Линейка биологически активных генно-терапевтических субстанций на основе гена tgfbr2 для коррекции патологических состояний клеток органов и тканей и органов и тканей человека, способ получения и использования

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена TGFBR2, связанных с количественным снижением белка TGFBR2, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генотерапевтическую субстанцию, выбранную из группы генотерапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена TGFBR2, с кодирующей последовательностью белка TGFBR2, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена TGFBR2, связанных с количественным снижением белка TGFBR2. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и может быть использовано для коррекции патологических состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с количественным снижением белка рецептора II типа трансформирующего фактора роста бетта, в частности, в терапевтических целях.

Предшествующий уровень.

Факторы роста - полипептиды с молекулярной массой 5-50 кДа, объединенные в группу трофических регуляторных субстанций. Подобно гормонам, эти факторы обладают широким спектром биологического действия на многие клетки - стимулируют или ингибируют митогенез, хемотаксис, дифференцировку. В отличие от гормонов, факторы роста, как правило, продуцируются неспециализированными клетками, находящимися во всех тканях, и обладают эндокринным, паракринным и аутокринным действием.

К факторам роста относятся белки семейства трансформирующих факторов роста, которое включает группу гомологичных гетеродимерных белков из 3х изоформ у млекопитающих. Так основной изоформой, секретируемой клетками иммунной системы, является продукт гена TGFB1 - трансформирующий фактор роста β1. Это полифункциональный цитокин, участвующий в регуляции процессов пролиферации, дифференцировки, миграции и апоптоза, а также ряда метаболических реакций в различных клетках-мишенях. В сущности, каждая клетка организма, включая эпителиальные, эндотелиальные, нервные и соединительно-тканные клетки, продуцирует трансформирующий фактор роста β1 и рецепторы к нему. Белок также продуцируется активированными T-лимфоцитами и макрофагами, тромбоцитами, почками, плацентой. Полагают, что этот белок является цитокином системного действия, поскольку он и его специфические рецепторы выявлены практически во всех типах клеток.

Белок рецептора 2 трансформирующего фактора роста β, кодируемый геном TGFBR2, является важным компонентом сигнального пути трансформирующего фактора роста β. (Massague др., 2005; Фэн и Derynck, 2005). Трансмембранный белок гена TGFBR2 имеет протеинкиназный домен и формирует гетеродимерный комплекс с белком другого рецептора гена TGFBR1, а также связывает трансформирующий фактор роста β1. В частности было показано, что эти активированные белки-рецепторы трансформирующего фактора роста β фосфорилируют специфические сигнальные эффекторы, белки Smad2 и Smad3, вызывая их связывание с опухолевым супрессором Smad4. Образующиеся комплексы транслоцируются из цитоплазмы в ядро, где они регулируют транскрипцию специфических генов, ответственных за клеточную пролиферацию, в частности, ингибиторов циклин-зависимых киназ - ферментов, которые участвуют в смене фаз клеточного цикла; регулируют транскрипцию и процессинг мРНК. Таким образом, ген TGFBR2 известен как ген-супрессор опухоли.

В заявке 2011110736 на патент на изобретение в РФ описан способ лечения индивидуума, имеющего множественную миелому, включающий в себя введение указанному индивидууму изолированных остеогенных плацентарных адгезивных клеток (ОРАС). Введение заметно снижает развитие одного или более симптомов указанной множественной миеломы (боли в костях, остеоцитные повреждения, анемию или почечную недостаточность), останавливает их развитие или улучшает их. Указанные клетки экспрессируют один или более генов (в т.ч. TGFB3, TGFBR1 и/или TGFBR2 - трансформирующий фактор роста бетта, рецептор 2) на заметно более высоком уровне, чем эквивалентное количество CD200+ - адгезивных плацентарных стволовых клеток, при этом уровень экспрессии оценивается с помощью количественной ПЦР в режиме реального времени. А также клетки ОРАС экспрессирует один или более генов (в т.ч. TGFB3, TGFBR1 и/или TGFBR2) на заметно более высоком уровне, чем эквивалентное количество полученных из костного мозга мезенхимальных стволовых клеток, или экспрессируют один или более генов (в т.ч. TGFB1, TGFB2, TGFB3, TGFBR1) на заметно более высоком уровне, чем эквивалентное количество клеток фибробластов, и где указанные клетки фибробластов подвергались эквивалентному количеству пассажей.

За прототип авторами было принято решение по патенту US 6291237, в котором показано генно-терапевтическое средство на основе нового полинуклеотида, кодирующего мутантную форму белка рецептора 2 трансформирующего фактора роста β. Нуклеотидная последовательность содержит по меньшей мере одну мутацию (GT вставка или делеция 1-2 A из poly A или замена G на A). Она была встроена в экспрессионный вектор Методы для детекции инактивированного белка рецептора 2 трансформирующего фактора роста бетта предложены для использования в диагностике рака. Недостатком данного подхода является то, что внесение модификаций в аминокислотную последовательность природного белка может привести к образованию структур, являющихся антигенными детерминантами. Также при создании генно-терапевтического средства в этом изобретении не учитывается индивидуальные характеристики пациента, в связи с чем может понадобиться линейка вариаций для данного средства.

Раскрытие изобретения

Задачей данного изобретения является создание линейки высокоэффективных биологически активных генно-терапевтических субстанций для коррекции патологических состояний организма человека способных препятствовать количественному снижению белка рецептора II типа трансформирующего фактора роста бетта в клетках органов и тканей и/или органах и тканях человека путем повышения уровня экспрессии гена TGFBR2 в клетках органов и тканей и/или органах и тканях человека, приводящего к повышению количества белка рецептора II типа трансформирующего фактора роста бетта, в клетках органов и тканей и/или органах и тканях организма с учетом индивидуальных особенностей пациента.

Задача решается за счет того, что создана линейка биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка рецептора II типа трансформирующего фактора роста бетта, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена TGFBR2 SEQ ID NO: 1 или одну из модифицированных кДНК гена TGFBR2, и содержащей также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, в частности в клетках органов и тканей человека и способную обеспечить высокий уровень экспрессии гена TGFBR2 и увеличить количество белка рецептора II типа трансформирующего фактора роста бетта в клетках органов и тканей и/или органах и тканях человека, в частности, в лейкоцитах, или T-лимфоцитах (хелперах), или В-лимфоцитах, или моноцитах, или тромбоцитах, или мононуклеарных клетках периферической крови, или остеобластах, или остеоцитах, или хондробластах, или хондроцитах, или HK-клетках (натуральных киллерах), или адипоцитах, или миоцитах, или гладкомышечных клетках, или клетках эпителия, или клетках эндотелия, или нейронах в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в костном мозге, или коре головного мозга, или слюнных железах, или поджелудочной железе, или желудке, или тонком кишечнике, или двенадцатиперстной кишке, или толстом кишечнике, или селезенке, или бронхах, или лимфатических узлах, или молочных железах, или коже, или гладких мышцах, или сердечной мышце, или скелетных мышцах, или миндалинах, или почках, или надпочечниках, или щитовидной железе, или мочевом пузыре, или предстательной железе, или плаценте, или фаллопиевых трубах, или яичниках, или семенниках, или шейке матки, или глазе или, или его роговице и склере, или зубах, или в костной, хрящевой, мышечной, эпителиальной, эндотелиальной, нервной, жировой тканях, или эндометрии матки, или плацентарной ткани, или твердой мозговой оболочке, или крови, или дентине, или легочной ткани в сочетании с транспортной молекулой или без нее при введении этих биологически активных генно-терапевтических субстанций в органы и ткани человека. Каждая биологически активная генно-терапевтическая субстанция из созданной линейки представляет генетическую конструкцию с кДНК гена TGFBR2, которая содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена TGFBR2, которая несет модификации не затрагивающие структуру белка рецептора II тира трансформирующего фактора роста бетта, а именно: делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность. В качестве модифицированной кДНК гена TGFBR2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7. В качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры.

Способ получения биологически активной генно-терапевтической субстанции для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка рецептора II типа трансформирующего фактора роста бетта заключается в том, что получают кДНК гена TGFBR2, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека.

Или способ получения биологически активной генно-терапевтической субстанции для коррекции патологических состояний клеток различных органов и тканей человека, связанных с количественным снижением белка рецептора II типа трансформирующего фактора роста бетта заключается в том, что получают кДНК гена TGFBR2, модифицируют его по п.п. 3, или 4, или 5 или 6 или 7 или 8, затем помещают модифицированную кДНК в векторную конструкцию, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека.

Способ использования каждой из созданных и представленных в линейке биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка рецептора II типа трансформирующего фактора роста бетта, заключается в трансфекции созданной биологически активной генно-терапевтической субстанцией, выбранной с учетом индивидуальных особенностей каждого конкретного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, клеток органов и тканей человека.

Или способ использования каждой из созданных и представленных в линейке биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с количественным снижением белка рецептора II типа трансформирующего фактора роста бетта, заключается во введении одной из созданных биологически активных генно-терапевтической субстанций, выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, в органы и ткани этого пациента, и/или во введении аутологичных клеток пациента, трансфицированных одной из созданных биологически активных генно-терапевтической субстанций, выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, в органы и ткани этого пациента.

Перечень фигур

На фиг. 1

Представлена нуклеотидная последовательность немодифицированной кДНК гена TGFBR2, последовательность которой идентична приводимой в базе данных GenBank под номером NM_001024847.2 TGFBR2 SEQ ID No: 1.

На фиг. 2

Представлена нуклеотидная последовательность модифицированной кДНК гена TGFBR2, SEQ ID No: 2, которая

содержит 3 нуклеотидных замены G→C в позициях 436, 475, 1075; 1 нуклеотидную замену T→G в позиции 439, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта.

На фиг. 3

Представлена нуклеотидная последовательность модифицированной кДНК гена TGFBR2, SEQ ID No: 3, которая

содержит 6 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384; 1 нуклеотидную замену T→G в позиции 439, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта.

На фиг. 4

Представлена нуклеотидная последовательность модифицированной кДНК гена TGFBR2, SEQ ID No: 4, которая

содержит 8 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384, 1402, 1471; 1 нуклеотидную замену T→G в позиции 439, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта.

На фиг. 5

Представлена нуклеотидная последовательность модифицированной кДНК гена TGFBR2, SEQ ID No: 5, которая

содержит 9 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384, 1402, 1471, 2101; 2 нуклеотидных замены T→G в позициях 439, 1666; 2 нуклеотидных замены A→G в позициях 1942, 1948, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта.

На фиг. 6

Представлена нуклеотидная последовательность модифицированной кДНК гена TGFBR2, SEQ ID No: 6, которая

содержит 11 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384, 1402, 1471, 2005, 2101, 2116; 3 нуклеотидных замены T→G в позициях 439, 1666, 2041; 2 нуклеотидных замены A→G в позициях 1942, 1948, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта.

На фиг. 7

Представлена нуклеотидная последовательность модифицированной кДНК гена TGFBR2, SEQ ID No: 7, которая

не содержит нетранслируемые 5' и 3' области гена и содержит 11 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384, 1402, 1471, 2005, 2101, 2116; 3 нуклеотидных замены T→G в позициях 439, 1666, 2041; 2 нуклеотидных замены A→G в позициях 1942, 1948, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта.

На фиг. 8

С целью последующего корректного определения генно-терапевтического эффекта после трансфекцей фибробластов биологически активной генно-терапевтической субстанцией с кДНК гена TGFBR2 проводили анализ эндогенной экспрессии гена TGFBR2 в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена TGFBR2, фибробласты со сниженной экспрессией гена TGFBR2

2 - кДНК гена TGFBR2, фибробласты с нормальной экспрессией гена TGFBR2

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена TGFBR2

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена TGFBR2

В качестве референтного гена использовали ген В2М (Бетта-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

На фиг. 9

С целью подтверждения увеличения экспрессии гена TGFBR2 в клеточной культуре фибробластов со сниженной экспрессией гена TGFBR2 при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена TGFBR2 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена TGFBR2 в фибробластах с нормальной экспрессией гена TGFBR2,

2 - кДНК гена TGFBR2 в фибробластах со сниженной экспрессией гена TGFBR2 до трансфекции БАГТС с кДНК гена TGFBR2

3 - кДНК гена TGFBR2 в фибробластах со сниженной экспрессией гена TGFBR2 после трансфекции БАГТС с кДНК гена TGFBR2

4 - кДНК гена TGFBR2 в фибробластах со сниженной экспрессией гена TGFBR2 после трансфекции вектором без кДНК гена TGFBR2

5 - кДНК гена В2М в фибробластах с нормальной экспрессией гена TGFBR2,

6 - кДНК гена В2М в фибробластах со сниженной экспрессией гена TGFBR2 до трансфекции БАГТС с кДНК гена TGFBR2

7 - кДНК гена В2М в фибробластах со сниженной экспрессией гена TGFBR2 после трансфекции БАГТС с кДНК гена TGFBR2

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена TGFBR2 после трансфекции вектором без кДНК гена TGFBR2

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена TGFBR2 уровень кДНК гена TGFBR2 в фибробластах не изменился, а в случае трансфекции вектором с кДНК TGFBR2 - уровень кДНК фибробластов со сниженной экспрессией гена TGFBR2 многократно увеличился (до уровня выше, чем уровень кДНК гена TGFBR2 в нормальных фибробластах).

На фиг. 10

С целью подтверждения увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в клеточной культуре фибробластов с нормальной экспрессией гена TGFBR2 при трансфекции данных клеток биологически активной генно-терапевтической субстанцией содержащей кДНК гена TGFBR2 представлен график изменения количества белка рецептора II типа трансформирующего фактора роста бетта нетрансфицированных фибробластов (культура A), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК TGFBR2 (культура B) и трансфицированных биологически активной генно-терапевтической субстанцией на базе генетической конструкции pCDNA 3.1-TGFBR2 SEQ ID No: 1 (культура С). Из графика следует, что при трансфекции фибробластов биологически активной генно-терапевтической субстанцией с кДНК гена TGFBR2 происходит увеличение количества белка рецептора II типа трансформирующего фактора роста бетта в клеточном лизате.

На фиг. 11

С целью подтверждения увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной биологически активной генно-терапевтической субстанцией представлен анализ изменения количества белка рецептора II типа трансформирующего фактора роста бетта в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (Б) и трансфицированные биологически активной генно-терапевтической субстанцией на базе pCMV6-TGFBR2 SEQ ID No: 7 (С) - в кожу предплечья. Также анализировали количественный уровень белка рецептора II типа трансформирующего фактора роста бетта в интактной коже. Показано повышение количества белка рецептора II типа трансформирующего фактора роста бетта в коже пациента в области введения фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией кДНК гена TGFBR2 (С).

На фиг. 12

С целью подтверждения увеличения количества белка рецептора II типа трансформирующего фактора роста бетта до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток биологически активными генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена TGFBR2 в зависимости от наличия и типа в них той или иной модификации кДНК гена TGFBR2 представлен анализ изменения количественного уровня белка рецептора II типа трансформирующего фактора роста бетта в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена TGFBR2, используемой для трансфекции фибробластов.

Культуры фибробластов 29 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-TGFBR2 SEQ ID No: 1, части (В) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-TGFBR2 SEQ ID No: 2, части (С) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-TGFBR2 SEQ ID No: 3, части (D) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-TGFBR2 SEQ ID No: 4, части (E) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-TGFBR2 SEQ ID No: 5, части (F) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-TGFBR2 SEQ ID No: 6, части (G) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-TGFBR2 SEQ ID No: 7, части (H) трансфицировали векторной плазмидой, не содержащей кДНК гена TGFBR2.

По итогам анализа количественного уровня белка рецептора II типа трансформирующего фактора роста бетта выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальное количество белка рецептора II типа трансформирующего фактора роста бетта и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при трансфекции pCMV6-TGFBR2 SEQ ID No: 1,

в группе 2 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при трансфекции pCMV6-TGFBR2 SEQ ID No: 2,

в группе 3 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при трансфекции pCMV6-TGFBR2 SEQ ID No: 3,

в группе 4 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при трансфекции pCMV6-TGFBR2 SEQ ID No: 4,

в группе 5 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при трансфекции pCMV6-TGFBR2 SEQ ID No: 5,

в группе 6 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при трансфекции pCMV6-TGFBR2 SEQ ID No: 6,

в группе 7 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при трансфекции pCMV6-TGFBR2 SEQ ID No: 7.

Ни в одной из клеточных культур не наблюдалось того, что максимальное количество белка рецептора II типа трансформирующего фактора роста бетта присутствует при трансфекции вектором без вставки кДНК гена TGFBR2.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентрации белка рецептора II типа трансформирующего фактора роста бетта (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена TGFBR2.

Из фигуры следует, что достижение максимального количества белка рецептора II типа трансформирующего фактора роста бетта в культурах фибробластов кожи различных пациентов при их трансфекции биологически активными генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена TGFBR2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных БАГТС TGFBR2 SEQ ID No: 1 (А)

части клеточных культур, трансфицированных БАГТС TGFBR2 SEQ ID No: 2 (В)

части клеточных культур, трансфицированных БАГТС TGFBR2 SEQ ID No: 3 (С)

части клеточных культур, трансфицированных БАГТС TGFBR2 SEQ ID No: 4 (D)

части клеточных культур, трансфицированных БАГТС TGFBR2 SEQ ID No: 5 (Е)

части клеточных культур, трансфицированных БАГТС TGFBR2 SEQ ID No: 6 (F)

части клеточных культур, трансфицированных БАГТС TGFBR2 SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (H)

На фиг. 13

С целью подтверждения увеличения экспрессии гена TGFBR2 в клеточной культуре кератоцитов и эпителиальных клеток глаза при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена TGFBR2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена TGFBR2, кератоциты до трансфекции

2 - кДНК гена TGFBR2, эпителий роговицы до трансфекции

3 - кДНК гена TGFBR2, кератоциты после трансфекции

4 - кДНК гена TGFBR2, эпителий роговицы после трансфекции

5 - кДНК гена В2М, кератоциты до трансфекции

6 - кДНК гена В2М, эпителий роговицы до трансфекции

7 - кДНК гена В2М, кератоциты после трансфекции

8 - кДНК гена В2М, эпителий роговицы после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена TGFBR2 в культуре кератоцитов и в культуре эпителия многократно вырос.

На фиг. 14

С целью подтверждения увеличения экспрессии гена TGFBR2 в клеточной культуре хондробластов при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена TGFBR2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена TGFBR2, до трансфекции

2 - кДНК гена TGFBR2, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного. Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена TGFBR2 вырос многократно.

На фиг. 15

С целью подтверждения увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в коже человека при введении в кожу биологически активной генно-терапевтической субстанции представлен анализ изменения количественного уровня белка рецептора II типа трансформирующего фактора роста бетта в коже. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена TGFBR2 pCMV6-TGFBR2 SEQ ID No: 4 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена TGFBR2 с транспортной молекулой (А) - в кожу предплечья. Показано увеличение количества белка рецептора II типа трансформирующего фактора роста бетта в биоптате кожи пациента 1B, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена TGFBR2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

На фиг. 16

С целью подтверждения увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в хрящевой ткани человека при введении в хрящевую ткань биологически активной генно-терапевтической субстанции представлен анализ изменения количественного уровня белка рецептора II типа трансформирующего фактора роста бетта в хрящевой ткани. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена TGFBR2 pCDNA 3.1 TGFBR2 SEQ ID No: 5 (В) и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена TGFBR2 с транспортной молекулой (А) - в хрящевую ткань.

Показано увеличение количественного уровня белка рецептора II типа трансформирующего фактора роста бетта в лизате биоптата хрящевой ткани пациента 1B, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена TGFBR2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

На фиг. 17

С целью подтверждения увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в мышечной ткани человека при введении в мышечную ткань биологически активной генно-терапевтической субстанции представлен анализ изменения количества белка рецептора II типа трансформирующего фактора роста бетта в мышечной ткани. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена TGFBR2 - pCMV6-Kan/Neo TGFBR2 SEQ ID No: 6 (В) и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена TGFBR2 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение количества белка рецептора II типа трансформирующего фактора роста бетта в биоптате мышечной ткани пациента 1B, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена TGFBR2, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

На фиг. 18

С целью подтверждения увеличения количества белка рецептора II типа трансформирующего фактора роста бетта до различного индивидуального уровня при введении в кожу пациентов биологически активных генно-терапевтических субстанций с модифицированными и нативной кДНК гена TGFBR2 анализировали количественный уровень белка рецептора II типа трансформирующего фактора роста бетта в коже человека в зависимости от наличия и типа модификаций в кДНК гена TGFBR2.

Каждому из 22-х пациентов, отобранных в случайном порядке, вводили в кожу предплечья 7 биологически активных генно-терапевтических субстанций pCMV6 - SEQ ID No: 1, pCMV6 - SEQ ID No: 2, pCMV6 - SEQ ID No: 3, pCMV6 - SEQ ID No: 4, pCMV6 - SEQ ID No: 5, pCMV6 - SEQ ID No: 6, pCMV6 - SEQ ID No: 7, и плацебо pCMV6 - XL5.

По итогам анализа количества белка рецептора II типа трансформирующего фактора роста бетта в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные количественные уровни белка рецептора II типа трансформирующего фактора роста бетта и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при введении pCMV6-TGFBR2 SEQ ID No: 1,

в группе 2 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при введении pCMV6-TGFBR2 SEQ ID No: 2,

в группе 3 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при введении pCMV6-TGFBR2 SEQ ID No: 3,

в группе 4 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при введении pCMV6-TGFBR2 SEQ ID No: 4,

в группе 5 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при введении pCMV6-TGFBR2 SEQ ID No: 5,

в группе 6 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при введении pCMV6-TGFBR2 SEQ ID No: 6,

в группе 7 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалась при введении pCMV6-TGFBR2 SEQ ID No: 7.

Ни в одном из биоптатов не наблюдалось того, что максимальное количество белка рецептора II типа трансформирующего фактора роста бетта присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка рецептора II типа трансформирующего фактора роста бетта (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена TGFBR2.

Из данного примера следует, что достижение максимального количества белка рецептора II типа трансформирующего фактора роста бетта в биоптатах кожи различных пациентов при введении им в кожу биологически активных генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена TGFBR2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента.

Обозначения:

биоптаты пациентов после введения БАГТС TGFBR2 SEQ ID No: 1 (А)

биоптаты пациентов после введения БАГТС TGFBR2 SEQ ID No: 2 (В)

биоптаты пациентов после введения БАГТС TGFBR2 SEQ ID No: 3 (С)

биоптаты пациентов после введения БАГТС TGFBR2 SEQ ID No: 4 (D)

биоптаты пациентов после введения БАГТС TGFBR2 SEQ ID No: 5 (Е)

биоптаты пациентов после введения БАГТС TGFBR2 SEQ ID No: 6 (F)

биоптаты пациентов после введения БАГТС TGFBR2 SEQ ID No: 7 (G)

биоптаты пациентов после введения плацебо (H) На фиг. 19

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количественный уровень белка рецептора II типа трансформирующего фактора роста бетта в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими нативную или модифицированные кДНК гена TGFBR2.

По итогам анализа количества белка рецептора II типа трансформирующего фактора роста бетта в культуре фибробластов пациента выделили вариант биологически активной генно-терапевтической субстанции, при трансфекции которой выявляется максимальная концентрация белка рецептора II типа трансформирующего фактора роста бетта в лизате клеточной культуры. В данном эксперименте максимальная концентрация белка рецептора II типа трансформирующего фактора роста бетта в лизате наблюдается при трансфекции биологически активной генно-терапевтической субстанцией на базе pCMV6 TGFBR2 SEQ ID No: 5, содержащей модифицированную кДНК TGFBR2, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры. Обозначения:

1 - клеточный лизат после трансфекции БАГТС TGFBR2 SEQ ID No: 1 (А)

2 - клеточный лизат после трансфекции БАГТС TGFBR2 SEQ ID No: 2 (В)

3 - клеточный лизат после трансфекции БАГТС TGFBR2 SEQ ID No: 3 (С)

4 - клеточный лизат после трансфекции БАГТС TGFBR2 SEQ ID No: 4 (D)

5 - клеточный лизат после трансфекции БАГТС TGFBR2 SEQ ID No: 5 (Е)

6 - клеточный лизат после трансфекции БАГТС TGFBR2 SEQ ID No: 6 (F)

7 - клеточный лизат после трансфекции БАГТС TGFBR2 SEQ ID No: 7 (G)

8 - клеточный лизат после трансфекции плацебо (Н)

На фиг. 20

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка рецептора II типа трансформирующего фактора роста бетта в лизатах биоптатов кожи этого пациента, после введения ему биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена TGFBR2.

По итогам анализа количества белка рецептора II типа трансформирующего фактора роста бетта в лизате биоптатов кожи пациента выделили вариант биологически активной генно-терапевтической субстанции, при введении которой выявляется максимальная концентрация белка рецептора II типа трансформирующего фактора роста бетта в лизате биоптата. В данном эксперименте максимальная концентрация белка рецептора II типа трансформирующего фактора роста бетта отмечена при введении биологически активной генно-терапевтической субстанции на базе pCMV6 TGFBR2 SEQ ID No: 3, содержащей модифицированную кДНК TGFBR2, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения БАГТС TGFBR2 SEQ ID No: 1 (А)

2 - лизат биоптата после введения БАГТС TGFBR2 SEQ ID No: 2 (В)

3 - лизат биоптата после введения БАГТС TGFBR2 SEQ ID No: 3 (С)

4 - лизат биоптата после введения БАГТС TGFBR2 SEQ ID No: 4 (D)

5 - лизат биоптата после введения БАГТС TGFBR2 SEQ ID No: 5 (Е)

6 - лизат биоптата после введения БАГТС TGFBR2 SEQ ID No: 6 (F)

7 - лизат биоптата после введения БАГТС TGFBR2 SEQ ID No: 7 (G)

8 - лизат биоптата после введения плацебо (Н)

Реализация изобретения.

При снижении экспрессии генов, кодирующих белки, например гена TGFBR2, происходит снижение количества белка в организме, что приводит к патологическим состояниям.

Экспериментальные исследования трансгенных мышей показали, что гомозиготные особи, умирают в середине эмбрионального периода развития, у них наблюдали с нарушения желточного мешка, системы кроветворения и васкулогенеза, а также дефекты свода черепа.

[PMID: 11070163], [PMID: 25857227], [PMID: 17114585], [PMID: 10748236], [PMID: 15374963], [PMID: 18821589], [PMID: 24355923], [PMID: 12091349], [PMID: 11857781], [PMID: 16780827], [PMID: 19520971], [PMID: 12975342], [PMID: 18990706], [PMID: 16332365], [PMID: 19270708], [PMID: 15741317], [PMID: 8873772], [PMID: 11559531], [PMID: 15548578]

Преимущества использования генетической конструкции с геном TGFBR2 для коррекции количественного уровня белка рецептора II типа трансформирующего фактора роста бетта в клетках органов и тканей человека, по сравнению с использованием полинуклеотида, как по прототипу патенту US 6291237 следующие:

1) легче обеспечить более высокий и стабильный уровень белка в клетках,

2) обеспечивается транспортировка биологически активной генно-терапевтической субстанции в больший спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка биологически активной генно-терапевтической субстанции.

3) учитываются индивидуальные характеристики пациента.

4) учтены индивидуальные особенности пациентов.

Таким образом, для создания линейки биологически активных генно-терапевтических субстанций по данному изобретению был выбран ген TGFBR2, а не белок, кодируемый этим геном.

Для получения линейки биологически активных генно-терапевтических субстанций осуществляют следующие действия:

1. Получение нативной кДНК гена TGFBR2, содержащей белок-кодирующую область гена TGFBR2, клонирование ее в промежуточную плазмиду для дальнейших модификаций этой кДНК

2. Внесение в последовательность нуклеотидов кДНК гена TGFBR2 модификаций с целью создания линейки кДНК гена TGFBR2, обеспечивающих достаточный для борьбы с патологическими проявлениями уровень трансляции белка рецептора II типа трансформирующего фактора роста бетта

3. Клонирование нативной и модифицированных кДНК гена TGFBR2 в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E.coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение линейки генетических конструкций, содержащих модифицированные и нативную кДНК гена TGFBR2 для создания на ее базе линейки биологически активных генно-терапевтических субстанций.

6. Создание линейки биологически активных генно-терапевтических субстанций, каждая из которых включает генетическую конструкцию с модифицированной или нативной кДНК гена TGFBR2, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных биологически активных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена TGFBR2, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, и анализ экспрессии гена TGFBR2 из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, биологически активными генно-терапевтическими субстанциями содержащими нативную и/или модифицированные кДНК гена TGFBR2 и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена TGFBR2 в различных комбинациях.

D) Сравнительный анализ изменения уровня кДНК и/или изменения количества белка рецептора II типа трансформирующего фактора роста бетта после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, биологически активными генно-терапевтическими субстанциями содержащими нативную и/или модифицированные кДНК гена TGFBR2 и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена TGFBR2. Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента биологически активной генно-терапевтической субстанции.

E) Введение пациентам в органы и ткани культуры клеток с кДНК гена TGFBR2, например, введение, в кожу человека, аутологичных фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией с кДНК гена TGFBR2 и параллельное введение пациентам в органы и ткани, например, в кожу, культур этих же клеток нетрансфицированных и трансфицированных вектором без вставки кДНК гена TGFBR2 и/или введение пациентам в органы и ткани биологически активных генно-терапевтических субстанций, например, введение в кожу человека биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК TGFBR2, а также плацебо в различных комбинациях.

F) Сравнительный анализ количества белка рецептора II типа трансформирующего фактора роста бетта в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных биологически активными генно-терапевтическими субстанциями, содержащими кДНК гена TGFBR2 и векторными плазмидами, не содержащими кДНК гена TGFBR2 и/или биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена TGFBR2, а также плацебо.

G) Введение пациентам в органы и ткани, например, хрящевую ткань, или мышечную ткань биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК гена TGFBR2, а также плацебо.

H) Сравнительный анализ количества белка рецептора II типа трансформирующего фактора роста бетта в органах и тканях человека, в частности в хрящевой ткани, или мышечной ткани человека, после введения биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК TGFBR2 а также плацебо.

I) Введение пациентам в органы и ткани, например, введение в кожу пациента биологически активных генно-терапевтических субстанций, содержащих нативную и модифицированные кДНК гена TGFBR2.

J) Сравнительный анализ количества белка рецептора II типа трансформирующего фактора роста бетта в органах и тканях пациента, в частности в коже, после введения биологически активных генно-терапевтических субстанций, содержащих нативную и модифицированные кДНК гена TGFBR2. Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций.

Пример 1.

Получение нативной (немодифицированной) кДНК гена TGFBR2.

Немодифицированная кДНК гена TGFBR2 представляет собой последовательность нуклеотидов, идентичную приводимой в базе данных GenBank под номером NM_001024847.2; нуклеотиды со 383 по 2161 транслируются в аминокислотную последовательность, соответствующую приведенной в GenBank под номером NP_001020018.1.

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) используют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно копированные праймеры, комплементарные нуклеотидам 107-126 5' CGCACGGAGCGACGACACCC 3' (TGFBR2F1) и 2183-2164 5' GGCCCAGCCTGCCCCAGAAG 3' (TGFBR2R7) из последовательности мРНК TGFBR2 (GenBank #NM_001024847.2), получают кДНК TGFBR2. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами. ПЦР проводят с помощью амплификатора Master CyclerGradient (Eppendorf, USA) в 50 мкл. реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера TGFBR2F1 и TGFBR2R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (pH 8,85 при 20°C), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific, USA) при следующих условиях: первоначальная денатурация при +98°C в течение 30 сек., 35 циклов, включающих денатурацию при +98°C в течение 10 сек., отжиг праймеров при +68°C в течение 30 сек. и элонгацию при +68°C в течение 4 минут.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany)

Амплифицированный фрагмент кДНК, несущий ген TGFBR2, клонируют в плазмидном векторе pUC19 (NEB, USA, кат номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, кат. номер N3041S) гидролизуют рестриктазой Smal (NEB, USA), (или другой рестриктазой, дающей тупые концы) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага T4 400000 ед./мл. (NEB.USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис-HCl, pH 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°C.

Полученной смесью трансформируют компетентные клетки Е.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки Петри с L-агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами TGFBR2F1 и TGFBR2R1 и подтверждают секвенированием по методу Сэнгера, которое показывает наличие клонов с разной ориентацией целевого гена: EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI

Полученная таким образом клонированная частичная (с 107 по 2183 н.п) нативная (немодифицированная) последовательность гена TGFBR2 длиной 2077 н.п.в плазмиде pUC19-TGFBR2 SEQ ID No: 1 имеет первичную структуру, приведенную на фиг. 1.

Пример 2.

Получение модифицированных кДНК гена TGFBR2.

Модификации проводят таким образом, чтобы не затрагивать первичную структуру белка рецептора II типа трансформирующего фактора роста бетта, а именно, делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности для получения линейки кДНК гена TGFBR2 с целью повышения эффективности транскрипции и трансляции белка рецептора II типа трансформирующего фактора роста бетта в клетках тканей и органов человека в нативную последовательность кДНК TGFBR2, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные, а также проводят делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChange II XL kit или QuikChange Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA,) согласно рекомендациям производителя. http://www.agilent.com/cs/library/usermanuals/Public/200513.

К плазмидной ДНК pUC 19-TGFBR2 SEQ ID No: 1 по Примеру 1 (вариант pUC 19-TGFBR2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и вариант pUC 19-TGFBR2 SEQ ID No: 1 с ориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI) в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 25-45 н.п. и проводят ПЦР в буфере QuikChange Multi reaction buffer (AgilentTechnologies, USA) со смесью ферментов QuikChange Multi mix (AgilentTechnologies, USA) при следующих условиях: 95°C, 1 мин; далее от 30 до 35 циклов: 95°C 1 минута, 55°C 1 минута, 65°C 2 минуты/1000 н.п. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°C. Полученной смесью трансформируют компетентные клетки E.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L-агаром, содержащих 100 мкг/мл ампициллина. Трансформированнные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК TGFBR2 SEQ ID No: 2 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК TGFBR2 SEQ ID Л/о;1, (вариант pUC 19-TGFBR2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и вариант pUC 19-TGFBR2 SEQ ID No: 1 сориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI), используемой в качестве матрицы:

1. TGFBR2 422-452 F:

,

комплементарную нуклеотидам 422-452, с заменами G→C в позиции 436 и T→G в позиции 439;

2. TGFBR2 460-488 F:

,

комплементарную нуклеотидам 460-488, с заменой G→C в позиции 475,

3. TGFBR2 1059-1088 F:

,

комплементарную нуклеотидам 1059-1088, с заменами G→C в позиции 1075

Модифицированная таким образом нуклеотидная последовательность кДНК TGFBR2 SEQ ID No: 2 содержит 3 нуклеотидных замены G→C в позициях 436, 475, 1075; 1 нуклеотидную замену T→G в позиции 439, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта и имеет первичную структуру, приведенную на фиг. 2.

Для получения модифицированной кДНК TGFBR2 SEQ ID No: 3 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК TGFBR2 SEQ ID No: 1, (вариант pUC 19-TGFBR2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и вариант pUC 19-TGFBR2 SEQ ID No: 1 сориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI), используемой в качестве матрицы:

1. TGFBR2 422-452 F:

,

комплементарную нуклеотидам 422-452, с заменами G→C в позиции 436 и T→G в позиции 439;

2. TGFBR2 460-488 F:

,

комплементарную нуклеотидам 460-488, с заменой G→C в позиции 475,

3. TGFBR2 1059-1088 F:

,

комплементарную нуклеотидам 1059-1088, с заменами G→C в позиции 1075

1. TGFBR2 438-463 F:

,

комплементарную нуклеотидам 438-463, с заменами T→G в позиции 439 и G→C в позиции 451;

2. TGFBR2 1134-1160 F:

,

комплементарную нуклеотидам 1134-1160, с заменой G→C в позиции 1147;

3. TGFBR2 1373-1397 F:

,

комплементарную нуклеотидам 1373-1397, с заменой G→C в позиции 1384

Модифицированная таким образом нуклеотидная последовательность кДНК TGFBR2 SEQ ID No: 3 содержит 6 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384; 1 нуклеотидную замену T→G в позиции 439, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта и имеет первичную структуру, приведенную на фиг 3.

Для получения модифицированной кДНК TGFBR2 SEQ ID No: 4 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК TGFBR2 SEQ ID No: 1 (вариант pUC 19-TGFBR2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и вариант pUC 19-TGFBR2 SEQ ID No: 1 сориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI), используемой в качестве матрицы:

1. TGFBR2 422-452 F:

,

комплементарную нуклеотидам 422-452, с заменами G→C в позиции 436 и T→G в позиции 439;

2. TGFBR2 460-488 F:

,

комплементарную нуклеотидам 460-488, с заменой G→C в позиции 475,

3. TGFBR2 1059-1088 F:

,

комплементарную нуклеотидам 1059-1088, с заменами G→C в позиции 1075

4. TGFBR2 438-463 F:

,

комплементарную нуклеотидам 438-463, с заменами T→G в позиции 439 и G→C в позиции 451;

5. TGFBR2 1134-1160 F:

,

комплементарную нуклеотидам 1134-1160, с заменой G→C в позиции 1147;

6. TGFBR2 1373-1397 F:

,

комплементарную нуклеотидам 1373-1397, с заменой G→С в позиции 1384

7. TGFBR2 1388-1414 F:

,

комплементарную нуклеотидам 1388-1414, с заменой G→C в позиции 1402;

8. TGFBR2 1458-1494 F:

комплементарную нуклеотидам 1458-1494, с заменой G→C в позиции 1471.

Модифицированная таким образом нуклеотидная последовательность кДНК TGFBR2 SEQ ID No: 4 содержит 8 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384, 1402, 1471; 1 нуклеотидную замену T→G в позиции 439, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта и имеет первичную структуру, приведенную на фиг 4.

Для получения модифицированной кДНК TGFBR2 SEQ ID No: 5 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК TGFBR2 SEQ ID No: 1 (вариант pUC 19-TGFBR2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и вариант pUC 19-TGFBR2 SEQ ID No: 1 сориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI), используемой в качестве матрицы:

1. TGFBR2 422-452 F:

,

комплементарную нуклеотидам 422-452, с заменами G→C в позиции 436 и T→G в позиции 439;

2. TGFBR2 460-488 F:

,

комплементарную нуклеотидам 460-488, с заменой G→C в позиции 475,

3. TGFBR2 1059-1088 F:

,

комплементарную нуклеотидам 1059-1088, с заменами G→C в позиции 1075

4. TGFBR2 438-463 F:

,

комплементарную нуклеотидам 438-463, с заменами T→G в позиции 439 и G→C в позиции 451;

5. TGFBR2 1134-1160 F:

,

комплементарную нуклеотидам 1134-1160, с заменой G→C в позиции 1147;

6. TGFBR2 1373-1397 F:

,

комплементарную нуклеотидам 1373-1397, с заменой G→C в позиции 1384

7. TGFBR2 1388-1414 F:

,

комплементарную нуклеотидам 1388-1414, с заменой G→C в позиции 1402;

8. TGFBR2 1458-1494 F:

комплементарную нуклеотидам 1458-1494, с заменой G→C в позиции 1471.

9. TGFBR2 1652-1681 F:

,

комплементарную нуклеотидам 1652-1681, с заменой T→G в позиции 1666;

10. TGFBR2 1933-1962 F:

,

комплементарную нуклеотидам 1933-1962, с заменами A→G в позициях 1942 и 1948;

11. TGFBR2 2092-2120 F:

,

комплементарную нуклеотидам 2092-2120, с заменой G→C в позиции 2101.

Модифицированная таким образом нуклеотидная последовательность кДНК TGFBR2 SEQ ID No: 5 содержит 9 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384, 1402, 1471, 2101; 2 нуклеотидных замены T→G в позициях 439, 1666; 2 нуклеотидных замены A→G в позициях 1942, 1948, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта и имеет первичную структуру, приведенную на фиг 5.

Для получения модифицированной кДНК TGFBR2 SEQ ID No: 6 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК TGFBR2 SEQ ID No: 1 (вариант pUC 19-TGFBR2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и вариант pUC 19-TGFBR2 SEQ ID No: 1 сориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI), используемой в качестве матрицы:

1. TGFBR2 422-452 F:

,

комплементарную нуклеотидам 422-452, с заменами G→C в позиции 436 и T→G в позиции 439;

2. TGFBR2 460-488 F:

,

комплементарную нуклеотидам 460-488, с заменой G→C в позиции 475,

3. TGFBR2 1059-1088 F:

,

комплементарную нуклеотидам 1059-1088, с заменами G→C в позиции 1075

4. TGFBR2 438-463 F:

,

комплементарную нуклеотидам 438-463, с заменами T→G в позиции 439 и G→C в позиции 451;

5. TGFBR2 1134-1160 F:

,

комплементарную нуклеотидам 1134-1160, с заменой G→C в позиции 1147;

6. TGFBR2 1373-1397 F:

,

комплементарную нуклеотидам 1373-1397, с заменой G→C в позиции 1384

7. TGFBR2 1388-1414 F:

,

комплементарную нуклеотидам 1388-1414, с заменой G→C в позиции 1402;

8. TGFBR2 1458-1494 F:

,

комплементарную нуклеотидам 1458-1494, с заменой G→C в позиции 1471.

9. TGFBR2 1652-1681 F:

,

комплементарную нуклеотидам 1652-1681, с заменой T→G в позиции 1666;

10. TGFBR2 1933-1962 F:

,

комплементарную нуклеотидам 1933-1962, с заменами A→G в позициях 1942 и 1948;

11. TGFBR2 2092-2120 F:

,

комплементарную нуклеотидам 2092-2120, с заменой G→C в позиции 2101.

12. TG TGFBR2 1993-2022 F:

,

комплементарную нуклеотидам 1993-2022 с заменой G→С в позиции 2005;

13. TGFBR2 2032-2060 F:

,

комплементарную нуклеотидам 2032-2060, с заменой T→G в позиции 2041;

14. TGFBR2 2102-2126 F:

,

комплементарную нуклеотидам 2102-2126 с заменой G→C в позиции 2116.

Модифицированная таким образом нуклеотидная последовательность кДНК TGFBR2 SEQ ID No: 6 содержит 11 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384, 1402, 1471, 2005, 2101, 2116; 3 нуклеотидных замены T→G в позициях 439, 1666, 2041; 2 нуклеотидных замены A→G в позициях 1942, 1948, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта и имеет первичную структуру, приведенную на фиг 6.

Для получения модифицированной кДНК TGFBR2 SEQ ID No: 7 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК TGFBR2 SEQ ID No: 1 (вариант pUC 19-TGFBR2 SEQ ID No: 1 с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и вариант pUC 19-TGFBR2 SEQ ID No: 1 сориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI), используемой в качестве матрицы:

1. TGFBR2 422-452 F:

,

комплементарную нуклеотидам 422-452, с заменами G→C в позиции 436 и T→G в позиции 439;

2. TGFBR2 460-488 F:

,

комплементарную нуклеотидам 460-488, с заменой G→C в позиции 475,

3. TGFBR2 1059-1088 F:

,

комплементарную нуклеотидам 1059-1088, с заменами G→C в позиции 1075

4. TGFBR2 438-463 F:

,

комплементарную нуклеотидам 438-463, с заменами T→G в позиции 439 и G→C в позиции 451;

5. TGFBR2 1134-1160 F:

,

комплементарную нуклеотидам 1134-1160, с заменой G→C в позиции 1147;

6. TGFBR2 1373-1397 F:

,

комплементарную нуклеотидам 1373-1397, с заменой G→C в позиции 1384

7. TGFBR2 1388-1414 F:

,

комплементарную нуклеотидам 1388-1414, с заменой G→C в позиции 1402;

8. TGFBR2 1458-1494 F:

комплементарную нуклеотидам 1458-1494, с заменой G→C в позиции 1471.

9. TGFBR2 1652-1681 F:

,

комплементарную нуклеотидам 1652-1681, с заменой T→G в позиции 1666;

10. TGFBR2 1933-1962 F:

,

комплементарную нуклеотидам 1933-1962, с заменами A→G в позициях 1942 и 1948;

11. TGFBR2 2092-2120 F:

,

комплементарную нуклеотидам 2092-2120, с заменой G→C в позиции 2101.

12. TG TGFBR2 1993-2022 F:

,

комплементарную нуклеотидам 1993-2022 с заменой G→C в позиции 2005;

13. TGFBR2 2032-2060 F:

,

комплементарную нуклеотидам 2032-2060, с заменой T→G в позиции 2041;

14. TGFBR2 2102-2126 F:

,

комплементарную нуклеотидам 2102-2126 с заменой G→C в позиции 2116.

15. а также для удаления 5'-нетранслируемой области гена TGFBR2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером:

для варианта с ориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI

16. а также для удаления 3'-нетранслируемой области гена TGFBR2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером

для варианта с ориентацией целевого гена HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI

17. а также для удаления 5'-нетранслируемой области гена TGFBR2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером

для варианта с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII

18. а также для удаления 3'-нетранслируемой области гена TGFBR2 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером

для варианта с ориентацией целевого гена EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII

Модифицированная таким образом нуклеотидная последовательность кДНК TGFBR2 SEQ ID No: 7 не содержит нетранслируемые 5' и 3' области гена и содержит 11 нуклеотидных замен G→C в позициях 436, 451, 475, 1075, 1147, 1384, 1402, 1471, 2005, 2101, 2116; 3 нуклеотидных замены T→G в позициях 439, 1666, 2041; 2 нуклеотидных замены A→G в позициях 1942, 1948, не приводящие к изменениям в аминокислотной последовательности белка рецептора II типа трансформирующего фактора роста бетта и имеет первичную структуру, приведенную на фиг 7.

Таким образом, получают линейку из 7 векторов на базе плазмиды pUC19, в которой клонированы кодирующие нативная и модифицированные нуклеотидные последовательности гена TGFBR2 (при этом каждый вектор из линейки получен в двух вариантах и содержит целевой ген с ориентацией EcoRI-5'NTR-кДНК TGFBR2-3'NTRHindIII и целевой ген с ориентацией HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI для создания генетических экспрессионных конструкций на базе разных векторов) для создания линейки биологически активных генно-терапевтических субстанций

Пример 3.

Создание генетических конструкций с модифицированными и нативной кДНК гена TGFBR2 для получения на их базе биологически активных генно-терапевтических субстанций.

Для экспрессии кДНК гена TGFBR2 в клетках органов и тканей человека полученные варианты кДНК TGFBR2 по Примеру 1 и Примеру 2 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E.coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции;

3) в векторе должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) наличие удобного полилинкера для клонирования. Примером такой плазмиды может быть pCMV6-XL5, pCMV6-Kan/Neo (OriGene, USA) или pCDNA 3.1 (+) (ThermoFisherScientific, USA).

При клонировании кДНК гена TGFBR2 в pCDNA 3.1 (+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину. При клонировании учитывают последовательность расположения сайтов HindIII и EcoRI в полилинкере pCDNA 3.1 (+) и поэтому для клонирования в данный вектор используют HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI ориентированный фрагмент в pUC19 по примеру 1.

При клонировании кДНК гена TGFBR2 в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину. При клонировании учитывают последовательность расположения сайтов EcoRI и HindIII в полилинкере pCMV6-XL5 (pCMV6-Kan/Neo) и поэтому для клонирования в данный вектор используют Eco RI-5'NTR-кДНК TGFBR2-3'NTR-HindIII ориентированный фрагмент в pUC19 по примеру 1.

Векторные плазмиды pUC19-TGFBR2 SEQ ID No: 1 с частичной нативной (немодифицированной) последовательностью гена TGFBR2 (с 107 по 2183 н.п.), pUC19-TGFBR2 SEQ ID No: 2, pUC19-TGFBR2 SEQ ID No: 3, pUC19-TGFBR2 SEQ ID No: 4, pUC19-TGFBR2 SEQ ID No: 5, pUC19-TGFBR2 SEQ ID No: 6, с частичной модифицированной путем замены оснований нуклеотидной последовательностью гена TGFBR2 (с 107 по 2183 н.п.) и pUC19-TGFBR2 SEQ ID No: 7 с модифицированной кДНК гена TGFBR2 и лишенной нетранслируемыех 5' и 3' областей данного гена, а также векторные плазмиды pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1 (+) для дальнейшей экспрессии гена TGFBR2 в эукариотических клетках, гидролизуют рестриктазами EcoRI и HindIII(NEB, USA) при 37°C в соответствующем буфере (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984).

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке HindIII-5'NTR-кДНК TGFBR2-3'NTR-EcoRI, либо Eco RI-5'NTR-кДНК TGFBR2-3'NTR-HindIII и линеаризованной плазмиде pCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1(+), вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit из примера 1 и смешивают. Полученную смесь рестрикционных фрагментов лигируют с помощью ДНК-лигазы фага T4. Лигирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°C в течение 10 ч. Лигированную ДНК используют для трансформации клеток Е.coli по стандартной методике с использованием хлористого кальция. Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit, анализируют с помощью гидролиза рестриктазами тEcoRI и HindIII и отбирают генетическую(ие) конструкцию(ии), содержащую(ие) в своем составе кодирующую последовательность гена TGFBR2 под контролем промотора цитомегаловируса CMV, и сигналом полиаденилирования гена гормона роста, обозначаемую как pCMV6 TGFBR2 SEQ ID No: (1-7) или pCMV6-Kan/Neo TGFBR2 SEQ ID No: (1-7) или pCDNA 3.1 TGFBR2 SEQ ID No: (1-7). Наличие вставки кДНК гена TGFBR2, ее последовательность и ориентацию также подтверждают с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих биологически активных генно-терапевтических субстанций.

Полученные генетические экспрессионные конструкции используют для получения на их базе биологически активных генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6 - XL5, (pCMV6-Kan/Neo) или pCDNA 3.1 (+) без вставки кДНК гена TGFBR2.

Пример 4.

Наращивание генетической конструкции в бактериальной культуре.

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена TGFBR2, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E.coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена TGFBR2 в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами EcoRI и HindIII и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (хондробластов, кератоцитов и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E.coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°C и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5.

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции биологически активной генно-терапевтической субстанцией и анализа экспрессии гена TGFBR2.

Для последующей трансфекции биологически активной генно-терапевтической субстанцией содержащей один из вариантов кДНК TGFBR2 по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например за ушной раковиной или с боковой внутренней поверхности в зоне локтевого сустава, размером около 3 мм, массой - до 20 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°C в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°C в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена TGFBR2, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAIater и хранили при 4°C в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260: D280 - не менее 1,8, а соотношение полос 28S: 18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК. В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6.

Анализ эндогенной экспрессии гена TGFBR2 в культуре первичных фибробластов.

Анализ экспрессии гена TGFBR2 из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена TGFBR2.

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена TGFBR2 и фибробласты с нормальной экспрессией гена TGFBR2, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК (1006-1178 н.п.), специфичной для гена TGFBR2, используют прямой праймер TGFBR2FA1 5' TCCTGGAAGATGACCGCTCTG 3' и обратный праймер TGFBR2-RA1 5' GACTGCCACTGTCTCAAACTGCTC 3'

Длина продукта амплификации - 173 нуклеотидов. В качестве референтного гена используют ген бетта-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена TGFBR2.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого праймера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°C 30 минут, денатурация 98°C - 15 мин., затем 40 циклов, включающих денатурацию 94°C - 15 сек., отжиг праймеров 56,1°C - 30 сек. и элонгацию 72°C - 30 сек.

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов TGFBR2 и В2М. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны). Количество ПЦР продуктов - кДНК генов TGFBR2 и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.

По итогам анализа экспрессии гена TGFBR2 в разных культурах фибробластов (с низкой экспрессией гена TGFBR2 и с нормальной экспрессией гена TGFBR2) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена TGFBR2, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7.

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена TGFBR2 биологически активной генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена TGFBR2 в культуре данных клеток.

Для оценки эффективности биологически активной генно-терапевтической субстанции, содержащей немодифицированную кДНК гена TGFBR2 по примеру 3, этой биологически активной генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена TGFBR2, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют биологически активной генно-терапевтической субстанцией на основе pCMV6-TGFBR2 SEQ ID No: 1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4×105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°C и в атмосфере, содержащей 5% CO2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, pH 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°C.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°C и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°C и в атмосфере, содержащей 5% CO2, после чего оценивали уровень кДНК гена TGFBR2 и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена TGFBR2 уровень кДНК гена TGFBR2 в фибробластах не изменился, а в случае трансфекции вектором с кДНК TGFBR2 - уровень кДНК фибробластов со сниженной экспрессией гена TGFBR2 многократно увеличился (до уровня выше, чем уровень кДНК гена TGFBR2 в нормальных фибробластах).

Показано, что в клетках трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6-TGFBR2 SEQ ID No: 1 наблюдается усиление экспрессии целевого гена TGFBR2

Пример 8.

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена TGFBR2 биологически активной генно-терапевтической субстанцией с кДНК гена TGFBR2 с целью подтверждения увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в культуре данных клеток.

Для оценки количества белка рецептора II типа трансформирующего фактора роста бетта использовали культуру фибробластов кожи человека по Примеру 5, в качестве транспортной молекулы - дендримеры SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия), в качестве трансфицируемых агентов - биологически активную генно-терапевтическую субстанцию на основе векторной плазмиды pCDNA 3.1(+), содержащую кДНК гена TGFBR2 - pCDNA 3.1 TGFBR2 SEQ ID No: 1(A), векторную плазмиду pCDNA 3.1(+), не содержащую кДНК гена TGFBR2 (В), в качестве контроля - водный раствор дендримеров без плазмидной ДНК (С). Приготовление комплекса ДНК-дендример и трансфекцию фибробластов проводили согласно Примеру 7.

После трансфекции клетки снимали раствором Версена. Для гомогенизации использовали смесь 100 мг клеток в 1 мл буфера PBS1x, которую подвергали двум этапам заморозки (-20°C на ночь) и разморозки в водяной бане (+37°C). После этого клеточный лизат центрифугировали 5 минут при 5000 × g (+4°C).

Отбирали супернатант и использовали его для количественного определения целевого белка.

Количественное определение продукта кДНК гена TGFBR2 проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, США).

В наборе использованы высоко специфичные антитела к TGFBR2, адсорбированные на лунках микропланшета.

1. При первой инкубации добавляли по 100 мкл каждого образца и калибраторов в соответствующие лунки, закрывали лунки клейкой пленкой и инкубировали 2,5 часа при +4°C при встряхивании на горизонтальном шейкере для планшетов. (Калибратор готовят следующим образом: делают 2-кратные разведения концентрированного рекомбинантного белка TGFBR2). Исследование калибраторов и образцов проводили в трех повторностях.

2. После инкубации отбирали жидкость и промывали лунки, добавляя 300 мкл 1х Промывочного буфера. Повторяли промывку 4 раза.

3. Затем в каждую лунку добавляли 100 мкл раствора связанных с биотином антитител, закрывали лунки чистой клейкой пленкой и инкубировали 1 час при комнатной температуре при встряхивании на горизонтальном шейкере для планшетов.

4. Отбирали жидкость и повторяли промывку, смотри пункт 2.

5. Далее в каждую лунку вносили по 100 мкл раствора фермента Пероксидазы хрена, связанным с стрептовидином, заклеивали планшет чистой пленкой и инкубировали 45 минут при комнатной температуре при постоянном встряхивании на горизонтальном шейкере для планшетов.

6. Отбирали жидкость и повторяли промывку, смотри пункт 2.

7. Затем в лунки добавили 100 мкл хромогенного субстрата 3,3',5,5'-тетраметилбензидин (3,3',5,5'-Tetramethylbenzidine) и инкубировали плашку 30 минут при комнатной температуре в темноте при постоянном встряхивании на горизонтальном шейкере для планшетов.

8. После добавляли 50 мкл стоп-реагента.

Оптическая плотность измерялась при длине волны 450 нм при помощи автоматического биохимического и иммуноферментного анализатора ChemWell (Awareness Technology Inc., США) и пропорциональна концентрации белка TGFBR2 в пробе. Численное значение концентрации определяется с помощью калибровочной кривой, построенной по калибраторам с известной концентрацией белка h TGFBR2, входящим в состав набора. Разница между значениями оптической плотности (ОП) калибраторов поставленных в трех повторностях не превышала 10%.

Статистическую обработку полученных результатов, осуществляли с помощью программного обеспечения для статистической обработки и визуализации данных R, версия 3.0.2 (https://www.r-project.org/).

Таким образом показано, что транфекция фибробластов полученной биологически активной генно-терапевтической субстанцией, несущей кДНК гена TGFBR2, приводит к увеличению количества белка рецептора II типа трансформирующего фактора роста бетта в клетках фибробластов.

Пример 9.

Введение в кожу человека клеточной культуры фибробластов, трансфицированной биологически активной генно-терапевтической субстанцией с кДНК гена TGFBR2 с целью подтверждения увеличения после этого количества белка рецептора II типа трансформирующего фактора роста бетта в биоптате кожи человека.

С целью анализа изменения количества белка рецептора II типа трансформирующего фактора роста бетта в тканях человека пациентам в кожу предплечья вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6-TGFBR2 SEQ ID No: 7(C) в комбинации с транспортными молекулами - липосомами TRANS FAST ТМ Transfection Reagent (PROMEGA, USA),

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°C, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°C и использовали далее в качестве биологически активной генно-терапевтической субстанции.

Для последующей трансфекции клеток биологически активной генно-терапевтической субстанцией выращивали первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосимы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°C и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°C в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга.

Определение количества белка рецептора II типа трансформирующего фактора роста бетта оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, США)t, как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl pH 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- TGFBR2 SEQ ID No: 7, произошло увеличение количества белка рецептора II типа трансформирующего фактора роста бетта, что может свидетельствовать об усилении экспрессии гена TGFBR2. Тогда как при введении контрольных культур фибробластов (нетрансфицированных и трансфицированных вектором без вставки кДНК гена TGFBR2 pCMV6-XL5) количество белка рецептора II типа трансформирующего фактора роста бетта в коже не изменялась.

Таким образом показана эффективность биологически активной генно-терапевтической субстанции, несущей модифицированную кДНК гена TGFBR2: трансфекция фибробластов полученной биологически активной генно-терапевтической субстанцией несущей модифицированную кДНК гена TGFBR2, приводит к повышению количества белка рецептора II типа трансформирующего фактора роста бетта в клетках фибробластов.

Пример 10.

Трансфекция культур фибробластов из биоптатов группы различных пациентов биологически активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную к ДНК TGFBR2.

С целью подтверждения индивидуального характера увеличения количества белка рецептора II типа трансформирующего фактора роста бетта до различного уровня при трансфекции клеточных культур фибробластов пациентов биологически активными генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена TGFBR2 анализировали количественный уровень белка рецептора II типа трансформирующего фактора роста бетта в клеточных лизатах фибробластов, трансфицированных разными биологически активными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные и нативную кДНК TGFBR2 в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена TGFBR2.

Последовательность нативной кДНК TGFBR2 приведена на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК TGFBR2 приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в зоне локтевого сустава 29 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень белка рецептора II типа трансформирующего фактора роста бетта в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС pH 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford М.М. (1976) Anal.Biochem. 72: 248-254.]).

Затем каждую из 29-ти культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 1, содержащей немодифицированную к ДНК TGFBR2 (SEQ ID No: 1.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. Вторую часть, обозначенную (В), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 2, содержащей вариант 1 модифицированной кДНК TGFBR2 (SEQ ID No: 2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (С), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 3, содержащей вариант 2 модифицированной кДНК TGFBR2 (SEQ ID No: 3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 4, содержащей вариант 3 модифицированной кДНК TGFBR2 (SEQ ID No: 4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 5, содержащей 4 вариант модифицированной кДНК TGFBR2 (SEQ ID No: 5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 6, содержащей вариант 5 модифицированной кДНК TGFBR2 SEQ ID No: 6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 7, содержащей вариант 6 модифицированной кДНК TGFBR2 (SEQ ID No: 7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой рСМV6-XL5, не содержащей кДНК TGFBR2 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка рецептора II типа трансформирующего фактора роста бетта оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, CUJA)t, как описано в Примере 8.

По итогам определения количества белка рецептора II типа трансформирующего фактора роста бетта выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни количества белка рецептора II типа трансформирующего фактора роста бетта и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при трансфекции немодифицированной кДНК TGFBR2. В эту группу вошло 4 культуры из 29.

В группе 2 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при трансфекции 1 вариантом модифицированной кДНК TGFBR2. В эту группу вошло 2 культуры из 29.

В группе 3 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при трансфекции 2 вариантом модифицированной «ДНК TGFBR2. В эту группу вошло 5 культур из 29.

В группе 4 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта наблюдалось при трансфекции 3 вариантом модифицированной кДНК TGFBR2. В эту группу вошло 6 культур из 29.

В группе 5 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при трансфекции 4 вариантом модифицированной кДНК TGFBR2. В эту группу вошло 4 культуры из 29.

В группе 6 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при трансфекции 5 вариантом модифицированной кДНК TGFBR2. В эту группу вошли 3 культуры из 29.

В группе 7 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при трансфекции 6 вариантом модифицированной кДНК TGFBR2. В эту группу вошло 5 культур из 29.

Ни в одной из клеточных культур не наблюдалось того, что при трансфекции вектором, не содержащим кДНК гена TGFBR2 количество белка рецептора II типа трансформирующего фактора роста бетта присутствует в максимальных количествах.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентраций белка рецептора II типа трансформирующего фактора роста бетта (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена TGFBR2.

Из данного примера следует, что достижение максимального количества белка рецептора II типа трансформирующего фактора роста бетта в культурах фибробластов кожи различных пациентов при их трансфекции биологически активными генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена TGFBR2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных биологически активных генно-терапевтических субстанций в рамках линейки биологически активных генно-терапевтических субстанций.

Пример 11.

Трансфекции клеточной культуры кератоцитов и эпителиальных клеток глаза биологически активной генно-терапевтической субстанцией без транспортной молекулы с целью подтверждения при этом увеличения экспрессии гена TGFBR2 в данных культурах клеток.

С целью выяснения эффективности биологически активной генно-терапевтической субстанции, содержащей кДНК TGFBR2, в различных типах клеток, трансфицировали кератоциты и эпителиальные клетки роговицы человека, без использования транспортных молекул.

Биопсийный материал из области лимба в виде круга диаметром 1-1.5 мм помещали в чашку Петри в сбалансированный солевой раствор Хэнкса, добавляли диспазу (20 мкл 25 ед/мл) и гентамицин и инкубировали 24 часа при +4. Затем отделяли эпителиальный слой от стромы и нарезали обе ткани кусочками 1-2 мм3.

Суспензию эпителиальных клеток получали путем инкубирования кусочков тканей в растворе Трипсин-ЭДТА в течение 15 минут при +37°C. Трипсинизацию останавливали добавлением соевого ингибитора трипсина в PBS. Клеточные суспензии отмывали центрифугированием при 700 об/мин и ресуспендировали в бессывороточной среде DMEM с гентамицином. Клетки растили в 25 см2 флаконах с 5 мл среды при 37°C и в атмосфере, содержащей 5% CO2. Через 24 часа среду с не прикрепившимися клетками удаляли и добавляли 5 мл свежей среды. Пересев производили каждые 7 дней в соотношении 1:2-1:3.

Суспензию кератоцитов получали путем инкубирования в среде RPMI-1640 с коллагеназой 300 ед/мл в течение 2 часов. Затем отмывали клетки и ресуспендировали в среде DMEM с 20% телячьей сывороткой и антибиотиком-антимикотиком. Клетки растили в 25 см2 флаконах с 1 мл среды при +37°C и в атмосфере, содержащей 5% CO2. Пересев производили каждые 7 дней в соотношении 1:4.

Поскольку эффективность трансфекции кератоцитов низкая, использовали биологически активную генно-терапевтическую субстанцию на основе плазмиды pCMV6-Kan/Neo TGFBR2 SEQ ID No: 2, содержащую дополнительный фактор селекции - ген neor, придающий устойчивость к антибиотику генетицину.

Биологически активную генно-терапевтическую субстанцию добавляли к клеткам и инкубировали клетки 1 час при 37°C. После инкубации добавляли бессывороточную среду DMEM к эпителиальным клеткам и среду DMEM, содержащую 10% фетальной телячьей сыворотки к кератоцитам и продолжали инкубировать 24 часа. После 24-часового инкубирования клетки высевали в новую среду DMEM, содержащую 400 μg/mL фактора селекции - антибиотика G418 (Geneticin). Выжившие клетки культивировали в течение 2 недель в 25 см3 флаконах с 5 мл среды с G418. Всего выращивали 24 образца культур эпителиальных клеток и 24 образца культур кератоцитов.

Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК проводили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена TGFBR2 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-RadUSA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение экспрессии (транскрипции) гена TGFBR2 наблюдали на 3 сутки для эпителиальных клеток и на 5 сутки - для кератоцитов.

На фигуре 13 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена TGFBR2, в кератоцитах и эпителиальных клетках роговицы.

Показано, что в кератоцитах и эпителиальных клетках роговицы человека, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6-Kan/Neo TGFBR2 SEQ ID No: 2, без транспортной молекулы, наблюдается усиление экспрессии целевого гена TGFBR2

Пример 12.

Трансфекции клеточной культуры хондробластов биологически активной генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена TGFBR2 в данных культуре клеток.

С целью выяснения эффективности биологически активной генно-терапевтической субстанции, содержащей кДНК гена TGFBR2, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали хондробласты человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биоптаты хрящевой ткани массой 50-150 мг измельчали на фрагменты до 10 мм3 и инкубировали в буферном растворе с коллагеназой II, гиалуронидазой и трипсином в течение 48 часов при +37°C. Клетки отмывали бессывороточной средой DMEM, ресуспендировали в той же среде с гентамицином и выращивали при +37°C и в атмосфере, содержащей 5% CO2 во флаконах 75 см2 с 15 мл среды. Рост осуществлялся в бессыворотчной среде, так как в монослойной культуре хондроциты меняют форму и биохимические свойства. Пересев производили каждые 4 дня в соотношении 1:3, клетки снимали с поверхности флакона раствором трипсин-ЭДТА с 0.02% раствором Версена.

Для трансфекции клеток биологически активной генно-терапевтической субстанцией содержащей кДНК гена TGFBR2 использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci.2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-N-(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6-Kan/Neo TGFBR2 SEQ ID No: 3 с модифицированной кДНК TGFBR2 SEQ ID No: 3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit(Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК TGFBR2 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение транскрипции TGFBR2 наблюдали на 4 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена TGFBR2.

Показано, что в хондробластах трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6-Kan/Neo TGFBR2 SEQ ID No: 3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается усиление экспрессии целевого гена TGFBR2

Пример 13.

Введение в кожу человека биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2 с целью подтверждения при этом увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в коже человека.

С целью анализа изменения количества белка рецептора II типа трансформирующего фактора роста бетта пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена TGFBR2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена TGFBR2 с транспортной молекулой (А) - в кожу предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6 TGFBR2 SEQ ID No: 4, которая содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 4), и плазмиду pCMV6-XL5, используемую в качестве плацебо - которая не содержит кДНК гена TGFBR2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Количество белка рецептора II типа трансформирующего фактора роста бетта оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, CUJA)t, как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения биологически активной генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее как описано в примере 9.

Показано, что в коже пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2, произошло увеличение количества белка рецептора II типа трансформирующего фактора роста бетта, тогда как при введении плацебо, количество белка рецептора II типа трансформирующего фактора роста бетта в коже не изменялась, что говорит об усилении экспрессии гена TGFBR2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2. Результаты отражены на фигуре 15

Пример 14.

Введение в хрящевую ткань человека биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2 с целью подтверждения при этом увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в хрящевой ткани человека.

С целью анализа изменения количества белка рецептора II типа трансформирующего фактора роста бетта пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена TGFBR2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена TGFBR2 с транспортной молекулой (А) - в хрящевую ткань ушных раковин с тыльной стороны.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCDNA 3.1 TGFBR2 SEQ ID No: 5, которая содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 5), и плазмиду pCDNA 3.1(+), используемую в качестве плацебо, которая не содержит кДНК гена TGFBR2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1-2 мм в хрящевую ткань ушных раковин с тыльной стороны. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,2 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 2-3 см друг от друга.

Количество белка рецептора II типа трансформирующего фактора роста бетта оценивали в лизатах биоптатов хрящевой ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, США)t. Как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков хрящевой ткани в зоне введения биологически активной генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, методом чрескожной пункционного биопсии при помощи одноразовой ручной биопсийной иглы, далее по примеру 9.

Показано, что в хрящевой ткани пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2, произошло увеличение количества белка рецептора II типа трансформирующего фактора роста бетта, тогда как при введении плацебо количество белка рецептора II типа трансформирующего фактора роста бетта в хрящевой ткани не изменялось, что подтверждает усиление экспрессии гена TGFBR2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2. Результаты отражены на фигуре 16.

Пример 15.

Введение в мышечную ткань человека биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2 с целью подтверждения при этом увеличения количества белка рецептора II типа трансформирующего фактора роста бетта в мышечной ткани человека.

С целью анализа изменения количества белка рецептора II типа трансформирующего фактора роста бетта пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена TGFBR2 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена TGFBR2 с транспортной молекулой (А) - в мышечную ткань икроножной мышцы.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo TGFBR2 SEQ ID No: 6, которая содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена TGFBR2, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга

Количество белка рецептора II типа трансформирующего фактора роста бетта оценивали в лизатах биоптатов мышечной ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, США)t. как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения биологически активной генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компании BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2, произошло увеличение количества белка рецептора II типа трансформирующего фактора роста бетта, тогда как при введении плацебо количество белка рецептора II типа трансформирующего фактора роста бетта в мышечной ткани не изменялась, что подтверждает усиление экспрессии гена TGFBR2 при использовании биологически активной генно-терапевтической субстанции с кДНК гена TGFBR2. Результаты отражены на фигуре 17.

Пример 16.

Введение группе различных пациентов биологически активных генно-терапевтическиих субстанций содержащих модифицированные и нативную кДНК TGFBR2.

С целью подтверждения индивидуального характера увеличения количества белка рецептора II типа трансформирующего фактора роста бетта до различного уровня при введении в кожу пациентов биологически активных генно-терапевтических субстанций с модифицированными и нативной кДНК гена TGFBR2 анализировали количественный уровень белка рецептора II типа трансформирующего фактора роста бетта в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена TGFBR2.

Последовательность нативной кДНК TGFBR2 приведена на фигуре 1, SEQ TGFBR2 ID No: 1., последовательности модифицированных кДНК TGFBR2 приведены на фигурах 2-7 (SEQ TGFBR2 ID No: 2, SEQ TGFBR2 ID No: 3, SEQ TGFBR2 ID No: 4, SEQ TGFBR2 ID No: 5, SEQ TGFBR2 ID No: 6, SEQ TGFBR2 ID No: 7).

При этом генетические конструкции, одна из которых содержит нативную кДНК гена TGFBR2 (SEQ ID No: 1), вторая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 4)), пятая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов биологически активных генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой биологически активной генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения биологически активных генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 22-х пациентов, отобранных в случайном порядке, вводили 7 биологически активных генно-терапевтических субстанций и плацебо в кожу предплечья.

Биопсийные образцы брали через 72 часа после введения биологически активных генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения биологически активных генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl pH 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

A - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6-SEQ ID No: 1, содержащий немодифицированную кДНК TGFBR2(SEQ ID No: 1.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

B - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6-SEQ ID No: 2, содержащий немодифицированную кДНК TGFBR2(SEQ ID No: 2.) по примеру 3 в сочетании с транспортной молекулой -дендримером по примеру 7.

C - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6-SEQ ID No: 3, содержащий немодифицированную кДНК TGFBR2 (SEQ ID No: 3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

D - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6-SEQ ID No: 4, содержащий немодифицированную кДНК TGFBR2 (SEQ ID No: 4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Е - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6-SEQ ID No: 5, содержащий немодифицированную кДНК TGFBR2 (SEQ ID No: 5) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

F - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6-SEQ ID No: 6, содержащий немодифицированную кДНК TGFBR2 (SEQ ID No: 6) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

G - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6-SEQ ID No: 7, содержащий немодифицированную кДНК TGFBR2(SEQ ID No: 7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащая кДНК гена TGFBR2no примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Количества белка рецептора II типа трансформирующего фактора роста бетта оценивали в девяти биоптатах кожи от каждого пациента (от A до H и в биоптате интактной кожи) через 72 часа после введения биологически активных генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, CHIA)t, как описано в Примере 8.

По итогам анализа количественного уровня белка рецептора II типа трансформирующего фактора роста бетта выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни количества белка рецептора II типа трансформирующего фактора роста бетта и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при введении немодифицированной кДНК TGFBR2. В эту группу вошли 3 биоптата из 22.

В группе 2 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при введении 1 варианта модифицированной кДНК TGFBR2. В эту группу вошли 3 биоптата из 22.

В группе 3 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при введении 2 варианта модифицированной кДНК TGFBR2. В эту группу вошли 2 биоптата из 22.

В группе 4 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при введении 3 варианта модифицированной кДНК TGFBR2. В эту группу вошли 3 биоптата из 22.

В группе 5 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при введении 4 варианта модифицированной кДНК TGFBR2. В эту группу вошли 3 биоптата из 22.

В группе 6 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при введении 5 варианта модифицированной кДНК TGFBR2. В эту группу вошли 4 биоптата из 22.

В группе 7 максимальное количество белка рецептора II типа трансформирующего фактора роста бетта, наблюдалось при введении 6 варианта модифицированной кДНК TGFBR2. В эту группу вошло 4 биоптата из 22.

Ни в одном из биоптатов не наблюдалось того, что при введении плацебо - векторной плазмиды, не содержащей кДНК гена TGFBR2 количество белка рецептора II типа трансформирующего фактора роста бетта, присутствует в максимальных количествах.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена TGFBR2.

Из данного примера следует, что достижение максимального количества белка рецептора II типа трансформирующего фактора роста бетта в биоптатах кожи различных пациентов при введении им в кожу биологически активных генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена TGFBR2, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных биологически активных генно-терапевтических субстанций в рамках линейки биологически активных генно-терапевтических субстанций.

Пример 17.

Трансфекция клеточной линии фибробластов пациента разными биологически активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК TGFBR2 с целью персонализированного выбора из линейки биологически активных генно-терапевтических субстанций наиболее эффективной биологически активной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка рецептора II типа трансформирующего фактора роста бетта в клеточных лизатах фибробластов этого пациента, трансфицированных разными биологически активными генно-терапевтическими субстанциями, содержащими нативную или модифицированные кДНК TGFBR2.

Последовательность нативной кДНК TGFBR2 приведена на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК TGFBR2 приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7).

Вырастили культуры фибробластов из биоптата пациента по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС pH 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Затем культуру фибробластов пациента разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 1, содержащей немодифицированную к ДНК TGFBR2 (SEQ ID No: 1.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. Вторую часть, обозначенную (B), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 2, содержащей вариант 1 модифицированной кДНК TGFBR2 (SEQ ID No: 2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (C), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 3, содержащей вариант 2 модифицированной кДНК TGFBR2 (SEQ ID No: 3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 4, содержащей вариант 3 модифицированной кДНК TGFBR2 (SEQ ID No: 4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 5, содержащей 4 вариант модифицированной кДНК TGFBR2 (SEQ ID No: 5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 6, содержащей вариант 5 модифицированной кДНК TGFBR2 SEQ ID No: 6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6-SEQ ID No: 7, содержащей вариант 6 модифицированной кДНК TGFBR2 (SEQ ID No: 7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК TGFBR2 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка рецептора II типа трансформирующего фактора роста бетта в клеточных лизатах фибробластов пациента проводили через 72 часа после трансфекции методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, США)t, как описано в Примере 8.

По итогам определения количества белка рецептора II типа трансформирующего фактора роста бетта в культуре фибробластов пациента выделили вариант биологически активной генно-терапевтической субстанции, при трансфекции которой наблюдается максимальное количество белка рецептора II типа трансформирующего фактора роста бетта в лизате клеточной культуры и соответственно наблюдается максимальная экспрессия гена TGFBR2. В данном эксперименте максимальное количество белка рецептора II типа трансформирующего фактора роста бетта в лизате отмечено при трансфекции биологически активной генно-терапевтической субстанцией на базе pCMV6 TGFBR2 SEQ ID No: 5, содержащей модифицированную кДНК TGFBR2, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18.

Введение в кожу пациента различных биологически активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена TGFBR2 с персонализированного целью выбора из линейки биологически активных генно-терапевтических субстанций наиболее эффективной биологически активной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали количество белка рецептора II типа трансформирующего фактора роста бетта в лизатах биоптатов кожи этого пациента, после введения ему в кожу биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена TGFBR2.

Последовательность нативной кДНК TGFBR2 приведена на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК TGFBR2 приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7)

Пациенту вводили 7 биологически активных генно-терапевтических субстанций и плацебо в кожу предплечья.

Первая биологически активная генно-терапевтическоая субстанция (A) на базе pCMV6-SEQ ID No: 1, содержащая немодифицированную кДНК TGFBR2 (SEQ ID No: 1.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая биологически активная генно-терапевтическая субстанция (В) на базе pCMV6-SEQ ID No: 2, содержащая вариант 1 модифицированной кДНК TGFBR2 (SEQ ID No: 2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

3-я биологически активная генно-терапевтическая субстанция

(C) на базе pCMV6-SEQ ID No: 3, содержащая вариант 2 модифицированной кДНК TGFBR2 (SEQ ID No: 3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

4-я биологически активная генно-терапевтическая субстанция (D) на базе pCMV6-SEQ ID No: 4, содержащая вариант 3 модифицированной кДНК TGFBR2 (SEQ ID No: 4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

5-я биологически активная генно-терапевтическая субстанция (Е) на базе pCMV6-SEQ ID No: 5, содержащая 4 вариант модифицированной кДНК TGFBR2 (SEQ ID No: 5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

6-я биологически активная генно-терапевтическая субстанция (F) на базе pCMV6-SEQ ID No: 6, содержащая вариант 5 модифицированной кДНК TGFBR2 SEQ ID No: 6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

7-я биологически активная генно-терапевтическая субстанция (G) на базе pCMV6-SEQ ID No: 7, содержащая вариант 6 модифицированной кДНК TGFBR2 (SEQ ID No: 7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

8-я - векторная плазмида pCMV6-XL5, не содержащая кДНК TGFBR2 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит нативную кДНК гена TGFBR2 (SEQ ID No: 1), вторая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 4), пятая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена TGFBR2 (SEQ ID No: 7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов биологически активных генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой биологически активной генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения биологически активных генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения биологически активных генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения биологически активных генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl pH 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Определение количества белка рецептора II типа трансформирующего фактора роста бетта определяли в девяти биоптатах кожи пациента через 72 часа после введения биологически активных генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human TGF-beta Receptor Type-2 ELISA Kit (Sigma-Aldrich, США)t, как описано в Примере 8.

По итогам определения количества белка рецептора II типа трансформирующего фактора роста бетта в лизате биоптатов кожи пациента выделили вариант биологически активной генно-терапевтической субстанции, при введении которой в кожу наблюдается максимальное количество белка рецептора II типа трансформирующего фактора роста бетта в лизате биоптата кожи и соответственно наблюдается максимальная экспрессия гена TGFBR2. В данном эксперименте максимальное количество целевого белка в лизате биоптата кожи отмечено при введении биологически активной генно-терапевтической субстанции на базе pCMV6 TGFBR2 SEQ ID No: 3, содержащей модифицированную кДНК TGFBR2, что показано на фигуре 20

Таким образом выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создана линейка биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, вследствие недостаточной экспрессии гена TGFBR2, способ ее получения и использования.

Созданная линейка биологически активных генно-терапевтических субстанций с использованием одной из модифицированных или нативной кДНК гена TGFBR2 позволяет на практике использовать входящие в линейку биологически активные генно-терапевтические субстанции для повышения до необходимого уровня количества белка рецептора II типа трансформирующего фактора роста бетта в различных клетках органов и тканей и/или органах и тканях человека.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант биологически активной генно-терапевтической субстанции из созданной линейки биологически активных генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить количество белка рецептора II типа трансформирующего фактора роста бетта в клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование биологически активной генно-терапевтической субстанции с нативной кДНК гена TGFBR2 не приводит к желаемому изменению уровня количества белка рецептора II типа трансформирующего фактора роста бетта в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена TGFBR2, приводящей к более эффективной экспрессии гена TGFBR2.

При использовании заявленной биологически активной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Линейка биологически активных генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена TGFBR2, повышая количество белка рецептора II типа трансформирующего фактора роста бетта в клетках органов и тканей и/или органах и тканях человека в частности, в лейкоцитах, или T-лимфоцитах (хелперах), или B-лимфоцитах, или моноцитах, или тромбоцитах, или мононуклеарных клетках периферической крови, или остеобластах, или остеоцитах, или хондробластах, или хондроцитах, или HK-клетках (натуральных киллерах), или адипоцитах, или миоцитах, или гладкомышечных клетках, или клетках эпителия, или клетках эндотелия, или нейронах в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в костном мозге, или коре головного мозга, или слюнных железах, или поджелудочной железе, или желудке, или тонком кишечнике, или двенадцатиперстной кишке, или толстом кишечнике, или селезенке, или бронхах, или лимфатических узлах, или молочных железах, или коже, или гладких мышцах, или сердечной мышце, или скелетных мышцах, или миндалинах, или почках, или надпочечниках, или щитовидной железе, или мочевом пузыре, или предстательной железе, или плаценте, или фаллопиевых трубах, или яичниках, или семенниках, или шейке матки, или глазе или, или его роговице и склере, или зубах, или в костной, хрящевой, мышечной, эпителиальной, эндотелиальной, нервной, жировой тканях, или эндометрии матки, или плацентарной ткани, или твердой мозговой оболочке, или крови, или дентине, или легочной ткани в сочетании с транспортной молекулой или без нее при введении этих биологически активных генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание линейки биологически активных генно-терапевтических субстанций, при использовании которых применительно к клеткам органов и тканей и/или органам и тканям человека компенсируются дефекты гена TGFBR2, влияющие на экспрессию этого гена или на количественный уровень белка рецептора II типа трансформирующего фактора роста бетта, кодируемого этим геном, а также компенсируется недостаточное количество белка рецептора II типа трансформирующего фактора роста бетта, вызванная факторами, влияющими на экспрессию гена TGFBR2.

Повышение эффективности коррекции количественного уровня белка рецептора II типа трансформирующего фактора роста бетта в клетках органов и тканей человека достигают за счет того, что при недостаточном количестве этого белка вследствие дефекта гена TGFBR2 используют не белок, а генетическую конструкцию с кДНК гена TGFBR2, кодирующую этот белок. При введении генетических конструкций в отличие от введения непосредственно белка, как в прототипе, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Промышленная применимость

Все приведенные примеры по созданию и использованию созданной линейки биологически активных генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр, мкл - микролитр

л - литр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е.ф - относительная единица флуоресценции

БАГТС - биологически активная генно-терапевтическая субстанция.

1. Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена TGFBR2, связанных с количественным снижением белка TGFBR2, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани, представляющее собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генотерапевтическую субстанцию, выбранную из группы генотерапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена TGFBR2, с кодирующей последовательностью белка TGFBR2, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена TGFBR2, SEQ ID No: 1, или модифицированной кДНК гена TGFBR2, при этом в качестве модифицированной кДНК гена TGFBR2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, и содержащей также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках органов и тканей человека и способную обеспечить высокий уровень экспрессии гена TGFBR2 и увеличить количество белка трансформирующего фактора роста бета-1 в клетках органов и тканей и/или органах и тканях человека, в сочетании с транспортной молекулой или без нее.

2. Средство по п. 1, отличающееся тем, что каждая из совокупности созданных генетических конструкций с кДНК гена TGFBR2 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена TGFBR2, которая несет модификации, не затрагивающие структуру белка трансформирующего фактора роста бета-1, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

3. Средство по п. 1, отличающееся тем, что в каждой из совокупности созданных биологически активных генотерапевтических субстанций в качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блок-сополимеры.

4. Способ получения средства по п. 1, заключающийся в том, что получают кДНК гена TGFBR2, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена TGFBR2, SEQ ID No: 1, или кДНК гена TGFBR2, или кДНК гена TGFBR2 SEQ ID No: 2, или кДНК гена TGFBR2 SEQ ID No: 3, или кДНК гена TGFBR2 SEQ ID No: 4, или кДНК гена TGFBR2 SEQ ID No: 5, или кДНК гена TGFB1 SEQ ID No: 6, или кДНК гена TGFBR2 SEQ ID No: 7.

5. Способ использования средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена TGFBR2, связанных с количественным снижением белка TGFBR2 по п. 1, заключающийся в трансфекции выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в совокупности биологически активных генотерапевтических субстанций в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из совокупности созданных генно-терапевтических субстанций, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/выбранных из группы созданных генно-терапевтических субстанций, или сочетанием обозначенных способов.



 

Похожие патенты:

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена COL1A1, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани человека, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генотерапевтическую субстанцию, выбранную из группы генотерапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена COL1A1, с кодирующей последовательностью белка альфа-1 цепи коллагена I типа, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, клеток эпителия слизистой оболочки полости рта; органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CLCA2 с кодирующей последовательностью белка хлоридного кальций-активируемого канала-2, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена TGFB1, связанных с количественным снижением белка трансформирующего фактора роста бета-1, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена TGFB1, с кодирующей последовательностью белка трансформирующего фактора роста бета-1, с делециями 5' и 3'-нетранслируемых областей, и содержащей также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена GPX3, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, причем каждая из совокупности биологически активных генно-терапевтических субстанций представляет собой генетическую конструкцию на основе векторной плазмиды, включающую участок кДНК гена GPX3 и содержащую также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, а именно в клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена SOD2, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена SOD2, с кодирующей последовательностью белка супероксиддисмутазы-1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена SOD2 SEQ ID No: 1, или модифицированной кДНК гена SOD2, при этом в качестве модифицированной кДНК гена SOD2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, органов и тканей человека, в сочетании с транспортной молекулой или без нее.

Изобретение относится к области биохимии, в частности к нуклеиновой кислоте, кодирующей белок слияния из многих субъединиц гликолатдегидрогеназы, а также трансгенной клетке растения, трансгенному растению и трансгенному семени, содержащим вышеуказанную нуклеиновую кислоту.

Изобретение относится к биотехнологии. Описана молекула нуклеиновой кислоты, содержащая двухцепочечную структуру,где двухцепочечная структура образована первой цепью и второй цепью, где первая цепь состоит из следующей нуклеотидной последовательности:5'-acGaGcUgGaCcAcUgGuCdTSdT-3' и вторая цепь состоит из следующей нуклеотидной последовательности:5'-GAcCaGuGgUcCaGcUcGudTSdT-3', где то, что нуклеотид указан строчной буквой, указывает на то, что нуклеотид является 2'-F-модифицированным, и подчеркивание нуклеотида указывает на то, что нуклеотид является 2'-O-метил-модифицированным и где dTSdT указывает на то, что на 3'-конце присоединен динуклеотид, состоящий из двух нуклеотидов dT, где указанные два dT ковалентно связаны посредством фосфотиоатной связи.

Настоящее изобретение относится к биохимии, генной инженерии и биотехнологии, в частности к новым полипептидам с антимикробной активностью в отношении энтерогеморрагических бактерий вида Escherichia coli.

Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 55-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 14-го – 34-го или 15-го – 34-го нуклеотидов, считая от 5'-конца 55-го экзона гена дистрофина человека.

Изобретение относится к области биохимии и молекулярно-генетической диагностики, в частности к способу выявления у субъекта предрасположенности к развитию панического расстройства.

Изобретение относится к медицине и предназначено для лечения миелодиспластического синдрома (МДС), где МДС выбирают из подгруппы МДС с низким риском по IPSS и/или подгруппы МДС с промежуточным-1 (int-1) риском.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, клеток эпителия слизистой оболочки полости рта; органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CLCA2 с кодирующей последовательностью белка хлоридного кальций-активируемого канала-2, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее.

Изобретение относится к новому кристаллическому материалу в одной кристаллической фазе, представляющему собой многокомпонентный сокристалл (a) гидрохлорида нилотиниба и (b) компонента, выбранного из фумаровой кислоты, малеиновой кислоты, янтарной кислоты, гентизиновой кислоты, метилового эфира галловой кислоты и изоникотинамида, или (a) нилотиниба, гидрохлорида нилотиниба или смеси нилотиниба и гидрохлорида нилотиниба и (b) компонента, выбранного из 1,5-нафталиндисульфоновой кислоты.

Изобретение относится к новым соединениям в ряду 1,2,3-замещенных солей бензимидазолия, а именно к бромидам 1,2,3-три и 1,2,3,5-замещенных бензимидазолия общей формулы I .Технический результат: получены новые соединения, обладающие ингибиторными свойствами в отношении протеин-тирозинфосфатазы типа 1B (РТР1В), которые могут быть использованы для борьбы с PTP1B-опосредованными заболеваниями.

Группа изобретений относится к биотехнологии, в частности к иммунологии, и может быть использована для получения рекомбинантного моноклонального биспецифического антитела против CD3*CD19.

Изобретение относится к биотехнологии. Описана молекула нуклеиновой кислоты, содержащая двухцепочечную структуру,где двухцепочечная структура образована первой цепью и второй цепью, где первая цепь состоит из следующей нуклеотидной последовательности:5'-acGaGcUgGaCcAcUgGuCdTSdT-3' и вторая цепь состоит из следующей нуклеотидной последовательности:5'-GAcCaGuGgUcCaGcUcGudTSdT-3', где то, что нуклеотид указан строчной буквой, указывает на то, что нуклеотид является 2'-F-модифицированным, и подчеркивание нуклеотида указывает на то, что нуклеотид является 2'-O-метил-модифицированным и где dTSdT указывает на то, что на 3'-конце присоединен динуклеотид, состоящий из двух нуклеотидов dT, где указанные два dT ковалентно связаны посредством фосфотиоатной связи.

Настоящая группа изобретений относится к медицине, а именно к онкологии, и касается лечения рака. Для этого идентифицируют опухоли, чувствительные к лечению акситинибом.

Группа изобретений относится к области медицины, а именно к фармацевтической комбинации, включающей: соединение (S)-пирролидин-1,2-дикарбоновой кислоты 2-амид 1-({4-метил-5-[2-(2,2,2-трифтор-1,1-диметилэтил)пиридин-4-ил]тиазол-2-ил}амид) или его фармацевтически приемлемую соль, и по меньшей мере один ингибитор ароматазы, выбранный из летрозола или экземестана, или его фармацевтически приемлемую соль для одновременного, раздельного или последовательного применения для лечения рака; а также к применению комбинации для лечения рака; к способу лечения рака; к набору и синергетической комбинации.

Изобретение раскрывает новые соединения замещенных пиразолонов формулы (I) и их фармацевтически приемлемые соли, которые ингибируют активность протеин тирозинкиназы и модулируют клеточную активность, например быстрое увеличение, дифференцирование, апоптоз, миграцию и инвазию.

Настоящее изобретение относится к биотехнологии и медицине, в частности к моноклональному антителу, которое специфично связывается с CEACAM1 человека. Настоящее изобретение также раскрывает полинуклеотид, кодирующий указанное антитело, плазмиду для его продукции, фармацевтическую и диагностическую композиции для лечения злокачественного новообразования, характеризующегося сверхэкспрессией CEACAM1, и для детекции CEACAM1 человека у индивидуума соответственно.

Изобретение относится к новой кристаллической форме В (S)-4-амино-N-(1-(4-хлорфенил)-3-гидроксипропил)-1-(7Н-пирроло[2,3-d]-пиримидин-4-ил)пиперидин-4-карбоксамида (соединение (I), проявляющей ингибирующую активность в отношении PKB (протеинкиназы В). Соединение может быть использовано для лечения рака или для приготовления лекарственного средства для лечения, опосредованного активностью PKB, в частности рака молочной железы, рака предстательной железы или рака желудка. Изобретение также относится к фармацевтической композиция, пригодной для лечения рака, опосредованного активностью PKB, содержащей соединение (I) в кристаллической форме В в терапевтически эффективном количестве, возможно вместе с микрокристаллической целлюлозой, маннитом, кроскармеллозой натрия и стеаратом магния. Кристаллическая форма В имеет картину дифракции рентгеновских лучей на порошке по меньшей мере с тремя характерными пиками при 2-тета примерно равном 12,3, 15,0 и 19,2°, в частности картину дифракции рентгеновских лучей на порошке с характерными пиками при 2-тета примерно равном 10,0, 12,3, 15,0, 17,1, 19,2 и 24,4°. Кристаллическая форма В термодинамически является более стабильной, чем другие кристаллические формы, и более предпочтительной с точки зрения продолжительности срока годности продукта и минимизации вариабельности в абсорбции. 4 н. и 5 з.п. ф-лы, 8 ил., 6 табл., 3 пр.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей иили органов и тканей человека на основе гена TGFBR2, связанных с количественным снижением белка TGFBR2, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генотерапевтическую субстанцию, выбранную из группы генотерапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена TGFBR2, с кодирующей последовательностью белка TGFBR2, с делециями 5 и 3-нетранслируемых областей, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для коррекции патологических состояний клеток органов и тканей иили органов и тканей человека, на основе гена TGFBR2, связанных с количественным снижением белка TGFBR2. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

Наверх