Тест-система для обнаружения днк вируса африканской чумы свиней с помощью полимеразной цепной реакции в режиме реального времени

Изобретение относится к области ветеринарной вирусологии, в частности к тест-системе для обнаружения ДНК особо опасного возбудителя африканской чумы свиней (АЧС). Изобретение предназначено для повышения степени специфичности и чувствительности тест-системы, а также сокращения времени проведения диагностики при снижении вероятности технологических ошибок во время лабораторных манипуляциях. Тест-система для обнаружения ДНК вируса африканской чумы свиней с помощью полимеразной цепной реакции в режиме реального времени включает пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, положительный контроль - рекомбинантную плазмиду, содержащую фрагмент гена vp72 вируса африканской чумы свиней, синтетические олигонуклеотидные праймеры и зонд. Используют синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72 и имеющие следующий нуклеитидный состав:

- прямой праймер,

- обратный праймер,

- флуоресцирующий зонд и взятые при соотношении 1:1:0,5, при этом BHQ1 - темновой гаситель флуоресценции присоединен к 3'-концевому нуклеотиду, а FAM - флуоресцентный краситель присоединен к нуклеотиду С, причем для постановки реакции используют 5-кратный буфер и в качестве отрицательного контроля используют дистиллированную воду. 1 табл., 9 ил.

 

Изобретение относится к области ветеринарной вирусологии, в частности к тест-системе для обнаружения ДНК особо опасного возбудителя африканской чумы свиней (АЧС) в культуре инфицированных клеток и пробах патологических материалов от свиней, и может быть использовано при диагностике АЧС в научно-исследовательских учреждениях, региональных, областных ветеринарных лабораториях и на предприятиях биологической промышленности.

Известна тест-система (см. патент РФ №2360971, кл. C12Q 1/68, 2009 г.), включающая пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, ПЦР-смесь для постановки реакции со специфическими олигонуклеотидными праймерами, комплиментарными высококонсервативной области генома вируса АЧС района гена Р30, положительный и отрицательный контроли.

Также известна тест-система (см. патент РФ №2125089, кл. C12Q 1/68, 1999 г. - прототип), включающая пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, положительный контроль - рекомбинантную плазмиду, содержащую фрагмент гена vp72 вируса африканской чумы свиней, синтетические олигонуклеотидные праймеры и зонд.

Недостатком прототипа является недостаточная степень специфичности и чувствительности тест-системы, а также длительность проведения диагностики, что не исключает вероятность технологических ошибок при лабораторных манипуляциях.

Техническим результатом является повышение степени специфичности и чувствительности тест-системы, а также сокращение времени проведения диагностики при снижении вероятности технологических ошибок во время лабораторных манипуляциях.

Технический результат достигается тем, что в тест-системе для обнаружения ДНК вируса африканской чумы свиней с помощью полимеразной цепной реакции в режиме реального времени, включающей пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, положительный контроль - рекомбинантную плазмиду, содержащую фрагмент гена vp72 вируса африканской чумы свиней, синтетические олигонуклеотидные праймеры и зонд, согласно изобретению используют синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72, имеющие следующий нуклеитидный состав:

- прямой праймер,

- обратный праймер,

- флуоресцирующий зонд и взятые при соотношении 1:1:0,5, при этом BHQ1 - темновой гаситель флуоресценции присоединен к 3'-концевому нуклеотиду, а FAM - флуоресцентный краситель присоединен к нуклеотиду С, причем для постановка реакции используют 5-кратный буфер и в качестве отрицательного контроля используют дистиллированную воду.

Существенными признаками, отличающими заявляемое техническое решение от прототипа, являются:

- нуклеотидные последовательности праймеров и зонда;

- формат амплификационной смеси;

- состав амплификационой смеси, в которой используют два внутренних контроля проведения полимеразной цепной реакции.

Новизна заявляемой тест-системы заключается в том, что она позволяет в биологических образцах, в качестве которых используют по выбору: плазму, сыворотку крови, мазки со слизистых от латентно инфицированных и больных животных; патологический материал от павших животных, в инфицированных культурах клеток, а также в продуктах свиноводства и изделиях свиного происхождения, выявлять специфическую последовательность консервативного участка генома вируса африканской чумы свиней без использования дополнительных методов детекции ампликонов, тем самым сокращая процент технологических ошибок. Формат и состав амплификационной смеси сокращает трудоемкость и продолжительность анализа, а также позволяют осуществлять эффективную наработку фрагментов нуклеиновой кислоты вируса африканской чумы свиней, содержащих выбранные функционально значимые консервативные локусы гена-мишени вируса.

Также тест-система отличается тем, что в ее составе используют синтетические олигонуклеотидные конструкции:

(прямой праймер),

(обратный праймер),

(флуоресцирующий зонд), где BHQ1 означает присоединенный к 3'-концевому нуклеотиду темновой гаситель флуоресценции, a FAM - флуоресцентный краситель FAM, присоединенный к нуклеотиду С.

На основе синтетических олигонуклеотидных конструкций SEQ NO 1-3 готовят амплификационную смесь для проведения ПЦР в режиме реального времени; наличие в изучаемой пробе нуклеиновой кислоты искомого вируса определяют ростом сигнала флуоресценции красителя. Причем структура синтетических олигонуклеотидных конструкций обеспечивает связывание только с полностью комплементарными ДНК-мишенями, что обуславливает яркий флуоресцентный сигнал. Кроме того, физико-химические свойства олигонуклеотидных конструкций SEQ NO 1-3 препятствуют образованию между собой шпилек и дуплексов (высокоэнергетических внутренних структур), способствуют образованию необходимого количества продукта амплификации, а также подобраны с учетом одинаковой температуры отжига на ДНК-мишени (60-62°С). Для стабильной работы олигонуклеотидных конструкций в растворе тест-системы оптимизированы концентрация MgCl2 и самих конструкций, а также соотношение прямых, обратных праймеров и флуоресцентных зондов, количество циклов амплификации и их время на каждом этапе.

Сущность изобретения поясняется чертежом, где представлены графики из отчета работы прибора Rotor-Gene 6000 при использовании Real-time PCR:

на фиг. 1 представлен график канала FAM - искомая ДНК АЧС для отрицательного образца;

на фиг. 2 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - отрицательный образец;

на фиг. 3 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - отрицательный образец;

на фиг. 4 представлен график канала FAM - искомая ДНК АЧС для положительного образца;

на фиг. 5 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - положительный образец;

на фиг. 6 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - положительный образец;

на фиг. 7 представлен график канала FAM - искомая ДНК АЧС для сомнительного образца;

на фиг. 8 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - сомнительный образец;

на фиг. 9 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - сомнительный образец;

Сущность изобретения поясняется чертежом, где представлены графики из отчета работы прибора Rotor-Gene 6000 при использовании Real-time PCR:

на фиг. 1 представлен график канала FAM - искомая ДНК АЧС для отрицательного образца;

на фиг. 2 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - отрицательный образец;

на фиг. 3 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - отрицательный образец;

на фиг. 4 представлен график канала FAM - искомая ДНК АЧС для положительного образца;

на фиг. 5 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - положительный образец;

на фиг. 6 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - положительный образец;

на фиг. 7 представлен график канала FAM - искомая ДНК АЧС для сомнительного образца;

на фиг. 8 представлен график канала Су5 - внутренний контрольный образец специфики - ДНК свиньи - сомнительный образец;

на фиг. 9 представлен график канала HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - сомнительный образец;

Примеры конкретного использования тест-системы

Тест-система снабжена пластиковыми флаконами и пробирками, термостабильным ферментом Tag-полимеразой, 5-кратным буфером для постановки реакции, смесью четырех дезоксинуклеотидтрифосфатов, рекомбинантной плазмидой, содержащей фрагмент гена vp72 вируса африканской чумы свиней в качестве положительнго контроля, синтетическими олигонуклеотидными праймерами и зондом комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72, имеющие следующий нуклеитидный состав:

- прямой праймер,

- обратный праймер,

- флуоресцирующий зонд и взятые при соотношении 1:1:0,5 и отрицательным контролем в качестве которого используют дистиллированную воду.

Пример 1. Проведение ПЦР анализа в формате «моноплексная ПЦР-РВ» для детекции вируса, выделенного из тканей свиней.

Для проведения ПЦР анализа проводили выделение вирусной ДНК из тканей селезенки свиньи. Выделение проводили по следующей методике с использованием коммерческого набора компании «ИДС» для экспресс-выделения «ДНК-экспресс».

Отбирают гомогенизат ткани селезенки и помещают его в пробирку на 1,5 мл с 300 мкл раствора «ДНК-экспресс». Добавляют в каждую пробирку по 10 мкл «ЭВК» (экзогенный внутренний контроль выделения, входит в состав коммерческого набора). Перемешивают на вортексе 5-10 сек. Осаждают капли с крышки пробирки коротким центрифугированием. Прогревают при 98°C в течение 15 минут. Центрифугируют 2 мин при максимальных оборотах (10-14,5 тыс.об/мин). Переносят надосадочную жидкость в чистую 1,5 мл пробирку. Перенесенную надосадочную жидкость используют для постановки ПЦР.

Для проведения самой ПЦР с использованием тест-системы требуется:

Подготовить необходимое количество пробирок с реакционной смесью, включая три пробирки для стандартных образцов ДНК и отрицательного контрольного образца. При конструировании праймеров и зонда основными требованиями являются: степень гомологии (комплементарность) с выбранным участком гена; отсутствие самокоплементарных участков внутри олигонуклеотидов и комплементарности друг другу, чтобы не допускать возникновения устойчивых вторичных структур (димеров); близость значений температуры отжига праймеров.

Разработанные олигонуклеотиды имеют оптимальные размер (24-25 пл.) и GC состав (45,8 и 48%), температуру отжига праймеров 55°C, температуру отжига зонда до 72°C.

Состав реакционной смеси был подобран таким образом, чтобы концентрация ионов MgCl2 была в пределах 2,0 - 2,5 мМ, что обеспечивает оптимальную скорость и точность работы фермента Taq-полимеразы, концентрация дНТФ - не более 2,5 мМ, концентрация каждого праймера -1,5 пмоль/мкл, зонда - 0,75 пмоль/мкл и объем пробы - 10 мкл.

Пробирки с амплификационной смесью расставляют в соответствии с заранее подготовленным протоколом, где указаны номера анализируемых проб, а также пробирки положительного и отрицательного контролей. Если реакцию проводят на анализаторе Rotor Gene 6000/Q (Corbett Research), то пробирки могут быть промаркированы.

Добавлят во все пробирки индивидуальными наконечниками с аэрозольными фильтрами по 7 мкл:

а) в амплификационную пробирку для постановки отрицательного контроля

- отрицательный контрольный образец (ОКО) из комплекта тест-системы;

б) в пробирки исследуемых образцов - исследуемые образцы ДНК;

в) в амплификационную пробирку для постановки положительного контроля

- положительный контрольный образец (ПКО) из комплекта тест-системы.

Для снижения риска контаминации образцы следует добавлять в указанном порядке.

Пробирку, в которую был внесен образец, следует по возможности немедленно закрыть крышкой и центрифугировать в течение 15 секунд на плашечной центрифуге или микроцентрифуге-вортексе. Затем переносят пробирки в прибор и проводят амплификацию.

Проводят амплификацию по программе для амплификатора Rotor-Gene Q или Rotor-Gene 6000 (Corbett Research), указанной в Таблице 1.

Детекция продуктов амплификации осуществляется прибором автоматически в каждом цикле амплификации. На основании этих данных управляющая программа строит кривые накопления флуоресцентного сигнала по каждому из заданных для образцов каналов.

Для работы с тест-системой используют каналы: FAM (специфический сигнал), HEX (сигнал внутреннего контроля), CY5 (сигнал экзогенного внутреннего контроля).

Оценка эффективности использования тест-системы осуществлялась по кривым накопления флуоресцентного сигнала по каждому из заданных для образцов каналов проводилась по графикам из отчета работы прибора Rotor-Gene 6000 при использовании Real-time PCR:

Для отрицательного образца

Фиг. 1. Канал FAM - искомая ДНК АЧС (фиолетовый цвет). Из исследуемых образцов не вышел. Регистрируется только сигнал контрольного образца (красный цвет).

Фиг. 2. Канал Су5 - внутренний контрольный образец специфики - ДНК АЧС (фиолетовый цвет) - выходят позже графика положительного контрольного образца (красный цвет), что говорит о незначительном ингибировании реакции.

Фиг. 3. Канал HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС (фиолетовый цвет). График экзогенного внутреннего контроля выделения и графики исследуемых образцов совпадают, что говорит, что реакция прошла успешно.

Для положительного образца

Фиг. 4. Канал FAM - искомая ДНК АЧС (синий цвет) - флуоресцентно сигнал начал накапливаться до 36 цикла, его можно считать положительным. Отрицательный контрольный образец не вышел - контаминации контроля нет.

Фиг. 5. Канал Су5 - внутренний контрольный образец специфики - ДНК АЧС (синий цвет) - накопление флуоресцентного сигнала достаточно, чтобы считать реакцию положительной. Черный график - отрицательный контрольный образец. Флуоресцирует благодаря наличию экзогенного контрольного образца, вносимого в пробирку на стадии выделения. Красный график - положительный контрольный образец.

Фиг. 6. Канал HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - накопления флуоресцентного сигнала достаточно, чтобы считать реакцию положительной. Черный график - отрицательный контрольный образец. Флуоресцирует благодаря наличию экзогенного контрольного образца, вносимого в пробирку на стадии выделения. Красный график – положительный.

Для сомнительного образца

Фиг. 7. Канал FAM - искомая ДНК АЧС (синий цвет) - по графику видно, что и отрицательный контрольный образец, и исследуемый образец вышли до 36 цикла, это говорит о возможной контаминации.

Фиг. 8. Канал Су5 - внутренний контрольный образец специфики - ДНК АЧС (синий цвет) - накопления флуоресцентного сигнала достаточно, чтобы считать реакцию положительной. Фиолетовый график - отрицательный контрольный образец. Флуоресцирует благодаря наличию экзогенного контрольного образца, вносимого в пробирку на стадии выделения. Красный график - положительный контрольный образец.

Фиг. 9. Канал HEX - внутренний контрольный образец выделения - синтетическая ДНК АЧС - накопления флуоресцентного сигнала достаточно, чтобы считать реакцию положительной. Фиолетовый график - отрицательный контрольный образец. Флуоресцирует благодаря наличию экзогенного контрольного образца, вносимого в пробирку на стадии выделения. Красный график - положительный контрольный образец.

При учете результата threshold (порог) устанавливали вручную на уровне 10% от максимального уровня флуоресценции в последнем цикле амплификации. Уровень threshold составил не более 0,02. Значения показателя «Ct» были на уровне 24-25. В положительных образцах кривая флуоресценции пересекает линию threshold и, в зависимости от интенсивности сигнала, возвышается над линией более или менее. В отрицательных образцах и отрицательном контроле флуоресценции не наблюдается, что отражается прямой детекции на уровне или ниже линии threshold.

Пример 1. Для анализа методом ПЦР были взяты 2 пробы тканей селезенки от свиней, признанных больными африканской чумой свиней, на основании ПЦР-исследований набором производства ГНУ ВНИИВВиМ, г. Покров. В процессе ПЦР в пробах были получены кривые флуоресценции, пересекающие линию threshold, при отсутствии таковой в отрицательном контроле. Это свидетельствует о воспроизводимости результатов проведенных опытов.

Пример 2. Применение реакции амплификации для выявления ДНК вируса африканской чумы свиней с использованием разработанных специфических олигонуклеотидных праймеров и зонда, входящих в тест-систему.

Для анализа методом ПЦР были взяты 6 проб тканей селезенки свиней. В процессе ПЦР во всех пробах были получены кривые флуоресценции, пересекающие линию threshold, при отсутствии таковой в отрицательном контроле. Значения показателя «Ct» составило от 32 до 36. Это свидетельствует о воспроизводимости результатов проведенных опытов.

Предложенная тест-система позволяет количественно выявлять на ранних стадиях высококонсервативную область гена VP72 вируса африканской чумы свиней. Применение олигонуклеотидного зонда позволяет повысить чувствительность и специфичность способа, исключить субъективность при оценке результатов. Использование предлагаемой модификации ПЦР позволяет значительно снизить возможность контаминации образцов, помещения, оборудования и реактивов, а также сократить сроки проведения анализа, что важно как для владельцев животных, так и для ветеринарных специалистов.

Предложенная тест-система апробирована с положительными результатами и регулярной воспроизводимостью этих результатов в 2016 году на 8 пробах тканей селезенки свиней, признанных больными африканской чумой свиней, на основании ПЦР-исследований набором производства ГНУ ВНИИВВиМ, г. Покров.

Работу проводили на базе ФГБОУ ВО «Краснодарский ГАУ».

Тест-система для обнаружения ДНК вируса африканской чумы свиней с помощью полимеразной цепной реакции в режиме реального времени, включающая пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, положительный контроль - рекомбинантную плазмиду, содержащую фрагмент гена vp72 вируса африканской чумы свиней, синтетические олигонуклеотидные праймеры и зонд, отличающаяся тем, что используют синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72, имеющие следующий нуклеитидный состав:

SEQ NO 1: 5'-CTG-CTC-ATG-GTA-TCA-ATC-3' - прямой праймер,

SEQ NO 2: 5'-GAT-ACC-ACA-AGA-TCG-CCG-3' - обратный праймер,

SEQ NO 3: 5'-FAM-CCA-CGG-GAG-GAA-TAC-CAA-CCC-AGT-G-BHQ1-3' - флуоресцирующий зонд и взятые при соотношении 1:1:0,5, при этом BHQ1 - темновой гаситель флуоресценции присоединен к 3'-концевому нуклеотиду, а РАМ - флуоресцентный краситель присоединен к нуклеотиду С, причем для постановки реакции используют 5-кратный буфер и в качестве отрицательного контроля используют дистиллированную воду.



 

Похожие патенты:

Изобретение относится к ветеринарной вирусологии, а именно к средствам диагностики африканской чумы свиней (АЧС). Изобретение позволяет повысить точность обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени.

Изобретение относится к области биологии и медицины. Предложен способ экстракции ДНК, пригодной для проведения количественной ПЦР в реальном времени, из сухих пятен цельной крови новорожденных, нанесенных на фильтровальную карточку для неонатального скрининга.

Изобретение относится к области биологии и медицины. Предложен способ экстракции ДНК, пригодной для проведения количественной ПЦР в реальном времени, из сухих пятен цельной крови новорожденных, нанесенных на фильтровальную карточку для неонатального скрининга.

Изобретение относится к биохимии. Описан способ обнаружения целевой нуклеиновой кислоты, полученной из последовательности ДНК Mycobacterium tuberculosis (ТВ) H37Rv, выбранной из группы, включающей IS6110, IS1084, МРТ 64, rrs, esat6, esat6-like, MDR, rpoB, katG, iniB и их фрагменты, у субъекта.

Изобретение относится к биохимии. Описан способ обнаружения целевой нуклеиновой кислоты, полученной из последовательности ДНК Mycobacterium tuberculosis (ТВ) H37Rv, выбранной из группы, включающей IS6110, IS1084, МРТ 64, rrs, esat6, esat6-like, MDR, rpoB, katG, iniB и их фрагменты, у субъекта.

Изобретение относится к области биотехнологии, а именно к способу одновременной детекции множества последовательностей нуклеотидов при проведении одной полимеразной цепной реакции.

Изобретение относится к области биохимии, в частности к способу обнаружения присутствия гена aad-12 в трансгенном растении сои, содержащем событие pDAB4472-1606. Также раскрыт набор для использования в указанном способе обнаружения присутствия или отсутствия гена aad-12 в геноме растения сои.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Настоящее изобретение относится к агробиотехнологии. Предложен набор синтетических олигонуклеотидов для выявления вируса крапчатости винограда (Grapevine fleck virus) с использованием метода полимеразной цепной реакции.

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha. Данное изобретение может найти применение в терапии. 4 ил.

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha. Данное изобретение может найти применение в терапии. 4 ил.

Изобретение относится к области медицины. Изобретение представляет собой набор специфичных олигонуклеотидных праймеров для видовой идентификации бактерий рода Acinetobacter и определения устойчивости к бета-лактамным антибиотикам, включающий: 2 пары олигонуклеотидных праймеров для амлификации гена rpoB, с нуклеотидными последовательностями atgcgtccaggcgagccaccaac, gcggctgaaa acttattcaa taac, tctg aacgctatga cttatc, atggtcgtgtttgtccaattgaa; 3 пары олигонуклеотидных праймеров для амлификации генов карбапенемаз ОХА-типа (оха-51 и оха-51-like), с нуклеотидными последовательностями gcaccataaggcaaccaccaca, aagtatttaaatgggatggg, agaatgggaaaagaacatgacc, ttggacttgagctcatgtctaag, gcaccataaggcaaccacccgg, aagtatttaaatgggatgcc; 2 пары олигонуклеотидных праймеров для амлификации гена карбапенемазы оха-23, с нуклеотидными последовательностями atctggtgtttaaaatgaataa, gattcatcaatactttgatgaa, tggaagggcgagaaaaggtcat, ggcaagggatataaaaccacaa; 2 пары олигонуклеотидных праймеров для амлификации гена карбапенемазы оха-40, с нуклеотидными последовательностями tgaagctcaaacacagggtgta, taaaaaaagaacttatcctatgtg, ccagtatatcaagagcttgcaag, ccttaaaattacaccagtacaagaag. Способ идентификации бактерий Acinetobacter и определения их устойчивости к бета-лактамным антибиотикам включает выделение ДНК из проб биоматериала или бактериальных культур и проведение ПЦР с синтетическими олигонуклеотидными праймерами, при этом используют предложенный набор олигонуклеотидных праймеров, и в случае обнаружения генов rpoB и оха-51 идентифицируют бактерий рода Acinetobacter, а при наличии генов оха-23 и оха-40, кодирующих карбапенемазы ОХА-23 и ОХА-40, делают вывод об устойчивости анализируемого штамма к антибактериальным препаратам бета-лактамного ряда. Изобретение позволяет идентифицировать бактерии Acinetobacter непосредственно в клиническом материале с одновременным определением устойчивости к карбапенемам ОХА-типа; а также может быть использован при выборе лекарственного препарата, режима лечения и для эпидемиологического контроля. 2 н.п. ф-лы, 2 табл.

Изобретение относится к областям молекулярной биологии и генетики растений, в частности к способу молекулярно-генетической идентификации растений березы на основе микросателлитных (SSR) локусов. Способ включает выделение ДНК из исследуемых образцов, проведение ПЦР, электрофоретическое разделение продуктов амплификации ДНК, документирование результатов ПЦР, определение длин амплифицированных фрагментов ДНК путем сравнения со стандартами молекулярной массы, получение таблицы многолокусных генотипов по микросателлитным локусам, сравнение полученных генотипов с генотипами исходных растений с целью установления идентичности особей и оценку вероятности встречаемости мультилокусных генотипов и случайного совпадения неродственных или родственных генотипов. Изобретение позволяет осуществлять надежную и достоверную идентификацию генотипов березы на индивидуальном уровне. Изобретение может быть использовано для широкого спектра видов рода Betula, являясь, таким образом, универсальным. 4 з.п. ф-лы, 3 табл., 4 ил.

Изобретение может быть использовано в ветеринарной практике и зоотехнии для диагностики четырех важных аллелей каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE). Предложен набор последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота путем проведения полимеразной цепной реакции в режиме реального времени, имеющих следующую структуру: 1 ил., 4 табл.

Изобретение может быть использовано в ветеринарной практике и зоотехнии для диагностики четырех важных аллелей каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE). Предложен набор последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота путем проведения полимеразной цепной реакции в режиме реального времени, имеющих следующую структуру: 1 ил., 4 табл.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития преэклампсии на основе комбинаций генов матриксных металлопротеиназ. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов. При выявлении сочетания аллеля С MMР-8 (rs11225395) и генотипа GG MMР-7 (rs11568818) прогнозируют низкий риск развития преэклампсии. Изобретение обеспечивает получение критериев оценки риска развития преэклампсии на основе генов матриксных металлопротеиназ. 3 ил., 3 пр.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития преэклампсии на основе комбинаций генов матриксных металлопротеиназ. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов. При выявлении сочетания аллеля С MMР-8 (rs11225395) и генотипа GG MMР-7 (rs11568818) прогнозируют низкий риск развития преэклампсии. Изобретение обеспечивает получение критериев оценки риска развития преэклампсии на основе генов матриксных металлопротеиназ. 3 ил., 3 пр.

Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования риска развития преэклампсии. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов цитокинов MMР-3, MMР-8 и MMР-12. Минимальный риск развития преэклампсии у женщин с наследственной отягощенностью прогнозируют при выявлении сочетания аллелей А MMР-8 (rs11225395), С MMР-8 (rs1320632), А MMР-12 (rs652438), а у женщин без наследственной отягощенности - при выявлении сочетания аллелей 6А MMР-3 (rs3025058), А MMР-8 (rs11225395), С MMР-8 (rs1320632). Изобретение обеспечивает получение критериев оценки риска развития преэклампсии у женщин с отягощенной и неотягощенной наследственностью. 4 ил., 8 пр.

Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования риска развития преэклампсии. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов цитокинов MMР-3, MMР-8 и MMР-12. Минимальный риск развития преэклампсии у женщин с наследственной отягощенностью прогнозируют при выявлении сочетания аллелей А MMР-8 (rs11225395), С MMР-8 (rs1320632), А MMР-12 (rs652438), а у женщин без наследственной отягощенности - при выявлении сочетания аллелей 6А MMР-3 (rs3025058), А MMР-8 (rs11225395), С MMР-8 (rs1320632). Изобретение обеспечивает получение критериев оценки риска развития преэклампсии у женщин с отягощенной и неотягощенной наследственностью. 4 ил., 8 пр.

Изобретение относится к области ветеринарной вирусологии, в частности к тест-системе для обнаружения ДНК особо опасного возбудителя африканской чумы свиней. Изобретение предназначено для повышения степени специфичности и чувствительности тест-системы, а также сокращения времени проведения диагностики при снижении вероятности технологических ошибок во время лабораторных манипуляциях. Тест-система для обнаружения ДНК вируса африканской чумы свиней с помощью полимеразной цепной реакции в режиме реального времени включает пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, положительный контроль - рекомбинантную плазмиду, содержащую фрагмент гена vp72 вируса африканской чумы свиней, синтетические олигонуклеотидные праймеры и зонд. Используют синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72 и имеющие следующий нуклеитидный состав: - прямой праймер, - обратный праймер, - флуоресцирующий зонд и взятые при соотношении 1:1:0,5, при этом BHQ1 - темновой гаситель флуоресценции присоединен к 3-концевому нуклеотиду, а FAM - флуоресцентный краситель присоединен к нуклеотиду С, причем для постановки реакции используют 5-кратный буфер и в качестве отрицательного контроля используют дистиллированную воду. 1 табл., 9 ил.

Наверх