Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа



Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена col1a2, связанных с количественным снижением белка альфа-2 цепи коллагена i типа
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2649820:

Селл энд Джин Терапи Лтд (GB)
Общество с ограниченной ответственностью "Прорывные Инновационные Технологии" (RU)

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, на основе генно-терапевтических субстанций с геном COL1A2, где клетки органов и тканей выбраны из фибробластов, кератоцитов, хондробластов и эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани человека, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена COL1A2 SEQ ID No: 1 или модифицированной кДНК гена COL1A2, при этом в качестве модифицированной кДНК гена COL1A2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства для лечения состояний человеческого организма, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, на основе генно-терапевтических субстанций с геном COL1A2; способа использования указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена COL1A2 и/или уменьшением активности белка каталазы. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и может быть использовано для коррекции патологических состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с пониженным количеством продукта гена COL1A1 - белка альфа-2 цепи коллагена I типа в частности, в терапевтических целях.

Предшествующий уровень.

Ген COL1A2 кодирует коллаген первого типа, альфа 2. Ген имеет в своей структуре 52 экзона. Белок COL1A2 состоит из 1366 аминокислотных остатков. Тип I коллагена является наиболее распространенным форма коллагена в организме человека.

Данные по нокаутным мышам по гену COL1A2 показали, что они демонстрируют нарушения в формировании костей, снижение уровня минерализации костей, и снижение массы тела.

[PMID: 8968022], [PMID: 12206762], [PMID: 8446583], [PMID: 8567960], [PMID: 19594296],

http://www.informatics.jax.org/reference/J:121691

Коллаген - основной структурный белок межклеточного матрикса. Он составляет от 25 до 33% общего количества белка в организме. Под термином "коллаген" подразумевают семейство близкородственных фибриллярных белков, которые являются основным белковым элементом кожи, костей, сухожилий, хряща, кровеносных сосудов, зубов. В разных тканях преобладают разные типы коллагена, а это, в свою очередь, определяется той ролью, которую коллаген играет в конкретном органе или ткани.

В тканях человека существует несколько различных типов коллагена. В настоящее время известно 19 типов коллагена, которые отличаются друг от друга по первичной структуре пептидных цепей, функциям и локализации в организме. Наиболее широко в организме присутствует коллаген I типа. Он встречается главным образом в соединительной ткани кожи, костях, сухожилиях, стенке артерий, роговице глаза, склере, плаценте, дентине. Причем около 40% его находится в коже, около 50% - в тканях скелета и 10% - в строме внутренних органов. Присутствие коллагена в коже придает ей эластичность, в хряще и кости -прочность, в сухожилиях - прочность и эластичность, в роговице глаза - обеспечивает прозрачность, также коллаген принимает участие в ранозаживляющих процессах.

Коллаген - внеклеточный белок, но он синтезируется в виде внутриклеточной молекулы предшественника, которая в ходе процессинга трансформируется в проколлаген и далее в коллаген. В коже, сухожилиях, и костях главным образом представлен коллаген, содержащий в своей структуре две молекулы альфа 1 типа и одну альфа 2 типа. Различия в коллагене из перечисленных выше трех типов ткани (кожа, сухожилия, кости) проявляются в уровне гидрокислирования пролиновых и лизиновых остатков. Коллаген имеет трехспиральную альфа структуру.

Ген COL1A2 кодирует белок альфа1-цепи коллагена I типа и является потенциально значимым в формировании генетической предрасположенности к остеопорозу и хрупкости костей с риском переломов. Мутации в локусе данного гена приводит к возникновению особей различных фенотипов, в том числе жизнеспособных и фертильных особей, так и тех, которые характеризуются летальностью еще в эмбриональном периоде развития. У гомозигот по COL1A1(-/-) аллелю наблюдаются нарушения в формировании костей, и их хрупкость, осетопороз, кожный фиброз, нарушение послеродовой инволюции матки. [PMID: 22589248], [PMID: 18248096], [PMID: 24443344], [PMID: 2402497], [PMID: 10608859]. Снижение активности белка альфа 1-цепи коллагена 1 типа наблюдается при некоторых болезнях при мутациях в гене COL1A2 а также вследствие экологических, возрастных причин, приводящих к снижению активности этого белка, что в свою очередь отражается на свойствах органов и тканей человека. Клиническая картина заболеваний, вызванных дефектами синтеза и созревания коллагена, является очень полиморфной. При многих заболеваниях отмечают не только костно-суставную патологию или изменения со стороны кожи, но и ярко выраженные висцеральные проявления (поражения кишечника, почек, легких, сердца, сосудов).

В связи с этим разработка лечебных средств для коррекции патологических состояний, связанных с понижением экспрессии гена(ов) коллагенов в клетках, тканях, органах человека является актуальной задачей.

Для коррекции патологических состояний в соединительных тканях человека существует несколько подходов с использованием коллагена.

Так в патенте RU 2136265 предложена гелеобразующая основа для косметических средств. Предлагаемая основа предназначена для использования в составах водосодержащих косметических средств для ухода за кожей и волосами. Основа, помимо белка коллагена, дополнительно содержит хитозан при массовом соотношении коллагена и хитозана 1:(0,012-0,48). Технический результат изобретения - расширение арсенала основ косметических средств. При этом известно, что все кремы, содержащие коллаген, эластин и гликозаминогликаны, дают временный незначительный эффект, так как эти субстанции редко проникают глубже эпидермиса и только частично сглаживают морщины и складки. Недостаток подхода наружного применения коллагенсодержащих препаратов кожи состоит в том, что эти вещества обладают краткосрочным действием и требуют постоянного применения, могут вызвать побочные явления, например, аллергическую реакцию, применение таких препаратов полностью не компенсирует недостаточную работу генов, ответственных за синтез коллагена в организме.

В патенте US 3949073, предложен способ укрепления соединительной ткани различных типов у млекопитающих при помощи введения в место укрепления полимеризующегося in situ раствора нативного коллагена, полученного с применением пепсина, т.е. лишенного неспиральных концов молекулы. Такие растворы коллагена могут быть введены в организм путем инъекции или нанесены на поверхность раны; при температуре тела эти растворы превращаются в гель. В них могут быть включены любые клетки, возможна также добавка к таким растворам других компонентов внеклеточного матрикса или лекарственных веществ. Это обусловило применение нативного коллагена, полученного с применением пепсина, с добавлением клеток и лекарственных препаратов или без них, для репарации различных тканевых патологий.

В патенте RU (11) 2214827 (13) С1 описан способ получения коллагена, изобретение может быть использовано при лечении различной тканевой патологии, в том числе восстановления тканей, для клеточного культивирования. В частности, коллагеном, полученным по указанной методике, проводили усиление соединительной ткани по методу, описанному в патенте US 3949073: после ряда манипуляций коллаген путем инъекции вводили в поврежденную ткань организма. В месте введения коллаген полимеризовывался (образовывал гель), и возникал аналог соединительной ткани, который в течение недели начинал заселяться фибробластами и васкуляризоваться. Также полученный коллаген был использован для репарации мочевого сфинктера (лечение недержания мочи). К коллагену могут быть добавлены любые клетки, компоненты межклеточного матрикса или лекарственные препараты, как например в заявке 2000115816 на изобретение РФ, МКИ A61K 35/48, опубл. 13.06.2000, где нативный коллаген с сохраненными неспиральными участками применялся для лечения кожных ран в сочетании с эмбриональными фибробластами человека и другими компонентами межклеточного матрикса, например, хондроитинсульфатом, и лекарственными препаратами. Как показали испытания, полученный по данному способу коллаген обладает низкой иммуногенной и аллергенной активностью. Предлагаемый коллаген также пригоден для получения тканевых эквивалентов и коллагеновых конструкций.

Недостаток данного подхода состоит в том, что при данном методе введения нативного белка коллагена желаемый терапевтический эффект может оказаться недостигнутым, и белок может вызвать побочные реакции.

В патенте US 0008071364 В2 описано генно-терапевтическое средство на основе эластина и коллагена для стимулирования образование хряща, например, суставного хряща.

За прототип авторами было принято решение по патентной заявке US 20030064369 А1, в которой описано генно-терапевтическое средство на основе проколлаген I N-протеиназы. Данный фермент участвует в процессинге проколлагена I и II типа в коллаген. В патенте показан список полипептидов и кодирующие их нуклеотидные последовательности, и антитела, которые иммуноспецифично связываются с полипептидом, а также производные, варианты, мутанты, фрагменты или вышеупомянутого полипептида, или полинуклеотида или антитела. Кроме того, изобретение раскрывает терапевтические, диагностические и исследовательские методы диагностики, лечения и профилактики различных заболеваний, связанных с любой из приведенных в патенте нуклеиновых кислот и белков человека. В списке полипептидов приведен белок, который гомологичен проколлаген I N-протеиназе человека из семейства цинк-связывающих металлопротеиназ. Показано, что кодирующая этот белок нуклеотидная последовательность, собственно полипептид, антитела к нему и родственные соединения согласно изобретению применимы в терапевтических и диагностических целях, например; при лечении синдрома Элерса-Данлоса типа VII С и/или других патологий. Синдром Элерса-Данлоса типа VII С - генетически обусловленное заболевание, которое возникает из-за отсутствия активности проколлаген I N-протеиназы, коллаген не образуется и наблюдается вялая, мягкая, одутловатая кожа. Показанная в патентной заявке опосредованная регуляция синтеза коллагена является частью механизма его процессинга (созревания) в клетке и не может влиять на основной механизм синтеза молекул для сборки коллагена в клетках пациента, что часто является причиной патологических состояний клеток органов и тканей и органов и тканей человека. Также при создании генно-терапевтическогосредства в этом изобретении не учитывается индивидуальные характеристики пациента.

Раскрытие изобретения

Задачей данного изобретения является создание линейки высокоэффективных биологически активных генно-терапевтических субстанций для коррекции патологических состояний организма человека способных препятствовать количественному снижению белка альфа-2 цепи коллагена I типа в клетках органов и тканей и/или органах и тканях человека путем повышения уровня экспрессии гена COL1A2 в клетках органов и тканей и/или органах и тканях человека, приводящего к повышению количества белка альфа-2 цепи коллагена I типа, в клетках органов и тканей и/или органах и тканях организма с учетом индивидуальных особенностей пациента.

Указанная задача решается за счет того, что создана линейка биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена COL1A2 SEQ ID No: 1 или одну из модифицированных кДНК гена COL1A2, и содержащей также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, в частности в клетках органов и тканей человека и способную обеспечить высокий уровень экспрессии гена COL1A2 и увеличить количество белка альфа-2 цепи коллагена I типа в клетках органов и тканей и/или органах и тканях человека, в частности, в гемопоэтических клетках, или мезенхимальных стволовых клетках, или хондробластах, или миоцитах, или миобластах, или фибробластах, или остеобластах, или кератоцитах, или эпителиальных клетках, или клетках роговицы, или эндотелиальных клетках, или эпителиальных клетках, в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в соединительно-тканных структурах, или коже, или суставах, или хрящевой ткани, или костной ткани, или мышечной ткани, или сухожилиях, или связках, или кровеносных сосудах, или стенке артерий, или роговице глаза, или склере, или плаценте, или дентине, или строме внутренних органов в сочетании с транспортной молекулой или без нее при введении этих биологически активных генно-терапевтических субстанций в органы и ткани человека. Каждая биологически активная генно-терапевтическая субстанция из созданной линейки представляет собой генетическую конструкцию с кДНК гена COL1A2, содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена COL1A2, которая несет модификации не затрагивающие структуру белка альфа-2 цепи коллагена I типа, а именно: делеции 5'-нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность. В качестве модифицированной кДНК гена COL1A2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7. В качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры.

Способ получения биологически активной генно-терапевтической субстанции для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа заключается в том, что получают кДНК гена COL1A2, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека.

Или способ получения биологически активной генно-терапевтической субстанции для коррекции патологических состояний клеток различных органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа заключается в том, что получают кДНК гена COL1A2, модифицируют его по п.п. 3, или 4, или 5 или 6 или 7 или 8, затем помещают модифицированную кДНК в векторную конструкцию, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека.

Способ использования каждой из созданных и представленных в линейке биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, заключается в трансфекции созданной биологически активной генно-терапевтической субстанцией, выбранной с учетом индивидуальных особенностей каждого конкретного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, клеток органов и тканей человека.

Или способ использования каждой из созданных и представленных в линейке биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена, заключается во введении одной из созданных биологически активных генно-терапевтической субстанций, выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, в органы и ткани этого пациента, и/или во введении аутологичных клеток пациента, трансфицированных одной из созданных биологически активных генно-терапевтической субстанций, выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, в органы и ткани этого пациента.

Перечень фигур

На фиг. 1

Представлена нуклеотидная последовательность немодифицированной кДНК гена COL1A2, последовательность которой идентична приводимой в базе даных GenBank под номером NM_000089.3 COL1A2 SEQ ID No: 1.

На фиг. 2

Представлена нуклеотидная последовательность модифицированной кДНК гена COL1A2, SEQ ID No: 2, которая

содержит 1 нуклеотидную замену A→G в позиции 4536, 4 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа.

На фиг. 3

Представлена нуклеотидная последовательность модифицированной кДНК гена COL1A2, SEQ ID No: 3, которая

содержит 1 нуклеотидную замену A→G в позиции 4536, 8 нуклеотидных замен T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа.

На фиг. 4

Представлена нуклеотидная последовательность модифицированной кДНК гена COL1A2, SEQ ID No: 4, которая

содержит 1 нуклеотидную замену A→G в позиции 4536, 12 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, 1740, 2496, 2613, 2802, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа.

На фиг. 5

Представлена нуклеотидная последовательность модифицированной кДНК гена COL1A2, SEQ ID No: 5, которая

содержит 1 нуклеотидную замену A→G в позиции 4536, 1 нуклеотидную замену G→C в позиции 3105; 16 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, 1740, 2496, 2613, 2802, 2928, 2937, 3189, 3249, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа.

На фиг. 6

Представлена нуклеотидная последовательность модифицированной кДНК гена COL1A2, SEQ ID No: 6, которая

содержит 1 нуклеотидную замену A→G в позиции 4536, 1 нуклеотидную замену G→C в позиции 3105; 20 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, 1740, 2496, 2613, 2802, 2928, 2937, 3117, 3189, 3249, 3405, 3486, 3963, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа.

На фиг. 7

Представлена нуклеотидная последовательность модифицированной кДНК гена COL1A2, SEQ ID No: 7, которая

не содержит нетранслируемые 5' и 3' области гена и содержит 1 нуклеотидную замену A→G в позиции 4536, 1 нуклеотидную замену G→C в позиции 3105; 20 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, 1740, 2496, 2613, 2802, 2928, 2937, 3117, 3189, 3249, 3405, 3486, 3963, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа.

На фиг. 8

С целью последующего корректного определения генно-терапевтического эффекта после трансфекции фибробластов биологически активной генно-терапевтической субстанции с кДНК гена COL1A2 проводили анализ эндогенной экспрессии гена COL1A2 в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена COL1A2, фибробласты со сниженной экспрессией гена COL1A2

2 - кДНК гена COL1A2, фибробласты с нормальной экспрессией гена COL1A2

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена COL1A2

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена COL1A2

В качестве референтного гена использовали ген В2М (Бета-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

На фиг. 9

С целью подтверждения увеличения экспрессии гена COL1A2 в клеточной культуре фибробластов со сниженной экспрессией гена COL1A2 при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена COL1A2 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена COL1A2 в фибробластах с нормальной экспрессией гена COL1A2,

2 - кДНК гена COL1A2 в фибробластах со сниженной экспрессией гена COL1A2 до трансфекции БАГТС с кДНК гена COL1A2

3 - кДНК гена COL1A2 в фибробластах со сниженной экспрессией гена COL1A2 после трансфекции БАГТС с кДНК гена COL1A2

4 - кДНК гена COL1A2 в фибробластах со сниженной экспрессией гена COL1A2 после трансфекции вектором без кДНК гена COL1A2

5 - кДНК гена В2М в фибробластах с нормальной экспрессией гена COL1A2,

6 - кДНК гена В2М в фибробластах со сниженной экспрессией гена COL1A2 до трансфекции БАГТС с кДНК гена COL1A2

7 - кДНК гена В2М в фибробластах со сниженной экспрессией гена COL1A2 после трансфекции БАГТС с кДНК гена COL1A2

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена COL1A2 после трансфекции вектором без кДНК гена COL1A2

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена COL1A2 уровень кДНК гена COL1A2 в фибробластах не изменился, а в случае трансфекции вектором с кДНК COL1A2 - уровень кДНК фибробластов со сниженной экспрессией гена COL1A2 многократно увеличился (до уровня выше, чем уровень кДНК гена COL1A2 в нормальных фибробластах).

На фиг. 10

С целью подтверждения увеличения количества белка альфа-2 цепи коллагена I типа в клеточной культуре фибробластов с нормальной экспрессией гена COL1A2 при трансфекции данных клеток биологически активной генно-терапевтической субстанцией содержащей кДНК гена COL1A2 представлен график изменения количества белка альфа-2 цепи коллагена I типа нетрансфицированных фибробластов (культура А), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК COL1A2 (культура В) и трансфицированных биологически активной генно-терапевтической субстанцией на базе генетической конструкции pCDNA 3.1-COL1A2 SEQ ID No: 1 (культура С). Из графика следует, что при трансфекции фибробластов биологически активной генно-терапевтической субстанцией с кДНК гена COL1A2 происходит увеличение количества белка альфа-2 цепи коллагена I типа в клеточном лизате.

На фиг. 11

С целью подтверждения увеличения количества белка альфа-2 цепи коллагена I типа в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной биологически активной генно-терапевтической субстанцией представлен анализ изменения количества белка альфа-2 цепи коллагена I типа в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (Б) и трансфицированные биологически активной генно-терапевтической субстанцией на базе pCMV6- COL1A2 SEQ ID No: 7 (С) - в кожу предплечья. Также анализировали количественный уровень белка альфа-2 цепи коллагена I типа в интактной коже. Показано повышение количества белка альфа-2 цепи коллагена I типа в коже пациента в области введения фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией с кДНК гена COL1A2 (С).

На фиг. 12

С целью подтверждения увеличения количества белка альфа-2 цепи коллагена 1 типа до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток биологически активными генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена COL1A2 в зависимости от наличия и типа в них той или иной модификации кДНК гена COL1A2 представлен анализ изменения количественного уровня белка альфа-2 цепи коллагена I типа в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена COL1A2, используемой для трансфекции фибробластов.

Культуры фибробластов 28 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали биологически активной генно-терапевтической субстанцией pCMV6- COL1A2 SEQ ID No: 1, части (В) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6- COL1A2 SEQ ID No: 2, части (С) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6- COL1A2 SEQ ID No: 3, части (D) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6- COL1A2 SEQ ID No: 4, части (E) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6- COL1A2 SEQ ID No: 5, части (F) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6- COL1A2 SEQ ID No: 6, части (G) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6- COL1A2 SEQ ID No: 7, части (H) трансфицировали векторной плазмидой, не содержащей кДНК гена COL1A2.

По итогам анализа количественного уровня белка альфа-2 цепи коллагена I типа выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальное количество белка альфа-2 цепи коллагена I типа и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при трансфекции pCMV6- COL1A2 SEQ ID No: 1,

в группе 2 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при трансфекции pCMV6- COL1A2 SEQ ID No: 2,

в группе 3 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при трансфекции pCMV6- COL1A2 SEQ ID No: 3,

в группе 4 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при трансфекции pCMV6- COL1A2 SEQ ID No: 4,

в группе 5 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при трансфекции pCMV6- COL1A2 SEQ ID No: 5,

в группе 6 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при трансфекции pCMV6- COL1A2 SEQ ID No: 6,

в группе 7 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при трансфекции pCMV6- COL1A2 SEQ ID No: 7.

Ни в одной из клеточных культур не наблюдалось того, что максимальное количество белка альфа-2 цепи коллагена I типа присутствует при трансфекции вектором без вставки кДНК гена COL1A2.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентрации белка альфа-2 цепи коллагена I типа (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена COL1A2.

Из фигуры следует, что достижение максимального количества белка альфа-2 цепи коллагена I типа в культурах фибробластов кожи различных пациентов при их трансфекции биологически активными генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена COL1A2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No: 1 (А)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No: 2 (В)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No: 3 (С)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No: 4 (D)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No: 5 (Е)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No: 6 (F)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

На фиг. 13

С целью подтверждения увеличения экспрессии гена COL1A2 в клеточной культуре кератоцитов и эпителиальных клеток роговицы глаза при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена COL1A2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена COL1A2, кератоциты до трансфекции

2 - кДНК гена COL1A2, эпителий роговицы до трансфекции

3 - кДНК гена COL1A2, кератоциты после трансфекции

4 - кДНК гена COL1A2, эпителий роговицы после трансфекции

5 - кДНК гена В2М, кератоциты до трансфекции

6 - кДНК гена В2М, эпителий роговицы до трансфекции

7 - кДНК гена В2М, кератоциты после трансфекции

8 - кДНК гена В2М, эпителий роговицы после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена COL1A2 в культуре кератоцитов и в культуре эпителия многократно вырос.

На фиг. 14

С целью подтверждения увеличения экспрессии гена COL1A2 в клеточной культуре хондробластов при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена COL1A2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена COL1A2, до трансфекции

2 - кДНК гена COL1A2, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена COL1A2 вырос многократно.

На фиг. 15

С целью подтверждения увеличения количества белка альфа-2 цепи коллагена I типа в коже человека при введении в кожу биологически активной генно-терапевтической субстанции представлен анализ изменения количественного уровня белка альфа-2 цепи коллагена I типа в коже. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию pCMV6- COL1A2 SEQ ID No: 4 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена COL1A2 с транспортной молекулой (А) - в кожу предплечья. Показано увеличение количества белка альфа-2 цепи коллагена I типа в биоптате кожи пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена COL1A2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

- пациент 1А

- пациент 1В

- пациент 1В до введения БАГТС

На фиг. 16

С целью подтверждения увеличения количества белка альфа-2 цепи коллагена I типа в хрящевой ткани человека при введении в хрящевую ткань биологически активной генно-терапевтической субстанции представлен анализ изменения количественного уровня белка альфа-2 цепи коллагена I типа в хрящевой ткани. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена COL1A2 pCDNA 3.1 COL1A2 SEQ ID No: 5 (В) и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена COL1A2 с транспортной молекулой (А) - в хрящевую ткань.

Показано увеличение количественного уровня белка альфа-2 цепи коллагена I типа в лизате биоптата хрящевой ткани пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена COL1A2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

- пациент 1А

- пациент 1В

- пациент 1В до введения БАГТС

На фиг. 17

С целью подтверждения увеличения количества белка альфа-2 цепи коллагена I типа в мышечной ткани человека при введении в мышечную ткань биологически активной генно-терапевтической субстанции представлен анализ изменения количества белка альфа-2 цепи коллагена I типа в мышечной ткани. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена COL1A2 - pCMV6-Kan/Neo COL1A2 SEQ ID No: 6 (В) и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена COL1A2 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение количества белка альфа-2 цепи коллагена I типа в биоптате мышечной ткани пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена COL1A2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

- пациент 1А

- пациент 1В

- пациент 1В до введения БАГТС

На фиг. 18

С целью подтверждения увеличения количества белка альфа-2 цепи коллагена I типа до различного индивидуального уровня при введении в кожу пациентов биологически активных генно-терапевтических субстанций с модифицированными и нативной кДНК гена COL1A2 анализировали количественный уровень белка альфа-2 цепи коллагена I типа в коже человека в зависимости от наличия и типа модификаций в кДНК гена COL1A2.

Каждому из 24-х пациентов, отобранных в случайном порядке, вводили в кожу предплечья 7 биологически активных генно-терапевтических субстанций pCMV6- SEQ ID No: 1, pCMV6-SEQ ID No: 2, pCMV6- SEQ ID No: 3, pCMV6- SEQ ID No: 4, pCMV6-SEQ ID No: 5, pCMV6- SEQ ID No: 6, pCMV6- SEQ ID No: 7, и плацебо pCMV6- XL5.

По итогам анализа количества белка альфа-2 цепи коллагена I типа в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные количественные уровни белка альфа-2 цепи коллагена I типа и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при введении pCMV6- COL1A2 SEQ ID No:1,

в группе 2 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при введении pCMV6- COL1A2 SEQ ID No: 2,

в группе 3 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при введении pCMV6- COL1A2 SEQ ID No: 3,

в группе 4 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при введении pCMV6- COL1A2 SEQ ID No: 4,

в группе 5 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при введении pCMV6- COL1A2 SEQ ID No: 5,

в группе 6 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалась при введении pCMV6- COL1A2 SEQ ID No: 6,

в группе 7 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалась при введении pCMV6- COL1A2 SEQ ID No: 7.

Ни в одном из биоптатов не наблюдалось того, что максимальное количество белка альфа-2 цепи коллагена I типа присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка альфа-2 цепи коллагена I типа (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена COL1A2.

Из данного примера следует, что достижение максимального количества белка альфа-2 цепи коллагена I типа в биоптатах кожи различных пациентов при введении им в кожу биологически активных генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена COL1A2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента.

Обозначения:

- биоптаты пациентов после введения БАГТС COL1A2 SEQ ID No: 1 (А)

- биоптаты пациентов после введения БАГТС COL1A2 SEQ ID No: 2 (В)

- биоптаты пациентов после введения БАГТС COL1A2 SEQ ID No: 3(C)

- биоптаты пациентов после введения БАГТС COL1A2 SEQ ID No: 4 (D)

- биоптаты пациентов после введения БАГТС COL1A2 SEQ ID No: 5(E)

- биоптаты пациентов после введения БАГТС COL1A2 SEQ ID No: 6(F)

- биоптаты пациентов после введения БАГТС COL1A2 SEQ ID No: 7(G)

- биоптаты пациентов после введения плацебо (Н)

На фиг. 19

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количественный уровень белка альфа-2 цепи коллагена I типа в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими нативную или модифицированные кДНК гена COL1A2.

По итогам анализа количества белка альфа-2 цепи коллагена 1 типа в культуре фибробластов пациента выделили вариант биологически активной генно-терапевтической субстанции, при трансфекции которой выявляется максимальная концентрация белка альфа-2 цепи коллагена I типа в лизате клеточной культуры. В данном эксперименте максимальная концентрация белка альфа-2 цепи коллагена I типа в лизате наблюдается при трансфекции биологически активной генно-терапевтической субстанцией на базе pCMV6 COL1A2 SEQ ID No: 5, содержащей модифицированную кДНК COL1A2, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Обозначения:

1 - клеточный лизат после трансфекции БАГТС COL1A2 SEQ ID No: 1 (А)

2 - клеточный лизат после трансфекции БАГТС COL1A2 SEQ ID No: 2 (В)

3 - клеточный лизат после трансфекции БАГТС COL1A2 SEQ ID No: 3 (С)

4 - клеточный лизат после трансфекции БАГТС COL1A2 SEQ ID No: 4 (D)

5 - клеточный лизат после трансфекции БАГТС COL1A2 SEQ ID No: 5 (Е)

6 - клеточный лизат после трансфекции БАГТС COL1A2 SEQ ID No: 6 (F)

7 - клеточный лизат после трансфекции БАГТС COL1A2 SEQ ID No: 7 (G)

8 - клеточный лизат после трансфекции плацебо (Н)

На фиг. 20

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка альфа-2 цепи коллагена I типа в лизатах биоптатов кожи этого пациента, после введения ему биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена COL1A2.

По итогам анализа количества белка альфа-2 цепи коллагена I типа в лизате биоптатов кожи пациента выделили вариант биологически активной генно-терапевтической субстанции, при введении которой выявляется максимальная концентрация белка альфа-2 цепи коллагена I типа в лизате биоптата. В данном эксперименте максимальная концентрация белка альфа-2 цепи коллагена I типа отмечена при введении биологически активной генно-терапевтической субстанции на базе pCMV6 COL1A2 SEQ ID No: 2, содержащей модифицированную кДНК COL1A2, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения БАГТС COL1A2 SEQ ID No: 1 (А)

2 - лизат биоптата после введения БАГТС COL1A2 SEQ ID No: 2 (В)

3 - лизат биоптата после введения БАГТС COL1A2 SEQ ID No: 3 (С)

4 - лизат биоптата после введения БАГТС COL1A2 SEQ ID No: 4 (D)

5 - лизат биоптата после введения БАГТС COL1A2 SEQ ID No: 5 (Е)

6 - лизат биоптата после введения БАГТС COL1A2 SEQ ID No: 6 (F)

7 - лизат биоптата после введения БАГТС COL1A2 SEQ ID No: 7 (G)

8 - лизат биоптата после введения плацебо (Н)

Реализация изобретения.

При снижении экспрессии генов, кодирующих белки коллагеногенеза, например гена COL1A2, происходит снижение количества белка в организме, что приводит к патологическим состояниям.

Данные по нокаутным мышам по гену COL1A2 показали, что они демонстрируют нарушения в формировании костей, снижение уровня минерализации костей, и снижение массы тела.

[PMID: 8968022], [PMID: 12206762], [PMID: 8446583], [PMID: 8567960], [PMID: 19594296],

Преимущества использования генетической конструкции с геном COL1A2 для коррекции количественного уровня белка альфа-2 цепи коллагена I типа в клетках органов и тканей человека, по сравнению с использованием белка проколлаген I N-протеиназы, как по прототипу US 20030064369 А1 следующие:

1) легче обеспечить более высокий и стабильный уровень белка в клетках,

2) не требуется сложная и дорогостоящая процедура рефолдинга и очистки белкового препарата,

3) обеспечивается транспортировка биологически активной генно-терапевтической субстанции в больший спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка биологически активной генно-терапевтической субстанции.

4) учитываются индивидуальные характеристики пациента.

Таким образом, для создания линейки биологически активных генно-терапевтических субстанций по данному изобретению был выбран ген COL1A2, а не белок, кодируемый этим геном.

Для получения линейки биологически активных генно-терапевтических субстанций осуществляют следующие действия:

1. Получение нативной кДНК гена COL1A2, содержащей белок-кодирующую область гена COL1A2, клонирование ее в промежуточную плазмиду для дальнейших модификаций этой кДНК

2. Внесение в последовательность нуклеотидов кДНК гена COL1A2 модификаций с целью создания линейки кДНК гена COL1A2, обеспечивающих достаточный для борьбы с патологическими проявлениями уровень трансляции белка альфа-2 цепи коллагена I типа

3. Клонирование нативной и модифицированных кДНК гена COL1A2 в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E.coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение линейки генетических конструкций, содержащих модифицированные и нативную кДНК гена COL1A2 для создания на ее базе линейки биологически активных генно-терапевтических субстанций.

6. Создание линейки биологически активных генно-терапевтических субстанций, каждая из которых включает генетическую конструкцию с модифицированной или нативной кДНК гена COL1A2, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных биологически активных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена COL1A2, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, и анализ экспрессии гена COL1A2 из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, биологически активными генно-терапевтическимисубстанциями содержащими нативную и/или модифицированные кДНК гена COL1A2 и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена COL1A2 в различных комбинациях.

D) Сравнительный анализ изменения уровня кДНК и/или изменения количества белка альфа-2 цепи коллагена I типа после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, биологически активными генно-терапевтическими субстанциями содержащими нативную и/или модифицированные кДНК гена COL1A2 и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена COL1A2. Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента биологически активной генно-терапевтической субстанции.

E) Введение пациентам в органы и ткани культуры клеток с кДНК гена COL1A2, например, введение, в кожу человека, аутологичных фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией с кДНК гена COL1A2 и параллельное введение пациентам в органы и ткани, например, в кожу, культур этих же клеток нетрансфицированных и трансфицированных вектором без вставки кДНК гена COL1A2 и/или введение пациентам в органы и ткани биологически активных генно-терапевтических субстанций, например, введение в кожу человека биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК COL1A2, а также плацебо в различных комбинациях.

F) Сравнительный анализ количества белка альфа-2 цепи коллагена I типа в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных биологически активными генно-терапевтическими субстанциями, содержащими кДНК гена COL1A2 и векторными плазмидами, не содержащими кДНК гена COL1A2 и/или биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена COL1A2, а также плацебо.

G) Введение пациентам в органы и ткани, например, хрящевую ткань, или мышечную ткань биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК гена COL1A2, а также плацебо.

H) Сравнительный анализ количества белка альфа-2 цепи коллагена I типа в органах и тканях человека, в частности в хрящевой ткани, или мышечной ткани человека, после введения биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК COL1A2 а также плацебо.

I) Введение пациентам в органы и ткани, например, введение в кожу пациента биологически активных генно-терапевтических субстанций, содержащих нативную и модифицированные кДНК гена COL1A2.

J) Сравнительный анализ количества белка альфа-2 цепи коллагена I типа в органах и тканях пациента, в частности в коже, после введения биологически активных генно-терапевтических субстанций, содержащих нативную и модифицированные кДНК гена COL1A2. Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций.

Пример 1.

Получение нативной (немодифицированной) кДНК гена COL1A2.

Немодифицированная кДНК гена COL1A2 представляет собой последовательность нуклеотидов, идентичную приводимой в базе даных GenBank под номером NM_000089.3; нуклеотиды со 472 по 4572 транслируются в аминокислотную последовательность, соответствующую приведенной в GenBank под номером NP_000080.2.

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) используют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно кинированные праймеры, комплементарные нуклеотидам 429-448 5' GGGGCTCTGCGACACAAGGA 3' (COL1A2F1) и 4782-4761 5' AATTTTTGGGGGAGCGGGGGAA 3' (COL1A2R1) из последовательности мРНК гена COL1A2 (GenBank NM_000089.3), получают кДНК COL1A2. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами. ПЦР проводят с помощью амплификатора Master CyclerGradient (Eppendorf, USA) в 50 мкл. реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера COL1A2F1 и COL1A2R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМтрис-HCl (рН 8,85 при 20°С), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific.USA) при следующих условиях: первоначальная денатурация при +98°С в течение 30 с, 35 циклов, включающих денатурацию при +98°С в течение 10 с, отжиг праймеров при +64°С в течение 30 с и элонгацию при +64°С в течение 9 минут.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany)

Амплифицированный фрагмент кДНК, несущий ген COL1A2, клонируют в плазмидном векторе pUC19 (NEB, USA, кат номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, кат. номер N3041S) гидролизуют рестриктазой Smal (NEB, USA), (или другой рестриктазой, дающей тупые концы) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага Т4 400000 ед./ мл. (NEB, USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис -HCl, рН 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°C.

Полученной смесью трансформируют компетентные клетки Е.coliTop10 (http://molbiol.ru/protocol/03_04.html). которые высевают на чашки Петри с L-агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами COL1A2F1 и COL1A2R1H подтверждают секвенированием по методу Сэнгера, которое показывает наличие клонов с разной ориентацией целевого гена: EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII и HindIII-5'NTR-кДНК COL1A2-3'NTR-EcoRI

Полученная таким образом клонированная частичная (с 429 по 4782 н.п.) нативная (немодифицированная) последовательность гена COL1A2 длиной 4354 н.п. в плазмиде pUC19- COL1A2 SEQ ID No: 1 имеет первичную структуру, приведенную на фиг. 1.

Пример 2.

Получение модифицированных кДНК гена COL1A2.

Модификации проводят таким образом, чтобы не затрагивать первичную структуру белка альфа-2 цепи коллагена I типа, а именно, делеции 5'-нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности для получения линейки кДНК гена COL1A2 с целью повышения эффективности транскрипции и трансляции альфа-2 коллагена I типа в клетках тканей и органов человека в нативную последовательность кДНК COL1A2, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные, а также проводят делеции 5'-нетранслируемых областей или делеции 3'-нетранслируемых областей таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChange II XL kit или QuikChange Multi Site-Directed Mutagenesis Kit (AgilentTechNo : logies, USA,) согласно рекомендациям производителя.

http://www.agilent.com/cs/library/usermanuals/Public/200513.

К плазмидной ДНК pUC 19-COL1A2 SEQ ID No: 1 по Примеру 1 (вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII и вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена HindIII-5'NTR- кДНК COL1A2-3'NTR-EcoRI) в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 25-45 н.п.и проводят ПЦР в буфере QuikChange Multi reaction buffer (AgilentTechNologies, USA) со смесью ферментов QuikChange Multi mix (AgilentTechNologies, USA) при следующих условиях: 95°C, 1 мин; далее от 30 до 35 циклов: 95°С 1 минута, 55°С 1 минута, 65°С 2 минуты/1000 н.п. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°С. Полученной смесью трансформируют компетентные клетки E.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L- агаром содержащих 100 мкг/мл. Трансформированнные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК COL1A2 SEQ ID No: 2 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК COL1A2 SEQ ID No: 1 (вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR- кДНК COL1A2-3'NTRHindIII и вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена HindIII-5'NTR- кДНК COL1A2-3'NTR-EcoRI), используемой в качестве матрицы:

1. COL1A2 4519-4553F:

5' GGTGCTGACCAGGAGTTCTTTGTGGACATTGG 3',

комплементарную нуклеотидам 4519-4553F, с заменой A→G в позиции 4536;

2. COL1A2 577-609 F:

5' GGAGATAGAGGACCACGGGGAGAAAGGGGTCCA 3',

комплементарную нуклеотидам 577-609, с заменой Т→G в позиции 594;

3. COL1A2 856-881 F:

5' GCAGGTGCTCGGGGTCCAGCTGGCCC 3',

комплементарную нуклеотидам 856-881, с заменой T→G в позиции 867;

4. COL1A2 956-979F:

5' AGGGTGCTCGGGGTTTCCCTGGAA 3',

комплементарную нуклеотидам 956-979F, с заменой T→G в позиции 966;

5. COL1A2 1110-1140 F:

5' AGGAGCCCGGGGGCTTCCTGGTGAGAGAGGA 3',

комплементарную нуклеотидам 1110-1140, с заменой T→G в позиции 1119.

Модифицированная таким образом нуклеотидная последовательность кДНК COL1A2 SEQ ID No: 2 содержит 1 нуклеотидную замену A→G в позиции 4536, 4 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа и имеет первичную структуру, приведенную на фиг. 2.

Для получения модифицированной кДНК COL1A2 SEQ ID No: 3 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК COL1A2 SEQ ID No: 1 (вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII и вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена HindIII-5'NTR-кДНК COL1A2-3'NTR-EcoRI), используемой в качестве матрицы:

1. COL1A2 4519-4553F:

5' GGTGCTGACCAGGAGTTCTTTGTGGACATTGG 3',

комплементарную нуклеотидам 4519-4553F, с заменой A→G в позиции 4536;

2. COL1A2 577-609 F:

5' GGAGATAGAGGACCACGGGGAGAAAGGGGTCCA 3',

комплементарную нуклеотидам 577-609, с заменой T→G в позиции 594;

3. COL1A2 856-881 F:

5' GCAGGTGCTCGGGGTCCAGCTGGCCC 3',

комплементарную нуклеотидам 856-881, с заменой T→G в позиции 867;

4. COL1A2 956-979F:

5' AGGGTGCTCGGGGTTTCCCTGGAA 3',

комплементарную нуклеотидам 956-979F, с заменой T→G в позиции 966;

5. COL1A2 1110-1140 F:

5' AGGAGCCCGGGGGCTTCCTGGTGAGAGAGGA 3',

комплементарную нуклеотидам 1110-1140, с заменой T→G в позиции 1119.

6. COL1A2 1133-1157 F:

5' AGAGAGGACGGGTTGGTGCCCCTGG 3',

комплементарную нуклеотидам 1133-1157, с заменой T→G в позиции 1143;

7. COL1A2 1161-1193 F:

5' AGCTGGTGCCCGGGGCAGTGATGGAAGTGTGGG 3',

комплементарную нуклеотидам 1161-1193, с заменой T→G в позиции 1173;

8. COL1A2 1303-1334F:

5' CCCGCCGGTCCCCGGGGTGAAGTGGGTCTTCC 3',

комплементарную нуклеотидам 1303-1334, с заменой T→G в позиции 1317;

9. COL1A2 1674-1701 F:

5' TCCTGGTTCTCGGGGTCTTCCTGGAGCT 3',

комплементарную нуклеотидам 1674-1701, с заменой T→G в позиции 1686.

Модифицированная таким образом нуклеотидная последовательность кДНК COL1A2 SEQ ID No: 3 содержит 1 нуклеотидную замену A→G в позиции 4536, 8 нуклеотидных замен T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа и имеет первичную структуру, приведенную на фиг 3.

Для получения модифицированной кДНК COL1A2 SEQ ID No: 4 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК COL1A2 SEQ ID No: 1 (вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII и вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена HindIII-5'NTR- кДНК COL1A2-3'NTR-EcoRI), используемой в качестве матрицы:

1. COL1A2 4519-4553F:

5' GGTGCTGACCAGGAGTTCTTTGTGGACATTGG 3',

комплементарную нуклеотидам 4519-4553F, с заменой A→G в позиции 4536;

2. COL1A2 577-609 F:

5' GGAGATAGAGGACCACGGGGAGAAAGGGGTCCA 3',

комплементарную нуклеотидам 577-609, с заменой T→G в позиции 594;

3. COL1A2 856-881 F:

5' GCAGGTGCTCGGGGTCCAGCTGGCCC 3',

комплементарную нуклеотидам 856-881, с заменой T→G в позиции 867;

4. COL1A2 956-979F:

5' AGGGTGCTCGGGGTTTCCCTGGAA 3',

комплементарную нуклеотидам 956-979F, с заменой T→G в позиции 966;

5. COL1A2 1110-1140 F:

5' AGGAGCCCGGGGGCTTCCTGGTGAGAGAGGA 3',

комплементарную нуклеотидам 1110-1140, с заменой T→G в позиции 1119.

6. COL1A2 1133-1157 F:

5' AGAGAGGACGGGTTGGTGCCCCTGG 3',

комплементарную нуклеотидам 1133-1157, с заменой T→G в позиции 1143;

7. COL1A2 1161-1193 F:

5' AGCTGGTGCCCGGGGCAGTGATGGAAGTGTGGG 3',

комплементарную нуклеотидам 1161-1193, с заменой T→G в позиции 1173;

8. COL1A2 1303-1334F:

5' CCCGCCGGTCCCCGGGGTGAAGTGGGTCTTCC 3',

комплементарную нуклеотидам 1303-1334, с заменой T→G в позиции 1317;

9. COL1A2 1674-1701 F:

5' TCCTGGTTCTCGGGGTCTTCCTGGAGCT 3',

комплементарную нуклеотидам 1674-1701, с заменой T→G в позиции 1686.

10. COL1A2 1725-1755 F:

5' CCCTCCTGGTAGTCGGGGTGCAAGTGGCCCT 3',

комплементарную нуклеотидам 1725-1755, с заменой T→G в позиции 1740;

11. COL1A2 2482-2516F:

5' AGAGATGGTGCTCGGGGTGCTCCTGGTGCTGTAGG 3',

комплементарную нуклеотидам 2482-2516, с заменой T→G в позиции 2496;

12. COL1A2 2601-2631F:

5' CCCTGGTGAACGGGGTGAGGTCGGTCCTGCT 3',

комплементарную нуклеотидам 2601-2631, с заменой T→G в позиции 2613;

13. COL1A2 2785-2813 F:

5' GGTCCTGCTGGAAGTCGGGGTGATGGAGG 3',

комплементарную нуклеотидам 2785-2813, с заменой T→G в позиции 2802.

Модифицированная таким образом нуклеотидная последовательность кДНК COL1A2 SEQ ID No: 4 содержит 1 нуклеотидную замену A→G в позиции 4536, 12 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, 1740, 2496, 2613, 2802, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа и имеет первичную структуру, приведенную на фиг 4.

Для получения модифицированной кДНК COL1A2 SEQ ID No:5 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК COL1A2 SEQ ID No: 1 (вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII и вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена HindIII-5'NTR- кДНК COL1A2-3'NTR-EcoRI), используемой в качестве матрицы:

1. COL1A2 4519-4553F:

5' GGTGCTGACCAGGAGTTCTTTGTGGACATTGG 3',

комплементарную нуклеотидам 4519-4553F, с заменой A→G в позиции 4536;

2. COL1A2 577-609 F:

5' GGAGATAGAGGACCACGGGGAGAAAGGGGTCCA 3',

комплементарную нуклеотидам 577-609, с заменой T→G в позиции 594;

3. COL1A2 856-881 F:

5' GCAGGTGCTCGGGGTCCAGCTGGCCC 3',

комплементарную нуклеотидам 856-881, с заменой T→G в позиции 867;

4. COL1A2 956-979F:

5' AGGGTGCTCGGGGTTTCCCTGGAA 3',

комплементарную нуклеотидам 956-979F, с заменой T→G в позиции 966;

5. COL1A2 1110-1140 F:

5' AGGAGCCCGGGGGCTTCCTGGTGAGAGAGGA 3',

комплементарную нуклеотидам 1110-1140, с заменой T→G в позиции 1119.

6. COL1A2 1133-1157 F:

5' AGAGAGGACGGGTTGGTGCCCCTGG 3',

комплементарную нуклеотидам 1133-1157, с заменой T→G в позиции 1143;

7. COL1A2 1161-1193 F:

5' AGCTGGTGCCCGGGGCAGTGATGGAAGTGTGGG 3',

комплементарную нуклеотидам 1161-1193, с заменой T→G в позиции 1173;

8. COL1A2 1303-1334F:

5' CCCGCCGGTCCCCGGGGTGAAGTGGGTCTTCC 3',

комплементарную нуклеотидам 1303-1334, с заменой T→G в позиции 1317;

9. COL1A2 1674-1701 F:

5' TCCTGGTTCTCGGGGTCTTCCTGGAGCT 3',

комплементарную нуклеотидам 1674-1701, с заменой T→G в позиции 1686.

10. COL1A2 1725-1755 F:

5' CCCTCCTGGTAGTCGGGGTGCAAGTGGCCCT 3',

комплементарную нуклеотидам 1725-1755, с заменой T→G в позиции 1740;

11. COL1A2 2482-2516F:

5' AGAGATGGTGCTCGGGGTGCTCCTGGTGCTGTAGG 3',

комплементарную нуклеотидам 2482-2516, с заменой T→G в позиции 2496;

12. COL1A2 2601-2631F:

5' CCCTGGTGAACGGGGTGAGGTCGGTCCTGCT 3',

комплементарную нуклеотидам 2601-2631, с заменой T→G в позиции 2613;

13. COL1A2 2785-2813 F:

5' GGTCCTGCTGGAAGTCGGGGTGATGGAGG 3',

комплементарную нуклеотидам 2785-2813, с заменой T→G в позиции 2802.

14. COL1A2 2911-2948 F:

5' GGGAAAGAAGGGCTTCGGGGTCCTCGGGGTGACCAAGG 3',

комплементарную нуклеотидам 2911-2948, с заменами T→G в позициях 2928, 2937;

15. COL1A2 3093-3125F:

5' TCTCCCTGGCTCCAGAGGTGAACGTGGTCTACC 3',

комплементарную нуклеотидам 3093-3125, с заменой G→C в позиции 3105;

16. COL1A2 3181-3209F:

5' GGGGCCCGGGGTCCTCCTGGTGCTGTGGG 3',

комплементарную нуклеотидам 3181-3209, с заменой T→G в позиции 3189;

17. COL1A2 3238-3266F:

5' GAAGCTGGTCGGGATGGCAACCCTGGGAA 3',

комплементарную нуклеотидам 3238-3266, с заменой T→G в позиции 3249.

Модифицированная таким образом нуклеотидная последовательность кДНК COL1A2 SEQ ID No: 5 содержит 1 нуклеотидную замену A→G в позиции 4536, 1 нуклеотидную замену G→C в позиции 3105; 16 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, 1740, 2496, 2613, 2802, 2928, 2937, 3189, 3249, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа и имеет первичную структуру, приведенную на фиг 5.

Для получения модифицированной кДНК COL1A2 SEQ ID No: 6 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК COL1A2 SEQ ID No: 1 (вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII и вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена HindIII-5'NTR- кДНК COL1A2-3'NTR-EcoRI), используемой в качестве матрицы:

1. COL1A2 4519-4553F:

5' GGTGCTGACCAGGAGTTCTTTGTGGACATTGG 3',

комплементарную нуклеотидам 4519-4553F, с заменой A→G в позиции 4536;

2. COL1A2 577-609 F:

5' GGAGATAGAGGACCACGGGGAGAAAGGGGTCCA 3',

комплементарную нуклеотидам 577-609, с заменой T→G в позиции 594;

3. COL1A2 856-881 F:

5' GCAGGTGCTCGGGGTCCAGCTGGCCC 3',

комплементарную нуклеотидам 856-881, с заменой T→G в позиции 867;

4. COL1A2 956-979F:

5' AGGGTGCTCGGGGTTTCCCTGGAA 3',

комплементарную нуклеотидам 956-979F, с заменой T→G в позиции 966;

5. COL1A2 1110-1140 F:

5' AGGAGCCCGGGGGCTTCCTGGTGAGAGAGGA 3',

комплементарную нуклеотидам 1110-1140, с заменой T→G в позиции 1119.

6. COL1A2 1133-1157 F:

5' AGAGAGGACGGGTTGGTGCCCCTGG 3',

комплементарную нуклеотидам 1133-1157, с заменой T→G в позиции 1143;

7. COL1A2 1161-1193 F:

5' AGCTGGTGCCCGGGGCAGTGATGGAAGTGTGGG 3',

комплементарную нуклеотидам 1161-1193, с заменой T→G в позиции 1173;

8. COL1A2 1303-1334F:

5' CCCGCCGGTCCCCGGGGTGAAGTGGGTCTTCC 3',

комплементарную нуклеотидам 1303-1334, с заменой T→G в позиции 1317;

9. COL1A2 1674-1701 F:

5' TCCTGGTTCTCGGGGTCTTCCTGGAGCT 3',

комплементарную нуклеотидам 1674-1701, с заменой T→G в позиции 1686.

10. COL1A2 1725-1755 F:

5' CCCTCCTGGTAGTCGGGGTGCAAGTGGCCCT 3',

комплементарную нуклеотидам 1725-1755, с заменой T→G в позиции 1740;

11. COL1A2 2482-2516F:

5' AGAGATGGTGCTCGGGGTGCTCCTGGTGCTGTAGG 3',

комплементарную нуклеотидам 2482-2516, с заменой T→G в позиции 2496;

12. COL1A2 2601-2631F:

5' CCCTGGTGAACGGGGTGAGGTCGGTCCTGCT 3',

комплементарную нуклеотидам 2601-2631, с заменой T→G в позиции 2613;

13. COL1A2 2785-2813 F:

5' GGTCCTGCTGGAAGTCGGGGTGATGGAGG 3',

комплементарную нуклеотидам 2785-2813, с заменой T→G в позиции 2802.

14. COL1A2 2911-2948 F:

5'

GGGAAAGAAGGGCTTCGGGGTCCTCGGGGTGACCAAGG 3',

комплементарную нуклеотидам 2911-2948, с заменами T→G в позициях 2928, 2937;

15. COL1A2 3093-3125F:

5' TCTCCCTGGCTCCAGAGGTGAACGTGGTCTACC 3',

комплементарную нуклеотидам 3093-3125, с заменой G→C в позиции 3105;

16. COL1A2 3181-3209F:

5' GGGGCCCGGGGTCCTCCTGGTGCTGTGGG 3',

комплементарную нуклеотидам 3181-3209, с заменой T→G в позиции 3189;

17. COL1A2 3238-3266F:

5' GAAGCTGGTCGGGATGGCAACCCTGGGAA 3',

комплементарную нуклеотидам 3238-3266, с заменой T→G в позиции 3249.

18. COL1A2 3099-3130 F:

5' TGGCTCCAGAGGTGAACGGGGTCTACCAGGTG 3',

комплементарную нуклеотидам 3099-3130, с заменами G→C в позиции 3105 и T→G в позиции 3117;

19. COL1A2 3391-3416 F:

5' AAACATGGAAACCGGGGTGAAACTGG 3',

комплементарную нуклеотидам 3391-3416, с заменой T→G в позиции 3405;

20. COL1A2 3476-3501F:

5' AAGGCATTCGGGGCGATAAGGGAGAG 3',

комплементарную нуклеотидам 3476-3501, с заменой T→G в позиции 3486; и

21. COL1A2 3948-3977F:

5' AGCTCGCACATGCCGGGACTTGAGACTCAG 3',

комплементарную нуклеотидам 3948-3977, с заменой T→G в позиции 3963.

Модифицированная таким образом нуклеотидная последовательность кДНК COL1A2 SEQ ID No: 6 содержит 1 нуклеотидную замену A→G в позиции 4536, 1 нуклеотидную замену G→C в позиции 3105; 20 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, 1740, 2496, 2613, 2802, 2928, 2937, 3117, 3189, 3249, 3405, 3486, 3963, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа и имеет первичную структуру, приведенную на фиг 6.

Для получения модифицированной кДНК COL1A2 SEQ ID No:7 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК COL1A2 SEQ ID No: 1 (вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII и вариант pUC 19-COL1A2 SEQ ID No: 1 с ориентацией целевого гена HindIII-5'NTR- кДНК COL7A2-3'NTR-EcoRI), используемой в качестве матрицы:

1. COL1A2 4519-4553F:

5' GGTGCTGACCAGGAGTTCTTTGTGGACATTGG 3',

комплементарную нуклеотидам 4519-4553F, с заменой A→G в позиции 4536;

2. COL1A2 577-609 F:

5' GGAGATAGAGGACCACGGGGAGAAAGGGGTCCA 3',

комплементарную нуклеотидам 577-609, с заменой T→G в позиции 594;

3. COL1A2 856-881 F:

5' GCAGGTGCTCGGGGTCCAGCTGGCCC 3',

комплементарную нуклеотидам 856-881, с заменой T→G в позиции 867;

4. COL1A2 956-979F:

5' AGGGTGCTCGGGGTTTCCCTGGAA 3',

комплементарную нуклеотидам 956-979F, с заменой T→G в позиции 966;

5. COL1A2 1110-1140 F:

5' AGGAGCCCGGGGGCTTCCTGGTGAGAGAGGA 3',

комплементарную нуклеотидам 1110-1140, с заменой T→G в позиции 1119.

6. COL1A2 1133-1157 F:

5' AGAGAGGACGGGTTGGTGCCCCTGG 3',

комплементарную нуклеотидам 1133-1157, с заменой T→G в позиции 1143;

7. COL1A2 1161-1193 F:

5' AGCTGGTGCCCGGGGCAGTGATGGAAGTGTGGG 3',

комплементарную нуклеотидам 1161-1193, с заменой T→G в позиции 1173;

8. COL1A2 1303-1334F:

5' CCCGCCGGTCCCCGGGGTGAAGTGGGTCTTCC 3',

комплементарную нуклеотидам 1303-1334, с заменой T→G в позиции 1317;

9. COL1A2 1674-1701 F:

5' TCCTGGTTCTCGGGGTCTTCCTGGAGCT 3',

комплементарную нуклеотидам 1674-1701, с заменой T→G в позиции 1686.

10. COL1A2 1725-1755 F:

5' CCCTCCTGGTAGTCGGGGTGCAAGTGGCCCT 3',

комплементарную нуклеотидам 1725-1755, с заменой T→G в позиции 1740;

11. COL1A2 2482-2516F:

5' AGAGATGGTGCTCGGGGTGCTCCTGGTGCTGTAGG 3',

комплементарную нуклеотидам 2482-2516, с заменой T→G в позиции 2496;

12. COL1A2 2601-2631F:

5' CCCTGGTGAACGGGGTGAGGTCGGTCCTGCT 3',

комплементарную нуклеотидам 2601-2631, с заменой T→G в позиции 2613;

13. COL1A2 2785-2813 F:

5' GGTCCTGCTGGAAGTCGGGGTGATGGAGG 3',

комплементарную нуклеотидам 2785-2813, с заменой T→G в позиции 2802.

14. COL1A2 2911-2948 F:

5'

GGGAAAGAAGGGCTTCGGGGTCCTCGGGGTGACCAAGG 3',

комплементарную нуклеотидам 2911-2948, с заменами T→G в позициях 2928, 2937;

15. COL1A2 3093-3125F:

5' TCTCCCTGGCTCCAGAGGTGAACGTGGTCTACC 3',

комплементарную нуклеотидам 3093-3125, с заменой G→C в позиции 3105;

16. COL1A2 3181-3209F:

5' GGGGCCCGGGGTCCTCCTGGTGCTGTGGG 3',

комплементарную нуклеотидам 3181-3209, с заменой T→G в позиции 3189;

17. COL1A2 3238-3266F:

5' GAAGCTGGTCGGGATGGCAACCCTGGGAA 3',

комплементарную нуклеотидам 3238-3266, с заменой T→G в позиции 3249.

18. COL1A2 3099-3130 F:

5' TGGCTCCAGAGGTGAACGGGGTCTACCAGGTG 3',

комплементарную нуклеотидам 3099-3130, с заменами G→C в позиции 3105 и T→G в позиции 3117;

19. COL1A2 3391-3416 F:

5' AAACATGGAAACCGGGGTGAAACTGG 3',

комплементарную нуклеотидам 3391-3416, с заменой T→G в позиции 3405;

20. COL1A2 3476-3501F:

5' AAGGCATTCGGGGCGATAAGGGAGAG 3',

комплементарную нуклеотидам 3476-3501, с заменой T→G в позиции 3486; и

21. COL1A2 3948-3977F:

5' AGCTCGCACATGCCGGGACTTGAGACTCAG 3',

комплементарную нуклеотидам 3948-3977, с заменой T→G в позиции 3963.

22. а также для удаления 5'-нетранслируемой области гена COL1A2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером: 5' AGGTCGACTCTAGAGGATCCCCGCCACCATGCTCAGCTTTGTGG 3' для варианта с ориентацией целевого гена HindIII-5'NTR-кДНК COL1A2-3'NTR-EcoRI

23. а также для удаления 3'-нетранслируемой области гена COL1A2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером: 5' GGCCCAGTCTGTTTCAAATAAGGGTACCGAGCTCGAATTCACTG G 3' для варианта с ориентацией целевого гена HindIII-5'NTR-кДНК COL1A2-3'NTR-EcoRI

24. а также для удаления 5'-нетранслируемой области гена COL1A2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером 5' GAATTCGAGCTCGGTACCCGCCACCATGCTCAGCTTTGTGGA 3' для варианта с ориентацией целевого гена EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII

25. а также для удаления 3'-нетранслируемой области гена COL1A2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером: 5' TGGCCCAGTCTGTTTCAAATAAGGGGATCCTCTAGAGTCGACC 3' - для варианта с ориентацией целевого гена EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII

Модифицированная таким образом нуклеотидная последовательность кДНК COL1A2 SEQ ID No: 7, размером 4101 н.п., не содержит нетранслируемые 5' и 3' области гена и содержит 1 нуклеотидную замену A→G в позиции 4536, 1 нуклеотидную замену G→C в позиции 3105; 20 нуклеотидных замены T→G в позициях 594, 867, 966, 1119, 1143, 1173, 1317, 1686, 1740, 2496, 2613, 2802, 2928, 2937, 3117, 3189, 3249, 3405, 3486, 3963, не приводящие к изменениям в аминокислотной последовательности белка альфа-2 цепи коллагена I типа и имеет первичную структуру, приведенную на фиг 7.

Таким образом, получают линейку из 7 векторов на базе плазмиды pUC19, в которой клонированы кодирующие нативная и модифицированные нуклеотидные последовательности гена COL1A2 (при этом каждый вектор из линейки получен в двух вариантах и содержит целевой ген с ориентацией EcoRI-5'NTR-кДНК COL1A2-3'NTRHindIII и целевой ген с ориентацией HindIII-5'NTR- кДНК COL1A2-3'NTR-EcoRI для создания генетических экспрессионных конструкций на базе разных векторов) для создания линейки биологически активных генно-терапевтических субстанций.

Пример 3.

Создание генетических конструкций с модифицированными и нативной кДНК гена COL1A2 для получения на их базе биологически активных генно-терапевтических субстанций.

Для экспрессии кДНК гена COL1A2 в клетках органов и тканей человека полученные варианты кДНК COL1A2 по Примеру 1 и Примеру 2 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E.coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции;

3) в векторе должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) наличие удобного полилинкера для клонирования. Примером такой плазмиды может быть pCMV6-XL5, pCMV6-Kan/Neo (OriGene, USA) или pCDNA 3.1 (+) (ThermoFisherScientific, USA).

При клонировании кДНК гена COL1A2 в pCDNA 3.1 (+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину. При клонировании учитывают последовательность расположения сайтов HindIII и EcoRI в полилинкере pCDNA 3.1 (+) и поэтому для клонирования в данный вектор используют HindIII-5'NTR-кДНК COL1A2-3'NTR-Eco RI ориентированный фрагмент в pUC19 по примеру 1.

При клонировании кДНК гена COL1A2 в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину. При клонировании учитывают последовательность расположения сайтов EcoRI и HindIII в полилинкере pCMV6-XL5 (pCMV6-Kan/Neo) и поэтому для клонирования в данный вектор используют Eco RI -5'NTR-кДНК COL1A2-3'NTR-HindIII ориентированный фрагмент в pUC19 по примеру 1.

Векторные плазмиды pUC19- COL1A2 SEQ ID No: 1 с частичной нативной (немодифицированной) последовательностью гена COL1A2 (с 429 по 4782 н.п.), pUC19- COL1A2 SEQ ID No: 2, pUC19- COL1A2 SEQ ID No: 3, pUC19- COL1A2 SEQ ID No: 4, pUC19- COL1A2 SEQ ID No: 5, pUC19- COL1A2 SEQ ID No: 6, с частичной модифицированной путем замены оснований нуклеотидной последовательностью гена COL1A2 (с 429 по 4782 н.п.) и pUC19- COL1A2 SEQ ID No: 7 с модифицированной кДНК гена COL1A2 и лишенной нетранслируемыех 5' и 3' областей данного гена, а также векторные плазмиды pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1 (+) для дальнейшей экспрессии гена COL1A2 в эукариотических клетках, гидролизуют рестриктазами EcoRI и HindIII(NEB, USA) при 37°С в соответствующем буфере (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984).

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке Hindill-5'NTR-кДНК COL7/42-3'NTR-EcoRI, либо Eco RI -5'NTR-кДНК COL1A2-3'NTR- HindIII и линеаризованной плазмиде pCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1(+), вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit из примера 1 и смешивают. Полученную смесь рестрикционных фрагментов лигируют с помощью ДНК-лигазы фага Т4. Лигирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°С в течение 10 ч. Лигированную ДНК используют для трансформации клеток Е.coli по стандартной методике с использованием хлористого кальция. Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit, анализируют с помощью гидролиза рестриктазами тEcoRI и HindIII и отбирают генетическую(ие) конструкцию(ии), содержащую(ие) в своем составе кодирующую последовательность гена COL1A2 под контролем промотора цитомегаловируса CMV, и сигналом полиаденилирования гена гормона роста, обозначаемую как pCMV6 COL1A2 SEQ ID No: (1-7) или pCMV6-Kan/Neo COL1A2 SEQ ID No: (1-7) или pCDNA 3.1 COL1A2 SEQ ID No: (1-7). Наличие вставки кДНК гена COL1A2, ее последовательность и ориентацию также подтверждают с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих биологически активных генно-терапевтических субстанций.

Полученные генетические экспрессионные конструкции используют для получения на их базе биологически активных генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6 - XL5, (pCMV6-Kan/Neo) или pCDNA 3.1(+) без вставки кДНК гена COL1A2.

Пример 4.

Наращивание генетической конструкции в бактериальной культуре.

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена COL1A2, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E.coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена COL1A2 в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами EcoRI и HindIII и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (хондробластов, кератоцитов и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E.coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°С и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5.

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции биологически активной генно-терапевтической субстанцией и анализа экспрессии гена COL1A2.

Для последующей трансфекции биологически активной генно-терапевтической субстанцией содержащей один из вариантов кДНК COL1A2 по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например за ушной раковиной или с боковой внутренней поверхности в зоне локтевого сустава, размером около 3 мм, массой - до 20 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°С в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°С в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена COL1A2, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAlater и хранили при 4°С в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260 : D280 - не менее 1,8, а соотношение полос 28S : 18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК. В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6.

Анализ эндогенной экспрессии гена COL1A2 в культуре первичных фибробластов.

Анализ экспрессии транскрипции гена COL1A2 из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена COL1A2.

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена COL1A2 и фибробласты с нормальной экспрессией гена COL1A2, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК (3354-3533 н.п.), специфичной для гена COL1A2, используют прямой праймер COL1A2FA1 5' GCGGTGGTGGTTATGACTTTGG 3'

и обратный праймер COL1A2-RA1 5' GGCATGTGCGAGCTGGGTTC 3'

Длина продукта амплификации - 180 нуклеотидов. В качестве референтного гена используют ген бета-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена COL1A2.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого прймера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°С 30 минут, денатурация 98°С - 15 мин., затем 40 циклов, включающих денатурацию 94°С - 15 с, отжиг праймеров 55,9°С - 30 с и элонгацию 72°С - 30 с.

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов COL1A2 и В2М. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны). Количество ПЦР продуктов - кДНК генов COL1A2 и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.

По итогам анализа экспрессии, гена COL1A2 в разных культурах фибробластов (с низкой экспрессией гена COL1A2 и с нормальной экспрессией гена COL1A2) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена COL1A2, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7.

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена COL1A2 биологически активной генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена COL1A2 в культуре данных клеток.

Для оценки эффективности биологически активной генно-терапевтической субстанции, содержащей немодифицированную кДНК гена COL1A2 по примеру 3, этой биологически активной генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена COL1A2, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют биологически активной генно-терапевтической субстанцией на основе pCMV6- COL1A2 SEQ ID No: 1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4×105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°С и в атмосфере, содержащей 5% CO2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, рН 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°С.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С и в атмосфере, содержащей 5% CO2, после чего оценивали уровень кДНК гена COL1A2 и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена COL1A2 уровень кДНК гена COL1A2 в фибробластах не изменился, а в случае трансфекции вектором с кДНК COL1A2 - уровень кДНК фибробластов со сниженной экспрессией гена COL1A2 многократно увеличился (до уровня выше, чем уровень кДНК гена COL1A2 в нормальных фибробластах).

Показано, что в клетках трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6-COL1A2 SEQ ID No: 1 наблюдается усиление экспрессии целевого гена COL1A2.

Пример 8.

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена COL1A2 биологически активной генно-терапевтической субстанцией с кДНК гена COL1A2 с целью подтверждения увеличения количества белка альфа-2 цепи коллагена I типа в культуре данных клеток.

Для оценки изменения количества белка альфа-2 цепи коллагена I типа использовали культуру фибробластов кожи человека по Примеру 5, в качестве транспортной молекулы - дендримеры SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия), в качестве трансфицируемых агентов - биологически активную генно-терапевтическую субстанцию на основе векторной плазмиды pCDNA 3.1(+), содержащую кДНК гена COL1A2 - pCDNA 3.1 COL1A2 SEQ ID No: 1(A), векторную плазмиду pCDNA 3.1(+), не содержащую кДНК гена COL1A2 (В), в качестве контроля - водный раствор дендримеров без плазпрмидной ДНК (С). Приготовление комплекса ДНК-дендример и трансфекцию фибробластов проводили согласно Примеру 7.

После трансфекции клетки снимали раствором Версена. Для гомогенизации использовали смесь 100 мг клеток в 1 мл буфера PBS1×, которую подвергали двум этапам заморозки (-20°С на ночь) и разморозки в водяной бане (+37°С). После этого клеточный лизат центрифугировали 5 минут при 5000×g (+4°С).

Отбирали супернатант и использовали его для количественного определения целевого белка. Количественное определение продукта кДНК гена COL1A2 проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США.

В наборе использованы высоко специфичные антитела к белка альфа-2 цепи коллагена I типа, адсорбированные на лунках микропланшета. При первой инкубации добавляли по 100 мкл каждого образца и калибраторов в соответствующие лунки, закрывали лунки клейкой пленкой и инкубировали 2 часа при 37°С. (Калибратор готовят следующим образом: прибавляют 1 мл Буфера для разведения образцов к лиофилизированному стандартному образцу, затем делают 2-кратные разведение стандартного образца). Исследование калибраторов и образцов клеточного лизата проводили в трех повторностях. После инкубации жидкость из лунок удаляли. Затем в каждую лунку добавляли 100 мкл связаннных с биотином анитител, закрывали лунки чистой клейкой пленкой и инкубировали 1 час при 37°С. Снимали пленку со стрипов и отбирали всю жидкость, после чего вносили по 200 мкл Промывочного раствора в каждую лунку, через 2 минуты удаляли жидкость. Повторяли промывку 3 раза.

Далее в каждую лунку вносили по 100 мкл раствора фермента Пероксидазы хрена, связанным с авидином, заклеивали планшет чистой пленкой и инкубировали 1 час при 37°С. А затем отбирали жидкость и повторяли промывку 5 раз как описано выше.

Затем в лунки добавили 90 мкл хромогенного субстрата 3,3',5,5'-тетраметилбензидин (3,3',5,5'-Tetramethylbenzidine) и инкубировали плашку 20 минут при 37°С в темноте. После добавляли 50 мкл стоп-реагента (1N H2SO4), тщательно перемешали. Оптическая плотность измерялась при длине волны 450 нм при помощи автоматического биохимического и иммуноферментного анализатора ChemWell (Awareness TechNology Inc., США) и пропорциональна концентрации белка COL1A2 в пробе. Численное значение концентрации определяется с помощью калибровочной кривой, построенной по калибраторам с известной концентрацией белка COL1A2, входящим в состав набора. Разница между значениями оптической плотности (ОП) калибраторов поставленных в трех повторностях не превышала 10%.

Статистическую обработку полученных результатов, осуществляли с помощью программного обеспечения для статистической обработки и визуализации данных R, версия 3.0.2 (https://www.r-project.org/).

Таким образом показано, что трансфекция фибробластов полученной биологически активной генно-терапевтической субстанцией, несущей кДНК гена COL1A2, приводит к увеличению количества белка альфа-2 цепи коллагена I типа в клетках фибробластов.

Пример 9.

Введение в кожу человека клеточной культуры фибробластов, трансфицированной биологически активной генно-терапевтической субстанцией с кДНК гена COL1A2 с целью подтверждения увеличения после этого количества белка альфа-2 цепи коллагена I типа в биоптате кожи человека.

С целью анализа изменения количества белка альфа-2 цепи коллагена I типа в тканях человека пациентам в кожу предплечья вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- COL1A2 SEQ ID No: 7(C) в комбинации с транспортными молекулами - липосомами TRANSFAST ТМ Transfection Reagent (PROMEGA, USA),

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°С, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°С и использовали далее в качестве биологически активной генно-терапевтической субстанции.

Для последующей трансфекции клеток биологически активной генно-терапевтической субстанцией выращивали первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосимы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга.

Определение количества белка альфа-2 цепи коллагена I типа оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- COL1A2 SEQ ID No: 7, произошло увеличение количества белка альфа-2 цепи коллагена I типа, что может свидетельствовать об усилении экспрессии гена COL1A2. Тогда как при введении контрольных культур фибробластов (нетрансфицированных и трансфицированных вектором без вставки кДНК гена COL1A2 pCMV6-XL5) количество белка альфа-2 цепи коллагена I типа в коже не изменялась.

Таким образом показана эффективность биологически активной генно-терапевтической субстанции, несущей модифицированную кДНК гена COL1A2: трансфекция фибробластов полученной биологически активной генно-терапевтической субстанцией несущей модифицированную кДНК гена COL1A2, приводит к повышению количества белка альфа-2 цепи коллагена I типа в клетках фибробластов.

Пример 10.

Трансфекция культур фибробластов из биоптатов группы различных пациентов биологически активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК COL1A2.

С целью подтверждения индивидуального характера увеличения количества белка альфа-2 цепи коллагена I типа до различного уровня при трансфекции клеточных культур фибробластов пациентов биологически активными генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена COL1A2 анализировали количественный уровень белка альфа-2 цепи коллагена I типа в клеточных лизатах фибробластов, трансфицированных разными биологически активными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные и нативную кДНК COL1A2 в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена COL1A2.

Последовательность нативной кДНК COL1A2 приведена на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК COL1A2 приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в зоне локтевого сустава 28 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень белка альфа-2 цепи коллагена I типа в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford М.М. (1976) Anal. Biochem. 72: 248-254.]).

Затем каждую из 29-ти культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 1, содержащей немодифицированную кДНК COL1A2 (SEQ ID No: 1) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. Вторую часть, обозначенную (В), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 2, содержащей вариант 1 модифицированной кДНК COL1A2 (SEQ ID No: 2) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (С), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 3, содержащей вариант 2 модифицированной кДНК COL1A2 (SEQ ID No: 3) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 4, содержащей вариант 3 модифицированной кДНК COL1A2 (SEQ ID No: 4) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 5, содержащей 4 вариант модифицированной кДНК COL1A2 (SEQ ID No: 5) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 6, содержащей вариант 5 модифицированной кДНК COL1A2 SEQ ID No: 6) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 7, содержащей вариант 6 модифицированной кДНК COL1A2 (SEQ ID No: 7) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК COL1A2 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка альфа-2 цепи коллагена I типа оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США), как описано в Примере 8.

По итогам определения количества белка альфа-2 цепи коллагена I типа выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни количества белка альфа-2 цепи коллагена I типа и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при трансфекции немодифицированной кДНК COL1A2. В эту группу вошло 3 культуры из 28.

В группе 2 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при трансфекции 1 вариантом модифицированной кДНК COL1A2. В эту группу вошло 4 культуры из 28.

В группе 3 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при трансфекции 2 вариантом модифицированной кДНК COL1A2. В эту группу вошло 5 культур из 28.

В группе 4 максимальное количество белка альфа-2 цепи коллагена I типа наблюдалось при трансфекции 3 вариантом модифицированной кДНК COL1A2. В эту группу вошло 6 культур из 28.

В группе 5 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при трансфекции 4 вариантом модифицированной кДНК COL1A2. В эту группу вошло 5 культур из 28.

В группе 6 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при трансфекции 5 вариантом модифицированной кДНК COL1A2. В эту группу вошли 2 культуры из 28.

В группе 7 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при трансфекции 6 вариантом модифицированной кДНК COL1A2. В эту группу вошло 3 культуры из 28.

Ни в одной из клеточных культур не наблюдалось того, что при трансфекции вектором, не содержащим кДНК гена COL1A2 количество белка альфа-2 цепи коллагена I типа присутствует в максимальных количествах.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентраций белка альфа-2 цепи коллагена I типа (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена COL1A2.

Из данного примера следует, что достижение максимального количества белка альфа-2 цепи коллагена I типа в культурах фибробластов кожи различных пациентов при их трансфекции биологически активными генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена COL1A2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных биологически активных генно-терапевтических субстанций в рамках линейки биологически активных генно-терапевтических субстанций.

Пример 11.

Трансфекции клеточной культуры кератоцитов и эпителиальных клеток глаза биологически активной генно-терапевтическойсубстанцией без транспортной молекулы с целью подтверждения при этом увеличения экспрессии гена COL1A2 в данных культурах клеток.

С целью выяснения эффективности биологически активной генно-терапевтической субстанции, содержащей кДНК COL1A2, в различных типах клеток, трансфицировали кератоциты и эпителиальные клетки роговицы человека, без использования транспортных молекул.

Биопсийный материал из области лимба в виде круга диаметром 1-1.5 мм помещали в чашку Петри в сбалансированный солевой раствор Хэнкса, добавляли диспазу (20 мкл 25 ед/мл) и гентамицин и инкубировали 24 часа при +4. Затем отделяли эпителиальный слой от стромы и нарезали обе ткани кусочками 1-2 мм3.

Суспензию эпителиальных клеток получали путем инкубирования кусочков тканей в растворе Трипсин-ЭДТА в течение 15 минут при +37°С. Трипсинизацию останавливали добавлением соевого ингибитора трипсина в PBS. Клеточные суспензии отмывали центрифугированием при 700 об/мин и ресуспендировали в бессывороточной среде DMEM с гентамицином. Клетки растили в 25 см2 флаконах с 5 мл среды при 37°С и в атмосфере, содержащей 5% CO2. Через 24 часа среду с не прикрепившимися клетками удаляли и добавляли 5 мл свежей среды. Пересев производили каждые 7 дней в соотношении 1:2-1:3.

Суспензию кератоцитов получали путем инкубирования в среде RPMI-1640 с коллагеназой 300 ед/мл в течение 2 часов. Затем отмывали клетки и ресуспендировали в среде DMEM с 20% телячьей сывороткой и антибиотиком-антимикотиком. Клетки растили в 25 см2 флаконах с 1 мл среды при +37°С и в атмосфере, содержащей 5% CO2. Пересев производили каждые 7 дней в соотношении 1:4.

Поскольку эффективность трансфекции кератоцитов низкая, использовали биологически активную генно-терапевтическую субстанцию на основе плазмиды pCMV6-Kan/Neo COL1A2 SEQ ID No: 2, содержащую дополнительный фактор селекции - ген neor, придающий устойчивость к антибиотику генетицину.

Биологически активную генно-терапевтическую субстанцию добавляли к клеткам и инкубировали клетки 1 час при 37°С. После инкубации добавляли бессывороточную среду DMEM к эпителиальным клеткам и среду DMEM, содержащую 10% фетальной телячьей сыворотки к кератоцитам и продолжали инкубировать 24 часа. После 24-часового инкубирования клетки высевали в новую среду DMEM, содержащую 400 μg/mL фактора селекции - антибиотика G418 (Geneticin). Выжившие клетки культивировали в течение 2 недель в 25 см3 флаконах с 5 мл среды с G418. Всего выращивали 24 образца культур эпителиальных клеток и 24 образца культур кератоцитов.

Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК проводили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена COL1A2 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-RadUSA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение экспрессии (транскрипции) гена COL1A2 наблюдали на 3 сутки для эпителиальных клеток и на 5 сутки - для кератоцитов.

На фигуре 13 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена COL1A2, в кератоцитах и эпителиальных клетках роговицы.

Показано, что в кератоцитах и эпителиальных клетках роговицы человека, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- Kan/Neo COL1A2 SEQ ID No: 2, без транспортной молекулы, наблюдается усиление экспрессии целевого гена COL1A2

Пример 12.

Трансфекции клеточной культуры хондробластов биологически активной генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена COL1A2 в данных культуре клеток.

С целью выяснения эффективности биологически активной генно-терапевтической субстанции, содержащей кДНК гена COL1A2, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали хондробласты человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биоптаты хрящевой ткани массой 50-150 мг измельчали на фрагменты до 10 мм3 и инкубировали в буферном растворе с коллагеназой II, гиалуронидазой и трипсином в течение 48 часов при +37°С. Клетки отмывали бессывороточной средой DMEM, ресуспендировали в той же среде с гентамицином и выращивали при +37°С и в атмосфере, содержащей 5% CO2 во флаконах 75 см2 с 15 мл среды. Рост осуществлялся в бессыворотчной среде, так как в монослойной культуре хондроциты меняют форму и биохимические свойства. Пересев производили каждые 4 дня в соотношении 1:3, клетки снимали с поверхности флакона раствором трипсин-ЭДТА с 0.02% раствором Версена.

Для трансфекции клеток биологически активной генно-терапевтической субстанцией содержащей кДНК гена COL1A2 использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci. 2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-N-(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6- Kan/Neo COL1A2 SEQ ID No: 3 с модифицированной кДНК COL1A2 SEQ ID No: 3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК COL1A2 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение транскрипции COL1A2 наблюдали на 5 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена COL1A2.

Показано, что в хондробластах трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- Kan/Neo COL1A2 SEQ ID No: 3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается усиление экспрессии целевого гена COL1A2.

Пример 13.

Введение в кожу человека биологически активной генно-терапевтической субстанции с кДНК гена COL1A2 с целью подтверждения при этом увеличения количества белка альфа-2 цепи коллагена I типа в коже человека.

С целью анализа изменения количества белка альфа-2 цепи коллагена I типа пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена COL1A2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена COL1A2 с транспортной молекулой (А) -в кожу предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6 COL1A2 SEQ ID No: 4, которая содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 4), и плазмиду pCMV6-XL5, используемую в качестве плацебо - которая не содержит кДНК гена COL1A2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Количество белка альфа-2 цепи коллагена I типа оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США),как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения биологически активной генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее как описано в примере 9.

Показано, что в коже пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена COL1A2, произошло увеличение количества белка альфа-2 цепи коллагена I типа, тогда как при введении плацебо, количество белка альфа-2 цепи коллагена I типа в коже не изменялась, что говорит об усилении экспрессии гена COL1A2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена COL1A2. Результаты отражены на фигуре 15.

Пример 14.

Введение в хрящевую ткань человека биологически активной генно-терапевтической субстанции с кДНК гена COL1A2 с целью подтверждения при этом увеличения количества белка альфа-2 цепи коллагена I типа в хрящевой ткани человека.

С целью анализа изменения количества белка альфа-2 цепи коллагена I типа пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена COL1A2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена COL1A2 с транспортной молекулой (А) - в хрящевую ткань ушных раковин с тыльной стороны.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) no примеру 9. Далее генетическую конструкцию pCDNA 3.1 COL1A2 SEQ ID No: 5, которая содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 5), и плазмиду pCDNA 3.1(+), используемую в качестве плацебо, которая не содержит кДНК гена COL1A2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1-2 мм в хрящевую ткань ушных раковин с тыльной стороны. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,2 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 2 -3 см друг от друга.

Количество белка альфа-2 цепи коллагена I типа оценивали в лизатах биоптатов хрящевой ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков хрящевой ткани в зоне введения биологически активной генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, методом чрескожной пункционного биопсии при помощи одноразовой ручной биопсийной иглы, далее по примеру 9.

Показано, что в хрящевой ткани пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена COL1A2, произошло увеличение количества белка альфа-2 цепи коллагена I типа, тогда как при введении плацебо количество белка альфа-2 цепи коллагена I типа в хрящевой ткани не изменялось, что подтверждает усиление экспрессии гена COL1A2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена COL1A2. Результаты отражены на фигуре 16.

Пример 15.

Введение в мышечную ткань человека биологически активной генно-терапевтической субстанции с кДНК гена COL1A2 с целью подтверждения при этом увеличения количества белка альфа-2 цепи коллагена I типа в мышечной ткани человека.

С целью анализа изменения количества белка альфа-2 цепи коллагена I типа пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена COL1A2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена COL1A2 с транспортной молекулой (А) - в мышечную ткань икроножной мышцы.

В качестве транспортной молекулы использовали порошок липосом TRANS FAST ТМ Transfection Reagent (PROMEGA, USA) no примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo COL1A2 SEQ ID No: 6, которая содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена COL1A2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга.

Количество белка альфа-2 цепи коллагена I типа оценивали в лизатах биоптатов мышечной ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения биологически активной генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компания BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена COL1A2, произошло увеличение количества белка альфа-2 цепи коллагена I типа, тогда как при введении плацебо количество белка альфа-2 цепи коллагена I типа в мышечной ткани не изменялась, что подтверждает усиление экспрессии гена COL1A2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена COL1A2. Результаты отражены на фигуре 17.

Пример 16.

Введение группе различных пациентов биологически активных генно-терапевтическиих субстанций содержащих модифицированные и нативную кДНК COL1A2.

С целью подтверждения индивидуального характера увеличения количества белка альфа-2 цепи коллагена I типа до различного уровня при введении в кожу пациентов биологически активных генно-терапевтических субстанций с модифицированными и нативной кДНК гена COL1A2 анализировали количественный уровень белка альфа-2 цепи коллагена I типа в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена COL1A2.

Последовательность нативной кДНК COL1A2 приведена на фигуре 1, SEQ COL1A2 ID No: 1., последовательности модифицированных кДНК COL1A2 приведены на фигурах 2-7 (COL1A2 SEQ ID No: 2, COL1A2 SEQ ID No: 3, COL1A2 SEQ ID No: 4, COL1A2 SEQ ID No: 5, COL1A2 SEQ ID No: 6, COL1A2 SEQ ID No: 7).

При этом генетические конструкции, одна из которых содержит нативную кДНК гена COL1A2 (SEQ ID No: 1), вторая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 4)), пятая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов биологически активных генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой биологически активной генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения биологически активных генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 24-х пациентов, отобранных в случайном порядке, вводили 7 биологически активных генно-терапевтических субстанций и плацебо в кожу предплечья.

Биопсийные образцы брали через 72 часа после введения биологически активных генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения биологически активных генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

А - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 1, содержащий немодифицированную кДНК COL1A2 (SEQ ID No: 1) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

В - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 2, содержащий немодифицированную кДНК COL1A2 (SEQ ID No: 2) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

С - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 3, содержащий немодифицированную кДНК COL1A2 (SEQ ID No: 3) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

D - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 4, содержащий немодифицированную кДНК COL1A2 (SEQ ID No: 4) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Е - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 5, содержащий немодифицированную кДНК COL1A2 (SEQ ID No: 5) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

F - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 6, содержащий немодифицированную кДНК COL1A2 (SEQ ID No: 6) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

G - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 7, содержащий немодифицированную кДНК COL1A2 (SEQ ID No: 7) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащая кДНК гена COL1A2 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Количества белка альфа-2 цепи коллагена I типа оценивали в девяти биоптатах кожи от каждого пациента (от А до Н и в биоптате интактной кожи) через 72 часа после введения биологически активных генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США), как описано в Примере 8.

По итогам количественного анализа белка альфа-2 цепи коллагена I типа выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни количества белка альфа-2 цепи коллагена I типа и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при введении немодифицированной кДНК COL1A2. В эту группу вошли 3 биоптата из 24.

В группе 2 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при введении 1 варианта модифицированной кДНК COL1A2. В эту группу вошли 2 биоптата из 24.

В группе 3 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при введении 2 варианта модифицированной кДНК COL1A2. В эту группу вошли 3 биоптата из 24.

В группе 4 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при введении 3 варианта модифицированной кДНК COL1A2. В эту группу вошли 4 биоптата из 24.

В группе 5 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при введении 4 варианта модифицированной кДНК COL1A2. В эту группу вошли 3 биоптата из 24.

В группе 6 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при введении 5 варианта модифицированной кДНК COL1A2. В эту группу вошли 3 биоптата из 24.

В группе 7 максимальное количество белка альфа-2 цепи коллагена I типа, наблюдалось при введении 6 варианта модифицированной кДНК COL1A2. В эту группу вошло 6 биоптатов из 24.

Ни в одном из биоптатов не наблюдалось того, что при введении плацебо - векторной плазмиды, не содержащей кДНК гена COL1A2 количество белка альфа-2 цепи коллагена I типа, присутствует в максимальных количествах.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена COL1A2.

Из данного примера следует, что достижение максимального количества белка альфа-2 цепи коллагена I типа в биоптатах кожи различных пациентов при введении им в кожу биологически активных генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена COL1A2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных биологически активных генно-терапевтических субстанций в рамках линейки биологически активных генно-терапевтических субстанций.

Пример 17.

Трансфекция клеточной линии фибробластов пациента разными биологически активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК COL1A2 с целью персонализированного выбора из линейки биологически активных генно-терапевтических субстанций наиболее эффективной биологически активной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка альфа-2 цепи коллагена I типа в клеточных лизатах фибробластов этого пациента, трансфицированных разными биологически активными генно-терапевтическими субстанциями, содержащими нативную или модифицированные кДНК COL1A2.

Последовательность нативной кДНК COL1A2 приведена на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК COL1A2 приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7).

Вырастили культуры фибробластов из биоптата пациента по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Затем культуру фибробластов пациента разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 1, содержащей немодифицированную кДНК COL1A2 (SEQ ID No: 1) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. Вторую часть, обозначенную (В), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 2, содержащей вариант 1 модифицированной кДНК COL1A2 (SEQ ID No: 2) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (С), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 3, содержащей вариант 2 модифицированной кДНК COL1A2 (SEQ ID No: 3) по примеру 3 в сочетании с транспортными молекулами - липосомами попримеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 4, содержащей вариант 3 модифицированной кДНК COL1A2 (SEQ ID No: 4) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 5, содержащей 4 вариант модифицированной кДНК COL1A2 (SEQ ID No: 5) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 6, содержащей вариант 5 модифицированной кДНК COL1A2 SEQ ID No: 6) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 7, содержащей вариант 6 модифицированной кДНК COL1A2 (SEQ ID No: 7) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК COL1A2 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка альфа-2 цепи коллагена I типа в клеточных лизатах фибробластов пациента проводили через 72 часа после трансфекции методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США), как описано в Примере 8.

По итогам определения количества белка альфа-2 цепи коллагена I типа в культуре фибробластов пациента выделили вариант биологически активной генно-терапевтической субстанции, при трансфекции которой наблюдается максимальное количество белка альфа-2 цепи коллагена I типа в лизате клеточной культуры и соответственно наблюдается максимальная экспрессия гена COL1A2. В данном эксперименте максимальное количество белка альфа-2 цепи коллагена I типа в лизате отмечено при трансфекции биологически активной генно-терапевтической субстанцией на базе pCMV6 COL1A2 SEQ ID No: 5, содержащей модифицированную кДНК COL1A2, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18.

Введение в кожу пациента различных биологически активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена COL1A2 с персонализированного целью выбора из линейки биологически активных генно-терапевтических субстанций наиболее эффективной биологически активной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка альфа-2 цепи коллагена I типа в лизатах биоптатов кожи этого пациента, после введения ему в кожу биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена COL1A2.

Последовательность нативной кДНК COL1A2 приведена на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК COL1A2 приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7)

Пациенту вводили 7 биологически активных генно-терапевтических субстанций и плацебо в кожу предплечья.

Первая биологически активная генно-терапевтическоая субстанция(А) на базе pCMV6- SEQ ID No: 1, содержащая немодифицированную кДНК COL1A2 (SEQ ID No: 1) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая биологически активная генно-терапевтическая субстанция (В) на базе pCMV6- SEQ ID No: 2, содержащая вариант 1 модифицированной кДНК COL1A2 (SEQ ID No: 2) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

3-я биологически активная генно-терапевтическая субстанция (C) на базе pCMV6- SEQ ID No: 3, содержащая вариант 2 модифицированной кДНК COL1A2 (SEQ ID No: 3) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

4-я биологически активная генно-терапевтическая субстанция (D) на базе pCMV6- SEQ ID No: 4, содержащая вариант 3 модифицированной кДНК COL1A2 (SEQ ID No: 4) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

5-я биологически активная генно-терапевтическая субстанция (Е) на базе pCMV6- SEQ ID No: 5, содержащая 4 вариант модифицированной кДНК COL1A2 (SEQ ID No: 5) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

6-я биологически активная генно-терапевтическая субстанция (F) на базе pCMV6- SEQ ID No: 6, содержащая вариант 5 модифицированной кДНК COL1A2 SEQ ID No: 6) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

7-я биологически активная генно-терапевтическая субстанция (G) на базе pCMV6- SEQ ID No: 7, содержащая вариант 6 модифицированной кДНК COL1A2 (SEQ ID No: 7) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

8-я - векторная плазмида pCMV6-XL5, не содержащая кДНК COL1A2 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит нативную кДНК гена COL1A2 (SEQ ID No: 1), вторая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 4), пятая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена COL1A2 (SEQ ID No: 7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов биологически активных генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой биологически активной генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения биологически активных генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения биологически активных генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения биологически активных генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Определение количества белка альфа-2 цепи коллагена I типа определяли в девяти биоптатах кожи пациента через 72 часа после введения биологически активных генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Hum Human collagen alpha-2(I) chian (COL1A2) ELISA Kit (MyBioSource, США), an collagen, type I, alpha 1 (COL1A2) ELISA Kit (MyBioSource, США), как описано в Примере 8.

По итогам определения количества белка альфа-2 цепи коллагена I типа в лизате биоптатов кожи пациента выделили вариант биологически активной генно-терапевтической субстанции, при введении которой в кожу наблюдается максимальное количество белка альфа-2 цепи коллагена I типа в лизате биоптата кожи и соответственно наблюдается максимальная экспрессия гена COL1A2. В данном эксперименте максимальное количество целевого белка в лизате биоптата кожи отмечено при введении биологически активной генно-терапевтической субстанции на базе pCMV6 COL1A2 SEQ ID No: 2, содержащей модифицированную кДНК COL1A2, что показано на фигуре 20.

Таким образом выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создана линейка биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, вследствие недостаточной экспрессии гена COL1A2, способ ее получения и использования.

Созданная линейка биологически активных генно-терапевтических субстанций с использованием одной из модифицированных или нативной кДНК гена COL1A2 позволяет на практике использовать входящие в линейку биологически активные генно-терапевтические субстанции для повышения до необходимого уровня количества белка альфа-2 цепи коллагена I типа в различных клетках органов и тканей и/или органах и тканях человека.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант биологически активной генно-терапевтической субстанции из созданной линейки биологически активных генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить количество белка альфа-2 цепи коллагена I типа в клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование биологически активной генно-терапевтической субстанции с нативной кДНК гена COL1A2 не приводит к желаемому изменению уровня количества белка альфа-2 цепи коллагена I типа в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена COL1A2, приводящей к более эффективной экспрессии гена COL1A2.

При использовании заявленной биологически активной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Линейка биологически активных генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена COL1A2, повышая количество белка альфа-2 цепи коллагена I типа в клетках органов и тканей и/или органах и тканях человека в частности, в гемопоэтических клетках, или мезенхимальных стволовых клетках, или хондробластах, или миоцитах, или миобластах, или фибробластах, или остеобластах, или кератоцитах, или эпителиальных клетках, или клетках роговицы, или эндотелиальных клетках, или эпителиальных клетках, в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в соединительно-тканных структурах, или коже, или суставах, или хрящевой ткани, или костной ткани, или мышечной ткани, или сухожилиях, или связках, или кровеносных сосудах, или стенке артерий, или роговице глаза, или склере, или плаценте, или дентине, или строме внутренних органов в сочетании с транспортной молекулой или без нее при введении этих биологически активных генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание линейки биологически активных генно-терапевтических субстанций, при использовании которых применительно к клеткам органов и тканей и/или органам и тканям человека компенсируются дефекты гена COL1A2, влияющие на экспрессию этого гена или на количественный уровень белка альфа-2 цепи коллагена I типа, кодируемого этим геном, а также компенсируется недостаточное количество белка альфа-2 цепи коллагена I типа, вызванная факторами, влияющими на экспрессию гена COL1A2.

Повышение эффективности коррекции количественного уровня белка альфа-2 цепи коллагена I типа в клетках органов и тканей человека достигают за счет того, что при недостаточном количестве этого белка вследствие дефекта гена COL1A2 используют не белок, а генетическую конструкцию с кДНК гена COL1A2, кодирующую этот белок. При введении генетических конструкций в отличие от введения непосредственно белка, как в прототипе, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Промышленная применимость.

Все приведенные примеры по созданию и использованию созданной линейки биологически активных генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр,

мкл - микролитр

л - литр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е. ф-относительная единица флуоресценции

БАГТС - биологически активная генно-терапевтическая субстанция

1. Средство для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, на основе генно-терапевтических субстанций с геном COL1A2, где клетки органов и тканей выбраны из фибробластов, кератоцитов, хондробластов и эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани человека, представляющее собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена COL1A2 SEQ ID No: 1 или модифицированной кДНК гена COL1A2, при этом в качестве модифицированной кДНК гена COL1A2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы в сочетании с транспортной молекулой или без нее, причем регуляторные элементы обеспечивают транскрипцию этой последовательности в эукариотических клетках, в клетках органов и тканей человека, способную обеспечить повышение экспрессии гена COL1A2 и увеличить количество белка альфа-2 цепи коллагена I типа в клетках органов и тканей и/или органах и тканях человека, в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

2. Средство по п. 1, отличающееся тем, что генетическая конструкция с кДНК гена COL1A2 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена COL1A2, которая несет модификации, не затрагивающие структуру белка альфа-2 цепи коллагена I типа - делеции 5'-нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

3. Средство по п. 1, отличающееся тем, что в качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блок-сополимеры.

4. Способ получения средства для лечения состояний человеческого организма, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, на основе генно-терапевтических субстанций с геном COL1A2 по п. 1, заключающийся в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций по п. 1, при этом получают кДНК гена COL1A2, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена COL1A2 с кодирующей последовательностью белка каталазы, с делециями 5'- и 3'-нетранслируемых областей, полученной на основе участка нативной немодифицированной кДНК гена COL1A2 SEQ ID No: 1, или модифицированной кДНК гена COL1A2, при этом в качестве модифицированной кДНК гена COL1A2 используют или SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

5. Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена COL1A2 и/или уменьшением активности белка каталазы, заключающийся в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/ выбранных из группы созданных генно-терапевтических субстанций по п. 1, или сочетанием обозначенных способов.



 

Похожие патенты:

Изобретение относится к области биохимии. Описана группа изобретений, включающая конъюгат, снижающий уровень экспрессированной в печени РНК, содержащий антисмысловой LNA-олигомер и ковалентно связанную с ним конъюгатную группировку, содержащую группу, направленную на асиалогликопротеиновый рецептор и фармацевтическую композицию, содержащую вышеуказанный конъюгат в эффективном количестве.

Изобретение относится к области биохимии, в частности к молекуле рекомбинантной ДНК, указывающей на присутствие трансгенного события, где показательный образец семени, содержащего указанное трансгенное событие, депонирован в ATCC как РТА-12669.

Изобретение относится к биохимии. Описан одноцепочечный олигонуклеотид антигена, комплементарный к антисмысловой нити ДНК целевого гена, содержащий 12-24 нуклеотида, причем указанный олигонуклеотид характеризуется последовательностью, содержащей по меньшей мере три группы по меньшей мере из двух следующих друг за другом гуанинов.

Изобретение относится к генной инженерии, биотехнологии и иммунобиологии. Описан способ получения рекомбинантного белка склеростина позвоночного животного.

Настоящая группа изобретений относится к области медицины, в частности фармакологии, и раскрывает способ получения липидной наночастицы, инкапсулирующей молекулу siPHK и фармацевтическую композицию, содержащую липидную наночастицу, инкапсулирующую молекулу siPHK.

Изобретение относится к генетической инженерии, в частности к способу модификации целевого геномного локуса путем гомологичной рекомбинации в мышиной эмбриональной стволовой (ES) клетке.

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha.

Настоящее изобретение относится к биохимии. Описана молекула L-нуклеиновой кислоты, способная связываться с C5a человека, где молекула L-нуклеиновой кислоты содержит центральный участок нуклеотидов, где центральный участок нуклеотидов содержит нуклеотидную последовательность 5' AUGn1GGUGKUn2n3RGGGHUGUKGGGn4Gn5CGACGCA 3' [SEQ ID NO: 61], где n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и G, A, U, C, H, K и R являются рибонуклеотидами, и dU, dG и dA являются 2'-дезоксирибонуклеотидами.
Изобретение относится к области биохимии, в частности к способу борьбы с личинками металловидки серой, включающему использование инсектицида на основе нуклеиновой кислоты, с использованием короткого одноцепочечного антисмыслового фрагмента генома бакуловируса из консервативного домена RING гена IAP.

Представлены полинуклеотидная библиотека для получения спаренных последовательностей антител, способ получения представляющего интерес полинуклеотида и способ анализа и использования данных секвенирования.

Настоящее изобретение относится к области биотехнологии и фармацевтики, в частности к конъюгатам антитела для лечения ревматоидного артрита у пациента. Антитело, входящее в состав указанных конъюгатов, специфически связывает Экстра-Домен-A (ED-A) фибронектина и конъюгировано с интерлейкином-10.

Изобретение относится к химико-фармацевтической промышленности и представляет собой способ профилактики нарушения метаболизма кальция в костной ткани, вызванного длительным приемом глюкокортикоидов, путем перорального употребления средства, обладающего антирадикальной активностью, отличающийся тем, что в качестве средства антирадикальной защиты используют масляный раствор серосодержащего антиоксиданта тио-фан-бис-[(3,5-ди-трет-бутил-4-гидроксифенил)пропил]сульфид на фоне глюкокортикоидной терапии.

Группа изобретений относится к медицине и может быть использована для улучшения насыщенности клетками и архитектуры дегенерированного диска у пациента с дегенеративными изменениями межпозвоночного диска.

Группа изобретений относится к медицине, а именно к иммунологии, и может быть использована для регенерации поврежденной ткани или органа у пациента. Способ включает введение указанному пациенту, имеющему активные зародышевые центры в лимфоидной ткани, стволовых клеток для доставки или хоуминга в поврежденную ткань или орган, нуждающиеся в регенерации; и иммунодепрессанта, ингибирующего связывание стволовых клеток с указанными активными зародышевыми центрами, до или в сочетании с введением стволовых клеток.

Изобретение относится к производным 1,4-бензотиазепина , а также к фармацевтическим композициям и применению. Технический результат: получены новые соединения, которые могут быть использованы для лечения заболеваний и состояний, связанных с RyRs, в частности нарушений сердечной деятельности, костно-мышечных нарушений и нарушений центральной нервной системы (ЦНС).

Изобретение относится к медицине, а именно получению ренгеноконтрастных цементов для закрытия небольших полостей в костных тканях. Рентгеноконтрастный инжектируемый кальций-фосфатный цемент для костной пластики содержит в качестве рентгеноконтрастного вещества оксид тантала Ta2O5, дополнительно содержит монокальцийфосфат моногидрат (МКФМ), а в качестве затворяющей жидкости - смесь коллоидной силикатной суспензии (КСС) с полиэтиленгликолем (ПЭГ) при следующем соотношении компонентов, масс.
Изобретение относится к медицине, а именно к травматологии, ортопедии и неврологии, и может быть использовано при лечении остеохондроза. Способ включает введение витамина В12.

Изобретение относится к производному индазола, имеющему приведенную ниже формулу, или к его фармацевтически приемлемой соли, а также к фармацевтической композиции, его содержащей.
Изобретение относится к медицине, в частности к способу получения пористого гидроксиапатит-коллагенового композита, который характеризуется тем, что гидроксиапатит, полученный конденсационным способом с использованием гидроакустического преобразователя, смешивают с коллагеном, полученную гидроксиапатит-коллагеновую смесь гомогенизируют в ультразвуковом поле с частотой (22÷44) кГц, плотностью мощности (1÷10) Вт/см3 в течение (10÷400) с.

Группа изобретений относится к фармацевтике. Описана фармацевтическая композиция для лечения заболеваний, опосредованных циклооксигеназой-2.

Изобретение относится к биотехнологии, в частности к композиции для ингибирования роста и стимуляции апоптоза клеток злокачественной опухоли колоректального рака путем блокирования функции генов МСМ4 и Livin.

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, на основе генно-терапевтических субстанций с геном COL1A2, где клетки органов и тканей выбраны из фибробластов, кератоцитов, хондробластов и эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани человека, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена COL1A2 SEQ ID No: 1 или модифицированной кДНК гена COL1A2, при этом в качестве модифицированной кДНК гена COL1A2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства для лечения состояний человеческого организма, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, на основе генно-терапевтических субстанций с геном COL1A2; способа использования указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена COL1A2 иили уменьшением активности белка каталазы. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

Наверх