Способ экспресс-диагностики лейкоза крупного рогатого скота



Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота
Способ экспресс-диагностики лейкоза крупного рогатого скота

Владельцы патента RU 2644233:

Федеральное государственное бюджетное научное учреждение "Федеральный Центр токсикологической, радиационной и биологической безопасности" ФГБНУ "ФЦТРБ-ВНИВИ" (RU)

Изобретение относится к области биохимии. Описан способ экспресс-диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции в режиме реального времени. Способ включает использование прямого и обратного олигонуклеотидного праймера, с добавлением в реакционную смесь олигонуклеотидного зонда с флуоресцентной меткой для выявления фрагмента гена провируса лейкоза крупного рогатого скота, отличающийся тем, что используют в качестве праймеров олигонуклеотиды структуры , а в качестве олигонуклеотидного зонда - зонд RT меченный с 5'-конца флуоресцентным красителем ROX и с 3'-конца гасителем RTQ2. Изобретение расширяет арсенал способов диагностики лейкоза крупного рогатого скота. 6 ил., 8 табл.

 

Изобретение относится к области химии. Описан способ экспресс-диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции в режиме реального времени. Способ включает в себя использование прямого и обратного праймера, с добавлением в реакционную смесь олигонуклеотидного зонда с флуоресцентной меткой для выявления гена провируса лейкоза крупного рогатого скота. выбор области генома идентифицируемого агента, структура и температурный режим отжига олигонуклеотидных праймеров.

Известен способ диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции (ПЦР), включающей прямой и обратный олигонуклеотидные праймеры для выявления фрагмента гена pol провируса лейкоза крупного рогатого скота с электрофоретическим определением размера амплифицируемого фрагмента нуклеотидной последовательности, в качестве праймеров используют олигонуклеотиды следующей структуры -

При постановке ПЦР этим способом размер продукта на выходе составляет 438 пар нуклеотидов.

Однако, данный способ требует проведение дополнительной стадии электрофоретической детекции, что повышает вероятность возникновения контаминации (пат. RU №2445370, МПК C12Q 1/68, опубл. 20.03.12 г.).

Известен также способ выделения ДНК провируса лейкоза крупного рогатого скота методом ПЦР в режиме реального времени, включающий прямой и обратный олигонуклеотидные праймеры с добавлением в реакционную смесь олигонуклеотидного зонда с флуоресцентной меткой для выявления фрагмента гена провируса лейкоза крупного рогатого скота с определением размера амплифицируемого фрагмента нуклеотидной последовательности. В качестве праймеров используют - Pol (nested, sense) и Pol (nested, antisense) и добавляют в реакционную смесь синтезированный зонд - Pol (molecular beacon) с флуоресцентной меткой. Размер продукта на выходе составляет 202 п.н. (Гулюкин М.И. и др. Применение ПЦР для выявления вируса лейкоза крупного рогатого скота. Харьков, «Ветеринарная медицина», вып. 92. с. 145-150).

В этом способе выявления ДНК провируса крупного рогатого скота методом ПЦР, наиболее близком к предлагаемому, из-за низкой консервативности и малой вариабельности снижается специфичность и эффективность обнаружения ДНК провируса лейкоза крупного рогатого скота (Mechanisms of leukemogenesis induced by bovine leukemia virus:prospects for novel antiretroviral therapies in human. N. Gillet, A. Florins, M.Boxus, C. Burteau, A. Nigro, F. Vandermeers, H. Balon, Amel-BayaBouzar, J. Defoichel, A. Burny, M. Reichert, R. Kettmann and Luc Willems. Rerovirology 2007, 4:18).

Технический результат, на достижение которого направлено изобретение, заключается в создании более специфичного и чувствительного способа обнаружения ДНК провируса лейкоза крупного рогатого скота методом ПЦР путем использования другой нуклеотидной последовательности генома вируса лейкоза крупного рогатого скота, а именно области гена р24.

Для достижения этого технического результата в способе экспресс-диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции в режиме реального времени, включающий использование прямого и обратного олигонуклеотидного праймера, с добавлением в реакционную смесь олигонуклеотидного зонда с флуоресцентной меткой для выявления фрагмента гена провируса лейкоза крупного рогатого скота, выявляют фрагмент гена р24 провируса лейкоза крупного рогатого скота и используют в качестве праймеров олигонуклеотиды структуры:

а в качестве олигонуклеотидного зонда-зонд

RT меченный с 5'-конца флуоресцентным красителем ROX и с 3'-конца гасителем RTQ2, которые имеют следующие характеристики: отсутствие самокомплементарных участков внутри каждого праймера и между прямым и обратным, температура отжига составляет 61,0°С для PF, 62,2°С для PR 66,4°С для RT и фланкируют область консервативного гена р24 ВЛКРС размером 140 пар нуклеотидов консервативного гена р24 провируса лейкоза КРС, который обнаруживают за счет детекции сигнала флуоресценции.

В результате ПЦР на стадии отжига происходит комплементарное присоединение праймеров и зонда к молекуле ДНК-мишени. Во время стадии элонгации происходит разрушение зонда за счет 3'-нуклеазной активности полимеразы, а флуоресцентная метка (краситель) выходит в реакционную смесь. Детектирующий амплификатор фиксирует свободную флуоресценцию реакционной смеси и по уровню флюоресценции можно контролировать прохождение ПЦР в режиме реального времени.

Отличительными признаками предлагаемого способа экспресс диагностики лейкоза крупного рогатого скота от прототипа, являются использование другой нуклеотидной последовательности генома ВЛКРС, а именно области гена р24, которая отличается более высокой степенью консервативности и использование олигонуклеотидного зонда меченного 5'-конца флуоресцентным красителем ROX и 3'- конца гасителем RTQ2, что позволяет получить достоверный, высокочувствительный, высокоспецифичный способ выявления фрагмента провирусной ДНК ВЛКРС в биологическом материале в течение 4 часов.

Предложенный способ осуществляли с помощью компьютерной программы Vector NTI 9.0 (Introgen, США). На основании информации, представленной в базах данных Интернет ресурсов EMBL (Германия), GenBank(CIIIA), по генотипам ВЛКРС была выбрана референс последовательность - К02120. Для оценки вариабельности и поиска консервативных участков нуклеотидных последовательностей, ограничивающих эту область, был произведен с использованием компьютерной программы BioEdit. В результате анализа была выбрана консервативная нуклеотидная последовательность гена р24. Подборка оптимальных к последовательности гена р24 праймеров и зонда. Проверка качеств, термодинамический анализ выбранных олигонуклеотидов был выполнен с помощью программы Vector NTI 9.0 (Introgen, США). Праймеры были проверены на отсутствие гомологии с последовательностями других вирусов и генома человека программой BLAST с помощью web-pecypca Национального центра биологической информации (NCBI) (http://blast.ncbi.nlm.nih.gov/). Оценка специфичности подтвердила гомологичность выбранных праймеров и зонда с нуклеотидной последовательностью гена р24 и отсутствие значимой гомологии с нуклеотидными последовательностями других видов вирусов. Расчетная длина специфического фрагмента составила 140 пар нуклеотидов (п.н.) Схема фланкируемого участка гена р24 генома вируса лейкоза крупного рогатого скота праймерами PF р24_140 и PR р24_140 представлена на рис. 1.

В таблице 1 приведены нуклеотидные последовательности праймеров и зонда, предлагаемые для обнаружения возбудителя лейкоза крупного рогатого скота по гену р24, кодирующего нуклеотидный белок.

Представленные праймеры и зонд имеют следующие характеристики: комплементарность к области гена р24 ВЛКРС, отсутствие самокоплементарных участков внутри каждого олигонуклеотида и между собой. Температура отжига составляет 61,0°С для PF p24, 62,2°С для PR р24 и 66,4°С для probe_RTp24. GC состав: 61,9% для PFp24, 63,6% - PR p24, 46,9% для probe_RTp24. Праймеры фланкируют фрагментконсервативного гена р24 ВЛКРС размером 140 пар нуклеотидов. Синтез разработанных олигонуклеотидных праймеров заказывается в коммерческом сервисном центре. Характеристика разработанных праймеров приведена в таблице 2.

В процессе проведения практических экспериментов подбирают оптимальные условия прохождения полимеразной цепной реакции, с использованием разработанных праймеров. Состав реакционной смеси представлен в таблице 3.

Как видно из таблицы 3, полимеразную цепную реакцию проводят в объеме реакционной смеси 25 мкл на 1 пробу ДНК.

Температурно-временной режим проведения реакции для амплификатора «Терцик» («ДНК-технология», Россия) представлен в таблице 4.

В качестве положительного контроля прохождения полимеразной цепной реакции с применением разработанных праймеров, используют лиофилизированный препарат положительного контрольного антигена (АГ) ВЛКРС. Препарат получен из вируса, накопленного в вируспродуцирующей культуре клеток почки эмбриона овцы (FLK). Предварительно препарат АГ был испытан в ПЦР анализе с помощью коммерческих наборов для детекции ДНК провируса лейкоза КРС отечественных производителей.

Детекцию результатов проводили в процессе амплификации на стадии «отжига» праймеров посредством детектирующего амплификатора ДТ-96 производства «ДНК-технология». Учет результатов вели по каналу флуоресценции ROX. Результаты анализа показаны в таблице 5 и на рис. 2, показана зависимость флуоресценции канала ROX от номера цикла по накоплению провируса лейкоза, где С 7 - положительный контроль (лиофилизированный препарат положительного контрольного антигена ВЛКРС), С 3 - отрицательный контроль.

Из таблицы 5 видно, положительное значение Ср по каналу ROX равное 23,9 свидетельствует о накоплении в процессе ПЦР ожидаемого продукта реакции - участка провирусной ДНК ВЛКРС.

Также учет результатов ПЦР был выполнен с помощью горизонтального электрофореза в 1,8% агарозном геле с добавлением бромистого этидия.

В процессе ПЦР получены продукты амплификации ДНК провируса лейкоза КРС длиной 140 п.н. Это свидетельствует о воспроизводимости результатов проведенных опытов. Электрофореграмма результатов полимеразной цепной реакции представлена на рис. 3, где 1 трэк - маркер молекулярного веса (от 100 до 1000 п. н.); 2 трэк - специфичный ампликон провирусной ДНК ВЛКРС; 3 трэк - ОКО (контрольный отрицательный образец).

В электрофоретической дорожке, соответствующей положительному контролю (К+), присутствовала светящаяся полоса. Ее электрофоретическая подвижность соответствовала длине ампликона 140 п.н. В электрофоретической дорожке, соответствующей отрицательному контролю (К-), такая полоса отсутствовала. Это свидетельствует о наличии искомого участка провирусной ДНК ВЛКРС.

Для определения чувствительности реакции амплификации с использованием разработанных специфических олигонуклеотидных праймеров и зонда был проведен анализ проб ДНК, выделенных из десятикратных разведений суспензии клеток FLK (вирус продуцирующая культура клеток почки эмбриона овцы, хронически инфицированная вирусом лейкоза КРС). Анализ показал, что последним разведением, в котором проходила ПЦР, является 5 разведение (10-5), что составляет 1,3×101 в.к./мл. Результаты ПЦР в реальном времени представлены в таблице 6 и на рис. 4 по определению чувствительности и специфичности реакции амплификации с использованием разработанных специфических олигонуклеотидных праймеров и зонда, где D 1 - К- - отрицательный контрольный образец; D 2- разведение (10-4); D 3- разведение (10-5); D 4- разведение (10-6); D 5- разведение (10-1); D 6 -разведение (10-2); D 7- разведение (10-3).

Для проверки специфичности, разработанные праймеры и зонд проверяли методом ПЦР в реальном времени с использованием следующих образцов ДНК:

1. провирусная ДНК FLK-BLV, выделенной из вирус продуцирующей культуры клеток почки эмбриона овцы (FLK), образец №1;

2. ДНК от здоровых коров, образец №2;

3. провирусная ДНК возбудителя иммунодефицита КРС, образец №3;

4. ДНК герпес вируса возбудителя инфекционного ринотрахеита КРС, образец №4;

5. ДНК Е. coli, образец №5;

6. ДНК бактерий рода Salmonella, образец №6.

Положительный результат в ПЦР получили только с образцами ДНК провирусной ДНК FLK-BLV. В остальных пробах ДНК продукт амплификации отсутствовал, приведены В таблице 7 и на рис. 5 представлены результаты ПЦР по определению специфичности разработанных праймеров и зонда, где С 3- провирусная ДНК FLK-BLV, выделенной из вирус продуцирующей культуры клеток почки эмбриона овцы (FLK), образец №1; С 2-отрицательный контрольный образец; С 4 ДНК от здоровых коров, образец №2; С 5 -провирусная ДНК возбудителя иммунодефицита КРС, образец №3; С 6 -ДНК герпес вируса возбудителя инфекционного ринотрахеита КРС, образец №4; С 7-ДНК Е. coli, образец №5; С 8-ДНК бактерий рода Salmonella, образец №6.

Как видно, из вышеописанных примеров, предложенный способ полимеразной цепной реакции в режиме реального времени с использованием оригинальных праймеров и зонда позволяет обнаруживать провирусную ДНК возбудителя лейкоза крупного рогатого скота.

Выбор высоко консервативной области гена р24 позволяет повысить специфичность данного способа диагностики лейкоза КРС.

Использование предлагаемых специфических праймеров и зонда повышает чувствительность метода ПЦР по сравнению с прототипом до 1,3×101 в.к./мл.

Предложенный способ апробирован с 2009-2015 гг на многих животноводческих фермах Республики Татарстан на более 500 пробах ДНК, полученных из крови крупного рогатого скота. Приводим один из примеров в таблице - 8 и на рис. 6 по амплификации специфических фрагментов ДНК провируса лейкоза КРС с помощью разработанных праймеров и олигонуклеотидного зонда для диагностики лейкоза КРС, где С 3-К- - отрицательный контрольный образец; С7 - отрицательная проба (кровь теленка неинфицированная вирусом лейкоза КРС); С 5-положительная проба (кровь коровы инфицированная вирусом лейкоза крс); С 9 - К+ - положительный контрольный образец.

Как видно из таблицы 8, предлагаемый способ экспресс-диагностики лейкоза КРС позволяет достоверно обнаруживать провирус лейкоза КРС в клинических образцах.

Предложенный способ неоднократно апробирован на базе лаборатории биохимии и молекулярно-генетического анализа ФГБНУ «ФЦТРБ-ВНИВИ» (г. Казань).

Таким образом, предлагаемый достоверный и высокочувствительный способ позволяет сократить время, упростить процесс ранней диагностики лейкоза КРС и выявления вируса лейкоза КРС.

Способ экспресс-диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции в режиме реального времени, включающий использование прямого и обратного олигонуклеотидного праймера, с добавлением в реакционную смесь олигонуклеотидного зонда с флуоресцентной меткой для выявления фрагмента гена провируса лейкоза крупного рогатого скота, отличающийся тем, что выявляют фрагмент гена р 24 провируса лейкоза крупного рогатого скота и используют в качестве праймеров олигонуклеотиды структуры PF: 5'-GGCACCGGGTTCGCAAGTAT-3', PR: 5'-CGGTTAGGCTGGTCATGTGGCC-3', а в качестве олигонуклеотидного зонда - зонд RT р 24 AAACACTACGACTTGCAATCTTACAGGCCGAC, меченный с 5'-конца флуоресцентным красителем ROX и с 3'-конца гасителем RTQ2, которые имеют следующие характеристики: отсутствие самокомплементарных участков внутри каждого праймера и между прямым и обратным, температура отжига составляет 61,0°C для PF, 62,2°C для PR и 66,4°C для зонда RT и фланкируют область консервативного гена р 24 вируса лейкоза крупного рогатого скота размером 140 пар нуклеотидов, который обнаруживают за счет детекции сигнала флуоресценции.



 

Похожие патенты:

Изобретение относится к области биотехнологии и генетической инженерии. Изобретение может быть использовано при экспресс-диагностике представителей вида V.

Изобретение относится к области биотехнологии и генетической инженерии. Изобретение может быть использовано при экспресс-диагностике представителей вида V.

Изобретение относится к области биохимии и биотехнологии, в частности к РНК-аптамеру, представляющему 26-звенный олигонуклеотид смешанного типа. Настоящий РНК-аптамер содержит пуриновые рибонуклеотиды и 2’-дезокси-2’-фторпиримидиновые рибонуклеотиды.

Изобретение относится к области медицины и предназначено для диагностики светлоклеточного почечно-клеточного рака (скПКР). В качестве исследуемых образцов используют образцы ткани почки в предположительно опухолевой и гистологически нормальной ткани пациента.

Изобретение относится к области медицины и предназначено для диагностики светлоклеточного почечно-клеточного рака (скПКР). В качестве исследуемых образцов используют образцы ткани почки в предположительно опухолевой и гистологически нормальной ткани пациента.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор олигонуклеотидных зондов для определения полиморфных маркеров в генах метаболизма лекарственных препаратов и генах иммунного ответа.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор олигонуклеотидных зондов для определения полиморфных маркеров в генах метаболизма лекарственных препаратов и генах иммунного ответа.

Изобретение относится к вариантам способа получения частиц, которые можно применять в различных методиках разделения и аналитических методах для захвата полинуклеотидов.

Изобретение относится к вариантам способа получения частиц, которые можно применять в различных методиках разделения и аналитических методах для захвата полинуклеотидов.

Изобретение относится к области медицины и предназначено для диагностики онкологических заболеваний. При исследовании образца, взятого у пациента, выделяют суммарную РНК, получают кДНК и амплифицируют ее с помощью полимеразной цепной реакции с праймерами, специфическими к нуклеотидной последовательности гена LINC00309 (Long intergenic non-protein coding RNA 309).

Изобретение относится к области биотехнологии и биохимии, конкретно к векторной конструкции. Описанная репортерная система на основе лентивирусных репортерных конструкций позволяет с высокой точностью зарегистрировать взаимодействия исследуемых белков в клетке животного, растения, гриба и бактерии, а также зарегистрировать явление транспортировки белка из одной клетки в другую.

Изобретение относится к способу определения токсичности химических веществ, генерирующих активные формы кислорода. Способ предусматривает добавление рибофлавина до конечной концентрации 1⋅10-5 мг/мл - 1⋅10-3 мг/мл в культуру Escherichia coli К12 MG1655 с плазмидой PkatG-lux, в которой lux оперон биолюминесценции морских фотобактерий Photobacterium leiognathi, Vibrio fischeri или Photorabdus luminescens поставлен под контроль промотора PkatG.

Изобретение относится к способу определения генотоксичности химических веществ. Способ предусматривает добавление рибофлавина до конечной концентрации 1⋅10-7 мг/мл - 1⋅10-5 мг/мл в культуру Escherichia coli К12 MG1655 с плазмидой pColD-lux, в которой lux оперон биолюминесценции морских фотобактерий Photobacterium leiognathi, Vibrio fischeri или Photorabdus luminescens поставлен под контроль промотора pColD.

Группа изобретений относится к области биохимии. Предложен метод выявления люциферазы в биологических образцах с использованием 3-гидроксигиспидина или 3-гидроксибиснориангонина в качестве люциферина.

Группа изобретений относится к области генной инженерии, в целом к трансгенным конструкциям, трансгенным животным, отличным от человека, способам количественного анализа активации GPCR лигандов неинвазивно в интактных животных, тканевых срезах или в нативных клетках, используя трансгенную модель, содержащую систему биолюминесцентного трансгена-репортера, которая является чувствительной к модуляции путей после связывания лиганда с рецепторами GPCR.

Изобретение относится к области биотехнологии, конкретно к реагенту для определения аденозин-5'-трифосфата. .

Изобретение относится к биотехнологии, в частности к способам получения иммобилизованных ферментов, и может быть использован в химии, биохимии, медицине, микробиологии, экологии и сельском хозяйстве для анализа веществ биолюминесцентным методом.

Изобретение относится к биотехнологии, конкретно к биокатализаторам на основе иммобилизованных клеток бактерий, и может быть использовано для получения иммобилизованного биокатализатора, предназначенного для определения различных токсикантов.

Изобретение относится к области биотехнологии и может быть использовано в различных аналитических системах, основанных на явлении биолюминесценции. .

Изобретение относится к области биохимии. .

Изобретение относится к области биотехнологии и генетической инженерии. Изобретение может быть использовано при экспресс-диагностике представителей вида V.

Изобретение относится к области биохимии. Описан способ экспресс-диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции в режиме реального времени. Способ включает использование прямого и обратного олигонуклеотидного праймера, с добавлением в реакционную смесь олигонуклеотидного зонда с флуоресцентной меткой для выявления фрагмента гена провируса лейкоза крупного рогатого скота, отличающийся тем, что используют в качестве праймеров олигонуклеотиды структуры, а в качестве олигонуклеотидного зонда - зонд RT меченный с 5-конца флуоресцентным красителем ROX и с 3-конца гасителем RTQ2. Изобретение расширяет арсенал способов диагностики лейкоза крупного рогатого скота. 6 ил., 8 табл.

Наверх