Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина



Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина
Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина
Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина
Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина
Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина
Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина
Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина
Рнк-проводники для подавления репликации вируса гепатита b и для элиминации вируса гепатита b из клетки-хозяина
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2652899:

Федеральное бюджетное учреждение науки "Центральный научно-исследовательский институт эпидемиологии" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора) (RU)

Изобретение относится к биотехнологии, а именно к генной инженерии. Описан РНК-проводник (направляющих РНК) для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 1 и SEQ ID NO: 2, и вторую нуклеотидную последовательность SEQ ID NO: 5, фланкирующую первую последовательность с 3´-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность содержит РАМ-мотив, способный распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus pyogenes с обеспечением элиминации вируса гепатита B. Также описан РНК-проводник для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 3 и SEQ ID NO: 4, и вторую нуклеотидную последовательность SEQ ID NO: 6, фланкирующую первую последовательность с 3´-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность способна распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus thermophilus с обеспечением элиминации вируса гепатита B. Изобретения могут быть использованы в системах CRISPR-Cas9 для воздействия на высококонсервативные области генома вируса гепатита В (HBV) с последующей элиминацией ДНК вируса HBV, включая кольцевую ковалентно замкнутую ДНК (ккзДНК) HBV, из клетки-хозяина, такой как клетка млекопитающего (например, человека), в частности из гепатоцита человека, а также для подавления репликации вируса гепатита B. По сравнению с известными из уровня техники РНК-проводниками, используемыми в системах CRISPR-Cas9 для воздействия на ДНК HBV, РНК-проводники по изобретению обеспечивают усиленное действие таких систем на высококонсервативные области генома вируса гепатита В и сокращение сроков элиминации вирусной ДНК из клетки-хозяина. 2 н. и 8 з.п. ф-лы, 8 ил., 2 табл., 3 пр.

 

Изобретение относится к области медицины и генной инженерии, а именно к числу средств – РНК-проводников (направляющих РНК), которые могут быть использованы в системах CRISPR-Cas9 для воздействия на высококонсервативные области генома вируса гепатита В (HBV) с последующей элиминацией ДНК вируса HBV, включая кольцевую ковалентно замкнутую ДНК (ккзДНК, cccDNA) HBV, из клетки-хозяина, такой как клетка млекопитающего (например, человека), в частности из гепатоцита человека, а также для подавления репликации вируса гепатита B. По сравнению с известными из уровня техники РНК-проводниками, используемыми в системах CRISPR-Cas9 для воздействия на ДНК HBV, РНК-проводники по изобретению обеспечивают усиленное действие таких систем на высококонсервативные области генома вируса гепатита В и сокращение сроков элиминации вирусной ДНК из клетки-хозяина.

Вирус гепатита В (HBV) является высококонтагиозным вирусом, способным инфицировать человека и вызывать острый или хронический гепатит В. Случаи заражения вирусным гепатитом В отмечаются по всему миру, с наибольшей распространенностью в странах Среднего и Ближнего Востока, Азии, странах Карибского Бассейна, Африки и Южной Америки. По данным ВОЗ, ежегодно регистрируются 350 млн новых случаев заражения вирусным гепатитом В, из которых 1 млн человек ежегодно погибает от его последствий, цирроза печени или гепатоцеллюлярной карциномы (ГЦК) (Custer B et al., 2004; Wright TL, 2006). В Российской Федерации, как и в странах Западной Европы, США, Канаде, Австралии, мероприятия по вакцинации против HBV значительно снизили заболеваемость острым гепатитом В, однако ежегодно в нашей стране регистрируется более сорока тысяч новых случаев хронической инфекции HBV, основной причины цирроза и рака печени (гепатоцеллюлярной карциномы), причем абсолютно большая доля заболевших гепатитом В приходится на молодое трудоспособное население (90%). Распространенность вирусного гепатита B в Российской Федерации составляет 2% от общего населения страны, то есть около 3 млн человек. Заболеваемость вирусом гепатита В – одна из самых серьезных проблем российского здравоохранения. (Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека, Государственный доклад «О состоянии санитарно-эпидемиологического благополучия населения в Российской Федерации в 2013 году», 24.06.2014, http://rospotrebnadzor.ru/documents/details.php?ELEMENT_ID=1984).

Острая форма инфекции HBV чаще всего протекает бессимптомно и характеризуется спонтанной элиминацией вируса. Однако в некоторых случаях острая форма инфекции может перетекать в хроническую. Как показано в литературе, хроническая форма инфекции (ХГВ) развивается у 95% новорожденных, у 20-30% детей в возрасте от 1 до 5 лет и менее чем у 5% взрослых (Trépo, et al. Lancet, 2014, 384(9959): 2053-63). В литературе показано, что у 1-2% взрослых с хроническим гепатитом B развивается цирроз печени, у 2-5% - гепатоцеллюлярная карцинома (Liaw et al, Hepatology, 1988, 8: 493-496; Fattovich et al, Gastroenterology, 2004; 127: S35-S50). У детей, страдающих ХГВ, риск развития гепатоцеллюлярной карциномы существенно повышен: показано, что она развивается у 25-50% детей, инфицированных HBV. В целом, как показано, примерно у 40% людей, страдающих ХГВ, рано или поздно развивается цирроз печени, гепатоцеллюлярная карцинома или печеночная недостаточность (Perz et al, Journal of Hepatology, 2006; 45: 529-538).

В качестве наиболее близкого аналога настоящего изобретения выбрана работа Kennedy E.M., et al. (“Suppression of hepatitis B virus DNA accumulation in chronically infected cells using a bacterial CRISPR/Cas RNA-guided DNA endonuclease” // Virology, 2015, 476: 196-205, URL: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4323668), в которой использование РНК-проводников совместно с белками Cas9 Streptococcus pyogenes позволяет воздействовать на различные стадии жизненного цикла вируса гепатита В, что позволяет не только уменьшить общий уровень вирусной ДНК HBV примерно в 1000 раз, но и снизить уровень ккзДНК HBV примерно в 10 раз; использование РНК-проводников совместно с белками Cas9 позволяет также инактивировать остаточную ккзДНК HBV.

Задачей изобретения является разработка новых средств – РНК-проводников (направляющих РНК), которые могут быть использованы в системах CRISPR-Cas9 с белками Cas9, такими как белки Cas9 Streptococcus pyogenes или Streptococcus thermophilus, для элиминации ДНК и прегеномной РНК вируса гепатита В из клетки-хозяина (например, из эукариотической клетки, такой как клетка гепатоцита млекопитающего или, более конкретно, клетка гепатоцита человека), и воздействия на различные стадии жизненного цикла вируса гепатита В (в том числе на стадии, способные к хронической персистенции в организме хозяина и приводящие к развитию у инфицированного лица цирроза печени и/или гепатоцеллюлярной карциномы). Изобретение обеспечивает повышение эффективности лечения острого и хронического вирусного гепатита B, а также повышение эффективности профилактики цирроза печени и гепатоцеллюлярной карциномы, вызванных хронической персистенцией кольцевой ковалентно замкнутой ДНК вируса гепатита B в организме хозяина.

Достигаемый технический результат является комплексным и включает в себя:

- повышение степени элиминации прегеномной РНК (пгРНК, pgRNA) вируса HBV - коррелята активной транскрипции при HBV инфекции;

-- сокращение продолжительности курса терапии, необходимого для элиминации ккзДНК HBV;

- повышение степени элиминации ккзДНК HBV – коррелята хронической персистенции HBV в организме хозяина, имеющей исход в гепатоцеллюлярную карциному и/или в цирроз печени;

- сокращение сроков элиминации ккзДНК HBV из гепатоцитов;

- уменьшение секретируемой ДНК HBV;

- уменьшение поверхностного антигена HBV (HBsAg);

- уменьшение кор-белка, компонента вирионов и регулятора транскрипции ккзДНК;

- уменьшение Х белка HBV, основного про-онкогенного фактора, одного из ключевых компонентов развития фиброза и ГЦК;

- расширение арсенала средств, которые могут использоваться в системе CRISPR-Cas9 для воздействия на высококонсервативные участки генома вируса гепатита B для элиминации различных стадий жизненного цикла вируса гепатита В, включая пгРНК HBV и ккзДНК HBV.

Задача решается, а технический результат достигается созданием молекулы РНК-проводника для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 1 (TCCGCAGTATGGATCGGCAG) и SEQ ID NO: 2 (GCAGATGAGAAGGCACAGAC), и вторую нуклеотидную последовательность SEQ ID NO: 5, фланкирующую первую последовательность с 3'-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность содержит РАМ-мотив, способный распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus pyogenes с обеспечением элиминации вируса гепатита B.

Согласно предпочтительным вариантам реализации указанный технический результат также достигается тем, что:

- РНК-направляемая ДНК-эндонуклеаза Cas9 Streptococcus pyogenes распознаёт последовательность ДНК, содержащую PAM-мотив NGG;

- клетка-хозяин представляет собой клетку млекопитающего, инфицированную вирусом гепатита В, или клетку млекопитающего, в которой персистирует вируc гепатита В;

- ДНК вируса гепатита B представляет собой кольцевую ковалентно замкнутую ДНК (ккзДНК).

Молекула РНК-проводника по п. 1, отличающаяся тем, что вирус гепатита B имеет генотип, который выбран из группы, включающей генотипы A, В, С, D, Е, F, G и H.

Задача также решается, а технический результат достигается созданием молекулы РНК-проводника для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 3 (GGCGGGGTTTTTCTTGTTGA) и SEQ ID NO: 4 (GGCACTAGTAAACTGAGCCA), и вторую нуклеотидную последовательность SEQ ID NO: 6, фланкирующую первую последовательность с 3'-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность способна распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus thermophilus с обеспечением элиминации вируса гепатита B.

Согласно предпочтительным вариантам реализации указанный технический результат также достигается тем, что:

- РНК-направляемая ДНК-эндонуклеаза Cas9 Streptococcus thermophilus распознаёт последовательность ДНК, содержащую PAM-мотив NNAGAAW;

- клетка-хозяин представляет собой клетку млекопитающего, инфицированную вирусом гепатита В, или клетку млекопитающего, в которой персистирует вируc гепатита В;

- ДНК вируса гепатита B представляет собой кольцевую ковалентно замкнутую ДНК (ккзДНК);

- вирус гепатита B имеет генотип, который выбран из группы, включающей генотипы A, В, С, D, Е, F, G и H.

Также изобретение поясняется чертежами.

На фиг. 1 приведено снижение транскрипции HBV при ко-трансфекции систем S. thermophiles CRISPR/Cas9 и плазмиды 1.1merHBV в клетках HepG2 уже на 3 сутки после трансфекции. РНК-проводник SEQ ID NO: 4 (St4) снижает pgRNA и S-RNA (S-РНК HBV) на 87% и 62%, соответственно, в то время как SEQ ID NO: 3 (St3) снижает транскрипцию HBV только по pgRNA на 69%.

На фиг. 2 приведено противовирусное действие систем S. thermophiles CRISPR/Cas9 с РНК-проводниками SEQ ID NO: 3 (St3) и SEQ ID NO: 4 (St4). Высокоэффективная нуклеофекция клеток-модели хронической инфекции HBV HepG2-1.1merHBV, плазмидами, кодирующими StCas9-T2A-Blasticidin и ПЦР-продукты с U6-промотором и РНК-проводниками St3 и St4, с последующей негативной селекцией нетрансфицированных клеток. St3 и St4 приводят к значительному снижению всех показателей вирусного цикла (pgRNA на 56% и 61%, S-RNA на 63% и 64%, секретируемого HBsAg на 0,45 МЕ/мл и 1,65 МЕ/мл, секретируемой ДНК HBV на 59% и 53%, ккзДНК на 60% и 74% для St3 и St4, соответственно).

На фиг. 3 показана нуклеофекция клеток HepG2-1.1merHBV. На фиг. 3A – результаты FACS-анализа нуклеофицированных клеток по зеленому каналу FITC-A; на фиг. 3В – иммунофлуоресцентные фотографии нуклеофицированных клеток в светлом поле (слева) и на канале FITC-А (справа). Эффективность нуклеофекции воспроизводимо составляет 85±2%.

На фиг. 4 показано сравнение противовирусной эффективности пятидесяти РНК-проводников системы CRISPR/Cas9. На модели ко-трансфекции клеток HepG2 системами CRISPR/Cas9 и плазмиды, запускающей цикл HBV (1.1merHBV) была проведена оценка противовирусной активности пятидесяти индивидуальных РНК-проводников, среди которых Sp37 (SEQ ID NO: 2), Sp31, Sp20 (SEQ ID NO: 1), Sp15, Sp12, Sp11, Sp9 и Sp8 показали высокую эффективность по снижению транскрипции HBV.

На фиг. 5 приведено противовирусное действие S.pyogenes CRISPR/Cas9. На 7-е сутки после нуклеофекции клеток HepG2-1.1merHBV плазмидой, кодирующей Cas9-T2A-Blasticidin, и ПЦР-продуктами с U6-промотором и РНК-проводником Sp20 или Sp37 приводит к снижению транскрипции HBV pgRNA на 85% и 86%, S-RNA на 70% и 43% и ккзДНК на 79% и 82% для Sp20 (SEQ ID NO: 1) и Sp37 (SEQ ID NO: 2), соответственно.

На фиг. 6 показана трансфекция CRISPR/Cas9 с эффективными РНК-проводниками снижает выработку HBcAg HBV. При ко-трансфекции клеток HepG2 системами CRISPR/Cas9 с плазмидой, запускающей цикл HBV, происходит снижение выработки кор-антигена HBV – белка, участвующего в сборке вирионов и транскрипции ккзДНК (представлено изображение по действию Sp20). Иммуноцитохимическое окрашивание клеток HepG2, красный канал (594 нм) HBcAg; синий канал (365 нм) Hoechst33342, ядра клеток, Merged – наложение изображений.

На фиг. 7 показана трансфекция CRISPR/Cas9 с эффективными РНК-проводниками снижает выработку HBxAg HBV. Ко-трансфекция клеток HepG2 снижает продукцию HBx белка HBV, основного про-онкогенного белка HBV, играющего ключевую роль в злокачественной трансформации гепатоцитов и развития гепатоцеллюлярной карциномы. Иммуноцитохимическое окрашивание клеток HepG2, красный канал (594 нм) HBxAg; синий канал (365 нм) Hoechst33342, ядра клеток, Merged – наложение изображений.

На фиг. 8 показано внесение разрывов в ккзДНК HBV. Выделение ккзДНК HBV на 7-е сутки после нуклеофекции проводили с помощью Hirt-экстракции и обработки изолятов ферментом Plasmid-safe ATP-dependent DNase, разрушающим все виды ДНК, кроме кольцевых форм. Секвенирование нового поколения с помощью MiSeq проводили на ампликонах, полученных с помощью специфических праймеров с участка, охватывающего сайт нуклеолитического разрыва. Как видно из чертежа, РНК-проводник Sp20 с плазмидой, кодирующей S.pyogenes Cas9, вносит многочисленные мутации (на чертеже представлены делеции), включая делеции, инсерции, инверсии, рекомбинации и SNP в зоне разрыва.

Далее приводятся примеры осуществления изобретения, которые иллюстрируют, но не охватывают все возможные варианты осуществления изобретения и не ограничивают изобретение.

Примеры осуществления изобретения

Пример 1

В экспериментах были использованы 4 вида систем CRISPR/Cas9, полученных из 4 видов бактериальных организмов: Cas9 Streptococcus pyogenes (SpCas9), Cas9 Streptococcus thermophiles (StCas9), Cas9 Neisseria meningitides (NmCas9) и Cas9 Francicella novicida (FnCas9). Отличие этих систем состоит в разных консенсусах участка PAM: NGG для SpCas9 и FnCas9 (при этом SpCas9 может расщеплять только ДНК, в то время как для FnCas9 была также показана активность в отношении РНК), NmCas9 с РАМ NNNNGATT и NNAGAAW для StCas9.

Первым этапом настоящей работы стал подбор последовательностей-мишеней в ккзДНК для создания РНК-проводников, с этой целью мы использовали современные алгоритмы in silico и программы, находящиеся в открытом доступе, включая BroadInstitute (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design) и Center for Organismal Studies, Heidelberg (http://crispr.cos.uni-heidelberg.de/). Был составлен перечень участков на геноме HBV с теоретически рассчитанной вероятностью их расщепления в консервативных и относительно консервативных участках генома.

Второй этап – синтез ПЦР-продуктов, содержащих U6-промотор и участок, соответствующий РНК-проводнику, с помощью двухэтапного мутагенного ПЦР (Cong L et al., 2013). Промежуточные продукты и ПЦР-продукты очищали на колонках Qiagen (QIAquick gel extraction kit) после вырезания из геля. Чистоту и концентрации ПЦР-продуктов оценивали по оптическому светопоглощению на спектрофотометре Nanodrop 2000. Для проверки точного совпадения полученных нуклеотидных последовательностей с заявленными последовательностями ПЦР-продуктов проводили клональное секвенирование. ПЦР-продукты получали в реакциях с высокоточной Q5-полимеразой (New England Biolabs).

Третий этап – проверка эффективности разрезания выбранных участков в культурах клеток-моделях хронической инфекции HBV in vitro. В основе этого этапа лежат два подхода.

Первый этап состоит в ко-трансфекции линии клеток гепатомы человека HepG2 векторами, кодирующими геном HBV под индуцибельным tet-on промотором (HBV генотипа D, 1.1mer-геном, предоставлено Dieter Glebe, Giessen University), плазмидами, кодирующими белки Cas9 (Addgene#63592 – SpCas9; Addgene#48669 – StCas9; Addgene#48670 – NMCas9; Addgene#68705 – FnCas9) и синтезированными ПЦР-продуктами, кодирующими РНК-проводник. Клетки ко-трансфицировали с помощью реагента полиэтиленимина или реагента Lipofectamine 2000, транскрипцию HBV активировали в течение 24 часов обработкой доксициклином (100 нг/мл). Оценку противовирусного действия систем CRISPR/Cas9 проводили через 3 суток по основным транскриптам ккзДНК HBV – прегеномной РНК HBV и S-РНК HBV методом ПЦР в режиме реального времени с помощью пары специфических праймеров и зондов после выделения нуклеиновых кислот, обработки ДНКазой I типа без РНКазной активности и обратной транскрипции.

Второй этап состоит в нуклеофекции модели хронической инфекции HBV, трансгенной линии клеток человека со вставкой 1.1mer генома HBV под индуцибельным tet-on промотором. Клетки HepG2-1.1merHBV воспроизводят полноценный цикл репликации HBV, в том числе образование полноценной ккзДНК, секрецию HBsAg и пр. Постановку нуклеофекции осуществляли на приборе Lonza с помощью наборов Amaxa 4D Nucleofector (V4XC-2024). В смесь для нуклеофекци входили: (1) вектор, кодирующий Cas9 белок с белком антибиотикорезистентности к бластицидину и (2) ПЦР-продукт, кодирующий РНК-проводник. Клетки нуклеофицировали, активировали сразу после нуклеофекции в течение 24 часов в среде с доксициклином (100 нг/мл). Эффективность нуклеофекции по данным проточной цитофлюориметрии составляла 80-85%. Для удаления не трансфицированных клеток проводили негативную селекцию путем инкубации клеток в полной среде с выбранной концентрацией бластицидина. Снятие клеток и выделение нуклеиновых кислот производили на 5 сутки после нуклеофекции. Противовирусное действие систем CRISPR/Cas9 оценивали по экспрессии прегеномной РНК HBV, S-РНК HBV, количествам секретируемого HBsAg, секретируемой ДНК HBV и относительному количеству ккзДНК. Остаточные матрицы ккзДНК в экспериментальных образцах с системами CRISPR/Cas9 использовали для амплификации участка нуклеолитического расщепления и секвенирования продуктов ПЦР методом NGS (MiSeq). Частоту мутаций подсчитывали в программе Geneious 6.1.8.

Пример 2

Для работы обоих типов систем (S.thermophiles и S.pyogenes) необходим РНК-проводник, состоящий из целевого участка, прилежащего к РАМ-последовательности (NGG и NNAGAAW, соответственно), и шпильки, распознаваемой белком Cas9.

На модели скрининга – ко-трансфекции клеток HepG2 плазмидой, кодирующей Cas9 белок, плазмидой 1.1merHBV, запускающей цикл вируса, и ПЦР-продуктами, кодирующими соответствующие РНК-проводники, по влиянию на снижение транскрипции HBV были отобраны РНК-проводники с наивысшими значениями противовирусного действия (см. фиг. 1, 3). Дальнейший анализ выявил РНК-проводники в высококонсервативных регионах генома HBV (см. таблицу 1), что позволяет использовать указанные РНК-проводники для лечения большинства пациентов с хроническим гепатитом B вне зависимости от генотипа или пригодных для большинства генотипов.

Таблица 1. Процент абсолютных (точных) совпадений последовательностей РНК-проводников с учетом РАМ-распознающих последовательностей для S.pyogenes CRISPR/Cas9 (NGG) и S.thermophiles CRISPR/Cas9 (NNAGAAW) среди всех генотипов HBV (А-Н). Процент был рассчитан в программе Geneious 6.1.8 с полногеномными последовательностями HBV, взятыми из базы данных GenBank. Все выбранные РНК-проводники с учетом РАМ-распознающих участков, располагаются в высококонсервативных областях, идентичных для большинства генотипов и абсолютного большинства субтипов внутри каждого генотипа.

РНК-проводник A (794), % B (1450), % C (1830), % D (882), % E (250), % F (227), % G (36), % H (26), % Противовирусная активность (pgRNA, %)
Sp20 98,7 83,7 90,3 91,6 86,4 96,5 100 88,5 90,7
Sp37 97,1 81,1 91,5 97,8 75,6 1,8 11,1 0 87,4
St3 95,6 3,0 88,7 93,5 0 0,9 97,2 0 69,8
St4 98,6 97,2 92,7 97,3 98 0,9 100 3,8 86,6

Эксперименты по нуклеофекции на модели хронической инфекции HepG2-1.1merHBV (см. фиг. 2, 3, 5) выявили, что S.thermophiles и S.pyogenes CRISPR/Cas9 снижают все показатели цикла HBV: транскрипцию (pgRNA, S-RNA), а главное, ключевой компонент вирусного цикла, ответственный за хронизацию инфекции, кольцевую ковалентно замкнутую ДНК (снижение ккзДНК на 60%-74% для S.thermophiles и на 79%-82% для S.pyogenes CRISPR/Cas9). Стоит отметить, что в прототипе и других объектах из уровня техники снижение ккзДНК происходит на 67% (Kennedy E.M., et al. “Suppression of hepatitis B virus DNA accumulation in chronically infected cells using a bacterial CRISPR/Cas RNA-guided DNA endonuclease” // Virology. 2015, 476: 196-205) и 71% (Ramanan V., et al. “CRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus” // Scientific Reports. 2015; 5:10833), что хуже показателей по снижению ккзДНК, которых удалось достичь авторам настоящего изобретения – 79-82 %.

Кроме того, в обеих вышеупомянутых работах результаты были получены к 13-м суткам или к 21-м суткам после внесения CRISPR/Cas9 систем, в то время как в условиях настоящего изобретения все результаты получены на 7-е сутки, причем на одной из лучших моделей хронического гепатита клетках HepG2-1.1merHBV, которые воспроизводят полноценный цикл репликации и наиболее близки по характеристикам к естественному циклу HBV. В целом, это говорит о значительно более выраженном противовирусном эффекте выбранных РНК-проводников. Более того, в отличие от всех ранее опубликованных в уровне техники данных в настоящем изобретении впервые использовали системы S.thermophiles CRISPR/Cas9 на модели хронического гепатита. Известно, что S.thermophiles CRISPR/Cas9 обладают меньшим размером, большей специфичностью действия и меньшей вероятностью внесения внецелевых разрывов в сравнении с классическим белком S.pyogenes Cas9, что связано с особенностями структуры белка S.thermophiles и более длинным РАМ (NNAGAAW – семь букв против NGG – трёх букв у S.pyogenes Cas9) (Müller M., et al. “Streptococcus thermophilus CRISPR-Cas9 Systems Enable Specific Editing of the Human Genome” // Molecular Therapy. 2016, 24(3): 636-644).

Пример 3

Также были получены данные по снижению секреции HBsAg, HBV DNA и снижению интенсивности окрашивания клеток на HBcAg HBV и HBxAg (Рис. 2, 5, 7). Методом секвенирования нового поколения было продемонстрировано, что оставшиеся матрицы ккзДНК содержат индел мутации и другие полиморфизмы в сайтах РНК-проводников (Рис. 6, Табл. 2), что указывает на прямое нуклеолитическое действие систем CRISPR/Cas9 на ккзДНК.

Таблица 2. Сводная таблица по внесению мутаций в ккзДНК под действием CRISPR/Cas9 систем с РНК-проводником Sp20. Результаты были получены на ккзДНК на 7 сутки после нуклеофекции CRISPR/Cas9 системы. Ампликоны, охватывающие участок нуклеолитического расщепления, были наработаны с ккзДНК и секвенированы методом NGS на секвенаторе MiSeq (97,079 прочтений). Результаты обрабатывали в программе Geneious 6.1.8.

Делеции (1-4 nts),
%
Делеции (5-10 nts),
%
Делеции
(13 nts),
%
Общие делеции,
%
Инсерции
(1-4 nts),
%
Общие инсерции,
%
SNP,
%
Частота варианта 17,40 1,12 0,50 19,10 0,35 35,10 0,49
Частота мутаций со сдвигом рамок считывания 10,20 1,10 0,50 11,80 0,21 21,10 0,49
Доля мутаций со сдвигом рамок считывания 61,80 60,10 100

Таким образом, угнетение вирусного цикла и внесение мутаций в матрицы ккзДНК, не подвергшиеся нуклеолитической деградации, связаны с действием выбранных CRISPR/Cas9 систем с указанными РНК-проводниками. В отличие от технологии siRNA и miRNA, которые используют короткие РНК для интерференции с транскриптами HBV и не оказывают прямого влияния на ккзДНК, действие CRISPR/Cas9 систем связано с прямым нуклеолитическим действием Cas9 белка на целевую мишень (ккзДНК). HBV – генетически гетерогенный вирус, поэтому получение высокоэффективных РНК-проводников, направляющих Cas9 белок к консервативным участкам HBV, – один из ключевых этапов в создании перспективного противовирусного средства. Мишени полученных РНК-проводников находятся в высококонсервативных регионах (доля абсолютных совпадений с учетом прилежащих РАМ-последовательностей выше 90% по большинству генотипов HBV), вызывают расщепление целевой мишени (ккзДНК) либо вносят многочисленные мутации и оказывают мощное противовирусное действие на всех использованных моделях.

1. Молекула РНК-проводника для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 1 и SEQ ID NO: 2, и вторую нуклеотидную последовательность SEQ ID NO: 5, фланкирующую первую последовательность с 3´-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность содержит РАМ-мотив, способный распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus pyogenes с обеспечением элиминации вируса гепатита B.

2. Молекула РНК-проводника по п. 1, отличающаяся тем, что РНК-направляемая ДНК-эндонуклеаза Cas9 Streptococcus pyogenes распознаёт последовательность ДНК, содержащую PAM-мотив NGG.

3. Молекула РНК-проводника по п. 1, отличающаяся тем, что клетка-хозяин представляет собой клетку млекопитающего, инфицированную вирусом гепатита В, или клетку млекопитающего, в которой персистирует вируc гепатита В.

4. Молекула РНК-проводника по п. 1, отличающаяся тем, что ДНК вируса гепатита B представляет собой кольцевую ковалентно замкнутую ДНК (ккзДНК).

5. Молекула РНК-проводника по п. 1, отличающаяся тем, что вирус гепатита B имеет генотип, который выбран из группы, включающей генотипы A, В, С, D, Е, F, G и H.

6. Молекула РНК-проводника для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 3 и SEQ ID NO: 4, и вторую нуклеотидную последовательность SEQ ID NO: 6, фланкирующую первую последовательность с 3´-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность способна распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus thermophilus с обеспечением элиминации вируса гепатита B.

7. Молекула РНК-проводника по п. 6, где РНК-направляемая ДНК-эндонуклеаза Cas9 Streptococcus thermophilus распознаёт последовательность ДНК, содержащую PAM-мотив NNAGAAW.

8. Молекула РНК-проводника по п. 6, отличающаяся тем, что клетка-хозяин представляет собой клетку млекопитающего, инфицированную вирусом гепатита В, или клетку млекопитающего, в которой персистирует вируc гепатита В.

9. Молекула РНК-проводника по п. 6, отличающаяся тем, что ДНК вируса гепатита B представляет собой кольцевую ковалентно замкнутую ДНК (ккзДНК).

10. Молекула РНК-проводника по п. 6, отличающаяся тем, что вирус гепатита B имеет генотип, который выбран из группы, включающей генотипы A, В, С, D, Е, F, G и H.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к полипептидам для лечения или предотвращения аллергий на аллергены пыльцы трав Ph1P1, пыльцы березы Betv1 и клеща домашней пыли Derp2, что может быть использовано в медицине.

Изобретение относится к биотехнологии и представляет собой способ получения вирусоподобных частиц, содержащих структурные антигены core, E1 и Е2 вируса гепатита С и способ очистки вирусоподобных частиц.

Изобретение относится к биотехнологии, а именно генной инженерии. Предложены способ получения рекомбинантного капсидного белка вируса гепатита E (rtHEV-ORF2) и рекомбинантная вакцина для профилактики вирусного гепатита E.

Изобретение относится к биотехнологии, а именно генной инженерии. Предложен штамм дрожжей Hansenula polymorpha - продуцент рекомбинантного капсидного белка вируса гепатита Е (HEV) генотипа 3.

Изобретение относится к области биотехнологии, в частности к набору из двух праймеров для амплификации нуклеиновой кислоты вируса гепатита А, к способу обнаружения вируса гепатита А в биологическом образце, а также к набору для обнаружения вируса гепатита А в биологическом образце.

Изобретение относится к молекулярной биологии, вирусологии и медицине. .

Вакцина // 2363492
Изобретение относится к области медицины, молекулярной биологии и генной инженерии. .

Изобретение относится к способам и композициям, полезным для предупреждения и лечения инфекций, вызванных вирусом гепатита С (HCV). .

Изобретение относится к области медицины и касается нового полипептида вируса гепатита С NS3/4A и его использования в вакцине. .

Изобретение относится к биотехнологии. Описана молекула нуклеиновой кислоты, содержащая двухцепочечную структуру,где двухцепочечная структура образована первой цепью и второй цепью, где первая цепь состоит из следующей нуклеотидной последовательности:5'-acGaGcUgGaCcAcUgGuCdTSdT-3' и вторая цепь состоит из следующей нуклеотидной последовательности:5'-GAcCaGuGgUcCaGcUcGudTSdT-3', где то, что нуклеотид указан строчной буквой, указывает на то, что нуклеотид является 2'-F-модифицированным, и подчеркивание нуклеотида указывает на то, что нуклеотид является 2'-O-метил-модифицированным и где dTSdT указывает на то, что на 3'-конце присоединен динуклеотид, состоящий из двух нуклеотидов dT, где указанные два dT ковалентно связаны посредством фосфотиоатной связи.

Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 55-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 14-го – 34-го или 15-го – 34-го нуклеотидов, считая от 5'-конца 55-го экзона гена дистрофина человека.

Изобретение относится к области биотехнологии. Предложены кольцевой двухцепочечный полинуклеотид для интеграции экзогенной нуклеиновой кислоты в геном клетки и способ интеграции экзогенной последовательности нуклеиновой кислоты в эндогенный локус клетки.

Изобретение относится к области биотехнологии. Предложены кольцевой двухцепочечный полинуклеотид для интеграции экзогенной нуклеиновой кислоты в геном клетки и способ интеграции экзогенной последовательности нуклеиновой кислоты в эндогенный локус клетки.

Группа изобретений относится к области биотехнологии. Предложены изолированный полинуклеотидный субстрат для каталитической нуклеиновой кислоты с ферментативной активностью и его применение, способ детектирования присутствия мишени в образце, использующий указанный субстрат, а также набор для детекции молекулы-мишени и комплект для детекции молекулы-мишени, содержащие указанный субстрат, и набор для применения в сигнальном каскаде, содержащий указанный комплект.

Группа изобретений относится к области биотехнологии. Предложены изолированный полинуклеотидный субстрат для каталитической нуклеиновой кислоты с ферментативной активностью и его применение, способ детектирования присутствия мишени в образце, использующий указанный субстрат, а также набор для детекции молекулы-мишени и комплект для детекции молекулы-мишени, содержащие указанный субстрат, и набор для применения в сигнальном каскаде, содержащий указанный комплект.

Настоящее изобретение относится к области биотехнологии, конкретно к молекуле мРНК, содержащей кодирующую область, кодирующую содержащий опухолевый антиген белок, по меньшей мере, одну гистоновую структуру типа «стебель-петля» и поли(A)-последовательность или сигнал полиаденилирования, и может быть использовано в медицине.

Группа изобретений относится к области биотехнологии. Предложен вариант мутантной рекомбинантной гепариназы I из Pedobacter heparinus, содержащий следующие аминокислотные замены по сравнению с аминокислотной последовательностью исходной гепариназы I: E117Q, Q118P, Е362Р, Y363P.

Изобретение относится к области биохимии, в частности к способу борьбы с насекомыми, выбранными из группы, состоящей из Pseudoplusia includens, Anticarsia gemmatalis, Spodoptera frugiperda и Heliothis virescens, а также к способу борьбы с сорняками сельскохозяйственной культуры сои, который включает обработку сельскохозяйственной культуры сои гербицидом глюфосинатом.

Изобретение относится к области биохимии. Описана группа изобретений, включающая конъюгат, снижающий уровень экспрессированной в печени РНК, содержащий антисмысловой LNA-олигомер и ковалентно связанную с ним конъюгатную группировку, содержащую группу, направленную на асиалогликопротеиновый рецептор и фармацевтическую композицию, содержащую вышеуказанный конъюгат в эффективном количестве.

Изобретение относится к области биохимии. Описан набор олигонуклеотидных проб для определения генотипа митохондриальной ДНК человека, характеризующийся тем, что данный набор позволяет определить генотип митохондриальной ДНК человека в 38 однонуклеотидных сайтах, расположенных в различных участках митохондриального генома и полиморфных в популяциях населения России различного этнического происхождения, с помощью метода ферментативного однонуклеотидного удлинения гибридизированной пробы, причем структура олигонуклеотидных проб учитывает вариабельность ДНК в близлежащих сайтах и группировку генотипируемых сайтов в 3 панели для мультиплексных реакций.

Изобретение относится к биотехнологии, а именно к генной инженерии. Описан РНК-проводник для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 1 и SEQ ID NO: 2, и вторую нуклеотидную последовательность SEQ ID NO: 5, фланкирующую первую последовательность с 3´-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность содержит РАМ-мотив, способный распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus pyogenes с обеспечением элиминации вируса гепатита B. Также описан РНК-проводник для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 3 и SEQ ID NO: 4, и вторую нуклеотидную последовательность SEQ ID NO: 6, фланкирующую первую последовательность с 3´-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность способна распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus thermophilus с обеспечением элиминации вируса гепатита B. Изобретения могут быть использованы в системах CRISPR-Cas9 для воздействия на высококонсервативные области генома вируса гепатита В с последующей элиминацией ДНК вируса HBV, включая кольцевую ковалентно замкнутую ДНК HBV, из клетки-хозяина, такой как клетка млекопитающего, в частности из гепатоцита человека, а также для подавления репликации вируса гепатита B. По сравнению с известными из уровня техники РНК-проводниками, используемыми в системах CRISPR-Cas9 для воздействия на ДНК HBV, РНК-проводники по изобретению обеспечивают усиленное действие таких систем на высококонсервативные области генома вируса гепатита В и сокращение сроков элиминации вирусной ДНК из клетки-хозяина. 2 н. и 8 з.п. ф-лы, 8 ил., 2 табл., 3 пр.

Наверх