Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена il-11 и/или уменьшением количества белка интерлейкина-11 на основе генно-терапевтических субстанций с геном il-11, способ получения и использования

Группа изобретений относится к медицине и касается средства для лечения состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11 на основе генно-терапевтических субстанций с геном IL-11, где клетки органов и тканей выбраны из клеток фибробластов, клеток эндометрия матки, хондроцитов и эпителиальных клеток; органы и ткани выбраны из кожи, матки, хрящевой ткани, эндометриальной ткани или мышечной ткани человека, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена IL-11, с кодирующей последовательностью белка интерлейкина-11, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 1 или участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 2 или модифицированной кДНК гена IL-11, при этом в качестве модифицированной кДНК гена IL-11 используют SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и может быть использовано для коррекции патологических состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением уровня экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11, в частности, в терапевтических целях.

Предшествующий уровень.

В организме человека присутствуют низкомолекулярные белки цитокины, которые продуцируются почти всеми эукариотическими клетками. Они осуществляют свое биологическое действие через взаимодействие со специфическими клеточными поверхностными рецепторами, которые экспрессируются в небольших количествах на соответствующих клетках. Они регулируют активацию, дифференцировку и пролиферацию иммунных и неиммунных клеток. Цитокины участвуют в опосредовании как воспалительных, так и иммунных реакций и являются критическими элементами в ответе органов и тканей человека на повреждение или инфекционно-вирусное поражение. К цитокинам относятся такие медиаторы как интерлейкины, хемокины, колониестимулирующие факторы, факторы роста, интерфероны, супрессорные факторы и другие.

Интерлейкины продуцируются различными клетками организма и являются факторами взаимодействия между клетками всех органов и систем. Во многих случаях они проявляют себя как факторы аутокринной регуляции. В настоящее время известны гены и установлены аминокислотные последовательности более двух десятков интерлейкинов, играющих важную роль в формировании противоопухолевой защиты. При любом опухолевом росте имеются нарушения в системе интерлейкинов, которые проявляются дисбалансом продукции и регуляции этих биологически активных веществ, а также изменением экспрессии соответствующих рецепторов.

Белок интерлейкин-11 (ген IL-11) первоначально был выявлен в клетках стромы костного мозга мышей. Затем кДНК человека была клонирована из линии фибробластов и определена в нормальной коже человека. Данный белок стимулирует развитие В-клеток, зависимое от Т-клеток и синергичен с интерлейкином-3 в поддержании формирования колоний мегакариоцитов мыши. Лимфопоэтический и гемопоэтический цитокин интерлейкин-11 стимулирует синтез белков острой фазы воспаления, идентичен с фактором, ингибирующим адипогенез мышей, модулирует функции макрофагов и Т-хелперов типа 1 в клеточной культуре, показывает противовоспалительную активность в моделях на животных (Иммунодерматология, 2008, №1: 41-55).

Интерлейкин-11 - многофункциональный цитокин, вырабатывается преимущественно клетками стромы (фибробластами) костного мозга и лимфоидных органов, стимулирует пролиферацию ранних стволовых клеток и дифференцированных клеток-предшественниц из разных источников, включая кровь и костный мозг. Интерлейкин-11 вызывает выраженную стимуляцию тромбоцитопоэза путем индукции пролиферации, дифференцировки и созревания мегакариоцитов. Действуя на клетки костного мозга и клетки печени эмбрионов, интерлейкин-11 совместно с другими цитокинами может стимулировать различные стадии эритропоэза.

Также интерлейкин-11 является провоспалительным интерлейкином, поскольку регулирует функции Т- и В-лимфоцитов, принимает участие в индукции активности ряда киллерных клеток, является аутокринным фактором для пролиферации мегакариоцитов. Подобно IL-1 и IL-6 принимает участие в индукции синтеза белков острой фазы. Роль IL-11 при опухолевом росте изучена слабо.

У женщин имеется маточный интерлейкин-11, который синтезируется железистым эпителием эндометрия и децидуализированными стромальными клетками преимущественно во время рецептивного периода, когда матка восприимчива к имплантации бластоцисты. У женщин с идиопатическим бесплодием в эндометрии наблюдается снижение взаимодействия эпителиального интерлейкина-11 с его рецепторами по сравнению с контролем. Существует положительная корреляция между уровнем интерлейкина-11 в промывочных водах матки, собранных в период ожидаемой имплантации, и ответной реакцией женщин на стимуляцию яичников при подготовке к ЭКО. Данный факт свидетельствует, что низкий уровень интерлейкина-11 может быть причиной снижения вероятности имплантации эмбриона. Эти исследования показывают, что интерлейкин-11, секретируемый эпителием матки в маточную полость, обеспечивает прикрепление и имплантацию бластоцисты. Таким образом, недостаточная активация рецептора интерлейкина-11 в матке в течение рецептивного периода, связанная с низким количеством этого белка или с невысокой активностью гена IL-11, может блокировать прикрепление и нормальную имплантацию бластоцисты, в результате чего беременность не наступает.(Молекулярный биология, 2011, том 45, №1, с. 44-55).

В заявке US 20130109583 А1 (Piraye Yurttas Beim, 02.05.2013) описана связь рецептора IL11 с бесплодием. Также проведены исследования, которые выявили уменьшение интерлейкина-11 в маточном смыве у женщин с эндометриозом по сравнению с женщинами без данного заболевания (Известны способы получения рекомбинантной плазмидной ДНК, содержащей IL-11 человека в клетках E.coli или дрожжей Pichia pastoris, которые основаны на изолировании мРНК IL-11 из клеток тканей человека, получении кДНК методом обратно-транскриптазной ПЦР с последующим клонированием в экспрессирующий вектор [Paul S.R. et al. Molecular cloning of a cDNA encoding interleukin 11, a stromal cell-derived lymphopoietic and hematopoietic cytokine. Proc. Natl. Acad. Sci. USA, 1990. 87 (19): p.7512-7563; Morris J.C. et al. Molecular cloning and characterization of murine interleukin-11. Exp. Hematol, 1996. 24 (12): p.1369-1376; Wang T.Y. et al. Expression of the Recombinant Human Interleukin-11 in Pichia pastoris. Sheng Wu Hua Xue Yu, Sheng Wu Wu Li Xue Bao (Shanghai), 2001. 33 (6): р.659-664]. Недостатком известных методов является невозможность получения целевого белка, в полной мере сохраняющего биологическую активность.

В патенте США №5215895 (1993) описан способ получения синтетического гена IL-11 для последующей экспрессии в клетках E.coli с использованием для экспрессии отдельных фрагментов полноразмерного гена. Однако полного сохранения биологической активности у рекомбинантного продукта не достигается.

Известен способ получения белка слияния тиоредоксин/интерлейкин-11 с помощью трансформированных штаммов E.coli с последующим расщеплением белка слияния и выходом целевого белка интерлейкина-11 с сохраненной биологической активностью цитокинов (пат. США 6143524, 2000). Также в патенте RU 2426787 описаны рекомбинантная плазмидная ДНК pET32M/mTrx-rh/L-11, созданная на основе модифицированного вектора рЕТ32М и содержащая синтетический ген интерлейкина-11 человека, слитый с геном мутантного тиоредоксина mTrx, способ ее получения и штамм E.coli BL21(DE3)/pET32M/mTrx-rhIL-11, трансформированного рекомбинантной плазмидной и продуцирующий интерлейкин-11 человека в растворимой форме составе слитного белка mTrx-rh/L-11. Изобретение предполагает использование высокоэффективного метода металлохелатной хроматографии для выделения слитного белка и очистки конечного продукта интерлейкина-11. Недостатком данного подхода является высокая стоимость получения чистого рекомбинантного белка.

За прототип авторами была принята заявка WO 1996018372 А2, в которой говорится о применении белка интерлейкина 11 и полинуклеотидов, кодирующих этот белок в терапии инсультов и нейропатии, а также - для выявления соединений-агонистов (лигандов), полезных при терапии. В частности, в заявке говорится о полинуклеотиде, который кодирует белок интерлейкина-11, для изготовления лекарственного средства для лечения инсульта или невропатии, а также - для генной терапии. Такая генная терапия включает введение полинуклеотидной последовательности гена IL-11 в соматические клетки методами генной инженерии для замены дефектного гена IL-11, или для повышения производства белка интерлейкина-11 при таком заболевании, как инсульт. Эти полинуклеотиды содержат нуклеотидную последовательность, кодирующую полипептид, который имеет по меньшей мере 95% идентичности с аминокислотной последовательностью нативного белка интерлейкина-11. В предпочтительном варианте реализации изобретения полинуклеотид включает нативную полинуклеотидную последовательность, кодирующую природный белок гена IL-11. Полинуклеотид может содержать некодирующие 5' и 3' последовательности - транскрибируемые, но нетранслируемые последовательности, сигналы сплайсинга и полиаденилировани, сайты связывания рибосом и последовательности, которые стабилизируют мРНК. Другие варианты осуществления настоящего изобретения включают в себя полинуклеотиды, кодирующие варианты полипептида, в котором аминокислотные остатки замещены, удалены или добавлены, в любой комбинации (например, от 5-го до 10-го, от 1-го до 5-го, от 1-го до 3-го и т.д.).

Полинуклеотиды по настоящему изобретению могут быть получены с использованием стандартных методов клонирования, используя библиотеки кДНК, геномные библиотеки ДНК, или могут быть синтезированы с использованием хорошо известных технологий. В частности, описано, что полинуклеотид с кодирующей последовательностью белка интерлейкина-11 может быть встроен для экспрессии в реплицирующемся дефектном ретровирусном векторе. Полученная конструкция может быть введена в клетку, трансдуцированную ретровирусным плазмидным вектором, содержащим РНК, которая кодирует полипептид по настоящему изобретению, таким образом, что клетка продуцирует инфекционные вирусные частицы, содержащие интересующий ген. Эти клетки-продуценты могут быть введены пациенту для экспрессии гена и получения полипептида in vivo.

Недостатком данного подхода является то, что при создании генно-терапевтического средства в этом изобретении применены методы, которые приводят к делециям, заменам, вставкам аминокислот целевого белка интерлейкина-11, что может приводить к изменению его структуры и свойств, а также не учитываются индивидуальные характеристики пациента, в связи с которыми может понадобиться группа вариаций для данного средства.

Раскрытие изобретения

Задачей данного изобретения является создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11 на основе генно-терапевтических субстанций с геном IL-11, представляющего собой группу генно-терапевтических субстанций, при использовании которых с учетом индивидуальных особенностей пациента, происходит повышение уровня экспрессии гена IL-11 и/или повышение количества белка интерлейкина-11, в клетках органов и тканей и/или органах и тканях организма.

Указанная задача решается за счет того, что создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11 на основе генно-терапевтических субстанций с геном IL-11, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена IL-11, с кодирующей последовательностью белка интерлейкина-11, с делециями 5' и 3'- нетранслируемых областей, а именно, полученной на основе участка нативной немодифицированной кДНК гена IL-11 SEQ ID No:1 или участка нативной немодифицированной кДНК гена IL-11 SEQ ID No:2, или модифицированной кДНК гена IL-11, при этом в качестве модифицированной кДНК гена IL-11 используют SEQ ID No:3, или SEQ ID No:4, или SEQ ID No:5, или SEQ ID No:6, или SEQ ID No:7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена IL-11 в эукариотических клетках, в частности в клетках органов и тканей человека, и способную увеличить количество белка интерлейкина-11 в клетках органов и тканей и/или органах и тканях человека, в частности в головном мозге, спинном мозге, тимусе, гипоталамусе, мозжечке, гипофизе, коре почек, почках, легких, кишечнике, желудке, аппендиксе, семенниках, матке, коже, костях, костном мозге, суставах, пуповине, митральном клапане, плаценте, в костной, мышечной, хрящевой, соединительной, эндометриальной ткани, синовиальном эндотелии, в нейронах ЦНС, в клетках трофобласта, в фибробластах матки, сперматогониях, сперматоцитах, сперматидах, в клетках эндометрия матки, в эндотелиальных клетках вен, в синовиоцитах, хондроцитах, в кератоцитах кожи, фибробластах и остеобластах костной ткани, в фибробластах, эпителиальных и мышечных клетках в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека. При этом каждая генетическая конструкция с модифицированной кДНК гена IL-11 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена IL-11, которая несет модификации, не затрагивающие структуру белка интерлейкина-11, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, не влияющие на кодируемую этой последовательностью аминокислотную последовательность. В качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры.

Способ получения средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11 по п. 1, заключается в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций по п. 1, при этом получают кДНК гена IL-11, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена IL-11 с кодирующей последовательностью белка интерлейкина-11, с делециями 5'- и 3-нетранслируемых областей, а именно, полученной на основе участка нативной немодифицированной кДНК гена IL-11 SEQ ID No:1 или участка нативной немодифицированной кДНК гена IL-11 SEQ ID No:2, или модифицированной кДНК гена IL-11, при этом в качестве модифицированной кДНК гена IL-11 используют, или SEQ ID No:3, или SEQ ID No:4, или SEQ ID No:5, или SEQ ID No:6, или SEQ ID No:7, или сочетание этих генетических конструкций.

Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11, в том числе женского бесплодия, заключается в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1. клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/ выбранных из группы созданных генно-терапевтических субстанций по п. 1, или сочетанием обозначенных способов.

Перечень фигур

На фиг. 1

Представлена нуклеотидная последовательность немодифицированной кДНК гена IL-11 длиной 600 н.п. SEQ ID No:1, которая имеет высокую гомологию с приводимой в базе данных GenBank под номером NM_000641 и кодирует изоформу Large белка интерлейкина-11 (GenBank NP_000632.1).

На фиг. 2

Представлена нуклеотидная последовательность немодифицированной кДНК гена IL-11 длиной 383 н.п. SEQ ID No:2, которая имеет высокую гомологию с приводимой в базе данных GenBank под номером NM_000641 и кодирует изоформу Small белка интерлейкина-11 (GenBank NP_001254647.1.).

На фиг. 3

Представлена нуклеотидная последовательность модифицированной кДНК гена IL-11, SEQ ID No:3, которая

содержит 6 нуклеотидных замен G→C в позициях 615, 633, 639, 621, 624, 627, не приводящих к изменениям в аминокислотной последовательности белка интерлейкина-11 (изоформа Small).

На фиг. 4

Представлена нуклеотидная последовательность модифицированной кДНК гена IL-11, SEQ ID No:4, которая

содержит 7 нуклеотидных замен G→C в позициях 450, 615, 633, 639, 621, 624, 627 и три нуклеотидных замены A→G в позициях 447, 456, 549, не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (изоформа Small).

На фиг. 5

Представлена нуклеотидная последовательность модифицированной кДНК гена IL-11, SEQ ID No:5, которая

содержит 8 нуклеотидных замен G→C в позициях 399, 450, 615, 633, 639, 621, 624, 627 и 4 нуклеотидных замены A→G в позициях 417, 447, 456, 549, не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (изоформа Small).

На фиг. 6

Представлена нуклеотидная последовательность модифицированной кДНК гена IL-11, SEQ ID No:6, которая

содержит 7 нуклеотидных замен G→C в позициях 450, 615, 633, 639, 621, 624, 627 и 3 нуклеотидных замены A→G в позициях 447, 456, 549, не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (изоформа Large).

На фиг. 7

Представлена нуклеотидная последовательность модифицированной кДНК гена IL-11, SEQ ID No:7, которая

содержит 10 нуклеотидных замен G→C в позициях 306, 312, 399, 450, 615, 633, 639, 621, 624, 627 и 5 нуклеотидных замен A→G в позициях 243, 417, 447, 456, 549, не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (изоформа Large).

На фиг. 8

С целью последующего корректного определения генно-терапевтического эффекта после трансфекции фибробластов генно-терапевтической субстанцей с кДНК гена IL-11 проводили анализ эндогенной экспрессии гена IL-11 в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена IL-11, фибробласты со сниженной экспрессией гена IL-11

2 - кДНК гена IL-11, фибробласты с нормальной экспрессией гена IL-11

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена IL-11

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена IL-11

В качестве референтного гена использовали ген В2М (Бета-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

На фиг. 9

С целью подтверждения увеличения экспрессии гена IL-11 в клеточной культуре фибробластов со сниженной экспрессией гена IL-11 при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена IL-11 с генетической конструкцией pCMV6- IL-11 SEQ ID No:1 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена IL-11 в фибробластах с нормальной экспрессией гена IL-11,

2 - кДНК гена IL-11 в фибробластах со сниженной экспрессией гена IL-11 до трансфекции ГТС с кДНК гена IL-11

3 - кДНК гена IL-11 в фибробластах со сниженной экспрессией гена IL-11 после трансфекции ГТС с кДНК гена IL-11

4 - кДНК гена IL-11 в фибробластах со сниженной экспрессией гена IL-11 после трансфекции вектором без кДНК гена IL-11

5 - кДНК гена В2М в фибробластах с нормальной экспрессией гена IL-11

6 - кДНК гена В2М в фибробластах со сниженной экспрессией гена IL-11 до трансфекции ГТС с кДНК гена IL-11

7 - кДНК гена В2М в фибробластах со сниженной экспрессией гена IL-11 после трансфекции ГТС с кДНК гена IL-11

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена IL-11 после трансфекции вектором без кДНК гена IL-11

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена IL-11 уровень кДНК гена IL-11 в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена IL-11 - уровень кДНК фибробластов со сниженной экспрессией гена IL-11 многократно увеличился (до уровня выше, чем уровень кДНК гена IL-11 в нормальных фибробластах).

На фиг. 10

С целью подтверждения увеличения количества белка интерлейкина-11 в клеточной культуре фибробластов с нормальной экспрессией гена IL-11 при трансфекции данных клеток генно-терапевтической субстанцией содержащей кДНК гена IL-11 представлен график изменения количества белка интерлейкина-11 нетрансфицированных фибробластов (культура А), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК гена IL-11 (культура В) и трансфицированных генно-терапевтической субстанцией с генетической конструкцией pCDNA 3.1-IL-11 SEQ ID No:1 (культура С). Из графика следует, что при трансфекции фибробластов генно-терапевтической субстанцией с кДНК гена IL-11 происходит увеличение количества белка интерлейкина-11 в клеточном лизате.

На фиг. 11

С целью подтверждения увеличения количества белка интерлейкина-11 в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией представлен анализ изменения количества белка интерлейкина-11 в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (Б) и трансфицированные генно-терапевтической субстанцией с генетической конструкцией pCMV6- IL-11 SEQ ID No:7 (С) - в кожу предплечья. Также анализировали количественный уровень белка интерлейкина-11 в интактной коже. Показано повышение количества белка интерлейкина-11 в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией кДНК гена IL-11 (С).

На фиг. 12

С целью подтверждения увеличения количества белка интерлейкина-11 до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток генно-терапевтическими субстанциями с участками нативных немодифицированных кДНК гена IL-11 и модифицированных кДНК гена IL-11, представлен анализ изменения количественного уровня белка интерлейкина-11 в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена IL-11, используемой для трансфекции фибробластов.

Культуры фибробластов 19 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали генно-терапевтической субстанцией pCMV6-IL-11 SEQ ID No:1, части (В) трансфицировали генно-терапевтической субстанцией pCMV6-IL-11 SEQ ID No:2, части (С) трансфицировали генно-терапевтической субстанцией pCMV6-IL-11 SEQ ID No:3, части (D) трансфицировали генно-терапевтической субстанцией pCMV6-IL-11 SEQ ID No:4, части (E) трансфицировали генно-терапевтической субстанцией pCMV6-IL-11 SEQ ID No:5, части (F) трансфицировали генно-терапевтической субстанцией pCMV6-IL-11 SEQ ID No:6, части (G) трансфицировали генно-терапевтической субстанцией pCMV6-IL-11 SEQ ID No:7, части (H) трансфицировали векторной плазмидой, не содержащей кДНК гена IL-11.

По итогам анализа количественного уровня белка интерлейкина-11 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальное количество белка интерлейкина-11 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка интерлейкина-11 наблюдалось при трансфекции pCMV6-IL-11 SEQ ID No:1,

в группе 2 максимальное количество белка интерлейкина-11 наблюдалось при трансфекции pCMV6-IL-11 SEQ ID No:2,

в группе 3 максимальное количество белка интерлейкина-11 наблюдалось при трансфекции pCMV6-IL-11 SEQ ID No:3,

в группе 4 максимальное количество белка интерлейкина-11 наблюдалось при трансфекции pCMV6-IL-11 SEQ ID No:4,

в группе 5 максимальное количество белка интерлейкина-11 наблюдалось при трансфекции pCMV6-IL-11 SEQ ID No:5,

в группе 6 максимальное количество белка интерлейкина-11 наблюдалось при трансфекции pCMV6-IL-11 SEQ ID No:6,

в группе 7 максимальное количество белка интерлейкина-11 наблюдалось при трансфекции pCMV6-IL-11 SEQ ID No:7.

Ни в одной из клеточных культур не наблюдалось того, что максимальное количество белка интерлейкина-11 присутствует при трансфекции вектором без вставки кДНК гена IL-11.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентрации белка интерлейкина-11 (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена IL-11.

Из фигуры следует, что достижение максимального количества белка интерлейкина-11 в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена IL-11, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных ГТС IL-11 SEQ ID No:1 (А)

части клеточных культур, трансфицированных ГТС IL-11 SEQ ID No:2 (В)

части клеточных культур, трансфицированных ГТС IL-11 SEQ ID No:3 (С)

части клеточных культур, трансфицированных ГТС IL-11 SEQ ID No:4 (D)

части клеточных культур, трансфицированных ГТС IL-11 SEQ ID No:5 (Е)

части клеточных культур, трансфицированных ГТС IL-11 SEQ ID No:6 (F)

части клеточных культур, трансфицированных ГТС IL-11 SEQ ID No:7 (G)

части клеточных культур, трансфицированных плацебо (Н)

На фиг. 13

С целью подтверждения увеличения экспрессии гена IL-11 в клеточной культуре эндометрия матки человека при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена IL-11 в генетической конструкции pCMV6-Kan/Neo IL-11 SEQ ID No:2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена IL-11, клетки эндометрия до трансфекции

2 - кДНК гена IL-11, клетки эндометрия после трансфекции

3 - кДНК гена В2М, клетки эндометрия до трансфекции

4 - кДНК гена В2М, клетки эндометрия после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена IL-11 в культуре клеток эндометрия человека многократно вырос.

На фиг. 14

С целью подтверждения увеличения экспрессии гена IL-11 в клеточной культуре хондроцитов при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена IL-11 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена IL-11, до трансфекции

2 - кДНК гена IL-11, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена IL-11 вырос многократно.

На фиг. 15

С целью подтверждения увеличения количества белка интерлейкина-11 в коже человека при введении в кожу генно-терапевтической субстанции представлен анализ изменения количественного уровня белка интерлейкина-11 в коже. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена IL-11 pCMV6-IL-11 SEQ ID No:4 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена IL-11 с транспортной молекулой (А) - в кожу предплечья. Показано увеличение количества белка интерлейкина-11 в биоптате кожи пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена IL-11, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 16

С целью подтверждения увеличения количества белка интерлейкина-11 в хрящевой ткани человека при введении в хрящевую ткань генно-терапевтической субстанции представлен анализ изменения количественного уровня белка интерлейкина-11 в хрящевой ткани. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена IL-11 pCDNA 3.1 IL-11 SEQ ID No:5 (В) и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена IL-11 с транспортной молекулой (А) - в хрящевую ткань.

Показано увеличение количественного уровня белка интерлейкина-11 в лизате биоптата хрящевой ткани пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена IL-11, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 17

С целью подтверждения увеличения количества белка интерлейкина-11 в мышечной ткани человека при введении в мышечную ткань генно-терапевтической субстанции представлен анализ изменения количества белка интерлейкина-11 в мышечной ткани. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена IL-11 - pCMV6-Kan/Neo IL-11 SEQ ID No:6 (В) и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена IL-11 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение количества белка интерлейкина-11 в биоптате мышечной ткани пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена IL-11, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 18

С целью подтверждения увеличения количества белка интерлейкина-11 до различного индивидуального уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными и участками нативных немодифицированных кДНК гена IL-11 анализировали количественный уровень белка интерлейкина-11 в коже человека в зависимости от наличия и типа модификаций в кДНК гена IL-11.

Каждому из 20-ти пациентов, отобранных в случайном порядке, вводили в кожу предплечья 7 генно-терапевтических субстанций pCMV6- SEQ ID No:1, pCMV6- SEQ ID No:2, pCMV6- SEQ ID No:3, pCMV6-SEQ ID No:4, pCMV6- SEQ ID No:5, pCMV6- SEQ ID No:6, pCMV6- SEQ ID No:7 и плацебо pCMV6- XL5.

По итогам анализа количества белка интерлейкина-11 в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные количественные уровни белка интерлейкина-11 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка интерлейкина-11 наблюдалось при введении pCMV6-IL-11 SEQ ID No:1,

в группе 2 максимальное количество белка интерлейкина-11 наблюдалось при введении pCMV6-IL-11 SEQ ID No:2,

в группе 3 максимальное количество белка интерлейкина-11 наблюдалось при введении pCMV6-IL-11 SEQ ID No:3,

в группе 4 максимальное количество белка интерлейкина-11 наблюдалось при введении pCMV6-IL-11 SEQ ID No:4,

в группе 5 максимальное количество белка интерлейкина-11 наблюдалось при введении pCMV6-IL-11 SEQ ID No:5,

в группе 6 максимальное количество белка интерлейкина-11 наблюдалось при введении pCMV6-IL-11 SEQ ID No:6,

в группе 7 максимальное количество белка интерлейкина-11. наблюдалось при введении pCMV6-IL-11 SEQ ID No:7.

Ни в одном из биоптатов не наблюдалось того, что максимальное количество белка интерлейкина-11 присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка интерлейкина-11 (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после введения пациентам этих генно-терапевтических субстанций, содержащих модифицированные и участки нативных немодифицированных кДНК гена IL-11.

Из данного примера следует, что достижение максимального количества белка интерлейкина-11 в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена IL-11, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента. Обозначения:

биоптаты пациентов после введения ГТС IL-11 SEQ ID No:1 (А)

биоптаты пациентов после введения ГТС IL-11 SEQ ID No:2 (В)

биоптаты пациентов после введения ГТС IL-11 SEQ ID No:3 (С)

биоптаты пациентов после введения ГТС IL-11 SEQ ID No:4 (D)

биоптаты пациентов после введения ГТС IL-11 SEQ ID No:5 (Е)

биоптаты пациентов после введения ГТС IL-11 SEQ ID No:6 (F)

биоптаты пациентов после введения ГТС IL-11 SEQ ID No:7 (G)

биоптаты пациентов после введения плацебо (Н)

На фиг. 19

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количественный уровень белка интерлейкина-11 в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими участки нативных немодифицированных кДНК гена IL-11 или модифицированных кДНК гена IL-11.

По итогам анализа количества белка интерлейкина-11 в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой выявляется максимальная концентрация белка интерлейкина-11 в лизате клеточной культуры. В данном эксперименте максимальная концентрация белка интерлейкина-11 в лизате наблюдается при трансфекции генно-терапевтической субстанцией на базе pCMV6 IL-11 SEQ ID No:1, содержащей модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Обозначения:

1 - клеточный лизат после трансфекции ГТС IL-11 SEQ ID No:1 (А)

2 - клеточный лизат после трансфекции ГТС IL-11 SEQ ID No:2 (В)

3 - клеточный лизат после трансфекции ГТС IL-11 SEQ ID No:3 (С)

4 - клеточный лизат после трансфекции ГТС IL-11 SEQ ID No:4 (D)

5 - клеточный лизат после трансфекции ГТС IL-11 SEQ ID No:5 (Е)

6 - клеточный лизат после трансфекции ГТС IL-11 SEQ ID No:6 (F)

7 - клеточный лизат после трансфекции ГТС IL-11 SEQ ID No:7 (G)

8 - клеточный лизат после трансфекции плацебо (Н)

На фиг. 20

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка интерлейкина-11 в лизатах биоптатов кожи этого пациента, после введения ему генно-терапевтических субстанций, содержащих участки нативных немодифицированных кДНК гена IL-11 или модифицированных кДНК гена IL-11.

По итогам анализа количества белка интерлейкина-11 в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой выявляется максимальная концентрация белка интерлейкина-11 в лизате биоптата. В данном эксперименте максимальная концентрация белка интерлейкина-11 отмечена при введении генно-терапевтической субстанции на базе pCMV6 IL-11 SEQ ID No:2, содержащей модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения ГТС IL-11 SEQ ID No:1 (А)

2 - лизат биоптата после введения ГТС IL-11 SEQ ID No:2 (В)

3 - лизат биоптата после введения ГТС IL-11 SEQ ID No:3 (С)

4 - лизат биоптата после введения ГТС IL-11 SEQ ID No:4 (D)

5 - лизат биоптата после введения ГТС IL-11 SEQ ID No:5 (Е)

6 - лизат биоптата после введения ГТС IL-11 SEQ ID No:6 (F)

7 - лизат биоптата после введения ГТС IL-11 SEQ ID No:7 (G)

8 - лизат биоптата после введения плацебо (Н)

Реализация изобретения.

При снижении экспрессии генов, кодирующих белки, например, гена IL-11, происходит снижение количества белка в организме, что приводит к патологическим состояниям.

Генетически детерминированная дисрегуляция цитокинов, к которым относится интерлейкин-11, ведет к инициации не только хронических воспалительных процессов, но и к генерализированным нарушениям. Известно, что дисбаланс в продукции белков, например, семейства интерлейкин-1 (IL-1β, IL1RA, IL1RI), влияет на характер протекания воспалительных заболеваний и является одним из пусковых механизмов патологических процессов [Симбирцев А.С., Рыдловская А.В. // Цитокины и воспаление. - 2005. - Т.4, №3. - С.4-10].

Так, в экспериментах на мышах с нокаутом генов интерлейкинов-1α и 1β установлено, что их отсутствие снижает активацию внутриклеточных провоспалительных сигналов (Huang et al., 1999); подавляет образование специфических антител в ответ на введение чужеродного антигена (Nakae et al., 2001); сокращает время повышенной секреции адренокортикотропного гормона при стрессе (Horai et al., 1998); уменьшает проявления синдрома болезни, вызванного инъекцией эндотоксина (Мошкин М.П. Вавиловский журнал генетики и селекции, 2014, Т. 18, №1, с. 43).

Снижение экспрессии гена IL-11 приводит также к снижению вероятности имплантации бластоцисты. (Молекулярная биология, 2011, том 45, №1, с. 44-55.)

Преимущества использования генетической конструкции с геном IL-11 для коррекции экспрессии гена IL-11 и количественного уровня белка интерлейкина-11 в клетках органов и тканей человека, по сравнению с использованием полипептидов, идентичных или схожих с белком интерлейкина-11 и полинуклеотидов, содержащих область, кодирующую интерлейкин-11, как по прототипу - заявке WO 1996018372 А2, следующие:

1) легче обеспечить более высокий и стабильный уровень целевого белка в клетках, не требуется сложная и дорогостоящая процедура выделения и очистки белка,

2) обеспечивается транспортировка генно-терапевтической субстанции в больший спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка генно-терапевтической субстанции,

3) учитываются индивидуальные характеристики пациента.

Таким образом, для создания группы генно-терапевтических субстанций по данному изобретению был выбран ген IL-11, а не белок интерлейкин-11, кодируемый этим геном.

Для получения группы генно-терапевтических субстанций осуществляют следующие действия:

1. Получение участка нативной кДНК гена IL-11, содержащей белок-кодирующую область гена IL-11, клонирование его в промежуточную плазмиду, переклонирование его в экспрессионные векторные плазмиды под контроль эукариотических регуляторных элементов для экспрессии целевого гена таким образом, что полученные генетические конструкции содержат кодирующие нуклеотидные последовательности кДНК двух различных изоформ белка интерлейкина 11 - Large-Small, которые являются участками нативной немодифицированной кДНК гена IL-11 и которые используются для дальнейших модификаций этих кДНК.

2. Внесение в последовательность нуклеотидов кДНК гена IL-11 модификаций с целью создания ряда кДНК гена IL-11, обеспечивающих достаточный для борьбы с патологическими проявлениями уровень трансляции белка интерлейкина-11.

3. Клонирование участков нативных немодифицированных кДНК гена IL-11 и полученных на их основе модифицированных кДНК гена IL-11 в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E.coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение ряда генетических конструкций, содержащих модифицированные кДНК гена IL-11 и участки нативных немодифицированных кДНК гена IL-11 для создания на его базе группы генно-терапевтических субстанций.

6. Создание группы генно-терапевтических субстанций, каждая из которых включает генетическую конструкцию с модифицированными кДНК гена IL-11 и участки нативных немодифицированных кДНК гена IL-11, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена IL-11, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или хондроцитов, или клеток эпителия эндометрия матки.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или хондроцитов, или эпителия эндометрия матки и анализ экспрессии гена IL-11 из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или хондроцитов, или клеток эпителия эндометрия матки генно-терапевтическими субстанциями содержащими участки нативных немодифицированных кДНК гена IL-11 и/или модифицированные кДНК гена IL-11 и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена IL-11 в различных комбинациях.

D) Сравнительный анализ изменения уровня мРНК гена IL-11 и/или изменения количества белка интерлейкина-11 после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или хондроцитов, или клеток эпителия эндометрия матки генно-терапевтическими субстанциями содержащими участки нативных немодифицированных кДНК гена IL-11 и/или модифицированные кДНК гена IL-11 и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена IL-11. Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента генно-терапевтической субстанции.

E) Введение пациентам в органы и ткани культуры клеток трансфицированных генно-терапевтической субстанцией с кДНК гена IL-11, например введение в кожу человека аутологичных фибробластов, трансфицированных генно-терапевтической субстанцией с кДНК гена IL-11, и параллельное введение пациентам в органы и ткани, например в кожу, культур этих же клеток нетрансфицированных и трансфицированных вектором без вставки кДНК гена IL-11 и/или введение пациентам в органы и ткани генно-терапевтических субстанций, например введение в кожу человека генно-терапевтических субстанций, содержащих участки нативных немодифицированных кДНК гена IL-11 и/или модифицированные кДНК IL-11, а также плацебо в различных комбинациях.

F) Сравнительный анализ количества белка интерлейкина-11 в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных генно-терапевтическими субстанциями, содержащими кДНК гена IL-11 и векторными плазмидами, не содержащими кДНК гена IL-11 и/или генно-терапевтических субстанций, содержащих участки нативных немодифицированных кДНК гена IL-11 или модифицированные кДНК гена IL-11, а также плацебо.

G) Введение пациентам в органы и ткани, например, хрящевую или мышечную ткань, генно-терапевтических субстанций, содержащих участки нативных немодифицированных кДНК гена IL-11 и/или модифицированных кДНК гена IL-11, а также плацебо.

H) Сравнительный анализ количества белка интерлейкина-11 в органах и тканях человека, в частности в хрящевой ткани, или мышечной ткани человека, после введения генно-терапевтических субстанций, содержащих участки нативных немодифицированных кДНК гена IL-11 и/или модифицированных кДНК гена IL-11, а также плацебо.

I) Введение пациентам в органы и ткани, например введение в кожу пациента генно-терапевтических субстанций, содержащих участки нативных немодифицированных кДНК гена IL-11 и модифицированные кДНК гена IL-11.

J) Сравнительный анализ количества белка интерлейкина-11 в органах и тканях пациента, в частности в коже, после введения генно-терапевтических субстанций, содержащих участки нативных немодифицированных кДНК гена IL-11 и модифицированных кДНК гена IL-11. Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента генно-терапевтической субстанции из группы генно-терапевтических субстанций.

Пример 1.

Получение и клонирование нативной немодифицированной кДНК гена IL-11.

Немодифицированная кДНК гена IL-11 представляет собой последовательность нуклеотидов, которая имеет высокую гомологию с нуклеотидной последовательностью гена и мРНК IL-11, приведенной в базе даных GenBank под номером NM_000641; нуклеотиды с 154 по 753 транслируются в аминокислотную последовательность белка интерлейкина-11, соответствующую приведенной в GenBank под номером NP_000632.1.

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) и используют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно кинированные праймеры, комплементарные нуклеотидам 11-30 5' CCCTGCTGCTCAGGGCACAT 3' (IL 11-F1) и 780-761 5' AGGACGGTGGTGGCTTTGGG 3' (IL 11-R1) из последовательности мРНК IL-11 (#NM_ NMJ300641), получают участок нативной немодифицированной кДНК гена IL 11, содержащий кодирующую последовательность белка интерлейкина-11 и частичные делеции 5'- и 3'-нетранслируемых областей. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами. ПЦР проводят с помощью амплификатора Master CyclerGradient (Eppendorf, USA) в 50 мкл реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера IL-11 F1 и IL-11 R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (рН 8,85 при 20°С), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific,USA) при следующих условиях: первоначальная денатурация при +98°С в течение 30 с, 35 циклов, включающих денатурацию при +98°С в течение 10 с, отжиг праймеров при +65°С в течение 30 с и элонгацию при +68°С течение 2 мин.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany)

Амплифицированный фрагмент кДНК длиной 770 н.п., несущий участок нативной немодифицированной кДНК гена IL 11, клонируют в плазмидном векторе pUC19 (NEB, USA, кат номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, кат. номер N3041S) гидролизуют рестриктазой, дающей тупые концы, например, Smal (NEB, USA) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага Т4 400000 ед./мл (NEB.USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис -HCl, рН 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°С.

Полученной смесью трансформируют компетентные клетки E.coli Top10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки Петри с L-агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами IL 11-F1 и IL 11-R1 и подтверждают секвенированием по методу Сэнгера.

Пример 2.

Получение генетических конструкций с участком немодифицированной кДНК гена IL-11.

Для экспрессии участка немодифицированной кДНК гена IL-11 в клетках органов и тканей человека вариант кДНК гена IL-11 по Примеру 1 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E.coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции;

3) в плазмиде должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) в плазмиде должно быть наличие удобного полилинкера для клонирования. Примером такой плазмиды может быть pCMV6- XL5, pCMV6-Kan/Neo (OriGene, USA) или pCDNA 3.1 (+) (ThermoFisherScientific, USA), либо плазмидные векторы вирусного происхождения - например, аденовирус человека 5-го серотипа.

5) Плазмида может содержать нуклеотидные последовательности с регуляторными элементами для репликации в клетках млекопитающих, например, такие как SV40 ori из вируса обезьян SV40 или ori P/EBNA-1 из вируса Эпштейн-Барра человека.

6) Плазмида также может содержать дополнительные регуляторные элементы, усиливающие трансляцию белка, например, участки связывания с транскрипционным фактором NFkB, обеспечивающим активный транспорт плазмидной ДНК в клеточное ядро для более эффективной транскрипции целевого гена.

При клонировании немодифицированой кДНК гена IL-11 в pCDNA 3.1 (+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину.

При клонировании немодифицированой кДНК гена IL-11 в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину.

Векторную плазмиду pUC19-IL-11 с участком нативной немодифицированной последовательности кДНК гена IL-11 используют в качестве матрицы для амплификации со следующими парами праймеров:

1) EcoRI - IL11 Large-Hind III

CCGAATTCGCCACATGAACTGTGTTTGCCGCCT (F) и

CCCAAGCTTTCACAGCCGAGTCTTCAGC (R)

2) Hind III - IL-11 Large -Eco RI

CCAAGCTTGCCACCATGAACTGTGTTTGCCGCCT (F) и

CCGAATTCTCACAGCCGAGTCTTCAGC (R)

3) EcoRI-IL11 Small - Hind III

GGGAATTCGCCACCATGAGTGCGGGGGCA (F) и

CCCAAGCTTTCACAGCCGAGTCTTCAGC (R)

4) Hind III - IL-11 Small - Eco RI

GGAAGCTTGCCACCATGAGTGCGGGGGCA (F) и

CCGAATTCTCACAGCCGAGTCTTCAGC (R)

Амплификацию проводят при условиях, приведенных в Примере 1. Далее продукты амплификации переосаждают этиловым спиртом, осадки промывают 70% этанолом и растворяют в 1× ТЕ буфере, после чего подвергают рестрикции с эндонуклеазами EcoRI и HindIII.

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке HindIII-5'NTR- кДНК IL-11-3'NTR- EcoRI, либо EcoRI-5'NTR- кДНК IL-11-3'NTR- HindIII и линеаризованной плазмиде pCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1(+), вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit из примера 1 и смешивают. Полученную смесь рестрикционных фрагментов лигируют с помощью ДНК-лигазы фага ТА. Лигирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°С в течение 10 ч. Лигированную ДНК используют для трансформации клеток Е. coli по стандартной методике с использованием хлористого кальция. Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit, анализируют с помощью гидролиза рестриктазами EcoRI и HindIII и отбирают генетическую (ие) конструкцию с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Таким образом, получают экспрессионые генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), которые содержат кодирующие нуклеотидные последовательности двух различных изоформ белка интерлейкина 11 - Large-Small, идентичных содержащимся в GenBank под номерами NP_000632.1 и NP_001254647.1 соответственно.

Конструкции PCMV6-XL5-IL-11 Seq ID No1, pCMV6-Kan/Neo-IL-11 Seq ID No1 и pCDNA 3.1(+)- IL-11 Seq ID No1 созданы для экспрессии изоформы белка, идентичной номеру NP_000632.1 (Large), содержат нуклеотидную последовательность длиной 600 н.п. с первичной структурой, приведенной на фиг. 1 Seq ID No1.

Конструкции pCMV6-XL5-IL-11 Seq ID No2, pCMV6-Kan/Neo-IL-11 Seq ID No2 и pCDNA 3.1(+)- IL-11 Seq ID No2 созданы для экспрессии изоформы белка, идентичной номеру NP_001254647.1 (Small), содержат нуклеотидную последовательность длиной 383 н.п. с первичной структурой, приведенной на фиг. 2 Seq ID No2.

Пример 3.

Модификации кДНК гена IL-11 в генетических конструкциях для получения на их основе генно-терапевтических субстанций.

Модификации проводят таким образом, чтобы не затрагивать первичную структуру природных изоформ белка интерлейкина-11, а именно нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности, для получения модифицированных кДНК гена IL-11 с целью повышения эффективности транскрипции и трансляции белка интерлейкина-11 в клетках тканей и органов человека в участок нативной последовательности кДНК IL 11, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChIL 11е II XL kit или QuikChIL 11е Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA) согласно рекомендациям производителя.

http://www.agilent.com/cs/library/usermanuals/Public/200513.

К плазмидной ДНК, полученной по Примеру 2, в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 19-45 н.п. и проводят ПЦР в буфере QuikChIL 11е Multi reaction buffer (AgilentTechnologies, USA) со смесью ферментов QuikChIL 11е Multi mix (AgilentTechnologies, USA) при следующих условиях: 95°C 1 мин; далее от 30 до 35 циклов: 95°С 1 мин, 55°С 1 мин, 65°С 2 мин/1000 н.п. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°С. Полученной смесью трансформируют компетентные клетки E.coli Тор10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L-агаром, содержащие 100 мкг/мл ампициллина. Трансформированнные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК гена IL-11, кодирующей изоформу Small белка интерлейкина-11 (SEQ ID No 3) проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-IL-11 Seq ID No2, pCMV6-Kan/Neo-IL-11 Seq ID No2 и pCDNA 3.1(+)- IL-11 Seq ID No2 с праймерами, комплементарными участкам нативной кДНК гена IL-11, приведенной в GenBank под номером NM_000641:

1. IL-11 600-633 F:

5' GCCCCAGCCACCCCCCGACCCGCCGGCGCCCCCG 3',

Комплементарный нуклеотидам 600-633, с заменой G→C в позиции 615;

2. IL-11 622-654F:

5' CCGGCGCCCCCCCTGGCCCCCCCCTCCTCAGCC 3',

Комплементарный нуклеотидам 622-654, с заменами G→C в позициях 633, 639;

3. IL-11 607-645F:

5'CCACCCCCCGACCCCCCCGCCCCCCCCCTGGCCCCCCCC 3',

Комплементарный нуклеотидам 607-645, с заменами G→C в позициях 615, 633, 639, 621, 624, 627;

Модифицированная таким образом нуклеотидная последовательность кДНК гена IL-11 SEQ ID No:3 содержит 6 нуклеотидных замен G→C в позициях 615, 633, 639, 621, 624, 627 не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (Small), кодируемого частичной последовательностью гена IL-11 Seq ID No 2, и имеет первичную структуру, приведенную на фиг. 3.

Для получения модифицированной кДНК гена IL-11, кодирующей изоформу Small белка интерлейкина-11 (SEQ ID No 4) проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-IL-11 Seq ID No2, pCMV6-Kan/Neo-IL-11 Seq ID No2 и pCDNA 3.1(+)- IL-11 Seq ID No2 с праймерами, комплементарными участкам нативной кДНК гена IL-11, приведенной в GenBank под номером NM_000641:

1. IL-11 600-633 F:

5' GCCCCAGCCACCCCCCGACCCGCCGGCGCCCCCG 3',

Комплементарный нуклеотидам 600-633, с заменой G→C в позиции 615;

2. IL-11 622-654F:

5' CCGGCGCCCCCCCTGGCCCCCCCCTCCTCAGCC 3',

Комплементарный нуклеотидам 622-654, с заменами G→C в позициях 633, 639;

3. IL-11 607-645F:

5' CCACCCCCCGACCCCCCCGCCCCCCCCCTGGCCCCCCCC 3',

Комплементарный нуклеотидам 607-645, с заменами G→C в позициях 615, 633, 639, 621, 624, 627;

4. IL-11 540-561 F:

5' GCAGGCCCGGCTGGACCGGCTG 3',

Комплементарный нуклеотидам 540-561, с заменой A→G в позиции 549;

5 IL-11 435-471F:

5' GACAAGGCTGCGGGCCGACCTGCTGTCCTACCTGCGG3',

Комплементарный нуклеотидам 435-471, с заменами A→G в позициях 447, 456 и G→C в позиции 450.

Модифицированная таким образом нуклеотидная последовательность кДНК гена IL-11 SEQ ID No:4 содержит 7 нуклеотидных замен G→C в позициях 450, 615, 633, 639, 621, 624, 627 и три нуклеотидных замены A→G в позициях 447, 456, 549; не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (Small), кодируемого частичной последовательностью гена IL-11 Seq ID No 2 и имеет первичную структуру, приведенную на фиг. 4.

Для получения модифицированной кДНК гена IL-11, кодирующей изоформу Small белка интерлейкина-11 (SEQ ID No 5) проводят последовательный ПЦР-мутагенез на плазмидах PCMV6-XL5-IL-11 Seq ID No2, pCMV6-Kan/Neo-IL-11 Seq ID No2 и pCDNA 3.1(+)- IL-11 Seq ID No2 с праймерами, комплементарными участкам нативной кДНК гена IL-11, приведенной в GenBank под номером NM_000641:

1. IL-11 600-633 F:

5' GCCCCAGCCACCCCCCGACCCGCCGGCGCCCCCG 3',

Комплементарный нуклеотидам 600-633, с заменой G→C в позиции 615;

2. IL-11 622-654F:

5' CCGGCGCCCCCCCTGGCCCCCCCCTCCTCAGCC 3',

Комплементарный нуклеотидам 622-654, с заменами G→C в позициях 633, 639;

3. IL-11 607-645F:

5' CCACCCCCCGACCCCCCCGCCCCCCCCCTGGCCCCCCCC 3',

Комплементарный нуклеотидам 607-645, с заменами G→C в позициях 615, 633, 639, 621, 624, 627;

4. IL-11 540-561 F:

5' GCAGGCCCGGCTGGACCGGCTG 3',

Комплементарный нуклеотидам 540-561, с заменой A→G в позиции 549;

5 IL-11 435-471F: 5' GACAAGGCTGCGGGCCGACCTGCTGTCCTACCTGCGG3',

Комплементарный нуклеотидам 435-471, с заменами A→G в позициях 447, 456 и G→C в позиции 450;

6. IL-11 401-432 F:

5' GGGCACTGGGAGCTCTGCAGCTCCCAGGTGTG 3',

Комплементарный нуклеотидам 401-432, с заменой A→G в позиции 417;

7. IL-11 387-412 F:

5' ATGAGTGCCGGGGCACTGGGAG 3',

Комплементарный нуклеотидам 387-412, с заменой G→C в позиции 399.

Модифицированная таким образом нуклеотидная последовательность кДНК гена IL-11 SEQ ID No:5 содержит 8 нуклеотидных замен G→C в позициях 399, 450, 615, 633, 639, 621, 624, 627 и 4 нуклеотидных замены A→G в позициях 417, 447, 456, 549; не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (Small), кодируемого частичной последовательностью гена IL-11 Seq ID No 2 и имеет первичную структуру, приведенную на фиг. 5.

Для получения модифицированной кДНК гена IL-11, кодирующей изоформу Large белка интерлейкина-11 (SEQ ID No 6) проводят последовательный ПЦР-мутагенез на плазмидах PCMV6-XL5-IL-11 Seq ID No1, pCMV6-Kan/Neo-IL-7? Seq ID No1 и pCDNA 3.1(+)- IL-11 Seq ID No1 с праймерами, комплементарными участкам нативной кДНК гена IL-11, приведенной в GenBank под номером NM_000641:

1. IL-11 600-633 F:

5' GCCCCAGCCACCCCCCGACCCGCCGGCGCCCCCG 3',

Комплементарный нуклеотидам 600-633, с заменой G→C в позиции 615;

2. IL-11 622-654F:

5' CCGGCGCCCCCCCTGGCCCCCCCCTCCTCAGCC 3',

Комплементарный нуклеотидам 622-654, с заменами G→C в позициях 633, 639;

3. IL-11 607-645F:

5' CCACCCCCCGACCCCCCCGCCCCCCCCCTGGCCCCCCCC 3',

Комплементарный нуклеотидам 607-645, с заменами G→C в позициях 615, 633, 639, 621, 624, 627;

4. IL-11 540-561 F:

5' GCAGGCCCGGCTGGACCGGCTG 3',

Комплементарный нуклеотидам 540-561, с заменой A→G в позиции 549;

5. IL-11 435-471F:

5' GACAAGGCTGCGGGCCGACCTGCTGTCCTACCTGCGG 3',

Комплементарный нуклеотидам 435-471, с заменами A→G в позициях 447, 456 и G→C в позиции 450.

Модифицированная таким образом нуклеотидная последовательность кДНК гена IL-11 SEQ ID No:6 содержит 7 нуклеотидных замен G→C в позициях 450, 615, 633, 639, 621, 624, 627 и 3 нуклеотидных замены A→G в позициях 447, 456, 549; не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (Large), кодируемого частичной последовательностью гена IL-11 Seq ID No 1 и имеет первичную структуру, приведенную на фиг. 6.

Для получения модифицированной кДНК гена IL-11, кодирующей изоформу Large белка интерлейкина-11 (SEQ ID No 7) проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-IL-11 Seq ID No1, pCMV6-Kan/Neo-IL-11 Seq ID No1 и pCDNA 3.1(+)- IL-11 Seq ID No1 с праймерами, комплементарными участкам нативной кДНК гена IL-11, приведенной в GenBank под номером NM_000641:

1. IL-11 600-633 F:

5' GCCCCAGCCACCCCCCGACCCGCCGGCGCCCCCG 3',

Комплементарный нуклеотидам 600-633, с заменой G→C в позиции 615;

2. IL-11 622-654F:

5' CCGGCGCCCCCCCTGGCCCCCCCCTCCTCAGCC 3',

Комплементарный нуклеотидам 622-654, с заменами G→C в позициях 633, 639;

3. IL-11 607-645F:

5' CCACCCCCCGACCCCCCCGCCCCCCCCCTGGCCCCCCCC 3',

Комплементарный нуклеотидам 607-645, с заменами G→C в позициях 615, 633, 639, 621, 624, 627;

4. IL-11 540-561 F:

5' GCAGGCCCGGCTGGACCGGCTG 3',

Комплементарный нуклеотидам 540-561, с заменой A→G в позиции 549;

5 IL-11 435-471F:

5' GACAAGGCTGCGGGCCGACCTGCTGTCCTACCTGCGG3',

Комплементарный нуклеотидам 435-471, с заменами A→G в позициях 447, 456 и G→C в позиции 450;

6. IL-11 401-432 F:

5' GGGCACTGGGAGCTCTGCAGCTCCCAGGTGTG 3',

Комплементарный нуклеотидам 401-432, с заменой A→G в позиции 417;

7. IL-11 387-412 F:

5' ATGAGTGCCGGGGCACTGGGAG 3',

Комплементарный нуклеотидам 387-412, с заменой G→C в позиции 399;

8. IL-11 293-325 F

5' GCTCTCTCCTGGCCGACACCCGGCAGCTGGCTG 3',

Комплементарный нуклеотидам 293-325, с заменами G→C в позициях 306 и 312;

9. IL-11 236-259 F

5' CCCCTCGGGTTTCCCCAGACCCTC 3',

Комплементарный нуклеотидам 236-259, с заменой A→G в позиции 243.

Модифицированная таким образом нуклеотидная последовательность кДНК гена IL-11 SEQ ID No:7 содержит 10 нуклеотидных замен G→C в позициях 306, 312, 399, 450, 615, 633, 639, 621, 624, 627 и 5 нуклеотидных замен A→G в позициях 243, 417, 447, 456, 549; не приводящие к изменениям в аминокислотной последовательности белка интерлейкина-11 (Large), кодируемого частичной последовательностью гена IL-11 Seq ID No 1 и имеет первичную структуру, приведенную на фиг. 7.

Таким образом, получают экспрессионные векторы на базе плазмид pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), в которых клонированы немодифицированные кДНК гена IL-11 (SEQ ID No:1 - Large, SEQ ID No:2 - Small) и модифицированные нуклеотидные последовательности гена IL-11, кодирующие две различные изоформы белка интерлейкина 11 - Small (SEQ ID No:3, 4, 5) и Large ((SEQ ID No:6, 7).

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Полученные экспрессионные векторы используют для получения на их основе генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6 - XL5, (pCMV6-Kan/Neo) или pCDNA 3.1 (+) без вставки кДНК гена IL-11.

Пример 4.

Наращивание генетической конструкции в бактериальной культуре.

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена IL-11, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E.coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена IL-11 в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами EcoRI и HindIII и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (хондроцитов, эндометрия матки и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E.coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°С и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5.

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции генно-терапевтической субстанцией и анализа экспрессии гена IL-11.

Для последующей трансфекции генно-терапевтической субстанцией содержащей один из вариантов кДНК гена IL-11 по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например, за ушной раковиной или с боковой внутренней поверхности в зоне локтевого сустава, размером около 3 мм, массой - до 20 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°С в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°С в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена IL-11, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAIater и хранили при 4°С в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260: D280 - не менее 1,8, а соотношение полос 28S: 18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК. В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6.

Анализ эндогенной экспрессии гена IL-11 в культуре первичных фибробластов.

Анализ экспрессии гена IL-11 из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена IL-11.

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена IL-11 и фибробласты с нормальной экспрессией гена IL-11, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК (845-996 н.п.), специфичной для гена IL-11, используют прямой праймер IL-11 FA1 5' CAGGTGGCTCTTCCCTGAA 3' и обратный праймер IL-11-RA1 5' CAGGCGGGACATCAGGAG 3'

Длина продукта амплификации - 101 нуклеотид. В качестве референтного гена используют ген бета-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена IL-11.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого примера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°С 30 мин, денатурация 98°С - 15 мин, затем 40 циклов, включающих денатурацию 94°С - 15 с, отжиг праймеров 61°С - 30 с и элонгацию 72°С - 30 с.

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов IL-11 и В2М. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны). Количество ПЦР продуктов - кДНК генов IL-11 и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.

По итогам анализа экспрессии гена IL-11 в разных культурах фибробластов (с низкой экспрессией гена IL-11 и с нормальной экспрессией гена IL-11) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена IL-11, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7.

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена IL-11 генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена IL -11 в культуре данных клеток.

Для оценки эффективности генно-терапевтической субстанции, содержащей немодифицированную кДНК гена IL-11 по примеру 3, этой генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена IL-11, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют генно-терапевтической субстанцией на основе pCMV6- IL-11 SEQ ID No:1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4×105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°С и в атмосфере, содержащей 5% СО2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, рН 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°С.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С и в атмосфере, содержащей 5% CO2, после чего оценивали уровень кДНК гена IL-11 и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена IL-11 уровень кДНК гена IL-11 в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена IL-11 - уровень кДНК фибробластов со сниженной экспрессией гена IL-11 многократно увеличился (до уровня выше, чем уровень кДНК гена IL-11 в нормальных фибробластах).

Показано, что в клетках трансфицированных генно-терапевтической субстанцией на основе pCMV6- IL-11 SEQ ID No:1 наблюдается усиление экспрессии целевого гена IL-11.

Пример 8.

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена IL-11 генно-терапевтической субстанцией с кДНК гена IL-11 с целью подтверждения увеличения количества белка интерлейкина-11 в культуре данных клеток.

Для оценки изменения количества белка интерлейкина-11 использовали культуру фибробластов кожи человека по Примеру 5, в качестве транспортной молекулы - дендримеры SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия), в качестве контроля - водный раствор дендримеров без плазмидной ДНК (А), векторную плазмиду pCDNA 3.1(+), не содержащую кДНК гена IL-11 (В), в качестве трансфицируемых агентов - генно-терапевтическую субстанцию на основе векторной плазмиды pCDNA 3.1(+), содержащую кДНК гена IL-11 - pCDNA 3.1 IL-11 EQ ID No: 1(C), Приготовление комплекса ДНК-дендример и трансфекцию фибробластов проводили согласно Примеру 7.

После трансфекции к 0,5 мл культуральной жидкости приливали 0,1 мл 1N HCl, тщательно перемешивали и инкубировали 10 минут при комнатной температуре. Затем нейтрализовывали смесь, добавляя 0,1 мл 1.2N NaOH/0.5M HEPES (рН 7-7,6) и тщательно перемешивали.

Данную смесь использовали для количественного определения целевого белка. Количественное определение продукта кДНК гена IL-11 проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Human IL-11 ELISA Kit (Interleukin-11) (Abeam, США) согласно методике производителя

http://www.abcam.com/ps/products/100/ab100551/documents/ab100551%20IL-11%20Human_ELISA_Kit%20(website).pdf.

Метод детекции результатов - колориметрический. Оптическая плотность образцов измерялась при длине волны 450 нм при помощи автоматического биохимического и иммуноферментного анализатора ChemWell (Awareness TechNology Inc., США) и пропорциональна концентрации белка IL-11 в пробе. Численное значение концентрации определяется с помощью калибровочной кривой, построенной по калибраторам с известной концентрацией белка IL-11, входящим в состав набора. Разница между значениями оптической плотности (ОП) калибраторов поставленных в трех повторностях не превышала 10%.

Статистическую обработку полученных результатов, осуществляли с помощью программного обеспечения для статистической обработки и визуализации данных R, версия 3.0.2 (https://www.r-project.org/).

Таким образом, показано, что транфекция фибробластов полученной генно-терапевтической субстанцией, несущей кДНК гена IL-11, приводит к увеличению количества белка интерлейкина-11 в клетках фибробластов. Результаты показаны на фигуре 10.

Пример 9.

Введение в кожу человека клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией с кДНК гена IL-11 с целью подтверждения увеличения после этого количества белка интерлейкина-11 в биоптате кожи человека.

С целью анализа изменения количества белка интерлейкина-11 в тканях человека пациентам в кожу предплечья вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных генно-терапевтической субстанцией на основе pCMV6-IL-11 SEQ ID No:7(C) в комбинации с транспортными молекулами - липосомами TRANSFAST ТМ Transfection Reagent (PROMEGA, USA).

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°С, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°С и использовали далее в качестве генно-терапевтической субстанции.

Для последующей трансфекции клеток генно-терапевтической субстанцией выращивали первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосимы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга.

Определение количества белка интерлейкина-11 оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human IL-11 ELISA Kit (lnterleukin-11) (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией на основе pCMV6- IL-11 SEQ ID No:7, произошло увеличение количества белка интерлейкина-11, что может свидетельствовать об усилении экспрессии гена IL-11. Тогда как при введении контрольных культур фибробластов (нетрансфицированных и трансфицированных вектором без вставки кДНК гена IL-11 pCMV6-XL5) количество белка интерлейкина-11 в коже не изменялась.

Таким образом, показана эффективность генно-терапевтической субстанции, несущей модифицированную кДНК гена IL-11 при введении в кожу человека клеточной культуры фибробластов, трансфицированных полученной генно-терапевтической субстанцией, несущей модифицированную кДНК гена IL-11, приводит к повышению количества белка интерлейкина- 11 в коже в зоне введения.

Пример 10.

Трансфекция культур фибробластов из биоптатов группы различных пациентов генно-терапевтическими субстанциями, содержащими модифицированные и участки нативных немодифицированных кДНК гена IL-11.

С целью подтверждения индивидуального характера увеличения количества белка интерлейкина-11 до различного уровня при трансфекции клеточных культур фибробластов пациентов генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена IL-11 анализировали количественный уровень белка интерлейкина-11 в клеточных лизатах фибробластов, трансфицированных разными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные и участки нативных немодифицированных кДНК гена IL-11 в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена IL-11.

Последовательности участков нативных немодифицированных кДНК гена IL-11 приведены на фигурах 1 и 2, SEQ ID No:1. и SEQ ID No:2, последовательности модифицированных кДНК гена IL-11 приведены на фигурах 3-7 (SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в зоне локтевого сустава 19 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень белка интерлейкина-11 в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мM NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford М.М. (1976) Anal. Biochem. 72: 248-254]).

Затем каждую из 19-ти культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:1, содержащей немодифицированную кДНК гена IL-11 Large изоформы (SEQ ID No:1.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No:2, содержащей немодифицированную кДНК гена IL-11 Small изоформы (SEQ ID No:2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:3, содержащей модифицированную кДНК гена IL-11 Small изоформы (SEQ ID No:3.) по примеру 3 в сочетании с транспортными молекулами - липосомами попримеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:4, содержащей модифицированную кДНК гена IL-11 Small изоформы (SEQ ID No:4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:5, содержащей модифицированную кДНК гена IL-11 Small изоформы (SEQ ID No:5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:6, содержащей модифицированную кДНК гена IL-11 Large изоформы (SEQ ID No:6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:7, содержащей вариант модифицированную кДНК гена IL-11 Large изоформы (SEQ ID No:7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена IL-11 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка интерлейкина-11 оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human IL-11 ELISA Kit (lnterleukin-11) (Abeam, США), как описано в Примере 8.

По итогам определения количества белка интерлейкина-11 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни количества белка интерлейкина-11 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка интерлейкина-11, наблюдалось при трансфекции немодифицированной кДНК гена IL-11 SEQ ID No:1. В эту группу вошло 2 культуры из 19.

В группе 2 максимальное количество белка интерлейкина-11, наблюдалось при трансфекции немодифицированной кДНК гена IL-11 SEQ ID No:2. В эту группу вошло 2 культуры из 19.

В группе 3 максимальное количество белка интерлейкина-11, наблюдалось при трансфекции модифицированной кДНК гена IL-11 SEQ ID No:3. В эту группу вошло 3 культуры из 19.

В группе 4 максимальное количество белка интерлейкина-11 наблюдалось при трансфекции модифицированной кДНК гена IL-11 SEQ ID No:4. В эту группу вошли 2 культуры из 19.

В группе 5 максимальное количество белка интерлейкина-11, наблюдалось при трансфекции модифицированной кДНК гена IL-11 SEQ ID No:5. В эту группу вошло 4 культуры из 19.

В группе 6 максимальное количество белка интерлейкина-11, наблюдалось при трансфекции модифицированной кДНК гена IL-11 SEQ ID No:6. В эту группу вошли 3 культуры из 19.

В группе 7 максимальное количество белка интерлейкина-11, наблюдалось при трансфекции модифицированной кДНК гена IL-11 SEQ ID No:7. В эту группу вошло 3 культуры из 19.

Ни в одной из клеточных культур не наблюдалось того, что при трансфекции вектором, не содержащим кДНК гена IL-11, количество белка интерлейкина-11 присутствует в максимальных количествах.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентраций белка интерлейкина-11 (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и нативные кДНК гена IL-11.

Из данного примера следует, что достижение максимального количества белка интерлейкина-11 в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена IL-11, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 11.

Введение в первичную клеточную культуру эпителия эндометрия матки человека генно-терапевтической субстанции с кДНК гена IL-11 с целью подтверждения при этом увеличения количества белка интерлейкина-11.

Клеточную культуру эпителия эндометрия человека получали путем взятия материала аспирационной биопсии. Трансфекцию этой клеточной культуры проводили генно-терапевтической субстанцией на основе плазмиды pCMV6-Kan/Neo IL-11 SEQ ID No:2, используя в качестве транспортной молекулы РАМАМ-дендримеры (Weihai CY Dendrimer Technology). В качестве контроля использовали плазмиду pCMV6- Kan/Neo без кДНК гена IL-11.

Перед проведением трансфекции была приготовлена смесь плазмидной ДНК из расчета, что на 25000 клеток необходимо 0,1 мкл раствора плазмидной ДНК (1 мкг/мл) и 0,3 мкл раствора РАМАМ дендример (1 мкг/мл) с доведением до 4 мкл буферным раствором Хенкса. Полученная смесь аккуратно пипетировалась и инкубировалась при комнатной температуре в течение 15 мин.

Непосредственно перед экспериментом первичная клеточная культура эпителия эндометрия человека промывалась средой DMEM. Затем клеточная культура инкубировалась в течение 1 ч с приготовленной трансфекционной смесью при плюс 37°С и 5% CO2. В качестве контроля добавляли 4 мкл буферного раствора Хенкса. После инкубирования клеточная культура промывалась средой DMEM, а затем добавлялась полная ростовая среда. Клеточная культура наблюдалась под микроскопом Zeiss Axio Observer А1 в течение 24 ч.

Сбор клеточной культуры эпителия эндометрия человека проводили через 24, 48, 72 и 96 ч после проведения трансфекции. Отбирали ростовую среду, 2 раза промывали буферным раствором Хенкса, 1 раз раствором ЭДТА, затем культуру клеток инкубировали в растворе трипсин-ЭДТА при 37°С в присутствии 5% CO2 в течение 4 минут. Реакцию трипсинизации ингибировали путем добавления ростовой среды. Чтобы избывиться от ростовой среды, суспензию клеток 2 раза промывали буферным раствором Хенкса с последующим центрифугированием. Полученный осадок ресуспендировали в консерванте RNAIater (Qiagen, Германия).

Выделение РНК производили с помощью набора RNeasy Mini Kit (Qiagen, Германия) согласно методике производителя. Для элиминации ДНК в ходе процедуры выделения РНК использовали набор RNAse-Free DNAse Set (Qiagen, Германия).

Концентрацию выделенной РНК измеряли спектрофотометрически с помощью NanoDrop 2000 (ThermoFisher Scientific Inc.). Оптическую плотность раствора РНК измеряли в диапазоне 220-320 нм. Для работы использовали образцы, для которых общее количество выделенной РНК было не менее 10 нг/мкл РНК, соотношение А260280 - не менее 1,8.

Качество выделенной РНК проверяли методом капилярного электрофореза на приборе QIAxcel (Qiagen, Германия), используя картридж RNA Quality Control Kit с помощью программы BioGel Software (Qiagen, Германия). Выделенная РНК хранилась на -80°С и использовалась для синтеза первой цепи кДНК методом ОТ-ПЦР.

Синтез суммарной кДНК первой цепи проводили, с помощью обратной транскриптазы RevertAid (Thermo Scientific, США) по методике производителя. В реакционную смесь объемом 20 мкл, состоящую из деионизованной воды, 5Х Reaction Buffer (250 мМ Tris-HCl (рН 8.3 at 25°С), 250 мМ KCI, 20 мМ MgCI2) 50 мМ DTT), dNTP (25 mM), вносили 200 Ед обратной транскриптазы и 5 пмоль случайного 9-нуклеотидного праймера, в качестве матрицы использовали 120 нг суммарной РНК. Обратную транскрипцию проводили при следующих условиях: 1 цикл предварительной инкубации при 25°С 10 мин, 1 цикл инкубации 52°С - 30 мин, 1 цикл инкубации 85°С - 5 мин.

Суммарную кДНК использовали для проведения ПЦР в реальном времени, которую проводили на амплификаторе CFX96 (Bio-Rad, США), с использованием реакционной смеси iTaq Universal SYBR Green Supermix (Bio-Rad, США), в состав которой входит интеркалирующий краситель SYBR Green I. Постановку реакции осуществляли в объеме 20 мкл согласно инструкции производителя с помощью высокоспецифичных праймеров QuantiTect Primer Assay (Qiagen, Германия) к гену IL11 и к референтному гену В2М. В качестве матрицы использовали: каждую пробу после стадии синтеза суммарной кДНК. Результаты амплификации оценивали в режиме реального времени с помощью программного обеспечения Bio-Rad CFX Manager 2.1 (Bio-Rad США) и qBase plus (Biogazelle, Бельгия). ПЦР проводили при следующих условиях: первоначальная денатурация при +95°С в течение 30 с, 45 циклов, включающих денатурацию при +95°С в течение 5 с, отжиг праймеров и элонгация при +60°С в течение 30 с.

Идентификацию полученных ПЦР-продуктов проводили путем капиллярного электрофореза в картридже QX DNA High Resolution (Qiagen, Германия) с помощью прибора для капиллярного электрофореза QIAxcel (Qiagen, Германия). В качестве выравнивающего маркера использовали QX Alignment Marker 15-3000 п., в качестве маркера длины - QX DNA Size Marker 50-800 п. н. После сравнения полученных данных с теоретически рассчитанной длиной обоих генов, учитывая погрешность прибора (±10 п. н.), было доказано, что детектируемый продукт соответствует гену IL11, и референтному гену В2М. В пробах с отрицательным контролем продукт не детектируется.

Показано, что, в клеточной культуре эпителия эндометрия человека трансфицированной генно-терапевтической субстанцией с кДНК гена IL-11 произошло увеличение количества белка интерлейкина-11, что подтверждает усиление экспрессии гена IL-11 при использовании генно-терапевтической субстанции с кДНК гена IL-11. Результаты отражены на фигуре 13.

Пример 12.

Трансфекции клеточной культуры хондроцитов генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена IL-11 в данных культуре клеток.

С целью выяснения эффективности генно-терапевтической субстанции, содержащей кДНК гена IL-11, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали хондроциты человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биоптаты хрящевой ткани массой 50-150 мг измельчали на фрагменты до 10 мм3 и инкубировали в буферном растворе с коллагеназой II, гиалуронидазой и трипсином в течение 48 часов при +37°С. Клетки отмывали бессывороточной средой DM ЕМ, ресуспендировали в той же среде с гентамицином и выращивали при +37°С и в атмосфере, содержащей 5% CO2 во флаконах 75 см2 с 15 мл среды. Рост осуществлялся в бессыворотчной среде, так как в монослойной культуре хондроциты меняют форму и биохимические свойства. Пересев производили каждые 4 дня в соотношении 1:3, клетки снимали с поверхности флакона раствором трипсин-ЭДТА с 0.02% раствором Версена.

Для трансфекции клеток генно-терапевтической субстанцией содержащей кДНК гена IL-11 использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci.2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-Ы-(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6- Kan/Neo IL-11 SEQ ID No:3 с модифицированной кДНК гена IL-11 SEQ ID No:3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена IL-11 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение транскрипции IL-11 наблюдали на 4 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена IL-11.

Показано, что в хондроцитах трансфицированных генно-терапевтической субстанцией на основе pCMV6- Kan/Neo IL-11 SEQ ID No:3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается усиление экспрессии целевого гена IL-11.

Пример 13.

Введение в кожу человека генно-терапевтической субстанции с кДНК гена IL-11 с целью подтверждения при этом увеличения количества белка интерлейкина-11 в коже человека.

С целью анализа изменения количества белка интерлейкина-11 пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена IL-11 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена IL-11 с транспортной молекулой (А) - в кожу предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6 IL-11 SEQ ID No:4, которая содержит модифицированную кДНК гена IL-11 (SEQ ID No:4) и плазмиду pCMV6-XL5, используемую в качестве плацебо, которая не содержит кДНК гена IL-11, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Количество белка интерлейкина-11 оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human IL-11 ELISA Kit (Interleukin-11) (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее, как описано в примере 9.

Показано, что в коже пациента в области введения генно-терапевтической субстанции с кДНК гена IL-11, произошло увеличение количества белка интерлейкина-11, тогда как при введении плацебо, количество белка интерлейкина-11 в коже не изменялась, что говорит об усилении экспрессии гена IL-11 при использовании генно-терапевтической субстанции с кДНК гена IL-11. Результаты отражены на фигуре 15.

Пример 14.

Введение в хрящевую ткань человека генно-терапевтической субстанции с кДНК гена IL-11 с целью подтверждения при этом увеличения количества белка интерлейкина-11 в хрящевой ткани человека.

С целью анализа изменения количества белка интерлейкина-11 пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена IL-11 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена IL-11 с транспортной молекулой (А) - в хрящевую ткань ушных раковин с тыльной стороны.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCDNA 3.1 IL-11 SEQ ID No:5, которая содержит модифицированную кДНК гена IL-11 (SEQ ID No:5), и плазмиду pCDNA 3.1(+), используемую в качестве плацебо, которая не содержит кДНК гена-IL-77, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1-2 мм в хрящевую ткань ушных раковин с тыльной стороны. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,2 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 2-3 см друг от друга.

Количество белка интерлейкина-11 оценивали в лизатах биоптатов хрящевой ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human IL-11 ELISA Kit (lnterleukin-11) (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков хрящевой ткани в зоне введения генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, методом чрескожной пункционного биопсии при помощи одноразовой ручной биопсийной иглы, далее по примеру 9.

Показано, что в хрящевой ткани пациента в области введения генно-терапевтической субстанции с кДНК гена IL-11, произошло увеличение количества белка интерлейкина-11, тогда как при введении плацебо количество белка интерлейкина-11 в хрящевой ткани не изменялось, что подтверждает усиление экспрессии гена IL-11 при использовании генно-терапевтической субстанции с кДНК гена IL-11. Результаты отражены на фигуре 16.

Пример 15.

Введение в мышечную ткань человека генно-терапевтической субстанции с кДНК гена IL-11 с целью подтверждения при этом увеличения количества белка интерлейкина-11 в мышечной ткани человека.

С целью анализа изменения количества белка интерлейкина-11 пациентам вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена IL-11 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена IL-11 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) no примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo IL-11 SEQ ID No:6, которая содержит модифицированную кДНК гена IL-11 (SEQ ID No:6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена IL-11, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга

Количество белка интерлейкина-11 оценивали в лизатах биоптатов мышечной ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human IL-11 ELISA Kit (lnterleukin-11) (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компания BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения генно-терапевтической субстанции с кДНК гена IL-11, произошло увеличение количества белка интерлейкина-11, тогда как при введении плацебо количество белка интерлейкина-11 в мышечной ткани не изменялась, что подтверждает усиление экспрессии гена IL-11 при использовании генно-терапевтической субстанции с кДНК гена IL-11. Результаты отражены на фигуре 17.

Пример 16.

Введение группе различных пациентов генно-терапевтическиих субстанций содержащих модифицированные кДНК гена IL-11 и участки нативных немодифицированных кДНК гена IL-11.

С целью подтверждения индивидуального характера увеличения количества белка интерлейкина-11 до различного уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными и немодифицированными кДНК гена IL-11 анализировали количественный уровень белка интерлейкина-11 в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена IL-11.

Последовательности участков нативной немодифицированной кДНК гена IL-11 приведены на фигурах 1 и 2, SEQ IL-11 ID No:1. и SEQ IL-11 ID No:1, последовательности модифицированных кДНК гена IL-11 приведены на фигурах 3-7 (SEQ IL-11 ID No:3, SEQ IL-11 ID No:4, SEQ IL-11 ID No:5, SEQ IL-11 IDNo:6, SEQIL-11 ID No:7).

При этом генетические конструкции, одна из которых содержит участок нативной немодифицированной кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:1), вторая генетическая конструкция содержит участок нативной немодифицированной кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:2), третья генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:3), четвертая генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:4), пятая генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:5), шестая генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:6), седьмая генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 20-ти пациентов, отобранных в случайном порядке, вводили 7 генно-терапевтических субстанций и плацебо в кожу предплечья.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

А - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No:1, содержащий немодифицированную кДНК гена IL-11 (SEQ ID No:1.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

В - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No:2, содержащий немодифицированную кДНК гена IL-11 (SEQ ID No:2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

С - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No:3, содержащий модифицированную кДНК гена IL-11 (SEQ ID No:3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

D - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No:4, содержащий модифицированную кДНК гена IL-11 (SEQ ID No:4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Е - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No:5, содержащий модифицированную кДНК гена IL-11 (SEQ ID No:5) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

F - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No:6, содержащий модифицированную кДНК гена IL-11 (SEQ ID No:6) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

G - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No:7, содержащий модифицированную кДНК гена IL-11 (SEQ ID No:7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащей кДНК гена IL-11 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Количества белка интерлейкина-11 оценивали в девяти биоптатах кожи от каждого пациента (от А до Н и в биоптате интактной кожи) через 72 часа после введения генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human IL-11 ELISA Kit (lnterleukin-11) (Abeam, США), как описано в Примере 8.

По итогам анализа количественного уровня белка интерлейкина-11 выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни количества белка интерлейкина-11 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка интерлейкина-11, наблюдалось при введении немодифицированной кДНК гена IL-11 SEQ ID No:1. В эту группу вошли 1 биоптата из 20.

В группе 2 максимальное количество белка интерлейкина-11, наблюдалось при введении немодифицированной кДНК гена IL-11 SEQ ID No:2. В эту группу вошли 3 биоптата из 20.

В группе 3 максимальное количество белка интерлейкина-11, наблюдалось при введении модифицированной кДНК гена IL-11 SEQ ID No:3. В эту группу вошли 3 биоптата из 20.

В группе 4 максимальное количество белка интерлейкина-11, наблюдалось при введении модифицированной кДНК гена IL-11 SEQ ID No:4. В эту группу вошли 3 биоптата из 20.

В группе 5 максимальное количество белка интерлейкина-11, наблюдалось при введении модифицированной кДНК гена IL-11 SEQ ID No:5. В эту группу вошли 3 биоптата из 20.

В группе 6 максимальное количество белка интерлейкина-11, наблюдалось при введении модифицированной кДНК гена IL-11 SEQ ID No:6. В эту группу вошли 4 биоптата из 20.

В группе 7 максимальное количество белка интерлейкина-11, наблюдалось при введении модифицированной кДНК гена IL-11 SEQ ID No:7. В эту группу вошли 3 биоптата из 20.

Ни в одном из биоптатов не наблюдалось того, что при введении плацебо - векторной плазмиды, не содержащей кДНК гена IL-11, количество белка интерлейкина-11 присутствует в максимальных количествах.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена IL-11.

Из данного примера следует, что достижение максимального количества белка интерлейкина-11 в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена IL-11, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 17.

Трансфекция клеточной линии фибробластов пациента разными генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена IL-11 и участки нативных немодифицированныех кДНК гена IL-11 с целью персонализированного выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка интерлейкина-11 в клеточных лизатах фибробластов этого пациента, трансфицированных разными генно-терапевтическими субстанциями, содержащими участки нативных немодифицированных кДНК гена IL-11 и/или модифицированные кДНК гена IL-11.

Последовательности участков нативной немодифицированной кДНК гена IL-11 приведены на фигурах 1 и 2, SEQ IL-11 ID No:1. и SEQ IL-11 ID No:1, последовательности модифицированных кДНК гена IL-11 приведены на фигурах 3-7 (SEQ IL-11 ID No:3, SEQ IL-11 ID No:4, SEQ IL-11 ID No:5, SEQ IL-11 ID No:6, SEQ IL-11 ID No:7).

Культуры фибробластов из биоптата пациента вырастили по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Затем культуру фибробластов пациента разделили на 8 частей. Первую часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:1, содержащей участок нативной немодифицированной кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:1.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:2, содержащей участок нативной немодифицированной кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Третью часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:3, содержащей модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Четвертую часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:4, содержащей модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Пятую часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:5, содержащей модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Шестую часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:6, содержащей модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Седьмую часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:7, содержащей модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Восьмую часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена IL-11 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка интерлейкина-11 в клеточных лизатах фибробластов пациента проводили через 72 часа после трансфекции методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human IL-11 ELISA Kit (lnterleukin-11) (Abeam, США), как описано в Примере 8.

По итогам определения количества белка интерлейкина-11 в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой наблюдается максимальное количество белка интерлейкина-11 в лизате клеточной культуры и соответственно наблюдается максимальная экспрессия гена IL-11. В данном эксперименте максимальное количество белка интерлейкина-11 в лизате отмечено при трансфекции генно-терапевтической субстанцией на базе pCMV6 IL-11 SEQ ID No:1, содержащей модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18.

Введение в кожу пациента различных генно-терапевтических субстанций, содержащих модифицированные кДНК гена IL-11 и участки нативных немодифицированных кДНК гена IL-11 с целью выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка интерлейкина-11 в лизатах биоптатов кожи этого пациента, после введения ему в кожу генно-терапевтических субстанций, содержащих модифицированные кДНК гена IL-11 и/или участки нативных кДНК гена IL-11.

Последовательности участков нативной немодифицированной кДНК гена IL-11 приведены на фигурах 1 и 2, SEQ IL-11 ID No:1. и SEQ IL-11 ID No:1, последовательности модифицированных кДНК гена IL-11 приведены на фигурах 3-7 (SEQ IL-11 ID No:3, SEQ IL-11 ID No:4, SEQ IL-11 ID No:5, SEQ IL-11 IDNo:6, SEQ IL-11 ID No:7).

Пациенту вводили 7 генно-терапевтических субстанций и плацебо в кожу предплечья.

Первая генно-терапевтическоая субстанция (А) на базе pCMV6- SEQ ID No:1, содержащая участок нативной немодифицированной кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:1) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая генно-терапевтическая субстанция (В) на базе pCMV6- SEQ ID No:2, содержащая участок нативной немодифицированной кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:2) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Третья генно-терапевтическая субстанция (С) на базе pCMV6- SEQ ID No:3, содержащая модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:3) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Четвертая генно-терапевтическая субстанция (D) на базе pCMV6- SEQ ID No:4, содержащая модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:4) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Пятая генно-терапевтическая субстанция (Е) на базе pCMV6- SEQ ID No:5, содержащая модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:5) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Шестая генно-терапевтическая субстанция (F) на базе pCMV6- SEQ ID No:6, содержащая модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:6) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Седьмая генно-терапевтическая субстанция (G) на базе pCMV6- SEQ ID No:7, содержащая модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:7) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Восьмая векторная плазмида pCMV6-XL5, не содержащая кДНК гена IL-11 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит участок нативной немодифицированной кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:1), вторая генетическая конструкция содержит участок нативной немодифицированной кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:2), третья генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:3), четвертая генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:4), пятая генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11 (SEQ ID No:5), шестая генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:6), седьмая генетическая конструкция содержит модифицированную кДНК гена IL-11 изоформы Large белка интерлейкина-11 (SEQ ID No:7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис- HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Определение количества белка интерлейкина-11 определяли в девяти биоптатах кожи пациента через 72 часа после введения генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human IL-11 ELISA Kit (lnterleukin-11) (Abeam, США), как описано в Примере 8.

По итогам определения количества белка интерлейкина-11 в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой в кожу наблюдается максимальное количество белка интерлейкина-11 в лизате биоптата кожи и соответственно наблюдается максимальная экспрессия гена IL-11. В данном эксперименте максимальное количество целевого белка в лизате биоптата кожи отмечено при введении генно-терапевтической субстанции на базе pCMV6 IL-11 SEQ ID No:2, содержащей модифицированную кДНК гена IL-11 изоформы Small белка интерлейкина-11, что показано на фигуре 20

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, возникших вследствие недостаточной экспрессии гена IL-11, способ его получения и использования.

Созданное средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций с использованием одной из модифицированных кДНК гена IL-11 или одного из участков нативных немодифицированных кДНК гена IL-11 позволяет на практике использовать входящие в группу генно-терапевтические субстанции для повышения до необходимого уровня количества белка интерлейкина-11 в различных клетках органов и тканей и/или органах и тканях человека путем увеличения экспрессии гена IL-11.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант генно-терапевтической субстанции из созданной группы генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить количество белка интерлейкина-11 в клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование генно-терапевтической субстанции с участком нативной немодифицированной кДНК гена IL-11 не приводит к желаемому изменению уровня количества белка интерлейкина-11 в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена IL-11, приводящей к более эффективной экспрессии гена IL-11.

При использовании заявленной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Группа генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена IL-11, повышая количество белка интерлейкина-11 в клетках органов и тканей и/или органах и тканях человека в частности, в нейронах ЦНС, в клетках трофобласта, в фибробластах матки, сперматогониях, сперматоцитах, сперматидах, в клетках эндометрия матки, в эндотелиальных клетках вен, в синовиоцитах, хондроцитах, в кератоцитах кожи, фибробластах и остеобластах костной ткани, в фибробластах, эпителиальных и мышечных клетках в сочетании с транспортной молекулой или без нее при трансфекции этими генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в головном мозге, спинном мозге, тимусе, гипоталамусе, мозжечке, гипофизе, коре почек, почках, легких, кишечнике, желудке, аппендиксе, семенниках, матке, коже, костях, костном мозге, суставах, пуповине, митральном клапане, плаценте, в костной, мышечной, хрящевой, соединительной, эндометриальной ткани, синовиальном эндотелии, в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание группы генно-терапевтических субстанций, при использовании которых применительно к клеткам органов и тканей и/или органам и тканям человека компенсируются дефекты гена IL-11, влияющие на уменьшение экспрессии этого гена и/или на количественный уровень белка интерлейкина-11, кодируемого этим геном, а также компенсируется недостаточное количество белка интерлейкина-11, вызванное факторами, влияющими на экспрессию гена IL-11.

Повышение эффективности коррекции количественного уровня белка интерлейкина-11 в клетках органов и тканей человека достигают за счет того, что при недостаточном количестве этого белка вследствие дефекта гена IL-11 используют не белок, а генетическую конструкцию с кДНК гена IL-11, кодирующую этот белок. При введении генетических конструкций в отличие от введения непосредственно белка, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Промышленная применимость.

Все приведенные примеры по созданию и использованию созданной группы генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр,

мкл - микролитр

л - литр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е.ф - относительная единица флуоресценции

ГТС - генно-терапевтическая субстанция

1. Средство для лечения состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11 на основе генно-терапевтических субстанций с геном IL-11, где клетки органов и тканей выбраны из клеток фибробластов, клеток эндометрия матки, хондроцитов и эпителиальных клеток; органы и ткани выбраны из кожи, матки, хрящевой ткани, эндометриальной ткани или мышечной ткани человека, представляющее собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена IL-11, с кодирующей последовательностью белка интерлейкина-11, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 1 или участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 2 или модифицированной кДНК гена IL-11, при этом в качестве модифицированной кДНК гена IL-11 используют SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, и способную увеличить количество белка интерлейкина-11 в эукариотических клетках, в клетках органов и тканей и/или органах и тканях человека, в сочетании с транспортной молекулой или без нее.

2. Средство по п. 1, отличающееся тем, что каждая генетическая конструкция с модифицированной кДНК гена IL-11 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена IL-11, которая несет модификации, не затрагивающие структуру белка интерлейкина-11, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций, и не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

3. Средство по п. 1, отличающееся тем, что в качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блок-сополимеры.

4. Способ получения средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11 по п. 1, заключающийся в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций по п. 1, при этом получают кДНК гена IL-11, затем помещают кДНК в векторную плазмиду, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена IL-11 с кодирующей последовательностью белка интерлейкина-11, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 1 или участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 2 или модифицированной кДНК гена IL-11, при этом в качестве модифицированной кДНК гена IL-11 используют, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

5. Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11, а именно женского бесплодия, заключающийся в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/выбранных из группы созданных генно-терапевтических субстанций по п. 1, или сочетанием обозначенных способов.



 

Похожие патенты:

Изобретение относится к медицине, в частности к акушерству и гинекологии, и может быть использовано при лечении первичного бесплодия, обусловленного тромбофилиями.

Изобретение относится к области медицины, а именно к фармацевтической композиции для стимуляции регенерации эпителиальных и/или соединительных тканей, включающей эффективное количество соединения формулы (I) (Треамида): или его фармацевтически приемлемой соли и фармацевтически приемлемый носитель.
Изобретение относится к медицине, а именно к акушерству и гинекологии, и может быть использовано для лечения пациенток с тонким эндометрием. Для этого эндометрий однократно орошают аутоплазмой, обогащенной тромбоцитами, в количестве 0,5-1 мл в качестве предгравидарной подготовки либо на фоне заместительной гормонотерапии в позднюю фазу пролиферации менструального цикла, а также вводят аутоплазму, обогащенную тромбоцитами.

Изобретение относится к фармацевтической промышленности и представляет собой фармацевтическую композицию, содержащую N-ацетил-L-цистеин (NAC) сам по себе или вместе с (2) селеном в форме селенометионина и/или (3) мелатонином и/или их физиологически приемлемыми солями и подходящий носитель или эксципиент, для использования в ЭКО-лечении бесплодия у млекопитающего, отличающуюся тем, что дозу 50-150 мг/кг массы тела NAC один раз в сутки в течение 1-3 суток вводят внутривенно, либо дозу 30-45 мг/кг массы тела NAC вводят один раз в сутки перорально, или, альтернативно, 600 мг NAC вводят три раза в сутки перорально в течение трех последовательных суток в неделю с последующими четырьмя сутками без введения лекарственного средства общей продолжительностью три месяца или более перед ЭКО-лечением.

Изобретение относится к медицине, а именно к акушерству и гинекологии, и может быть использовано для лечения женского бесплодия у млекопитающих, не страдающих диабетом, путем применения терапевтически эффективного количества соли вольфрама (VI) с фармацевтически или ветеринарно пригодной катионной группой или ее сольвата.

Изобретение относится к медицине, а именно к андрологии, репродуктологии. Применение «Экстракта мицелия вешенки «РЕВИТАЦЕЛ» в качестве препарата для приращения процентного соотношения уровня повышения активности сперматозоидов человека.

Изобретение относится к области репродуктивных биотехнологий, предназначенных для ускоренного воспроизводства и тиражирования потомства животных, и представляет собой фармацевтическую композицию с пролонгированным действием гонадотропинов для проведения индукции суперовуляции у самок млекопитающих, содержащую фолликулостимулирующий гормон (ФСГ) и лютеинизирующий гормон (ЛГ) при соотношениях ФСГ/ЛГ (1/0,001-1/1) и пролонгатор действия фолликулостимулирующего гормона - биологически деградируемый полимер полиэтиленгликоль (ПЭГ), отличающуюся тем, что дополнительно содержит 0,25-1% раствор новокаина, а в качестве пролонгатора используют ПЭГ с молекулярной массой от 6000 до 70000 Да, при следующих соотношениях компонентов: ФСГ/ЛГ (1/0,001-1/1) активностью 800-1000 ME в 0,25-1%-ном растворе новокаина от 65 до 90 вес.

Группа изобретений относится к медицине и касается препарата для стимуляции фолликулогенеза, содержащего суспензию химерного белка с водонерастворимой ферментативно неактивной хлорамфениколацетилтрансферазой без 10 С-терминальных аминокислот, аминокислотным спейсером и соматостатином-14 с последовательностью аминокислот AGCFWKTFTSC в рафинированном растительном масле с добавлением апирогенной воды для инъекций.

Изобретение относится к области медицины, конкретно к фармакологии, и касается средства для профилактики и лечения патозооспермии. Предложено применение диборнола крысам-самцам репродуктивного возраста в качестве средства профилактики и корригирующей терапии патозооспермии.

Настоящее изобретение относится к низкодозовым фармацевтическим композициям, содержащим ингибитор ароматазы 4,4'-[фтор-(1-H-1,2,4-триазол-1-ил)метилен]бисбензонитрил в виде активного ингредиента в подходящем носителе.

Изобретение относится к области биотехнологии, конкретно к получению вектора экспрессии, содержащего (а) нуклеотидную последовательность С68 и (б) мультиантигенную конструкцию ДНК, кодирующую иммуногенные полипептиды простатоассоциированных антигенов (РАА), что может быть использовано в медицине.

Представленная группа изобретений касается полинуклеотида, кодирующего вариант хоминг-эндонуклеазы (ХЭ) I-OnuI, экспрессионного вектора, содержащего такой полинуклеотид, полипептида эндонуклеазы, композиции для лечения гемоглобинопатии и клетки, содержащей указанные полинуклеотид, вектор или полипетид эндонуклеазы.

Настоящее изобретение относится к биотехнологии, в частности к выделенной молекуле нуклеиновой кислоты, кодирующей химерный рецептор антигена (CAR), направленный против антигена созревания В-клеток (ВСМА).

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена САТ и/или уменьшением активности белка каталазы, на основе генно-терапевтических субстанций с геном CAT, где клетки органов и тканей выбраны из фибробластов, эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CAT, с кодирующей последовательностью белка каталазы, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1 или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

Настоящее изобретение относится к биотехнологии, в частности к композиции для продукции целевого полипептида в клетке или ткани млекопитающего и способу получения указанного полипептида в клетке или ткани млекопитающего in vitro с применением такой композиции.

Изобретение относится к области биохимии. Описана группа изобретений, включающая фармацевтическую композицию для экспрессии полипептида в клетке млекопитающего и применение композиции для получения лекарственного средства для повышения уровня интересующего полипептида у млекопитающего.

Изобретение относится к области биотехнологии, конкретно к новым иммуногенам на основе перекрывающихся пептидов (OLP), и может быть использовано в медицине для предупреждения или лечения ВИЧ инфекции.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Изобретение относится к области биотехнологии, конкретно к химерному антигенному рецептору (CAR), обладающему специфичностью к CD22, что может быть использовано в медицине.

Изобретения касаются молекулы нуклеиновой кислоты, кодирующей гомодимерный белок, гомодимерного белка, аминокислотной цепи, способной формировать гомодимерный белок, их применения для получения лекарственного средства, клетки-хозяина, фармацевтической и вакцинной композиций, способа получения гомодимерного белка или аминокислотной цепи и способа получения вакцины.

Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 55-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 14-го – 34-го или 15-го – 34-го нуклеотидов, считая от 5'-конца 55-го экзона гена дистрофина человека. Также описана фармацевтическая композиция для лечения мышечной дистрофии, включающая в качестве действующего ингредиента антисмысловой олигомер, или его фармацевтически приемлемую соль, или гидрат. Кроме того, представлен способ лечения мышечной дистрофии, включающий введение терапевтически эффективного количества заявленного олигомера. Изобретение расширяет арсенал средств для лечения мышечной дистрофии. 3 н. и 8 з.п. ф-лы, 31 ил., 15 табл., 39 пр.

Группа изобретений относится к медицине и касается средства для лечения состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена IL-11 иили уменьшением количества белка интерлейкина-11 на основе генно-терапевтических субстанций с геном IL-11, где клетки органов и тканей выбраны из клеток фибробластов, клеток эндометрия матки, хондроцитов и эпителиальных клеток; органы и ткани выбраны из кожи, матки, хрящевой ткани, эндометриальной ткани или мышечной ткани человека, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена IL-11, с кодирующей последовательностью белка интерлейкина-11, с делециями 5- и 3-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 1 или участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 2 или модифицированной кДНК гена IL-11, при этом в качестве модифицированной кДНК гена IL-11 используют SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена IL-11 иили уменьшением количества белка интерлейкина-11. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

Наверх