Линейка биологически активных генно-терапевтических субстанций на основе гена clca2 для коррекции патологических состояний клеток органов и тканей и органов и тканей человека, способ получения и использования

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, клеток эпителия слизистой оболочки полости рта; органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CLCA2 с кодирующей последовательностью белка хлоридного кальций-активируемого канала-2, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка CLCA2. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 20 ил., 18 пр.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и может быть использовано для коррекции патологических состояний, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, клеток различных органов и тканей, а также собственно органов и тканей человека в частности, в терапевтических целях.

Предшествующий уровень.

Белки CLCA1 и CLCA2 принадлежат к семейству белков кальций-активируемых хлоридных каналов проводимости. Белки этого семейства имеют высокую степень гомологии в размере, последовательности (75-89%), структуре, но значительно отличаются по своему распределению в тканях организма. Так CLCA1 находится в различных тканях, например, в слизистой оболочке тонкой и толстой кишки, и участвует в процессах секреции и поглощения.

Белок гена CLCA2 играет важную роль в кальцезависимой модуляции тока, индуцированным ионами хлора. Данный канал может выступать в качестве супрессора развития рака груди и рака прямой кишки. Играет ключевую роль в клеточной адгезии в начальных стадиях метастазирования в легких (рак легких) через связывание с ITGB4 (интегрин бета 4). Так как этот белок экспрессируется преимущественно в трахее и легких, поэтому предполагается, что он играет роль в сложном патогенезе муковисцидоза. Также белок вовлечен в качестве гена-супрессора опухоли рака молочной железы. При этом стоит отметить, что в то время как продукт гена CLCA2 экспрессируется в нормальной здоровой ткани молочной железы, экспрессии гена CLCA2 не наблюдается в малигнизированной ткани молочных желез. Был показан высокий уровень экспрессии гена CLCA2 в роговице, коже, влагалище, пищеводе, гортани, а также - в легких, трахее, эпителиальных клетках. Белок гена CLCA2 селективно экспрессируется в эндотелии мелких легочных артерий, артериол, междольковых и субплевральных венулах. В небольшом количестве экспрессируется в почках и семенниках.

Исследования по нокаутным мышам показали, что у гомозигот(-/-) с выключенным геном CLCA2, наблюдается увеличение размеров печени по отношению к размерам тела, а также детектируется гипертрофия гепатоцитов, и был один случай мультифокального некроза печени. (http://www.informatics.jax.org/reference/J:101679.)

Таким образом, белок гена CLCA2 может служить супрессором при онкологических заболеваниях или удобным иммуногистохимическим маркером при диагностике рака (например, при различении плоскоклеточной карциномы (SCC) и аденокарциномы (ADC).

В заявке на изобретение US 20040265859 описаны выделенные и очищенные полипептиды кальций-активируемых хлоридных каналов, которые использованы для ингибирования образования метастатической опухоли (опухоли легкого) у индивидуума, а также способ применения этих пептидов, который включает стадию введения индивидууму пептида в комбинации с фармацевтически приемлемым наполнителем.

В заявке на изобретение WO/2002/094876 показаны способы и композиции для лечения наработки муцина при сопутствующей болезни. В частности, описано, что нуклеотидная последовательность, кодирующая белок гена CLCA4 вставлена в вектор для экспрессии под области инициации и терминации транскрипции, с помощью которого кодирующую последовательность вводят в геном клетки-хозяина. Также показано, что экспрессия введенной последовательности увеличивается или уменьшается в трансгенном животном по сравнении с диким типом. Изобретение содержит способ получения соединения-кандидата модулирующее активность секреции муцина, причем указанный способ включает: (а) контактирование модели CLCA2 / секреция муцина либо CLCA4 / секреция муцина с указанным потенциальным агентом; (б) наблюдение эффекта указанного кандидата на секрецию муцина. Причем модулирующее соединение может оказывать как ингибирующее, так и усиливающее действие на экспрессию. CLCA2 модулирующее соединение может быть представлено как фармацевтический препарат для лечения респираторных заболеваний, связанных с наработкой муцина (хронического бронхита, астмы, муковисцидоза, хронического обструктивного заболевания легких или бронхоэктазов). Изобретение содержит описание способа диагностики секреции муцина дыхательной системой, связанной с болезненным состояниям пациента, причем указанный способ включает: определение уровня экспрессии CLCA2 в дыхательной системе в присутствии или в отсутствие болезненного состояния, причем повышенные уровни экспрессии CLCA2 по сравнению с контролем указывает на наличие указанного болезненное состояние (гиперсекреция муцина). Болезненное состояние может быть связано и с пониженной секрецией муцина, тогда экспрессия CLCA2 будет пониженной.

За прототип авторами было принято решение по заявке на изобретение US 20030064946, в которой показаны метод и реагент для ингибирования белка хлоридного кальций-активируемого канала-1. В частности, описаны молекула нуклеиновой кислоты, которая понижает экспрессию гена CLCA1, вектор для экспрессии этой молекулы в клетках млекопитающего или человека и использование этой конструкции для лечения состояний, выбранных из группы заболеваний - хроническая обструктивная болезнь легких, хронический бронхит, астма, муковисцидоз, синдром обструктивного кишечника. При этом молекула нуклеиновой кислоты может быть представлена ДНКзимом с ферментными свойствами или антисмысловой молекулой нуклеиновой кислоты, химически синтезирована и содержать модификации, например, по меньшей мере одну модификацию 2'-сахара, одно нуклеиновое основание. Описан также способ уменьшения активности CLCA1 в клетке млекопитающего, включающий стадию контактирования указанной клетки с молекулой нуклеиновой кислоты, которая регулирует экспрессию гена CLCA1, в условиях, подходящих для указанного снижение активности CLCA1. А также - способ лечения пациента, имеющего состояние, связанное с уровнем CLCA1, включающий контакт клетки пациента с молекулой нуклеиновой кислоты, которая регулирует экспрессию гена CLCA1, в условиях, подходящих для указанного лечения.

Данный подход направлен на решение частной задачи уменьшения экспрессии гена CLCA1, продукт которого регулирует процесс уменьшения секреции муцина. Поэтому он не может быть применен для решения проблемы увеличения экспрессии генов белков кальций-активируемых хлоридных каналов проводимости, например, CLCA2 как гена-супрессора рака. Также при создании генно-терапевтического средства в этом изобретении не учитывается индивидуальные характеристики пациента, в связи с чем может понадобиться линейка вариаций для данного средства.

Раскрытие изобретения

Задачей данного изобретения является создание линейки высокоэффективных биологически активных генно-терапевтических субстанций для коррекции патологических состояний организма человека способных препятствовать количественному снижению белка хлоридного кальций-активируемого канала-2 в клетках органов и тканей и/или органах и тканях человека путем повышения уровня экспрессии гена CLCA2 в клетках органов и тканей и/или органах и тканях человека, приводящего к повышению количества белка хлоридного кальций-активируемого канала-2, в клетках органов и тканей и/или органах и тканях организма с учетом индивидуальных особенностей пациента.

Создана линейка биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена CLCA2 SEQ ID No:1 или одну из модифицированных кДНК гена CLCA2, и содержащей также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, в частности в клетках органов и тканей человека и способную обеспечить высокий уровень экспрессии гена CLCA2 и увеличить количество белка хлоридного кальций-активируемого канала-2 в клетках органов и тканей и/или органах и тканях человека, в частности, клетках эпидермиса, в частности кератиноцитах, фибробластах, в клетках слизистой оболочки, жировой ткани, в частности в адипоцитах, клетках эпителия, клетках эндотелия, клетках молочной железы, клетках легочной и плацентарной ткани, клетках костного мозга, в частности в стволовых клетках, в клетках лимфотических узлов, семенников, гепатоцитах в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, коже, мочевом пузыре, миндалинах, влагалище, матке, шейке матки, костном мозге, молочных железах, трахее, легких, толстом кишечнике, прямой кишке, тонком кишечнике, пищеводе, гортани, глазах, в роговице, зрительном волокне, лимфатических узлах, предстательной железе, семенниках, почках, мочевом пузыре, языке, печени и в слизистой оболочке пищевода, слизистой оболочке полости рта, жировой ткани, легочной ткани, плацентарной ткани, ретикулярной соединительной ткани, в эндотелии мелких легочных артерий, артериол, междольковых и субплевральных венулах в сочетании с транспортной молекулой или без нее при введении этих биологически активных генно-терапевтических субстанций в органы и ткани человека. Каждая из линейки созданных биологически активных генно-терапевтических субстанций представляет собой генетическую конструкцию с кДНК гена CLCA2 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена CLCA2, которая несет модификации не затрагивающие структуру белка хлоридного кальций-активируемого канала-2, а именно: делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность. В качестве модифицированной кДНК гена CLCA2 используют SEQ ID No:2, или SEQ ID No:3, или SEQ ID No:4, или SEQ ID No:5, или SEQ ID No:6, SEQ ID No:7. В качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры

Способ получения биологически активной генно-терапевтической субстанции для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2 заключающийся в том, что получают кДНК гена CLCA2, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека.

Или способ получения биологически активной генно-терапевтической субстанции для коррекции патологических состояний клеток различных органов и тканей человека, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, заключающийся в том, что получают кДНК гена CLCA2, модифицируют его по п.п. 3, или 4, или 5 или 6 или 7 или 8, затем помещают модифицированную кДНК в векторную конструкцию, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека.

Способ использования каждой из созданных и представленных в линейке биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, заключается в трансфекции созданной биологически активной генно-терапевтической субстанцией, выбранной с учетом индивидуальных особенностей каждого конкретного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, клеток органов и тканей человека.

Или способ использования каждой из созданных и представленных в линейке биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, заключается во введении одной из созданных биологически активных генно-терапевтической субстанций, выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, в органы и ткани этого пациента, и/или во введении аутологичных клеток пациента, трансфицированных одной из созданных биологически активных генно-терапевтической субстанций, выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, в органы и ткани этого пациента.

Перечень фигур

На фиг. 1

Представлена нуклеотидная последовательность немодифицированной кДНК гена CLCA2, последовательность которой идентична приводимой в базе даных GenBank под номером NM_006536.5 CLCA2 SEQ ID No:1.

На фиг. 2

Представлена нуклеотидная последовательность модифицированной кДНК гена CLCA2, SEQ ID No:2, которая

содержит 2 нуклеотидных замены A→G в позициях 636, 642, одну нуклеотидную замену T→G в позиции 672 и одну нуклеотидную замену G→C в позиции 1071, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2.

На фиг. 3

Представлена нуклеотидная последовательность модифицированной кДНК гена CLCA2, SEQ ID No:3, которая

содержит три нуклеотидные замены A→G в позициях 636, 642, 1281; две нуклеотидных замены T→G в позициях 672, 1536; и две нуклеотидных замены G→C в позициях 1071, 1749, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2.

На фиг. 4

Представлена нуклеотидная последовательность модифицированной кДНК гена CLCA2, SEQ ID No:4, которая

содержит четыре нуклеотидные замены A→G в позициях 636, 642, 1281, 1800; две нуклеотидных замены T→G в позициях 672, 1536; и четыре нуклеотидных замены G→C в позициях 1071, 1749, 2121, 2181, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2.

На фиг. 5

Представлена нуклеотидная последовательность модифицированной кДНК гена CLCA2, SEQ ID No:5, которая

содержит шесть нуклеотидных замен A→G в позициях 636, 642, 1281, 1800, 2373, 2640; две нуклеотидных замены T→G в позициях 672, 1536; и пять нуклеотидных замен G→C в позициях 1071, 1749, 2121, 2181, 2697, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2.

На фиг. 6

Представлена нуклеотидная последовательность модифицированной кДНК гена CLCA2, SEQ ID No:6, которая

содержит восемь нуклеотидных замен A→G в позициях 636, 642, 1281, 1800, 2373, 2640, 2391, 2763; две нуклеотидных замены T→G в позициях 672, 1536; и шесть нуклеотидных замен G→C в позициях 1071, 1749, 2121, 2181, 2697, 2676, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2.

На фиг. 7

Представлена нуклеотидная последовательность модифицированной кДНК гена CLCA2, SEQ ID No:7, которая

не содержит нетранслируемые 5' и 3' области гена и содержит восемь нуклеотидных замен A→G в позициях 636, 642, 1281, 1800, 2373, 2640, 2391, 2763; две нуклеотидных замены T→G в позициях 672, 1536; и шесть нуклеотидных замен G→C в позициях 1071, 1749, 2121, 2181, 2697, 2676, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2.

На фиг. 8

С целью последующего корректного определения генно-терапевтического эффекта после трансфекции фибробластов биологически активной генно-терапевтической субстанцией с кДНК гена CLCA2 проводили анализ эндогенной экспрессии гена CLCA2 в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена CLCA2, фибробласты со сниженной экспрессией гена CLCA2

2 - кДНК гена CLCA2, фибробласты с нормальной экспрессией гена CLCA2

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена CLCA2

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена CLCA2

В качестве референтного гена использовали ген В2М (Бета-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

На фиг. 9

С целью подтверждения увеличения экспрессии гена CLCA2 в клеточной культуре фибробластов со сниженной экспрессией гена CLCA2 при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена CLCA2 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена CLCA2 в фибробластах с нормальной экспрессией гена CLCA2,

2 - кДНК гена CLCA2 в фибробластах со сниженной экспрессией гена CLCA2 до трансфекции БАГТС с кДНК гена CLCA2

3 - кДНК гена CLCA2 в фибробластах со сниженной экспрессией гена CLCA2 после трансфекции БАГТС с кДНК гена CLCA2

4 - кДНК гена CLCA2 в фибробластах со сниженной экспрессией гена CLCA2 после трансфекции вектором без кДНК гена CLCA2

5 - кДНК гена В2М в фибробластах с нормальной экспрессией гена CLCA2,

6 - кДНК гена В2М в фибробластах со сниженной экспрессией гена CLCA2 до трансфекции БАГТС с кДНК гена CLCA2

7 - кДНК гена В2М в фибробластах со сниженной экспрессией гена CLCA2 после трансфекции БАГТС с кДНК гена CLCA2

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена CLCA2 после трансфекции вектором без кДНК гена CLCA2

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена CLCA2 уровень кДНК гена CLCA2 в фибробластах не изменился, а в случае трансфекции вектором с кДНК CLCA2 - уровень кДНК фибробластов со сниженной экспрессией гена CLCA2 многократно увеличился (до уровня выше, чем уровень кДНК гена CLCA2 в нормальных фибробластах).

На фиг. 10

С целью подтверждения увеличения количества белка хлоридного кальций-активируемого канала-2 в клеточной культуре фибробластов с нормальной экспрессией гена CLCA2 при трансфекции данных клеток биологически активной генно-терапевтической субстанцией содержащей кДНК гена CLCA2 представлен график изменения количества белка хлоридного кальций-активируемого канала-2 нетрансфицированных фибробластов (культура А), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК CLCA2 (культура В) и трансфицированных биологически активной генно-терапевтической субстанцией на базе генетической конструкции pCDNA 3.1-CLCA2 SEQ ID No:1 (культура С). Из графика следует, что при трансфекции фибробластов биологически активной генно-терапевтической субстанцией с кДНК гена CLCA2 происходит увеличение количества белка хлоридного кальций-активируемого канала-2 в клеточном лизате.

На фиг. 11

С целью подтверждения увеличения количества белка хлоридного кальций-активируемого канала-2 в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной биологически активной генно-терапевтической субстанцией представлен анализ изменения количества белка хлоридного кальций-активируемого канала-2 в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (Б) и трансфицированные биологически активной генно-терапевтической субстанцией на базе pCMV6-CLCA2 SEQ ID No:7 (С) - в кожу предплечья. Также анализировали количественный уровень белка хлоридного кальций-активируемого канала-2 в интактной коже. Показано повышение количества белка хлоридного кальций-активируемого канала-2 в коже пациента в области введения фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией кДНК гена CLCA2 (С).

На фиг. 12

С целью подтверждения увеличения количества белка хлоридного кальций-активируемого канала-2 до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток биологически активными генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена CLCA2 в зависимости от наличия и типа в них той или иной модификации кДНК гена CLCA2 представлен анализ изменения количественного уровня белка хлоридного кальций-активируемого канала-2 в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена CLCA2, используемой для трансфекции фибробластов.

Культуры фибробластов 28 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-CLCA2 SEQ ID No:1, части (В) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-CLCA2 SEQ ID No:2, части (С) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-CLCA2 SEQ ID No:3, части (D) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-CLCA2 SEQ ID No:4, части (E) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-CLCA2 SEQ ID No:5, части (F) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-CLCA2 SEQ ID No:6, части (G) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-CLCA2 SEQ ID No:7, части (H) трансфицировали векторной плазмидой, не содержащей кДНК гена CLCA2.

По итогам анализа количественного уровня белка хлоридного кальций-активируемого канала-2 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальное количество белка хлоридного кальций-активируемого канала-2 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при трансфекции pCMV6-CLCA2 SEQ ID No:1,

в группе 2 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при трансфекции pCMV6-CLCA2 SEQ ID No:2,

в группе 3 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при трансфекции pCMV6-CLCA2 SEQ ID No:3,

в группе 4 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при трансфекции pCMV6-CLCA2 SEQ ID No:4,

в группе 5 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при трансфекции pCMV6-CLCA2 SEQ ID No:5,

в группе 6 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при трансфекции pCMV6-CLCA2 SEQ ID No:6,

в группе 7 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при трансфекции pCMV6-CLCA2 SEQ ID No:7.

Ни в одной из клеточных культур не наблюдалось того, что максимальное количество белка хлоридного кальций-активируемого канала-2 присутствует при трансфекции вектором без вставки кДНК гена CLCA2.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентрации белка хлоридного кальций-активируемого канала-2 (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена CLCA2.

Из рисунка следует, что достижение максимального количества белка хлоридного кальций-активируемого канала-2 в культурах фибробластов кожи различных пациентов при их трансфекции биологически активными генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена CLCA2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No:1 (А)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No:2 (В)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No:3 (С)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No:4 (D)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No:5 (Е)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No:6 (F)

части клеточных культур, трансфицированных БАГТС CLCA2 SEQ ID No:7 (G)

части клеточных культур, трансфицированных плацебо (Н)

На фиг. 13

С целью подтверждения увеличения экспрессии гена CLCA2 в клеточной культуре кератоцитов и эпителиальных клеток глаза при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена CLCA2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена CLCA2, кератоциты до трансфекции

2 - кДНК гена CLCA2, эпителий роговицы до трансфекции

3 - кДНК гена CLCA2, кератоциты после трансфекции

4 - кДНК гена CLCA2, эпителий роговицы после трансфекции

5 - кДНК гена В2М, кератоциты до трансфекции

6 - кДНК гена В2М, эпителий роговицы до трансфекции

7 - кДНК гена В2М, кератоциты после трансфекции

8 - кДНК гена В2М, эпителий роговицы после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена CLCA2 в культуре кератоцитов и в культуре эпителия многократно вырос.

На фиг. 14

С целью подтверждения увеличения экспрессии гена CLCA2 в клеточной культуре эпителия слизистой оболочки полости рта при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена CLCA2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена CLCA2, до трансфекции

2 - кДНК гена CLCA2, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена CLCA2 вырос многократно.

На фиг. 15

С целью подтверждения увеличения количества белка хлоридного кальций-активируемого канала-2 в коже человека при введении в кожу биологически активной генно-терапевтической субстанции представлен анализ изменения количественного уровня белка хлоридного кальций-активируемого канала-2 в коже. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена CLCA2 pCMV6-CLCA2 SEQ ID No:4 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена CLCA2 с транспортной молекулой (А) - в кожу предплечья. Показано увеличение количества белка хлоридного кальций-активируемого канала-2 в биоптате кожи пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена CLCA2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения БАГТС

На фиг. 16

С целью подтверждения увеличения количества белка хлоридного кальций-активируемого канала-2 в слизистой оболочке рта человека при введении в слизистую оболочку рта биологически активной генно-терапевтической субстанции представлен анализ изменения количественного уровня белка хлоридного кальций-активируемого канала-2 в слизистой оболочке рта. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена CLCA2 pCDNA 3.1 CLCA2 SEQ ID No5 (В) и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена CLCA2 с транспортной молекулой (А) - в слизистую оболочку рта.

Показано увеличение количественного уровня белка хлоридного кальций-активируемого канала-2 в лизате биоптата слизистой оболочки рта пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена CLCA2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения БАГТС

На фиг. 17

С целью подтверждения увеличения количества белка хлоридного кальций-активируемого канала-2 в мышечной ткани человека при введении в мышечную ткань биологически активной генно-терапевтической субстанции представлен анализ изменения количества белка хлоридного кальций-активируемого канала-2 в мышечной ткани. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена CLCA2 - pCMV6-Kan/Neo CLCA2 SEQ ID No:6 (В) и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена CLCA2 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение количества белка хлоридного кальций-активируемого канала-2 в биоптате мышечной ткани пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена CLCA2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения БАГТС

На фиг. 18

С целью подтверждения увеличения количества белка хлоридного кальций-активируемого канала-2 до различного индивидуального уровня при введении в кожу пациентов биологически активных генно-терапевтических субстанций с модифицированными и нативной кДНК гена CLCA2 анализировали количественный уровень белка хлоридного кальций-активируемого канала-2 в коже человека в зависимости от наличия и типа модификаций в кДНК гена CLCA2.

Каждому из 24-ти пациентов, отобранных в случайном порядке, вводили в кожу предплечья 7 биологически активных генно-терапевтических субстанций pCMV6- SEQ ID No:1, pCMV6- SEQ ID No:2, pCMV6- SEQ ID No:3, pCMV6- SEQ ID No:4, pCMV6- SEQ ID No:5, pCMV6- SEQ ID No:6, pCMV6- SEQ ID No:7, и плацебо pCMV6- XL5.

По итогам анализа количества белка хлоридного кальций-активируемого канала-2 в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные количественные уровни белка хлоридного кальций-активируемого канала-2 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при введении pCMV6-CLCA2 SEQ ID No:1,

в группе 2 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при введении pCMV6-CLCA2 SEQ ID No:2,

в группе 3 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при введении pCMV6-CLCA2 SEQ ID No:3,

в группе 4 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при введении pCMV6-CLCA2 SEQ ID No:4,

в группе 5 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при введении pCMV6-CLCA2 SEQ ID No:5,

в группе 6 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалась при введении pCMV6-CLCA2 SEQ ID No:6,

в группе 7 максимальное количество белка хлоридного кальций-активируемого канала-2. наблюдалась при введении pCMV6-CLCA2 SEQ ID No:7.

Ни в одном из биоптатов не наблюдалось того, что максимальное количество белка хлоридного кальций-активируемого канала-2 присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка хлоридного кальций-активируемого канала-2 (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена CLCA2.

Из данного примера следует, что достижение максимального количества белка хлоридного кальций-активируемого канала-2 в биоптатах кожи различных пациентов при введении им в кожу биологически активных генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена CLCA2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента.

Обозначения:

биоптаты пациентов после введения БАГТС CLCA2 SEQ ID No:1 (А)

биоптаты пациентов после введения БАГТС CLCA2 SEQ ID No:2 (В)

биоптаты пациентов после введения БАГТС CLCA2 SEQ ID No:3 (С)

биоптаты пациентов после введения БАГТС CLCA2 SEQ ID No:4 (D)

биоптаты пациентов после введения БАГТС CLCA2 SEQ ID No:5 (Е)

биоптаты пациентов после введения БАГТС CLCA2 SEQ ID No:6 (F)

биоптаты пациентов после введения БАГТС CLCA2 SEQ ID No:7 (G)

биоптаты пациентов после введения плацебо (Н)

На фиг. 19

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количественный уровень белка хлоридного кальций-активируемого канала-2 в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими нативную или модифицированные кДНК гена CLCA2.

По итогам анализа количества белка хлоридного кальций-активируемого канала-2 в культуре фибробластов пациента выделили вариант биологически активной генно-терапевтической субстанции, при трансфекции которой выявляется максимальная концентрация белка хлоридного кальций-активируемого канала-2 в лизате клеточной культуры. В данном эксперименте максимальная концентрация белка хлоридного кальций-активируемого канала-2 в лизате наблюдается при трансфекции биологически активной генно-терапевтической субстанцией на базе pCMV6 CLCA2 SEQ ID No:3, содержащей модифицированную кДНК CLCA2, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Обозначения:

1 - клеточный лизат после трансфекции БАГТС CLCA2 SEQ ID No:1 (А)

2 - клеточный лизат после трансфекции БАГТС CLCA2 SEQ ID No:2 (В)

3 - клеточный лизат после трансфекции БАГТС CLCA2 SEQ ID No:3 (С)

4 - клеточный лизат после трансфекции БАГТС CLCA2 SEQ ID No:4 (D)

5 - клеточный лизат после трансфекции БАГТС CLCA2 SEQ ID No:5 (Е)

6 - клеточный лизат после трансфекции БАГТС CLCA2 SEQ ID No:6 (F)

7 - клеточный лизат после трансфекции БАГТС CLCA2 SEQ ID No:7 (G)

8 - клеточный лизат после трансфекции плацебо (Н)

На фиг. 20

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка хлоридного кальций-активируемого канала-2 в лизатах биоптатов кожи этого пациента, после введения ему биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена CLCA2.

По итогам анализа количества белка хлоридного кальций-активируемого канала-2 в лизате биоптатов кожи пациента выделили вариант биологически активной генно-терапевтической субстанции, при введении которой выявляется максимальная концентрация белка хлоридного кальций-активируемого канала-2 в лизате биоптата. В данном эксперименте максимальная концентрация белка хлоридного кальций-активируемого канала-2 отмечена при введении биологически активной генно-терапевтической субстанции на базе pCMV6 CLCA2 SEQ ID NO:6, содержащей модифицированную кДНК CLCA2, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения БАГТС CLCA2 SEQ ID No:1 (А)

2 - лизат биоптата после введения БАГТС CLCA2 SEQ ID No:2 (В)

3 - лизат биоптата после введения БАГТС CLCA2 SEQ ID No:3 (С)

4 - лизат биоптата после введения БАГТС CLCA2 SEQ ID No:4 (D)

5 - лизат биоптата после введения БАГТС CLCA2 SEQ ID No:5 (Е)

6 - лизат биоптата после введения БАГТС CLCA2 SEQ ID No:6 (F)

7 - лизат биоптата после введения БАГТС CLCA2 SEQ ID No:7 (G)

8 - лизат биоптата после введения плацебо (Н)

Реализация изобретения.

При снижении экспрессии генов, кодирующих белки, например гена CLCA2, происходит снижение количества белка в организме, что приводит к патологическим состояниям.

Исследования по нокаутным мышам показали, что у гомозигот(-/-) с выключенным геном CLCA2, наблюдается увеличение размеров печени по отношению к размерам тела, а также детектируется гипертрофия гепатоцитов, и был один случай мультифокального некроза печени. (http://www.informatics.jax.org/reference/J:101679.)

Преимущества использования генетической конструкции с геном CLCA2 для коррекции количественного уровня белка хлоридного кальций-активируемого канала-2 в клетках органов и тканей человека, по сравнению с использованием рекомбинантной нуклеиновой кислоты, как по прототипу US 20030064946 следующие:

1) легче обеспечить более высокий и стабильный уровень белка в клетках,

2) не требуется сложная и дорогостоящая процедура рефолдинга и очистки белкового препарата,

3) обеспечивается транспортировка биологически активной генно-терапевтической субстанции в больший спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка биологически активной генно-терапевтической субстанции.

4) учитываются индивидуальные характеристики пациента.

Таким образом, для создания линейки биологически активных генно-терапевтических субстанций по данному изобретению был выбран ген CLCA2, а не белок, кодируемый этим геном.

Для получения линейки биологически активных генно-терапевтических субстанций осуществляют следующие действия:

1. Получение нативной кДНК гена CLCA2, содержащей белок-кодирующую область гена CLCA2, клонирование ее в промежуточную плазмиду для дальнейших модификаций этой кДНК

2. Внесение в последовательность нуклеотидов кДНК гена CLCA2 модификаций с целью создания линейки кДНК гена CLCA2, обеспечивающих достаточный для борьбы с патологическими проявлениями уровень трансляции белка хлоридного кальций-активируемого канала-2

3. Клонирование нативной и модифицированных кДНК гена CLCA2 в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E.coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение линейки генетических конструкций, содержащих модифицированные и нативную кДНК гена CLCA2 для создания на ее базе линейки биологически активных генно-терапевтических субстанций.

6. Создание линейки биологически активных генно-терапевтических субстанций, каждая из которых включает генетическую конструкцию с модифицированной или нативной кДНК гена CLCA2, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных биологически активных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена CLCA2, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки рта, или кератоцитов, или эпителиальных клеток роговицы.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки рта, или кератоцитов, или эпителиальных клеток роговицы, и анализ экспрессии гена CLCA2 из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки рта, или кератоцитов, или эпителиальных клеток роговицы, биологически активными генно-терапевтическими субстанциями содержащими нативную и/или модифицированные кДНК гена CLCA2 и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена CLCA2 в различных комбинациях.

D) Сравнительный анализ изменения уровня кДНК и/или изменения количества белка хлоридного кальций-активируемого канала-2 после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки рта, или кератоцитов, или эпителиальных клеток роговицы, биологически активными генно-терапевтическими субстанциями содержащими нативную и/или модифицированные кДНК гена CLCA2 и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена CLCA2. Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента биологически активной генно-терапевтической субстанции.

E) Введение пациентам в органы и ткани культуры клеток с кДНК гена CLCA2, например, введение, в кожу человека, аутологичных фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией с кДНК гена CLCA2 и параллельное введение пациентам в органы и ткани, например, в кожу, культур этих же клеток нетрансфицированных и трансфицированных вектором без вставки кДНК гена CLCA2 и/или введение пациентам в органы и ткани биологически активных генно-терапевтических субстанций, например, введение в кожу человека биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК CLCA2, а также плацебо в различных комбинациях.

F) Сравнительный анализ количества белка хлоридного кальций-активируемого канала-2 в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных биологически активными генно-терапевтическими субстанциями, содержащими кДНК гена CLCA2 и векторными плазмидами, не содержащими кДНК гена CLCA2 и/или биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена CLCA2, а также плацебо.

G) Введение пациентам в органы и ткани, например, в слизистую оболочку рта или мышечную ткань биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК гена CLCA2, а также плацебо.

H) Сравнительный анализ количества белка хлоридного кальций-активируемого канала-2 в органах и тканях человека, в частности в слизистой оболочке рта или мышечной ткани человека, после введения биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК CLCA2 а также плацебо.

I) Введение пациентам в органы и ткани, например, введение в кожу пациента биологически активных генно-терапевтических субстанций, содержащих нативную и модифицированные кДНК гена CLCA2.

J) Сравнительный анализ количества белка хлоридного кальций-активируемого канала-2 в органах и тканях пациента, в частности в коже, после введения биологически активных генно-терапевтических субстанций, содержащих нативную и модифицированные кДНК гена CLCA2. Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций.

Пример 1.

Получение нативной (немодифицированной) кДНК гена CLCA2.

Немодифицированная кДНК гена CLCA2 представляет собой последовательность нуклеотидов, идентичную приводимой в базе данных GenBank под номером NM_006536.5; нуклеотиды со 163 по 2994 транслируются в аминокислотную последовательность, соответствующую приведенной в GenBank под номером NP_006527.1

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) и используют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно кинированные праймеры, комплементарные нуклеотидам 3-22 5' CCAGATGGATCCACCCCAGA 3' (CLCA2F1) и 3046-3026 5' GTCGAAGGCCATGGGTCTTAT 3' (CLCA2R1) из последовательности мРНК CLCA2 (GenBank NM_006536.5), получают кДНК CLCA2. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами. ПЦР проводят с помощью амплификатора Master CyclerGradient (Eppendorf, USA) в 50 мкл реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера CLCA2 F1 и CLCA2 R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (рН 8,85 при 20°С), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific, USA) при следующих условиях: первоначальная денатурация при 98°С в течение 30 сек., 35 циклов, включающих денатурацию при 98°С в течение 10 сек., отжиг праймеров при 60°С в течение 30 сек. и элонгацию при 68°С в течение 6 мин.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany)

Амплифицированный фрагмент кДНК, несущий ген CLCA2, клонируют в плазмидном векторе pUC19 (NEB, USA, кат. номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, кат. Номер N3041S) гидролизуют рестриктазой Smal (NEB, USA), (или другой рестриктазой, дающей тупые концы) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага Т4 400000 ед./мл. (NEB, USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис -HCl, рН 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°С.

Полученной смесью трансформируют компетентные клетки E.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки Петри с L-агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами CLCA2 F1 и CLCA2 R1 и подтверждают секвенированием по методу Сэнгера, которое показывает наличие клонов с разной ориентацией целевого гена: EcoRI-5'NTR-кДНК CLCA2 -3'NTRHindIII и HindIII--5'NTR-кДНК CLCA2 -3'NTR-EcoRI.

Полученная таким образом клонированная частичная (с 3 по 3046 н.п) нативная (немодифицированная) последовательность гена CLCA2 длиной 3044 н.п. в плазмиде pUC19-CLCA2 SEQ ID No:1 имеет первичную структуру, приведенную на фигуре 1.

Пример 2.

Получение модифицированных кДНК гена CLCA2.

Модификации проводят таким образом, чтобы не затрагивать первичную структуру белка хлоридного кальций-активируемого канала-2, а именно, делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности для получения линейки кДНК гена CLCA2 с целью повышения эффективности транскрипции и трансляции белка хлоридного кальций-активируемого канала-2 в клетках тканей и органов человека в нативную последовательность кДНК CLCA2, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные, а также проводят делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChange II XL kit или QuikChange Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA,) согласно рекомендациям производителя.

http://www.agilent.com/cs/library/usermanuals/Public/200513.

К плазмидной ДНК pUC 19-CLCA2 SEQ ID No:1 по Примеру 1 (вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена EcoRI-5'NTR-кДНК CLCA2-3'NTRHindIII и вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена HindIII--5'NTR-кДНК CLCA2-3'NTR-EcoRI) в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 25-45 н.п. и проводят ПЦР в буфере QuikChange Multi reaction buffer (AgilentTechnologies, USA) со смесью ферментов QuikChange Multi mix (AgilentTechnologies, USA) при следующих условиях: 95°C, 1 мин; далее от 30 до 35 циклов: 95°С 1 минута, 55°С 1 минута, 65°С 2 минуты. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°С. Полученной смесью трансформируют компетентные клетки Е.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L-агаром, содержащих 100 мкг/мл ампициллина. Трансформированнные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК CLCA2 SEQ ID No:2 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК CLCA2 SEQ ID No:1, (вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена гена SacI-5'-CLCA2-3'-XbaI и вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена XbaI-5'-CLCA2-3'-SacI), используемой в качестве матрицы:

1. CLCA2 627-661 F:

5' CGGATCACGGGGCCGGGTGTTTGTCCATGAATGGG 3',

комплементарным нуклеотидам 627-661, с заменами A→G в позициях 636 и 642;

2. CLCA2 662-690 F:

5' CCCACCTCCGGTGGGGTGTGTTCGATGAG 3', комплементарным нуклеотидам 662-690, с заменой T→G в позиции 672; и

3. CLCA2 1060-1085 F:

5' CCCACATTCTCCCTTGTACAGGCTGG 3', комплементарным нуклеотидам 1060-1085, с заменой G→C в позиции 1071.

Модифицированная таким образом нуклеотидная последовательность кДНК CLCA2 SEQ ID No:2 содержит 2 нуклеотидных замены A→G в позициях 636, 642, одну нуклеотидную замену T→G в позиции 672 и одну нуклеотидную замену G→C в позиции 1071, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2 и имеет первичную структуру, приведенную на фиг. 2.

Для получения модифицированной кДНК CLCA2 SEQ ID No:3 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК CLCA2 SEQ ID No:1, (вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена гена SacI-5'-CLCA2-3'-XbaI и вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена XbaI-5'-CLCA2-3'-SacI), используемой в качестве матрицы:

1. CLCA2 627-661 F:

5' CGGATCACGGGGCCGGGTGTTTGTCCATGAATGGG 3',

комплементарным нуклеотидам 627-661, с заменами A→G в позициях 636 и 642;

2. CLCA2 662-690 F:

5' CCCACCTCCGGTGGGGTGTGTTCGATGAG 3', комплементарным нуклеотидам 662-690, с заменой T→G в позиции 672; и

3. CLCA2 1060-1085 F:

5' CCCACATTCTCCCTTGTACAGGCTGG 3', комплементарным нуклеотидам 1060-1085, с заменой G→C в позиции 1071.

4. CLCA2 1270-1296 F:

5' AATGATGATCGGAAGTTGCTGGTTTCA 3',

комплементарным нуклеотидам 1270-1296, с заменой A→G в позиции 1281;

5. CLCA2 1526-1547 F:

5' AATTATCACGGCTTACAGGAGG 3',

комплементарным нуклеотидам 1526-1547, с заменой T→G в позиции 1536;

6. CLCA2 1741-1763 F:

5' CTAGTTACCTGGCAGGCCAGTGG 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 1749.

Модифицированная таким образом нуклеотидная последовательность кДНК CLCA2 SEQ ID No:3 содержит три нуклеотидные замены A→G в позициях 636, 642, 1281; две нуклеотидных замены T→G в позициях 672, 1536; и две нуклеотидных замены G→C в позициях 1071, 1749, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2 и имеет первичную структуру, приведенную на фиг 3.

Для получения модифицированной кДНК CLCA2 SEQ ID No:4 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК CLCA2 SEQ ID No:1 (вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена гена SacI-5'-CLCA2-3'-XbaI и вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией, целевого гена XbaI-5'-CLCA2-3'-SacI), используемой в качестве матрицы:

1. CLCA2 627-661 F:

5' CGGATCACGGGGCCGGGTGTTTGTCCATGAATGGG 3',

комплементарным нуклеотидам 627-661, с заменами A→G в позициях 636 и 642;

2. CLCA2 662-690 F:

5' CCCACCTCCGGTGGGGTGTGTTCGATGAG 3', комплементарным нуклеотидам 662-690, с заменой T→G в позиции 672; и

3. CLCA2 1060-1085 F:

5' CCCACATTCTCCCTTGTACAGGCTGG 3', комплементарным нуклеотидам 1060-1085, с заменой G→C в позиции 1071.

4. CLCA2 1270-1296 F:

5' AATGATGATCGGAAGTTGCTGGTTTCA 3',

комплементарным нуклеотидам 1270-1296, с заменой A→G в позиции 1281;

5. CLCA2 1526-1547 F:

5' AATTATCACGGCTTACAGGAGG 3',

комплементарным нуклеотидам 1526-1547, с заменой T→G в позиции 1536;

6. CLCA2 1741-1763 F:

5' CTAGTTACCTGGCAGGCCAGTGG 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 1749.

7. CLCA2 1792-1814 F:

5' GATGGACGGAAATACTACACAAA 3',

комплементарным нуклеотидам 1792-1814, с заменой A→G в позиции 1800;

8. CLCA2 2110-2135 F:

5' GATCCTGTTACCCTGAGACTCCTTGA 3',

комплементарным нуклеотидам 2110-2135, с заменой G→C в позиции 2121;

9. CLCA2 2174-2199 F:

5' TTTACTCCAGGTATTTTTTCTCCTTT 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 2181.

Модифицированная таким образом нуклеотидная последовательность кДНК CLCA2 SEQ ID No:4 содержит четыре нуклеотидные замены A→G в позициях 636, 642, 1281, 1800; две нуклеотидных замены T→G в позициях 672, 1536; и четыре нуклеотидных замены G→C в позициях 1071, 1749, 2121, 2181, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2 и имеет первичную структуру, приведенную на фиг 4.

Для получения модифицированной кДНК CLCA2 SEQ ID No:5 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК CLCA2 SEQ ID No:1 (вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена гена SacI-5'-CLCA2-3'-XbaI и вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена XbaI-5'-CLCA2-3'-SacI), используемой в качестве матрицы:

1. CLCA2 627-661 F:

5' CGGATCACGGGGCCGGGTGTTTGTCCATGAATGGG 3',

комплементарным нуклеотидам 627-661, с заменами A→G в позициях 636 и 642;

2. CLCA2 662-690 F:

5' CCCACCTCCGGTGGGGTGTGTTCGATGAG 3', комплементарным нуклеотидам 662-690, с заменой T→G в позиции 672; и

3. CLCA2 1060-1085 F:

5' CCCACATTCTCCCTTGTACAGGCTGG 3', комплементарным нуклеотидам 1060-1085, с заменой G→C в позиции 1071.

4. CLCA2 1270-1296 F:

5' AATGATGATCGGAAGTTGCTGGTTTCA 3',

комплементарным нуклеотидам 1270-1296, с заменой A→G в позиции 1281;

5. CLCA2 1526-1547 F:

5' AATTATCACGGCTTACAGGAGG 3',

комплементарным нуклеотидам 1526-1547, с заменой T→G в позиции 1536;

6. CLCA2 1741-1763 F:

5' CTAGTTACCTGGCAGGCCAGTGG 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 1749.

7. CLCA2 1792-1814 F:

5' GATGGACGGAAATACTACACAAA 3',

комплементарным нуклеотидам 1792-1814, с заменой A→G в позиции 1800;

8. CLCA2 2110-2135 F:

5' GATCCTGTTACCCTGAGACTCCTTGA 3',

комплементарным нуклеотидам 2110-2135, с заменой G→C в позиции 2121;

9. CLCA2 2174-2199 F:

5' TTTACTCCAGGTATTTTTTCTCCTTT 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 2181.

10. CLCA2 2364-2387 F,:

5' GGAGGAGCGGAAGTGGGGCTTTAG 3',

комплементарным нуклеотидам 2364-2387, с заменой A→G в позиции 2373;

11. CLCA2 2631-2653 F:

5' ATCAAAGCGGAATCCTCAGCAAG 3',

комплементарным нуклеотидам 2631-2653, с заменой A→G в позиции 2640;

12. CLCA2 2689-2715 F:

5' ATTTCCACCAATGGACCTGAACATCAG 3',

комплементарным нуклеотидам 2689-2715, с заменой G→C в позиции 2697.

Модифицированная таким образом нуклеотидная последовательность кДНК CLCA2 SEQ ID No:5 содержит шесть нуклеотидных замен A→G в позициях 636, 642, 1281, 1800, 2373, 2640; две нуклеотидных замены T→G в позициях 672, 1536; и пять нуклеотидных замен G→C в позициях 1071, 1749, 2121, 2181, 2697, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2 и имеет первичную структуру, приведенную на фиг 5. белок

Для получения модифицированной кДНК CLCA2 SEQ ID No:6 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК CLCA2 SEQ ID No:1 (вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена гена SacI-5'-CLCA2-3'-XbaI и вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена XbaI-5'-CLCA2-3'-SacI), используемой в качестве матрицы:

1. CLCA2 627-661 F:

5' CGGATCACGGGGCCGGGTGTTTGTCCATGAATGGG 3',

комплементарным нуклеотидам 627-661, с заменами A→G в позициях 636 и 642;

2. CLCA2 662-690 F:

5' CCCACCTCCGGTGGGGTGTGTTCGATGAG 3', комплементарным нуклеотидам 662-690, с заменой T→G в позиции 672; и

3. CLCA2 1060-1085 F:

5' CCCACATTCTCCCTTGTACAGGCTGG 3', комплементарным нуклеотидам 1060-1085, с заменой G→C в позиции 1071.

4. CLCA2 1270-1296 F:

5' AATGATGATCGGAAGTTGCTGGTTTCA 3',

комплементарным нуклеотидам 1270-1296, с заменой A→G в позиции 1281;

5. CLCA2 1526-1547 F:

5' AATTATCACGGCTTACAGGAGG 3',

комплементарным нуклеотидам 1526-1547, с заменой T→G в позиции 1536;

6. CLCA2 1741-1763 F:

5' CTAGTTACCTGGCAGGCCAGTGG 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 1749.

7. CLCA2 1792-1814 F:

5' GATGGACGGAAATACTACACAAA 3',

комплементарным нуклеотидам 1792-1814, с заменой A→G в позиции 1800;

8. CLCA2 2110-2135 F:

5' GATCCTGTTACCCTGAGACTCCTTGA 3',

комплементарным нуклеотидам 2110-2135, с заменой G→C в позиции 2121;

9. CLCA2 2174-2199 F:

5' TTTACTCCAGGTATTTTTTCTCCTTT 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 2181.

10. CLCA2 2364-2387 F,:

5' GGAGGAGCGGAAGTGGGGCTTTAG 3',

комплементарным нуклеотидам 2364-2387, с заменой A→G в позиции 2373;

11. CLCA2 2631-2653 F:

5' ATCAAAGCGGAATCCTCAGCAAG 3',

комплементарным нуклеотидам 2631-2653, с заменой A→G в позиции 2640;

12. CLCA2 2689-2715 F:

5' ATTTCCACCAATGGACCTGAACATCAG 3',

комплементарным нуклеотидам 2689-2715, с заменой G→C в позиции 2697.

13. CLCA2 2378-2405 F:

5' GGGGCTTTAGCCGGGTCAGCTCAGGAGG 3',

комплементарным нуклеотидам 2378-2405, с заменой A→G в позиции 2391;

14. CLCA2 2663-2689 F:

5' GGGAGATATTTACCTTCTCACCCCAAA 3',

комплементарным нуклеотидам 2663-2689, с заменой G→C в позиции 2676;

15. CLCA2 2755-2775 F:

5' GCAATACGGGCAATGGATAGG 3',

комплементарным нуклеотидам 2755-2755, с заменой A→G в позиции 2763.

Модифицированная таким образом нуклеотидная последовательность кДНК CLCA2 SEQ ID NO:6 содержит восемь нуклеотидных замен A→G в позициях 636, 642, 1281, 1800, 2373, 2640, 2391, 2763; две нуклеотидных замены T→G в позициях 672, 1536; и шесть нуклеотидных замен G→C в позициях 1071, 1749, 2121, 2181, 2697, 2676, не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2 и имеет первичную структуру, приведенную на фиг 6.

Для получения модифицированной кДНК CLCA2 SEQ ID No:7 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК CLCA2 SEQ ID No:1 (вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена гена SacI-5'-CLCA2-3'-XbaI и вариант pUC 19-CLCA2 SEQ ID No:1 с ориентацией целевого гена XbaI-5'-CLCA2-3'-SacI), используемой в качестве матрицы:

1. CLCA2 627-661 F:

5' CGGATCACGGGGCCGGGTGTTTGTCCATGAATGGG 3',

комплементарным нуклеотидам 627-661, с заменами A→G в позициях 636 и 642;

2. CLCA2 662-690 F:

5' CCCACCTCCGGTGGGGTGTGTTCGATGAG 3', комплементарным нуклеотидам 662-690, с заменой T→G в позиции 672; и

3. CLCA2 1060-1085 F:

5' CCCACATTCTCCCTTGTACAGGCTGG 3', комплементарным нуклеотидам 1060-1085, с заменой G→C в позиции 1071.

4. CLCA2 1270-1296 F: 5' AATGATGATCGGAAGTTGCTGGTTTCA 3',

комплементарным нуклеотидам 1270-1296, с заменой A→G в позиции 1281;

5. CLCA2 1526-1547 F:

5' AATTATCACGGCTTACAGGAGG 3',

комплементарным нуклеотидам 1526-1547, с заменой T→G в позиции 1536;

6. CLCA2 1741-1763 F:

5' CTAGTTACCTGGCAGGCCAGTGG 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 1749.

7. CLCA2 1792-1814 F:

5' GATGGACGGAAATACTACACAAA 3',

комплементарным нуклеотидам 1792-1814, с заменой A→G в позиции 1800;

8. CLCA2 2110-2135 F:

5' GATCCTGTTACCCTGAGACTCCTTGA 3',

комплементарным нуклеотидам 2110-2135, с заменой G→C в позиции 2121;

9. CLCA2 2174-2199 F:

5' TTTACTCCAGGTATTTTTTCTCCTTT 3',

комплементарным нуклеотидам 1741-1763, с заменой G→C в позиции 2181.

10. CLCA2 2364-2387 F,:

5' GGAGGAGCGGAAGTGGGGCTTTAG 3',

комплементарным нуклеотидам 2364-2387, с заменой A→G в позиции 2373;

11. CLCA2 2631-2653 F:

5' ATCAAAGCGGAATCCTCAGCAAG 3',

комплементарным нуклеотидам 2631-2653, с заменой A→G в позиции 2640;

12. CLCA2 2689-2715 F:

5' ATTTCCACCAATGGACCTGAACATCAG 3',

комплементарным нуклеотидам 2689-2715, с заменой G→C в позиции 2697.

13. CLCA2 2378-2405 F:

5' GGGGCTTTAGCCGGGTCAGCTCAGGAGG 3',

комплементарным нуклеотидам 2378-2405, с заменой A→G в позиции 2391;

14. CLCA2 2663-2689 F:

5' GGGAGATATTTACCTTCTCACCCCAAA 3',

комплементарным нуклеотидам 2663-2689, с заменой G→C в позиции 2676;

15. CLCA2 2755-2775 F:

5' GCAATACGGGCAATGGATAGG 3',

комплементарным нуклеотидам 2755-2755, с заменой A→G в позиции 2763.

16. а также для удаления 5' -нетранслируемой области гена CLCA2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером:

5'

GAATTCGAGCTCGGTACCCGCCACCATGACCCAAAGGAGCA 3' для варианта с ориентацией целевого гена SacI-5'-CLCA2-3'-XbaI

17. а также для удаления 3' -нетранслируемой области гена CLCA2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером 5' AGAATGGAACAAAATTATTATAAGGGGATCCTCTAGAGTCG 3'

для варианта с ориентацией целевого гена SacI-5'-CLCA2-3'-XbaI

18. а также для удаления 5' -нетранслируемой области гена CLCA2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером: 5' GACTCTAGAGGATCCCCGCCACCATGACCCAAAGGAGCA 3'

для варианта с ориентацией целевого гена XbaI-5'-CLCA2-3'-SacI

19. а также для удаления 3' -нетранслируемой области гена CLCA2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером 5' GGAACAAAATTATTATAAGGGTACCGAGCTCGAATTCACTGG 3'

для варианта с ориентацией целевого гена XbaI-5'-CLCA2-3'-SacI

Модифицированная таким образом нуклеотидная последовательность кДНК CLCA2 SEQ ID No:7 не содержит нетранслируемые 5' и 3' области гена и содержит восемь нуклеотидных замен A→G в позициях 636, 642, 1281, 1800, 2373, 2640, 2391, 2763; две нуклеотидных замены T→G в позициях 672, 1536; и шесть нуклеотидных замен G→C в позициях 1071, 1749, 2121, 2181, 2697, 2676; не приводящие к изменениям в аминокислотной последовательности белка хлоридного кальций-активируемого канала-2 и имеет первичную структуру, приведенную на фиг 7.

Таким образом, получают линейку из 7 векторов на базе плазмиды pUC19, в которой клонированы кодирующие нативная и модифицированные нуклеотидные последовательности гена CLCA2 (при этом каждый вектор из линейки получен в двух вариантах и содержит целевой ген с ориентацией SacI-5'-CLCA2-3'-XbaI и целевой ген с ориентацией XbaI-5'-CLCA2-3'-SacI для создания генетических экспрессионных конструкций на базе разных векторов) для создания линейки биологически активных генно-терапевтических субстанций.

Пример 3.

Создание генетических конструкций с модифицированными и нативной кДНК гена CLCA2 для получения на их базе биологически активных генно-терапевтических субстанций.

Для экспрессии кДНК гена CLCA2 в клетках органов и тканей человека полученные варианты кДНКCLCA2 по Примеру 1 и Примеру 2 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E.coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции;

3) в векторе должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) наличие удобного полилинкера для клонирования. Примером такой плазмиды может быть pCMV6-XL5, pCMV6-Kan/Neo (OriGene, USA) или pCDNA 3.1(+) (ThermoFisherScientific, USA).

При клонировании кДНК гена CLCA2 в pCDNA 3.1(+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину. При клонировании учитывают последовательность расположения сайтов XbaI и SacI в полилинкере pCDNA 3.1(+) и поэтому для клонирования в данный вектор используют XbaI-5'-CLCA2-3'-SacI ориентированный фрагмент в pUC19 по примеру 1.

При клонировании кДНК гена CLCA2 в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину. При клонировании учитывают последовательность расположения сайтов SacI и XbaI в полилинкере pCMV6-XL5 (pCMV6-Kan/Neo) и поэтому для клонирования в данный вектор используют Eco RI - SacI-5'-CLCA2-3'-XbaI ориентированный фрагмент в pUC19 по примеру 1.

Векторные плазмиды pUC19-CLCA2 SEQ ID No:1 с частичной нативной (немодифицированной) последовательностью гена CLCA2 (с 3 по 3046 н.п.), pUC19-CLCA2 SEQ ID No:2, pUC19-CLCA2 SEQ ID No:3, pUC19-CLCA2 SEQ ID No:4, pUC19-CLCA2 SEQ ID No:5, pUC19-CLCA2 SEQ ID No:6, с частичной модифицированной путем замены оснований нуклеотидной последовательностью гена CLCA2 (с 3 по 3046 н.п.) и pUC19-CLCA2 SEQ ID No:7 с модифицированной кДНК гена CLCA2 и лишенной нетранслируемыех 5' и 3' областей данного гена, а также векторные плазмиды pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+) для дальнейшей экспрессии гена CLCA2 в эукариотических клетках, гидролизуют рестриктазами SacI и XbaI (NEB, USA) при 37°С в соответствующем буфере (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984).

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке XbaI-5'-CLCA2-3'-SacI, либо SacI-5'-CLCA2-3'-XbaI и линеаризованной плазмиде PCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1(+), вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit из примера 1 и смешивают. Полученную смесь рестрикционных фрагментов лигируют с помощью ДНК-лигазы фага Т4. Лигирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°С в течение 10 ч. Лигированную ДНК используют для трансформации клеток Е.coli по стандартной методике с использованием хлористого кальция. Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit, анализируют с помощью гидролиза рестриктазами тEcoRI и HindIII и отбирают генетическую (ие) конструкцию (ии), содержащую (ие) в своем составе кодирующую последовательность гена CLCA2 под контролем промотора цитомегаловируса CMV, и сигналом полиаденилирования гена гормона роста, обозначаемую как pCMV6 CLCA2 SEQ ID No:(1-7) или pCMV6-Kan/Neo CLCA2 SEQ ID No:(1-7) или pCDNA 3.1 CLCA2 SEQ ID No:(1-7). Наличие вставки кДНК гена CLCA2, ее последовательность и ориентацию также подтверждают с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих биологически активных генно-терапевтических субстанций.

Полученные генетические экспрессионные конструкции используют для получения на их базе биологически активных генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6 - XL5, (pCMV6-Kan/Neo) или pCDNA 3.1(+) без вставки кДНК гена CLCA2.

Пример 4.

Наращивание генетической конструкции в бактериальной культуре.

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена CLCA2, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E.coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена CLCA2 в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами SacI и XbaI и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (клеток эпителия слизистой оболочки рта, кератоцитов и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E.coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°С и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5.

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции биологически активной генно-терапевтической субстанцией и анализа экспрессии гена CLCA2.

Для последующей трансфекции биологически активной генно-терапевтической субстанцией содержащей один из вариантов кДНК CLCA2 по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например за ушной раковиной или с боковой внутренней поверхности в зоне локтевого сустава, размером около 3 мм, массой - до 20 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°С в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°С в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена CLCA2, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAlater и хранили при 4°С в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260 : D280 - не менее 1,8, а соотношение полос 28S : 18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК.

В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6.

Анализ эндогенной экспрессии гена CLCA2 в культуре первичных фибробластов.

Анализ экспрессии гена CLCA2 из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена CLCA2.

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена CLCA2 и фибробласты с нормальной экспрессией гена CLCA2, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК (939-1110 н.п.), специфичной для гена CLCA2, используют прямой праймер CLCA2 FA1 5' AGAAGCACCAAACCTACAGAAC 3' и обратный праймер CLCA2 -RA1 5' ATCCAGCACTAAACAGACCACT 3'.

Длина продукта амплификации - 172 нуклеотида. В качестве референтного гена используют ген бета-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена CLCA2.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого прймера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°С 30 минут, денатурация 98°С - 15 мин., затем 40 циклов, включающих денатурацию 94°С - 15 сек., отжиг праймеров 55,7°С - 30 сек. и элонгацию 72°С - 30 сек.

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов CLCA2 и В2М. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны). Количество ПЦР продуктов - кДНК генов CLCA2 и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.

По итогам анализа экспрессии гена CLCA2 в разных культурах фибробластов (с низкой экспрессией гена CLCA2 и с нормальной экспрессией гена CLCA2) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена CLCA2, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7.

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена CLCA2 биологически активной генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена CLCA2 в культуре данных клеток.

Для оценки эффективности биологически активной генно-терапевтической субстанции, содержащей немодифицированную кДНК гена CLCA2 по примеру 3, этой биологически активной генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена CLCA2, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют биологически активной генно-терапевтической субстанцией на основе pCMV6- CLCA2 SEQ ID No:1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4×105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°С и в атмосфере, содержащей 5% CO2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, рН 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°С.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С и в атмосфере, содержащей 5% CO2, после чего оценивали уровень кДНК гена CLCA2 и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена CLCA2 уровень кДНК гена CLCA2 в фибробластах не изменился, а в случае трансфекции вектором с кДНК CLCA2 - уровень кДНК фибробластов со сниженной экспрессией гена CLCA2 многократно увеличился (до уровня выше, чем уровень кДНК гена CLCA2 в нормальных фибробластах).

Показано, что в клетках трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6-CLCA2 SEQ ID No:1 наблюдается усиление экспрессии целевого гена CLCA2

Пример 8.

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена CLCA2 биологически активной генно-терапевтической субстанцией с кДНК гена CLCA2 с целью подтверждения увеличения количества белка хлоридного кальций-активируемого канала-2 в культуре данных клеток.

Для оценки количества белка хлоридного кальций-активируемого канала-2 использовали культуру фибробластов кожи человека по Примеру 5, в качестве транспортной молекулы - дендримеры SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия), в качестве трансфицируемых агентов - биологически активную генно-терапевтическую субстанцию на основе векторной плазмиды pCDNA 3.1(+), содержащую кДНК гена CLCA2 - pCDNA 3.1 CLCA2 SEQ ID No: 1(A), векторную плазмиду pCDNA 3.1(+), не содержащую кДНК гена CLCA2 (В), в качестве контроля - водный раствор дендримеров без плазпрмидной ДНК (С). Приготовление комплекса ДНК-дендример и трансфекцию фибробластов проводили согласно Примеру 7

После трансфекции клетки снимали раствором Версена. Для гомогенизации использовали смесь 100 мг клеток в 1 мл буфера PBS1x, которую подвергали двум этапам заморозки (-20°С на ночь) и разморозки в водяной бане (+37°С). После этого клеточный лизат центрифугировали 5 минут при 5000 × g (+4°С).

Отбирали супернатант и использовали его для количественного определения целевого белка. Количественное определение продукта кДНК гена CLCA2 проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США).

В наборе использованы высоко специфичные антитела к белка хлоридного кальций-активируемого канала-2, адсорбированные на лунках микропланшета. При первой инкубации добавляли по 100 мкл каждого образца и калибраторов в соответствующие лунки, закрывали лунки клейкой пленкой и инкубировали 2 часа при 37°С. (Калибратор готовят следующим образом: прибавляют 1 мл Буфера для разведения образцов к лиофилизированному стандартному образцу, затем делают 2-кратные разведение стандартного образца). Исследование калибраторов и образцов клеточного лизата проводили в трех повторностях. После инкубации жидкость из лунок удаляли, Затем в каждую лунку добавляли 100 мкл связаннных с биотином анитител, закрывали лунки чистой клейкой пленкой и инкубировали 1 час при 37°С. Снимали пленку со стрипов и отбирали всю жидкость, после чего вносили по 200 мкл Промывочного раствора в каждую лунку, через 2 минуты удаляли жидкость. Повторяли промывку 3 раза.

Далее в каждую лунку вносили по 100 мкл раствора фермента Пероксидазы хрена, связанным с авидином, заклеивали планшет чистой пленкой и инкубировали 1 час при 37°С. А затем отбирали жидкость и повторяли промывку 5 раз как описано выше.

Затем в лунки добавили 90 мкл хромогенного субстрата 3,3',5,5'-тетраметилбензидин (3,3',5,5'-Tetramethylbenzidine) и инкубировали плашку 20 минут при 37°С в темноте. После добавляли 50 мкл стоп-реагента (1N H2SO4), тщательно перемешали. Оптическая плотность измерялась при длине волны 450 нм при помощи автоматического биохимического и иммуноферментного анализатора ChemWell (Awareness Technology Inc., США) и пропорциональна концентрации белка CLCA2 в пробе. Численное значение концентрации определяется с помощью калибровочной кривой, построенной по калибраторам с известной концентрацией белка CLCA2, входящим в состав набора. Разница между значениями оптической плотности (ОП) калибраторов поставленных в трех повторностях не превышала 10%.

Статистическую обработку полученных результатов, осуществляли с помощью программного обеспечения для статистической обработки и визуализации данных R, версия 3.0.2 (https://www.r-project.org/).

Таким образом показано, что транфекция фибробластов полученной биологически активной генно-терапевтической субстанцией, несущей кДНК гена CLCA2, приводит к увеличению количества белка хлоридного кальций-активируемого канала-2 в клетках фибробластов.

Пример 9.

Введение в кожу человека клеточной культуры фибробластов, трансфицированной биологически активной генно-терапевтической субстанцией с кДНК гена CLCA2 с целью подтверждения увеличения после этого количества белка хлоридного кальций-активируемого канала-2 в биоптате кожи человека.

С целью анализа изменения количества белка хлоридного кальций-активируемого канала-2 в тканях человека пациентам в кожу предплечья вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- CLCA2 SEQ ID No:7(C) в комбинации с транспортными молекулами - липосомами TRANSFAST ТМ Transfection Reagent (PROMEGA, USA),

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°С, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°С и использовали далее в качестве биологически активной генно-терапевтической субстанции.

Для последующей трансфекции клеток биологически активной генно-терапевтической субстанцией выращивали первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосимы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга.

Определение количества белка хлоридного кальций-активируемого канала-2 оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- CLCA2 SEQ ID No:7, произошло увеличение количества белка хлоридного кальций-активируемого канала-2, что может свидетельствовать об усилении экспрессии гена CLCA2. Тогда как при введении контрольных культур фибробластов (нетрансфицированных и трансфицированных вектором без вставки кДНК гена CLCA2 pCMV6-XL5) количество белка хлоридного кальций-активируемого канала-2 в коже не изменялась.

Таким образом показана эффективность биологически активной генно-терапевтической субстанции, несущей модифицированную кДНК гена CLCA2: трансфекция фибробластов полученной биологически активной генно-терапевтической субстанцией несущей модифицированную кДНК гена CLCA2, приводит к повышению количества белка хлоридного кальций-активируемого канала-2 в клетках фибробластов.

Пример 10.

Трансфекция культур фибробластов из биоптатов группы различных пациентов биологически активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК CLCA2.

С целью подтверждения индивидуального характера увеличения количества белка хлоридного кальций-активируемого канала-2 до различного уровня при трансфекции клеточных культур фибробластов пациентов биологически активными генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена CLCA2 анализировали количественный уровень белка хлоридного кальций-активируемого канала-2 в клеточных лизатах фибробластов, трансфицированных разными биологически активными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные и нативную кДНК CLCA2 в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена CLCA2.

Последовательность нативной кДНК CLCA2 приведена на фигуре 1, SEQ ID No:1., последовательности модифицированных кДНК CLCA2 приведены на фигурах 2-7 (SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в зоне локтевого сустава 28 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень белка хлоридного кальций-активируемого канала-2 в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford М.М. (1976) Anal. Biochem. 72: 248-254.]).

Затем каждую из 28-ти культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:1, содержащей немодифицированную кДНК CLCA2 (SEQ ID No:1.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. Вторую часть, обозначенную (В), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:2, содержащей вариант 1 модифицированной кДНК CLCA2 (SEQ ID No:2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (С), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:3, содержащей вариант 2 модифицированной кДНК CLCA2 (SEQ ID No:3.) по примеру 3 в сочетании с транспортными молекулами - липосомами попримеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:4, содержащей вариант 3 модифицированной кДНК CLCA2 (SEQ ID No:4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:5, содержащей 4 вариант модифицированной кДНК CLCA2 (SEQ ID No:5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:6, содержащей вариант 5 модифицированной кДНК CLCA2 SEQ ID No:6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:7, содержащей вариант 6 модифицированной кДНК CLCA2 (SEQ ID No:7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК CLCA2 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка хлоридного кальций-активируемого канала-2 оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США), как описано в Примере 8.

По итогам определения количества белка хлоридного кальций-активируемого канала-2 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни количества белка хлоридного кальций-активируемого канала-2 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при трансфекции немодифицированной кДНК CLCA2. В эту группу вошло 2 культуры из 28.

В группе 2 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при трансфекции 1 вариантом модифицированной кДНК CLCA2. В эту группу вошло 3 культуры из 28.

В группе 3 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при трансфекции 2 вариантом модифицированной кДНК CLCA2. В эту группу вошло 6 культур из 28.

В группе 4 максимальное количество белка хлоридного кальций-активируемого канала-2 наблюдалось при трансфекции 3 вариантом модифицированной кДНК CLCA2. В эту группу вошло 6 культур из 28.

В группе 5 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при трансфекции 4 вариантом модифицированной кДНК CLCA2. В эту группу вошло 6 культур из 28.

В группе 6 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при трансфекции 5 вариантом модифицированной кДНК CLCA2. В эту группу вошли 3 культуры из 28.

В группе 7 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при трансфекции 6 вариантом модифицированной кДНК CLCA2. В эту группу вошло 2 культуры из 28.

Ни в одной из клеточных культур не наблюдалось того, что при трансфекции вектором, не содержащим кДНК гена CLCA2 количество белка хлоридного кальций-активируемого канала-2 присутствует в максимальных количествах.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентраций белка хлоридного кальций-активируемого канала-2 (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена CLCA2.

Из данного примера следует, что достижение максимального количества белка хлоридного кальций-активируемого канала-2 в культурах фибробластов кожи различных пациентов при их трансфекции биологически активными генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена CLCA2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных биологически активных генно-терапевтических субстанций в рамках линейки биологически активных генно-терапевтических субстанций.

Пример 11.

Трансфекции клеточной культуры кератоцитов и эпителиальных клеток глаза биологически активной генно-терапевтической субстанцией без транспортной молекулы с целью подтверждения при этом увеличения экспрессии гена CLCA2 в данных культурах клеток.

С целью выяснения эффективности биологически активной генно-терапевтической субстанции, содержащей кДНК CLCA2, в различных типах клеток, трансфицировали кератоциты и эпителиальные клетки роговицы человека, без использования транспортных молекул.

Биопсийный материал из области лимба в виде круга диаметром 1-1.5 мм помещали в чашку Петри в сбалансированный солевой раствор Хэнкса, добавляли диспазу (20 мкл 25 ед/мл) и гентамицин и инкубировали 24 часа при +4. Затем отделяли эпителиальный слой от стромы и нарезали обе ткани кусочками 1-2 мм3.

Суспензию эпителиальных клеток получали путем инкубирования кусочков тканей в растворе Трипсин-ЭДТА в течение 15 минут при +37°С. Трипсинизацию останавливали добавлением соевого ингибитора трипсина в PBS. Клеточные суспензии отмывали центрифугированием при 700 об/мин и ресуспендировали в бессывороточной среде DMEM с гентамицином. Клетки растили в 25 см2 флаконах с 5 мл среды при 37°С и в атмосфере, содержащей 5% CO2. Через 24 часа среду с не прикрепившимися клетками удаляли и добавляли 5 мл свежей среды. Пересев производили каждые 7 дней в соотношении 1:2-1:3.

Суспензию кератоцитов получали путем инкубирования в среде RPMI-1640 с коллагеназой 300 ед/мл в течение 2 часов. Затем отмывали клетки и ресуспендировали в среде DMEM с 20% телячьей сывороткой и антибиотиком-антимикотиком. Клетки растили в 25 см2 флаконах с 1 мл среды при +37°С и в атмосфере, содержащей 5% CO2. Пересев производили каждые 7 дней в соотношении 1:4.

Поскольку эффективность трансфекции кератоцитов низкая, использовали биологически активную генно-терапевтическую субстанцию на основе плазмиды pCMV6-Kan/Neo CLCA2 SEQ ID No:2, содержащую дополнительный фактор селекции - ген neor, придающий устойчивость к антибиотику генетицину.

Биологически активную генно-терапевтическую субстанцию добавляли к клеткам и инкубировали клетки 1 час при 37°С. После инкубации добавляли бессывороточную среду DMEM к эпителиальным клеткам и среду DMEM, содержащую 10% фетальной телячьей сыворотки к кератоцитам и продолжали инкубировать 24 часа. После 24-часового инкубирования клетки высевали в новую среду DMEM, содержащую 400 μg/mL фактора селекции - антибиотика G418 (Geneticin). Выжившие клетки культивировали в течение 2 недель в 25 см3 флаконах с 5 мл среды с G418. Всего выращивали 24 образца культур эпителиальных клеток и 24 образца культур кератоцитов.

Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК проводили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена CLCA2 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-RadUSA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение экспрессии (транскрипции) гена CLCA2 наблюдали на 3 сутки для эпителиальных клеток и на 5 сутки - для кератоцитов.

На фигуре 13 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена CLCA2, в кератоцитах и эпителиальных клетках роговицы.

Показано, что в кератоцитах и эпителиальных клетках роговицы человека, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- Kan/Neo CLCA2 SEQ ID No:2, без транспортной молекулы, наблюдается усиление экспрессии целевого гена CLCA2

Пример 12.

Трансфекции клеточной культуры эпителия слизистой оболочки полости рта биологически активной генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена CLCA2 в данных культуре клеток.

С целью выяснения эффективности биологически активной генно-терапевтической субстанции, содержащей кДНК гена CLCA2, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали эпителий слизистой оболочки полости рта человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биоптаты слизистой оболочки полости рта массой 40 мг измельчали на фрагменты до 10 мм3. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37 оС в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37оС в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры клеток эпителия после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 105 клеток.

Для трансфекции клеток биологически активной генно-терапевтической субстанцией содержащей кДНК гена CLCA2 использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci. 2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-N-(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6- Kan/NeoCLCA2 SEQ ID No3 с модифицированной кДНК CLCA2 SEQIDNo3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit(Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК CLCA2 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение транскрипции CLCA2 наблюдали на 4 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена CLCA2.

Показано, что в клетках эпителия слизистой оболочки полости рта трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- Kan/NeoCLCA2 SEQIDNo3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается усиление экспрессии целевого гена CLCA2

Пример 13.

Введение в кожу человека биологически активной генно-терапевтической субстанции с кДНК гена CLCA2 с целью подтверждения при этом увеличения количества белка хлоридного кальций-активируемого канала-2 в коже человека.

С целью анализа изменения количества белка хлоридного кальций-активируемого канала-2 пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена CLCA2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена CLCA2 с транспортной молекулой (А) - в кожу предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию рСМV6 CLCA2 SEQ ID No:4, которая содержит модифицированную кДНК гена CLCA2 (SEQ ID No:4), и плазмиду pCMV6-XL5, используемую в качестве плацебо - которая не содержит кДНК гена CLCA2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Количество белка хлоридного кальций-активируемого канала-2 оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения биологически активной генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее как описано в примере 9.

Показано, что в коже пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена CLCA2, произошло увеличение количества белка хлоридного кальций-активируемого канала-2, тогда как при введении плацебо, количество белка хлоридного кальций-активируемого канала-2 в коже не изменялась, что говорит об усилении экспрессии гена CLCA2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена CLCA2. Результаты отражены на фигуре 15.

Пример 14.

Введение в слизистую оболочку рта человека биологически активной генно-терапевтической субстанции с кДНК гена CLCA2 с целью подтверждения при этом увеличения количества белка хлоридного кальций-активируемого канала-2 в слизистой оболочке рта человека.

С целью анализа изменения количества белка хлоридного кальций-активируемого канала-2 пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена CLCA2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена CLCA2 с транспортной молекулой (А) - в слизистую оболочку рта.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCDNA 3.1CLCA2 SEQ ID No5, которая содержит модифицированную кДНК гена CLCA2 (SEQIDNo5), и плазмиду pCDNA 3.1(+), используемую в качестве плацебо, которая не содержит кДНК гена CLCA2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1-2 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 2-4 см друг от друга.

Количество белка хлоридного кальций-активируемого канала-2 оценивали в лизатах биоптатов слизистой оболочки рта пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков слизистой оболочки рта в зоне введения биологически активной генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL), далее по примеру 9.

Показано, что в слизистой оболочке рта пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена CLCA2, произошло увеличение количества белка хлоридного кальций-активируемого канала-2, тогда как при введении плацебо количество белка хлоридного кальций-активируемого канала-2 в слизистой оболочке рта не изменялась, что подтверждает усиление экспрессии гена CLCA2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена CLCA2. Результаты отражены на фигуре 16.

Пример 15.

Введение в мышечную ткань человека биологически активной генно-терапевтической субстанции с кДНК гена CLCA2 с целью подтверждения при этом увеличения количества белка хлоридного кальций-активируемого канала-2 в мышечной ткани человека.

С целью анализа изменения количества белка хлоридного кальций-активируемого канала-2 пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена CLCA2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена CLCA2 с транспортной молекулой (А) - в мышечную ткань икроножной мышцы.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo CLCA2 SEQ ID No:6, которая содержит модифицированную кДНК гена CLCA2 (SEQ ID No:6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена CLCA2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга

Количество белка хлоридного кальций-активируемого канала-2 оценивали в лизатах биоптатов мышечной ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения биологически активной генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компания BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена CLCA2, произошло увеличение количества белка хлоридного кальций-активируемого канала-2, тогда как при введении плацебо количество белка хлоридного кальций-активируемого канала-2 в мышечной ткани не изменялась, что подтверждает усиление экспрессии гена CLCA2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена CLCA2. Результаты отражены на фигуре 17.

Пример 16.

Введение группе различных пациентов биологически активных генно-терапевтическиих субстанций содержащих модифицированные и нативную кДНК CLCA2.

С целью подтверждения индивидуального характера увеличения количества белка хлоридного кальций-активируемого канала-2 до различного уровня при введении в кожу пациентов биологически активных генно-терапевтических субстанций с модифицированными и нативной кДНК гена CLCA2 анализировали количественный уровень белка хлоридного кальций-активируемого канала-2 в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена CLCA2.

Последовательность нативной кДНК CLCA2 приведена на фигуре 1, SEQ CLCA2 ID No:1., последовательности модифицированных кДНК CLCA2 приведены на фигурах 2-7 (CLCA2 SEQ ID No:2, CLCA2 SEQ ID No:3, CLCA2 SEQ ID No:4, CLCA2 SEQ ID No:5, CLCA2 SEQ ID No:6, CLCA2 SEQ ID No:7).

При этом генетические конструкции, одна из которых содержит нативную кДНК гена CLCA2 (SEQ ID No:1), вторая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:2), третья генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:3), четвертая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:4), пятая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:5), шестая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID NO:6), седьмая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов биологически активных генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой биологически активной генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения биологически активных генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 24-х пациентов, отобранных в случайном порядке, вводили 7 биологически активных генно-терапевтических субстанций и плацебо в кожу предплечья.

Биопсийные образцы брали через 72 часа после введения биологически активных генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения биологически активных генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

А - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:1, содержащий немодифицированную кДНК CLCA2(SEQ ID No:1.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

В - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:2, содержащий немодифицированную кДНК CLCA2(SEQ ID No:2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

С - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:3, содержащий немодифицированную кДНК CLCA2(SEQ ID No:3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

D - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:4, содержащий немодифицированную кДНК CLCA2(SEQ ID No:4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Е - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:5, содержащий немодифицированную кДНК CLCA2(SEQ ID No:5) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

F - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:6, содержащий немодифицированную кДНК CLCA2(SEQ ID No:6) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

G - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:7, содержащий немодифицированную кДНК CLCA2(SEQ ID No:7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащая кДНК гена CLCA2 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Количества белка хлоридного кальций-активируемого канала-2 оценивали в девяти биоптатах кожи от каждого пациента (от А до Н и в биоптате интактной кожи) через 72 часа после введения биологически активных генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США), как описано в Примере 8.

По итогам количественного анализа белка хлоридного кальций-активируемого канала-2 выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни количества белка хлоридного кальций-активируемого канала-2 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при введении немодифицированной кДНК CLCA2. В эту группу вошли 3 биоптата из 24.

В группе 2 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при введении 1 варианта модифицированной кДНК CLCA2. В эту группу вошли 2 биоптата из 24.

В группе 3 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при введении 2 варианта модифицированной кДНК CLCA2. В эту группу вошли 3 биоптата из 24.

В группе 4 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при введении 3 варианта модифицированной кДНК CLCA2. В эту группу вошли 4 биоптата из 24.

В группе 5 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при введении 4 варианта модифицированной кДНК CLCA2. В эту группу вошли 3 биоптата из 24.

В группе 6 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при введении 5 варианта модифицированной кДНК CLCA2. В эту группу вошли 3 биоптата из 24.

В группе 7 максимальное количество белка хлоридного кальций-активируемого канала-2, наблюдалось при введении 6 варианта модифицированной кДНК CLCA2. В эту группу вошло 6 биоптатов из 24.

Ни в одном из биоптатов не наблюдалось того, что при введении плацебо - векторной плазмиды, не содержащей кДНК гена CLCA2 количество белка хлоридного кальций-активируемого канала-2, присутствует в максимальных количествах.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена CLCA2.

Из данного примера следует, что достижение максимального количества белка хлоридного кальций-активируемого канала-2 в биоптатах кожи различных пациентов при введении им в кожу биологически активных генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена CLCA2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных биологически активных генно-терапевтических субстанций в рамках линейки биологически активных генно-терапевтических субстанций.

Пример 17.

Трансфекция клеточной линии фибробластов пациента разными биологически активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК CLCA2 с целью персонализированного выбора из линейки биологически активных генно-терапевтических субстанций наиболее эффективной биологически активной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка хлоридного кальций-активируемого канала-2 в клеточных лизатах фибробластов этого пациента, трансфицированных разными биологически активными генно-терапевтическими субстанциями, содержащими нативную или модифицированные кДНК CLCA2.

Последовательность нативной кДНК CLCA2 приведена на фигуре 1, SEQ ID No:1., последовательности модифицированных кДНК CLCA2 приведены на фигурах 2-7 (SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID NO:6, SEQ ID No:7).

Вырастили культуры фибробластов из биоптата пациента по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Затем культуру фибробластов пациента разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:1, содержащей немодифицированную кДНК CLCA2 (SEQ ID No:1.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. Вторую часть, обозначенную (В), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:2, содержащей вариант 1 модифицированной кДНК CLCA2 (SEQ ID No:2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (С), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:3, содержащей вариант 2 модифицированной кДНК CLCA2 (SEQ ID No:3.) по примеру 3 в сочетании с транспортными молекулами - липосомами попримеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:4, содержащей вариант 3 модифицированной кДНК CLCA2 (SEQ ID No:4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:5, содержащей 4 вариант модифицированной кДНК CLCA2 (SEQ ID No:5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:6, содержащей вариант 5 модифицированной кДНК CLCA2 SEQ ID No:6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:7, содержащей вариант 6 модифицированной кДНК CLCA2 (SEQ ID No:7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК CLCA2 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка хлоридного кальций-активируемого канала-2 в клеточных лизатах фибробластов пациента проводили через 72 часа после трансфекции методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США), как описано в Примере 8.

По итогам определения количества белка хлоридного кальций-активируемого канала-2 в культуре фибробластов пациента выделили вариант биологически активной генно-терапевтической субстанции, при трансфекции которой наблюдается максимальное количество белка хлоридного кальций-активируемого канала-2 в лизате клеточной культуры и соответственно наблюдается максимальная экспрессия гена CLCA2. В данном эксперименте максимальное количество белка хлоридного кальций-активируемого канала-2 в лизате отмечено при трансфекции биологически активной генно-терапевтической субстанцией на базе pCMV6 CLCA2 SEQ ID No:3, содержащей модифицированную кДНК CLCA2, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18.

Введение в кожу пациента различных биологически активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена CLCA2 с персонализированного целью выбора из линейки биологически активных генно-терапевтических субстанций наиболее эффективной биологически активной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка хлоридного кальций-активируемого канала-2 в лизатах биоптатов кожи этого пациента, после введения ему в кожу биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена CLCA2.

Последовательность нативной кДНК CLCA2 приведена на фигуре 1, SEQ ID No:1., последовательности модифицированных кДНК CLCA2 приведены на фигурах 2-7 (SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID NO:6, SEQ ID No:7)

Пациенту вводили 7 биологически активных генно-терапевтических субстанций и плацебо в кожу предплечья.

Первая биологически активная генно-терапевтическоая субстанция(А) на базе pCMV6- SEQ ID No:1, содержащая немодифицированную кДНК CLCA2 (SEQ ID No:1.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая биологически активная генно-терапевтическая субстанция (В) на базе pCMV6- SEQ ID No:2, содержащая вариант 1 модифицированной кДНК CLCA2 (SEQ ID No:2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

3-я биологически активная генно-терапевтическая субстанция (С) на базе pCMV6- SEQ ID No:3, содержащая вариант 2 модифицированной кДНК CLCA2 (SEQ ID No:3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

4-я биологически активная генно-терапевтическая субстанция (D) на базе pCMV6- SEQ ID No:4, содержащая вариант 3 модифицированной кДНК CLCA2 (SEQ ID No:4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

5-я биологически активная генно-терапевтическая субстанция (Е) на базе pCMV6- SEQ ID No:5, содержащая 4 вариант модифицированной кДНК CLCA2 (SEQ ID No:5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

6-я биологически активная генно-терапевтическая субстанция (F) на базе pCMV6- SEQ ID No:6, содержащая вариант 5 модифицированной кДНК CLCA2 SEQ ID No:6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

7-я биологически активная генно-терапевтическая субстанция (G) на базе pCMV6- SEQ ID No:7, содержащая вариант 6 модифицированной кДНК CLCA2 (SEQ ID No:7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

8-я - векторная плазмида pCMV6-XL5, не содержащая кДНК CLCA2 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит нативную кДНК гена CLCA2 (SEQ ID No:1), вторая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:2), третья генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:3), четвертая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:4), пятая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:5), шестая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:6), седьмая генетическая конструкция содержит модифицированную кДНК гена CLCA2 (SEQ ID No:7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов биологически активных генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой биологически активной генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения биологически активных генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения биологически активных генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения биологически активных генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Определение количества белка хлоридного кальций-активируемого канала-2 определяли в девяти биоптатах кожи пациента через 72 часа после введения биологически активных генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Chloride Channel Accessory 2 (CLCA2) ELISA Kit (Antibodies-online, США), как описано в Примере 8.

По итогам определения количества белка хлоридного кальций-активируемого канала-2 в лизате биоптатов кожи пациента выделили вариант биологически активной генно-терапевтической субстанции, при введении которой в кожу наблюдается максимальное количество белка хлоридного кальций-активируемого канала-2 в лизате биоптата кожи и соответственно наблюдается максимальная экспрессия гена CLCA2. В данном эксперименте максимальное количество целевого белка в лизате биоптата кожи отмечено при введении биологически активной генно-терапевтической субстанции на базе pCMV6 CLCA2 SEQ ID No:6, содержащей модифицированную кДНК CLCA2, что показано на фигуре 20.

Таким образом выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создана линейка биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, вследствие недостаточной экспрессии гена CLCA2, способ ее получения и использования.

Созданная линейка биологически активных генно-терапевтических субстанций с использованием одной из модифицированных или нативной кДНК гена CLCA2 позволяет на практике использовать входящие в линейку биологически активные генно-терапевтические субстанции для повышения до необходимого уровня количества белка хлоридного кальций-активируемого канала-2 в различных клетках органов и тканей и/или органах и тканях человека.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант биологически активной генно-терапевтической субстанции из созданной линейки биологически активных генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить количество белка хлоридного кальций-активируемого канала-2 в клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование биологически активной генно-терапевтической субстанции с нативной кДНК гена CLCA2 не приводит к желаемому изменению уровня количества белка хлоридного кальций-активируемого канала-2 в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена CLCA2, приводящей к более эффективной экспрессии гена CLCA2.

При использовании заявленной биологически активной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Линейка биологически активных генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена CLCA2, повышая количество белка хлоридного кальций-активируемого канала-2 в клетках органов и тканей и/или органах и тканях человека в частности, клетках эпидермиса, в частности кератиноцитах, фибробластах, в клетках слизистой оболочки, жировой ткани, в частности в адипоцитах, клетках эпителия, клетках эндотелия, клетках молочной железы, клетках легочной и плацентарной ткани, клетках костного мозга, в частности в стволовых клетках, в клетках лимфотических узлов, семенников, гепатоцитах в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, коже, мочевом пузыре, миндалинах, влагалище, матке, шейке матки, костном мозге, молочных железах, трахее, легких, толстом кишечнике, прямой кишке, тонком кишечнике, пищеводе, гортани, глазах, в роговице, зрительном волокне, лимфатических узлах, предстательной железе, семенниках, почках, мочевом пузыре, языке, печени и в слизистой оболочке пищевода, слизистой оболочке полости рта, жировой ткани, легочной ткани, плацентарной ткани, ретикулярной соединительной ткани, в эндотелии мелких легочных артерий, артериол, междольковых и субплевральных венулах в сочетании с транспортной молекулой или без нее при введении этих биологически активных генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание линейки биологически активных генно-терапевтических субстанций, при использовании которых применительно к клеткам органов и тканей и/или органам и тканям человека компенсируются дефекты гена CLCA2, влияющие на экспрессию этого гена или на количественный уровень белка хлоридного кальций-активируемого канала-2, кодируемого этим геном, а также компенсируется недостаточное количество белка хлоридного кальций-активируемого канала-2, вызванная факторами, влияющими на экспрессию гена CLCA2.

Повышение эффективности коррекции количественного уровня белка хлоридного кальций-активируемого канала-2 в клетках органов и тканей человека достигают за счет того, что при недостаточном количестве этого белка вследствие дефекта гена CLCA2 используют не белок, а генетическую конструкцию с кДНК гена CLCA2, кодирующую этот белок. При введении генетических конструкций в отличие от введения непосредственно белка, как в прототипе, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Промышленная применимость.

Все приведенные примеры по созданию и использованию созданной линейки биологически активных генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр, мкл - микролитр

л - литр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е. ф-относительная единица флуоресценции

БАГТС - биологически активная генно-терапевтическая субстанция

1. Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, клеток эпителия слизистой оболочки полости рта; органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани человека, представляющее собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CLCA2 с кодирующей последовательностью белка хлоридного кальций-активируемого канала-2, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена CLCA2 SEQ ID No: 1, или модифицированной кДНК гена CLCA2, при этом в качестве модифицированной кДНК гена CLCA2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в клетках органов и тканей человека и способную обеспечить высокий уровень экспрессии гена CLCA2 и увеличить количество белка хлоридного кальций-активируемого канала-2 в клетках органов и тканей и/или органах и тканях человека, в сочетании с транспортной молекулой или без нее.

2. Средство по п. 1, отличающееся тем, что каждая из совокупности созданных генетических конструкций с кДНК гена CLCA2 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена CLCA2, которая несет модификации, не затрагивающие структуру белка хлоридного кальций-активируемого канала-2, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

3. Средство по п. 1, отличающееся тем, что в каждой из совокупности созданных биологически активных генно-терапевтических субстанций в качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколения, или амфифильные блок-сополимеры.

4. Способ получения средства по п. 1, заключающийся в том, что получают кДНК гена CLCA2, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена CLCA2 SEQ ID No: 1, или кДНК гена CLCA2 SEQ ID No: 2, или кДНК гена CLCA2 SEQ ID No: 3, или кДНК гена CLCA2 SEQ ID No: 4, или кДНК гена CLCA2 SEQ ID No: 5, или кДНК гена CLCA2 SEQ ID No: 6, или кДНК гена CLCA2 SEQ ID No: 7.

5. Способ использования средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка CLCA2 по п. 1, заключающийся в трансфекции выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в совокупности биологически активных генно-терапевтических субстанций в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из совокупности созданных генно-терапевтических субстанций, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/выбранных из группы созданных генно-терапевтических субстанций, или сочетанием обозначенных способов.



 

Похожие патенты:

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена TGFB1, связанных с количественным снижением белка трансформирующего фактора роста бета-1, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена TGFB1, с кодирующей последовательностью белка трансформирующего фактора роста бета-1, с делециями 5' и 3'-нетранслируемых областей, и содержащей также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена GPX3, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, причем каждая из совокупности биологически активных генно-терапевтических субстанций представляет собой генетическую конструкцию на основе векторной плазмиды, включающую участок кДНК гена GPX3 и содержащую также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, а именно в клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена SOD2, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена SOD2, с кодирующей последовательностью белка супероксиддисмутазы-1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена SOD2 SEQ ID No: 1, или модифицированной кДНК гена SOD2, при этом в качестве модифицированной кДНК гена SOD2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, органов и тканей человека, в сочетании с транспортной молекулой или без нее.

Изобретение относится к области биохимии, в частности к нуклеиновой кислоте, кодирующей белок слияния из многих субъединиц гликолатдегидрогеназы, а также трансгенной клетке растения, трансгенному растению и трансгенному семени, содержащим вышеуказанную нуклеиновую кислоту.

Изобретение относится к биотехнологии. Описана молекула нуклеиновой кислоты, содержащая двухцепочечную структуру,где двухцепочечная структура образована первой цепью и второй цепью, где первая цепь состоит из следующей нуклеотидной последовательности:5'-acGaGcUgGaCcAcUgGuCdTSdT-3' и вторая цепь состоит из следующей нуклеотидной последовательности:5'-GAcCaGuGgUcCaGcUcGudTSdT-3', где то, что нуклеотид указан строчной буквой, указывает на то, что нуклеотид является 2'-F-модифицированным, и подчеркивание нуклеотида указывает на то, что нуклеотид является 2'-O-метил-модифицированным и где dTSdT указывает на то, что на 3'-конце присоединен динуклеотид, состоящий из двух нуклеотидов dT, где указанные два dT ковалентно связаны посредством фосфотиоатной связи.

Настоящее изобретение относится к биохимии, генной инженерии и биотехнологии, в частности к новым полипептидам с антимикробной активностью в отношении энтерогеморрагических бактерий вида Escherichia coli.

Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 55-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 14-го – 34-го или 15-го – 34-го нуклеотидов, считая от 5'-конца 55-го экзона гена дистрофина человека.

Изобретение относится к области биохимии и молекулярно-генетической диагностики, в частности к способу выявления у субъекта предрасположенности к развитию панического расстройства.
Изобретение относится к области биохимии. Предложен набор реактивов для выделения ДНК из биологических объектов.

Изобретение относится к области биотехнологии. Предложены кольцевой двухцепочечный полинуклеотид для интеграции экзогенной нуклеиновой кислоты в геном клетки и способ интеграции экзогенной последовательности нуклеиновой кислоты в эндогенный локус клетки.

Изобретение относится к новому кристаллическому материалу в одной кристаллической фазе, представляющему собой многокомпонентный сокристалл (a) гидрохлорида нилотиниба и (b) компонента, выбранного из фумаровой кислоты, малеиновой кислоты, янтарной кислоты, гентизиновой кислоты, метилового эфира галловой кислоты и изоникотинамида, или (a) нилотиниба, гидрохлорида нилотиниба или смеси нилотиниба и гидрохлорида нилотиниба и (b) компонента, выбранного из 1,5-нафталиндисульфоновой кислоты.

Изобретение относится к новым соединениям в ряду 1,2,3-замещенных солей бензимидазолия, а именно к бромидам 1,2,3-три и 1,2,3,5-замещенных бензимидазолия общей формулы I .Технический результат: получены новые соединения, обладающие ингибиторными свойствами в отношении протеин-тирозинфосфатазы типа 1B (РТР1В), которые могут быть использованы для борьбы с PTP1B-опосредованными заболеваниями.

Группа изобретений относится к биотехнологии, в частности к иммунологии, и может быть использована для получения рекомбинантного моноклонального биспецифического антитела против CD3*CD19.

Изобретение относится к биотехнологии. Описана молекула нуклеиновой кислоты, содержащая двухцепочечную структуру,где двухцепочечная структура образована первой цепью и второй цепью, где первая цепь состоит из следующей нуклеотидной последовательности:5'-acGaGcUgGaCcAcUgGuCdTSdT-3' и вторая цепь состоит из следующей нуклеотидной последовательности:5'-GAcCaGuGgUcCaGcUcGudTSdT-3', где то, что нуклеотид указан строчной буквой, указывает на то, что нуклеотид является 2'-F-модифицированным, и подчеркивание нуклеотида указывает на то, что нуклеотид является 2'-O-метил-модифицированным и где dTSdT указывает на то, что на 3'-конце присоединен динуклеотид, состоящий из двух нуклеотидов dT, где указанные два dT ковалентно связаны посредством фосфотиоатной связи.

Настоящая группа изобретений относится к медицине, а именно к онкологии, и касается лечения рака. Для этого идентифицируют опухоли, чувствительные к лечению акситинибом.

Группа изобретений относится к области медицины, а именно к фармацевтической комбинации, включающей: соединение (S)-пирролидин-1,2-дикарбоновой кислоты 2-амид 1-({4-метил-5-[2-(2,2,2-трифтор-1,1-диметилэтил)пиридин-4-ил]тиазол-2-ил}амид) или его фармацевтически приемлемую соль, и по меньшей мере один ингибитор ароматазы, выбранный из летрозола или экземестана, или его фармацевтически приемлемую соль для одновременного, раздельного или последовательного применения для лечения рака; а также к применению комбинации для лечения рака; к способу лечения рака; к набору и синергетической комбинации.

Изобретение раскрывает новые соединения замещенных пиразолонов формулы (I) и их фармацевтически приемлемые соли, которые ингибируют активность протеин тирозинкиназы и модулируют клеточную активность, например быстрое увеличение, дифференцирование, апоптоз, миграцию и инвазию.

Настоящее изобретение относится к биотехнологии и медицине, в частности к моноклональному антителу, которое специфично связывается с CEACAM1 человека. Настоящее изобретение также раскрывает полинуклеотид, кодирующий указанное антитело, плазмиду для его продукции, фармацевтическую и диагностическую композиции для лечения злокачественного новообразования, характеризующегося сверхэкспрессией CEACAM1, и для детекции CEACAM1 человека у индивидуума соответственно.

Изобретение относится к области биотехнологии, конкретно к получению вектора экспрессии, содержащего (а) нуклеотидную последовательность С68 и (б) мультиантигенную конструкцию ДНК, кодирующую иммуногенные полипептиды простатоассоциированных антигенов (РАА), что может быть использовано в медицине.

Изобретение относится к области иммунологии. Предложено одноцепочечное антитело к раково-эмбриональному антигену, а также включающий его химерный мономолекулярный Т-клеточный рецептор, вектор и клетка-хозяин для получения химерного мономолекулярного Т-клеточного рецептора.

Изобретение относится к медицине и предназначено для лечения миелодиспластического синдрома (МДС), где МДС выбирают из подгруппы МДС с низким риском по IPSS и/или подгруппы МДС с промежуточным-1 (int-1) риском. Используется ингибитор сигнального пути CD95, который связывает CD95-рецептор (CD95) и/или CD95-лиганд (CD95L). Способ позволяет расширить арсенал терапевтических средств. 17 з.п. ф-лы, 13 ил.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей иили органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, клеток эпителия слизистой оболочки полости рта; органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CLCA2 с кодирующей последовательностью белка хлоридного кальций-активируемого канала-2, с делециями 5 и 3-нетранслируемых областей, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для коррекции патологических состояний клеток органов и тканей иили органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка CLCA2. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 20 ил., 18 пр.

Наверх