Набор последовательности праймеров и аллельспецифических зондов для одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота

Изобретение может быть использовано в ветеринарной практике и зоотехнии для диагностики четырех важных аллелей каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE). Предложен набор последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота путем проведения полимеразной цепной реакции в режиме реального времени, имеющих следующую структуру:

1 ил., 4 табл.

 

Изобретение относится к области молекулярной генетики и может быть использовано в ветеринарной практике и зоотехнии для диагностики четырех важных аллелей каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE). Предложенный способ и тест-система для его осуществления позволяют одновременно идентифицировать четыре аллеля в локусе каппа-казеина с помощью ПЦР в режиме реального времени (ПЦР-РВ) на основе праймеров и аллель-специфических зондов.

У крупного рогатого скота известно 15 вариантов каппа-казеина, однако в силу лабораторных возможностей наиболее часто выявлялись CNA и CNB аллеля (Prinzenberg Е.М. et al., 1999; Strzalkowska N. et al., 2002). Установлено, что CNB аллель принимает участие в формировании устойчивости к температурному режиму белков молока, сокращению времени коагуляции, лучшему створаживанию и формированию мицелл различных размеров, которые наиболее приемлемы для изготовления сыра (Мао I.L. et al., 1992; Prinzenberg Е.М. et al., 1999). Выход сыра из молока коров с κ-CNBB генотипом на 10% выше по сравнению с κ-CNAA вариантом. Наличие κ-CNB аллели способствует не только увеличению выхода сыра и улучшению его качества, он еще коррелирует с другими ценными параметрами молочной продуктивности (содержанием белка в молоке и молочной продуктивностью). Влияние κ-CNB аллеля на содержание белка в молоке показано на многих породах, включая черно-пеструю голштинизированную и даже гибридов зебу х черно-пестрая. Данное положение может быть объяснено явлением, вызываемым замещением аминокислот в белке из-за мутаций в IV экзоне каппа-казеинового гена. Поэтому отбор животных по κ-CNB аллелю интегрирован в селекционные программы молочного скота многих стран мира (Marziali A.S., Ng-Kwai-Hang K.F., 1986; Fox P.F., 1992; Freyer G. et al, 1999; Lunden A., Afforselles J., 2000; Амерханов X.A., Марзанов H.C., 1999; Марзанов H.C. и др., 2010; 2014).

В Российской Федерации племенных животных тестируют на носительство только двух аллелей каппа-казеина (κ-CNA, κ-CNB), а результаты в обязательном порядке, наряду с группами крови и мутантными аллелями, вызывающими наследственные болезни, регулярно публикуют в каталогах по племенным быкам (Шапочкин В.В., Ескин Г.В., 2004; Савенко Н.А. и др., 2007; Ескин Г.В. и др., 2010; 2014-2015).

В открытой печати есть ряд работ, в которых предложены не только методы диагностики, но и показано, что качество молока от животных с κ-CNB аллелем лучше, чем с κ-CNA (Rahali V., Menard J.L., 1991), κ-CNC (Macheboeuf D. et al., 1993) и κ-CNE (Gravert H.О. et al., 1991). Знание точковых мутаций, по которым различаются данные аллели, позволило разработать ПЦР-ПДРФ методы их выявления для κ-CNA и κ-CNB (Denicourt D. et al., 1990; Medrano J.F., Aguilar-Cordova E., 1990; Zadworny D., Kuhnlein U., 1990), κ-CNC (Schlee P., Rotmann O., 1992) и κ-CNE (Schlieben S. et al., 1991). Однако диагностика при раздельном их выявлении занимает много времени. Orita М. et al. (1989) опубликовали, как они считали в то время, простой метод для определения мутаций ДНК и назвали его «Метод определения однонитевого конформационного полиморфизма ДНК (PCR-single strand conformation polymorphism, PCR-SSCP). Метод позволял выявлять наличие нуклеотидных замен, делеций и инсерций на протяжении всей длины амплифицированного продукта. Метод PCR-SSCP заключается в следующем: продукт амплификации денатурируют и полученные однонитевые молекулы разделяют с помощью электрофореза в полиакриламидном геле. Любая, даже однонуклеотидная замена приводит к изменению заряда и, как следствие, изменению конформации однонитевого фрагмента и его электрофоретической подвижности в геле, что дает возможность выявлять полиморфные варианты. Однако этот метод не позволяет определить, какие именно изменения произошли? Поэтому метод PCR-SSCP часто проводят вместе с последующим секвенированием.

Таким образом, в молекулярной генетике существует очевидная потребность в оценке наиболее часто встречаемых четырех аллелей каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE). Кроме того, из-за незнания этих вопросов, закупаемый племенной материал не тестируют на κ-CNA, κ-CNB, κ-CNC, κ-CNE аллели, в результате происходит засорение российских пород крупного рогатого скота нежелательными генотипами по каппа-казеину.

Из технического уровня известен генетический тест для идентификации двух аллелей каппа-казеина (κ-CNA, κ-CNB) крупного рогатого скота (Патент на изобретение №2386700, опубликован 20.04.2010). Данное изобретение принято в качестве ближайшего аналога.

Отличительной особенностью заявленного изобретения от выявленного аналога является возможность определения сразу четырех наиболее часто встречаемых аллелей (κ-CNA, κ-CNB, κ-CNC, κ-CNE), т.е. идет одновременное определение четырех вариантов по методике ПЦР в реальном времени (ПЦР-РВ), с помощью праймеров и аллель-специфических зондов, зная точки мутаций, при этом подход детекции принципиально иной. Кроме того, по имеющемуся патенту возможно выявление только двух аллелей (κ-CNA, κ-CNB), что недостаточно в современных условиях оценки технологических возможностей животного, поскольку под κ-CNA аллелью скрываются практически все его известные варианты каппа-казеина. В качестве примера приведем результаты аттестации племенного быка Смайл 91941 англерской породы на каппа-казеин. При диаллельном (κ-CNA, κ-CNB) его анализе он имел бы генотип κ-CNAA, в то же время по предлагаемому нами методу на самом деле, у него κ-CNAC гетерозигота. Таким образом, κ-CNA аллель как бы скрывает засорение стад и пород крупного рогатого скота другими своими производными, в частности κ-CNC и κ-CNE, которые являются наиболее встречаемыми и ухудшателями качества молока на сыропригодность у разводимого молочного скота.

В заявленном изобретении осуществляется идентификация полиморфизма в локусе каппа-казеина с помощью ПЦР-РВ и использованием TaqMan зондов. В ближайшем аналоге диагностируют каппа-казеин, с использованием электрофоретического метода детекции, что является принципиально другим методом диагностики данного полиморфизма и занимает больше времени, необходимого оборудования и реактивов.

Целью настоящего изобретения является создание способа одновременной диагностики четырех аллелей (κ-CNA, κ-CNB, κ-CNC, κ-CNE) с помощью ПЦР в реальном времени (ПЦР-РВ) и разработка тест-системы для его осуществления с использованием наборов олигонуклеотидов-праймеров и зондов, имеющих специфические последовательности.

Предлагаемый к патентованию набор праймеров и зондов в сравнении со всеми изученными аналогами имеет следующие преимущества:

специфическая структура праймеров и зондов, а также с помощью предлагаемого к патентованию набора праймеров и зондов можно одновременно в одной пробирке провести полимеразную цепную реакцию в режиме реального времени (ПЦР-РВ), что обеспечивает быстроту проведения диагностики и получение результата сразу по четырем наиболее часто встречаемым аллелям (κ-CNA, κ-CNB, κ-CNC, κ-CNE).

В настоящем изобретении представлен способ одновременной диагностики четырех аллелей у различных пород крупного рогатого скота. Тест-система разработана для аттестации всех половозрастных групп животных: быков-производителей, быковоспроизводящих групп коров, ремонтного молодняка, а также семени из спермобанка и эмбрионов.

Техническим результатом заявленного изобретения является возможность диагностики одновременно четырех аллелей (κ-CNA, κ-CNB, κ-CNC, κ-CNE); сокращение времени выполнения полимеразной цепной реакции в реальном времени (ПЦР-РВ) (через 3 часа получен результат); нетрудоемкость; возможность выполнять повторности; проводить контроль правильности исследования.

Указанный технический результат достигается тем, что проводят выделение ДНК из биологического материала, постановку полимеразной цепной реакции в режиме реального времени с использованием реактивов. Реактивы в виде трех комплектов. Каждый комплект состоит из компонентов (реакционная смесь, разбавитель и полимераза), которые необходимо смешать в нужном объеме непосредственно перед проведением исследования.

При подготовке к проведению реакции рассчитывают необходимый объем компонентов, исходя из количества исследуемых образцов плюс 4, из которых три положительных контрольных образца и один отрицательный контрольный образец для каждой реакционной смеси. Реактивы смешивают, затем в подготовленные для ПЦР пробирки вносят по 20 мкл приготовленной ПЦР-смеси, в каждую ПЦР пробирку добавляют по 5 мкл контрольных и исследуемых образцов. Пробирки помещают в амплификатор. Отжиг праймеров происходит на этапе циклирования при 64°С в течение 30 с при числе циклов амплификации, равном 40. Анализ полученных данных проводят путем сравнения амплифицированных участков генов, результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией.

Тест-система содержит 3 реакционных смеси (50 мМ KCl, 50 мМ TRIS-НСl, 250 нМ dNTP, 2,5 мМ MgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 нМ), разбавитель - деионизированная вода 1 мл, 2,5 ед. Taq ДНК-полимеразы, а также 3 положительных контрольных образца, один отрицательный контрольный образец - для каждой реакционной смеси. Праймеры и флуоресцентно-меченные олигонуклеотидные пробы имеют следующие последовательности:

Экспериментально установлен оптимальный состав реакционной смеси для проведения полимеразной цепной реакции в режиме реального времени, подобрано сочетание праймеров, необходимое и достаточное соотношение компонентов реакционной смеси и определен режим постановки ПЦР, что является важным при проведении ПЦР-анализа. Система рассчитана на проведение 100 реакций объемом 25 мкл (20 мкл реакционной смеси +5 мкл исследуемого образца).

Подбор праймеров и аллель-специфических зондов (табл. 1) проводили при помощи пакета прикладных программ «Oligo 6.0» на основании анализа нуклеотидных последовательностей локуса каппа-казеина, опубликованных в базе данных Национального центра биотехнологической информации США (NCBI - National Center for Biotechnology Information USA).

Источником для проведения диагностики служит предварительно выделенная ДНК из образцов биологического материала (цельной крови, спермы, эмбрионов, молока или кожи).

Выделение ДНК проводили сорбентным методом (ДНК-сорб-В, ФБУН ЦНИИ эпидемиологии Роспотребнадзора, Москва). Далее выделенную ДНК использовали в реакции: 5 мкл образца добавляют к реакционной смеси ПЦР.

Реакционная смесь для ПЦР-анализа имеет следующий состав: 50 мМ KCl, 50 мМ TRIS-HCl, 25 мМ dNTP, 250 мМ MgCl2, 2,5 ед. Taq ДНК-полимеразы, праймеры в концентрации 200 нМ, флуоресцентные зонды - в концентрации 100 нМ, при этом праймеры и флуоресцентно-меченные олигонуклеотидные пробы имеют определенные специфические последовательности (табл. 1).

Подготовку к проведению реакции осуществляли следующим образом.

Необходимый объем компонентов рассчитывали исходя из количества исследуемых образцов плюс 4 (три положительных контрольных образца и один отрицательный контрольный образец) для каждой из трех реакционных смесей. Набор компонентов для реакции представлен в табл. 2.

Примечание: * - содержит все необходимые компоненты для проведения ПЦР-РВ. Условия хранения: №1-3, при температуре -16-20°С.

Компоненты размораживали, перемешивали и центрифугировали. Готовили смесь компонентов, добавляя их в порядке, указанном в табл. 3.

ПЦР пробирки маркировали. В подготовленные для ПЦР пробирки вносили по 20 мкл смеси компонентов. Затем в каждую ПЦР пробирку вносили по 5 мкл контрольных и исследуемых образцов в соответствии с маркировкой, перемешивали многократным пипетированием и плотно закрывали крышку. Пробирки помещали в амплификатор, затем программировали работу прибора.

Профиль реакции:

1. Удержание температуры 94°С - 3 мин, один повтор.

2. Циклирование 1 (без детекции)

94°С - 20 сек

61°С - 20 сек

64°С - 30 сек

Цикл повторяли 10 раз.

3. Циклирование 2 (с детекцией)

94°С - 20 сек

61°С - 20 сек

64°С - 30 сек - детекция по каналам: Green, Yellow

Цикл повторяли 30 раз.

В процессе циклирования отжиг праймеров и синтез новой цепи ДНК происходил при температуре 64°С. При первом циклировании детекцию не проводили, так как данные не репрезентативны. При втором циклировании проводили 30 повторов, в результате получали стабильные данные, которые являются окончательными в плане диагностики генотипов.

Создание шаблона ПЦР-РВ, а также анализ результатов исследования осуществляли при помощи программного обеспечения «Rotor-Gene 6000 1.8» к прибору Rotor Gene Q (Corbett Research, Австралия).

Результатом анализа является определение сочетания четырех аллелей гена каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE) у крупного рогатого скота.

Интерпретацию результатов анализа исследуемых образцов проводили в соответствии с табл. 4.

Примечание: PC1, РС2, РС3 - реакционные смеси 1, 2, 3, содержащие флуоресцентно-меченные олигонуклеотидные пробы со следующими азотистыми основаниями: аденин (А), цитозин (С), гуанин (G), используемые для диагностики генотипов и аллелей в локусе каппа-казеина; Green и Yellow - каналы флуоресценции в приборе Rotor Gene Q (Corbett Research, Австралия), по которым определяются генотипы и аллели в локусе каппа-казеина.

Для достоверного результата анализа должны выполняться следующие условия:

1. Результат реакции для ПКО1 должен быть положительным по каналу Green, отрицательным по каналу Yellow.

2. Результат реакции для ПКО2 должен быть положительным по каналам Green и Yellow.

3. Результат реакции для ПКО3 должен быть положительным по каналу Yellow, отрицательным по каналу Green.

4. Результат реакции для ОКО должен быть отрицательным по обоим каналам.

В случае получения положительных результатов для ОКО по любому из каналов детекции результаты исследования считаются недействительными. Требуется предпринять меры по выявлению и ликвидации источника контаминации и провести повторный анализ.

Результат анализа для образца считается неопределенным, если реакция по каналам Green и Yellow отрицательная. В этом случае необходимо повторное исследование образца.

В заявленном изобретении использована технология дифференциации аллелей с помощью олигонуклеотидных проб. При использовании флуоресцентно-меченных олигонуклеотидных проб для различения однонуклеотидных полиморфизмов (ОНП) применяют подход, основанный на различии в эффективности гибридизации аллель-специфичных проб на каждом цикле ПЦР. Используют пару гибридизационных проб для каждой реакционной смеси, специфичных для каждого аллельного варианта, меченных разными флуорофорами и разрушаемых в ходе ПЦР за счет 5' - экзонуклеазной активности Taq - полимеразы. Детекция каждого из аллелей основана на различии в эффективности гибридизации пробы на каждом цикле ПЦР с полностью комплементарным пробе аллелем и аллелем с заменой одного нуклеотида. Поскольку только гибридизованные пробы разрушаются ферментом, накопление сигнала пропорционально эффективности гибридизации. Различие в эффективности гибридизации проб очень незначительно, однако эта небольшая разница накапливается от цикла к циклу и в итоге позволяет достоверно различать аллели.

Результаты интерпретируются на основании наличия или отсутствия пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией. В качестве примера рассмотрен образец №1 κ-CN (табл. 4, рис. 1).

Результатом реакции являются кривые накопления флуоресцентного сигнала, пересекающие пороговую линию. Для РС1 на рисунке присутствует две кривые, пересекающие пороговую линию, что соответствует гетерозиготе АС. Для РС2 на рисунке присутствует одна кривая пересекающая пороговую линию, что соответствует дикому типу или гомозиготе AG. Для РС3 на рисунке присутствует две кривые, пересекающие пороговую линию, что соответствует гетерозиготе GA. Совокупность результатов по трем реакционным смесям позволяет сделать вывод о принадлежности испытуемого образца к генотипу к-CNAC.

Основными преимуществами заявляемого изобретения являются:

1. Одновременная аттестация элитных животных различных пород крупного рогатого скота по четырем аллелям (κ-CNA, κ-CNB, κ-CNC, κ-CNE) при помощи заявленной тест-системы позволит целенаправленно формировать аллелофонд быков-производителей, быковоспроизводящих групп коров, ремонтный молодняк, а также накапливать племенной материал (банк семени и эмбрионов).

2. Наличие генетического паспорта по четырем аллелям каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE), а также тест-системы для его осуществления позволит эффективно вести селекционную работу в племенных стадах крупного рогатого скота Российской Федерации.

3. При завозе племенного материала в Российскую Федерацию из-за рубежа обязательно наличие генетического паспорта по четырем аллелям каппа-казеина (κ-CNA, κ-CNB, κ-CNC, κ-CNE). С целью подтверждения генотипа по каппа-казеину, закупленные животные после карантина должны пройти повторную аттестацию.

Литература

1. Амерханов Х.А., Марзанов Н.С. Генетики смотрят в будущее // Племенное дело. - 1999. - №1. - С. 7-9.

2. Каталог быков-производителей ОАО «Головной центр по воспроизводству сельскохозяйственных животных» / под ред. Ескина Г.В. Быково. - 2010. - 36 с.

3. Каталог быков-производителей ОАО «Головной центр по воспроизводству сельскохозяйственных животных» / Ескин Г.В. и др. Быково. - 2014-2015. - 36 с.

4. Марзанов Н.С, Родригез К.С., Иолчиев Б.С., Тохов М.Х., Саморуков Ю.В., Скок Н.М., Марзанова Л.К., Амерханов Х.А. Генетические особенности гибридов зебу х крупный рогатый скот по полиморфным системам белков крови и молока // Доклады РАСХН. - 2010. - №4. - С. 38-43.

5. Марзанов Н.С., Ескин Г.В., Турбина И.С., Попов Н.А., Попов А.Н., Марзанова Л.К., Тохов М.Х., Петров С.Н., Гетоков О.О., Начоев Х.Х., Дохова З.Л., Лось Н.Ф., Марзанова С.Н. Использование генной технологии для характеристики коров бурой швицкой породы, разводимой в предгорной зоне Северного Кавказа. Методическое пособие. Москва. ФГБНУ «Росинформагротех». - 2014. - 53 с.

6. Савенко Н.А., Бошляков В.Н., Жуков В.Ф. и др. Каталог быков-производителей ОАО «Московское» по племенной работе. - Москва: МСХиП МО. - 2007. - 104 с.

7. Шапочкин В.В., Ескин Г.В. Каталог быков-производителей ФГУП «ЦСИО». Подольск. - 2002. - 51 с.

8. Denicourt, D., Sabour M.P., McAllister A.J. Detection of bovine k-casein genomic variants by the polymerase chain reaction method // Anim. Genet. - 1990. - Vol. 21. - P. 215-216.

9. Fox P.F. Advanced Dairy Chemistry Proteins. London: Elsevier Science Publisher. - 1992. - Vol. 1.

10. Freyer G., Liu Z., Erhardt G., Panicke L. Casein polymorphism and between milk production traits // J. Anim. Breed Genet. - 1999. - Vol. 116. - P. 87-97.

11. Gravert, H.O., Schulte-Coerno H., Oloffs K. The relevance of k-casein for genetic differences in cheesemaking properties. Paper presented at Specialists mtg of the Int. Circle of Dairy Research Leaders on Genetic Polymorphism of Milk Proteins. April 11-12, 1991. Laboratory of Dairy Science, Swiss Federal Institute of Technology, Zurich. - 1991.

12. Lunden A., Afforselles J. Gene frequency of κ-casein in Swedish Red and White breeding bulls // Animal Genomics: Synthesis of Past, Present, and Future Directions. 27th International Conference on Animal Genetics. Minnesota. USA. - 2000. - P. 84.

13. Macheboeuf D., Coulon J.B., D'Hour P. Effect of breed, protein genetic variants and feeding on cows' milk coagulation properties // J. Dairy Res. - 1993. - Vol .60. - P. 43-54.

14. Mao I.L., Buttazzoni L.G., Aleandri R. Effects of polymorphic milk protein genes on milk yield and composition traits in Holstein cattle // Acta Agric. Scand. - 1992. - Vol. 42. - P. 1-7.

15. Marziali A.S., Ng-Kwai-Hang K.F. Effects of milk composition and genetic polymorphism on cheese composition // J. Dairy Sci. - 1986. - Vol. 69. - P. 2533-2542.

16. Medrano J.F., Aguilar-Cordova E. Genotyping of bovine k-casein loci following DNA sequence amplification // Bio/Technology. - 1990. - Vol. 8. - P. 144-146.

17. Orita M., Suzuki Y., Sekiya Т., Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction // Genomics. - 1989. - Vol. 5. - P. 874-879.

18. Prinzenberg E.M., Krause I., Erhardt G. SSCP analysis at the bovine CSN3 locus discriminates six alleles corresponding to known protein variants (А, В, С, E, F, G) and three new DNA polymorphisms (H, I, A1) // Anim. Biotechnol. - 1999. - Vol. 10. - P 49-62.

19. Rahali V., Menard J.L. Influence of genetic variants of β-lactoglobulin and k-casein on milk composition and cheesemaking properties // Lait. - 1991. - Vol. 71. - P. 275-297.

20. Schlee, P., Rotmann O. Identification of bovine kappacasein С by using the polymerase chain reaction // J. Anim. Breed. Genet. - 1992. - Vol. 109. - P. 153-155.

21. Schlieben S., Erhardt G., Senft B. Genotyping of bovine kappa-casein (k-CnA, k-CnB, k-CnC, k-CnE) following DNA sequence amplification and direct sequencing of k-CnE PCR product // Anim. Genet. - 1991. - Vol. 22. - P. 333-342.

22. Strzalkowska N., Krzyzewski J., Zwierzchowski L., Ryniewicz Z. Effects of к-casein and β-lactoglobulin loci polymorphism, cows' age, stage of lactation and somatic cell count on daily milk yield and milk composition in Polish Black - and - White cattle // Animal Science Papers and Reports. - 2002. - Vol. 20. - N1. - P. 21-35.

23. Zadworny D., Kuhnlein U. The identification of the kappa-casein genotype in Holstein dairy cattle using the polymerase chain reaction // Theor. Appl. Genet. - 1990. - Vol. 80. - P. 631-634.

Набор последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота путем проведения полимеразной цепной реакции в режиме реального времени, имеющих следующую структуру:

CSN3_F tgtgctgagtaggtatcctagttatgg
CSN3_R gcgttgtcttctttgatgtctccttag
CSN3-HinfI-wt2 (FAM)-tagctactctagaagattctccaga-(RTQ1)
CSN3-HinfI-m2 (R6G)-gctactctagaagcttctccagaa-(BHQ2)
CSN3-HaeIII-wt (FAM)-agaagttattgagAgcccacct-(RTQ1)
CSN3-HaeIII-m2 (R6G)-cagaagttattgagGgccc-(BHQ2)
CSN3-MaeII-wt (FAM)-catggcacGtcacccaca-(RTQ1)
CSN3-MaeII-m (R6G)-tggcacAtcacccacacc-(BHQ2)



 

Похожие патенты:

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha.

Изобретение относится к области биологии и медицины. Предложен способ экстракции ДНК, пригодной для проведения количественной ПЦР в реальном времени, из сухих пятен цельной крови новорожденных, нанесенных на фильтровальную карточку для неонатального скрининга.

Изобретение относится к биохимии. Описан способ обнаружения целевой нуклеиновой кислоты, полученной из последовательности ДНК Mycobacterium tuberculosis (ТВ) H37Rv, выбранной из группы, включающей IS6110, IS1084, МРТ 64, rrs, esat6, esat6-like, MDR, rpoB, katG, iniB и их фрагменты, у субъекта.

Изобретение относится к области биотехнологии, а именно к способу одновременной детекции множества последовательностей нуклеотидов при проведении одной полимеразной цепной реакции.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Настоящее изобретение относится к агробиотехнологии. Предложен набор синтетических олигонуклеотидов для выявления вируса крапчатости винограда (Grapevine fleck virus) с использованием метода полимеразной цепной реакции.

Изобретение относится к области биотехнологии, конкретно к способу генетического типирования штаммов чумного микроба (Yersinia pestis) и псевдотуберкулезного микроба (Yersinia pseudotuberculosis) с использованием набора синтетических олигонуклеотидных праймеров и фрагментного анализа флуоресцентно-меченных ДНК-ампликонов на капиллярном ДНК-анализаторе.

Изобретение относится к области биохимии. Описан способ экспресс-диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции в режиме реального времени.

Изобретение относится к области биотехнологии и генетической инженерии. Изобретение может быть использовано при экспресс-диагностике представителей вида V.

Изобретение относится к области медицины и предназначено для диагностики светлоклеточного почечно-клеточного рака (скПКР). В качестве исследуемых образцов используют образцы ткани почки в предположительно опухолевой и гистологически нормальной ткани пациента.

Изобретение относится к областям молекулярной биологии и генетики растений, в частности к способу молекулярно-генетической идентификации растений березы на основе микросателлитных (SSR) локусов.

Изобретение относится к области медицины. Изобретение представляет собой набор специфичных олигонуклеотидных праймеров для видовой идентификации бактерий рода Acinetobacter и определения устойчивости к бета-лактамным антибиотикам, включающий: 2 пары олигонуклеотидных праймеров для амлификации гена rpoB, с нуклеотидными последовательностями atgcgtccaggcgagccaccaac, gcggctgaaa acttattcaa taac, tctg aacgctatga cttatc, atggtcgtgtttgtccaattgaa; 3 пары олигонуклеотидных праймеров для амлификации генов карбапенемаз ОХА-типа (оха-51 и оха-51-like), с нуклеотидными последовательностями gcaccataaggcaaccaccaca, aagtatttaaatgggatggg, agaatgggaaaagaacatgacc, ttggacttgagctcatgtctaag, gcaccataaggcaaccacccgg, aagtatttaaatgggatgcc; 2 пары олигонуклеотидных праймеров для амлификации гена карбапенемазы оха-23, с нуклеотидными последовательностями atctggtgtttaaaatgaataa, gattcatcaatactttgatgaa, tggaagggcgagaaaaggtcat, ggcaagggatataaaaccacaa; 2 пары олигонуклеотидных праймеров для амлификации гена карбапенемазы оха-40, с нуклеотидными последовательностями tgaagctcaaacacagggtgta, taaaaaaagaacttatcctatgtg, ccagtatatcaagagcttgcaag, ccttaaaattacaccagtacaagaag.

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha.

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha.

Изобретение относится к области ветеринарной вирусологии, в частности к тест-системе для обнаружения ДНК особо опасного возбудителя африканской чумы свиней (АЧС). Изобретение предназначено для повышения степени специфичности и чувствительности тест-системы, а также сокращения времени проведения диагностики при снижении вероятности технологических ошибок во время лабораторных манипуляциях.

Изобретение относится к ветеринарной вирусологии, а именно к средствам диагностики африканской чумы свиней (АЧС). Изобретение позволяет повысить точность обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени.

Изобретение относится к области биологии и медицины. Предложен способ экстракции ДНК, пригодной для проведения количественной ПЦР в реальном времени, из сухих пятен цельной крови новорожденных, нанесенных на фильтровальную карточку для неонатального скрининга.

Изобретение относится к области биологии и медицины. Предложен способ экстракции ДНК, пригодной для проведения количественной ПЦР в реальном времени, из сухих пятен цельной крови новорожденных, нанесенных на фильтровальную карточку для неонатального скрининга.

Изобретение относится к биохимии. Описан способ обнаружения целевой нуклеиновой кислоты, полученной из последовательности ДНК Mycobacterium tuberculosis (ТВ) H37Rv, выбранной из группы, включающей IS6110, IS1084, МРТ 64, rrs, esat6, esat6-like, MDR, rpoB, katG, iniB и их фрагменты, у субъекта.

Изобретение относится к биохимии. Описан способ обнаружения целевой нуклеиновой кислоты, полученной из последовательности ДНК Mycobacterium tuberculosis (ТВ) H37Rv, выбранной из группы, включающей IS6110, IS1084, МРТ 64, rrs, esat6, esat6-like, MDR, rpoB, katG, iniB и их фрагменты, у субъекта.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития преэклампсии на основе комбинаций генов матриксных металлопротеиназ. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов. При выявлении сочетания аллеля С MMР-8 (rs11225395) и генотипа GG MMР-7 (rs11568818) прогнозируют низкий риск развития преэклампсии. Изобретение обеспечивает получение критериев оценки риска развития преэклампсии на основе генов матриксных металлопротеиназ. 3 ил., 3 пр.

Изобретение может быть использовано в ветеринарной практике и зоотехнии для диагностики четырех важных аллелей каппа-казеина. Предложен набор последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота путем проведения полимеразной цепной реакции в режиме реального времени, имеющих следующую структуру: 1 ил., 4 табл.

Наверх