная пленка представлена биопленкой или мукоидной пленкой.

9. Способ по п. 8, в котором биопленка или мукоидная пленка содержит нуклеиновую кислоту.

10. Способ по п. 9, в котором нуклеиновая кислота представлена внеклеточной нуклеиновой кислотой.

11. Способ по п. 9, в котором нуклеиновая кислота представлена ДНК, РНК или их комбинацией.

12. Способ по п. 6, в котором эффективное количество композиции составляет от 5 нг/мл до 3 мг/мл нуклеазы.

13. Способ по п. 12, в котором эффективное количество композиции составляет от 1 мг/мл до 3 мг/мл нуклеазы.



 

Похожие патенты:

Группа изобретений относится к области медицины и представляет собой: глазную взвесь, содержащую циклоспорин А формы 2 и какую-либо среду, где циклоспорин А формы 2 характеризуется следующими пиками при сканировании рентгеновским дифрактометром с излучением Cu Kα, 2θ: 7,5, 8,8, 10,2, 11,3, 12,7, 13,8, 14,5, 15,6 и 17,5; способ приготовления состава циклоспорина, который включает этапы смешивания циклоспорина А формы 2 со средой для образования взвеси; размельчение взвеси; глазную взвесь, содержащую частицы циклоспорина А Формы 2; и среду, в которой средний размер (d90) частиц меньше чем около 10 мкм; способ лечения состояния выбранного из: сидром сухого глаза, блефарит, заболевание мейбомиевой железы, нарушение чувствительности роговицы, аллергический конъюнктивит, атопический кератоконъюнктивит, весенний кератоконъюнктивит и птеригий, включающий этап применения к пациенту, имеющему такое состояние, вышеуказанной глазной взвеси.

Группа изобретений относится к медицине. Описаны биоразлагаемые устройства, такие как имплантаты для контролируемой доставки терапевтических агентов, в частности больших молекул, таких как белки и антитела.

Изобретение относится к области офтальмологии и представляет собой офтальмологическую композицию, предназначенную для введения в силиконовую гидрогелевую контактную линзу, для лечения, предотвращения или смягчения синдрома сухого глаза, где композиция содержит сложный эфир противовоспалительного липоидного медиатора в количестве от приблизительно 0,01% до 5,0% по весу в расчете на общую массу композиции, где противовоспалительный липоидный медиатор представляет собой этиловый эфир альфа-линолевой кислоты и пропиленгликоль, где противовоспалительный липоидный медиатор присутствует в форме сложного эфира.

Изобретение относится к соединению общей формулы (I), обладающему высокой антагонистической активностью по отношению к S1P2 человека, и может применяться для приготовления лекарственного средства для лечения заболевания, опосредованного S1P2, такого как заболевание, обусловленное сужением сосудов, фиброз и респираторное заболевание.

Изобретение относится к области медицины и фармацевтической промышленности, а именно к офтальмической композиции в виде глазных капель, содержащей полиафроновую дисперсию и имеющей вязкость от 1 до 50 Па⋅с при скорости сдвига 1 с-1, где указанная композиция включает неионное, негалогенированное поверхностно-активное вещество, фармацевтически приемлемое масло, выбранное из группы, состоящей из касторового масла, длинноцепочечных триглицеридов, среднецепочечных триглицеридов, минерального масла, силиконов, фосфолипидов, моно- и диглицеридов и смесей двух или более из них, и фармацевтически активный агент – циклоспорин, при этом композиция не содержит фторированное поверхностно-активное вещество.

Группа изобретений относится к области медицины и представляет собой офтальмологический состав, содержащий циклоспорин А формы 2 и какой-либо гидрогель, где циклоспорин А формы 2 характеризуется следующими пиками при сканировании рентгеновским дифрактометром с излучением Cu Кα, 2θ: 7,5, 8,8, 10,2, 11,3, 12,7, 13,8, 14,5, 15,6 и 17,5; а также способ лечения состояния, выбранного из: сидром сухого глаза, блефарит, заболевание мейбомиевой железы, нарушение чувствительности роговицы, аллегрический конъюнктивит, атопический кератоконънюктивит и птеригия, включающий этап применения к пациенту, имеющему такое состояние, указанного состава.

Изобретение относится к способу получения Формы 2 циклоспорина А, которая является кинетически стабильной формой циклоспорина А в водных суспензиях. Способ получения формы 2 циклоспорина А, характеризующейся основными кристаллическими пиками 2θ рентгеновской порошковой дифракторгаммы при 7,5, 8,8, 10,2, 11,3, 12,7, 13,8, 14,5, 15,6 и 17,5, включает стадии: a) приготовление суспензии циклоспорина А в растворителе, содержащем воду и ингредиент, выбранный из группы, состоящей из ацетонитрила, 1,4-диоксана и этанола; b) первый цикл нагревания-охлаждения, включающий нагревание суспензии до температуры от 5 до 50°С, затем охлаждение суспензии до температуры от 1 до 35°С; c) второй цикл нагревания-охлаждения, включающий нагревание суспензии до температуры от 5 до 50°С, затем охлаждение суспензии до температуры от 1 до 35°С и d) третий цикл нагревания-охлаждения, включающий нагревание суспензии до температуры от 5 до 50°С, затем охлаждение суспензии до температуры от 1 до 35°С.
Изобретение относится к медицине, а именно к офтальмологии, и предназначено для лечения васкуляризированного бельма роговицы вследствие ожоговой травмы глаза. Для осуществления способа выполняют инсталляцию препарата пептидов в конъюнктивальную полость: с первых по 14-е сутки - шестикратно в течение часа с интервалом между закапываниями 10 минут, далее с 14-х по 30-е сутки - четырехкратно в течение часа с интервалом 20 минут.

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для улучшения зрительной функции у субъекта. Для улучшения зрительной функции у субъекта, имеющего дефицит эндогенно продуцированного 11-цис-ретиналя, вводят первую терапевтическую дозу синтетического производного ретиналя субъекту в форме разделенной дневной дозы в течение периода времени приблизительно от 2 до приблизительно 7 дней.
Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для лечения макулярного отека сетчатки. Для осуществления способа выполняют введение пролонгированного кортикостероида дипроспан в субтеноновое пространство.

Группа изобретений относится к медицине и может быть использована для лечения сердечной недостаточности с застойными явлениями (CHF), диабета или предиабета in vivo у пациента, нуждающегося в этом.

Настоящее изобретение относится к фармацевтической промышленности, а именно к применению композиции, изготовленной из сырьевых материалов, состоящей из Ganoderma, Radix Panacis Quinquefolii или Radix Et Rhizoma Ginseng и ферментированного порошка Cordyceps sinensis и/или от Cordyceps, взятых в определенном количестве, в производстве медицинской продукции или лекарственных средств для профилактики и лечения вызванной лучевой терапией или химиотерапией лейкопении, при котором композицию получают путем смешивания сырьевых материалов и экстрагирования их с водой и/или спиртом (варианты).
Изобретение относится к ветеринарии, а именно к способу лечения субклинического мастита у лактирующих коров. Коровам интрацистернально вводят в пораженные доли вымени лечебный препарат «Малавит» в концентрации 15-25%.

Изобретение относится к фармацевтической промышленности и представляет собой ранозаживляющую композицию для местного применения, по существу состоящая из: тетрадекагидрата сульфата алюминия, присутствующего в количестве от приблизительно 40,0 мас.

Изобретение относится к фармацевтической химии, фармакологии и медицине. Предложено применение бис(2-аминоэтан-1-сульфоната) кальция в качестве средства, проявляющего системный гемостатический эффект.

Группа изобретений относится к области химии и химико-фармацевтической промышленности, а именно к новому клатратному комплексу N-карбамоилметил-4-фенил-2-пирролидона или 4-фенилпирацетама с циклодекстрином при их мольном соотношении от 1:1 до 1:10 соответственно и к вариантам способа его получения, а также к фармацевтической композиции, содержащей указанный клатратный комплекс в эффективном количестве совместно с фармацевтически приемлемым наполнителем и/или эксципиентом и к лекарственному средству в виде капсул, таблеток или раствора для инъекций на основе такого клатратного комплекса.

Изобретение относится к химико-фармацевтической промышленности и представляет собой перорально биодоступный неводный жидкий состав для лечения болезни сердца и/или гипертонии, содержащий по меньшей мере 7 мас.% пропиленгликоля от общей массы состава, кардиотоническое средство, или ингибитор ангиотензинпревращающего фермента, или комбинацию кардиотонического средства и ингибитора ангиотензинпревращающего фермента.

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для применения в офтальмологическом диагностическом способе. В офтальмологическом диагностическом способе применяют вещества, выбранные из группы, состоящей из рибофлавина, его сложных эфиров и их солей и гидратов.

Изобретение относится к композиции, ингибирующей теломеразу. Указанная композиция включает блок-сополимер полиоксиэтилена и полиоксипропилена, а также координационное соединение производного имидизол-4-она, ингибирующее теломеразу, общей формулы При этом координационное соединение производного имидазол-4-она содержится в количестве от 5 до 60 мас.%, блок-сополимер – остальное.

Изобретение относится к медицине, а именно к офтальмологии, и предназначено для профилактики и лечения возрастной катаракты ядерного вида. Глазные капли для профилактики и лечения возрастной катаракты ядерного вида содержат следующие компоненты: натрия хлорид - 4,1 мг, натрия дигидрофосфат (моногидрат) - 4,6 мг, натрия гидрофосфат (безводный) - 4,74 мг, бензалкония хлорид - 0,2 мг, ондансетрона гидрохлорида дигидрат - 0,002-0,2 мг и воду для инъекций - 1,0 мл.

Настоящее изобретение относится к области биотехнологии, конкретно к способу улучшения сократительной способности сердца, повышения капиллярной плотности или снижения миокардиальной гипертрофии у пациента с поврежденным миокардом, что может быть использовано в медицине.

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для лечения синдрома сухости глаз. Композиция для лечения синдрома сухости глаз, связанного с нуклеиновыми кислотами, который развивается в результате выработкиобразования нуклеиновых кислот вместе с образованием глазных мукоидных пленок иили биопленок, содержит дезоксирибонуклеазу I и офтальмологическое вспомогательное вещество, и не содержит антибиотик. Композицию наносят на поверхность глаза для удаления нуклеиновой кислоты с поверхности глаза. Также обеспечивается способ лечения указанного синдрома сухости глаз, предусматривающий введение указанной композиции в глаз в эффективном количестве. Использование группы изобретений позволяет повысить эффективность лечения синдрома сухости глаз, связанного с нуклеиновыми кислотами, который развивается в результате выработкиобразования нуклеиновых кислот вместе с образованием глазных мукоидных пленок иили биопленок. 2 н. и 11 з.п. ф-лы, 16 ил., 7 пр.

Наверх