Способ выявления мутаций, приводящих к резистентности у mycoplasma genitalium и mycoplasma pneumoniae к макролидным антибиотикам



Способ выявления мутаций, приводящих к резистентности у mycoplasma genitalium и mycoplasma pneumoniae к макролидным антибиотикам
Способ выявления мутаций, приводящих к резистентности у mycoplasma genitalium и mycoplasma pneumoniae к макролидным антибиотикам
Способ выявления мутаций, приводящих к резистентности у mycoplasma genitalium и mycoplasma pneumoniae к макролидным антибиотикам
Способ выявления мутаций, приводящих к резистентности у mycoplasma genitalium и mycoplasma pneumoniae к макролидным антибиотикам
Способ выявления мутаций, приводящих к резистентности у mycoplasma genitalium и mycoplasma pneumoniae к макролидным антибиотикам
C12N1/00 - Микроорганизмы, например простейшие; их композиции (лекарственные препараты, содержащие материал из микроорганизмов A61K 35/66; приготовление лекарственных составов, содержащих бактериальные антигены или антитела, например бактериальных вакцин A61K 39/00); способы размножения, содержания или консервирования микроорганизмов или их композиций; способы приготовления или выделения композиций, содержащих микроорганизмы; питательные среды

Владельцы патента RU 2646123:

Федеральное государственное бюджетное образовательное учреждение высшего образования "Смоленский государственный медицинский университет" Министерства здравоохранения Российской Федерации (RU)

Изобретение относится к медицине и биологии, в частности к диагностике, а именно: к ДНК-анализу, и может быть использовано для выявления мутаций резистентности к макролидным антибиотикам у Mycoplasma genitalium и Mycoplasma pneumonia, а именно в позициях 2058/2059 и 2611 23S рРНК. Для детекции мутаций разрабатывают два реверсных праймера для М. pneumoniae: Mpn2611-Rv AAGCAACACTCTTCAATCTTCC(T-BHQ1)А и Mpn2059-Rv3 ATCAATATTATGCTACAGTAAAGCT(T-BHQ1)CAG, а также два реверсных праймера для М. genitalium: Mge2611-Rev AGCAAAGCTCTTCAATCTTCC(T-BHQ1)G и Mge2059-Rv3 ATCAATATTATGCTACAGTAAAGCT(T-BHQ1)CACG. Применение предложенного способа позволяет снизить трудозатраты и время анализа за счет использования технологии ПЦР в режиме реального времени. 2 ил., 3 табл., 2 пр.

 

Изобретение относится к медицине и биологии, в частности к диагностике, а именно: к ДНК-анализу, и может быть использовано для выявления маркеров резистентности к макролидным антибиотикам у Mycoplasma genitalium и Mycoplasma pneumoniae. Известен способ выявления мутаций, приводящих к резистентности у Mycoplasma genitalium к макролидным антибиотикам, основанный на полимеразной цепной реакции в режиме реального времени (ПЦР-РВ) в варианте FRET и анализа кривых плавления, включающий: амплификацию и детектирование точечных мутаций с использованием пары праймеров и пары зондов. В одном из существующих на данный момент методов выявления мутаций, основанных на ПЦР-РВ, детектирование мутаций: A2058G, A2059G, А2058С-(согласно нумерации для Е. coli) осуществляется с помощью праймеров к гену 23S рРНК и зондов, которые содержат флуорофор на 5'-конце и гаситель на 3'-конце; связывание этого зонда с ампликоном и последующее расщепление за счет 5'-экзонуклеазной активности Taq-полимеразы сопровождается нарастанием флуоресценции. Выявление мутаций проводят с использованием постамплификационного анализа кривых плавления (Touati A1, Peuchant О, Jensen JS, , Pereyre S. Direct detection of macrolide resistance in Mycoplasma genitalium isolates from clinical specimens from France by use of real-time PCR and melting curve analysis. J Clin Microbiol. 2014 May; 52 (5): 1549-55).

Основные недостатки этого способа:

1. Не позволяет одновременно выявлять в этом же клиническом материале нуклеотидные замены в позиции 2611 в гене 23S рРНК М. genitalium и М. pneumoniae.

2. Не позволяет выявлять все возможные виды мутаций, метод детектирует наличие только трех: в позиции A2058G, A2059G и А2058С в гене 23S рРНК М. genitalium.

3. Не был адаптирован и апробирован для выявления мутаций к макролидным антибиотикам у М. pneumoniae.

Техническим результатом предлагаемого способа является выявление наличия мутаций в гене 23S рРНК М. genitalium и М. pneumoniae в клиническом материале пациента для выбора адекватной антибиотикотерапии и контроля эпидемиологического процесса.

Сущность предлагаемого способа состоит в том, что осуществляют выявление любых нуклеотидных замен в позициях 2058, 2059 и 2611 в гене 23S рРНК М. genitalium и М. pneumoniae с помощью ПЦР-РВ и последующего анализа кривых плавления зондов на двух каналах FAM и JOE, непосредственно в клиническом материале в мультиплексном формате (в одной пробирке), используя в реакции две пары праймеров и два зонда соответственно для каждого вида микоплазм. Система праймеров и зондов построена следующим образом: две пары праймеров к 5'-концевому фрагменту 23S рРНК и два зонда содержат различные флуоресцентные метки (R6G-меченный зонд) для выявления замен в позиции 2611 и (FAM-меченный зонд) для выявления замен в позиции 2058/2059, при этом о наличии в исследуемом образце однонуклеотидных замен судят по характерным пикам плавления, которые имеют меньшую температуру плавления относительно образцов, имеющих генотип WT-дикий тип.

Используемые зонды и праймеры удовлетворяют следующим требованиям:

1) 100% консервативность участков связывания во всех известных последовательностях 23S рРНК внутри детектируемых видов;

2) специфичность последовательностей для детектируемых видов;

3) длина от 22 до 29 нуклеотидов;

4) большее содержание С по сравнению с G;

5) отсутствие 4 последовательно расположенных G;

6) не более двух G/C на 3'-конце;

7) температура плавления зондов на 7-8°С выше температуры плавления праймеров;

Способ осуществляется следующим образом.

Образцы ДНК М. genitalium или М. pneumoniae выделяют из клинического материала (моча, урогенитальные и респираторные мазки, образцы тканей, мокрота, бронхоальвеолярный лаваж) и используют как мишень для последующего анализа.

Этап амплификации и одновременного детектирования флуоресцентного сигнала, а также последующий анализ кривых плавления ПЦР-продуктов проводят с помощью ДНК-амплификатора, работающего в режиме реального времени.

В пробирке смешивают реакционную смесь объемом 25 мкл: к воде добавляют олигонуклеотидные праймеры и зонды (синтез ЗАО «Синтол», Россия) в концентрации, указанной в таблице на Фиг. 1 и Фиг. 2, 0,2 мМ дНТФ, 2 мМ MgCl2, 5 ед. ДНК-полимеразы SNP-detect, 1х ПЦР буфер SNP detect (Evrogen, Россия) и 5 мкл образца ДНК. Используют специальную полимеразу SNP-detect с характеристиками, позволяющими с высокой точностью выявлять однонуклеотидные полиморфизмы, а также обеспечить горячий старт реакции. Амплификацию проводят с использованием прибора Rotor-Gene 6000 (Corbett Research, Австралия) согласно следующему протоколу: начальная инкубация 15 мин при 95°С; затем 55 циклов: 20 сек. денатурации при 95°С и 15 сек. отжига-элонгации при 55°С с детекцией флуоресценции на каналах FAM и JOE (R6G); затем проводят анализ кривых плавления с начальной инкубацией 2 мин при 45°С и последующим повышением температуры на 1°С каждые 10 сек. до 85°C с детекцией флуоресценции не только на канале FAM, но и на канале JOE (R6G). Для детекции мутаций в мультиплексном варианте в двух целевых участках гена 23S рРНК М. pneumoniae и М. genitalium, включающих позиции 2058-2059 и 2611, разрабатывают два реверсных праймера для М. pneumoniae: Mpn2611-Rv AAGCAACACTCTTCAATCTTCC(T-BHQ1) А и Mpn2059-Rv3 ATCAATATTATGCTACAGTAAAGCT(T-BHQ1)CAG, а также два реверсных праймера для М. genitalium: Mge2611-Rev AGCAAAGCTCTTCAATCTTCC(T-BHQ1)G и Mge2059-Rv3 ATCAATATTATGCTACAGTAAAGCT(T-BHQ1)CACG, которые в процессе реакции формируют цепь ДНК, комплементарную зонду. Эти праймеры располагаются непосредственно перед областью связывания зонда и содержат внутренний нефлуоресцирующий (темновой) гаситель флуоресценции (BHQ1). Для детекции целевой последовательности, располагающейся внутри участка связывания праймеров, разрабатывают два олигонуклеотидных зонда, содержащих флуорофоры (FAM и R6G) на 3'-конце и полностью комплементарные последовательностям 23S рДНК дикого типа, указанные в таблице на Фиг. 1 и Фиг. 2.

В соответствии с описанным выше дизайном, мутации в участках 23S рРНК выявляют с помощью постамплификационного анализа кривых плавления зондов: образцы, содержащие однонуклеотидные замены в области связывания зонда, характеризуются сниженной аффинностью и, соответственно, меньшей температурой плавления (Tm) зонда. В качестве целевого фрагмента для выявления мутаций выбирают специфичный участок, который характеризуется областью с высокой Г-Ц (гуанин-цитозин) насыщенностью и содержанием вторичных структур («сложное» генетическое окружение), окружающее полиморфизмы. Несмотря на «сложное» генетическое окружение способ выявляет различные (известные и неизвестные) мутации в заданных позициях. После этапа плавления зондов визуально оценивают полученные пики одновременно на двух детектируемых каналах FAM и JOE (R6G), сравнивают температуры плавления полученных пиков с контрольными образцами и делают вывод о наличии мутации в исследуемом образце: если на канале FAM исследуемый образец имеет Tm=62°С±0,3°С, это свидетельствует о наличии «дикого» фенотипа - без мутации; если Tm=52°С±0,3°С, это свидетельствует о наличии мутации A2058/2059G; если Tm=55°С±0,3°С, это свидетельствует о наличии мутации А2059С; если Tm=56,8°С±0,3°С, это свидетельствует о наличии мутации А2058С; если на канале JOE исследуемый образец имеет Tm=62°С±0,3°С, это свидетельствует о наличии «дикого» фенотипа - без мутации; если Tm=53°С±0,3°С, это свидетельствует о наличии мутации A2611G; если Tm=54,5°С±0,3°С, это свидетельствует о наличии мутации А2611Т, что отражено в таблице Фиг. 5.

Контрольные образцы ДНК М. pneumoniae и М. genitalium, несущие мутации A2058G и A2059G, дают одинаковые пики и характеризуются Tm=52,3°С±0,3°С, но хорошо дифференцируются от образцов «дикого типа» по температуре плавления зонда Mpn2058-Pb2 на 9,8°С. Контрольный образец, имеющий замену в позиции А2059С, имеет ΔTm=2,7°С, по сравнению с контрольным пиком A2058G/A2059G, и ΔTm=7,1°С по сравнению с образцом «дикого типа», а А2058С имеет ΔTm=4,5°С, по сравнению с контрольным пиком A2058G/A2059G, и ΔTm=5,3°С по сравнению с образцом «дикого типа». Анализ расчетных и экспериментальных Tm показывает, что значимые мутации в позициях A2058G/A2059G, А2059С и А2058С хорошо дифференцируются при скрининговом анализе, а также визуально отличаются от образцов «дикого типа». Таким образом, предложенный способ характеризуется хорошей дискриминирующей способностью, что согласуется с результатами, полученными для контрольных образцов.

Пример одновременного выявления различных мутаций устойчивости к макролидам в гене 23S рРНК М. pneumoniae и М. genitalium с помощью оценки кривых плавления флюоресцентно-меченных зондов после проведения мультиплексной ПЦР-РВ на канале FAM представлен на Фиг. 3. Пример одновременного выявления различных мутаций устойчивости к макролидам в гене 23S рРНК М. pneumoniae и М. genitalium с помощью оценки кривых плавления флюоресцентно-меченных зондов после проведения мультиплексной ПЦР-РВ на канале JOE (R6G) представлен на Фиг. 4. Разница в температуре плавления зонда Mpn2611-Pb для мутантного образца C2611G по сравнению с образцом дикого типа составляет 9,0°С. Визуально различимая ΔTm образцов, имеющих мутации и «дикого» фенотипа, указывает на хорошую дискриминирующую способность предложенного способа выявления мутаций к макролидным антибиотикам.

Пример 1. Пациент В., 35 лет, поступил на амбулаторный прием в кожно-венерологический диспансер (КВД) с жалобами на зуд, жжение и болезненность при мочеиспускании в области уретры. При объективном осмотре: кожные покровы наружных половых органов чистые, высыпаний нет. Отделяемое уретры скудное, светлое. Общее состояние пациента оценивалось как удовлетворительное. У пациента был взят соскоб из уретры для стандартных исследований. С использованием коммерческой системы методом ПЦР в режиме реального времени была выявлена ДНК М. genitalium. Пациенту назначена антибактериальная терапия: доксициклин по 100 мг 2 раза в день 10 дней.

Через 4 недели мужчина явился для контрольного обследования с аналогичными жалобами на зуд, жжение и болезненность в уретре. В результате ПЦР-исследования была повторно обнаружена ДНК М. genitalium. Терапия была изменена: джозамицин 500 мг 3 раза в день в течение 10 дней. Повторно пациент обратился на прием к врачу через 1,5 месяца, результаты анализа подтвердили положительный тест на М. genitalium, это указывало на отсутствие клинического эффекта терапии.

Врачи КВД передали клинические образцы для дополнительного анализа. Для более детального исследования клинического материала все три образца исследовались с применением разработанного способа выявления мутаций к макролидным антибиотикам. В результате исследования во всех образцах была выявлена мутация в 23S рРНК М. genitalium, характеризующаяся нуклеотидной заменой A2058G. Наличие замены подтверждено результатами секвенирования. Был сделан вывод о том, что пациент первично был заражен устойчивым к макролидам штаммом, но ввиду распространения в популяции (40-60%) устойчивости урогенитальных микоплазм к тетрациклинам стартовая терапия доксициклином была неэффективна, штамм сохранял свою жизнеспособность.

Пример 2. С целью расшифровки эпидемиологических особенностей вспышки пневмонии, вызванной М. pneumoniae у детей младшего школьного возраста в Хабаровске, был проведен дополнительный молекулярно-генетический скрининг клинического материала на выявление мутаций к макролидным антибиотикам. В связи с тем, что эти антибиотики являются препаратами выбора для терапии пациентов с инфекциями, вызванными М. pneumoniae, наличие маркеров резистентности может снизить эффективность терапии и привести к осложнениям. Из 30 обследованных пациентов, выделивших М. pneumoniae, 19 образцов (63%) продемонстрировали специфические пики плавления, характерные для фенотипа A2058/2059G. Это самый распространенный фенотип резистентности, характерный для вспышек такого рода. Результаты исследования были подтверждены секвенированием, все образцы имели профиль A2058G. Таким образом, антибактериальная терапия была скорректирована с учетом выявленных мутаций, это обеспечило быстрое выздоровление пациентов.

Предлагаемый способ был использован для быстрого выявления мутаций и прогнозирования возможной устойчивости респираторных микоплазм к макролидным антибиотикам, это является очень важным инструментом, особенно в случаях возникновения вспышек в организованных коллективах.

В модельных экспериментах по оценке аналитической чувствительности способа выявления мутаций с использованием разведений ДНК показано, что нижний предел обнаружения для М. genitalium и М. pneumoniae в присутствии избыточного количества ДНК человека (200 нг) составляет не менее 500 геном-эквивалентов на реакцию. При этом неспецифическая амплификация отсутствует при исследовании типичной урогенитальной и респираторной флоры.

Для оценки клинической чувствительности и специфичности предложенного способа проведен параллельный анализ 450 урогенитальных образцов и 223 респираторных образцов. Для всех образцов получены типичные профили плавления зондов Mge2611-Pb и Mpn2611-Pb «дикого типа». Специфические последовательности 23S рРНК М. genitalium были обнаружены в 436 образцах (относительная чувствительность 97%) и М. pneumoniae в 218 образцах (относительная чувствительность 97,8%).

Предлагаемый способ выявления мутаций к макролидным антибиотикам у Mycoplasma genitalium и Mycoplasma pneumoniae с помощью ПЦР-РВ с эффектом гашения флуоресценции зонда праймером обеспечивает следующие преимущества:

1. Позволяет выявлять любые нуклеотидные замены в позициях 2058, 2059 и 2611 в гене 23S рРНК Mycoplasma genitalium и Mycoplasma pneumoniae с помощью анализа кривых плавления зондов непосредственно после проведения амплификации в мультиплексном формате с использованием уникальных праймеров и зондов.

2. Благодаря высокой чувствительности и специфичности может использоваться не только для анализа культивированных штаммов, но и для прямой диагностики в образцах клинического материала.

3. Может являться дополнительным инструментом в тактике подбора адекватной терапии, особенно в случаях возникновения вспышек в организованных коллективах, вызванных Mycoplasma pneumoniae.

4. Предложенный способ может быть использован для прогнозирования возможной устойчивости к антибиотикам при наличии неуспехов терапии.

5. Позволяет снизить трудозатраты и время анализа за счет использования технологии ПЦР в режиме реального времени.

Способ выявления мутаций, приводящих к резистентности у Mycoplasma genitalium и Mycoplasma pneumoniae к макролидным антибиотикам, включающий амплификацию выделенной ДНК исследуемого образца, ПЦР-амплификацию мишени: 2058 и 2059 позиции гена 23S рРНК Mycoplasma genitalium, оценку кривых плавления зондов на детектируемом канале FAM, отличающийся тем, что в реакционную пробирку в мультиплексном варианте добавляют пару праймеров и один зонд для каждой позиции М. pneumoniae и М. genitalium. Для детекции мутаций в мультиплексном варианте в двух целевых участках гена 23S рРНК М. pneumoniae и М. genitalium, включающих позиции 2058-2059 и 2611, добавляют два реверсных праймера для М. pneumoniae: Mpn2611-Rv AAGCAACACTCTTCAATCTTCC(T-BHQ1)А и Mpn2059-Rv3 ATCAATATTATGCTACAGTAAAGCT(T-BHQ1)CAG, а также два реверсных праймера для М. genitalium: Mge2611-Rev AGCAAAGCTCTTCAATCTTCC(T-BHQ1)G и Mge2059-Rv3 ATCAATATTATGCTACAGTAAAGCT(T-BHQ1)CACG; для детекции целевой последовательности, располагающейся внутри участка связывания праймеров, разрабатывают два олигонуклеотидных зонда, содержащих флуорофоры (FAM и R6G) на 3'-конце и полностью комплементарные последовательностям 23S рДНК дикого типа, содержащих флуорофоры (FAM и R6G) для каждой детектируемой мишени 2058, 2059, а также 2611 позиции гена 23S рРНК Mycoplasma genitalium или Mycoplasma pneumoniae, проводят амплификацию ДНК-мишени с последующим этапом плавления зондов, при этом визуально оценивают полученные пики одновременно на двух детектируемых каналах FAM и JOE (R6G), сравнивают температуры плавления полученных пиков с контрольными образцами и делают вывод о наличии мутации в исследуемом образце: если на канале FAM исследуемый образец имеет Tm = 62°С±0,3°С, это свидетельствует о наличии «дикого» фенотипа - без мутации; если Tm = 52°С±0,3°С, это свидетельствует о наличии мутации A2058/2059G; если Tm = 55°С±0,3°С, это свидетельствует о наличии мутации А2059С; если Tm = 56,8°С±0,3°С, это свидетельствует о наличии мутации А2058С; если на канале JOE (R6G) исследуемый образец имеет Tm = 62°С±0,3°С, это свидетельствует о наличии «дикого» фенотипа - без мутации; если Tm = 53°С±0,3°С, это свидетельствует о наличии мутации A2611G; если Tm = 54,5°С±0,3°С, это свидетельствует о наличии мутации А2611Т.



 

Похожие патенты:

Изобретение относится к области биохимии. Описана группа объектов, включающая способ определения бактерии вида Dickeya solani методом петлевой изотермической амплификации (LAMP) и набор праймеров для определения бактерии вида Dickeya solani методом петлевой изотермической амплификации (LAMP).

Изобретение относится к области биохимии. Описан способ дифференциации штаммов Yersinia pestis на основной и неосновные подвиды методом ПЦР в режиме реального времени.

Изобретение относится к области биотехнологии, конкретно к бис-Met-гистонам, и может быть использовано в медицине. Молекула нуклеиновой кислоты кодирует полипептид, состоящий из двух остатков метионина в качестве первого и второго N-концевых аминокислотных остатков, соединенных через пептидную связь со зрелым эукариотическим гистоном H1.
Изобретения относятся к экологии. Биологически активный препарат, ускоряющий минерализацию останков, включает смесь спор непатогенных бактерий, принадлежащих к виду Bacillus, причем дополнительно включает компонент, сдерживающий влагу - глинистый нетоксичный минерал, способный разбухать при гидратации в 14-16 раз, питательные вещества, витамины, микроэлементы и источник тепловой активации для поддержания жизнедеятельности непатогенных бактерий в виде пероксида калия K2O2 и/или пероксида натрия Na2O2.
Изобретение относится к сельскому хозяйству. Осуществляют обеспечение питания корневой системы растения посредством воспроизведения в субстрате, предназначенном для выращивания растений, ассоциативного симбиоза композиции микробиологических инокулянтов и живой биомассы зеленых микроводорослей, либо сине-зеленых микроводорослей, либо комбинации зеленых и сине-зеленых микроводорослей, обеспечивающего воспроизведение в субстрате процесса кислородно-углеродного цикла аналогично происходящему в условиях естественного почвенного биоценоза.
Изобретение относится к сельскому хозяйству. Осуществляют активацию субстратов посредством воспроизведения в субстрате, предназначенном для выращивания растений, ассоциативного симбиоза композиции микробиологических инокулянтов и живой биомассы зеленых микроводорослей, либо сине-зеленых микроводорослей, либо комбинации зеленых и сине-зеленых микроводорослей, обеспечивающего воспроизведение в субстрате процесса кислородно-углеродного цикла аналогично происходящему в условиях естественного почвенного биоценоза.

Изобретения относятся в целом к микробным инокулянтам. Микробный инокулянт для использования в увеличении роста растений, продуктивности растений и/или качества почвы содержит штаммы двух или более видов бактерий, выбранных из Lactobacillus parafarraginis, Lactobacillus buchneri, Lactobacillus rapi и Lactobacillus zeae.

Изобретение относится к области биотехнологии, конкретно к молекулярной биологии и генетике. Заявлен набор последовательностей нуклеотидов, который может быть использован для диагностики частых у жителей РФ делеций гена DMD, ответственного за мышечную дистрофию Дюшена/Беккера, исходя из частот мутаций среди пациентов - жителей Российской Федерации.

Изобретение относится к биохимии и области медицинской микробиологии. Описан способ подвидовой дифференциации штаммов возбудителя чумы Yersinia pestis.

Изобретение относится к ветеринарной гельминтологии и предназначено для диагностических исследований фекалий рогатого скота на наличие круглых гельминтов в личиночной стадии развития и их идентификации.

Изобретение относится к медицинской технике и может быть использовано для формирования канала в биологических мягких тканях, например, дренажного канала в склерокорнеальной зоне глаза.

Изобретение относится к медицинской технике и применяется для визуализации игл при биопсии. Ультразвуковая система содержит: 3D ультразвуковой зонд для визуализации, включающий в себя двумерный матричный датчик; игольную направляющую, присоединяющуюся к зонду для визуализации с заранее заданной ориентацией относительно зонда для визуализации.

Группа изобретений относится к медицине, в частности к нейрофизиологии и психофизиологии, и касается микрозабора эндогенных веществ из одной структуры и последующего выведения их в другую структуру мозга.

Изобретение относится к медицине, урологии. Перед взятием биопсийного материала из мочевого пузыря вводят цистоскоп.

Изобретение относится к области обработки данных и медицины, а именно к нейроонкологии. Способ включает следующие этапы, на которых получают изображение исследуемого участка ткани, полученное в ходе проведения флуоресцентной диагностики и фиксированное с помощью монохромной и цветной видеокамер.
Изобретение относится к медицине, в частности к способу диагностики заболеваний, включающему анкеты-опросники, и может использоваться для диагностики первичного гиперпаратиреоза.

Изобретение относится к медицине, а именно к общей хирургии, травматологии, ортопедии и гнойной хирургии. Через введенный в полость сустава троакар осуществляют забор биоматериалов для исследований посредством поочередного выполнения эвакуации суставного аспирата с помощью шприца через центральный канал троакара.
Изобретение относится к медицине, а именно к акушерству и гинекологии, паразитологии, венерологии, медицинской микробиологии, гематологии, и может быть использовано для диагностики урогенитального трихомониаза.

Изобретение относится к медицинской технике, а именно к биопсийным устройствам. Устройство содержит стержень и трубчатый элемент.
Изобретение относится к медицине, а именно к гинекологии. Предварительно под контролем лапароскопа при горизонтальном положении тела пациентки на операционном столе исключают возможные патологические изменения в брюшной полости. Затем выполняют функциональную пробу, для чего выполняют перемещение операционного стола, во время которого приподнимают верхнюю и опускают нижнюю части тела пациентки, создавая поддиафрагмальный пневмоперитонеум, определяют состоятельность стенок и клапанного аппарата яичниковых вен. Способ позволяет обеспечить повышение точности определения скрытых форм варикозной болезни вен, интраоперационно оценить повреждения вен малого таза и оценить результаты оперативного лечения, а также предупреждает вероятность рецидива хирургического лечения и повторное оперативное вмешательство. 1 з.п. ф-лы, 2 пр.

Изобретение относится к медицине и биологии, в частности к диагностике, а именно: к ДНК-анализу, и может быть использовано для выявления мутаций резистентности к макролидным антибиотикам у Mycoplasma genitalium и Mycoplasma pneumonia, а именно в позициях 20582059 и 2611 23S рРНК. Для детекции мутаций разрабатывают два реверсных праймера для М. pneumoniae: Mpn2611-Rv AAGCAACACTCTTCAATCTTCCА и Mpn2059-Rv3 ATCAATATTATGCTACAGTAAAGCTCAG, а также два реверсных праймера для М. genitalium: Mge2611-Rev AGCAAAGCTCTTCAATCTTCCG и Mge2059-Rv3 ATCAATATTATGCTACAGTAAAGCTCACG. Применение предложенного способа позволяет снизить трудозатраты и время анализа за счет использования технологии ПЦР в режиме реального времени. 2 ил., 3 табл., 2 пр.

Наверх