Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена сат и/или уменьшением активности белка каталазы на основе генно-терапевтических субстанций с геном сат, способ получения и использования

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена САТ и/или уменьшением активности белка каталазы, на основе генно-терапевтических субстанций с геном CAT, где клетки органов и тканей выбраны из фибробластов, эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CAT, с кодирующей последовательностью белка каталазы, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1 или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций. Группа изобретений также касается способа получения указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы; способа использования указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках при одновременной минимизации вероятности встраивания элементов генетической конструкции в геном пациента. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и может быть использовано для коррекции патологических состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением уровня экспрессии гена CAT и/или уменьшением активности белка каталазы, в частности, в терапевтических целях.

Предшествующий уровень.

В настоящее время доказана роль окислительного (оксидативного) стресса в заболеваниях различных систем органов: при сердечно-сосудистых заболеваниях (атеросклероз, повреждения при ишемии/реперфузии, рестеноз и гипертензия), при злокачественных и воспалительных заболеваниях (синдром острой дыхательной недостаточности, астма, воспалительные заболевания кишечника, воспаление глаз и кожи, артриты), при метаболических заболеваниях (диабет), при патологиях центральной нервной системы (боковой амиотрофический склероз - болезнь Шарко, болезнь Альцгеймера, болезнь Паркинсона, инсульт и др.). Наиболее предрасположены к оксидативному стрессу кожа, дыхательная система, мозг, глаза, система кровообращения и репродуктивная система.

Нарушение баланса между процессами образования активных форм кислорода (свободных радикалов) и процессами их нейтрализации за счет работы системы антиоксидантной защиты является основной характеристикой оксидативного стресса, в результате которого происходит повреждение активными формами кислорода различных клеток, тканей и органов. В процессе повреждения данных биологических систем участвуют три активные формы кислорода: супероксид-анион (O2.-), перекись водорода (H2O2) и гидроксид-анион (OH).

В нормальных условиях свободные радикалы быстро нейтрализуется естественными антиоксидантами - внутриклеточными, мембранными и внеклеточными. Уровни антиоксидантов и обеспечение хорошей защиты со стороны антиоксидантных систем очень важны для предотвращения оксидативного стресса. Для оценки состояния антиоксидантной системы необходимо определение содержания/ активности наиболее важных антиоксидантов, что позволит выявлять лиц с повышенным риском развития заболеваний, связанных с оксидативным стрессом, проводить мониторинг за течением заболевания и эффективностью применяемой терапии, обосновывать применение в комплексном лечении больного генно-терапевтических средств на основе генов антиоксидантов. Антиоксидантные механизмы могут быть энзиматическими (практически всегда внутриклеточные) и не энзиматические (как внутриклеточные, так и внеклеточные). Ферментные (энзиматические) антиоксиданты являются средствами внутриклеточной защиты, поскольку в плазме крови и в лимфе они обнаруживаются лишь в следовых количествах. К внутриклеточным энзиматическим антиоксидантам относятся белки супероксиддисмутазы, пероксидазы и белок каталазы. Супероксиддисмутазы катализируют превращение супероксид-аниона в кислород и перекись водорода, которая затем утилизируется глутатионпероксидазами и каталазой.

Каталаза - фермент, относящийся к классу оксидоредуктаз, который катализирует гетеролитическое расщепление O-O-связи в перекиси водорода при реакции разложения пероксид водорода на воду и молекулярный кислород (2H2O2→2H2O+O2), а также участвует в окислении в присутствии пероксида водорода низкомолекулярных спиртов и нитритов. Таким образом, функция каталазы сводится к утилизации токсичного пероксида водорода, который образуется в ходе различных окислительных процессов в организме. Каталаза - хромопротеид с молекулярной массой около 240000 Д, состоит из 4 субъединиц, имеющих по одной группе гема. Это высокоактивный фермент, который не требует энергии для активации. При избытке метионина, цистина, меди, цинка возникает снижение активности каталазы.

Ген каталазы CAT имеет длину 34 кБ, содержит 13 экзонов, его кодирующая последовательность 1581 н.п.

Фермент каталаза содержится почти во всех организмах, и участвует в тканевом дыхании, в процессах окисления и восстановления гемоглобина, заживления поверхностных дефектов роговицы. По данным иммуногистохимических методов, максимальная активность каталазы (в 6 раз выше средней) определяется в ретинальном пигментном эпителии глаза. Она локализована преимущественно в пероксисомах клетки и цитоплазме. Пероксисомы встречаются в клетках всех тканей организма человека, но особенно они многочисленны в гепатоцитах, в клетках проксимальных почечных канальцев, корковом слое надпочечников, миелиновых структурах нервных клеток и жировой ткани. У человека высокое содержание каталазы обнаружено в лейкоцитах и эритроцитах, а также в печени (до 60% общей активности) и почках. Энзиматическая активность каталазы в нервных тканях, в частности, в мозге, составляет лишь несколько процентов от ее уровня в печени (Биополимеры и клетка, 1992, 8(6): 3). Для защиты от активных форм кислорода нейтрофилы содержат каталазу и глутатион-пероксидазу (Klebanoff, Clark, 1978). Также каталазу содержат моноциты.

Каталаза относится к наиболее важным компонентам антиоксидантной системы в коже. Описан полиморфизм гена каталазы в промоторной области (-262С>Т), который приводит к нарушению связывания транскрипционных факторов и вызывает снижение экспрессии гена каталазы, а также дальнейшее изменение активности фермента. Показано, что данный полиморфизм ассоциирован с повышением риска развития рака молочной железы. Также определено снижение частоты носителей мутантного аллеля Т/Т среди больных плоскоклеточным раком кожи, что может указывать на роль каталазы в развитии данного новообразования (Онкология. 2013. - N 3. - С. 45-47). У больных псориазом отмечено повышение активности каталазы в эритроцитах и фибробластах кожи (Марков Х.М. Российский педиатрический журнал. 2005. - N 6. - С. 31-35)

Исторически первым подходом к проблеме использования ферментов для лечения заболеваний было их включение в полимерные микрокапсулы. Примером использования микрокапсулированной каталазы в клинической практике является применение микрокапсул с каталазой для лечения в ротовой полости человека ран, образующихся при акаталаземии в результате накопления выделяемой бактериями перекиси водорода (Chang Т.М. S.J Dent. Res., 1972, 51, p. 319-321.).

Было разработано лекарственное средство в виде назального спрея, в основе которого использовали экзосомы, полученные из лейкоцитов пузырьки, состоящие из протеинов и липидов, в которые была помещена каталаза. Экзосомы формируются мембранами клеток для перемещения химических сигналов. Такой способ доставки фермента был использован для преодоления гемато-энцефалического барьера и доставки антиоксиданта в головной мозг для лечения болезни Паркинсона и других нейродегенеративных заболеваний. (Matthew J. Haney, Natalia L. Klyachko, Yuling Zhao, Richa Gupta, Evgeniya G. Plotnikova, Zhijian He, Tejash Patel, Aleksandr Piroyan, Marina Sokolsky, Alexander V. Kabanov, Elena V. Batrakova. Exosomes as drug delivery vehicles for Parkinson's disease therapy. Journal of Controlled Release, 2015; 207, 10 June 2015, Pages 18-30). Недостаток данного подхода состоит в том, что при данном методе введения желаемый терапевтический эффект может оказаться недостигнутым, а также в том, что получение подобных препаратов высокой чистоты является дорогостоящим, а при недостаточной степени очистки возможны побочные реакции.

В патенте RU 2538675 С2 описано изобретение, которое заключается в применении комбинации экзогенного легочного сурфактанта, CuZn-супероксиддисмутазы и каталазы для одновременного, последовательного или раздельного использования в предотвращении бронхолегочной дисплазии (BPD) у недоношенных детей с респираторным дистресс-синдромом (RDS). Набор для предотвращения BPD состоит из: а) экзогенного легочного сурфактанта (предпочтительным модифицированным природным легочным сурфактантом является порактант альфа, состоящему из полярных липидов, в основном фосфолипидов, и белков SP-B и SP-C.) и фармацевтически приемлемого носителя или разбавителя в первой стандартной лекарственной форме; b) CuZn-супероксиддисмутазы человека из эритроцитов или печени или данный рекомбинантный белок человека и фармацевтически приемлемого носителя или разбавителя во второй стандартной лекарственной форме (необязательно), с) каталазы человека из эритроцитов или печени или данный рекомбинантный белок человека и, фармацевтически приемлемого носителя или разбавителя в третьей стандартной лекарственной форме (необязательно); d) контейнера для хранения указанных первой, второй и третьей лекарственных форм. Использование комбинации повышает эффективность лечения BPD за счет синергетического эффекта совместного действия компонентов. Описанное в патенте лекарственное средство находится в форме, подходящей для ингаляции или интратрахеального введения. Данное изобретение основывается на данных о том, что CuZn-супероксиддисмутаза и каталаза в конкретных дозах действуют синергично на утилизационную активность экзогенных легочных сурфактантов по отношению к активным формам кислорода, и при этом применение указанных антиоксидантных ферментов в заявленных однократных дозах не инактивирует модифицированный природный легочный сурфактант. Недостаток данного подхода состоит в том, что при использовании белкового препарата антиоксиданта желаемый терапевтический эффект может оказаться недостигнутым или кратковременным, а также - при недостаточной степени очистки белка-фермента возможны побочные реакции или проявление его недостаточной ферментативной активности.

Известно также введение в организм генетических конструкций, модулирующих активность природного гена. За прототип авторами было принято решение по заявке WO 2000054595, содержащее способы применения аденоассоциированных вирусных композиций, в частности, использование rAAV конструкций, экспрессирующих каталазу и супероксиддисмутазу в композиции для доставки к зрительному нерву, а также - способы лечения и облегчения симптомов демиелинизирующих заболеваний животного, такие как рассеянный склероз, аллергический энцефаломиелит и неврит зрительного нерва. В изобретении использован рекомбинантный адено-ассоциированный вирус для доставки терапевтического гена CAT или SOD в трансформированные клетки, чтобы защитить такие клетки от негативного воздействия перекиси водорода. Эти эффекты включают в себя классическую демиелинизацию и разрушение гематоэнцефалического барьера, которые являются отличительными чертами многих заболеваний, связанных с демиелинизирующими нарушениями центральной нервной системы. В примерах описано применение сегментов нуклеиновых кислот, которые кодируют, в том числе полипептиды супероксиддисмутазы, каталазы и подобные белки. В некоторых вариантах осуществления изобретения, предложен сайт-направленный мутагенез кодирующих полинуклеотидных последовательностей для изменения активности или эффективности векторных конструкций. Также предполагается проведение внесение изменений в аминокислотную последовательность за счет изменения нуклеотидной последовательности таким образом, чтобы был получен биологически функционально эквивалентный белок.

В изобретении описан способ подавления окислительного повреждения путем применения вирусно-опосредованного переноса генов человека, которые снижают уровни перекиси водорода или супероксида в зрительных нервах на модели in vivo. Показано, что при введении гена CAT активность каталазы была увеличена примерно в два раза в различных типах клеток зрительного нерва. Также выявлено, что при введении этого гена демиелинизация снижается на 38%, отек зрительного нерва снижается на 29%, клеточная инфильтрация - на 34%, нарушение гематоэнцефалического барьера - на 64%, a in vivo уровень H2O2 на 61%. Таким образом, результаты исследований подтверждают эффективность использования системы доставки генов каталазы (CAT) или супероксиддисмутазы (SOD) с использованием вирусных векторов в качестве терапевтической стратегии для подавления рассеянного склероза. Основным преимуществом такой генной терапии с генами CAT, SOD или других генов, подавляющих оксидативный стресс, является то, что после однократного введения, ген(ы) непрерывно работает(ют) в клетках нервной системы, тем самым обеспечивая долговременную защиту от воздействия активных форм кислорода или перекиси водорода. Следовательно, пациенты требуют менее частой госпитализации или дополнительного лечения.

Недостатком данного подхода является то, что при создании генно-терапевтического средства в этом изобретении использован аденоассоциированный вирус, который может интегрироваться в хромосому клетки-хозяина, а также - не учитываются индивидуальные характеристики пациента, в связи с которыми может понадобиться группа вариаций для данного средства.

Раскрытие изобретения

Задачей данного изобретения является создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена CAT и/или уменьшением активности белка каталазы, на основе генно-терапевтических субстанций с геном CAT.

Указанная задача решается за счет того, что создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы на основе генно-терапевтических субстанций с кДНК гена CAT, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CAT, с кодирующей последовательностью белка каталазы, с делециями 5' и 3'-нетранслируемых областей, а именно, полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1, или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена CAT в эукариотических клетках, в частности в клетках органов и тканей человека, и способную увеличить активность белка каталазы в клетках органов и тканей и/или органах и тканях человека, в частности в эритроцитах, или лейкоцитах, или моноцитах, или нейтрофилах, или гепатоцитах, или эпителиальных клетках роговицы, или в нефронах, или в клетках проксимальных почечных канальцев, или в клетках коркового слоя надпочечников, или в нервных клетках, или клетках жировой ткани, или клетках кожи (например, фибробластах), в эпителиальных клетках, или клетках мышечной ткани в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в печени, надпочечниках, почках, головном и спинном мозге, глазе, роговице, коже, в крови, в нервной ткани, в жировой ткани, в мышечной ткани, в эпителиальной ткани, в дерме в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека. При этом каждая генетическая конструкция с модифицированной кДНК гена CAT содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена CAT, которая несет модификации, не затрагивающие структуру белка каталазы, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, не влияющие на кодируемую этой последовательностью аминокислотную последовательность. В качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры.

Способ получения средства для лечения состояний человеческого организма связанного с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы заключается в получении каждой генно-терапевтической субстанции из группы созданных генно-терапевтических субстанций., при этом получают кДНК гена CAT, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена CAT с кодирующей последовательностью белка каталазы, с делециями 5' и 3'-нетранслируемых областей, а именно, полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1, или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют, или SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы, заключается в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций, клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/ выбранных из группы созданных генно-терапевтических субстанций, или сочетанием обозначенных способов.

Описание фигур

На фиг. 1

Представлена нуклеотидная последовательность немодифицированной кДНК гена CAT длиной 1584 н.п. SEQ ID No: 1, которая имеет высокую гомологию с приводимой в базе данных GenBank под номером NM_001752 и кодирует белок каталазу (GenBank NP_001743.1.)

На фиг. 2

Представлена нуклеотидная последовательность модифицированной кДНК гена CAT, SEQ ID No: 2, которая содержит 1 нуклеотидную замену G→C в позиции 152, 1 нуклеотидную замену T→G в позиции 230 и 3 нуклеотидных замены A→G в позициях 194, 221 и 287, не приводящие к изменениям в аминокислотной последовательности белка каталазы.

На фиг. 3

Представлена нуклеотидная последовательность модифицированной кДНК гена CAT, SEQ ID No: 3, которая

содержит 2 нуклеотидных замены G→C в позициях 152, 449; 2 нуклеотидных замены T→G в позициях 230, 479; 4 нуклеотидных замены A→G в позициях 194, 221, 287, 386; 1 нуклеотидную замену А→С в позиции 566; не приводящие к изменениям в аминокислотной последовательности белка каталазы.

На фиг. 4

Представлена нуклеотидная последовательность модифицированной кДНК гена CAT, SEQ ID No: 4, которая

содержит 5 нуклеотидных замены G→C в позициях 152, 449, 626, 839, 842; 3 нуклеотидных замены T→G в позициях 230, 479, 653; 6 нуклеотидных замены A→G в позициях 194, 221, 287, 386, 653, 1043; 1 нуклеотидную замену А→С в позиции 566;; 1 нуклеотидную замену Т→С в позиции 1041; не приводящие к изменениям в аминокислотной последовательности белка каталазы.

На фиг. 5

Представлена нуклеотидная последовательность модифицированной кДНК гена CAT, SEQ ID NO: 5, которая

содержит 6 нуклеотидных замены G→C в позициях 152, 449, 626, 839, 842, 1262; 5 нуклеотидных замены T→G в позициях 230, 479, 653, 1229, 1253; 7 нуклеотидных замены A→G в позициях 194, 221, 287, 386, 653, 1043, 1235; 3 нуклеотидных замены А→С в позициях 566, 1085, 1208; 1 нуклеотидную замену Т→С в позиции 1041; не приводящие к изменениям в аминокислотной последовательности белка каталазы.

На фиг. 6

Представлена нуклеотидная последовательность модифицированной кДНК гена CAT, SEQ ID NO: 6, которая

содержит 8 нуклеотидных замен G→C в позициях 152, 449, 626, 839, 842, 1262, 1325, 1523; 6 нуклеотидных замены T→G в позициях 230, 479, 653, 1229, 1253, 1463; 7 нуклеотидных замены A→G в позициях 194, 221, 287, 386, 653, 1043, 1235; 3 нуклеотидных замены А→С в позициях 566, 1085, 1208; 1 нуклеотидную замену Т→С в позиции 1041; не приводящие к изменениям в аминокислотной последовательности белка каталазы.

На фиг. 7

Представлена нуклеотидная последовательность модифицированной кДНК гена CAT, SEQ ID No: 7, которая

содержит 10 нуклеотидных замен G→C в позициях 152, 449, 626, 839, 842, 1262, 1325, 1523, 1613, 1649; 6 нуклеотидных замены T→G в позициях 230, 479, 653, 1229, 1253, 1463; 7 нуклеотидных замены A→G в позициях 194, 221, 287, 386, 653, 1043, 1235; 3 нуклеотидных замены А→С в позициях 566, 1085, 1208; 1 нуклеотидную замену Т→С в позиции 1041; не приводящие к изменениям в аминокислотной последовательности белка каталазы.

На фиг. 8

С целью последующего корректного определения генно-терапевтического эффекта после трансфекции фибробластов генно-терапевтической субстанцией с кДНК гена CAT проводили анализ эндогенной экспрессии гена CAT в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена CAT, фибробласты со сниженной экспрессией гена CAT,

2 - кДНК гена CAT, фибробласты с нормальной экспрессией гена CAT,

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена CAT,

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена CAT.

В качестве референтного гена использовали ген В2М (Бета-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

На фиг. 9

С целью подтверждения увеличения экспрессии гена CAT в клеточной культуре фибробластов со сниженной экспрессией гена CAT при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена CAT с генетической конструкцией pCMV6-САТ SEQ ID No: 1 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена CAT в фибробластах с нормальной экспрессией гена CAT,

2 - кДНК гена CAT в фибробластах со сниженной экспрессией гена CAT до трансфекции ГТС с кДНК гена CAT,

3 - кДНК гена CAT в фибробластах со сниженной экспрессией гена CAT после трансфекции ГТС с кДНК гена CAT,

4 - кДНК гена CAT в фибробластах со сниженной экспрессией гена CAT после трансфекции вектором без кДНК гена CAT,

5 - кДНК гена В2М в фибробластах с нормальной экспрессией гена CAT,

6 - кДНК гена В2М в фибробластах со сниженной экспрессией гена САТ до трансфекции ГТС с кДНК гена CAT,

7 - кДНК гена В2М в фибробластах со сниженной экспрессией гена CAT после трансфекции ГТС с кДНК гена CAT,

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена CAT после трансфекции вектором без кДНК гена CAT.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена САТ уровень кДНК гена CAT в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена CAT - уровень кДНК фибробластов со сниженной экспрессией гена CAT многократно увеличился (до уровня выше, чем уровень кДНК гена CAT в нормальных фибробластах).

На фиг. 10

С целью подтверждения увеличения активности белка каталазы, в клеточной культуре фибробластов с нормальной экспрессией гена CAT при трансфекции данных клеток генно-терапевтической субстанцией содержащей кДНК гена CAT представлен график изменения активности белка каталазы, нетрансфицированных фибробластов (культура А), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК гена CAT (культура В) и трансфицированных генно-терапевтической субстанцией с генетической конструкцией pCDNA 3.1-CAT SEQ ID No: 1 (культура С). Из графика следует, что при трансфекции фибробластов генно-терапевтической субстанцией с кДНК гена CAT происходит увеличение активности белка каталазы, в клеточном лизате.

Культура А

Культура В

Культура С

На фиг. 11

С целью подтверждения увеличения активности белка каталазы, в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией, представлен анализ изменения активности белка каталазы, в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (В) и трансфицированные генно-терапевтической субстанцией с генетической конструкцией pCMV6- CAT SEQ ID No: 7 (С) - в кожу предплечья. Также анализировали активность белка каталазы, в интактной коже (D). Показано повышение активности белка каталазы, в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией кДНК гена CAT (С).

A - аутологичные нетрансфицированные фибробласты

B - трансфицированные вектором pCMV6-XL5 фибробласты

C - трансфицированные субстанцией с pCMV6-CAT SEQ ID No: 7

D - активность белка CAT в интактной коже

На фиг. 12

С целью подтверждения увеличения активности белка каталазы до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток генно-терапевтическими субстанциями с участком нативной немодифицированной кДНК гена CAT и модифицированных кДНК гена CAT, представлен анализ изменения уровня активности белка каталазы в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена CAT, используемой для трансфекции фибробластов.

Культуры фибробластов 18 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали генно-терапевтической субстанцией pCMV6-CAT SEQ ID No: 1, части (В) трансфицировали генно-терапевтической субстанцией pCMV6-CA7 SEQ ID No: 2, части (С) трансфицировали генно-терапевтической субстанцией pCMV6-CAT SEQ ID No: 3, части (D) трансфицировали генно-терапевтической субстанцией pCMV6-CAT SEQ ID No: 4, части (E) трансфицировали генно-терапевтической субстанцией pCMV6-CAT SEQ ID No: 5, части (F) трансфицировали генно-терапевтической субстанцией pCMV6-CAT SEQ ID No: 6, части (G) трансфицировали генно-терапевтической субстанцией pCMV6-CA7 SEQ ID No: 7, части (H) трансфицировали векторной плазмидой, не содержащей кДНК гена CAT.

По итогам анализа уровня активности белка каталазы, выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальную активность белка каталазы, и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальная активность белка каталазы, наблюдалась при трансфекции pCMV6-CAT SEQ ID No: 1,

в группе 2 максимальная активность белка каталазы, наблюдалась при трансфекции pCMV6-CAT SEQ ID No: 2,

в группе 3 максимальная активность белка каталазы, наблюдалась при трансфекции pCMV6-CAT SEQ ID No: 3,

в группе 4 максимальная активность белка каталазы, наблюдалась при трансфекции pCMV6-GA7 SEQ ID No: 4,

в группе 5 максимальная активность белка каталазы, наблюдалась при трансфекции pCMV6-CA7 SEQ ID No: 5,

в группе 6 максимальная активность белка каталазы, наблюдалась при трансфекции pCMV6-CAT SEQ ID No: 6,

в группе 7 максимальная активность белка каталазы, наблюдалась при трансфекции pCMV6-CA7 SEQ ID No: 7.

Ни в одной из клеточных культур не наблюдалось того, что максимальная активность белка каталазы присутствует при трансфекции вектором без вставки кДНК гена CAT.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей ингибирования цветной реакции (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена CAT.

Из фигуры следует, что достижение максимальной активности белка каталазы, в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена CAT, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных ГТС CAT SEQ ID No: 1(A)

части клеточных культур, трансфицированных ГТС CAT SEQ ID No: 2 (В)

части клеточных культур, трансфицированных ГТС CAT SEQ ID No: 3 (С)

части клеточных культур, трансфицированных ГТС CAT SEQ ID No: 4 (D)

части клеточных культур, трансфицированных ГТС CAT SEQ ID No: 5 (E)

части клеточных культур, трансфицированных ГТС CAT SEQ ID No: 6 (F)

части клеточных культур, трансфицированных ГТС CAT SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

На фиг. 13

С целью подтверждения увеличения экспрессии гена CAT в клеточной культуре эпителиальных клеток глаза человека при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена CAT в генетической конструкции pCMV6-Kan/Neo CAT SEQ ID No: 2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена CAT, эпителий роговицы до трансфекции

2 - кДНК гена CAT, эпителий роговицы после трансфекции

3 - кДНК гена В2М, эпителий роговицы до трансфекции

4 - кДНК гена В2М, эпителий роговицы после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена CAT в культуре клеток эпителия роговицы человека многократно вырос.

На фиг. 14

С целью подтверждения увеличения экспрессии гена CAT в клеточной культуре эпителия слизистой оболочки полости рта при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена CAT приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена CAT, до трансфекции

2 - кДНК гена CAT, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена САТ вырос многократно.

На фиг. 15

С целью подтверждения увеличения активности белка каталазы, в коже человека при введении в кожу генно-терапевтической субстанции представлен анализ изменения активности белка каталазы в коже. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена CAT pCMV6-CA7 SEQ ID No: 4(В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена CAT с транспортной молекулой (А) - в кожу предплечья. Показано увеличение активности белка каталазы, в биоптате кожи пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена CAT, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 16

С целью подтверждения увеличения активности белка каталазы в слизистой оболочке полости рта человека при введении в слизистую оболочку полости рта генно-терапевтической субстанции представлен анализ изменения активности белка каталазы, в слизистой оболочке полости рта. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена CAT pCDNA 3.1 CAT SEQ ID No: 5 (В) и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды, не содержащей кДНК гена CAT с транспортной молекулой (А) - в слизистую оболочку полости рта.

Показано увеличение активности белка каталазы, в лизате биоптата слизистой оболочки полости рта пациента 1В, которому вводилась генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена CAT, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 17

С целью подтверждения увеличения активности белка каталазы, в мышечной ткани человека при введении в мышечную ткань генно-терапевтической субстанции представлен анализ изменения активности белка каталазы в мышечной ткани. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазм иду с кДНК гена CAT - pCMV6-Kan/Neo CAT SEQ ID No: 6 (В) и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды, не содержащей кДНК гена CAT с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение активности белка каталазы, в биоптате мышечной ткани пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена CAT, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 18

С целью подтверждения увеличения активности белка каталазы до различного индивидуального уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными кДНК гена CAT и участком нативной немодифицированной кДНК гена CAT анализировали уровень активности белка каталазы в коже человека в зависимости от наличия и типа модификаций в кДНК гена CAT.

Каждому из 21-го пациента, которые были отобраны в случайном порядке, вводили в кожу предплечья 7 генно-терапевтических субстанций pCMV6- SEQ ID No: 1, pCMV6- SEQ ID No: 2, pCMV6- SEQ ID No: 3, pCMV6- SEQ ID No: 4, pCMV6- SEQ ID No: 5, pCMV6- SEQ ID No: 6, pCMV6- SEQ ID No: 7, и плацебо pCMV6- XL5.

По итогам анализа уровня активности белка каталазы, в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни активности белка каталазы, и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальная активность белка каталазы, наблюдалась при введении pCMV6-CAT SEQ ID No: 1,

в группе 2 максимальная активность белка каталазы, наблюдалась при введении pCMV6-CAT SEQ ID No: 2,

в группе 3 максимальная активность белка каталазы, наблюдалась при введении pCMV6-CAT SEQ ID No: 3,

в группе 4 максимальная активность белка каталазы, наблюдалась при введении pCMV6-CAT SEQ ID No: 4,

в группе 5 максимальная активность белка каталазы, наблюдалась при введении pCMV6-CAT SEQ ID No: 5,

в группе 6 максимальная активность белка каталазы, наблюдалась при введении pCMV6-CAT SEQ ID No: 6,

в группе 7 максимальная активность белка каталазы, наблюдалась при введении pCMV6-CAT SEQ ID No: 7.

Ни в одном из биоптатов не наблюдалось того, что максимальная активность белка каталазы, присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей ингибирования цветной реакции, (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после введения пациентам этих генно-терапевтических субстанций, содержащих модифицированные кДНК гена CAT и участок нативной немодифицированной кДНК гена CAT.

Из данного примера следует, что достижение максимальной активности белка каталазы, в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена CAT, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента.

Обозначения:

биоптаты пациентов после введения ГТС CAT SEQ ID No: 1(A)

биоптаты пациентов после введения ГТС CAT SEQ ID No: 2(В)

биоптаты пациентов после введения ГТС CAT SEQ ID No: 3(С)

биоптаты пациентов после введения ГТС CAT SEQ ID No: 4(D)

биоптаты пациентов после введения ГТС CAT SEQ ID No: 5(E)

биоптаты пациентов после введения ГТС CAT SEQ ID No: 6(F)

биоптаты пациентов после введения ГТС CAT SEQ ID No: 7(G)

биоптаты пациентов после введения плацебо (Н)

На фиг. 19

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали активность белка каталазы, в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими участок нативной немодифицированной кДНК гена CAT или модифицированные кДНК гена CAT.

По итогам анализа активности белка каталазы, в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой происходит максимальное ингибирование в лизате клеточной культуры и соответственно наблюдается максимальная активность каталазы. В данном эксперименте максимальное ингибирование в лизате наблюдается при трансфекции генно-терапевтической субстанцией на базе pCMV6 CAT SEQ ID No: 1, содержащей участок нативной немодифицированной кДНК гена CAT, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Обозначения:

1 - клеточный лизат после трансфекции ГТС CAT SEQ ID No: 1

2 - клеточный лизат после трансфекции ГТС CAT SEQ ID No: 2

3 - клеточный лизат после трансфекции ГТС CAT SEQ ID No: 3

4 - клеточный лизат после трансфекции ГТС CAT SEQ ID No: 4

5 - клеточный лизат после трансфекции ГТС CAT SEQ ID No: 5

6 - клеточный лизат после трансфекции ГТС CAT SEQ ID No: 6

7 - клеточный лизат после трансфекции ГТС CAT SEQ ID No: 7

8 - клеточный лизат после трансфекции плацебо.

На фиг. 20

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали активность белка каталазы в лизатах биоптатов кожи этого пациента, после введения ему генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена CAT или участки модифицированных кДНК гена CAT.

По итогам анализа активности белка каталазы, в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой происходит максимальное ингибирование в лизате биоптата кожи и соответственно наблюдается максимальная активность каталазы. В данном эксперименте максимальная концентрация белка каталазы, отмечена при введении генно-терапевтической субстанции на базе pCMV6 CAT SEQ ID No: 2, содержащей модифицированную кДНК гена, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения ГТС CAT SEQ ID No: 1

2 - лизат биоптата после введения ГТС CAT SEQ ID No: 2

3 - лизат биоптата после введения ГТС CAT SEQ ID No: 3

4 - лизат биоптата после введения ГТС CAT SEQ ID No: 4

5 - лизат биоптата после введения ГТС CAT SEQ ID No: 5

6 - лизат биоптата после введения ГТС CAT SEQ ID No: 6

7 - лизат биоптата после введения ГТС CAT SEQ ID No: 7

8 - лизат биоптата после введения плацебо.

Реализация изобретения.

При снижении экспрессии генов, кодирующих белки окислительно-восстановительного баланса, например, гена CAT, происходит снижение антиоксидантной активности белка в организме. Мыши, гомозиготные с нарушением работы CAT гена, демонстрируют нормальный фенотип, хотя у них наблюдали небольшие аномалии в процессе митохондриального дыхания. [PMID: 5929246], [PMID: 6058079], [PMID: 5087482], [PMID: 4713148], [PMID: 15178682].

Преимущества использования генетической конструкции с геном CAT для коррекции экспрессии гена САТ и активности белка каталазы в клетках органов и тканей человека, по сравнению с использованием аденоассоциированных вирусных композиций, в частности, использование rAAV конструкций, экспрессирующих каталазу и супероксиддисмутазу в композиции для доставки к зрительному нерву, а также - способы лечения и облегчения симптомов демиелинизирующих заболеваний животного, такие как рассеянный склероз, аллергический энцефаломиелит и неврит зрительного нерва согласно заявке WO 2000054595 (прототип) следующие:

1) легче обеспечить более высокий и стабильный уровень целевого белка в клетках, при одновременной минимизации вероятности встраивания элементов генетической конструкции в геном пациента.

2) обеспечивается транспортировка генно-терапевтической субстанции в большой спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка генно-терапевтической субстанции при одновременной минимизации вероятности встраивания элементов генетической конструкции в геном пациента.

3) учитываются индивидуальные характеристики пациента.

Таким образом, для создания группы генно-терапевтических субстанций по данному изобретению был выбран ген CAT, а не белок каталаза, кодируемый этим геном.

Для получения группы генно-терапевтических субстанций осуществляют следующие действия:

1. Получение участка нативной кДНК гена CAT, содержащей белок-кодирующую область гена CAT и делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей, клонирование его в промежуточную плазмиду, переклонирование его в экспрессионные векторные плазмиды под контроль эукариотических регуляторных элементов для экспрессии целевого гена таким образом, что полученные генетические конструкции содержат кодирующую нуклеотидную последовательность кДНК белка каталазы, которая является участком нативной немодифицированной кДНК гена CAT и которая используется для дальнейших модификаций.

2. Внесение в последовательность нуклеотидов кДНК гена CAT модификаций с целью создания ряда кДНК гена CAT, обеспечивающих достаточный для борьбы с патологическими проявлениями уровень трансляции белка каталазы.

3. Клонирование участка нативной немодифицированной кДНК гена CAT и полученных на его основе модифицированных кДНК гена CAT в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E.coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение ряда генетических конструкций, содержащих модифицированные кДНК гена CAT и участок нативной немодифицированной кДНК гена CAT для создания на их базе группы генно-терапевтических субстанций.

6. Создание группы генно-терапевтических субстанций, каждая из которых включает генетическую конструкцию с модифицированными кДНК гена CAT и участок нативной немодифицированной кДНК гена CAT, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена CAT, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки полости рта, или клеток эпителия роговицы глаза.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки полости рта, или клеток эпителия роговицы глаза и анализ экспрессии гена CAT из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки полости рта, или клеток эпителия роговицы глаза генно-терапевтическими субстанциями содержащими участок нативной немодифицированной кДНК гена CAT и/или модифицированные кДНК гена CAT и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена CAT в различных комбинациях.

D) Сравнительный анализ изменения уровня мРНК гена CAT и/или изменения активности белка каталазы, после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки полости рта, или клеток эпителия роговицы глаза генно-терапевтическими субстанциями содержащими участок нативной немодифицированной кДНК гена CAT и/или модифицированные кДНК гена CAT и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена CAT Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента генно-терапевтической субстанции.

E) Введение пациентам в органы и ткани культуры клеток трансфицированных генно-терапевтической субстанцией с кДНК гена CAT, например, введение, в кожу человека, аутологичных фибробластов, трансфицированных генно-терапевтической субстанцией с кДНК гена САТ и параллельное введение пациентам в органы и ткани, например, в кожу, культур этих же клеток нетрансфицированных и трансфицированных вектором без вставки кДНК гена CAT и/или введение пациентам в органы и ткани генно-терапевтических субстанций, например, введение в кожу человека генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена CAT и/или модифицированные кДНК CAT, а также плацебо в различных комбинация.

F) Сравнительный анализ активности белка каталазы, в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных генно-терапевтическими субстанциями, содержащими кДНК гена CAT и векторными плазмидами, не содержащими кДНК гена CAT и/или генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена CAT или модифицированные кДНК гена CAT, а также плацебо.

G) Введение пациентам в органы и ткани, например, в слизистую оболочку полости рта или мышечную ткань, генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена CAT и/или модифицированных кДНК гена CAT, а также плацебо.

H) Сравнительный анализ активности белка каталазы, в органах и тканях человека, в частности в слизистой оболочке полости рта, или мышечной ткани человека, после введения генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена CAT и/или участки модифицированных кДНК гена САТ а также плацебо.

I) Введение пациентам в органы и ткани, например, введение в кожу пациента генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена CAT и участки модифицированных кДНК гена CAT

J) Сравнительный анализ активности белка каталазы, в органах и тканях пациента, в частности в коже, после введения генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена CAT и участки модифицированных кДНК гена CAT Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента генно-терапевтической субстанции из группы генно-терапевтических субстанций.

Пример 1.

Получение и клонирование нативной немодифицированной кДНК гена CAT.

Немодифицированная кДНК гена CAT представляет собой последовательность нуклеотидов, которая имеет высокую гомологию с нуклеотидной последовательностью гена и мРНК CAT, приведенной в базе данных GenBank под номером NM_001752; нуклеотиды с 90 по 1673 транслируются в аминокислотную последовательность белка каталазы, соответствующую приведенной в GenBank под номером NP_NP_001743.1.

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) и используют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно кинированные праймеры, комплементарные нуклеотидам 24-46 5' GCTGAGGGTGGAGACCCACG 3' (CAT-F1) и 1710-1691 5' ACGCTAAGCTTCGCTGCACA 3' (CAT-R1) из последовательности мРНК CAT (GenBank NM_001752), получают участок нативной немодифицированной кДНК гена CAT, содержащий кодирующую последовательность белка каталазы, и частичные делеции 5'- и 3'-нетранслируемых областей. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами, на амплификаторе Master CyclerGradient (Eppendorf, USA) в 50 мкл. реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера CAT F1 и CAT R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (pH 8,85 при 20°C), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific, USA) при следующих условиях: первоначальная денатурация при +98°C в течение 30 сек., 35 циклов, включающих денатурацию при +98°C в течение 10 сек., отжиг праймеров при +65°C в течение 30 сек. и элонгацию при +68°C течение 2 минут.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany)

Амплифицированный фрагмент кДНК длиной 1684 н.п., несущий участок нативной немодифицированной кДНК гена CAT, клонируют в плазмидном векторе pUC19 (NEB, USA, кат номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, кат. номер N3041S) гидролизуют рестриктазой, дающей тупые концы, например, Smal (NEB, USA) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага Т4 400000 ед./мл. (NEB, USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис -HCl, pH 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°C.

Полученной смесью трансформируют компетентные клетки E.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки Петри с L-агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами CAT--F1 и CAT--R1 и подтверждают секвенированием по методу Сэнгера.

Пример 2.

Получение генетических конструкций с участком немодифицированной кДНК гена CAT

Для экспрессии участка немодифицированной кДНК гена CAT в клетках органов и тканей человека вариант кДНК гена CAT по Примеру 1 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E.coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции, либо другой фактор селекции не содержащий генов резистентности к антибиотикам;

3) в плазмиде должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) в плазмиде должно быть наличие удобного полилинкера для клонирования. Примером такой плазмиды может быть pCMV6-XL5, pCMV6-Kan/Neo (OriGene, USA) или pCDNA 3.1 (+) (ThermoFisherScientific, USA), либо плазмидные векторы вирусного происхождения - например, аденовирус человека 5-го серотипа;

5) Плазмида может содержать нуклеотидные последовательности с регуляторными элементами для репликации в клетках млекопитающих, например, такие как SV40 ori из вируса обезьян SV40 или ori P/EBNA-1 из вируса Эпштейн-Барра человека;

6) Плазмида также может содержать дополнительные регуляторные элементы, усиливающие трансляцию белка, например, участки связывания с транскрипционным фактором NFkB, обеспечивающим активный транспорт плазмидной ДНК в клеточное ядро для более эффективной транскрипции целевого гена.

При клонировании участка немодифицированной кДНК гена CAT в pCDNA 3.1 (+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину.

При клонировании участка немодифицированной кДНК гена CAT в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину.

Векторную плазмиду pUC19-CAT с участком нативной немодифицированной последовательности кДНК гена CAT используют в качестве матрицы для амплификации со следующими парами праймеров:

1 пара для ориентации Xbal - CAT - Sacl:

2 пара для ориентации Sacl - CAT - Xbal

Амплификацию проводят при условиях, приведенных в Примере 1. Далее продукты амплификации переосаждают этиловым спиртом, осадки промывают 70% этанолом и растворяют в 1х ТЕ буфере, после чего подвергают рестрикции с эндонуклеазами Sacl и Xbal.

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке Xbal-5'NTR- кДНК CAT-3'NTR- Sacl, либо Sacl -5'NTR-кДНК CAT-3'NTR- Xbal и линеаризованной плазмиде pCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1(+), вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit (Qiagen, Germany) и смешивают. Полученную смесь рестрикционных фрагментов легируют с помощью ДНК-лигазы фага Т4. Легирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°C в течение 10 ч. Легированную ДНК используют для трансформации клеток Е. coli по стандартной методике с использованием хлористого кальция (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984). Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit (Qiagen, Germany), анализируют с помощью гидролиза рестриктазами Sacl и Xbal и отбирают генетическую(ие) конструкцию(ии) с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Таким образом, получают экспрессионые генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), которые содержат нуклеотидную последовательность длиной 1584 н.п. с первичной структурой, приведенной на фиг. 1 Seq ID No 1.

Пример 3.

Модификации кДНК гена CAT в генетических конструкциях для получения на их основе генно-терапевтических субстанций.

Модификации проводят таким образом, чтобы не затрагивать первичную структуру белка каталазы, а именно, нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности для получения модифицированных кДНК гена CAT с целью повышения эффективности транскрипции и трансляции белка каталазы, в клетках тканей и органов человека в участок нативной последовательности кДНК гена CAT, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChCATe II XL kit или QuikChCATe Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA,) согласно рекомендациям производителя.

http://www.agilent.com/cs/library/usermanuals/Public/200513.

К плазмидной ДНК, полученной по Примеру 2, в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 19-45 н.п. и проводят ПЦР в буфере QuikChCATe Multi reaction buffer (AgilentTechnologies, USA) со смесью ферментов QuikChCATe Multi mix (AgilentTechnologies, USA) при следующих условиях: 95°C, 1 мин; далее от 30 до 35 циклов: 95°C 1 минута, 55°C 1 минута, 65°C 2 минуты/1000 н.п. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°C. Полученной смесью трансформируют компетентные клетки E.coli Тор10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L-агаром, содержащих 100 мкг/мл ампициллина. Трансформированные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК гена CAT SEQ ID No 2 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-CAT Seq ID No 1, pCMV6-Kan/Neo-CAT Seq ID No 1 и pCDNA 3.1(+)- CAT Seq ID No 1 с праймерами, комплементарными участкам нативной кДНК гена CAT, приведенной в GenBank под номером NM_001752:

1. CAT 137-163 F:

Комплементарный нуклеотидам 137-163, с заменой G→C в позиции 152;

2. CAT 183-210F:

Комплементарный нуклеотидам 183-210, с заменой A→G в позиции 194;

3. CAT217-250F:

Комплементарный нуклеотидам 217-250, с заменами A→G в позиции 221 и T→G в позиции 230.

4. 4. CAT 272-300F:

Комплементарный нуклеотидам 272-300, с заменой A→G в позиции 287;

Модифицированная таким образом нуклеотидная последовательность кДНК CAT SEQ ID No: 2 содержит 1 нуклеотидную замену G→C в позиции 152, 1 нуклеотидную замену T→G в позиции 230 и 3 нуклеотидных замены A→G в позициях 194, 221 и 287, не приводящие к изменениям в аминокислотной последовательности белка каталазы и имеет первичную структуру, приведенную на фиг. 2:

Для получения модифицированной кДНК гена CAT SEQ ID No 3 проводят последовательный ПЦР-мутагенез на плазмидах PCMV6-XL5-CAT Seq ID No 1, pCMV6-Kan/Neo-CAT Seq ID No 1 и pCDNA 3.1(+)-CAT Seq ID No 1 с праймерами, комплементарными участкам нативной кДНК гена CAT, приведенной в GenBank под номером NM_001752:

1. CAT 137-163 F:

Комплементарный нуклеотидам 137-163, с заменой G→C в позиции 152;

2. CAT 183-210F:

Комплементарный нуклеотидам 183-210, с заменой A→G в позиции 194;

3. CAT217-250F:

Комплементарный нуклеотидам 217-250, с заменами A→G в позиции 221 и T→G в позиции 230.

4. CAT272-300F:

Комплементарный нуклеотидам 272-300, с заменой A→G в позиции 287;

5. CAT375-400F:

Комплементарный нуклеотидам 375-390, с заменой A→G в позиции 386;

6. CAT441-460F:

Комплементарный нуклеотидам 441-460, с заменой G→C в позиции 449;

7. CAT469-494F:

Комплементарный нуклеотидам 469-494, с заменой T→G в позиции 479;

8. CAT555-580F:

Комплементарный нуклеотидам 555-580, с заменой А→С в позиции 566;

Модифицированная таким образом нуклеотидная последовательность кДНК CAT SEQ ID No: 3 содержит 2 нуклеотидных замены G→C в позициях 152, 449; 2 нуклеотидных замены T→G в позициях 230, 479; 4 нуклеотидных замены A→G в позициях 194, 221, 287, 386; 1 нуклеотидную замену А→С в позиции 566; не приводящие к изменениям в аминокислотной последовательности белка каталазы, и имеет первичную структуру, приведенную на фиг. 3.

Для получения модифицированной кДНК гена CAT SEQ ID No 4 проводят последовательный ПЦР-мутагенез на плазмидах PCMV6-XL5-CAT Seq ID No 1, pCMV6-Kan/Neo-CAT Seq ID No 1 и pCDNA 3.1(+)- CAT Seq ID No 1 с праймерами, комплементарными участку нативной кДНК гена CAT, приведенной в GenBank под номером NM_001752:

1. CAT 137-163 F:

Комплементарный нуклеотидам 137-163, с заменой G→C в позиции 152;

2. CAT183-210F:

Комплементарный нуклеотидам 183-210, с заменой A→G в позиции 194;

3. CAT 217-250F:

Комплементарный нуклеотидам 217-250, с заменами A→G в позиции 221 и T→G в позиции 230.

4. CAT 272-300F:

Комплементарный нуклеотидам 272-300, с заменой A→G в позиции 287;

5. CAT 375-400F:

Комплементарный нуклеотидам 375-390, с заменой A→G в позиции 386;

6. CAT 441-460F:

Комплементарный нуклеотидам 441-460, с заменой G→C в позиции 449;

7. CAT 469-494F:

Комплементарный нуклеотидам 469-494, с заменой T→G в позиции 479;

8. CAT 555-580F:

Комплементарный нуклеотидам 555-580, с заменой А→С в позиции 566;

Комплементарный нуклеотидам 555-580, с заменой А→С в позиции 566;

9. CAT 617-640F:

Комплементарный нуклеотидам 616-640, с заменой G→C в позиции 626;

10. CAT 637-675F:

Комплементарный нуклеотидам 637-675, с заменами A→G в позиции 653 и T→G в позиции 656;

11. CAT 831-859F:

Комплементарный нуклеотидам 831-859, с заменами G→C в позициях 839 и 842;

12. CAT 1029-1056F:

Комплементарный нуклеотидам 1029-1056, с заменами A→G в позиции 1043 и Т→С в позиции 1041;

Модифицированная таким образом нуклеотидная последовательность кДНК CAT SEQ ID No: 4 содержит 5 нуклеотидных замены G→C в позициях 152, 449, 626, 839, 842; 3 нуклеотидных замены T→G в позициях 230, 479, 653; 6 нуклеотидных замены A→G в позициях 194, 221, 287, 386, 653, 1043; 1 нуклеотидную замену А→С в позиции 566;; 1 нуклеотидную замену Т→С в позиции 1041; не приводящие к изменениям в аминокислотной последовательности белка каталазы, и имеет первичную структуру, приведенную на фиг. 4.

Для получения модифицированной кДНК гена CAT SEQ ID No 5 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-CAT Seq ID No 1, pCMV6-Kan/Neo-CAT Seq ID No 1 и pCDNA 3.1(+)- CAT Seq ID No 1 с праймерами, комплементарными участкам нативной кДНК гена CAT, приведенной в GenBank под номером NM_001752:

1. CAT 137-163 F:

Комплементарный нуклеотидам 137-163, с заменой G→C в позиции 152;

2. CAT 183-210F:

Комплементарный нуклеотидам 183-210, с заменой A→G в позиции 194;

3. CAT 217-250F:

Комплементарный нуклеотидам 217-250, с заменами A→G в позиции 221 и T→G в позиции 230.

4. CAT 272-300F:

Комплементарный нуклеотидам 272-300, с заменой A→G в позиции 287;

5. CAT 375-400F:

Комплементарный нуклеотидам 375-390, с заменой A→G в позиции 386;

6. CAT 441-460F:

Комплементарный нуклеотидам 441-460, с заменой G→C в позиции 449;

7. CAT 469-494F:

Комплементарный нуклеотидам 469-494, с заменой T→G в позиции 479;

8. CAT 555-580F:

Комплементарный нуклеотидам 555-580, с заменой А→С в позиции 566;

Комплементарный нуклеотидам 555-580, с заменой А→С в позиции 566;

9. CAT 617-640F:

Комплементарный нуклеотидам 616-640, с заменой G→С в позиции 626;

10. CAT 637-675F:

Комплементарный нуклеотидам 637-675, с заменами A→G в позиции 653 и T→G в позиции 656;

11. CAT 831-859F:

Комплементарный нуклеотидам 831-859, с заменами G→C в позициях 839 и 842;

12. CAT 1029--1056F:

Комплементарный нуклеотидам 1029-1056, с заменами A→G в позиции 1043 и Т→С в позиции 1041;

13. CAT 1077-1099F:

Комплементарный нуклеотидам 1077-1099, с заменой А→С в позиции 1085;

14. CAT 1198-1223F:

Комплементарный нуклеотидам 1198-1223, с заменой А→С в позиции 1208;

15. CAT 1214--1252F:

Комплементарный нуклеотидам 1029-1055, с заменами A→G в позиции 1235 и T→G в позиции 1229;

16. CAT 1246--1276F:

Комплементарный нуклеотидам 1246-1276, с заменами T→G в позиции 1253 и G→C в позиции 1262;

Модифицированная таким образом нуклеотидная последовательность кДНК CAT SEQ ID No: 5 содержит 6 нуклеотидных замены G→С в позициях 152, 449, 626, 839, 842, 1262; 5 нуклеотидных замены T→G в позициях 230, 479, 653, 1229, 1253; 7 нуклеотидных замены A→G в позициях 194, 221, 287, 386, 653, 1043, 1235; 3 нуклеотидных замены А→С в позициях 566, 1085, 1208; 1 нуклеотидную замену Т→С в позиции 1041; не приводящие к изменениям в аминокислотной последовательности белка каталазы, и имеет первичную структуру, приведенную на фиг. 5.

Для получения модифицированной кДНК гена CAT SEQ ID No 6 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-CAT Seq ID No 1, pCMV6-Kan/Neo-CAT Seq ID No 1 и pCDNA 3.1(+)- CAT Seq ID No 1 с праймерами, комплементарными участкам нативной кДНК гена CAT, приведенной в GenBank под номером NM_001752:

1. CAT 137-163 F:

Комплементарный нуклеотидам 137-163, с заменой G→C в позиции 152;

2. CAT 183-210F:

Комплементарный нуклеотидам 183-210, с заменой A→G в позиции 194;

3. CAT 217-250F:

Комплементарный нуклеотидам 217-250, с заменами A→G в позиции 221 и T→G в позиции 230.

4. CAT 272-300F:

Комплементарный нуклеотидам 272-300, с заменой A→G в позиции 287;

5. CAT 375-400F:

Комплементарный нуклеотидам 375-390, с заменой A→G в позиции 386;

6. CAT 441-460F:

Комплементарный нуклеотидам 441-460, с заменой G→C в позиции 449;

7. CAT 469-494F:

Комплементарный нуклеотидам 469-494, с заменой T→G в позиции 479;

8. CAT 555-580F:

Комплементарный нуклеотидам 555-580, с заменой А→С в позиции 566;

9. CAT 617-640F:

Комплементарный нуклеотидам 616-640, с заменой G→C в позиции 626;

10. CAT 637-675F:

Комплементарный нуклеотидам 637-675, с заменами A→G в позиции 653 и T→G в позиции 656;

11. CAT 831-859F:

Комплементарный нуклеотидам 831-859, с заменами G→C в позициях 839 и 842;

12. CAT 1029--1056F:

Комплементарный нуклеотидам 1029-1056, с заменами А→G в позиции 1043 и Т→С в позиции 1041;

13. CAT 1077-1099F:

Комплементарный нуклеотидам 1077-1099, с заменой А→С в позиции 1085;

14. CAT 1198-1223F:

Комплементарный нуклеотидам 1198-1223, с заменой А→С в позиции 1208;

15. CAT 1214--1252F:

Комплементарный нуклеотидам 1029-1055, с заменами A→G в позиции 1235 и T→G в позиции 1229;

16. CAT 1246--1276F:

Комплементарный нуклеотидам 1246-1276, с заменами T→G в позиции 1253 и G→C в позиции 1262;

17. CAT 1317-1336F:

Комплементарный нуклеотидам 1317-1336, с заменой G→C в позиции 1325;

18. CAT 1453-1476F:

Комплементарный нуклеотидам 1453-1476, с заменой T→G в позиции 1463;

19. CAT 1513-1537F:

Комплементарный нуклеотидам 1513-1537, с заменой G→C в позиции 1523;

Модифицированная таким образом нуклеотидная последовательность кДНК CAT SEQ ID No: 6 содержит 8 нуклеотидных замен G→C в позициях 152, 449, 626, 839, 842, 1262, 1325, 1523; 6 нуклеотидных замены T→G в позициях 230, 479, 653, 1229, 1253, 1463; 7 нуклеотидных замены A→G в позициях 194, 221, 287, 386, 653, 1043, 1235; 3 нуклеотидных замены А→С в позициях 566, 1085, 1208; 1 нуклеотидную замену Т→С в позиции 1041; не приводящие к изменениям в аминокислотной последовательности белка каталазы, и имеет первичную структуру, приведенную на фиг. 6.

Для получения модифицированной кДНК гена CAT SEQ ID No 7 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-CAT Seq ID No 1, pCMV6-Kan/Neo-CAT Seq ID No 1 и pCDNA 3.1(+)- CAT Seq ID No 1 с праймерами, комплементарными участкам нативной кДНК гена CAT, приведенной в GenBank под номером NM_001752:

1. CAT 137-163 F:

Комплементарный нуклеотидам 137-163, с заменой G→C в позиции 152;

2. CAT 183-210F:

Комплементарный нуклеотидам 183-210, с заменой A→G в позиции 194;

3. CAT 217-250F:

Комплементарный нуклеотидам 217-250, с заменами A→G в позиции 221 и T→G в позиции 230.

4. CAT 272-300F:

Комплементарный нуклеотидам 272-300, с заменой A→G в позиции 287;

5. CAT 375-400F:

Комплементарный нуклеотидам 375-390, с заменой A→G в позиции 386;

6. CAT 441-460F:

Комплементарный нуклеотидам 441-460, с заменой G→C в позиции 449;

7. CAT 469-494F:

Комплементарный нуклеотидам 469-494, с заменой T→G в позиции 479;

8. CAT 555-580F:

Комплементарный нуклеотидам 555-580, с заменой А→С в позиции 566;

Комплементарный нуклеотидам 555-580, с заменой А→С в позиции 566;

9. CAT 617-640F:

Комплементарный нуклеотидам 616-640, с заменой G→C в позиции 626;

10. CAT 637-675F:

Комплементарный нуклеотидам 637-675, с заменами A→G в позиции 653 и T→G в позиции 656;

11. CAT 831-859F:

Комплементарный нуклеотидам 831-859, с заменами G→C в позициях 839 и 842;

12. CAT 1029--1056F:

Комплементарный нуклеотидам 1029-1056, с заменами A→G в позиции 1043 и Т→С в позиции 1041;

13. CAT 1077-1099F:

Комплементарный нуклеотидам 1077-1099, с заменой А→С в позиции 1085;

14. CAT 1198-1223F:

Комплементарный нуклеотидам 1198-1223, с заменой А→С в позиции 1208;

15. CAT 1214--1252F:

Комплементарный нуклеотидам 1029-1055, с заменами A→G в позиции 1235 и T→G в позиции 1229;

16. CAT 1246--1276F:

Комплементарный нуклеотидам 1246-1276, с заменами T→G в позиции 1253 и G→C в позиции 1262;

17. CAT 1317-1336F:

Комплементарный нуклеотидам 1317-1336, с заменой G→C в позиции 1325;

18. CAT 1453-1476F:

Комплементарный нуклеотидам 1453-1476, с заменой T→G в позиции 1463;

19. CAT 1513-1537F:

Комплементарный нуклеотидам 1513-1537, с заменой G→C в позиции 1523;

20. CAT 1605-1628F:

Комплементарный нуклеотидам 1605-1628, с заменой G→C в позиции 1613;

21. CAT 1635-1662F:

Комплементарный нуклеотидам 1635-1662, с заменой G→C в позиции 1649;

Модифицированная таким образом нуклеотидная последовательность кДНК CAT SEQ ID No: 7 содержит 10 нуклеотидных замен G→C в позициях 152, 449, 626, 839, 842, 1262, 1325, 1523, 1613, 1649; 6 нуклеотидных замены T→G в позициях 230, 479, 653, 1229, 1253, 1463; 7 нуклеотидных замены A→G в позициях 194, 221, 287, 386, 653, 1043, 1235; 3 нуклеотидных замены А→С в позициях 566, 1085, 1208; 1 нуклеотидную замену Т→С в позиции 1041; не приводящие к изменениям в аминокислотной последовательности белка каталазы, и имеет первичную структуру, приведенную на фиг. 7.

Таким образом, получают экспрессионные векторы на базе плазмид pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), в которых клонированы участок нативной немодифицированной кДНК гена CAT (SEQ ID No: 1) и модифицированные нуклеотидные последовательности кДНК гена CAT (SEQ ID No: 2, 3, 4, 5, 6, 7), кодирующие белок каталазу.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Полученные экспрессионные векторы используют для создания на их основе генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6 - XL5, (pCMV6-Kan/Neo) или pCDNA 3.1 (+) без вставки кДНК гена CAT.

Пример 4.

Наращивание генетической конструкции в бактериальной культуре.

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена CAT, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E.coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена CAT в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами EcoRI и HindIII и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (клеток эпителия слизистой оболочки полости рта, или клеток эпителия роговицы глаза и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E.coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°C и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5.

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции генно-терапевтической субстанцией и анализа экспрессии гена CAT.

Для последующей трансфекции генно-терапевтической субстанцией содержащей один из вариантов кДНК гена CAT по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например, за ушной раковиной или с боковой внутренней поверхности в зоне локтевого сустава, размером около 3 мм, массой - до 20 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°C в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°C в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена CAT, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAlater и хранили при 4°C в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260: D280 - не менее 1,8, а соотношение полос 28S: 18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК. В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6.

Анализ эндогенной экспрессии гена CAT в культуре первичных фибробластов.

Анализ экспрессии гена CAT из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена CAT

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена CAT и фибробласты с нормальной экспрессией гена CAT, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК (542-642 н.п.), специфичной для гена CAT, используют прямой праймер CAT FA1 5' TCATCAGGGATCCCATATTGTT 3' и обратный праймер CAT-RA1 5' CCTTCAGATGTGTCTGAGGATTT 3'

Длина продукта амплификации -72 нуклеотид. В качестве референтного гена используют ген бета-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена CAT.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого прймера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°C 30 минут, денатурация 98°C -15 мин., затем 40 циклов, включающих денатурацию 94°C - 15 сек., отжиг праймеров 60°C - 30 сек. и элонгацию 72°C - 30 сек.

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов CAT и В2М. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны). Количество ПЦР продуктов - кДНК генов CAT и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.

По итогам анализа экспрессии гена CAT в разных культурах фибробластов (с низкой экспрессией гена CAT и с нормальной экспрессией гена CAT) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена CAT, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7.

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена CAT генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена CAT в культуре данных клеток.

Для оценки эффективности генно-терапевтической субстанции, содержащей немодифицированную кДНК гена CAT по примеру 2, этой генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена CAT, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют генно-терапевтической субстанцией на основе pCMV6- CAT SEQ ID No: 1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4 × 105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°C и в атмосфере, содержащей 5% CO2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, pH 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°C.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°C и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°C и в атмосфере, содержащей 5% CO2, после чего оценивали уровень кДНК гена CAT и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена CAT уровень кДНК гена CAT в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена CAT - уровень кДНК фибробластов со сниженной экспрессией гена CAT многократно увеличился (до уровня выше, чем уровень кДНК гена CAT в нормальных фибробластах).

Показано, что в клетках трансфицированных генно-терапевтической субстанцией на основе pCMV6- CAT SEQ ID No: 1 наблюдается усиление экспрессии целевого гена CAT

Пример 8.

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена CAT генно-терапевтической субстанцией с кДНК гена CAT с целью подтверждения увеличения активности каталазы в культуре данных клеток.

Для оценки изменения уровня активности каталазы, использовали культуру фибробластов кожи человека по Примеру 5, в качестве транспортной молекулы - дендримеры SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия), в качестве контроля - водный раствор дендримеров без плазмидной ДНК (А), векторную плазмиду pCDNA 3.1(+), не содержащую кДНК гена CAT (В), в качестве трансфицируемых агентов - генно-терапевтическую субстанцию на основе векторной плазмиды pCDNA 3.1(+), содержащую кДНК гена CAT - pCDNA 3.1 CAT EQ ID No: 1(C), Приготовление комплекса ДНК-дендример и трансфекцию фибробластов проводили согласно Примеру 7.

После трансфекции к 0,5 мл культуральной жидкости приливали 0,1 мл 1N HCl, тщательно перемешивали и инкубировали 10 минут при комнатной температуре. Затем нейтрализовывали смесь, добавляя 0,1 мл 1.2N NaOH/0.5M HEPES (pH 7-7,6) и тщательно перемешивали.

Данную смесь использовали для определения активности каталазы, которое проводили колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abcam, США) согласно методике производителя http://www.abcam.com/ps/products/83/ab83464/documents/ab83464%20Catalase%20Activitv%20Assay%20Kit%20(Colorimetric%20fluorometric)%20protocol%20v8%20(website).pdf Каталаза из образца вступает в реакцию с H2O2, а непрореагировавший остаток H2O2 вступает в реакцию с зондом для получения продукта, который измеряется колориметрически при OD 570 нм на микроплашечном ридере. Значение активности каталазы обратно пропорционально полученному сигналу.

Статистическую обработку полученных результатов, осуществляли с помощью программного обеспечения для статистической обработки и визуализации данных R, версия 3.0.2 (https://www.r-project.org/).

Таким образом, показано, что транфекция фибробластов полученной генно-терапевтической субстанцией, несущей кДНК гена CAT, приводит к увеличению активности каталазы в клетках фибробластов. Результаты показаны на фигуре 10.

Пример 9.

Введение в кожу человека клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией с кДНК гена CAT с целью подтверждения увеличения после этого активности каталазы в биоптате кожи человека.

С целью анализа изменения уровня экспрессии гена CAT в тканях человека, пациентам в кожу предплечья вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных генно-терапевтической субстанцией на основе pCMV6- CAT SEQ ID No: 7(C) в комбинации с транспортными молекулами - липосомами TRANSFAST ТМ Transfection Reagent (PROMEGA, USA),

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°C, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°C и использовали далее в качестве генно-терапевтической субстанции.

Для последующей трансфекции клеток генно-терапевтической субстанцией выращивали первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосимы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°C и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°C в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга.

Оценку активности белка каталазы проводили в лизатах биоптатов кожи пациента колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl pH 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для определения активности целевого белка.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией на основе pCMV6- CAT SEQ ID No: 7, произошло увеличение активности каталазы, что может свидетельствовать об усилении экспрессии гена CAT. Тогда как при введении контрольных культур фибробластов (нетрансфицированных и трансфицированных вектором без вставки кДНК гена CAT pCMV6-XL5) активность каталазы, в коже не изменялась.

Таким образом, показана эффективность генно-терапевтической субстанции при введении в кожу человека клеточной культуры фибробластов, трансфицированных полученной генно-терапевтической субстанцией, несущей модифицированную кДНК гена CAT, что приводит к повышению уровня экспрессии гена CAT и активности каталазы в коже в зоне введения.

Пример 10.

Трансфекция культур фибробластов из биоптатов группы различных пациентов генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена CAT и участок нативной немодифицированной кДНК гена CAT.

С целью подтверждения индивидуального характера увеличения экспрессии гена CAT до различного уровня при трансфекции клеточных культур фибробластов пациентов генно-терапевтическими субстанциями с модифицированными кДНК гена CAT и участком нативной кДНК гена CAT анализировали активность белка каталазы в клеточных лизатах фибробластов, трансфицированных разными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные кДНК гена CAT и участок нативной немодифицированной кДНК гена CAT в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена CAT.

Последовательности участка нативной немодифицированной кДНК гена CAT приведены на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК гена CAT приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID NO: 6, SEQ ID No: 7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в зоне локтевого сустава 18 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень белка каталазы в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС pH 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford М.М. (1976) Anal. Biochem. 72: 248-254.]).

Затем каждую из 18-ти культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 1, содержащей немодифицированную кДНК гена CAT (SEQ ID No: 1.) по примеру 2 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 2, содержащей модифицированную кДНК гена CAT (SEQ ID No: 2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

3-ю часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 3, содержащей модифицированную кДНК гена CAT (SEQ ID No: 3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

4-ю часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 4, содержащей модифицированную кДНК гена CAT (SEQ ID No: 4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

5-ю часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 5, содержащей модифицированную кДНК гена CAT (SEQ ID No: 5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

6-ю часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 6, содержащей модифицированную кДНК гена CAT (SEQ ID No: 6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

7-ю часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 7, содержащей вариант модифицированную кДНК гена CAT (SEQ ID No: 7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена CAT по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Оценку активности белка каталазы проводили в лизатах биоптатов кожи пациента колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abeam, США), как описано в Примере 8.

По итогам определения активности каталазы выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни экспрессии и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальная активность белка каталазы, наблюдалось при трансфекции немодифицированной кДНК гена С А Т SEQ ID No: 1. В эту группу вошло 2 культуры из 18.

В группе 2 максимальная активность белка каталазы, наблюдалось при трансфекции модифицированной кДНК гена CAT SEQ ID No: 2. В эту группу вошло 2 культуры из 18.

В группе 3 максимальная активность белка каталазы, наблюдалось при трансфекции модифицированной кДНК гена CAT SEQ ID No: 3. В эту группу вошло 3 культуры из 18.

В группе 4 максимальная активность белка каталазы, наблюдалось при трансфекции модифицированной кДНК гена CAT SEQ ID No: 4. В эту группу вошли 3 культуры из 18.

В группе 5 максимальная активность белка каталазы, наблюдалось при трансфекции модифицированной кДНК гена CAT SEQ ID No: 5. В эту группу вошло 2 культуры из 18.

В группе 6 максимальная активность белка каталазы, наблюдалось при трансфекции модифицированной кДНК гена CAT SEQ ID No: 6. В эту группу вошли 4 культуры из 18.

В группе 7 максимальная активность белка каталазы, наблюдалось при трансфекции модифицированной кДНК гена CAT SEQ ID No: 7. В эту группу вошло 2 культуры из 18.

Ни в одной из клеточных культур, трансфицированных генно-терапевтической субстанцией с векторной плазмидой, не содержащей кДНК гена CAT не была обнаружена максимальная активность каталазы, в отличие от клеточных культур, трансфицированных генно-терапевтическими субстанциями с генетическими конструкциями, содержащими кДНК гена CAT.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей активности каталазы, (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и участок нативной кДНК гена CAT.

Из данного примера следует, что достижение максимального уровня активности каталазы в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена CAT, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 11.

Введение в клеточную культуру эпителиальных клеток глаза человека генно-терапевтической субстанции с кДНК гена CAT с целью подтверждения при этом увеличения экспрессии гена CAT.

Биопсийный материал из области лимба в виде круга диаметром 1-1.5 мм помещали в чашку Петри в сбалансированный солевой раствор Хэнкса, добавляли диспазу (20 мкл 25 ед/мл) и гентамицин и инкубировали 24 часа при +4. Затем отделяли эпителиальный слой от стромы и нарезали обе ткани кусочками 1-2 мм3.

Суспензию эпителиальных клеток получали путем инкубирования кусочков тканей в растворе Трипсин-ЭДТА в течение 15 минут при +37°C. Трипсинизацию останавливали добавлением соевого ингибитора трипсина в PBS. Клеточные суспензии отмывали центрифугированием при 700 об/мин и ресуспендировали в бессывороточной среде DMEM с гентамицином. Клетки растили в 25 см2 флаконах с 5 мл среды при 37°C и в атмосфере, содержащей 5% CO2. Через 24 часа среду с не прикрепившимися клетками удаляли и добавляли 5 мл свежей среды. Пересев производили каждые 7 дней в соотношении 1:2 - 1:3.

Трансфекцию этой клеточной культуры проводили генно-терапевтической субстанцией на основе плазмиды pCMV6-Kan/Neo CAT SEQ ID No: 2, используя в качестве транспортной молекулы РАМАМ-дендримеры (Weihai CY Dendrimer Technology). В качестве контроля использовали плазмиду pCMV6- Kan/Neo без кДНК гена CAT.

Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК проводили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена CAT проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-RadUSA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение экспрессии (транскрипции) гена CAT наблюдали на 3 сутки.

На фигуре 13 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена CAT в эпителиальных клетках роговицы.

Показано, что, в клеточной культуре эпителия эндометрия человека, трансфицированной генно-терапевтической субстанцией с кДНК гена CAT, произошло увеличение экспрессии гена CAT при использовании генно-терапевтической субстанции с кДНК гена CAT

Пример 12.

Трансфекция клеточной культуры эпителия слизистой оболочки полости рта генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена CAT в данной культуре клеток.

С целью выяснения эффективности генно-терапевтической субстанции, содержащей кДНК гена CAT, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали эпителий слизистой оболочки полости рта человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биоптаты слизистой оболочки полости рта массой 40 мг измельчали на фрагменты до 10 мм3. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37 оС в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37оС в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры клеток эпителия после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 105 клеток.

Для трансфекции клеток генно-терапевтической субстанцией содержащей кДНК гена CAT использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci. 2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-N-(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6- Kan/Neo CAT SEQ ID No: 3 с модифицированной кДНК гена CAT SEQ ID No: 3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена CAT проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение транскрипции CAT наблюдали на 4 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена CAT.

Показано, что в клетках эпителия слизистой оболочки полости рта, трансфицированных генно-терапевтической субстанцией на основе pCMV6- Kan/Neo CAT SEQ ID No: 3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается увеличение экспрессии целевого гена CAT.

Пример 13.

Введение в кожу человека генно-терапевтической субстанции с кДНК гена CAT с целью подтверждения при этом увеличения уровня активности каталазы в коже человека.

С целью анализа увеличения уровня активности каталазы пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена CAT (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена CAT с транспортной молекулой (А) - в кожу предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) no примеру 9. Далее генетическую конструкцию pCMV6 CAT SEQ ID No: 4, которая содержит модифицированную кДНК гена CAT (SEQ ID No: 4) и плазмиду pCMV6-XL5, используемую в качестве плацебо - которая не содержит кДНК гена CAT, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Оценку активности белка каталазы проводили в лизатах биоптатов кожи пациента колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее, как описано в примере 9.

Показано, что в коже пациента в области введения генно-терапевтической субстанции с кДНК гена CAT, произошло увеличение активности каталазы, тогда как при введении плацебо, активность каталазы в коже не изменялась, что говорит об увеличении экспрессии гена CAT при использовании генно-терапевтической субстанции с кДНК гена CAT. Результаты отражены на фигуре 15.

Пример 14.

Введение в слизистую оболочку полости рта человека генно-терапевтической субстанции с кДНК гена CAT с целью подтверждения при этом увеличения уровня активности каталазы в слизистой оболочке рта человека.

С целью анализа уровня экспрессии целевого гена CAT пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена CAT (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена CAT с транспортной молекулой (А) - в слизистую оболочку полости рта.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCDNA 3.1 CAT SEQ ID No: 5, которая содержит модифицированную кДНК гена CAT (SEQ ID No: 5), и плазмиду pCDNA 3.1(+), используемую в качестве плацебо, которая не содержит кДНК гена CAT, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1-2 мм в слизистую оболочку полости рта. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,25 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 2-4 см друг от друга.

Оценку активности белка каталазы проводили в лизатах биоптатов слизистой оболочки полости рта пациента колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков слизистой оболочки полости рта в зоне введения генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL), далее по примеру 9.

Показано, что слизистой оболочке полости рта пациента в области введения генно-терапевтической субстанции с кДНК гена CAT, произошло увеличение активности каталазы, тогда как при введении плацебо активность каталазы в слизистой оболочке рта не изменялось, что подтверждает увеличение экспрессии гена CAT при использовании генно-терапевтической субстанции с кДНК гена CAT. Результаты отражены на фигуре 16.

Пример 15.

Введение в мышечную ткань человека генно-терапевтической субстанции с кДНК гена CAT с целью подтверждения при этом увеличения уровня экспрессии целевого гена CAT в мышечной ткани человека.

С целью анализа уровня экспрессии целевого гена CAT пациентам вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена CAT (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена CAT с транспортной молекулой (А) - в мышечную ткань в зоне предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo CAT SEQ ID NO: 6, которая содержит модифицированную кДНК гена CAT (SEQ ID NO: 6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена CAT, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга

Активность белка каталазы измеряли в лизатах биоптатов мышечной ткани пациента колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компания BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения генно-терапевтической субстанции с кДНК гена CAT, произошло увеличение активности белка каталазы, тогда как при введении плацебо активность каталазы в мышечной ткани не изменялась, что подтверждает увеличение экспрессии гена CAT при использовании генно-терапевтической субстанции с кДНК гена CAT. Результаты отражены на фигуре 17

Пример 16.

Введение группе различных пациентов генно-терапевтических субстанций содержащих модифицированные кДНК гена CAT и участок нативной немодифицированной кДНК гена CAT.

С целью подтверждения индивидуального характера увеличения уровня экспрессии целевого гена CAT до различного уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными и немодифицированной кДНК гена CAT анализировали уровень активности белка каталазы, в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена CAT.

Последовательность участка нативной немодифицированной кДНК гена CAT приведена на фигуре 1, SEQ CAT ID No: 1, последовательности модифицированных кДНК гена CAT приведены на фигурах 2-7 (SEQ CAT ID No: 2, SEQ CAT ID No: 3, SEQ CAT ID No: 4, SEQ CAT ID No: 5, SEQ CAT ID NO: 6, SEQ CAT ID No: 7).

При этом генетические конструкции, одна из которых содержит участок нативной немодифицированной кДНК гена CAT (SEQ ID No: 1), вторая генетическая конструкция содержит участок модифицированной кДНК гена CAT (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 4), пятая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID NO: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК в сочетании с транспортными молекулами - липосомами по примеру 9.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 21-го пациента, которые были отобраны в случайном порядке, вводили 7 генно-терапевтических субстанций и плацебо в кожу предплечья.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl pH 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для определения активности целевого белка.

А - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 1, содержащий немодифицированную кДНК гена CAT (SEQ ID No: 1.) по примеру 2 в сочетании с транспортными молекулами - липосомами по примеру 9. В - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 2, содержащий модифицированную кДНК гена CAT (SEQ ID No: 2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. С - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 3, содержащий модифицированную кДНК гена CAT (SEQ ID No: 3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

D - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 4, содержащий модифицированную кДНК гена CAT (SEQ ID No: 4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Е - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 5, содержащий модифицированную кДНК гена CAT (SEQ ID No: 5) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

F - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 6, содержащий модифицированную кДНК гена CAT (SEQ ID No: 6) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

G - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 7, содержащий модифицированную кДНК гена CAT (SEQ ID No: 7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащей кДНК гена CAT по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Активность белка каталазы измеряли в девяти биоптатах кожи от каждого пациента (от А до Н и в биоптате интактной кожи) через 72 часа после введения генно-терапевтических субстанций колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abeam, США), как описано в Примере 8.

По итогам анализа активности белка каталазы, выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни активности белка каталазы и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальная активность белка каталазы, наблюдалось при введении немодифицированной кДНК гена CAT SEQ ID No: 1. В эту группу вошел 2 биоптата из 21.

В группе 2 максимальная активность белка каталазы, наблюдалось при введении модифицированной кДНК гена CAT SEQ ID No: 2. В эту группу вошли 3 биоптата из 21.

В группе 3 максимальная активность белка каталазы, наблюдалось при введении модифицированной кДНК гена CAT SEQ ID No: 3. В эту группу вошли 3 биоптата из 21.

В группе 4 максимальная активность белка каталазы, наблюдалось при введении модифицированной кДНК гена CAT SEQ ID No: 4. В эту группу вошли 4 биоптата из 21.

В группе 5 максимальная активность белка каталазы, наблюдалось при введении модифицированной кДНК гена CAT SEQ ID No: 5. В эту группу вошли 2 биоптата из 21.

В группе 6 максимальная активность белка каталазы, наблюдалось при введении модифицированной кДНК гена CAT SEQ ID No: 6. В эту группу вошли 4 биоптата из 21.

В группе 7 максимальная активность белка каталазы, наблюдалось при введении модифицированной кДНК гена CAT SEQ ID No: 7. В эту группу вошли 3 биоптата из 21.

Ни в одном из биоптатов, в которые были введены генно-терапевтические субстанции плацебо - векторной плазмидой, не содержащей кДНК гена CAT, не была обнаружена максимальная активность белка каталазы, в отличие от биоптатов, в которые были введены генно-терапевтические субстанции с генетическими конструкциями, содержащими кДНК гена CAT.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей активности белка (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и участок нативной кДНК гена CAT.

Из данного примера следует, что достижение максимального уровня активности белка каталазы в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена CAT, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 17.

Трансфекция клеточной линии фибробластов пациента разными генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена CAT и участок нативной немодифицированной кДНК гена CAT с целью персонализированного выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали активность белка каталазы, в клеточных лизатах фибробластов этого пациента, трансфицированных разными генно-терапевтическими субстанциями, содержащими участок нативной немодифицированной кДНК гена CAT и/или модифицированные кДНК гена CAT.

Последовательность участка нативной немодифицированной кДНК гена CAT приведена на фигуре 1, SEQ CAT ID No: 1, последовательности модифицированных кДНК гена CAT приведены на фигурах 2-7 (SEQ CAT ID No: 2, SEQ CAT ID No: 3, SEQ CAT ID No: 4, SEQ CAT ID No: 5, SEQ CAT ID No: 6, SEQ CAT ID No: 7).

Культуры фибробластов из биоптата пациента вырастили по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС pH 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Затем культуру фибробластов пациента разделили на 8 частей. Первую часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 1, содержащей участок нативной немодифицированной кДНК гена СДТ (SEQ ID No: 1.) по примеру 2 в сочетании с транспортными молекулами - липосомами по примеру 9.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 2, содержащей участок модифицированной кДНК гена CAT (SEQ ID No: 2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Третью часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 3, содержащей модифицированную кДНК гена CAT (SEQ ID No: 3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Четвертую часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 4, содержащей модифицированную кДНК гена CAT (SEQ ID No: 4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Пятую часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 5, содержащей модифицированную кДНК гена CAT (SEQ ID No: 5.) по примеру 3 в сочетании с транспортными молекулами -липосомами по примеру 9.

Шестую часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID NO: 6, содержащей модифицированную кДНК гена CAT (SEQ ID NO: 6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Седьмую часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 7, содержащей модифицированную кДНК гена CAT (SEQ ID No: 7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Восьмую часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена CAT по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение активности белка каталазы, в клеточных лизатах фибробластов пациента проводили через 72 часа после трансфекции колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abeam, США), как описано в Примере 8.

По итогам определения активности белка каталазы, в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой наблюдается максимальная активность белка каталазы, в лизате клеточной культуры и соответственно наблюдается максимальная экспрессия гена CAT. В данном эксперименте максимальная активность белка каталазы в лизате отмечена при трансфекции генно-терапевтической субстанцией на базе pCMV6 CAT SEQ ID No: 1, содержащей немодифицированную кДНК гена CAT, что показано на фиг. 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18.

Введение в кожу пациента различных генно-терапевтических субстанций, содержащих модифицированные кДНК гена CAT и участок нативной немодифицированной кДНК гена CAT с целью выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали активность белка каталазы, в лизатах биоптатов кожи этого пациента, после введения ему в кожу генно-терапевтических субстанций, содержащих модифицированные кДНК гена CAT и/или участок нативной кДНК гена CAT.

Последовательность участка нативной немодифицированной кДНК гена CAT приведена на фигуре 1, SEQ CAT ID No: 1, последовательности модифицированных кДНК гена CAT приведены на фигурах 2-7 (SEQ CAT ID No: 2, SEQ CAT ID No: 3, SEQ CAT ID No: 4, SEQ CAT ID No: 5, SEQ CAT ID No: 6, SEQ CAT ID No: 7).

Пациенту вводили 7 генно-терапевтических субстанций и плацебо в кожу предплечья.

Первая генно-терапевтическоая субстанция (А) на базе pCMV6- SEQ ID No: 1, содержащая участок нативной немодифицированной кДНК гена CAT (SEQ ID No: 1.) по примеру 2 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая генно-терапевтическая субстанция (В) на базе pCMV6- SEQ ID No: 2, содержащая модифицированную кДНК гена CAT (SEQ ID No: 2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Третья генно-терапевтическая субстанция (С) на базе pCMV6- SEQ ID No: 3, содержащая модифицированную кДНК гена CAT (SEQ ID No: 3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Четвертая генно-терапевтическая субстанция (D) на базе pCMV6- SEQ ID No: 4, содержащая модифицированную кДНК гена CAT (SEQ ID No: 4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Пятая генно-терапевтическая субстанция (Е) на базе pCMV6- SEQ ID No: 5, содержащая модифицированную кДНК гена CAT (SEQ ID No: 5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Шестая генно-терапевтическая субстанция (F) на базе pCMV6- SEQ ID No: 6, содержащая модифицированную кДНК гена CAT (SEQ ID No: 6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Седьмая генно-терапевтическая субстанция (G) на базе pCMV6- SEQ ID No: 7, содержащая модифицированную кДНК гена CAT (SEQ ID No: 7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Восьмая векторная плазмида pCMV6-XL5, не содержащая кДНК гена CAT по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит участок нативной немодифицированной кДНК гена CAT (SEQ ID No: 1), вторая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 4), пятая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID NO: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена CAT (SEQ ID No: 7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг.

Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl pH 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для определения активности целевого белка.

Определение активности белка каталазы проводили в девяти биоптатах кожи пациента через 72 часа после введения генно-терапевтических субстанций колориметрическим методом, используя набор Catalase Activity Assay Kit (Colorimetric/Fluorometric) (Abeam, США), как описано в Примере 8.

По итогам определения активности белка каталазы, в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой в кожу наблюдается максимальная активность белка каталазы, в лизате биоптата кожи и соответственно наблюдается максимальная экспрессия гена CAT. В данном эксперименте максимальная активность целевого белка в лизате биоптата кожи отмечена при введении генно-терапевтической субстанции на базе pCMV6 CAT SEQ ID No: 2, содержащей модифицированную кДНК гена CAT, что показано на фигуре 20

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, возникших вследствие недостаточной экспрессии гена CAT, способ его получения и использования.

Созданное средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций с использованием одной из модифицированных кДНК гена CAT или участка нативной немодифицированной кДНК гена CAT позволяет на практике использовать входящие в группу генно-терапевтические субстанции для повышения до необходимого уровня белка каталазы, в различных клетках органов и тканей и/или органах и тканях человека путем увеличения экспрессии гена CAT.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант генно-терапевтической субстанции из созданной группы генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить активность белка каталазы, в клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование генно-терапевтической субстанции с участком нативной немодифицированной кДНК гена CAT не приводит к желаемому изменению уровня активности белка каталазы, в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена CAT, приводящей к более эффективной экспрессии гена CAT.

При использовании заявленной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Группа генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена CAT, повышая активность белка каталазы, в клетках органов и тканей и/или органах и тканях человека в частности, в эритроцитах, или лейкоцитах, или моноцитах, или нейтрофилах, или гепатоцитах, или эпителиальных клетках роговицы, или в нефронах, или в клетках проксимальных почечных канальцев, или в клетках коркового слоя надпочечников, или в нервных клетках, или клетках жировой ткани, или клетках кожи (например, фибробластах), в эпителиальных клетках, или клетках мышечной ткани в сочетании с транспортной молекулой или без нее при трансфекции этими генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в печени, надпочечниках, почках, головном и спинном мозге, глазе, роговице, коже, в крови, в нервной ткани, в жировой ткани, в мышечной ткани, в эпителиальной ткани, в дерме в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена CAT и/или уменьшением активности белка каталазы, на основе генно-терапевтических субстанций с геном CAT, представляющего собой группу генно-терапевтических субстанций, при использовании которых с учетом индивидуальных особенностей пациента, происходит повышение уровня экспрессии гена CAT и/или повышение активности белка каталазы, в клетках органов и тканей и/или органах и тканях организма.

Кроме этого при введении генетических конструкций в отличие от введения непосредственно белка, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Повышение эффективности коррекции уровня активности белка каталазы, в клетках органов и тканей человека достигают за счет того, что при недостаточной активности этого белка вследствие дефекта гена CAT используют не белок, а генетическую конструкцию с кДНК гена CAT, кодирующую этот белок.

Промышленная применимость.

Все приведенные примеры по созданию и использованию созданной группы генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр,

мкл - микролитр

л - литр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е. ф - относительная единица флуоресценции

ГТС - генно-терапевтическая субстанция

1. Средство для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена САТ и/или уменьшением активности белка каталазы, на основе генно-терапевтических субстанций с геном CAT, где клетки органов и тканей выбраны из фибробластов, эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани, представляющее собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CAT, с кодирующей последовательностью белка каталазы, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1 или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие повышение экспрессии гена CAT в эукариотических клетках, в клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

2. Средство по п. 1, отличающееся тем, что каждая генетическая конструкция с модифицированной кДНК гена CAT содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена CAT, которая несет модификации, не затрагивающие структуру белка каталазы, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций, и не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

3. Средство по п. 1, отличающееся тем, что в качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блок-сополимеры.

4. Способ получения средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы, по п. 1, заключающийся в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций по п. 1, при этом получают кДНК гена CAT, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена CAT с кодирующей последовательностью белка каталазы, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1 или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют, или SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

5. Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT и/или уменьшением активности белка каталазы, заключающийся в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/ выбранных из группы созданных генно-терапевтических субстанций по п. 1, или сочетанием обозначенных способов.



 

Похожие патенты:

Изобретение относится к медицине, а именно к фармацевтике, и может быть использовано для подавления окислительного стресса у млекопитающих. Антиоксидантный комплекс по изобретению представляет собой комплекс карнозина с α-липоевой кислотой, полученный путем смешивания α-липоевой кислоты с водным раствором карнозина в эквимолярном соотношении.

Изобретение относится к медицине, а именно к онкологии, и может быть использовано для лечения лучевых повреждений органов малого таза. Для этого системно и местно воздействуют лекарственным средством на область патологического очага, при этом трансвагинально или трансректально вводят ультразвуковой датчик с адаптером, затем через канал адаптера в область патологического процесса проводят инъекционную иглу и вводят однородную жидкую смесь рексода в дозировке от 6,4 млн ЕД до 12,8 млн ЕД совместно с дексаметазоном в дозировке от 6,0 мг до 10,0 мг.

Изобретение относится к фармацевтической, косметической промышленности, а именно к фармацевтической композиции, обладающей антиоксидантной активностью. Фармацевтическая композиция, обладающая антиоксидантной активностью против свободных радикалов, содержащая: a) экстракт семян или семян и листьев Vitis vinifera, содержащий комбинацию флавоноидов катехина и кверцетина в молярном соотношении в диапазоне соответственно от 6:1 до 3:1, или а') экстракт семян или семян и листьев Vitis vinifera, содержащий комбинацию флавоноидов катехина и кверцетина в молярном соотношении в диапазоне соответственно от 7:1 до 4:1, или а'') смесь экстрактов Vitis vinifera а) и а'), или а''') смесь катехина и кверцетина в молярном соотношении в диапазоне соответственно от 7:1 до 3:1, вместе с b) экстрактом листьев маслин Olea europaea L., содержащим гидрокситирозол в количестве в диапазоне от 1% до 30% по массе экстракта, или b') гидрокситирозол в количестве, равном количеству, содержащемуся в экстракте b), в которой отношение а'), или а''), или а''') к b) или b') находится в диапазоне между от 6:1 до 6:3.

Изобретение относится к экспериментальной медицине и может найти применение в космонавтике для поддержания на высоком уровне операторской деятельности космонавтов в условиях не прогнозированного воздействия радиации, а также реабилитации пациентов после протонной терапии опухолей головного мозга.

Изобретение относится к области медицины и фармакологии, в частности к области средств растительного происхождения с широким спектром фармакологического действия, и раскрывает средство, обладающее гиполипидемическим, гепатозащитным и антиоксидантным действием.

Изобретение относится к новому комплексному соединению - 5-гидрокси-3,6-диметилурацила с янтарной кислотой, соответствующему нижеуказанной структурной формуле. Соединение обладает мембраностабилизирующей и антирадикальной активностью, а также уменьшенной токсичностью по сравнению с известными соединениями идентичного назначения: Комплексное соединение получают путем смешивания эквимолярных количеств 5-гидрокси-3,6-диметилурацила с янтарной кислотой в органическом растворителе, с последующим нагреванием реакционной смеси в течение 1 часа при температуре 70°C, охлаждением реакционной смеси и фильтрацией выпавших кристаллов.
Изобретение относится к фармацевтической промышленности, а именно к композиции с антиоксидантной активностью. Композиция с антиоксидантной активностью, содержащая гель из листьев алоэ вера; сок винограда; экстракт зеленого чая; витаминную смесь, содержащую витамин В1, витамин В9, витамин В12 и витамин Е; хлорофилл; кофермент Q10; холин; селен и экстракт из узла пшеницы, содержащий 10% ресвератрола, взятые в определенном количестве.

Изобретение относится к фармацевтической промышленности и касается способа получения антиоксидантного лекарственного препарата в форме таблеток на основе биологически активных соединений (БАС) послеспиртовой зерновой барды.

Группа изобретений относится к полибактериальному пробиотическому препарату, включающему новые штаммы молочнокислых бактерий Lactobacillus gasseri 7/12 NBIMCC No. 8720, Lactobacillus plantarum F12 NBIMCC No 8722 и Lactobacillus helveticus A1, NBIMCC No 8721, обладающему противовоспалительной иммуномодулирующей, гипохолестеринемической, антиоксидантной и антигипертензивной активностью.

Изобретение относится к новому соединению - (5-бром-2-гидроксифенил)метилиденгидразиду 2-[6-метил-4-(тиетан-3-илокси)пиримидин-2-илтио]уксусной кислоты формулы I. Соединение обладает антиоксидантной активностью и обладает стимулирующей защитной активностью фагоцитов.

Настоящее изобретение относится к биотехнологии, в частности к композиции для продукции целевого полипептида в клетке или ткани млекопитающего и способу получения указанного полипептида в клетке или ткани млекопитающего in vitro с применением такой композиции.

Изобретение относится к области биохимии. Описана группа изобретений, включающая фармацевтическую композицию для экспрессии полипептида в клетке млекопитающего и применение композиции для получения лекарственного средства для повышения уровня интересующего полипептида у млекопитающего.

Изобретение относится к области биотехнологии, конкретно к новым иммуногенам на основе перекрывающихся пептидов (OLP), и может быть использовано в медицине для предупреждения или лечения ВИЧ инфекции.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Изобретение относится к области биотехнологии, конкретно к химерному антигенному рецептору (CAR), обладающему специфичностью к CD22, что может быть использовано в медицине.

Изобретения касаются молекулы нуклеиновой кислоты, кодирующей гомодимерный белок, гомодимерного белка, аминокислотной цепи, способной формировать гомодимерный белок, их применения для получения лекарственного средства, клетки-хозяина, фармацевтической и вакцинной композиций, способа получения гомодимерного белка или аминокислотной цепи и способа получения вакцины.

Предложенная группа изобретений относится к области биотехнологии и молекулярной биологии. Предложены набор олигонуклеотидов для синтеза генетической конструкции, предназначенной для коррекции митохондриальной дисфункции, вызванной «основной делецией», генетическая конструкция и способ доставки генетической конструкции в митохондрии клеток человека.

Группа изобретений относится к медицине и может быть использована для лечения сердечной недостаточности с застойными явлениями (CHF), диабета или предиабета in vivo у пациента, нуждающегося в этом.

Изобретение относится к биохимии. Описан способ повышения экспрессии гена сайт-1 мембраносвязанной пептидазы транскрипционных факторов (MBTPS1) в клетках или тканях млекопитающего in vivo или in vitro, включающий: приведение указанных клеток или тканей в контакт по меньшей мере с одним антисмысловым олигонуклеотидом, составляющим в длину от 10 до 30 нуклеотидов, который специфично гибридизуется с комплементарным участком природного антисмыслового полинуклеотида, имеющего последовательность SEQ ID NO: 2, и повышает, за счет этого, экспрессию указанного гена сайт-1 мембраносвязанной пептидазы транскрипционных факторов (MBTPS1) в клетках или тканях млекопитающего in vivo или in vitro.

Изобретение относится к области биотехнологии, конкретно к получению светочувствительного химерного белка, способного включать световой сигнал в сигнальный каскад метаботропного глутаматного рецептора 6 (mGluR6), который является природным компонентом клеточной мембраны ON-биполярных клеток во внутреннем слое сетчатки, что может быть использовано в медицине.

Настоящее изобретение относится к биотехнологии, в частности к выделенной молекуле нуклеиновой кислоты, кодирующей химерный рецептор антигена (CAR), направленный против антигена созревания В-клеток (ВСМА). Настоящее изобретение также раскрывает клетки-хозяева, такие как Т-клетки или натуральные киллеры (NK-клетки), экспрессирующие CAR, и относится к способам разрушения клеток множественной миеломы с использованием указанных клеток. Настоящее изобретение позволяет расширить арсенал средств для лечения множественной миеломы. 12 н. и 10 з.п. ф-лы, 9 ил., 4 табл., 6 пр.

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена САТ иили уменьшением активности белка каталазы, на основе генно-терапевтических субстанций с геном CAT, где клетки органов и тканей выбраны из фибробластов, эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CAT, с кодирующей последовательностью белка каталазы, с делециями 5- и 3-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1 или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций. Группа изобретений также касается способа получения указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT иили уменьшением активности белка каталазы; способа использования указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена CAT иили уменьшением активности белка каталазы. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках при одновременной минимизации вероятности встраивания элементов генетической конструкции в геном пациента. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

Наверх