Набор синтетических олигонуклеотидов для определения последовательности 1 интрона, примыкающей ко 2 экзону, генов системы hla i и ii классов (hla-a и hla-drb1)


G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2649064:

Общество с ограниченной ответственностью "Научно-производственная фирма ДНК-Технология" (ООО "НПФ ДНК-технология") (RU)

Изобретение относится к области биохимии и молекулярной биологии, в частности к набору синтетических олигонуклеотидов. Указанный набор предназначен для определения последовательности 1 интрона, примыкающей ко 2 экзону, генов системы HLA I и II классов (HLA-A и HLA-DRB1) методом ПЦР и состоит из следующих праймеров: dr1in6s 5’-GGATCCTCCTCCAGCTCCTG-3’, dr1in2a 5’-CCGCTCCGTCCCATTGAAGA-3’, A1in1s 5’-CTCCGAACCCTCCTCCTGCTA-3’, A1in2a 5’-GCTGTCGAACCGCACGGACTG-3’. Изобретение позволяет определять последовательности 1 интрона, примыкающей ко 2 экзону, генов системы HLA I и II классов. 1 ил.

 

1. Область техники.

Предложенные синтетические олигонуклеотиды и их применение относятся к области медицины, биологии и биотехнологии и могут быть использованы для определения последовательности 1 интрона, примыкающей ко 2 экзону, генов системы HLA I и II классов (HLA-A и HLA-DRB1).

Гены главного комплекса тканевой совместимости (МНС - Major Histocompatibility Complex), в последствие названные HLA (Human Leucocyte Antigens), являются многофункциональными, их клиническое значение не ограничивается рамками трансплантологии, а связано также с рисками развития различных заболеваний и репродуктивных нарушений.

На современном этапе можно выделить несколько важных направлений практического использования типирования генов HLA.

1. Трансплантология.

Риск осложнений при пересадке значительно снижается при выборе донора с генетической структурой, сходной с генетическими характеристиками пациента. Подобрать донора, полностью совместимого с реципиентом по генам HLA, очень сложно, поскольку число комбинаций, составленных из генов этого семейства, чрезвычайно велико. Вероятность найти полностью совместимого неродственного донора составляет от 1:1000 до 1:1000000 в зависимости от распространенности того или иного гена HLA. Поэтому во всем мире уже созданы и активно создаются регистры доноров костного мозга (гемопоэтических стволовых клеток) - базы, содержащие данные о донорах: результаты тканевого типирования донора, личные и контактные данные. К этой базе обращаются, когда больному требуется пересадка стволовых клеток и начинается поиск неродственного генетически совместимого донора. Национальные регистры неродственных доноров объединены в Международную Ассоциацию Доноров Костного Мозга (WMDA).

2. Популяционные исследования.

Исследования полиморфизма HLA в различных этнических группах позволяют обнаружить особенности распределения специфичностей генов HLA и их гаплотипипов, а также новые аллельные варианты генов HLA. Эти данные имеют как чисто научное, так и прикладное значение. Знания об особенностях популяций важны для более прицельного подбора доноров костного мозга.

3. HLA и болезни.

В результате усилий ученых из разных стран мира получены данные о значении генов HLA для развития аутоиммунных заболеваний в разных популяционных группах. Установлены как положительно, так и отрицательно ассоциированные с развитием заболеваний варианты генов HLA. С одной стороны, гены HLA являются маркерами различной аутоиммунной патологии (сахарный диабет 1 типа, ревматоидный артрит, анкилозирующий спондилит, целиакия и др.), с другой стороны, маркерами чувствительности и устойчивости к разным инфекционным заболеваниям (лепра, туберкулез, гепатит В и С и др.). Также существует ассоциация генов HLA с чувствительностью к применяемым лекарственным средствам (гиперчувствительность к абакавиру (применяется в качестве антиретровирусной терапии при ВИЧ-инфекции I типа)).

4. HLA и репродукция.

Исследования роли системы HLA в вопросах репродукции идут по двум направлениям. Первое касается изучения связи аутоиммунной патологии с репродуктивными неудачами, а также поиском маркеров HLA аутоиммунного процесса и соответственно репродуктивных потерь, связанных с аутоиммунитетом, второе - значения совместимости партнеров по вариантам HLA для репродуктивного результата.

Развитие технологий привело к быстрому накоплению сведений о широчайшем полиморфизме этой системы.

На данный момент в базе данных Комитета имеются сиквенсы 3492 аллелей HLA-A и 1929 аллелей HLA-DRB1 (данные на 27.09.2016). Таким образом, база данных по вариантам HLA-генов не является окончательной, она продолжает постоянно увеличиваться.

К HLA типированию генов на высоким разрешении предъявляются следующие требования:

- для HLA I класса полное прочтение 2 и 3 экзонов, включая нулевые аллели и разрешение всех неоднозначностей;

- для HLA II класса полное прочтение 2 экзона, включая нулевые аллели и разрешение всех неоднозначностей.

Эти требования накладывают определенные рамки при создании системы для типирования генов HLA. Для полного прочтения экзона необходимо расположить праймеры на интроне. Однако если обратиться к базе данных последовательностей аллелей HLA, поддерживаемой Номенклатурным Комитетом Всемирной Организации Здравоохранения по факторам системы HLA, то обращает на себя внимание, что для HLA-A известно 3492 последовательности 2 экзона, в то время для 1 интрона известна всего 241 последовательность. И для HLA-DRB1 известно 1929 последовательности 2 экзона и всего 43 последовательности 1 интрона.

Поэтому для достижения требований к высокому разрешению необходимо изучение областей интронов, примыкающих к типируемым экзонам.

2. Уровень техники.

Для определения последовательности генов используются различные методики секвенирования (SBT - sequence-based typing) и NGS (next generation sequencing)).

Метод определения нуклеотидной последовательности ДНК по Сэнгеру (SBT) и его различные модификации являются золотым стандартом в области секвенирования ДНК. Однако появление технологий высокопроизводительного секвенирования (NGS) позволило не только увеличить производительность и скорость прочтения до миллиардов пар оснований, но и существенно снизить стоимость процесса.

Определение последовательности нуклеиновых кислот методами высокопроизводительного секвенирования, по сути, представляет собой одновременное (параллельное) прочтение последовательности нескольких миллионов разных (относительно коротких) фрагментов исходной ДНК. В настоящее время производительность достигает нескольких геномов человека за один запуск одного прибора и постоянно увеличивается.

Общая последовательность этапов высокопроизводительного секвенирования для наиболее популярных технологических вариантов:

1) разрушение ДНК с получением фрагментов определенной длины или амплификация продуктов определенной длины (таргетное секвенирование);

2) присоединение синтетических олигонуклеотидных адаптеров по краям фрагментов;

3) наработка (амплификация) каждого фрагмента ДНК в отдельном микрореакторе с микрочастицей (эмульсионная ПЦР) и/или непосредственно на поверхности предметного стекла (мостиковая ПЦР);

4) определение последовательности фрагментов ДНК-методами, предложенными производителями приборов;

5) биоинформационный анализ данных (коротких прочтений).

Предлагаемое изобретение с дальнейшим использованием технологии NGS делает определение последовательностей генов HLA более быстрым и удешевляет подобные исследования, что позволит в дальнейшем создать надежную систему для типирования генов HLA на высоком разрешении.

3. Раскрытие изобретения.

Техническим результатом, на достижение которого направлено предлагаемое изобретение, является изучение области 1 интрона, примыкающего к 2 экзону, с целью дальнейшего создание надежной системы для типирования генов HLA на высоком разрешении, что позволит использовать ее для создания регистра доноров костного мозга и проведения массовых исследований, связанных с ассоциациями с различными болезнями и репродукцией.

Для достижения указанного результата используется постановка ПЦР (таргетное секвенирование) с помощью специфичных праймеров, расположенных на константном регионе в области, примыкающей ко 2 экзону, следующего нуклеотидного состава:

dr 1 in6s 5'- GGATCCTCCTCCAGCTCCTG - 3'

dr 1 in2a 5'- CCGCTCCGTCCCATTGAAGA - 3'

A 1 in1s 5'- CTCCGAACCCTCCTCCTGCTA -3'

A 1 in2a 5'- GCTGTCGAACCGCACGGACTG -3'

Дополнительно в реакционную смесь включают следующие стандартные компоненты:

- смесь дезоксирибонуклеотидтрифосфатов четырех типов;

- реакционный буфер (100 мМ Tris-HCl (рН 8.8 при 25°С), 500 мМ KCl, 0.8% Р40, 20 мМ MgCl2);

- бидистилированная вода;

- Taq-полимераза;

- минеральное масло;

- парафин.

4. Осуществление изобретения.

В качестве материала для исследования рекомендуется использовать кровь человека. Выделение ДНК из биоматериала производится с использованием комплекта реагентов для выделения ДНК (не является предметом данного патента).

В данную реакционную смесь добавляют образец ДНК и проводят ПЦР, регистрацию сигнала осуществляют с помощью электрофореза в агарозном геле.

Наличие ампликона определяют после окончания программы амплификации по наличию продукта длиной 345 п.н. для первой пары праймеров и 301 п.н. для второй пары праймеров.

Праймеры Праймеры
dr 1 in6s A 1 in1s
dr 1 in2a A 1 in2a

Список литературы:

1. Хаитов P.M. Физиология иммунной системы. - М.: ВИНИТИ РАН, 2001.

2. Болдырева М.Н. HLA (класс II) и естественный отбор. «Функциональный» генотип, гипотеза преимущества «функциональной» гетерозиготности. Диссертация на соискание ученой степени доктора медицинских наук, 2007.

3. Трофимов Д.Ю. Создание отечественной инновационной технологической платформы для решения актуальных фундаментальных и прикладных задач современной иммунологии на основе ПЦР в реальном времени. Диссертация на соискание ученой степени доктора медицинских наук, 2009.

4. Ребриков Д.В., Коростин Д.О., Шубина Е.С., Ильинский В.В. NGS: высокопроизводительное секвенирование. - М.: «БИНОМ. Лаборатории знаний», 2014.

5. Алексеев Л.П., Гусева И.А., Ульянова Л.И., Стрижаков А.Н., Тимохина Т.Ф. HLA-совместимость и привычное невынашивание беременности. // Иммунология. - 1986. - №2. - С. 76-77.

6. Болдырева М.Н., Хаитов Р.М., Барцева О.Б., Гузов И.И., Барко И.Ю., Померанцева Е.И., Богатова О.В., Гуськова И.А., Янкевич Т.Э., Хромова Н.А., Сергеев И.В., Филиппова Е.В., Алексеев Л.П. Исследование роли HLADRB1-генов при невынашивании беременности неясного генеза. // Иммунология. - 2004. - Том 25. - №1. - С. 4-8.

7. Болдырева М.Н., Хаитов P.M., Дедов И.И., Богатова О.В., Гуськова И.А., Янкевич Т.Э., Зилов А.В., Осокина И.В., Евсеева И.В., Ганичева Л.Л., Кашенин М.Н., Алексеев Л.П. Новый взгляд на механизм HLA ассоциированной предрасположенности к сахарному диабету 1 типа. Теоретические и прикладные аспекты. Иммунология. - 2005. - №6.

Набор синтетических олигонуклеотидов для определения последовательности 1 интрона, примыкающей ко 2 экзону, генов системы HLA I и II классов (HLA-A и HLA-DRB1) методом ПЦР, отличающийся тем, что в качестве специфичных праймеров используются:

dr1in6s 5'-GGATCCTCCTCCAGCTCCTG-3',

dr1in2a 5'-CCGCTCCGTCCCATTGAAGA-3',

A1in1s 5'-CTCCGAACCCTCCTCCTGCTA-3',

A1in2a 5'-GCTGTCGAACCGCACGGACTG-3',

потом проводится электрофорез в агарозном геле с целью определения наличия продуктов определенной длины.



 

Похожие патенты:
Изобретение относится к области медицины, а именно к акушерству и гинекологии, для прогнозирования развития преэклампсии на ранней стадии беременности на сроке 11-14 недель проводят сбор анамнестических данных.

Изобретение относится к таким областям медицины как акушерство, гинекология и репродуктология и представляет собой способ прогнозирования наступления беременности в программе экстракорпорального оплодотворения (ЭКО) при селективном переносе эмбрионов.

Изобретение относится к таким областям медицины как акушерство, гинекология и репродуктология и представляет собой способ прогнозирования наступления беременности в программе экстракорпорального оплодотворения (ЭКО) при селективном переносе эмбрионов.

Изобретение относится к области медицины, в частности к медицинской генетике и офтальмологии, и предназначено для ДНК-диагностики врожденной формы катаракты. Из периферической крови выделяют ДНК.

Изобретение относится к медицине, а именно к медицинской лабораторной диагностике в онкологии, и позволяет проводить дифференциальную диагностику лихорадки неясного генеза.

Изобретение относится к области медицины, в частности к акушерству, гинекологии, репродуктологии и иммунологии, и предназначено для прогнозирования результативности программы экстракорпорального оплодотворения (ЭКО).

Изобретение относится к области медицины, в частности к акушерству и гинекологии. Предложен способ выявления наследственной предрасположенности к развитию задержки роста плода у курящих женщин.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована при диагностике 5Т4-положительного рака. Способы по изобретению включают тестирование образца крови от млекопитающего, где образец крови содержит популяцию клеток, закрепление образца крови на подложке, детектирование в образце крови наличия или отсутствия ядросодержащих клеток с использованием первого маркера, детектирование наличия или отсутствия в образце крови экспрессии на клетке второго маркера, детектирование в образце крови наличия или отсутствия экспрессии на клетке третьего маркера, детектирования в образце крови наличия или отсутствия экспрессии на клетке четвертого маркера, где четвертый маркер представляет собой человеческий антиген 5Т4 и анализ первого, второго, третьего и четвертого маркеров в популяции клеток для распознавания и характеристики циркулирующих опухолевых клеток.

Изобретение относится к медицине, в частности к способу прогнозирования летальности у пациентов с инфарктом миокарда, который заключается в определении концентрации белковых факторов в плазме крови в первые 24 часа острой коронарной патологии и при плазменной концентрации ассоциированного с беременностью протеина плазмы А более 20 мМЕ/л наблюдается негативный прогноз госпитальной летальности, а снижение уровня инсулиноподобного фактора роста 1 менее 150 нг/мл у пациентов с инфарктом миокарда является неблагоприятным прогностическим фактором полугодовой летальности.

Изобретение относится к области спортивной медицины и предназначено для определения наследственной предрасположенности человека к спортивной деятельности. Осуществляют забор биологического материала, выделение ДНК, генотипирование по локусам ACE, PPPARGC1A, PPARGC1B, PPARG2, PPARA, PPARD, VDR, CALCR, VEGFA, GNB3, NOS3, AGT 704, AGT 521, IL6.

Изобретение относится к области медицины, в частности к медицинской генетике и офтальмологии, и предназначено для ДНК-диагностики врожденной формы катаракты. Из периферической крови выделяют ДНК.

Изобретение относится к области биохимии, в частности к молекуле рекомбинантной ДНК, указывающей на присутствие трансгенного события, где показательный образец семени, содержащего указанное трансгенное событие, депонирован в ATCC как РТА-12669.

Изобретение относится к области медицины, в частности к онкологии, и предназначено для диагностики метастазов рака толстой кишки. Из тканевых проб толстой кишки выделяют тотальную ДНК.

Изобретение относится к области медицины, в частности к акушерству, гинекологии, репродуктологии и иммунологии, и предназначено для прогнозирования результативности программы экстракорпорального оплодотворения (ЭКО).

Изобретение относится к области медицины, в частности к акушерству и гинекологии. Предложен способ выявления наследственной предрасположенности к развитию задержки роста плода у курящих женщин.

Изобретение относится к области спортивной медицины и предназначено для определения наследственной предрасположенности человека к спортивной деятельности. Осуществляют забор биологического материала, выделение ДНК, генотипирование по локусам ACE, PPPARGC1A, PPARGC1B, PPARG2, PPARA, PPARD, VDR, CALCR, VEGFA, GNB3, NOS3, AGT 704, AGT 521, IL6.

Изобретение относится к области медицины, в частности к травматологии, ортопедии и ревматологии, и предназначено для прогнозирования развития идиопатического коксартроза.

Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования риска развития преэклампсии. Из периферической венозной крови женщин русской национальности, являющихся уроженками Центрального Черноземья России, выделяют ДНК и проводят анализ полиморфизмов генов цитокинов MMР-3, MMР-8 и MMР-12.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития преэклампсии на основе комбинаций генов матриксных металлопротеиназ.

Группа изобретений касается онкологии и фармакологии. Предложено терапевтическое и/или профилактическое средство против опухоли с мутацией в RET и против метастазов опухоли, которое содержат соединение формулы (I), где R - C1-6-алкил, его соль или его сольват в качестве активного ингредиента; терапевтическое и/или профилактическое средство того же состава, используемое для пациента с мутацией в RET и против метастазов опухоли; способ идентификации рака или пациента, реагирующего на лечение соединением формулы (I).

Изобретение относится к области биохимии и молекулярной биологии, в частности к набору синтетических олигонуклеотидов. Указанный набор предназначен для определения последовательности 1 интрона, примыкающей ко 2 экзону, генов системы HLA I и II классов методом ПЦР и состоит из следующих праймеров: dr1in6s 5’-GGATCCTCCTCCAGCTCCTG-3’, dr1in2a 5’-CCGCTCCGTCCCATTGAAGA-3’, A1in1s 5’-CTCCGAACCCTCCTCCTGCTA-3’, A1in2a 5’-GCTGTCGAACCGCACGGACTG-3’. Изобретение позволяет определять последовательности 1 интрона, примыкающей ко 2 экзону, генов системы HLA I и II классов. 1 ил.

Наверх