Композиция для предотвращения запахов, содержащая не имеющие запах микроорганизмы, и ее применение

Группа изобретений относится к биотехнологии. Предложены композиция, включающая штаммы нескольких культур микроорганизмов, применение указанной композиции, способ нанесения композиции, способ предотвращения запаха, способ проверки запаха в системе кондиционирования воздуха транспортного средства, предусматривающие нанесение композиции на сердцевину испарителя в концентрации 104-108 КОЕ/г, а также 14 штаммов, относящихся к видам микроорганизмов, входящим в состав композиции. Изобретения обеспечивают эффективное предотвращение запаха из системы кондиционирования воздуха транспортного средства. 18 н. и 11 з.п. ф-лы, 19 ил., 12 табл., 14 пр.

 

УРОВЕНЬ ТЕХНИКИ

(a) Область техники

Изобретение относится к композиции для предотвращения запахов, содержащей не имеющие запах микроорганизмы или их культуру, и способу предотвращения запахов с их применением.

(b) Уровень техники изобретения

Чистый воздух признан неотъемлемым компонентом для здоровья и благосостояния человека. Неприятно пахнущий или загрязненный воздух значительно портит приятную атмосферу. Например, неудовлетворительное качество воздуха в помещении при условиях герметичности обусловлено двумя важными факторами. Одним из них являются загрязнители воздуха, генерируемые непосредственно материалами, которые составляют воздухонепроницаемую среду (например, здание, транспортное средство и т.д.), а другой - это запах, генерируемый в результате деятельности человека или обусловленный внешними веществами системы кондиционирования воздуха.

Система кондиционирования воздуха относится к системе, разработанной для снижения температуры внутри помещения и оптимизации атмосферы внутри помещения в зданиях, транспортных средствах, поездах, кораблях, воздушных суднах и т.д. с целью кондиционирования температуры, влажности, скорости потока и чистоты воздуха. С улучшением уровня жизни применение системы кондиционирования воздуха постепенно увеличивается. Несмотря на большое количество улучшений в основной функции системы кондиционирования воздуха еще предстоит решить много проблем в экологическом аспекте качества воздуха в помещениях.

Причиной запаха в системе кондиционирования воздуха, в частности кондиционере, как известно, являются метаболиты, продуцируемые плесневыми грибами и бактериями. Однако конкретно еще не идентифицировано, какие плесневые грибы и бактерии продуцируют какое количество данных метаболитов.

В системе кондиционирования воздуха весь воздух, который проходит через вентилятор, проходит сердцевину испарителя. Во время теплообмена между холодным охлаждающим веществом и воздухом на поверхности сердцевины испарителя вследствие разницы температур происходит конденсация воды. Когда конденсации воды продолжается, создается окружающая среда, благоприятная для заселения и пролиферации плесневых грибов и бактерий на сердцевине испарителя. Если плесневые грибы и бактерии размножаются на сердцевине испарителя, на которую воздействует наружный воздух, микроорганизмы продуцируют в качестве метаболитов микробные летучие органические соединения (mVOC). Таким образом, когда воздух, который проходит через сердцевину испарителя, дует внутри помещений, внутренняя часть помещения может подвергаться неприятному запаху вследствие летучих органических соединений, продуцируемых плесневыми грибами и бактериями после длительного использования.

После длительного использования поверхность сердцевины испарителя покрыта биопленкой, которая состоит из бактерий, скоплений клеток и внеклеточных полимерных веществ (EPS). EPS включают в себя различные компоненты, такие как белки, полисахариды, полиуроновые кислоты, нуклеиновые кислоты, липиды и т.д. На поверхности сердцевины испарителя различные бактерии и плесневые грибы пролиферируют вместе с биопленкой в качестве питательной среды и продуцируют различные микробные летучие органические соединения (mVOC) в качестве метаболитов, которые известны как причины скверного запаха кондиционера воздуха.

Хотя различные типы ароматических веществ являются коммерчески доступными для устранения данного неприятного запаха, они не устраняют коренным образом плесневые грибы и бактерии, пролиферирующие на сердцевине испарителя, а всего лишь временно разбавляют неприятный запах. Также антибактериальные агенты, которые являются коммерчески доступными в настоящее время, не разработаны для действия конкретно на отдельные плесневые грибы или бактерии, пролиферирующие на сердцевине испарителя, но их применяют, потому что считается, что они обладают антибактериальным действием против основных патогенных микроорганизмов.

Авторы представленного изобретения раскрыли в патентной публикации Кореи № 10-2012-0020309 способ изготовления сердцевины испарителя, покрытой биопленкой, образованной специальными микроорганизмами, которые не имеют запаха или аромата для предотвращения прикрепления и роста бактерий и плесневых грибов, которые вызывают неприятный запах на сердцевине испарителя.

Однако не было идентифицировано, какие бактерии являются не имеющими запаха микроорганизмами. Также не было ясно показано, могут ли они выживать на сердцевине испарителя после нанесения на него и могут ли предотвратить заселение микроорганизмов, вызывающих неприятный запах, и вследствие этого могут ли предотвращать неприятный запах.

Описание выше уровня техники данной области предназначено только для улучшения понимания уровня техники представленного изобретения и не должно истолковываться как признание, что описанные выше методики являются известными рядовым специалистам в области техники, к которой относится представленное изобретение.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Авторы представленного изобретения предприняли усилия, чтобы найти способ эффективного контроля микроорганизмов, вызывающих неприятный запах, с применением не имеющих запаха микроорганизмов. В результате авторы успешно провели скрининг 13 разновидностей микроорганизмов, которые не вызывают неприятный запах в системе кондиционирования воздуха, и подтвердили, что когда биопленку образуют с применением их или их комбинации, рост вызывающих неприятный запах микроорганизмов можно предотвратить, и, таким образом, неприятный запах можно предотвратить.

Представленное изобретение направлено на предоставление композиции для предотвращения запахов, которая содержит не имеющие запаха микроорганизмы или их культуру.

Представленное изобретение также направлено на предоставление сердцевины испарителя, покрытого композицией для предотвращения запахов.

Представленное изобретение также направлено на предоставление способа изготовления не имеющей запаха сердцевины испарителя, которая не вызывает запах в системе кондиционирования воздуха, который включает нанесение композиции для предотвращения запахов на сердцевину испарителя.

Представленное изобретение также направлено на предоставление способа предотвращения запахов из системы кондиционирования воздуха, который включает нанесение композиции для предотвращения запахов на сердцевине испарителя.

Представленное изобретение также направлено на предоставление способа проверки запахов из системы кондиционирования воздуха, который включает нанесение композиции для предотвращения запахов на сердцевину испарителя.

Представленное изобретение также направлено на предоставление не имеющих запаха микроорганизмов для покрытия сердцевины испарителя для предотвращения запахов из системы кондиционирования воздуха.

Другие цели и преимущества представленного изобретения будут очевидны из следующего подробного описания, чертежей и формулы изобретения.

В одном аспекте представленное изобретение предоставляет композицию для предотвращения запахов, которая содержит не имеющие запаха микроорганизмы или их культуру.

Авторы представленного изобретения предприняли усилия, чтобы найти способ эффективного контроля микроорганизмов, вызывающих неприятный запах, с применением не имеющих запаха микроорганизмов. В частности, авторы пытались искоренить принципиальную причину неприятных запахов из системы кондиционирования воздуха. В результате авторы успешно провели скрининг 13 разновидностей микроорганизмов, которые не вызывают неприятный запах в системе кондиционирования воздуха, и подтвердили, что когда биопленку образуют с применением их или их комбинации, рост вызывающих неприятный запах микроорганизмов можно предотвратить, и, таким образом, неприятный запах можно предотвратить.

В представленном изобретении термин «система кондиционирования воздуха» относится к системе, которая поддерживает температуру, влажность, чистоту, поток и т.д. воздуха внутреннего пространства, которое полностью или частично изолировано от внешней среды. В качестве предпочтительного примера, изолированное пространство может являться внутренним пространством, которое полностью или частично изолировано от внешней среды, такое как внутри здания, транспортного средства, поезда, корабля, воздушного судна и т.д. В качестве предпочтительного примера, системой кондиционирования воздуха может быть кондиционер воздуха.

В системе кондиционирования воздуха весь воздух, который проходит через вентилятор, проходит сердцевину испарителя. На поверхности сердцевины испарителя создаются благоприятные условия для роста микроорганизмов в виде конденсации воды вследствие того, что сохраняется разница температур. В результате со временем образуется биопленка. Микроорганизмы метаболизируют различные вещества, витающие в воздухе внутри помещений или вне помещения, в качестве питательных веществ и продуцируют различные микробные летучие органические соединения (mVOC) в виде метаболитов, которые выделяют скверный запах.

Биопленка представляет собой группу живых микроорганизмов, заключенных в мембрану. Мембрана защищает микроорганизмы от внешней среды и снабжает питательными веществами. Мембрана состоит из внеклеточных полимерных веществ (EPS), которые включают в себя различные компоненты, такие как белки, полисахариды, полиуроновые кислоты, нуклеиновые кислоты, липиды и т.д. На поверхности сердцевины испарителя пролиферируют разнообразные микроорганизмы, используя их в качестве питательных веществ, и продуцируют метаболиты, которые выделяют неприятный запах.

Авторы представленного изобретения провели скрининг микроорганизмов, которые не вызывают неприятный запах из сердцевины испарителя, и посредством культивирования выделили доминирующие штаммы, которые образуют колонии микроорганизмов. Доминирующие штаммы могут быть выделены и культивированы, согласно различным способам, известным в предшествующем уровне техники, и можно было провести скрининг доминирующих микроорганизмов, например, основываясь на степени разбавления или морфологических характеристиках, таких как цвет, размер, форма и т.д., колоний.

Доминирующие микроорганизмы включают в себя Methylobacterium, Acinetobacter, Bacillus, Brevibacillus, Deinococcus, Pseudomonas, Sphingomonas или Flavobacterium, конкретно Methylobacterium aquaticum, Methylobacterium brachiatum, Methylobacterium platani, Acinetobacter johnsonii, Bacillus vietnamensis, Brevibacillus invocatus, Deinococcus ficus, Leifsonia soli, Pseudomonas nitroreducens, Sphingomonas aquatilis, Methylobacterium komagatae, Deinococcus apachensis или Flavobacterium oceanosedimentum.

Данные микроорганизмы помещали в Корейский Центр культивирования микроорганизмов 14 ноября 2012 года или 10 декабря 2013 года, и им были даны следующие учетные номера: Methylobacterium aquaticum HKMC-1 (Учетный номер: KCCM11325P), Methylobacterium brachiatum HKMC-2 (Учетный номер: KCCM11326P), Methylobacterium platani HKMC-3 (Учетный номер: KCCM11327P), Acinetobacter johnsonii HKMC-4 (Учетный номер: KCCM11328P), Bacillus vietnamensis HKMC-5 (Учетный номер: KCCM11329P), Brevibacillus invocatus HKMC-6 (Учетный номер: KCCM11330P), Deinococcus ficus HKMC-7 (Учетный номер: KCCM11331P), Leifsonia soli HKMC-8 (Учетный номер: KCCM11332P), Pseudomonas nitroreducens HKMC-9 (Учетный номер: KCCM11333P), Sphingomonas aquatilis HKMC-10 (Учетный номер: KCCM11334P), Methylobacterium komagatae HKMC-11 (Учетный номер: KCCM11335P), Deinococcus apachensis HKMC-12 (Учетный номер: KCCM11499P) и Flavobacterium oceanosedimentum HKMC-13 (Учетный номер: KCCM11500P).

Микроорганизмы могут быть включены в композицию для предотвращения запахов по отдельности или в комбинации с другими микроорганизмами.

Композицию для предотвращения запахов по настоящему изобретению можно применять для предотвращения заселения продуцирующих неприятный запах микроорганизмов и/или неприятных запахов, продуцируемых ими. Другими словами, композицию по настоящему изобретению можно применять для предотвращения заселения продуцирующих неприятный запах микроорганизмов посредством нанесения или распыления на все или отдельные части продуцирующих неприятный запах устройств (например, системы кондиционирования воздуха, блока обработки использованной воды и т.д.), изделий (например, мусорной корзины, туалетного бачка и т.д.), животных (например, загрязненного домашнего скота и т.д.) или тела человека (например, ротовая полость, диабетическая стопа и т.д.).

Композиция для предотвращения запахов по настоящему изобретению может дополнительно содержать различные средовые компоненты, известные в предшествующем уровне техники, для улучшения образования биопленки на различных объектах. Средовые компоненты могут включать в себя, например, агар, желатин, альгинат, каррагинан или пектин. Конкретно, для сердцевины испарителя в системе кондиционирования воздуха можно применять среду PTYG, среду R2A или среду LB.

Композиция для предотвращения запахов по настоящему изобретению может дополнительно содержать, в дополнение к не имеющим запаха микроорганизмам, ароматическое вещество, стерилизующий агент, противомикробный агент и т.д. для предотвращения неприятных запахов или для предотвращения или устранения продуцирующих неприятный запах микроорганизмов.

В предпочтительном иллюстративном варианте осуществления представленного изобретения композиция представленного изобретения предназначена для предотвращения запахов из системы кондиционирования воздуха.

Система кондиционирования воздуха, к которой применима композиция по настоящему изобретению, может быть установлена в зданиях, транспортных средствах, поездах, кораблях, воздушных суднах и т.д. с целью кондиционирования температуры, влажности, скорости потока или чистоты воздуха.

Объектом, на который наносится биопленка по настоящему изобретению, может быть система кондиционирования воздуха. Система кондиционирования воздуха включает в себя компрессор, вентилятор, сердцевину испарителя и т.д. Конкретно, объектом, на который наносится биопленка по настоящему изобретению, может быть сердцевина испарителя.

В частности, среда, благоприятная для заселения и пролиферации микроорганизмов, создается на поверхности сердцевины испарителя в системе кондиционирования воздуха вследствие теплообмена воздуха. Со временем микроорганизмы, заселившиеся на поверхности, образуют стабильную биопленку, которую трудно удалить. Другими словами, не имеющие запаха микроорганизмы могут пролиферировать заблаговременно, так чтобы можно было предотвратить заселение продуцирующих неприятный запах микроорганизмов.

Авторы представленного изобретения обнаружили, что биопленка, состоящая только из не имеющих запаха микроорганизмов, которые представляют собой доминирующие виды или обладают наилучшей жизнеспособностью, может быть образована на сердцевине испарителя посредством заблаговременного их нанесения на сердцевину испарителя системы кондиционирования воздуха, и, тем самым, неприятные запахи и пролиферацию и заселение других продуцирующих неприятный запах микроорганизмов можно в значительной степени предотвратить (Примеры 9-14).

В еще одном аспекте представленное изобретение предоставляет сердцевину испарителя, покрытую композицией для предотвращения запахов, и способ ее изготовления.

Пластина сердцевины испарителя изготовлена из алюминия или сплава алюминия, а сердцевина испарителя изготовлена с применением обработанного антибактериальным составом алюминия или необработанного антибактериальным составом сплава алюминия. Однако материал сердцевины испарителя не ограничен алюминием или сплавом алюминия. В целом сердцевина испарителя может быть изготовлена из любого металла, обладающего хорошей теплопроводностью и высокой стойкостью к коррозии, такого как медь, в дополнение к алюминию или его сплаву. В электрическом транспортном средстве, например, теплообменник может быть соединен с устройством Пельтье. Подобно этому может быть использован любой материал, пока не будет достигнута структура, делающая возможным легкое осуществление теплообмена.

Композиция для предотвращения запахов, содержащая не имеющие запаха микроорганизмы или их культуру, может быть нанесена на сердцевину испарителя, согласно различным способам, известным в предшествующем уровне техники (например, распыление, покрытие, погружение). Предпочтительно, сердцевина испарителя может быть погружена в культуру не имеющих запаха микроорганизмов, так чтобы не имеющие запаха микроорганизмы могли быть равномерно нанесены на пластину внутри сердцевины испарителя. Покрытие может выполняться однократно или несколько раз.

Культура не имеющих запаха микроорганизмов может иметь оптическую плотность (O.D.), составляющую 0,3-0,9, более предпочтительно 0,4-0,8.

При применении культуры микроорганизмов, имеющей значение O.D., составляющее 0,3-0,9, микроорганизмы могут быть нанесены в концентрации, составляющей 104-108 КОЕ/г. И при применении культуры микроорганизмов, имеющей значение O.D., составляющее 0,4-0,89, микроорганизмы могут быть нанесены в концентрации, составляющей 105-107 КОЕ/г. Учитывая, что концентрация микроорганизмов, представленных на сердцевине испарителя в используемом транспортном средстве, составляет приблизительно 106 КОЕ/г, микроорганизмы можно предпочтительно наносить в концентрации, составляющей 105-107 КОЕ/г, с применением культуры микроорганизмов, обладающей значением O.D., составляющим 0,4-0,8.

Нанесенные не имеющие запаха микроорганизмы могут образовывать биопленку, которая является стабильной в течение длительного времени (30 дней или долее, 60 дней или долее, или 90 дней или долее), будучи равномерно распределенной и заселяющей поверхность сердцевины испарителя (Примеры 11-13).

В еще одном аспекте представленное изобретение предоставляет способ предотвращения запахов из системы кондиционирования воздуха, включающий нанесение композиции для предотвращения запахов на сердцевине испарителя.

Авторы представленного изобретения провели эксперименты после установки стенда на крыше транспортного средства, а затем монтажа на ней сердцевины испарителя, покрытого композицией представленного изобретения, для того чтобы исследовать, может ли сердцевина испарителя сохранять популяцию не имеющих запаха микроорганизмов в условиях внешнего воздуха, и предотвратить заселение других продуцирующих неприятный запах микроорганизмов. В результате было обнаружено, что популяция не имеющих запаха микроорганизмов, нанесенная первоначально, сохранялась в течение 60 дней, а экзогенные микроорганизмы, которые способны продуцировать неприятный запах, не были выявлены (Пример 14).

Соответственно, когда биопленка образована посредством нанесения композиции для предотвращения запахов, содержащей не имеющие запаха микроорганизмы по настоящему изобретению, приток и заселение экзогенных микроорганизмов, которые способны продуцировать неприятные запахи, могут быть в значительной степени предотвращены, и, таким образом, неприятные запахи из системы кондиционирования воздуха могут быть в значительной степени предотвращены.

В еще одном аспекте представленное изобретение предоставляет способ, контролирующий запахи из системы кондиционирования воздуха, включающий нанесение композиции для предотвращения запахов на сердцевину испарителя.

Продуцируют ли микроорганизмы, содержащиеся в композиции для предотвращения запахов, запахи, фактически может зависеть от компонентов источника питания, которые метаболизируют микроорганизмы. Вследствие этого, является важным, чтобы микроорганизмы не продуцировали запахи при снабжении источниками питания в смежных промышленных областях.

В случае системы кондиционирования воздуха микроорганизмы метаболизируют различные вещества, витающие в воздухе внутри помещений и вне помещений в качестве питательных веществ. Другими словами, источниками питания микроорганизмов являются загрязнители внутреннего и наружного воздуха или компоненты отработанных газов (нефтяное топливо, такое как бензин, дизельное топливо, сжиженный углеводородный газ и т.д.). Соответственно, можно проверить заранее, будут ли выделяться запахи из системы кондиционирования воздуха в реальной промышленной установке, посредством введения данных источников питания в сердцевину испарителя с нанесенными микроорганизмами.

В еще одном аспекте представленное изобретение предоставляет Methylobacterium aquaticum HKMC-1 (Учетный номер: KCCM11325P), Methylobacterium brachiatum HKMC-2 (Учетный номер: KCCM11326P), Methylobacterium platani HKMC-3 (Учетный номер: KCCM11327P), Acinetobacter johnsonii HKMC-4 (Учетный номер: KCCM11328P), Bacillus vietnamensis HKMC-5 (Учетный номер: KCCM11329P), Brevibacillus invocatus HKMC-6 (Учетный номер: KCCM11330P), Deinococcus ficus HKMC-7 (Учетный номер: KCCM11331P), Leifsonia soli HKMC-8 (Учетный номер: KCCM11332P), Pseudomonas nitroreducens HKMC-9 (Учетный номер: KCCM11333P), Sphingomonas aquatilis HKMC-10 (Учетный номер: KCCM11334P), Methylobacterium komagatae HKMC-11 (Учетный номер: KCCM11335P), Deinococcus apachensis HKMC-12 (Учетный номер: KCCM11499P) или Flavobacterium oceanosedimentum HKMC-13 (Учетный номер: KCCM11500P) в качестве микроорганизмов для покрытия сердцевины испарителя для предотвращения запахов из системы кондиционирования воздуха.

Данные микроорганизмы можно применять для покрытия сердцевины испарителя для предотвращения запахов из системы кондиционирования воздуха либо по отдельности, либо в комбинации.

Свойства и преимущества представленного раскрытия можно суммировать в виде следующего:

(i) Представленное изобретение предоставляет композицию для предотвращения запахов, которая содержит не имеющие запаха микроорганизмы или их культуру.

(ii) Представленное изобретение также предоставляет сердцевину испарителя, которая покрыта композицией для предотвращения запахов, и способ ее изготовления.

(iii) В дополнение, представленное изобретение предоставляет способ предотвращения запахов, который включает нанесение композиции для предотвращения запахов на сердцевину испарителя.

(iv) Когда биопленка образована посредством нанесения композиции для предотвращения запахов по настоящему изобретению на объект, который может заселить продуцирующий неприятный запах микроорганизм, неприятные запахи можно в значительной степени эффективно предотвратить посредством предотвращения притока и заселения продуцирующих неприятный запах экзогенных микроорганизмов.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

ФИГ. 1 показывает чашку Петри, в которой стерилизованная алюминиевая пластина погружена в питательную среду для инокуляции не имеющих запаха микроорганизмов.

ФИГ. 2 показывает популяцию колоний различных цветов для комбинации 1 в оценке выживаемости в течение 30 дней.

ФИГ. 3 показывает соотношение колоний различных цветов для комбинации 1 в оценке выживаемости в течение 30 дней.

ФИГ. 4 показывает соотношение штаммов для комбинации 1 в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 5 показывает соотношение штаммов для комбинации 2 в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 6 показывает соотношение штаммов для комбинации 3 в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 7 показывает соотношение штаммов Methylobacterium sp. для комбинации 3 в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 8 показывает соотношение штаммов для комбинации 4 в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 9 показывает соотношение штаммов для комбинации 5 в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 10 показывает соотношение штаммов для комбинации А в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 11 показывает соотношение штаммов для комбинации B в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 12 показывает соотношение штаммов для комбинации C в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 13 показывает соотношение штаммов для комбинации D в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 14 показывает соотношение штаммов для комбинации E в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 15 показывает соотношение штаммов для комбинации F в оценке выживаемости в течение 30 дней, измеренной с помощью rep-ПЦР.

ФИГ. 16 показывает популяцию комбинации Methylobacterium aquaticum и Methylobacterium komagatae в оценке выживаемости в течение 90 дней.

ФИГ. 17 показывает соотношение штаммов для комбинации Methylobacterium aquaticum и Methylobacterium komagatae в оценке выживаемости в течение 90 дней, измеренной с помощью rep-ПЦР.

ФИГ. 18 показывает популяцию комбинации Methylobacterium aquaticum и Methylobacterium komagatae на стенде.

ФИГ. 19 показывает изменение в популяции комбинации Methylobacterium aquaticum и Methylobacterium komagatae на стенде, измеренное с помощью rep-ПЦР.

ПОДРОБНОЕ ОПИСАНИЕ

Здесь и далее представленное изобретение описано более подробно с помощью примеров. Следующие примеры предназначены только для иллюстративных целей, и квалифицированным или рядовым специалистам в данной области техники должно быть понятно, что объем правовых притязаний данного изобретения не ограничивается примерами.

ПРИМЕРЫ

Пример 1: Используемые транспортные средства, выделяющие неприятные запахи

Таблица 1
Транспортное средство Тип образца
1 Транспортное средство А Сердцевина испарителя
2 Транспортное средство B Сердцевина испарителя
3 Транспортное средство C Сердцевина испарителя
4 Транспортное средство D Сердцевина испарителя
5 Транспортное средство E Сердцевина испарителя

Образцы сердцевин испарителя были взяты из сердцевин испарителей, установленных в 5 используемых транспортных средствах (транспортные средства A-E), выделяющих неприятные запахи.

Пример 2: Подготовка образцов сердцевин испарителей

Образцы сердцевины испарителя, взятые из сердцевин испарителей использовавшихся транспортных средств A-E, хранили в герметичных полиэтиленовых мешках при 4°C до применения. Для выделения и культивирования микроорганизмов 5 г образцов пластин взяли из различных частей каждой сердцевины испарителя, включая передние и задние части, с применением стерилизованных длинноносых плоскогубцев, а затем смешали перед применением.

Пример 3: Выделение микроорганизмов из сердцевин испарителей

Микроорганизмы выделяли из сердцевин испарителей, как указано далее.

1. Образцы, взятые из сердцевины испарителя, смешали и поместили в смеситель.

2. В смеситель добавили 200 мл стерилизованного 1x фосфатно-солевого буферного раствора (PBS).

3. Смешанные образцы и PBS смешивали в течение 30 секунд.

4. Смеситель был оставлен на льду в течение 1 минуты.

5. Стадии 3 и 4 повторяли более 2 раз.

6. Получившуюся в результате суспензию центрифугировали при 4°C в течение 3 минут при 13000 об/мин.

7. Взяли только супернатант и перенесли его в новую пробирку.

8. Поверхность сердцевины испарителя, с которой взяли образцы, протерли несколько раз стерилизованной ватной палочкой, пропитанной супернатантом.

9. Головку ватной палочки поместили в супернатант, а затем перемешали вихревым способом.

10. Осадок, полученный в стадии 6, и смесь, полученную на стадии 9, смешали и применяли в качестве инокуляционного раствора.

Микроорганизмы физически выделили из сердцевин испарителей транспортных средств A-E с помощью стадий 1-10.

Пример 4: Выделение и культивирование микроорганизмов

Аэробные гетеротрофные бактерии, обычно называемые нормальными бактериями, выделили из кондиционера воздуха посредством культивирования на гетеротрофной пластинке. Для выделения нормальных бактерий в качестве комплексных питательных сред применяли агаровую среду PTYG и агаровую среду R2A. Агаровую среду PTYG приготовили путем добавления 0,25 г пептона (Difco), 0,25 г триптона (Difco), 0,5 г дрожжевого экстракта (Difco), 0,5 г глюкозы (Difco), 30 мг MgSO4 (Sigma), 3 мг CaCl2 (Sigma) и 15 г бактоагара (Difco) к 980 мл дистиллированной воды и стерилизовали при 121°C в течение 15 минут под высоким давлением после регулирования pH до 7,0. Агаровую среду R2A приготовили путем добавления 0,5 г дрожжевого экстракта (Difco), 0,5 г протеозного пептона № 3 (Difco), 0,5 г казаминовых кислот (Difco), 0,5 г декстрозы (Difco), 0,5 г растворимого крахмала (Difco), 0,3 г натрия пирувата (Difco), 0,3 г дикалийсульфата (Difco), 0,05 г магния сульфата (Difco) и 15 г бактоагара (Difco) к 980 мл дистиллированной воды и стерилизовали при 121°C в течение 15 минут под высоким давлением после регулирования pH до 7,2. Для выделения недоминирующих нормальных бактерий применяли три разновидности антибиотиков (Таблица 2). Каждый антибиотик инокулировали при приблизительно 50°C после стерилизации посредством фильтрации среды до концентрации, составляющей 100 частей на миллион.

Таблица 2
Антибиотик Тип Изготовитель
1 Канамицин Аминогликозид Sigma
2 Ампициллин бета-лактамный Sigma
3 Хлорамфеникол Хлорамфеникол Sigma

Пример 5: Выделение и культивирование грибов (плесневых грибов)

Грибы (плесневые грибы) выделили из кондиционера воздуха посредством культивирования на аэробной пластине с применением питательных сред. Для выделения грибов (плесневых грибов) применяли картофельно-декстрозный агар и солодово-пептонный агар. Картофельно-декстрозный агар приготовили путем добавления 4 г картофельного крахмала (Difco), 20 г декстрозы (Difco) и 15 г бактоагара (Difco) к 980 мл дистиллированной воды и стерилизовали при 121°C в течение 15 минут под высоким давлением после регулирования pH до 5,1. Солодово-пептонный агар приготовили путем добавления 20 г экстракта из корня солодки (Difco) и 15 г (Difco) бактоагара к 980 мл дистиллированной воды и стерилизовали при 121°C в течение 15 минут под высоким давлением после регулирования pH до 5,0.

Для культивирования грибов использовали чашку Петри 90 мм × 15 мм, а культивированные грибы выделяли, используя чашку Петри 60 мм × 15 мм.

Пример 6: Выделение и культивирование доминирующих штаммов

Доминирующие штаммы выделили и культивировали, основываясь на степени разбавления или морфологических характеристиках, таких как цвет, размер, форма и т.д., колоний, как указано далее.

1. Плесневые грибы и бактерии отделили от культуральной среды.

2. Бактерии, демонстрирующие различные морфологические свойства, отделили посредством инокулирования в сложные среды с использованием петли.

3. Бактериальную культуру из инокулированных сред, показавшую наилучший рост, выделяли и пересевали.

4. Плесневые грибы инокулировали в сложные среды после извлечения концевых частей гифы с помощью скальпеля.

5. Из инокулированных сред культуру плесневых грибов, показавшую наилучший рост, выделяли и пересевали.

Пример 7: Генетическая характеристика доминирующих бактерий

Фингерпринтинг, основанный на анализе образцов rep-ПЦР

rep-ПЦР представляет собой метод молекулярного биологического фингерпринтинга для структурного анализа бактериальных хромосом, который позволяет распознавать различные штаммы бактерий. Получение генетической характеристики выполняли с применением REP-ПЦР, как указано далее.

(1) Лизис клеток

1. 2,5 мкл Lyse-N-Go PCR reagent (Thermo) добавили в пробирку для ПЦР.

2. Колонию пипеткой переместили в пробирку на чистом столе. При пипетировании обращали внимание на то, чтобы получившийся в результате раствор не стал мутным.

3. Культивирование проводили на оборудовании для ПЦР согласно инструкциям изготовителя.

4. Лизис клеток осуществляли согласно протоколу лизиса, описанному в таблице 3. На 9-ом цикле температуру удерживали на 80°C.

Таблица 3
Цикл Температура (°C) Время (секунды)
1 65 30
2 8 30
3 65 90
4 97 180
5 8 60
6 65 180
7 97 60
8 65 60
9 80 удерживали

(2) Реакция ПЦР

Используя реагент для ПЦР, приготовленный, как описано в таблице 4, ПЦР-амплификацию выполняли путем проведения предварительной денатурации при 94°C в течение 7 минут и повторяя 33 цикла предварительной денатурации при 92°C в течение 1 минуты, отжигая при 51,5°C в течение 1 минуты и продолжая при 65°C в течение 8 минут, как описано в таблице 5.

Таблица 4
1 дНТФ (2,5 мм каждый) 12,5 мкл
2 Буфер Гитчера 5,0 мкл
3 Диметилсульфоксид (ДМСО) (100%) 2,5 мкл
4 Автоклавированный 3° D.W. 0,3 мкл
5 Праймер BOXA1R (50 пмоль/мкл) 1,0 мкл
5'CTACGGCAAGGCGACGCTGACG
6 BSA (10 мг/мл) 0,4 мкл
7 Бактериальная ДНК 2,5 мкл
8 ДНК-полимераза Taq (Roche) (5 Ед/мкл) 0,8 мкл

Таблица 5
Стадия 1 94°C 7 мин
Стадия 2 92°C 1 мин
Стадия 3 51,5°C 1 мин
Стадия 4 65°C 8 мин
Стадии 2, 3, 4: дополнительные 33 цикла
Стадия 6 65°C 16 мин
Стадия 7 4°C

(3) Электрофорез в геле

ПЦР-амплифицированные фрагменты ДНК загрузили в 1,2-1,5% агарозный гель с добавлением EtBr после смешивания с 6x красителем с образцом в соотношении 1:5. Поскольку большинство продуктов ПЦР находились в диапазоне 100-1000 пар нуклеотидных оснований, их загружали вместе с лэддерами на 100 пар нуклеотидных оснований. Затем выполняли электрофорез настолько медленно, насколько это возможно (50 В), чтобы красители бромфеноловый синий и ксиленцианол переместились на половину всего геля. Штаммы, демонстрирующие одинаковый образец ДНК на геле, считали одинаковыми штаммами.

(4) Выделение доминирующих бактерий, основываясь на анализе гена 16S рРНК

Ген 16S рибосомальной рибонуклеиновой кислоты (рРНК) применяется для генетической идентификации бактерий. Таким образом, бактерии, дифференцируемые посредством rep-ПЦР, можно идентифицировать на уровнях их родов и видов. 16S рРНК представляет собой РНК, которая составляет рибосому посредством взаимодействия с различными белками. Поскольку полные последовательности или последовательности оснований олигонуклеотидов известны для более чем 2000 видов бактерий, бактерии могут быть сгруппированы на основе подобия гена 16S рРНК. Поскольку различие в последовательности оснований гена 16S рРНК значительно меньше, чем в последовательностях оснований других генов в геноме, сходство последовательности оснований 16S рРНК рассматривается как мера эволюционной дистанции между организмами. Идентификацию микроорганизмов, в частности, промышленно полезных микроорганизмов, основанную на сходстве последовательности оснований фрагментов гена 16S рРНК, применяли в качестве типичного способа идентификации наряду с анализом жирных кислот и профиля ассимиляции углеводов.

<ПЦР 16S рРНК>

Условия для ПЦР (всего 50 мкл): смесь (44,5 мкл) растворов, описанных в Таблице 6, за исключением ДНК и Taq, добавили в лизирующий раствор, описанный выше. В дальнейшем выполняли ПЦР-амплификацию путем проведения предварительной денатурации при 94°C в течение 5 минут и повторяя 29 циклов предварительной денатурации при 94°C в течение 1 минуты, отжигая при 55°C в течение 1 минуты и продолжая при 72°C в течение 1 минуты и 30 секунд, как описано в таблице 7.

Таблица 6
Автоклавированная 3° дист. вода 22 мкл
10x буфер (Roche) 5 мкл
дНТФ (Roche, 2,5 ммоль) 5 мкл
Диметилсульфоксид 5 мкл
BSA (10 мг/мл) 2,5 мкл
27mf (20 пмоль/мкл) 2,5 мкл
1492r (20 пмоль/мкл) 2,5 мкл
ДНК 5 мкл
Taq (Roche) 0,5 мкл

Таблица 7
Стадия 1 94°C 5 мин
Стадия 2 94°C 1 мин
Стадия 3 55°C 1 мин
Стадия 4 72°C 1 мин 30 сек
Переход к стадии 2: дополнительные 29 циклов
Стадия 6 72°C 10 мин
Стадия 7 4°C удерживание

(5) ПЦР очистка

Продукты ПЦР 16S рРНК очищали, применяя набор для очистки QIAquick PCR.

1. Продукты ПЦР добавляли в 5x фосфатный буфер.

2. Получившийся в результате раствор перенесли в колонку QIAquick.

3. Для связывания ДНК раствор центрифугировали в течение 1 минуты.

4. Для отмывания 750 мкл обогащенного фосфатного буфера добавляли в колонку QIAquick и проводили центрифугирование в течение 1 минуты.

5. Центрифугирование проводили в течение 1 минуты.

6. Получившийся в результате раствор переносили в чистую QIAquick колонка.

7. Для выделения ДНК добавляли 30 мкл EB буфера, и получившемуся в результате раствору давали постоять в течение 1 минуты.

8. После проведения центрифугирования в течение 1 минуты, ДНК, растворенную в EB, собирали в пробирку.

(6) Выделенные микроорганизмы и их характеристика

<Микроорганизм 1>

1. Название микроорганизма: HKMC-1

Род: Methylobacterium

Вид: aquaticum

Учетный номер: KCCM11325P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 2>

1. Название микроорганизма: HKMC-2

Род: Methylobacterium

Вид: brachiatum

Учетный номер: KCCM11326P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2 ) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 3>

1. Название микроорганизма: HKMC-3

Род: Methylobacterium

Вид: platani

Учетный номер: KCCM11327P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 4>

1. Название микроорганизма: HKMC-4

Род: Acinetobacter

Вид: johnsonii

Учетный номер: KCCM11328P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 5>

1. Название микроорганизма: HKMC-5

Род: Bacillus

Вид: vietnamensis

Учетный номер: KCCM11329P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 6>

1. Название микроорганизма: HKMC-6

Род: Brevibacillus

Вид: invocatus

Учетный номер: KCCM11330P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 7>

1. Название микроорганизма: HKMC-7

Род: Deinococcus

Вид: ficus

Учетный номер: KCCM11331P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 8>

1. Название микроорганизма: HKMC-8

Род: Leifsonia

Вид: soli

Учетный номер: KCCM11332P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 9>

1. Название микроорганизма: HKMC-9

Род: Pseudomonas

Вид: nitroreducens

Учетный номер: KCCM11333P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 10>

1. Название микроорганизма: HKMC-10

Род: Sphingomonas

Вид: aquatilis

Учетный номер: KCCM11334P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 11>

1. Название микроорганизма: HKMC-11

Род: Methylobacterium

Вид: komagatae

Учетный номер: KCCM11335P (2012.11.14)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 12>

1. Название микроорганизма: HKMC-12

Род: Deinococcus

Вид: apachensis

Учетный номер: KCCM11499P (2013.12.10)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

<Микроорганизм 13>

1. Название микроорганизма: HKMC-13

Род: Flavobacterium

Вид: oceanosedimentum

Учетный номер: KCCM11500P (2013.12.10)

2. Условие восстановления

a. Восстанавливающий агент

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

b. Культивирование при 28°C в течение 7 дней

3. Среда

(1) Композиция: среда PTYG (на 1 л среды, 0,25 г пептона, 0,25 г триптона, 0,5 г дрожжевого экстракта, 0,5 г глюкозы, 30 мг MgSO4 и 3 мг CaCl2) или среда R2A.

(2) pH: 7,0

(3) Условия стерилизации: 20 минут при 121°C

4. Условия культивирования

a. Аэробное/анаэробное: аэробное

b. Температура: 28°C

c. Культивирование с перемешиванием или без перемешивания (жидкое или твердое)

5. Условия хранения

Температура: -70°C

Пример 8: Сенсорная оценка выделенных микроорганизмов на алюминиевой пластине

(1) Культивирование в питательной среде

Для сенсорной оценки 11 видов из числа микроорганизмов, идентифицированных в Примере 7, микроорганизмы культивировали в питательных средах при 28°C в течение 7 дней. Методика культивирования бактерий в питательных средах проводилась, как указано далее.

1. Выделенные микроорганизмы инокулировали в жидкую питательную среду.

2. Культивирование проводили при 28°C в течение 5-7 дней.

3. 100 мкл бактерий, культивированных в жидкой среде, инокулировали в твердую питательную среду.

4. Инокулированные бактерии равномерно распределили, применяя распылитель.

5. Бактерии культивировали в герметичную чашку Петри при 28°C в течение 10 дней.

(2) Сенсорная оценка на алюминиевой пластине

Прямоугольную алюминиевую пластину простерилизовали, а затем погрузили в питательную среду. Для инокуляции бактерий культивирование выполняли в питательную среду при тех же условиях, что и стадии 2-4. Результат сенсорной оценки дан в Таблице 8.

1. Обработанная противомикробным составом алюминиевая пластина: применяли коммерчески доступный продукт покрытой противомикробным составом сердцевины испарителя.

2. Необработанная противомикробным составом, покрытая гидрофильным составом алюминиевая пластина: алюминиевая пластина, которая была покрыта только гидрофильным составом, без противомикробного покрытия, была специально изготовлена для сравнения с покрытой антибактериальным составом пластиной. Хотя сердцевина испарителя была изготовлена из алюминия с целью уменьшения массы, она может также быть изготовлена из других металлов, таких как медь, нержавеющая сталь и т.д.

Таблица 8
Обработанная противомикробным составом пластина Необработанная противомикробным составом пластина Штамм
1 не имеющая запаха не имеющая запаха Methylobacterium aquaticum HKMC-1
2 не имеющая запаха не имеющая запаха Methylobacterium brachiatum HKMC-2
3 не имеющая запаха не имеющая запаха Methylobacterium platani HKMC-3
4 не имеющая запаха не имеющая запаха Acinetobacter johnsonii HKMC-4
5 не имеющая запаха не имеющая запаха Bacillus vietnamensis HKMC-5
6 не имеющая запаха не имеющая запаха Brevibacillus invocatus HKMC-6
7 не имеющая запаха не имеющая запаха Deinococcus ficus HKMC-7
8 не имеющая запаха не имеющая запаха Leifsonia soli HKMC-8
9 не имеющая запаха не имеющая запаха Pseudomonas nitroreducens HKMC-9
10 не имеющая запаха не имеющая запаха Sphingomonas aquatilis HKMC-10
11 не имеющая запаха не имеющая запаха Methylobacterium komagatae HKMC-11

Для всех 11 видов микроорганизмов запах не был обнаружен, когда их культивировали после инокуляции на обработанную противомикробным составом алюминиевую пластину и необработанную противомикробным составом пластину.

Пример 9: Оценка оптимальных условий для нанесения не имеющих запах микроорганизмов

(1) Анализ оптимальной концентрации для нанесения не имеющих запах микроорганизмов на пластину

Для нанесения 11 видов не имеющих запаха микроорганизмов на сердцевину испарителя исследовали оптимальную концентрацию покрытия для инокулирования микроорганизмов до концентрации, составляющей приблизительно 106 КОЕ/г, как описано в приоритетной заявке от 2012 года. Methylobacterium aquaticum культивировали при 28°C до наступления поздней лог-фазы и затем культивировали при 4°C в течение 18 часов после промывания стерильным 0,85% солевым раствором. После культивирования при 4°C измеренная оптическая плотность (O.D.) составляла 0,749, 0,588, 0,55, 0,5 и 0,45. 2 г U-образной пластины покрыли культурой посредством погружения в течение 1 часа при комнатной температуре и встряхивали при постоянных об/мин. Пластину, покрытую микроорганизмом при различных концентрациях, извлекли из смесителя и высевали на R2A агаровую пластинку после серийных разведений.

Было обнаружено, что концентрация микроорганизмов, покрывающих пластину, варьировала в зависимости от значений O.D. Когда O.D. составляла 0,749, степень покрытия составляла приблизительно 1,53×108±1,52×107 КОЕ/г пластины. А когда O.D. составляла 0,588 и 0,55, степень покрытия составляла приблизительно 4,00×107±1,00×107 КОЕ/г пластины и 1,03×107±8,50×105 КОЕ/г пластины, соответственно. В дополнение, когда O.D. составляла 0,5 и 0,45, степень покрытия составляла 6,00×106±7,00×105 КОЕ/г пластины и 2,53×106±3,51×105 КОЕ/г, соответственно. Другими словами, степень покрытия была пропорциональна O.D. Значение O.D., составляющее 0,5, при котором микроорганизмы наносили в концентрации, составляющей 106 КОЕ/г, которая является одинаковой с уровнем сердцевины испарителя, из которой выделяли микроорганизмы, было выбрано для нанесения других 10 не имеющих запаха видов микроорганизмов.

(2) Оценка окрашиваемости не имеющих запаха микроорганизмов на сердцевине испарителя и пластине

В результате теста покрытия пластины 11 видами не имеющих запаха микроорганизмов показали одинаковую степень покрытия при одинаковой O.D. независимо от рода. Соответственно, количество Methylobacterium aquaticum, нанесенной на сердцевину испарителя, измеряли, применяя культуру, соответствующую значению O.D. пластины.

Methylobacterium aquaticum, доведенная до O.D. 0,5, показала степень покрытия, составляющую 8,95×106±5,51×105 КОЕ/г пластины на сердцевине испарителя. Когда эту же культуру нанесли на сердцевину испарителя, степень покрытия составила 2,55×106±3,51×105 КОЕ/г пластины. Соответственно, подтвердилось, что микроорганизмы наносили в той же самой степени, когда применяли культуру такой же O.D.

Пример 10: Сенсорная оценка выделенных микроорганизмов, нанесенных на сердцевину испарителя

(1) Нанесение 11 видов не имеющих запаха микроорганизмов на покрытие сердцевины испарителя и сенсорная оценка

Для сенсорной оценки микроорганизмов, идентифицированных в примере 8, каждый из 11 видов не имеющих запаха микроорганизмов наносили на сердцевину испарителя.

Неприятные запахи, продуцируемые микроорганизмами, проанализировали посредством теста обонятельной оценки. Сердцевины испарителей, покрытые микроорганизмами, оценивали с помощью 15 панелей сенсорной оценки. В результате 11 видов микроорганизмов набрали 1,78±0,41 (5-балльная шкала, 0: запаха нет; 1: очень слабый запах (едва определяемый запах); 2: слабый запах (едва различимый запах); 3: отчетливый запах (различимый запах); 4: сильный запах; 5: очень сильный запах). Methylobacterium sp. продемонстрировали показатель ниже среднего, составивший 1,625±0,29. 3 обычных штамма, Methylobacterium aquaticum, Methylobacterium brachiatum и Methylobacterium platani, набрали 1,6±0,35. Deinococcus ficus набрал наивысший показатель, составивший 2,8, за которым следует Bacillus vietnamensis с 2,1 (Таблица 8).

На основании результата сенсорной оценки исключили 3 вида микроорганизмов, Methylobacterium brachiatum, Bacillus vietnamensis и Deinococcus ficus, которые продуцируют относительно сильные запахи.

Стадия 2: После прекращения работы восстанавливающего устройства (температура: 25°C, влажность: 30-50%, скорость воздуха: 0 м3/ч), запах оценивали после незначительного открытия впускного отверстия восстанавливающего устройства.

Таблица 9
Сенсорная оценка микроорганизмов, нанесенных на сердцевину испарителя
Штамм Запах в воздухе Запах при условии восстановления* Результат оценки (5-балльная шкала) Выбор
1 Methylobacterium aquaticum Без запаха Без запаха 1,4 выбран
2 Methylobacterium brachiatum Без запаха X 2 -
3 Methylobacterium platani Без запаха Без запаха 1,4 выбран
4 Acinetobacter johnsonii Без запаха Без запаха 1,5 выбран
5 Bacillus vietnamensis Без запаха X 2,1 -
6 Brevibacillus invocatus Без запаха Без запаха 1,5 выбран
7 Deinococcus ficus Без запаха X 2,8 -
8 Leifsonia soli Без запаха Без запаха 1,7 выбран
9 Pseudomonas nitroreducens Без запаха Без запаха 1,6 выбран
10 Sphingomonas aquatilis Без запаха Без запаха 1,6 выбран
11 Methylobacterium komagatae Без запаха Без запаха 1,7 выбран
ст. контроль (стерилизованная сердцевина испарителя) - - 2,1
Условие восстановления*: Стадия 1: После подачи бензина (источник питания для микроорганизмов) восстанавливающее устройство работало в течение 2 часов (температура: 25°C, влажность: 50-90%, скорость воздуха: 170 м3/ч, источник питания: 10 частей на миллион бензина).

(2) Сенсорная оценка комбинаций не имеющих запаха микроорганизмов

8 видов не имеющих запаха микроорганизмов, выбранных на основании сенсорной оценки, комбинировали с Methylobacterium aquaticum и Methylobacterium platani для получения 14 оптимизированных комбинаций не имеющих запаха микроорганизмов. Для сенсорной оценки комбинаций не имеющих запаха микроорганизмов их смешивали с одинаковой плотностью и наносили на сердцевину испарителя.

В результате обонятельной оценки, средний показатель сенсорной оценки 14 комбинаций составил 1,89±0,52 (5-балльная шкала). Комбинация 14, которая содержала обычные штаммы, а также Acinetobacter johnsonii, Sphingomonas aquatilis и Pseudomonas nitroreducens, продемонстрировала наименьший показатель сенсорной оценки, составивший 1,25, а комбинация, содержащая обычные штаммы и Acinetobacter johnsonii, продемонстрировала наивысший показатель сенсорной оценки, составивший 3,14 (Таблица 10). На основании данной количественной оценки и теста оценки качества запаха, для итогового теста на выживаемость отобрали 10 комбинаций за исключением 2 комбинаций, содержащих обычные штаммы и одну из Acinetobacter johnsonii и Brevibacillus invocatus, комбинации 7, содержащей Brevibacillus invocatus, Sphingomonas aquatilis и Methylobacterium komagatae, и комбинации 13, содержащей Leifsonia soli, Sphingomonas aquatilis и Pseudomonas nitroreducens.

Таблица 10
Сенсорная оценка комбинаций не имеющих запаха микроорганизмов
Комбинация Обонятельная оценка Результат
1 Обычные штаммы (Methylobacterium aquaticum и Methylobacterium platani) 1,98 выбран
2 Acinetobacter johnsonii 3,14 X
3 Brevibacillus invocatus 2,12 X
4 Sphingomonas aquatilis и Brevibacillus invocatus 1,38 выбран
5 Leifsonia soli и Methylobacterium komagatae 1,38 выбран
6 Acinetobacter johnsonii, Sphingomonas aquatilis и Methylobacterium komagatae 1,33 выбран
7 Brevibacillus invocatus, Sphingomonas aquatilis и Methylobacterium komagatae 2,33 X
8 Pseudomonas nitroreducens 2,13 выбран
9 Acinetobacter johnsonii и Pseudomonas nitroreducens 2 выбран
10 Brevibacillus invocatus, Acinetobacter johnsonii и Pseudomonas nitroreducens 1,5 выбран
11 Leifsonia soli и Pseudomonas nitroreducens 1,86 выбран
12 Brevibacillus invocatus, Sphingomonas aquatilis и Pseudomonas nitroreducens 1,7 выбран
13 Leifsonia soli, Sphingomonas aquatilis и Pseudomonas nitroreducens 2,38 X
14 Acinetobacter johnsonii, Sphingomonas aquatilis и Pseudomonas nitroreducens 1,25 выбран

Пример 11: Оценка выживаемости 10 комбинаций в течение 30 дней

Для комбинаций микроорганизмов, выбранных исходя из результата сенсорной оценки в примере 9-(2), осуществляли оценку выживаемости в течение 30 дней. Количество и комбинации микроорганизмов указаны далее (Таблица 11).

Таблица 11
Комбинации микроорганизмов, применяемые в оценке выживаемости в течение 30 дней
Комбинация
1 Methylobacterium aquaticum, Methylobacterium platani, Brevibacillus invocatus, Sphingomonas aquatilis и Pseudomonas nitroreducens
2 Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii, Sphingomonas aquatilis и Pseudomonas nitroreducens
3 Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii, Sphingomonas aquatilis и Methylobacterium komagatae
4 Methylobacterium aquaticum, Methylobacterium platani, Brevibacillus invocatus, Acinetobacter johnsonii и Pseudomonas nitroreducens
5 Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii и Pseudomonas nitroreducens
6 Methylobacterium aquaticum, Methylobacterium platani, Leifsonia soli и Pseudomonas nitroreducens
7 Methylobacterium aquaticum, Methylobacterium platani, Leifsonia soli и Methylobacterium komagatae
8 Methylobacterium aquaticum, Methylobacterium platani, Sphingomonas aquatilis и Brevibacillus invocatus
9 Methylobacterium aquaticum, Methylobacterium platani и Pseudomonas nitroreducens
10 Methylobacterium aquaticum и Methylobacterium platani

Микроорганизмы культивировали и наносили на сердцевину испарителя в порядке от комбинации 1 до комбинации 10. Степень покрытия составляла 106 КОЕ/г пластины.

Комбинация 1 показала степень покрытия, составляющую 1,09×107±8,65×105 КОЕ/г пластины, на сердцевину испарителя. Красная колония была обнаружена при 8,70×106±2,35×106 КОЕ/г пластины, белая колония при 2,50×105±7,07×104 КОЕ/г пластины и желтая колония 1,90×106±1,73×105 КОЕ/г пластины. Через 30 дней общее микробное число составило 4,63×106±5,09×104 КОЕ/г пластины, с общим микробным числом только красной колонии, составляющим 4,63×106±1,53×105 КОЕ/г пластины (ФИГ. 2). Другими словами, доля красной колонии, на которую приходилось более 80%, через 30 дней увеличилась до 100% (ФИГ. 3). На основании фенотипа предполагалось, что красная колония содержит Methylobacterium, которая содержит розовый пигмент. В результате анализа rep-ПЦР Methylobacterium platani и Brevibacillus invocatus не были выявлены в момент времени 0. В частности, следует заметить, что Methylobacterium platani, которую применяли в качестве обычного штамма, не была обнаружена. Для комбинации 1 Methylobacterium aquaticum была обнаружена больше всего в 70 из всего 86 rep-ПЦР образцов в момент времени 0. Sphingomonas aquatilis была обнаружена в 12 образцах, и Pseudomonas nitroreducens была обнаружена в 4 образцах. Через 30 дней Methylobacterium aquaticum была обнаружена во всех 32 образцах, при этом другие микроорганизмы не были обнаружены (ФИГ. 4).

В комбинации 2 Acinetobacter johnsonii, Sphingomonas aquatilis и Pseudomonas nitroreducens применяли вместе с обычными штаммами Methylobacterium aquaticum и Methylobacterium platani. В момент времени 0, общее микробное число на сердцевину испарителя составило 1,52×107±5,42×105 КОЕ/г пластины. Через 30 дней общее микробное число на сердцевину испарителя составило 3,23×106±8,39×104 КОЕ/г пластины. Анализ rep-ПЦР образцов выявил, что Methylobacterium aquaticum, Sphingomonas aquatilis и Pseudomonas nitroreducens выживали на сердцевине испарителя в момент времени 0. Из 105 rep-ПЦР образцов Methylobacterium aquaticum была обнаружена в 94 образцах, Sphingomonas aquatilis была обнаружена в 7 образцах, и Pseudomonas nitroreducens была обнаружена в 4 образцах. Через 30 дней Methylobacterium aquaticum была обнаружена во всех 30 rep-ПЦР образцах (ФИГ. 5).

Для комбинации 3 общее микробное число составило 1,83×107±3,89×105 КОЕ/г пластины в момент времени 0. Через 30 дней общее микробное число составило 5,23×106±1,50×105 КОЕ/г пластины. Когда популяцию микроорганизмов анализировали посредством rep-ПЦР, среди 5 микроорганизмов, содержавшихся в комбинации, 4 микроорганизма, Methylobacterium aquaticum, Acinetobacter johnsonii, Sphingomonas aquatilis и Methylobacterium komagatae, за исключением Methylobacterium platani, выживали на сердцевине испарителя в момент времени 0. Через 30 дней выживал Methylobacterium komagatae, а также Methylobacterium aquaticum, один из обычных штаммов. В момент времени 0 из 101 образца Methylobacterium aquaticum была обнаружена в 49 образцах, Acinetobacter johnsonii была обнаружена в 1 образце, Sphingomonas aquatilis была обнаружена в 11 образцах, и Methylobacterium komagatae была обнаружена в 40 образцах. Через 30 дней Methylobacterium aquaticum была обнаружена в 19 образцах, и Methylobacterium komagatae была обнаружена в 15 образцах (ФИГ. 6). Было обнаружено, что соотношение двух выживших видов Methylobacterium было постоянным при приблизительно 1:1 в течение 30 дней (ФИГ. 7).

Для комбинации 4 общее микробное число 5 штаммов составило 2,04×107±4,91×105 КОЕ/г пластины в момент нанесения. Когда популяцию микроорганизмов анализировали посредством rep-ПЦР, из 86 образцов Methylobacterium aquaticum была обнаружена в 80 образцах, Methylobacterium platani была обнаружена в 1 образце, Brevibacillus invocatus была обнаружена в 3 образцах, и Pseudomonas nitroreducens была обнаружена в 2 образцах (ФИГ. 8).

Комбинация 5 состояла из 4 штаммов Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii и Pseudomonas nitroreducens. В момент нанесения на сердцевину испарителя общее микробное число составило 2,86×107±1,19×106 КОЕ/г пластины. Когда популяцию микроорганизмов анализировали посредством rep-ПЦР, из 28 образцов Methylobacterium aquaticum была обнаружена в 24 образцах, а Acinetobacter johnsonii и Pseudomonas nitroreducens были выявлены в 2 образцах, соответственно (ФИГ. 9).

Исходя из оценки выживаемости комбинаций микроорганизмов было обнаружено, что Methylobacterium platani, применявшаяся в качестве обычного штамма, показывает низкую выживаемость при нанесении на сердцевину испарителя других микроорганизмов. Вследствие этого были приготовлены дополнительные комбинации микроорганизмов с применением другого обычного штамма Methylobacterium aquaticum и Methylobacterium komagatae, которые показали соизмеримую выживаемость в течение 30 дней, а выживаемость оценивали в течение 30 дней.

Пример 12: Оценка выживаемости дополнительных 6 комбинаций в течение 30 дней

В качестве микроорганизма для замены Methylobacterium platani выбрали Methylobacterium komagatae, которая показала слабую выживаемость в оценке выживаемости в течение 30 дней. Methylobacterium komagatae комбинировали с обычным штаммом Methylobacterium aquaticum для приготовления 6 дополнительных комбинаций микроорганизмов (Таблица 12). Дополнительно приготовленные комбинации содержали малое количество микроорганизмов, которые продемонстрировали отличную выживаемость, хотя они не являлись не имеющими запаха, с целью приготовления более стабильных комбинаций.

Таблица 12
Дополнительные комбинации микроорганизмов, применявшиеся в оценке выживаемости в течение 30 дней
Комбинация
A Methylobacterium aquaticum, Methylobacterium komagatae, Bacillus vietnamensis и Deinococcus ficus
B Methylobacterium aquaticum, Methylobacterium komagatae, Curtobacterium flaccumfaciens, Deinococcus apachensis и Bacillus subtilis subsp. Subtilis
C Methylobacterium aquaticum, Methylobacterium komagatae, Spirosoma linguale, Sphingomonas dokdonensis и Leifsonia soli
D Methylobacterium aquaticum, Methylobacterium komagatae, Microbacterium flavescens, Leifsonia shinshuensis и Methylobacterium aerolatum
E Methylobacterium aquaticum, Methylobacterium komagatae, Spirosoma panaciterrae, Flavobacterium oceanosedimentum и Brevundimonas kwangchunensis
F Methylobacterium aquaticum, Methylobacterium komagatae, Methylobacterium brachiatum, Paenibacillus timonensis и Rhizobium massiliae, Bacillus licheniformis

Для комбинации A общее микробное число на сердцевине испарителя составило 4,30×106±1,25×106 КОЕ/г пластины в момент нанесения. Даже через 30 дней микроорганизмы выживали на пластине при 4,30×106±1,25×106 КОЕ/г. Когда популяцию нанесенных микроорганизмов исследовали посредством анализа rep-ПЦР образцов, из 45 образцов Methylobacterium aquaticum была обнаружена в 8 образцах, и Methylobacterium komagatae была обнаружена в 37 образцах. Через 30 дней из 20 образцов Methylobacterium aquaticum была обнаружена в 5 образцах, Methylobacterium komagatae была обнаружена в 15 образцах. Хотя доля Methylobacterium aquaticum немного увеличилась, изменение было незначительным (ФИГ. 10).

Для комбинации B общее микробное число составило 2,07×107±1,11×106 КОЕ/г пластины в момент времени 0. Через 30 дней общее микробное число составило 1,74×107±1,30×106 КОЕ/г пластины. Когда популяцию микроорганизмов исследовали посредством rep-ПЦР, из 34 репрезентативных образцов Methylobacterium aquaticum была обнаружена в 1 образце, и Methylobacterium komagatae была обнаружена в 11 образцах. Во всех других 22 образцах был обнаружен Deinococcus apachensis. Другими словами, Deinococcus apachensis составлял 40% или более нанесенных микроорганизмов (ФИГ. 11). Через 30 дней анализ rep-ПЦР образцов выявил, что выжившими микроорганизмами являлись Methylobacterium aquaticum 11,1%, Methylobacterium komagatae 22,2% и Deinococcus apachensis 66,6%. Другими словами, хотя доля Methylobacterium aquaticum немного увеличилась по сравнению со временем 0, выживали все 3 микроорганизма.

Для комбинации C применяли Methylobacterium aquaticum, Methylobacterium komagatae, Spirosoma linguale, Sphingomonas dokdonensis и Leifsonia soli. Когда комбинацию 5 штаммов нанесли на сердцевину испарителя, общее микробное число составило 7,53×106±3,74×105 КОЕ/г пластины. Через 30 дней общее микробное число составило 3,70×106±1,37×105 КОЕ/г пластины.

В результате анализа rep-ПЦР образцов для идентификации выживших микроорганизмов, из 51 репрезентативного образца Methylobacterium aquaticum была обнаружена в 4 образцах, Methylobacterium komagatae была обнаружена в 30 образцах, Spirosoma linguale была обнаружена в 3 образцах, и Sphingomonas dokdonensis была обнаружена в 14 образцах в момент времени 0. Через 30 дней Methylobacterium aquaticum составила 29,6%, и Methylobacterium komagatae составила 59,2%. Другими словами, соотношение Methylobacterium aquaticum немного увеличилось. Spirosoma linguale не была обнаружена, и доля Sphingomonas dokdonensis немного уменьшилась до 11,1% по сравнению со временем 0 (ФИГ. 12).

Для комбинации D общее микробное число в момент времени 0 составило 1,75×107±1,24×106 КОЕ/г пластины. Через 30 дней общее микробное число составило 6,03×106±1,01×106 КОЕ/г пластины. При исследовании соотношения бактерий посредством rep-ПЦР Methylobacterium aquaticum составила 16,3%, Methylobacterium komagatae составила 47,3%, и Microbacterium flavescens составила 36,4% в момент времени 0. Через 30 дней Methylobacterium aquaticum увеличилось до 34,3%, и Methylobacterium komagatae также немного увеличилось до 57,1%. В отличие от этого Microbacterium flavescens уменьшилась до 8,6% (ФИГ. 13).

Для комбинации E общее микробное число составило 8,53×106±3,21×105 КОЕ/г пластины в момент времени 0. Через 30 дней общее микробное число составило 1,20×106±3,84×104 КОЕ/г пластины. При анализе популяции посредством rep-ПЦР из 75 образцов Methylobacterium aquaticum была обнаружена в 8 образцах, Methylobacterium komagatae была обнаружена в 21 образце, Flavobacterium oceanosedimentum была обнаружена в 32 образцах, и Brevundimonas kwangchunensis была обнаружена в 14 образцах в момент времени 0. Через 30 дней из 89 репрезентативных образцов Methylobacterium aquaticum была обнаружена в 16 образцах, Methylobacterium komagatae была обнаружена в 32 образцах, Flavobacterium oceanosedimentum была обнаружена в 39 образцах, и Brevundimonas kwangchunensis была обнаружена в 2 образцах, соответственно (ФИГ. 14).

Spirosoma panaciterrae определили с трудом в момент времени 0, а соотношение Brevundimonas kwangchunensis в значительной степени уменьшилось через 30 дней.

Для комбинации F применяли 6 штаммов, включающих в себя два обычных штамма Methylobacterium sp. В момент времени 0 общее микробное число составило 1,60×107±1,15×106 КОЕ/г пластины. Через 30 дней общее микробное число составило 9,03×106±2,42×105 КОЕ/г пластины. Когда популяцию штаммов анализировали посредством rep-ПЦР, из 71 репрезентативного образца Methylobacterium aquaticum была обнаружена в 54 образцах, и Methylobacterium komagatae была обнаружена в 17 образцах в момент времени 0. Через 30 дней Methylobacterium aquaticum была обнаружена в 50 образцах, и Methylobacterium komagatae была обнаружена в 23 образцах из 73 образцов (ФИГ. 15).

Пример 13: Оценка выживаемости комбинаций обычных штаммов в течение 90 дней

Для оценки долгосрочного действия в течение 90 дней были приготовлены различные комбинации не имеющих запаха микроорганизмов. Первые, Methylobacterium aquaticum и Methylobacterium komagatae, включенные во все комбинации в качестве обычных штаммов, тестировали в течение 90 дней.

Когда два штамма Methylobacterium sp. наносили на сердцевину испарителя, измеренное общее микробное число составило 1,92×107±8,02×105 КОЕ/г пластины в момент времени 0. Каждые 30 дней брали 5 г пластины, и измеряли общее микробное число. Количество выживших бактерий составило 8,70×106±6,56×105 КОЕ/г пластины через 30 дней, 4,10×106±3,00×105 КОЕ/г пластины через 60 дней и 3,13×106±5,51×105 КОЕ/г пластины через 90 дней (ФИГ. 16). 71, 66, 41 и 44 репрезентативных образца, взятые из каждого места отбора проб, подвергли анализу rep-ПЦР образцов. В момент времени 0 Methylobacterium aquaticum была обнаружена в 37 образцах, и Methylobacterium komagatae была обнаружена в 34 образцах. Через 30, 60 и 90 дней количества образцов составили 35 и 31, 27 и 14, и 25 и 19, соответственно (ФИГ. 17). Другими словами, %-ая доля Methylobacterium aquaticum составила 52,1-65,8%, и %-ая доля Methylobacterium komagatae составила 34,1-47,9%. Данное равномерное соотношение предполагает, что два штамма могут сосуществовать в течение долгосрочного периода.

Пример 14: Оценка выживаемости комбинаций обычных штаммов на стенде транспортного средства

Для того чтобы исследовать рост комбинации обычных штаммов Methylobacterium aquaticum и Methylobacterium komagatae при внешних условиях, два штамма нанесли на сердцевину испарителя, а сердцевину испарителя установили на стенде, который, в свою очередь, был установлен на крыше транспортного средства. После процедуры исследовали изменение в штаммах, подвергнутых действию наружного воздуха.

На сердцевине испарителя, покрытой двумя штаммами, общее микробное число составило 3,20×107±6,56×106 КОЕ/г пластины. Общее микробное число на сердцевину испарителя составило 6,23×106±1,99×105 КОЕ/г пластины через 30 дней и 1,08×106±4,36×104 КОЕ/г пластины через 60 дней (ФИГ. 18). Даже если сердцевина испарителя подвергалась воздействию внешней среды, экзогенные микроорганизмы, отличающиеся от колонии Methylobacterium sp., через 60 дней не были обнаружены. Если выявленные микроорганизмы идентифицировали посредством rep-ПЦР, соотношение штаммов составляло 1:1 в момент времени 0. Через 30 дней Methylobacterium aquaticum уменьшилась до 4,2%, и после 60 дней была обнаружена только Methylobacterium komagatae (ФИГ. 19).

Заключение

11 видов не имеющих запаха микроорганизмов, выделенных из сердцевины испарителя, разделили на 4 группы, исходя из морфологических характеристик. 11 видов микроорганизмов были идентифицированы как различные виды посредством определения последовательности 16S рДНК.

Микроорганизмы, идентифицированные посредством определения последовательности 16S рДНК, подвергли rep-ПЦР, и, как было обнаружено, они представляли собой 11 различных rep-ПЦР групп.

После выполнения сенсорной оценки отдельных штаммов после нанесения на сердцевину испарителя были в итоге отобраны 8 микроорганизмов, которые продуцировали относительно менее неприятные запахи, Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii, Brevibacillus invocatus, Leifsonia soli, Pseudomonas nitroreducens, Sphingomonas aquatilis и Methylobacterium komagatae.

Сенсорную оценку осуществляли для 14 комбинаций, приготовленных из выбранных 8 видов микроорганизмов. В результате в общей сложности выбрали 10 комбинаций для итогового теста на выживаемость. Среди них 4 комбинации состояли из 5 штаммов, 4 комбинации состояли из 4 штаммов, 1 комбинация состояла из 3 комбинаций, и 1 комбинация состояла из 2 штаммов, включая 2 обычных штамма. Поскольку было обнаружено, что Methylobacterium platani является непригодной, приготовили 6 дополнительных комбинаций и подвергли оценке выживаемости в течение 30 дней. В результате в качестве обычных штаммов выбрали Methylobacterium aquaticum и Methylobacterium komagatae. Комбинацию, состоящую только из двух обычных штаммов Methylobacterium aquaticum и Methylobacterium komagatae, подвергли оценке выживаемости в течение 90 дней. В результате выполненной оценки выживаемости в течение 90 дней в лабораторных условиях комбинация сохраняла такую же популяцию, как и в момент нанесения. В дополнение, сердцевину испарителя, покрытую комбинацией микроорганизмов, установили на стенде крыши транспортного средства, и оценивали выживаемость после воздействия наружного воздуха. В результате общее микробное число сохранялось на 106 КОЕ/г пластины и экзогенные микроорганизмы не были обнаружены.

Представленное изобретение было описано подробно со ссылкой на конкретные варианты его осуществления. Однако квалифицированным специалистам в данной области будет понятно, что в данных вариантах осуществления могут быть произведены различные изменения и модификации без отхода от принципов и сущности изобретения, объем которого определен в прилагаемой формуле изобретения и ее эквивалентах.

1. Композиция для предотвращения запахов из систем кондиционирования воздуха транспортного средства, содержащая микроорганизмы, выбранные из группы, состоящей из Methylobacterium komagatae, Methylobacterium aquaticum, Methylobacterium brachiatum и Methylobacterium platani.

2. Композиция по п.1, в которой Methylobacterium komagatae представляет собой Methylobacterium komagatae HKMC-11 (KCCM11335P), Methylobacterium aquaticum представляет собой Methylobacterium aquaticum HKMC-1 (KCCM11325P), Methylobacterium brachiatum представляет собой Methylobacterium brachiatum HKMC-2 (KCCM11326P) и Methylobacterium platani представляет собой Methylobacterium platani HKMC-3 (KCCM11327P).

3. Композиция по п.1, содержащая дополнительно один или более микроорганизмов, выбранных из группы, состоящей из Acinetobacter johnsonii, Bacillus vietnamensis, Brevibacillus invocatus, Deinococcus ficus, Leifsonia soli, Pseudomonas nitroreducens, Sphingomonas aquatilis, Deinococcus apachensis и Flavobacterium oceanosedimentum, или их культуру.

4. Композиция по п.3, содержащая один или более микроорганизмов, выбранных из группы, состоящей из Acinetobacter johnsonii HKMC-4 (KCCM11328P), Bacillus vietnamensis HKMC-5 (KCCM11329P), Brevibacillus invocatus HKMC-6 (KCCM11330P), Deinococcus ficus HKMC-7 (KCCM11331P), Leifsonia soli HKMC-8 (KCCM11332P), Pseudomonas nitroreducens HKMC-9 (KCCM11333P), Sphingomonas aquatilis HKMC-10 (KCCM11334P), Deinococcus apachensis HKMC-12 (KCCM11499P) и Flavobacterium oceanosedimentum HKMC-13 (KCCM11500P), или их культуру.

5. Применение композиции для предотвращения запахов из систем кондиционирования воздуха транспортного средства по п.1 для обработки сердцевины испарителя систем кондиционирования воздуха транспортного средства.

6. Применение по п.5, причем микроорганизмы композиции по п.1 нанесены на сердцевину испарителя в концентрации, составляющей 104-108 КОЕ/г.

7. Применение по п.6, причем микроорганизмы нанесены с применением культуры микроорганизмов, имеющей оптическую плотность (O.D.), составляющую 0,3-0,9.

8. Применение по п.5, причем микроорганизмы, содержащиеся в композиции, образуют биопленку на сердцевине испарителя.

9. Способ изготовления не имеющей запаха сердцевины испарителя, которая не продуцирует запахи из системы кондиционирования воздуха, включающий нанесение композиции по любому из пп.1-4 на сердцевину испарителя.

10. Способ изготовления по п.9, в котором указанное нанесение включает нанесение микроорганизмов, содержащихся в композиции, на сердцевину испарителя в концентрации, составляющей 104-108 КОЕ/г.

11. Способ изготовления по п.9, при этом способ дополнительно включает образование биопленки пролиферирующими микроорганизмами, содержащимися в композиции.

12. Способ предотвращения запахов из системы кондиционирования воздуха, включающий нанесение композиции по любому из пп.1-4 на сердцевину испарителя.

13. Способ предотвращения запахов по п.12, в котором указанное нанесение включает нанесение микроорганизмов, содержащихся в композиции, на сердцевину испарителя в концентрации, составляющей 104-108 КОЕ/г.

14. Способ предотвращения запахов по п.12, при этом способ дополнительно включает образование биопленки пролиферирующими микроорганизмами, содержащимися в наносимой композиции.

15. Способ проверки запахов из системы кондиционирования воздуха, включающий нанесение композиции по любому из пп.1-4 на сердцевину испарителя.

16. Способ проверки запахов по п.15, при этом способ включает введение нефтяного топлива или загрязнителей воздуха в качестве питательной среды для микроорганизмов, содержащихся в композиции, и проверку, будут ли продуцироваться запахи.

17. Штамм Methylobacterium komagatae HKMC-11 (KCCM11335P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

18. Штамм Methylobacterium aquaticum HKMC-1 (KCCM11325P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

19. Штамм Methylobacterium brachiatum HKMC-2 (KCCM11326P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

20. Штамм Methylobacterium platani HKMC-3 (KCCM11327P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

21. Штамм Acinetobacter johnsonii HKMC-4 (KCCM11328P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

22. Штамм Bacillus vietnamensis HKMC-5 (KCCM11329P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

23. Штамм Brevibacillus invocatus HKMC-6 (KCCM11330P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

24. Штамм Deinococcus ficus HKMC-7 (KCCM11331P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

25. Штамм Leifsonia soli HKMC-8 (KCCM11332P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

26. Штамм Pseudomonas nitroreducens HKMC-9 (KCCM11333P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

27. Штамм Sphingomonas aquatilis HKMC-10 (KCCM11334P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

28. Штамм Deinococcus apachensis HKMC-12 (KCCM11499P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.

29. Штамм Flavobacterium oceanosedimentum HKMC-13 (KCCM11500P) для предотвращения запахов из систем кондиционирования воздуха транспортного средства.



 

Похожие патенты:

Группа изобретений относится к области биотехнологии. Предложено применение полипептида с аминокислотной последовательностью SEQ ID NO: 1 в качестве гомосеринсукцинилтрансферазы или кодирующего его полинуклеотида, имеющего нуклеотидную последовательность SEQ ID NO: 2 или 3, для получения О-сукцинилгомосерина.

Группа изобретений относится к области биотехнологии. Предложено применение полипептида с аминокислотной последовательностью SEQ ID NO: 1 в качестве гомосеринсукцинилтрансферазы или кодирующего его полинуклеотида, имеющего нуклеотидную последовательность SEQ ID NO: 2 или 3, для получения О-сукцинилгомосерина.

Группа изобретений относится к области биотехнологии. Предложен способ ферментативного получения серусодержащих аминокислот, включающий стадии, на которых: а) получают микроорганизм семейства Enterobacteriaceae или микроорганизм семейства Corynebacteriaceae, в котором происходит сверхэкспрессия гена, кодирующего полипептид с активностью тиосульфат-сульфотрансферазы; б) ферментируют микроорганизм, полученный на стадии а), в среде, которая содержит неорганический источник серы, выбранный из группы, включающей соль тиосерной кислоты или смесь соли тиосерной кислоты и соли серной кислоты, получая ферментационный бульон, и в) концентрируют серусодержащую аминокислоту в ферментационном бульоне, полученном на стадии б).

Группа изобретений относится к вариантам штамма молочнокислых бактерий и их применению. Предложен штамм молочнокислых бактерий рода Lactobacillus DSM 25972, штамм молочнокислых бактерий рода Lactobacillus DSM 25987, штамм молочнокислых бактерий рода Lactobacillus 25988, штамм молочнокислых бактерий рода Lactobacillus DSM 25989 и штамм молочнокислых бактерий рода Lactobacillus DSM 25973.

Группа изобретений относится к вариантам штамма Streptococcus и их применению. Предложены штамм Streptococcus CECT 7746, штамм Streptococcus CECT 7747, штамм Streptococcus CECT 7773, штамм Streptococcus CECT 7775, полезные как агенты против ротовых патогенных Streptococci.

Изобретение относится к биотехнологии. Предложен экобиопрепарат «Центрум-MMS», представляющий собой ассоциацию микроорганизмов Pseudomonas fluorescens ВКМ В-6847 и Rhodococcus erythropolis ВКМ Ас-1769, который предложено применять для биодеградации несимметричного диметилгидразина.

Группа изобретений относится к биотехнологии и клинической микробиологии. Предложены сердечно-мозговая питательная среда для диагностики инфекции в кровотоке и способ ее получения.

Изобретение относится к биотехнологии. Предложен способ получения этанола, предусматривающий ферментацию содержащих СО газообразных субстратов с помощью ацетогенных бактерий.

Изобретение относится к биотехнологии и может быть использовано в сельском хозяйстве. Предложен способ обработки зерна, предназначенного для скармливания сельскохозяйственным животным, предусматривающий обеззараживание зерна перед высушиванием и закладкой на хранение суспензией штамма Bacillus subtilis-93-ДЕП в концентрации 1×1010 КОЕ/мл из расчета 5л на тонну зерна.

Изобретение относится к биотехнологии. Штамм Enterococcus hirae Ф-ф (37), обладающий антагонистической активностью по отношению к условно-патогенной и патогенной микрофлоре, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-12672.

Изобретение относится к химико-фармацевтической промышленности и представляет собой композицию для обеззараживания и ароматизации воздуха, содержащую смесь эфирного масла сосны сибирской, эфирного масла пихты сибирской и этилового спирта.

Изобретение относится к химико-фармацевтической промышленности и представляет собой композицию для обеззараживания и ароматизации воздуха, содержащую смесь эфирного масла сосны сибирской, эфирного масла пихты сибирской и этилового спирта.

Изобретение относится к химико-фармацевтической промышленности и представляет собой композицию для обеззараживания и ароматизации воздуха, содержащую смесь эфирного масла сосны сибирской, эфирного масла пихты сибирской и этилового спирта.

Способ дезодорирования воздуха в лифтах относится к области дезодорации воздуха и предназначен для уменьшения запахов от испражнений или экскрементов животных в лифтах.

Изобретение относится к области ветеринарии. Предложен способ профилактики африканской чумы свиней, включающий выявление животных с инфекционным заболеванием на начальной стадии развития, убой больных и дальнейшее обследование остальных животных.
Изобретение относится к области медицины, а именно к дезинфектологии, и предназначено для профилактики вспышек инфекционных заболеваний. Для дезинфекции систем вентиляции вначале в отсутствие притока воздуха аэрозоль дезинфицирующего средства нагнетают в технологические отверстия вентиляционных каналов в расчетном количестве.

Изобретение относится к области ветеринарии. Предложен способ профилактики нодулярного дерматита крупного рогатого скота (КРС), включающий выявление животных с инфекционным заболеванием на начальной стадии развития, убой больных и дальнейшее обследование остальных животных.

Изобретение относится к области ветеринарии и предназначено для профилактики оспы овец и коз. Способ включает выявление 2,5-3% от общего количества животных с инфекционным заболеванием на начальной стадии развития в очаге и 1-й угрожаемой зоне, убой больных и дальнейшее обследование остальных животных.
Группа изобретений относится к бытовой химии, а именно к способу выделения активного ингредиента в воздух, включающему распыление распылительной композиции в воздух, содержащей носитель, включающий н-пропиловый эфир дипропиленгликоля и который имеет давление паров менее 14 Па при 20°С, и активный ингредиент в смеси с носителем; а также к распылительному устройству, содержащему распыляющий электрод, соединенный с емкостью для помещения распылительной композиции, разрядный электрод вблизи распыляющего электрода и участок для приложения электрического поля к распыляющему электроду и разрядному электроду, чтобы распылительная композиция, поступающая из резервуара в распыляющий электрод, выбрасывалась с распыляющего электрода в воздух.

Изобретение относится к области дезинфекции и предназначено для создания дезинфицирующего фильтрационного барьера на приточных и вытяжных отверстиях воздуховодов канальной вентиляции и вентиляционных решетках систем естественной и механической вентиляции.

Группа изобретений относится к области фотокаталитической очистки газов и может быть использована для уничтожения органических загрязняющих веществ, присутствующих в воздухе.

Группа изобретений относится к биотехнологии. Предложены композиция, включающая штаммы нескольких культур микроорганизмов, применение указанной композиции, способ нанесения композиции, способ предотвращения запаха, способ проверки запаха в системе кондиционирования воздуха транспортного средства, предусматривающие нанесение композиции на сердцевину испарителя в концентрации 104-108 КОЕг, а также 14 штаммов, относящихся к видам микроорганизмов, входящим в состав композиции. Изобретения обеспечивают эффективное предотвращение запаха из системы кондиционирования воздуха транспортного средства. 18 н. и 11 з.п. ф-лы, 19 ил., 12 табл., 14 пр.

Наверх