Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена lif и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном lif, способ получения и использования

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, где клетки органов и тканей выбраны из фибробластов, клеток эндометрия матки, эпителиальных клеток; органы и ткани выбраны из кожи, слизистой оболочки рта или мышечной ткани, представляющего собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена LIF, с кодирующей последовательностью белка фактора, ингибирующего лейкемию, с делениями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека. Группа изобретений также касается способа получения указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию; способа использования указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 20 ил., 18 пр.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и может быть использовано для коррекции патологических состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, в частности, в терапевтических целях.

Предшествующий уровень.

В организме человека присутствуют низкомолекулярные белки цитокины, которые осуществляют свое биологическое действие через взаимодействие со специфическими клеточными поверхностными рецепторами. Цитокины регулируют активацию, дифференцировку и пролиферацию иммунных и неиммунных клеток, участвуют в опосредовании как воспалительных, так и иммунных реакций, являются критическими элементами в ответе органов и тканей человека на повреждение или инфекционно-вирусное поражение.

Фактор, ингибирующий лейкемию ((leukemia inhibitory factor, ген LIF), представляет собой высокогликолизированный полипептид с молекулярной массой 45-56 кДа, который кодируется геном, локализованным у человека в хромосоме 22ql2. Он является цитокином из семейства интерлейкина-6 (IL-6), оказывающим свое действие путем связывания с трансмембранным рецептором, состоящим из 2-х субъединиц - рецептора LIF (LIFR) и гликопротеина др130. Этот белок оказывает влияние на пролиферацию, дифференцировку и выживание клеток в различных тканях, в том числе в тканях репродуктивного тракта, где он участвует во многих процессах, начиная с роста и развития гамет и заканчивая наступлением беременности.

Фактор, ингибирующий лейкемию - один из ключевых паракринных маркеров имплантации, имеющий важное значение во время аппозиции и адгезии бластоцисты. Этот белок обладает свойствами провоспалительного и гемопоэтического цитокина и частично дублирует биологические свойства IL-6, IL-11 и др. Концентрация фактора, ингибирующего лейкемию, в смывах из полости матки и образцах ткани эндометрия ниже у пациенток с бесплодием неясного генеза, а также у больных с безуспешными попытками ЭКО по сравнению с фертильными женщинами [Dimitriadis Е et al. // Hum. Reprod. 2005; 11 (6): 613-30.]. При этом у женщин с бесплодием с выраженной экспрессией гена LIF в середине лютеиновой фазы шансы на достижение беременности были в 6,4 раза выше, чем у пациенток со сниженной экспрессией гена LIF [Serafini Р et al. // Int J Gynecol Obstet 2008; 102: 23-7].

Фактор, ингибирующий лейкемию, выполняет следующие функции в организме человека: осуществляет поддержку роста и ингибирование дифференциации нормальных эмбриональных стволовых клеток, стимуляцию продукции белков острой фазы гепатоцитами; воздействует на свойство интерлейкина 3 усиливать мегакариоцитарную дифференцировку миелоидных клеток-предшественников и стимулировать костную резорбцию и формирование кости; при развитии нервной системы индуцирует и усиливает синтез нейропептидов и ацетилхолина в симпатической нервной системе и является нейротрофическим фактором выживания, влияет на гемопоэз, энергетический метаболизм. Растворимая форма белка фактора, ингибирующего лейкемию, может быть определена в таких биологических жидкостях человека, как сыворотка, цельная кровь, синовиальная жидкость и моча.

Количественная оценка данного белка у здоровых людей и у пациентов, страдающих различными заболеваниями, помогает получить полную картину при различных клинических ситуациях. Ключевое значение имеет определение гликозилированной формы белка фактора, ингибирующего лейкемию, с использованием антител, полученных к такой молекуле и гликозилированного стандарта. Было показано, что уровень этого белка в крови, моче и других биологических жидкостях повышается в патологичесских условиях, таких как гиперкальциемия, полицитемия, эритропоэтический криз, гипертромбоцитемия; при остром отторжении аллотрансплантата, особенно почки; при остеопорозе. У человека этот белок играет важную роль при воспалительных заболеваниях легких - в остром и хроническом воспалении, а также при пневмонии. При ревматоидном артрите количество белка повышено в сыворотке и синовиальной жидкости, также оно повышено при раке (аденокарциноме, мезотелиоме, меланоме), при перитонитах. Показано, что многие линии человеческих опухолевых клеток конститутивно продуцируют определяемые уровни фактора, ингибирующего лейкемию, тогда как обычно экспрессия этого белка индуцируется стимулирующими факторами. Концентрация фактора, ингибирующего лейкемию, в костном мозге значительно повышена у пациентов с онкогематологическими заболеваниями. Сильно повышен уровень этого белка в амниотической жидкости и ассоциирован с внутриутробными инфекциями.

Таким образом, повышение количества фактора, ингибирующего лейкемию, в организме человека может быть примером защитной функции при патологических состояниях.

В патенте US 5712156 показан метод повышения эффективности имплантации и выживаемости эмбрионов с использованием белка фактора, ингибирующего лейкемию (ген LIF), человека, полученного рекомбинантным способом. Бластоцисты культивировали 48 часов в среде с белком фактора, ингибирующего лейкемию, и имплантировали в матку овцы. Количество прижившихся бластоцист оказалось в 4 раза выше, чем в случае, когда бластоцисты культивировали в среде без белка фактора, ингибирующего лейкемию. При использовании рекомбинантного белка мыши, эффекта, повышающего выживаемость эмбрионов и эффективность имплантации, обнаружено не было. В заявке WO 2000001404 и патенте US 5962321 также предложено использовать препарат белка фактора, ингибирующего лейкемию, в качестве агента, повышающего вероятность имплантации эмбриона. Эффективность данного метода продемонстрирована на лабораторных животных. Недостатком данного подхода является высокая стоимость получения чистого рекомбинантного белка, а также неоднократное введение белка увеличивает стоимость лечения пациента.

Более эффективным и перспективным методом лечения является использование генно-терапевтических методов, в частности - введение непосредственно в эндометрий генетической конструкции, несущей кДНК гена LIF.

Известны исследования по получению генетических конструкций с геном LIF, которые осуществляли с помощью технологии ОТ-ПЦР с использованием в качестве матрицы мРНК, выделенной из плаценты. В ПЦР были использованы праймеры, позволяющие получить кДНК, кодирующую как зрелый белок, так и белок с сигнальным пептидом. После определения первичной последовательности продуктов ПЦР, клонированных в pUC28, фрагмент ДНК, кодирующий зрелый белок, был субклонирован в вектор экспрессии рЕТ24. Индукция IPTG приводила к синтезу в клетках E.coli белка - продукта гена LIF, который получен в рефолдированной форме, и его биологическая активность была проверена на культуре миелоидных лейкемических клеток мыши М1. Для экспрессии LIF в клетках млекопитающих были сконструированы две рекомбинантные плазмиды на основе вектора экспрессии для эукариотических клеток pCVU55763, в которых экспрессию рекомбинантного гена LIF, кодирующего белок с сигнальным пептидом, обеспечивает цитомегаловирусный промотор. Было показано, что генетически модифицированные клетки трех линий, полученных трансфекцией рекомбинантными плазмидами с геном LIF, экспрессируют гликозилированный белок, который секретируют в культуральную среду (С.Е. Рымарь с соавт. // "Журн. АМН ", 2010, т. 16, додаток. - С. 159-160.). При этом использования полученных генетических конструкций в качестве генно-терапевтического средства не проводилось.

В заявке WO 2002020609 А2, в которой говорится о применении белка интерлейкина 11, который сходен по структуре с белком фактора, ингибирующего лейкемию, и относится к одному с ним семейству IL-6 цитокинов, а также полинуклеотидов, кодирующих этот белок в терапии инсультов и нейропатии, а также- для выявления соединений-агонистов (лигандов), полезных при терапии. В частности, в заявке говорится о полинуклеотиде, который кодирует белок интерлейкина 11, для изготовления лекарственного средства для лечения инсульта или невропатии, а также - для генной терапии. Такая генная терапия включает введение полинуклеотидной последовательности гена IL-11 в соматические клетки методами генной инженерии для замены дефектного гена IL-11, или для повышения производства белка интерлейкина 11 при таком заболевании, как инсульт. В предпочтительном варианте реализации изобретения полинуклеотид включает нативную полинуклеотидную последовательность, кодирующую природный белок гена IL-11. Полинуклеотид может содержать некодирующие 5' и 3' последовательности - транскрибируемые, но нетранслируемые последовательности, сигналы сплайсинга и полиаденилирования, сайты связывания рибосом и последовательности, которые стабилизируют мРНК. Другие варианты осуществления настоящего изобретения включают в себя полинуклеотиды, кодирующие варианты полипептида, в котором аминокислотные остатки замещены, удалены или добавлены, в любой комбинации.

Недостатком данного подхода является то, что при создании генно-терапевтического средства в этом изобретении применены методы, которые приводят к делециям, заменам, вставкам аминокислот целевого белка, что может приводить к изменению его структуры и свойств, а также не учитываются индивидуальные характеристики пациента, в связи с которыми может понадобиться группа вариаций для данного средства.

За прототип авторами был принята заявка WO 0194605, в которой раскрыты способы применения полинуклеотидов, кодирующих цитокин или рецептор цитокина, при получении трансформированных клеток-хозяев и трансгенных животных. В частности, описано использование векторных композиций на основе рекомбинантного аденоассоциированного вируса (Раав), содержащих полинуклеотидные последовательности, которые экспрессируют один или несколько цитокинов млекопитающих или полипептиды рецептора цитокина в клетке млекопитающего или человека. Заявленный вектор может содержать участок нуклеиновой кислоты, который кодирует цитокин, выбранный из группы, состоящей из интерлейкина, лептина, фактора, ингибирущего лейкемию (LIF), и нейротрофического фактора. Векторная композиция может дополнительно содержать наночастицы, а именно - нанокапсулы, липосомы, липид, или липидный комплекс.

Также раскрыты способы лечения и облегчения симптомов различных состояний и расстройств у животных, включая слепоту, пигментный ретинит, возрастная макулярная дегенерация, ожирение, анорексия, и связанные с ними расстройства пищевого поведения, а также неврологические и скелетно-мышечные нарушения, в том числе, например, боковой амиотрофический склероз, которые связаны с дефицитом цитокина или полипептида рецептора цитокина у млекопитающего или человека. Способ включает в себя введение генетической конструкции, которая кодирует один или более цитокин или полипептиды рецептора цитокина в фармацевтически приемлемом носителе животному в количестве и в течение периода времени, достаточного для лечения или уменьшения дефицита таких полипептидов как лептин (LEP), BDNF, LIF, BDNF рецептор, LIF-рецептор, рецептор лептина, цилиарного нейротрофического фактора (CNTF) и рецептора полипептида CNTF.

Недостатком данного подхода является то, что при создании генно-терапевтического средства в этом изобретении использован аденоассоциированный вирус, который может интегрироваться в хромосому клетки-хозяина, а также - не учитываются индивидуальные характеристики пациента, в связи с которыми может понадобиться группа вариаций для данного средства.

Раскрытие изобретения

Задачей данного изобретения является создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, представляющего собой группу генно-терапевтических субстанций, при использовании которых с учетом индивидуальных особенностей пациента, происходит повышение уровня экспрессии гена LIF и/или повышение количества белка фактора, ингибирующего лейкемию, в клетках органов и тканей и/или органах и тканях организма

Указанная задача решается за счет того, что создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию на основе генно-терапевтических субстанций с кДНК гена LIF, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена LIF, с кодирующей последовательностью белка фактора, ингибирующего лейкемию, с делециями 5' и 3'-нетранслируемых областей, а именно, полученной на основе участка нативной немодифицированной кДНК гена LIF SEQ ID No: 1, или модифицированной кДНК гена LIF, при этом в качестве модифицированной кДНК гена LIF используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена LIF в эукариотических клетках, в частности в клетках органов и тканей человека, и способную увеличить количество белка фактора, ингибирующего лейкемию в клетках органов и тканей и/или органах и тканях человека, в частности в коре головного мозга, гиппокампе, в боковых желудочках головного мозга, мозжечке, щитовидной железе, паращитовидной железе, надпочечниках, аппендиксе, костном мозге, лимфатических узлах, миндалинах, селезенке, сердце, носоглотке, бронхах, легких, печени, желчном пузыре, печени, поджелудочной железе, слюнных железах, желудке, двенадцатиперстной кишке, тонкой кишке, толстой кишке, прямой кишке, почке, мочевом пузыре, семенниках, семенных канатиках, простате, семенных везикулах, молочных железах, шейке матки, фаллопиевых трубах, яичниках, плаценте, коже, в слизистой оболочке полости рта, сердечной мышечной ткани, скелетной мышечной ткани, гладкой мышечной ткани, эндометрии матки, жировой ткани, мягких тканях, в фибробластах, клетках эндометрия матки, эпителиальных и мышечных клетках в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека. При этом каждая генетическая конструкция с модифицированной кДНК гена LIF содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена LIF, которая несет модификации, не затрагивающие структуру белка фактора, ингибирующего лейкемию, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, не влияющие на кодируемую этой последовательностью аминокислотную последовательность. В качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры.

Способ получения средства для лечения состояний человеческого организма связанного с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, по п. 1., заключается в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций по п. 1, при этом получают кДНК гена LIF, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена LIF с кодирующей последовательностью белка фактора, ингибирующего лейкемию, с делециями 5' и 3'-нетранслируемых областей, а именно, полученной на основе участка нативной немодифицированной кДНК гена LIF SEQ ID No: 1, или модифицированной кДНК гена LIF, при этом в качестве модифицированной кДНК гена LIF используют, или SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, в том числе женского бесплодия, заключается в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1. клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/ выбранных из группы созданных генно-терапевтических субстанций по п. 1., или сочетанием обозначенных способов.

Перечень фигур

На фиг. 1

Представлена нуклеотидная последовательность немодифицированной кДНК гена LIF длиной 318 н.п. SEQ ID No: 1, которая имеет высокую гомологию с приводимой в базе данных GenBank под номером NM_002309 и кодирует белок фактора, ингибирующего лейкемию (GenBank NP_002300.1).

На фиг. 2

Представлена нуклеотидная последовательность модифицированной кДНК гена LIF, SEQ ID No: 2, которая содержит 2 нуклеотидных замены G→C в позициях 171 и 219; не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию.

На фиг. 3

Представлена нуклеотидная последовательность модифицированной кДНК гена LIF, SEQ ID No: 3, которая

содержит 2 нуклеотидных замены G→C в позициях 171 и 219; 2 нуклеотидных замены А→С в позициях 264 и 480, не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию.

На фиг. 4

Представлена нуклеотидная последовательность модифицированной кДНК гена LIF, SEQ ID No: 4, которая

содержит 1 нуклеотидную замену A→G в позиции 399, 2 нуклеотидных замены G→C в позициях 171 и 219; 2 нуклеотидных замены А→С в позициях 264 и 480, не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию.

На фиг. 5

Представлена нуклеотидная последовательность модифицированной кДНК гена LIF, SEQ ID No: 5, которая

содержит 1 нуклеотидную замену A→G в позиции 399, 4 нуклеотидных замены G→C в позициях 171, 219, 417, 426; 2 нуклеотидных замены А→С в позициях 264 и 480, не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию.

На фиг. 6

Представлена нуклеотидная последовательность модифицированной кДНК гена LIF, SEQ ID No: 6, которая

содержит 1 нуклеотидную замену A→G в позиции 399, 5 нуклеотидных замен G→C в позициях 171, 219, 417, 426, 447; 2 нуклеотидных замены А-^С в позициях 264 и 480, не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию.

На фиг. 7

Представлена нуклеотидная последовательность модифицированной кДНК гена LIF, SEQ ID No: 7, которая

содержит 2 нуклеотидных замены A→G в позициях 399, 591; 6 нуклеотидных замен G→C в позициях 171, 219, 417, 426, 447, 675; 2 нуклеотидных замены А→С в позициях 264 и 480, не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию.

На фиг. 8

С целью последующего корректного определения генно-терапевтического эффекта после трансфекции фибробластов генно-терапевтической субстанцей с кДНК гена LIF проводили анализ эндогенной экспрессии гена LIF в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена LIF, фибробласты со сниженной экспрессией гена LIF,

2 - кДНК гена LIF, фибробласты с нормальной экспрессией гена LIF,

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена LIF,

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена LIF.

В качестве референтного гена использовали ген В2М (Бета-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

На фиг. 9

С целью подтверждения увеличения экспрессии гена LIF в клеточной культуре фибробластов со сниженной экспрессией гена LIF при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена LIF с генетической конструкцией pCMV6-LIF SEQ ID No: 1 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена LIF в фибробластах с нормальной экспрессией гена LIF,

2 - кДНК гена LIF в фибробластах со сниженной экспрессией гена LIF до трансфекции ГТС с кДНК гена LIF,

3 - кДНК гена LIF в фибробластах со сниженной экспрессией гена LIF после трансфекции ГТС с кДНК гена LIF,

4 - кДНК гена LIF в фибробластах со сниженной экспрессией гена LIF после трансфекции вектором без кДНК гена LIF,

5 - кДНК гена В2М в фибробластах с нормальной экспрессией гена LIF,

6 - кДНК гена В2М в фибробластах со сниженной экспрессией гена LIF до трансфекции ГТС с кДНК гена LIF,

7 - кДНК гена В2М в фибробластах со сниженной экспрессией гена LIF после трансфекции ГТС с кДНК гена LIF,

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена LIF после трансфекции вектором без кДНК гена LIF.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена LIF уровень кДНК гена LIF в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена LIF -уровень кДНК фибробластов со сниженной экспрессией гена LIF многократно увеличился (до уровня выше, чем уровень кДНК гена LIF в нормальных фибробластах).

На фиг. 10

С целью подтверждения увеличения количества белка фактора, ингибирующего лейкемию, в клеточной культуре фибробластов с нормальной экспрессией гена LIF при трансфекции данных клеток генно-терапевтической субстанцией содержащей кДНК гена LIF представлен график изменения количества белка фактора, ингибирующего лейкемию, нетрансфицированных фибробластов (культура А), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК гена LIF (культура В) и трансфицированных генно-терапевтической субстанцией с генетической конструкцией pCDNA 3.1-LIF SEQ ID No: 1 (культура С). Из графика следует, что при трансфекции фибробластов генно-терапевтической субстанцией с кДНК гена LIF происходит увеличение количества белка фактора, ингибирующего лейкемию, в клеточном лизате.

На фиг. 11

С целью подтверждения увеличения количества белка фактора, ингибирующего лейкемию, в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией, представлен анализ изменения количества белка фактора, ингибирующего лейкемию, в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (Б) и трансфицированные генно-терапевтической субстанцией с генетической конструкцией pCMV6- LIF SEQ ID No: 7 (С) - в кожу предплечья. Также анализировали количественный уровень белка фактора, ингибирующего лейкемию, в интактной коже. Показано повышение количества белка фактора, ингибирующего лейкемию, в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией кДНК гена LIF (С).

На фиг. 12

С целью подтверждения увеличения количества белка фактора, ингибирующего лейкемию до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток генно-терапевтическими субстанциями с участком нативной немодифицированной «ДНК гена LIF и модифицированных кДНК гена LIF, представлен анализ изменения количественного уровня белка фактора, ингибирующего лейкемию, в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена LIF, используемой для трансфекции фибробластов.

Культуры фибробластов 18 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали генно-терапевтической субстанцией pCMV6-LIF SEQ ID No: 1, части (В) трансфицировали генно-терапевтической субстанцией pCMV6-LIF SEQ ID No: 2, части (С) трансфицировали генно-терапевтической субстанцией pCMV6-LIF SEQ ID No: 3, части (D) трансфицировали генно-терапевтической субстанцией pCMV6-LIF SEQ ID No: 4, части (E) трансфицировали генно-терапевтической субстанцией pCMV6-LIF SEQ ID No: 5, части (F) трансфицировали генно-терапевтической субстанцией pCMV6-LIF SEQ ID No: 6, части (G) трансфицировали генно-терапевтической субстанцией pCMV6-LIF SEQ ID No: 7, части (H) трансфицировали векторной плазмидой, не содержащей кДНК гена LIF.

По итогам анализа количественного уровня белка фактора, ингибирующего лейкемию, выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальное количество белка фактора, ингибирующего лейкемию, и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции pCMV6-LIF SEQ ID No: 1,

в группе 2 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции pCMV6-LIF SEQ ID No: 2,

в группе 3 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции pCMV6-LIF SEQ ID No: 3,

в группе 4 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции pCMV6-LIF SEQ ID No: 4,

в группе 5 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции pCMV6-LIF SEQ ID No: 5,

в группе 6 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции pCMV6-LIF SEQ ID No: 6,

в группе 7 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции pCMV6-LIF SEQ ID No: 7.

Ни в одной из клеточных культур не наблюдалось того, что максимальное количество белка фактора, ингибирующего лейкемию, присутствует при трансфекции вектором без вставки кДНК гена LIF.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентрации белка фактора, ингибирующего лейкемию, (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена LIF.

Из фигуры следует, что достижение максимального количества белка фактора, ингибирующего лейкемию, в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена LIF, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 1 (А)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 2 (В)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 3 (С)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 4 (D)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 5 (Е)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 6 (F)

части клеточных культур, трансфицированных ГТС LIF SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

На фиг. 13

С целью подтверждения увеличения экспрессии гена LIF в клеточной культуре эндометрия матки человека при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена LIF в генетической конструкции pCMV6-Kan/Neo LIF SEQ ID No: 2 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена LIF, клетки эндометрия до трансфекции

2 - кДНК гена LIF, клетки эндометрия после трансфекции

3 - кДНК гена В2М, клетки эндометрия до трансфекции

4 - кДНК гена В2М, клетки эндометрия после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена LIF в культуре клеток эндометрия матки человека многократно вырос.

На фиг. 14

С целью подтверждения увеличения экспрессии гена LIF в клеточной культуре эпителия слизистой оболочки полости рта при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена LIF приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена LIF, до трансфекции

2 - кДНК гена LIF, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена LIF вырос многократно.

На фиг. 15

С целью подтверждения увеличения количества белка фактора, ингибирующего лейкемию, в коже человека при введении в кожу генно-терапевтической субстанции представлен анализ изменения количественного уровня белка фактора, ингибирующего лейкемию, в коже. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена LIF pCMV6-LIF SEQ ID No: 4 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена LIF с транспортной молекулой (А) - в кожу предплечья. Показано увеличение количества белка фактора, ингибирующего лейкемию, в биоптате кожи пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена LIF, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 16

С целью подтверждения увеличения количества белка фактора, ингибирующего лейкемию в слизистой оболочке полости рта человека при введении в слизистую оболочку полости рта генно-терапевтической субстанции представлен анализ изменения количественного уровня белка фактора, ингибирующего лейкемию, в слизистой оболочке полости рта. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена LIF pCDNA 3.1 LIF SEQ ID No: 5 (В) и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена LIF с транспортной молекулой (А) - в слизистую оболочку полости рта.

Показано увеличение количественного уровня белка фактора, ингибирующего лейкемию, в лизате биоптата слизистой оболочки полости рта пациента 1 В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена LIF, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 17

С целью подтверждения увеличения количества белка фактора, ингибирующего лейкемию, в мышечной ткани человека при введении в мышечную ткань генно-терапевтической субстанции представлен анализ изменения количества белка фактора, ингибирующего лейкемию, в мышечной ткани. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена LIF - pCMV6-Kan/Neo LIF SEQ ID No: 6 (В) и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена LIF с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение количества белка фактора, ингибирующего лейкемию, в биоптате мышечной ткани пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена LIF, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 18

С целью подтверждения увеличения количества белка фактора, ингибирующего лейкемию, до различного индивидуального уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными кДНК гена LIF и участком нативной немодифицированной кДНК гена LIF анализировали количественный уровень белка фактора, ингибирующего лейкемию в коже человека в зависимости от наличия и типа модификаций в кДНК гена LIF.

Каждому из 21-го пациента, которые были отобраны в случайном порядке, вводили в кожу предплечья 7 генно-терапевтических субстанций pCMV6- SEQ ID No: 1, pCMV6- SEQ ID No: 2, pCMV6- SEQ ID No: 3, pCMV6- SEQ ID No: 4, pCMV6- SEQ ID No: 5, pCMV6- SEQ ID No: 6, pCMV6- SEQ ID No: 7, и плацебо pCMV6- XL5.

По итогам анализа количества белка фактора, ингибирующего лейкемию, в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные количественные уровни белка фактора, ингибирующего лейкемию, и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении pCMV6-LIF SEQ ID No: 1,

в группе 2 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении pCMV6-LIF SEQ ID No: 2,

в группе 3 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении pCMV6-LIF SEQ ID No: 3,

в группе 4 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении pCMV6-LIF SEQ ID No: 4,

в группе 5 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении pCMV6-LIF SEQ ID No: 5,

в группе 6 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении pCMV6-LIF SEQ ID No: 6,

в группе 7 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении pCMV6-LIF SEQ ID No: 7.

Ни в одном из биоптатов не наблюдалось того, что максимальное количество белка фактора, ингибирующего лейкемию, присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка фактора, ингибирующего лейкемию, (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после введения пациентам этих генно-терапевтических субстанций, содержащих модифицированные кДНК гена LIF и участок нативной немодифицированной кДНК гена LIF.

Из данного примера следует, что достижение максимального количества белка фактора, ингибирующего лейкемию, в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена LIF, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента.

Обозначения:

биоптаты пациентов после введения ГТС LIF SEQ ID No: 1 (А)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 2 (В)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 3 (С)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 4 (D)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 5 (Е)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 6 (F)

биоптаты пациентов после введения ГТС LIF SEQ ID No: 7 (G)

биоптаты пациентов после введения плацебо (Н)

На фиг. 19

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количественный уровень белка фактора, ингибирующего лейкемию, в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими участок нативной немодифицированнойкДНК гена LIF или модифицированные кДНК гена LIF.

По итогам анализа количества белка фактора, ингибирующего лейкемию, в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой выявляется максимальная концентрация белка фактора, ингибирующего лейкемию, в лизате клеточной культуры. В данном эксперименте максимальная концентрация белка фактора, ингибирующего лейкемию, в лизате наблюдается при трансфекции генно-терапевтической субстанцией на базе pCMV6 LIF SEQ ID No: 1, содержащей участок нативной немодифицированной кДНК гена LIF, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Обозначения:

1 - клеточный лизат после трансфекции ГТС LIF SEQ ID No: 1 (А)

2 - клеточный лизат после трансфекции ГТС LIF SEQ ID No: 2 (В)

3 - клеточный лизат после трансфекции ГТС LIF SEQ ID No: 3 (С)

4 - клеточный лизат после трансфекции ГТС LIF SEQ ID No: 4 (D)

5 - клеточный лизат после трансфекции ГТС LIF SEQ ID No: 5 (Е)

6 - клеточный лизат после трансфекции ГТС LIF SEQ ID No: 6 (F)

7 - клеточный лизат после трансфекции ГТС LIF SEQ ID No: 7 (G)

8 - клеточный лизат после трансфекции плацебо (Н)

На фиг. 20

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка фактора, ингибирующего лейкемию, в лизатах биоптатов кожи этого пациента, после введения ему генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена LIF или участки модифицированных кДНК гена LIF.

По итогам анализа количества белка фактора, ингибирующего лейкемию, в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой выявляется максимальная концентрация белка фактора, ингибирующего лейкемию, в лизате биоптата. В данном эксперименте максимальная концентрация белка фактора, ингибирующего лейкемию, отмечена при введении генно-терапевтической субстанции на базе pCMV6 LIF SEQ ID No: 7, содержащей модифицированную кДНК гена, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения ГТС LIF SEQ ID No: 1 (А)

2 - лизат биоптата после введения ГТС LIF SEQ ID No: 2 (В)

3 - лизат биоптата после введения ГТС LIF SEQ ID No: 3 (С)

4 - лизат биоптата после введения ГТС LIF SEQ ID No: 4 (D)

5 - лизат биоптата после введения ГТС LIF SEQ ID No: 5 (Е)

6 - лизат биоптата после введения ГТС LIF SEQ ID No: 6 (F)

7 - лизат биоптата после введения ГТС LIF SEQ ID No: 7 (G)

8 - лизат биоптата после введения плацебо (Н)

Реализация изобретения.

При снижении экспрессии генов, кодирующих белки, например, гена LIF, происходит снижение количества белка в организме, что приводит к патологическим состояниям.

Так, снижение экспрессии гена LIF в клетках железистого эпителия эндометрия матки экспериментально моделируется введением антагониста прогестерона мифепристона на 2-й день после овуляции у приматов. Введение мифепристона макакам резус в раннюю секреторную фазу цикла вызывало у них ингибирование имплантации бластоцисты [Ghosh D., Kumar P.G.L.L, Sengupta J. // Endocrinol 1998; 157:1:115-125].

У мышей экспрессия гена LIF увеличивается в эндометриальных железах непосредственно перед имплантацией, на 4-й день после овуляции, что регулируется факторами материнского организма. У нокаутных по этому гену мышей процессы оогенеза и оплодотворения не нарушены, однако образовавшиеся бластоцисты не способны к имплантации. [Гьюдайс Линда С. // Пробл. эндокринол., 1999; 5:30-32].

Преимущества использования генетической конструкции с геном LIF для коррекции экспрессии гена LIF и количественного уровня белка фактора, ингибирующего лейкемию, в клетках органов и тканей человека, по сравнению с использованием полинуклеотидов, кодирующих цитокин или рецептор цитокина, клонированных в плазмиде на основе рекомбинантного аденоассоциированного вируса (Раав), как по прототипу - патенту WO 0194605 следующие:

1) легче обеспечить более высокий и стабильный уровень целевого белка в клетках,

2) обеспечивается транспортировка генно-терапевтической субстанции в больший спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка генно-терапевтической субстанции,

3) учитываются индивидуальные характеристики пациента.

Таким образом, для создания группы генно-терапевтических субстанций по данному изобретению был выбран ген LIF, а не белок фактора, ингибирующего лейкемию, кодируемый этим геном.

Для получения группы генно-терапевтических субстанций осуществляют следующие действия:

1. Получение участка нативной кДНК гена LIF, содержащей белок-кодирующую область гена LIF, клонирование его в промежуточную плазмиду, переклонирование его в экспрессионные векторные плазмиды под контроле эукариотических регуляторных элементов для экспрессии целевого гена таким образом, что полученные генетические конструкции содержат кодирующую нуклеотидную последовательность кДНК белка фактора, ингибирующего лейкемию, которая является участком нативной немодифицированной кДНК гена LIF и которая используются для дальнейших модификаций.

2. Внесение в последовательность нуклеотидов кДНК гена LIF модификаций с целью создания ряда кДНК гена LIF, обеспечивающих достаточный для борьбы с патологическими проявлениями уровень трансляции белка фактора, ингибирующего лейкемию.

3. Клонирование участка нативной немодифицированной кДНК гена LIF и полученных на его основе модифицированных кДНК гена LIF в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E.coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение ряда генетических конструкций, содержащих модифицированные «ДНК гена LIF и участок нативной немодифицированной кДНК гена LIF для создания на их базе группы генно-терапевтических субстанций.

6. Создание группы генно-терапевтических субстанций, каждая из которых включает генетическую конструкцию с модифицированными кДНК гена LIF и участок нативной немодифицированной кДНК гена LIF, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена LIF, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки полости рта, или клеток эпителия эндометрия матки.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки полости рта, или эпителия эндометрия матки и анализ экспрессии гена LIF из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки полости рта, или клеток эпителия эндометрия матки генно-терапевтическими субстанциями содержащими участок нативной немодифицированной кДНК гена LIF и/или модифицированные кДНК гена LIF и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена LIF в различных комбинациях.

D) Сравнительный анализ изменения уровня мРНК гена LIF и/или изменения количества белка фактора, ингибирующего лейкемию, после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или клеток эпителия слизистой оболочки полости рта, или клеток эпителия эндометрия матки генно-терапевтическими субстанциями содержащими участок нативной немодифицированной кДНК гена LIF и/или модифицированные кДНК гена LIF и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена LIF. Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента генно-терапевтической субстанции.

E) Введение пациентам в органы и ткани культуры клеток трансфицированных генно-терапевтической субстанцией с кДНК гена LIF, например, введение, в кожу человека, аутологичных фибробластов, трансфицированных генно-терапевтической субстанцией с кДНК гена LIF и параллельное введение пациентам в органы и ткани, например, в кожу, культур этих же клеток нетрансфицированных и трансфицированных вектором без вставки кДНК гена LIF и/или введение пациентам в органы и ткани генно-терапевтических субстанций, например, введение в кожу человека генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена LIF и/или модифицированные кДНК LIF, а также плацебо в различных комбинация.

F) Сравнительный анализ количества белка фактора, ингибирующего лейкемию, в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных генно-терапевтическими субстанциями, содержащими кДНК гена LIF и векторными плазмидами, не содержащими кДНК гена LIF и/или генно-терапевтических субстанций, содержащих участок нативной немодифицированнойкДНК гена LIF или модифицированные кДНК гена LIF, а также плацебо.

G) Введение пациентам в органы и ткани, например, в слизистую оболочку полости рта или мышечную ткань, генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена LIF и/или модифицированных кДНК гена LIF, а также плацебо.

H) Сравнительный анализ количества белка фактора, ингибирующего лейкемию, в органах и тканях человека, в частности в слизистой оболочке полости рта, или мышечной ткани человека, после введения генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена LIF и/или участки модифицированных кДНК гена LIF а также плацебо.

I) Введение пациентам в органы и ткани, например, введение в кожу пациента генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена LIF и участки модифицированных кДНК гена LIF.

J) Сравнительный анализ количества белка фактора, ингибирующего лейкемию, в органах и тканях пациента, в частности в коже, после введения генно-терапевтических субстанций, содержащих участок нативной немодифицированной кДНК гена LIF и участки модифицированных кДНК гена LIF. Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента генно-терапевтической субстанции из группы генно-терапевтических субстанций.

Пример 1.

Получение и клонирование нативной немодифицированной кДНК гена LIF

Немодифицированная кДНК гена LIF представляет собой последовательность нуклеотидов, которая имеет высокую гомологию с нуклеотидной последовательностью гена и мРНК LIF, приведенной в базе даных GenBank под номером NM_002309; нуклеотиды с 157 по 765 транслируются в аминокислотную последовательность белка фактора, ингибирующего лейкемию, соответствующую приведенной в GenBank под номером NP_002300.1.

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) и используют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно кинированные праймеры, комплементарные нуклеотидам 1-20 5' 3' (LIF-F1) и 930-911 5' 3' (LIF-R1) из последовательности мРНК LIF (NM_002309.), получают участок нативной немодифицированной кДНК гена LIF, содержащий кодирующую последовательность белка фактора, ингибирующего лейкемию, и частичные делеции 5' и 3'-нетранслируемых областей. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами, на амплификаторе Master CyclerGradient (Eppendorf, USA) в 50 мкл. реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера LIF F1 и LIF R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (рН 8,85 при 20°С), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific, USA) при следующих условиях: первоначальная денатурация при +98°С в течение 30 сек., 35 циклов, включающих денатурацию при +98°С в течение 10 сек., отжиг праймеров при +65°С в течение 30 сек. и элонгацию при +68°С течение 2 минут.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany).

Амплифицированный фрагмент кДНК длиной 931 н.п, несущий участок нативной немодифицированной кДНК гена LIF, клонируют в плазмидном векторе pUC19 (NEB, USA, кат номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, KaT.HOMepN3041S) гидролизуют рестриктазой, дающей тупые концы, например, Smal (NEB, USA) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага Т4 400000 ед./ мл. (NEB, USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис -HCl, рН 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°C.

Полученной смесью трансформируют компетентные клетки Е.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки Петри с L- агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами LIF-F1 и LIF--R1 и подтверждают секвенированием по методу Сэнгера.

Пример 2.

Получение генетических конструкций с участком немодифицированной кДНК гена LIF

Для экспрессии участка немодифицированной кДНК гена LIF в клетках органов и тканей человека вариант кДНК гена LIF по Примеру 1 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E.coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции;

3) в плазмиде должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) в плазмиде должно быть наличие удобного полилинкера для клонирования. Примером такой плазмиды может быть pCMV6-XL5, pCMV6-Kan/Neo (OriGene, USA) или pCDNA 3.1 (+) (ThermoFisherScientific, USA), либо плазмидные векторы вирусного происхождения - например, аденовирус человека 5-го серотипа.

5) Плазмида может содержать нуклеотидные последовательности с регуляторными элементами для репликации в клетках млекопитающих, например, такие как SV40 ori из вируса обезьян SV40 или ori P/EBNA-1 из вируса Эпштейн-Барра человека.

6) Плазмида также может содержать дополнительные регуляторные элементы, усиливающие трансляцию белка, например, участки связывания с транскрипционным фактором NFkB, обеспечивающим активный транспорт плазмидной ДНК в клеточное ядро для более эффективной транскрипции целевого гена.

При клонировании участка немодифицированой кДНК гена LIF в pCDNA 3.1 (+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину.

При клонировании участка немодифицированой кДНК гена LIF в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину.

Векторную плазмиду pUC19-LIF с участком нативной немодифицированной последовательности кДНК гена LIF используют в качестве матрицы для амплификации со следующими парами праймеров:

1) для ориентации Hind III - LIF - Eco RI

LIF F2

LIF R2

2) для ориентации Eco RI -LIF-Hind III

LIF F3

LIF R3

Амплификацию проводят при условиях, приведенных в Примере 1. Далее продукты амплификации переосаждают этиловым спиртом, осадки промывают 70% этанолом и растворяют в 1х ТЕ буфере, после чего подвергают рестрикции с эндонуклеазами EcoRI и HindIII.

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке HindIII-5'NTR-кДНК LIF-3'NTR- EcoRI, либо EcoRI -5'NTR-кДНК LIF-3'NTR- HindIII и линеаризованной плазмиде pCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1(+), вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit из примера 1 и смешивают. Полученную смесь рестрикционных фрагментов лигируют с помощью ДНК-лигазы фага Т4. Лигирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°С в течение 10 ч. Лигированную ДНК используют для трансформации клеток Е. coli по стандартной методике с использованием хлористого кальция. Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit, анализируют с помощью гидролиза рестриктазами EcoRI и Hindlll и отбирают генетическую (ие) конструкцию с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Таким образом, получают экспрессионые генетические. конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), которые содержат нуклеотидную последовательность длиной 318 н.п.с первичной структурой, * приведенной на фиг. 1 Seq ID No1.

Пример 3.

Модификации кДНК гена LIF в генетических конструкциях для получения на их основе генно-терапевтических субстанций

Модификации проводят таким образом, чтобы не затрагивать первичную структуру белка фактора, ингибирующего т лейкемию, а именно, нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности, для получения модифицированных кДНК гена LIF с целью повышения эффективности транскрипции и трансляции белка фактора, ингибирующего лейкемию, в клетках тканей и органов человека в участок нативной 9 последовательности кДНК гена LIF, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChLIFe II XL kit или QuikChLIFe Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA,) согласно рекомендациям производителя. http://www.agilent.com/cs/library/userrnanuals/Public/200513.

К плазмидной ДНК, полученной по Примеру 2, в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 19-45 н.п. и проводят ПЦР в буфере QuikChLIFe Multi reaction buffer (AgilentTechnologies, USA) со смесью ферментов QuikChLIFe Multi mix (AgilentTechnologies, USA) при следующих условиях: 95°C, 1 мин; далее от 30 до 35 циклов: 95°С 1 минута, 55°С 1 минута, 65°С 2 минуты/1000 н.п. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°С. Полученной смесью трансформируют компетентные клетки E.coli Тор10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L-агаром, содержащих 100 мкг/мл ампициллина. Трансформированнные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК гена LIF SEQ ID No 2 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan/Neo-LIF Seq ID No1 и pCDNA 3.1(+)- LIF Seq ID No1 с праймерами, комплементарными участку нативной кДНК гена LIF, приведенной в GenBank под номером NM_002309.4:

1. LIF 157-189 F:

Комплементарный нуклеотидам 157-189, с заменой G→C в позиции 171;

2. LIF 208-234 F:

Комплементарный нуклеотидам 208-234, с заменой G→C в позиции 219.

Модифицированная таким образом нуклеотидная последовательность кДНК гена LIF SEQ ID No: 2 содержит 2 нуклеотидных замены G→C в позициях 171 и 219; не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию, и имеет первичную структуру, приведенную на фиг. 2.

Для получения модифицированной кДНК гена LIF SEQ ID No 3 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan/Neo-LIF Seq ID No1 и pCDNA 3.1(+)- LIF Seq ID No1 с праймерами, комплементарными участку нативной кДНК гена LIF, приведенной в GenBank под номером NM_002309.4:

1. LIF 157-189 F:

Комплементарный нуклеотидам 157-189, с заменой G→C в позиции 171;

2. LIF 208-234 F:

Комплементарный нуклеотидам 208-234, с заменой G→C в позиции 219;

3. LIF 247-279 F:

Комплементарный нуклеотидам 247-279, с заменой А→С в позиции 264;

4. LIF 466-503 F:

Комплементарный нуклеотидам 466-503, с заменой А→С в позиции 480;

Модифицированная таким образом нуклеотидная последовательность кДНК гена LIF SEQ ID No: 3 содержит 2 нуклеотидных замены G→C в позициях 171 и 219; 2 нуклеотидных замены А→С в позициях 264 и 480; не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию, и имеет первичную структуру, приведенную на фиг. 3.

Для получения модифицированной кДНК гена LIF SEQ ID No 4 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan/Neo-LIF Seq ID No1 и pCDNA 3.1(+)- LIF Seq ID No1 с праймерами, комплементарными участку нативной кДНК гена LIF, приведенной в GenBank под номером NM_002309.4:

1. LIF 157-189 F:

Комплементарный нуклеотидам 157-189, с заменой G→C в позиции 171;

2. LIF 208-234 F:

Комплементарный нуклеотидам 208-234, с заменой G→C в позиции 219;

3. LIF 247-279 F:

Комплементарный нуклеотидам 247-279, с заменой А→С в позиции 264;

4. LIF 466-503 F:

Комплементарный нуклеотидам 466-503, с заменой А→С в позиции 480;

5. LIF 382-414 F:

Комплементарный нуклеотидам 382-414, с заменой A→G в позиции 399;

Модифицированная таким образом нуклеотидная последовательность кДНК гена LIF SEQ ID No: 4 содержит 1 нуклеотидную замену A→G в позиции 399, 2 нуклеотидных замены G→C в позициях 171 и 219; 2 нуклеотидных замены А→С в позициях 264 и 480; не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию, и имеет первичную структуру, приведенную на фиг. 4.

Для получения модифицированной кДНК гена LIF SEQ ID No 5 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan/Neo-LIF Seq ID No1 и pCDNA 3.1(+)- LIF Seq ID No1 с праймерами, комплементарными участку нативной кДНК гена LIF, приведенной в GenBank под номером NM_002309.4:

1. LIF 157-189 F:

Комплементарный нуклеотидам 157-189, с заменой G→C в позиции 171;

2. LIF 208-234 F:

Комплементарный нуклеотидам 208-234, с заменой G→C в позиции 219;

3. LIF 247-279 F:

Комплементарный нуклеотидам 247-279, с заменой А→С в позиции 264;

4. LIF 466-503 F:

Комплементарный нуклеотидам 466-503, с заменой А→С в позиции 480;

5. LIF 382-414 F:

Комплементарный нуклеотидам 382-414, с заменой A→G в позиции 399;

6. LIF 403-444 F:

Комплементарный нуклеотидам 403-444, с заменами G→C, в позициях 417, 426;

Модифицированная таким образом нуклеотидная последовательность кДНК гена LIF SEQ ID No: 5 содержит 1 нуклеотидную замену A→G в позиции 399, 4 нуклеотидных замены G→C в позициях 171, 219, 417, 426; 2 нуклеотидных замены А→С в позициях 264 и 480; не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию, и имеет первичную структуру, приведенную на фиг. 5.

Для получения модифицированной кДНК гена LIF SEQ ID No 6 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan/Neo-LIF Seq ID No1 и pCDNA 3.1(+)- LIF Seq ID No1 с праймерами, комплементарными участку нативной кДНК гена LIF, приведенной в GenBank под номером NM_002309.4:

1. LIF 157-189 F:

Комплементарный нуклеотидам 157-189, с заменой G→C в позиции 171;

2. LIF 208-234 F:

Комплементарный нуклеотидам 208-234, с заменой G→C в позиции 219;

3. LIF 247-279 F:

Комплементарный нуклеотидам 247-279, с заменой А→С в позиции 264;

4. LIF 466-503 F:

Комплементарный нуклеотидам 466-503, с заменой А→С в позиции 480;

5. LIF 382-414 F:

Комплементарный нуклеотидам 382-414, с заменой A→G в позиции 399;

6. LIF 403-444 F:

Комплементарный нуклеотидам 403-444, с заменами G→C в позициях 417, 426;

7. LIF 432-465 F:

Комплементарный нуклеотидам 432-465, с заменой G→C в позиции 447;

Модифицированная таким образом нуклеотидная последовательность кДНК гена LIF SEQ ID No: 6 содержит 1 нуклеотидную замену A→G в позиции 399, 5 нуклеотидных замен G→C в позициях 171, 219, 417, 426, 447; 2 нуклеотидных замены А→С в позициях 264 и 480; не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию, и имеет первичную структуру, приведенную на фиг. 6.

Для получения модифицированной кДНК гена LIF SEQ ID No 7 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-LIF Seq ID No1, pCMV6-Kan/Neo-LIF Seq ID No1 и pCDNA 3.1(+)- LIF Seq ID No1 с праймерами, комплементарными участку нативной кДНК гена LIF, приведенной в GenBank под номером NM_002309.4:

1. LIF 157-189 F:

Комплементарный нуклеотидам 157-189, с заменой G→C в позиции 171;

2. LIF 208-234 F:

Комплементарный нуклеотидам 208-234, с заменой G→C в позиции 219;

3. LIF 247-279 F:

Комплементарный нуклеотидам 247-279, с заменой А→С в позиции 264;

4. LIF 466-503 F:

Комплементарный нуклеотидам 466-503, с заменой А→С в позиции 480;

5. LIF 382-414 F:

Комплементарный нуклеотидам 382-414, с заменой A→G в позиции 399;

6. LIF 403-444 F:

Комплементарный нуклеотидам 403-444, с заменами G→C в позициях 417, 426;

7. LIF 432-465 F:

Комплементарный нуклеотидам 432-465, с заменой G→C в позиции 447;

8. LIF 572-606 F:

Комплементарный нуклеотидам 572-606, с заменой A→G в позиции 591;

9. LIF 661-691 F:

Комплементарный нуклеотидам 661-691, с заменой G→C в_ позиции 675;

Модифицированная таким образом нуклеотидная последовательность кДНК гена LIF SEQ ID No: 7 содержит 2 нуклеотидных замены A→G в позициях 399, 591; 6 нуклеотидных замен G→C в позициях 171, 219, 417, 426, 447, 675; 2 нуклеотидных замены А→С в позициях 264 и 480; не приводящих к изменениям в аминокислотной последовательности белка фактора, ингибирующего лейкемию, и имеет первичную структуру, приведенную на фиг. 7.

Таким образом, получают экспрессионные векторы на базе плазмид pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), в которых клонированы участок нативной немодифицированной кДНК гена LIF (SEQ ID No: 1) и модифицированные нуклеотидные последовательности кДНК гена LIF (SEQ ID No: 2, 3, 4, 5, 6, 7), кодирующие белок фактора, ингибирующего лейкемию.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Полученные экспрессионные векторы используют для получения на их основе генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6 - XL5, (pCMV6-Kan/Neo) или pCDNA 3.1 (+) без вставки кДНК гена LIF.

Пример 4.

Наращивание генетической конструкции в бактериальной культуре

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена LIF, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E.coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена LIF в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами EcoRI и Hindlll и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (клеток эпителия слизистой оболочки полости рта, или клеток эпителия эндометрия матки и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E.coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°С и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5.

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции генно-терапевтической субстанцией и анализа экспрессии гена LIF.

Для последующей трансфекции генно-терапевтической субстанцией содержащей один из вариантов кДНК гена LIF по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например, за ушной раковиной или с боковой внутренней поверхности в зоне локтевого сустава, размером около 3 мм, массой - до 20 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°С в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°С в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3) 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена LIF, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAlater и хранили при 4°С в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260: D280 - не менее 1,8, а соотношение полос 28S: 18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК. В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6.

Анализ эндогенной экспрессии гена LIF в культуре первичных фибробластов

Анализ экспрессии гена LIF из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена LIF.

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена LIF и фибробласты с нормальной экспрессией гена LIF, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК (251-332 н.п.), специфичной для гена LIF, используют прямой праймер LIF FA1 и обратный праймер LIF -RA1

Длина продукта амплификации -82 нуклеотида. В качестве референтного гена используют ген бета-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена LIF.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого прймера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°С 30 минут, денатурация 98°С - 15 мин., затем 40 циклов, включающих денатурацию 94°С - 15 сек., отжиг праймеров 62°С - 30 сек. и элонгацию 72°С - 30 сек.

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов LIF и В2М. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны). Количество ПЦР продуктов - кДНК генов LIF и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.

По итогам анализа экспрессии гена LIF в разных культурах фибробластов (с низкой экспрессией гена LIF и с нормальной экспрессией гена LIF) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена LIF, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7.

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена LIF генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена LIF в культуре данных клеток

Для оценки эффективности генно-терапевтической субстанции, содержащей немодифицированную кДНК гена LIF по примеру 2, этой генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена LIF, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют генно-терапевтической субстанцией на основе pCMV6- LIF SEQ ID No: 1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4 × 105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°С и в атмосфере, содержащей 5% CO2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, рН 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°С.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% СО2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С и в атмосфере, содержащей 5% CO2) после чего оценивали уровень кДНК гена LIF и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена LIF уровень кДНК гена LIF в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена LIF - уровень кДНК фибробластов со сниженной экспрессией гена LIF многократно увеличился (до уровня выше, чем уровень кДНК гена LIF в нормальных фибробластах).

Показано, что в клетках трансфицированных генно-терапевтической субстанцией на основе pCMV6- LIF SEQ ID No: 1 наблюдается усиление экспрессии целевого гена LIF.

Пример 8.

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена LIF генно-терапевтической субстанцией с кДНК гена LIF с целью подтверждения увеличения количества белка фактора, ингибирующего лейкемию, в культуре данных клеток.

Для оценки изменения количества белка фактора, ингибирующего лейкемию, использовали культуру фибробластов кожи человека по Примеру 5, в качестве транспортной молекулы - дендримеры SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия), в качестве контроля - водный раствор дендримеров без плазмидной ДНК (А), векторную плазмиду pCDNA 3.1(+), не содержащую кДНК гена LIF (В), в качестве трансфицируемых агентов - генно-терапевтическую субстанцию на основе векторной плазмиды pCDNA 3.1(+), содержащую кДНК гена LIF - pCDNA 3.1 LIF EQ ID No: 1(C), Приготовление комплекса ДНК-дендример и трансфекцию фибробластов проводили согласно Примеру 7.

После трансфекции к 0,5 мл культуральной жидкости приливали 0,1 мл 1N HCI, тщательно перемешивали и инкубировали 10 минут при комнатной температуре. Затем нейтрализовывали смесь, добавляя 0,1 мл 1.2N NaOH/0.5M HEPES (рН 7-7,6) и тщательно перемешивали.

Данную смесь использовали для количественного определения целевого белка. Количественное определение продукта кДНК гена LIF проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Human LIF ELISA Kit (Abeam, США) согласно методике производителя http.//www.abcam.com/ps/products/100/ab100582/documents/ab10058 2%20LIF%20Human%20ELISA_Kit%20v3%20(website).pdf

Метод детекции результатов - колориметрический. Оптическая плотность образцов измерялась при длине волны 450 нм при помощи автоматического биохимического и иммуноферментного анализатора ChemWell (Awareness TechNology Inc., США) и пропорциональна концентрации белка LIF в пробе. Численное значение концентрации определяется с помощью калибровочной кривой, построенной по калибраторам с известной концентрацией белка LIF, входящим в состав набора. Разница между значениями оптической плотности (ОП) калибраторов поставленных в трех повторностях не превышала 10%.

Статистическую обработку полученных результатов, осуществляли с помощью программного обеспечения для статистической обработки и визуализации данных R, версия 3.0.2 (https://www.r-project.org/).

Таким образом, показано, что транфекция фибробластов полученной генно-терапевтической субстанцией, несущей кДНК гена LIF, приводит к увеличению количества белка фактора, ингибирующего лейкемию, в клетках фибробластов. Результаты показаны на фигуре 10.

Пример 9.

Введение в кожу человека клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией с кДНК гена LIF с целью подтверждения увеличения после этого количества белка фактора, ингибирующего лейкемию, в биоптате кожи человека

С целью анализа изменения количества белка фактора, ингибирующего лейкемию, в тканях человека пациентам в кожу предплечья вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных генно-терапевтической субстанцией на основе pCMV6- LIF SEQ ID No: 7(C) в комбинации с транспортными молекулами - липосомами TRANSFAST ТМ Transfection Reagent (PROMEGA, USA).

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°С, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°С и использовали далее в качестве генно-терапевтической субстанций.

Для последующей трансфекции клеток генно-терапевтической субстанцией выращивали первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосимы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга.

Определение количества белка фактора, ингибирующего лейкемию, оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human LIF ELISA Kit (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией на основе pCMV6- LIF SEQ ID No: 7, произошло увеличение количества белка фактора, ингибирующего лейкемию, что может свидетельствовать об усилении экспрессии гена LIF. Тогда как при введении контрольных культур фибробластов (нетрансфицированных и трансфицированных вектором 6ej3 вставки кДНК гена LIF pCMV6-XL5) количество белка фактора, ингибирующего лейкемию, в коже не изменялась.

Таким образом, показана эффективность генно-терапевтической субстанции при введении в кожу человека клеточной культуры фибробластов, трансфицированных полученной генно-терапевтической субстанцией, несущей модифицированную кДНК гена LIF, что приводит к повышению количества белка фактора, ингибирующего лейкемию, в коже в зоне введения.

Пример 10.

Трансфекция культур фибробластов из биоптатов группы различных пациентов генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена LIF и участок нативной немодифицированной кДНК гена LIF

С целью подтверждения индивидуального характера увеличения количества белка фактора, ингибирующего лейкемию, до различного уровня при трансфекции клеточных культур фибробластов пациентов генно-терапевтическими субстанциями с модифицированными кДНК гена LIF и участком нативной кДНК гена LIF анализировали количественный уровень белка фактора, ингибирующего лейкемию, в клеточных лизатах фибробластов, трансфицированных разными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные кДНК гена LIF и участок нативной немодифицированной кДНК гена LIF в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена LIF.

Последовательности участка нативной немодифицированной кДНК гена LIF приведена на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК гена LIF приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ IP No: 5, SEQ ID No: 6, SEQ ID No: 7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в зоне локтевого сустава 18 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень белка фактора, ингибирующего лейкемию, в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 MMNaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford М.М. (1976) Anal. Biochem. 72: 248-254]).

Затем каждую из 18-ти культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 1, содержащей немодифицированную кДНК гена LIF (SEQ ID No: 1.) по примеру 2 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 2, содержащей модифицированную кДНК гена LIF (SEQ ID No: 2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

3-ю часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 3, содержащей модифицированную кДНК гена LIF (SEQ ID No: 3.) по примеру 3 в в сочетании с транспортной молекулой -дендримером по примеру 7.

4-ю часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 4, содержащей модифицированную кДНК гена LIF (SEQ ID No: 4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

5-ю часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 5, содержащей модифицированную кДНК гена LIF (SEQ ID No: 5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

6-ю часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 6, содержащей модифицированную кДНК гена LIF (SEQ ID No: 6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

7-ю часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 7, содержащей вариант модифицированную кДНК гена LIF (SEQ ID No: 7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена LIF по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Определение количества белка фактора, ингибирующего лейкемию, оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human LIF ELISA Kit (Abeam, США), как описано в Примере 8.

По итогам определения количества белка фактора, ингибирующего лейкемию выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни количества белка фактора, ингибирующего лейкемию и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции немодифицированной кДНК гена LIF SEQ ID No: 1. В эту группу вошло 2 культуры из 18.

В группе 2 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции модифицированной кДНК гена LIF SEQ ID No: 2. В эту группу вошло 2 культуры из 18.

В группе 3 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции модифицированной кДНК гена LIFSEQ ID No: 3. В эту группу вошло 3 культуры из 18.

В группе 4 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции модифицированной кДНК гена LIF SEQ ID No: 4. В эту группу вошли 3 культуры из 18.

В группе 5 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции модифицированной кДНК гена LIFSEQ ID No: 5. В эту группу вошло 2 культуры из 18.

В группе 6 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции модифицированной кДНК гена LIF SEQ ID No: 6. В эту группу вошли 4 культуры из 18.

В группе 7 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при трансфекции модифицированной кДНК гена LIF SEQ ID No: 7. В эту группу вошло 2 культуры из 18.

Ни в одной из клеточных культур, трансфицированных генно-терапевтической субстанцией с векторной плазмидой, не содержащей кДНК гена LIF, не было обнаружено максимальное количество белка фактора, ингибирующего лейкемию, в отличие от клеточных культур, трансфицированных генно-терапевтическими субстанциями с генетическими конструкциями, содержащими кДНК гена LIF.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентраций белка фактора, ингибирующего лейкемию, (усредненных в рамках группы, ъ случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и участок нативной кДНК гена LIF.

Из данного примера следует, что достижение максимального количества белка фактора, ингибирующего лейкемию, в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано "с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена LIF, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 11.

Введение в первичную клеточную культуру эпителия эндометрия матки человека генно-терапевтической субстанции с кДНК гена LIF с целью подтверждения при этом увеличения количества белка фактора, ингибирующего лейкемию

Клеточную культуру эпителия эндометрия человека получали путем взятия материала аспирационной биопсии. Трансфекцию этой клеточной культуры проводили генно-терапевтической субстанцией на основе плазмиды pCMV6-Kan/Neo LIF SEQ ID No: 2, используя в качестве транспортной молекулы РАМАМ-дендримеры (Weihai CY Dendrimer Technology). В качестве контроля использовали плазмиду pCMV6- Kan/Neo без кДНК гена LIF.

Перед проведением трансфекции была приготовлена смесь плазмидной ДНК из расчета, что на 25000 клеток необходимо 0,1 мкл раствора плазмидной ДНК (1 мкг/мл) и 0,3 мкл раствора РАМАМ дендример (1 мкг/мл) с доведением до 4 мкл буферным раствором Хенкса. Полученная смесь аккуратно пипетировалась и инкубировалась при комнатной температуре в течение 15 мин.

Непосредственно перед экспериментом первичная клеточная культура эпителия эндометрия человека промывалась средой DMEM. Затем клеточная культура инкубировалась в течение 1 ч с приготовленной трансфекционной смесью при плюс 37°С и 5% CO2. В качестве контроля добавляли 4 мкл буферного раствора Хенкса. После инкубирования клеточная культура промывалась средой DMEM, а затем добавлялась полная ростовая среда. Клеточная культура наблюдалась под микроскопом Zeiss Axio Observer А1 в течение 24 ч.

Сбор клеточной культуры эпителия эндометрия человека проводили через 24, 48, 72 и 96 ч после проведения трансфекции. Отбирали ростовую среду, 2 раза промывали буферным раствором Хенкса, 1 раз раствором ЭДТА, затем культуру клеток инкубировали в растворе трипсин-ЭДТА при 37°С в присутствии 5% С02 в течение 4 минут. Реакцию трипсинизации ингибировали путем добавления ростовой среды. Чтобы избывиться от ростовой среды, суспензию клеток 2 раза промывали буферным раствором Хенкса с последующим центрифугированием. Полученный осадок ресуспендировали в консерванте RNAlater (Qiagen, Германия).

Выделение РНК производили с помощью набора RNeasy Mini Kit (Qiagen, Германия) согласно методике производителя. Для элиминации ДНК в ходе процедуры выделения РНК использовали набор RNAse-Free DNAse Set (Qiagen, Германия).

Концентрацию выделенной РНК измеряли спектрофотометрически с помощью NanoDrop 2000 (ThermoFisher Scientific Inc.). Оптическую плотность раствора РНК измеряли в диапазоне 220-320 нм. Для работы использовали образцы, для которых общее количество выделенной РНК было не менее 1j) нг/мкл РНК, соотношение А260280 - не менее 1,8.

Качество выделенной РНК проверяли методом капиллярного электрофореза на приборе QIAxcel (Qiagen, Германия), используя картридж RNA Quality Control Kit с помощью программы BioGel Software (Qiagen, Германия). Выделенная РНК хранилась на -80°С и использовалась для синтеза первой цепи кДНК методом ОТ-ПЦР.

Синтез суммарной кДНК первой цепи проводили, с помощью обратной транскриптазы RevertAid (Thermo Scientific, США) по методике производителя. В реакционную смесь объемом 20 мкл., состоящую из деионизованной воды, 5Х Reaction Buffer (250 мМ Tris-HCl (рН 8.3 at 25°С), 250 мМ KCl, 20 мМ MgCl2, 50 мМ DTT), dNTP (25 mM), вносили 200 Ед обратной транскриптазы и 5 пмоль случайного 9-нуклеотидного праймера, в качестве матрицы использовали 120 нг суммарной РНК. Обратную транскрипцию проводили при следующих условиях: 1 цикл предварительной инкубации при 25°С 10 минут, 1 цикл инкубации 52°С - 30 мин., 1 цикл инкубации 85°С - 5 мин.

Суммарную кДНК использовали для проведения ПЦР в реальном времени, которую проводили на амплификаторе CFX96 (Bio-Rad, США), с использованием реакционной смеси iTaq Universal SYBR Green Supermix (Bio-Rad, США), в состав которой входит интеркалирующий краситель SYBR Green I. Постановку реакции осуществляли в объеме 20 мкл согласно инструкции производителя с помощью высокоспецифичных праймеров QuantiTect Primer Assay (Qiagen, Германия) к гену LIF и к референтному гену В2М. В качестве матрицы использовали: каждую пробу после стадии синтеза суммарной кДНК. Результаты амплификации оценивали в режиме реального времени с помощью программного обеспечения Bio-Rad CFX Manager 2.1 (Bio-Rad США) и qBase plus (Biogazelle, Бельгия). ПЦР проводили при следующих условиях: первоначальная денатурация при +95°С в течение 30 сек., 45 циклов, включающих денатурацию при +95°С в течение 5 сек., отжиг праймеров и элонгация при +60°С в течение 30 сек.

Идентификацию, полученных ПЦР-продуктов проводили путем капиллярного электрофореза в картридже QX DNA High Resolution (Qiagen, Германия) с помощью прибора для капиллярного электрофореза QIAxcel (Qiagen, Германия). В качестве выравнивающего маркера использовали QX Alignment Marker 15-3000 п. , в качестве маркера длины - QX DNA Size Marker 50-800 п.н. После сравнения полученных данных с теоретически рассчитанной длиной обоих генов, учитывая погрешность прибора (±10 п.н.), было доказано, что детектируемый продукт соответствует гену LIF, и референтному гену В2М. В пробах с отрицательным контролем продукт не детектируется.

Показано, что, в клеточной культуре эпителия эндометрия человека, трансфицированной генно-терапевтической субстанцией с кДНК гена LIF, произошло увеличение количества белка фактора, ингибирующего лейкемию, что подтверждает усиление экспрессии гена LIF при использовании генно-терапевтической субстанции с кДНК гена LIF. Результаты отражены на фигуре 13.

Пример 12.

Трансфекция клеточной культуры эпителия слизистой оболочки полости рта генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена LIF в данной культуре клеток.

С целью выяснения эффективности генно-терапевтической субстанции, содержащей кДНК гена LIF, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали эпителий слизистой оболочки полости рта человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биоптаты слизистой оболочки полости рта массой 40 мг измельчали на фрагменты до 10 мм3. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°С в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37оС в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут.Рост культуры клеток эпителия после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 105 клеток.

Для трансфекции клеток генно-терапевтической субстанцией содержащей кДНК гена LIF использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci.2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-N-(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6- Kan/Neo LIF SEQ ID No: 3 с модифицированной кДНК гена LIF SEQ ID No: 3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена LIF проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение транскрипции LIF наблюдали на 4 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена LIF.

Показано, что в клетках эпителия слизистой оболочки полости рта, трансфицированных генно-терапевтической субстанцией на основе pCMV6- Kan/Neo LIF SEQ ID No: 3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается усиление экспрессии целевого гена LIF.

Пример 13.

Введение в кожу человека генно-терапевтической субстанции с кДНК гена LIF с целью подтверждения при этом увеличения количества белка фактора, ингибирующего лейкемию, в коже человека.

С целью анализа изменения количества белка фактора, ингибирующего лейкемию, пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена LIF (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена LIF с транспортной молекулой (А) - в кожу предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6 LIF SEQ ID No: 4, которая содержит модифицированную кДНК гена LIF (SEQ ID No: 4) и плазмиду pCMV6-XL5, используемую в качестве плацебо -которая не содержит кДНК гена LIF, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо -около 0,3 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Количество белка фактора, ингибирующего лейкемию, оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human LIF ELISA Kit (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее, как описано в примере 9.

Показано, что в коже пациента в области введения генно-терапевтической субстанции с кДНК гена LIF, произошло увеличение количества белка фактора, ингибирующего лейкемию, тогда как при введении плацебо, количество белка фактора, ингибирующего лейкемию в коже не изменялась, что говорит об усилении экспрессии гена LIF при использовании генно-терапевтической субстанции с кДНК гена LIF. Результаты отражены на фигуре 15.

Пример 14.

Введение в слизистую оболочку полости рта человека генно-терапевтической субстанции с кДНК гена LIF с целью подтверждения при этом увеличения количества белка фактора, ингибирующего лейкемию, в слизистой оболочке рта человека человека.

С целью анализа изменения количества белка фактора, ингибирующего лейкемию пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена LIF (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена LIF с транспортной молекулой (А) - в слизистую оболочку полости рта.

В качестве транспортной молекулы использовали порошок липосом TRANS FAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCDNA 3.1 LIF SEQ ID No: 5, которая содержит модифицированную кДНК гена LIF (SEQ ID No: 5), и плазмиду pCDNA 3.1(+), используемую в качестве плацебо, которая не содержит кДНК гена LIF, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1-2 мм в хрящевую ткань ушных раковин с тыльной стороны. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 2-4 см друг от друга.

Количество белка фактора, ингибирующего лейкемию, оценивали в лизатах биоптатов слизистой оболочки полости рта пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human LIF ELISA Kit (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков слизистой оболочки полости рта в зоне введения генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL), далее по примеру 9.

Показано, что слизистой оболочке полости рта пациента в области введения генно-терапевтической субстанции с кДНК гена LIF, произошло увеличение количества белка фактора, ингибирующего лейкемию, тогда как при введении плацебо количество белка фактора, ингибирующего лейкемию, в слизистой оболочке рта не изменялось, что подтверждает усиление экспрессии гена LIF при использовании генно-терапевтической субстанции с кДНК гена LIF. Результаты отражены на фигуре 16.

Пример 15.

Введение в мышечную ткань человека генно-терапевтической субстанции с кДНК гена LIF с целью подтверждения при этом увеличения количества белка фактора, ингибирующего лейкемию в мышечной ткани человека.

С целью анализа изменения количества белка фактора, ингибирующего лейкемию пациентам вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена LIF (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена LIF с транспортной молекулой (А) - в мышечную ткань в зоне предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo LIF SEQ ID No: 6, которая содержит модифицированную кДНК гена LIF (SEQ ID No: 6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена LIF, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга.

Количество белка фактора, ингибирующего лейкемию, оценивали в лизатах биоптатов мышечной ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human LIF ELISA Kit (Abeam, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компания BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения генно-терапевтической субстанции с кДНК гена LIF, произошло увеличение количества белка фактора, ингибирующего лейкемию, тогда как при введении плацебо количество белка фактора, ингибирующего лейкемию в мышечной ткани не изменялась, что подтверждает усиление экспрессии гена LIF при использовании генно-терапевтической субстанции с кДНК гена LIF. Результаты отражены на фигуре 17.

Пример 16.

Введение группе различных пациентов генно-терапевтическиих субстанций содержащих модифицированные кДНК гена LIF и участок нативной немодифицированной кДНК гена LIF.

С целью подтверждения индивидуального характера увеличения количества белка фактора, ингибирующего лейкемию, до различного уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными и немодифицированной кДНК гена LIF анализировали количественный уровень белка фактора, ингибирующего лейкемию, в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена LIF.

Последовательность участка нативной немодифицированной кДНК гена LIF приведена на фигуре 1, SEQ LIF ID No: 1, последовательности модифицированных кДНК гена LIF приведены на фигурах 2-7 (SEQ LIF ID No: 2, SEQ LIF ID No: 3, SEQ LIF ID No: 4, SEQ LIF ID No: 5, SEQ LIF ID No: 6, SEQ LIF ID No: 7).

При этом генетические конструкции, одна из которых содержит участок нативной немодифицированной кДНК гена LIF (SEQ ID No: 1), вторая генетическая конструкция содержит участок модифицированной кДНК гена LIF (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 4), пятая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК в сочетании с транспортными молекулами - липосомами по примеру 9.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 21-го пациента, которые были отобраны в случайном порядке, вводили 7 генно-терапевтических субстанций и плацебо в кожу предплечья.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

А - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 1, содержащий немодифицированную кДНК гена LIF (SEQ ID No: 1.) по примеру 2 в сочетании с транспортными молекулами - липосомами по примеру 9. В - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 2, содержащий модифицированную кДНК гена LIF (SEQ ID No: 2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. С - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 3, содержащий модифицированную кДНК гена LIF (SEQ ID No: 3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

D - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 4, содержащий модифицированную кДНК гена LIF (SEQ ID No: 4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Е - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 5, содержащий модифицированную кДНК гена LIF (SEQ ID No: 5) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

F - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 6, содержащий модифицированную кДНК гена LIF (SEQ ID No: 6) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

G - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 7, содержащий модифицированную кДНК гена LIF (SEQ ID No: 7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащей кДНК гена LIF по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Количество белка фактора, ингибирующего лейкемию, оценивали в девяти биоптатах кожи от каждого пациента (от А до Н и в биоптате интактной кожи) через 72 часа после введения генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human LIF ELISA Kit (Abeam, США), как описано в Примере 8.

По итогам анализа количественного уровня белка фактора, ингибирующего лейкемию, выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни количества белка фактора, ингибирующего лейкемию и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении немодифицированной кДНК гена LIF SEQ ID No: 1. В эту группу вошел 1 биоптат из 21.

В группе 2 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении модифицированной кДНК гена LIF SEQ ID No: 2. В эту группу вошли 3 биоптата из 21.

В группе 3 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении модифицированной кДНК гена LIF SEQ ID No: 3. В эту группу вошли 3 биоптата из 21.

В группе 4 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении модифицированной кДНК гена LIF SEQ ID No: 4. В эту группу вошли 4 биоптата из 21.

В группе 5 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении модифицированной кДНК гена LIF SEQ ID No: 5. В эту группу вошли 3 биоптата из 21.

В группе 6 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении модифицированной кДНК гена LIF SEQ ID No: 6. В эту группу вошли 4 биоптата из 21.

В группе 7 максимальное количество белка фактора, ингибирующего лейкемию, наблюдалось при введении модифицированной кДНК гена LIF SEQ ID No: 7. В эту группу вошли 3 биоптата из 21.

Ни в одном из биоптатов, в которые были введены генно-терапевтические субстанции плацебо - векторной плазмидой, не содержащей кДНК гена LIF, не было обнаружено максимальное количество белка фактора, ингибирующего лейкемию, в отличие от биоптатов, в которые были введены генно-терапевтические субстанции с генетическими конструкциями, содержащими кДНК гена LIF.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и участок нативной кДНК гена LIF.

Из данного примера следует, что достижение максимального количества белка фактора, ингибирующего лейкемию, в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена LIF, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 17.

Трансфекция клеточной линии фибробластов пациента разными генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена LIF и участок нативной немодифицированной кДНК гена LIF с целью персонализированного выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка фактора, ингибирующего лейкемию, в клеточных лизатах фибробластов этого пациента, трансфицированных разными генно-терапевтическими субстанциями, содержащими участок нативной немодифицированной кДНК гена LIF и/или модифицированные кДНК гена LIF.

Последовательность участка нативной немодифицированной кДНК гена LIF приведена на фигуре 1, SEQ LIF ID No: 1, последовательности модифицированных кДНК гена LIF приведены на фигурах 2-7 (SEQ LIF ID No: 2, SEQ LIF ID No: 3, SEQ LIF ID No: 4, SEQ LIF ID No: 5, SEQ LIF ID No: 6, SEQ LIF ID No: 7).

Культуры фибробластов из биоптата пациента вырастили по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Затем культуру фибробластов пациента разделили на 8 частей. Первую часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 1, содержащей участок нативной немодифицированной кДНК гена LIF (SEQ ID No: 1.) по примеру 2 в сочетании с транспортными молекулами - липосомами по примеру 9.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 2, содержащей участок модифицированной кДНК гена LIF (SEQ ID No: 2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Третью часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 3, содержащей модифицированную кДНК гена LIF (SEQ ID No: 3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Четвертую часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 4, содержащей модифицированную кДНК гена LIF (SEQ ID No: 4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Пятую часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 5, содержащей модифицированную кДНК гена LIF (SEQ ID No: 5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Шестую часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 6, содержащей модифицированную кДНК гена LIF (SEQ ID No: 6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Седьмую часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 7, содержащей модифицированную кДНК гена LIF (SEQ ID No: 7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Восьмую часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена LIF по примеру 3 в сочетании с транспортными молекулами -липосомами по примеру 9.

Определение количества белка фактора, ингибирующего лейкемию, в клеточных лизатах фибробластов пациента проводили через 72 часа после трансфекции методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human LIF ELISA Kit (Abeam, США), как описано в Примере 8.

По итогам определения количества белка фактора, ингибирующего лейкемию, в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой наблюдается максимальное количество белка фактора, ингибирующего лейкемию, в лизате клеточной культуры и соответственно наблюдается максимальная экспрессия гена LIF. В данном эксперименте максимальное количество белка фактора, ингибирующего лейкемию, в лизате отмечено при трансфекции генно-терапевтической субстанцией на базе pCMV6 LIF SEQ ID No: 1, содержащей немодифицированную кДНК гена LIF, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18.

Введение в кожу пациента различных генно-терапевтических субстанций, содержащих модифицированные «ДНК гена LIF и участок нативной немодифицированной кДНК гена LIF с целью выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка фактора, ингибирующего лейкемию, в лизатах биоптатов кожи этого пациента, после введения ему в кожу генно-терапевтических субстанций, содержащих модифицированные кДНК гена LIF и/или участок нативной кДНК гена LIF.

Последовательность участка нативной немодифицированной кДНК гена LIF приведена на фигуре 1, SEQ LIF ID No: 1, последовательности модифицированных кДНК гена LIF приведены на фигурах 2-7 (SEQ LIF ID No: 2, SEQ LIF ID No: 3, SEQ LIF ID No: 4, SEQ LIF ID No: 5, SEQ LIF ID No: 6, SEQ LIF ID No: 7).

Пациенту вводили 7 генно-терапевтических субстанций и плацебо в кожу предплечья.

Первая генно-терапевтическоая субстанция (А) на базе pCMV6- SEQ ID No: 1, содержащая участок нативной немодифицированной кДНК гена LIF (SEQ ID No: 1.) по примеру 2 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая генно-терапевтическая субстанция(В) на базе pCMV6-SEQ ID No: 2, содержащая модифицированную кДНК гена LIF (SEQ ID No: 2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Третья генно-терапевтическая субстанция (С) на базе pCMV6-SEQ ID No: 3, содержащая модифицированную кДНК гена LIF (SEQ ID No: 3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Четвертая генно-терапевтическая субстанция (D) на базе pCMV6- SEQ ID No: 4, содержащая модифицированную кДНК гена LIF (SEQ ID No: 4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Пятая генно-терапевтическая субстанция (Е) на базе pCMV6-SEQ ID No: 5, содержащая модифицированную кДНК гена LIF (SEQ ID No: 5.) по примеру 3 в сочетании с транспортной молекулой -дендримером по примеру 7.

Шестая генно-терапевтическая субстанция (F) на базе pCMV6- SEQ ID No: 6, содержащая модифицированную кДНК гена LIF (SEQ ID No: 6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Седьмая генно-терапевтическая субстанция (G) на базе pCMV6- SEQ ID No: 7, содержащая модифицированную кДНК гена LIF (SEQ ID No: 7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Восьмая векторная плазмида pCMV6-XL5, не содержащая кДНК гена LIF по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит участок нативной немодифицированной кДНК гена LIF (SEQ ID No: 1), вторая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 4), пятая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена LIF (SEQ ID No: 7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Определение количества белка фактора, ингибирующего лейкемию, определяли в девяти биоптатах кожи пациента через 72 часа после введения генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human LIF ELISA Kit (Abeam, США), как описано в Примере 8.

По итогам определения количества белка фактора, ингибирующего лейкемию, в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой в кожу наблюдается максимальное количество белка фактора, ингибирующего лейкемию, в лизате биоптата кожи и соответственно наблюдается максимальная экспрессия гена LIF. В данном эксперименте максимальное количество целевого белка в лизате биоптата кожи отмечено при введении генно-терапевтической субстанции на базе pCMV6 LIF SEQ ID No: 2, содержащей модифицированную кДНК гена LIF, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, возникших вследствие недостаточной экспрессии гена LIF, способ его получения и использования.

Созданное средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций с использованием одной из модифицированных кДНК гена LIF или участка нативной немодифицированной кДНК гена LIF позволяет на практике использовать входящие в группу генно-терапевтические субстанции для повышения до необходимого уровня количества белка фактора, ингибирующего лейкемию, в различных клетках органов и тканей и/или органах и тканях человека путем увеличения экспрессии гена LIF.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант генно-терапевтической субстанции из созданной группы генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить количество белка фактора, ингибирующего лейкемию, в клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование генно-терапевтической субстанции с участком нативной немодифицированной кДНК гена LIF не приводит к желаемому изменению уровня количества белка фактора, ингибирующего лейкемию, в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена LIF, приводящей к более эффективной экспрессии гена LIF.

При использовании заявленной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Группа генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена LIF, повышая количество белка фактора, ингибирующего лейкемию, в клетках органов и тканей и/или органах и тканях человека в частности, в фибробластах, эпителиальных и мышечных клетках, в клетках эндометрия матки, в сочетании с транспортной молекулой или без нее при трансфекции этими генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в коре головного мозга, гиппокампе, в боковых желудочках головного мозга, мозжечке, щитовидной железе, паращитовидной железе, надпочечниках, аппендиксе, костном мозге, лимфатических узлах, миндалинах, селезенке, сердце, носоглотке, бронхах, легких, печени, желчном пузыре, печени, поджелудочной железе, слюнных железах, желудке, двенадцатиперстной кишке, тонкой кишке, толстой кишке, прямой кишке, почке, мочевом пузыре, семенниках, семенных канатиках, простате, семенных везикулах, молочных железах, шейке матки, фаллопиевых трубах, яичниках, плаценте, коже, в слизистой оболочке полости рта, сердечной мышечной ткани, скелетной мышечной ткани, гладкой мышечной ткани, эндометрии матки, жировой ткани, мягких тканях, в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, представляющего собой группу генно-терапевтических субстанций, при использовании которых с учетом индивидуальных особенностей пациента, происходит повышение уровня экспрессии гена LIF и/или повышение количества белка фактора, ингибирующего лейкемию, в клетках органов и тканей и/или органах и тканях организма.

Кроме этого при введении генетических конструкций в отличие от введения непосредственно белка, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Повышение эффективности коррекции количественного уровня белка фактора, ингибирующего лейкемию, в клетках органов и тканей человека достигают за счет того, что при недостаточном количестве этого белка вследствие дефекта гена LIF используют не белок, а генетическую конструкцию с кДНК гена LIF, кодирующую этот белок.

Промышленная применимость.

Все приведенные примеры по созданию и использованию созданной группы генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр, мкл - микролитр

л - литр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е. ф-относительная единица флуоресценции

ГТС - генно-терапевтическая субстанция

Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, способ получения и использования

SEQ ID No:1

ATGAAGGTCTTGGCGGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCGGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATACGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Фиг.1

Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, способ получения и использования

SEQ ID No:2

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATACGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Фиг.2

Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, способ получения и использования

SEQ ID No:3

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Фиг.3

Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, способ получения и использования

SEQ ID No:4

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTGTGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Фиг.4

Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, способ получения и использования

SEQ ID No:5

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTGTGTGGCCCCAACGTGACCGACTTCCCCCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Фиг.5

Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, способ получения и использования

SEQ ID No:6

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTGTGTGGCCCCAACGTGACCGACTTCCCCCCCTTCCACGCCAACGGCACCGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Фиг.6

Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, способ получения и использования

SEQ ID No:7

ATGAAGGTCTTGGCCGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCCGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATCCGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTGTGTGGCCCCAACGTGACCGACTTCCCCCCCTTCCACGCCAACGGCACCGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATCGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGGGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCCGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG

Фиг.7

1. Средство для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, где клетки органов и тканей выбраны из фибробластов, клеток эндометрия матки, эпителиальных клеток; органы и ткани выбраны из кожи, слизистой оболочки рта или мышечной ткани, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена LIF, с кодирующей последовательностью белка фактора, ингибирующего лейкемию, с делениями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена LIF SEQ ID No: 1, или модифицированной кДНК гена LIF, при этом в качестве модифицированной кДНК гена LIF используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7 или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие повышение экспрессии гена LIF в эукариотических клетках, в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

2. Средство по п. 1, отличающееся тем, что каждая генетическая конструкция с модифицированной кДНК гена LIF содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена LIF, которая несет модификации, не затрагивающие структуру белка фактора, ингибирующего лейкемию, а именно нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций, и не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

3. Средство по п. 1, отличающееся тем, что в качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры.

4. Способ получения средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, по п. 1, заключающийся в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций по п. 1., при этом получают кДНК гена LIF, затем помещают кДНК в векторную плазмиду, способную обеспечить повышение экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена LIF с кодирующей последовательностью белка фактора, ингибирующего лейкемию, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена LIF SEQ ID No: 1 или модифицированной кДНК гена LIF, при этом в качестве модифицированной кДНК гена LIF используют или SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

5. Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF и/или уменьшением количества белка фактора, ингибирующего лейкемию, а именно женского бесплодия, заключающийся в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п.1, клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/ выбранных из группы созданных генно-терапевтических субстанций по п. 1, или сочетанием обозначенных способов.



 

Похожие патенты:

Группа изобретений относится к медицине и может быть использована для стимуляции сперматогенеза, в том числе при лечении нарушений фертильности, вызванных врожденной или приобретенной патологией ткани семенников.

Группа изобретений относится к медицине и касается средства для лечения состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11 на основе генно-терапевтических субстанций с геном IL-11, где клетки органов и тканей выбраны из клеток фибробластов, клеток эндометрия матки, хондроцитов и эпителиальных клеток; органы и ткани выбраны из кожи, матки, хрящевой ткани, эндометриальной ткани или мышечной ткани человека, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена IL-11, с кодирующей последовательностью белка интерлейкина-11, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 1 или участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 2 или модифицированной кДНК гена IL-11, при этом в качестве модифицированной кДНК гена IL-11 используют SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, в сочетании с транспортной молекулой или без нее.

Изобретение относится к медицине, в частности к акушерству и гинекологии, и может быть использовано при лечении первичного бесплодия, обусловленного тромбофилиями.

Изобретение относится к области медицины, а именно к фармацевтической композиции для стимуляции регенерации эпителиальных и/или соединительных тканей, включающей эффективное количество соединения формулы (I) (Треамида): или его фармацевтически приемлемой соли и фармацевтически приемлемый носитель.
Изобретение относится к медицине, а именно к акушерству и гинекологии, и может быть использовано для лечения пациенток с тонким эндометрием. Для этого эндометрий однократно орошают аутоплазмой, обогащенной тромбоцитами, в количестве 0,5-1 мл в качестве предгравидарной подготовки либо на фоне заместительной гормонотерапии в позднюю фазу пролиферации менструального цикла, а также вводят аутоплазму, обогащенную тромбоцитами.

Изобретение относится к фармацевтической промышленности и представляет собой фармацевтическую композицию, содержащую N-ацетил-L-цистеин (NAC) сам по себе или вместе с (2) селеном в форме селенометионина и/или (3) мелатонином и/или их физиологически приемлемыми солями и подходящий носитель или эксципиент, для использования в ЭКО-лечении бесплодия у млекопитающего, отличающуюся тем, что дозу 50-150 мг/кг массы тела NAC один раз в сутки в течение 1-3 суток вводят внутривенно, либо дозу 30-45 мг/кг массы тела NAC вводят один раз в сутки перорально, или, альтернативно, 600 мг NAC вводят три раза в сутки перорально в течение трех последовательных суток в неделю с последующими четырьмя сутками без введения лекарственного средства общей продолжительностью три месяца или более перед ЭКО-лечением.

Изобретение относится к медицине, а именно к акушерству и гинекологии, и может быть использовано для лечения женского бесплодия у млекопитающих, не страдающих диабетом, путем применения терапевтически эффективного количества соли вольфрама (VI) с фармацевтически или ветеринарно пригодной катионной группой или ее сольвата.

Изобретение относится к медицине, а именно к андрологии, репродуктологии. Применение «Экстракта мицелия вешенки «РЕВИТАЦЕЛ» в качестве препарата для приращения процентного соотношения уровня повышения активности сперматозоидов человека.

Изобретение относится к области репродуктивных биотехнологий, предназначенных для ускоренного воспроизводства и тиражирования потомства животных, и представляет собой фармацевтическую композицию с пролонгированным действием гонадотропинов для проведения индукции суперовуляции у самок млекопитающих, содержащую фолликулостимулирующий гормон (ФСГ) и лютеинизирующий гормон (ЛГ) при соотношениях ФСГ/ЛГ (1/0,001-1/1) и пролонгатор действия фолликулостимулирующего гормона - биологически деградируемый полимер полиэтиленгликоль (ПЭГ), отличающуюся тем, что дополнительно содержит 0,25-1% раствор новокаина, а в качестве пролонгатора используют ПЭГ с молекулярной массой от 6000 до 70000 Да, при следующих соотношениях компонентов: ФСГ/ЛГ (1/0,001-1/1) активностью 800-1000 ME в 0,25-1%-ном растворе новокаина от 65 до 90 вес.

Группа изобретений относится к медицине и касается препарата для стимуляции фолликулогенеза, содержащего суспензию химерного белка с водонерастворимой ферментативно неактивной хлорамфениколацетилтрансферазой без 10 С-терминальных аминокислот, аминокислотным спейсером и соматостатином-14 с последовательностью аминокислот AGCFWKTFTSC в рафинированном растительном масле с добавлением апирогенной воды для инъекций.

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Синергетический эффект, обусловленный наличием 3'-UTR гена альбумина и 3’-некодирующей области матричной РНК, уложенной во вторичную структуру типа «стебель-петля», в структуре искусственной нуклеиновой кислоты, позволяет повысить стабильность и продлить экспрессию кодируемого белка.

Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 55-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 14-го – 34-го или 15-го – 34-го нуклеотидов, считая от 5'-конца 55-го экзона гена дистрофина человека.

Группа изобретений относится к медицине и касается средства для лечения состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена IL-11 и/или уменьшением количества белка интерлейкина-11 на основе генно-терапевтических субстанций с геном IL-11, где клетки органов и тканей выбраны из клеток фибробластов, клеток эндометрия матки, хондроцитов и эпителиальных клеток; органы и ткани выбраны из кожи, матки, хрящевой ткани, эндометриальной ткани или мышечной ткани человека, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена IL-11, с кодирующей последовательностью белка интерлейкина-11, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 1 или участка нативной немодифицированной кДНК гена IL-11 SEQ ID No: 2 или модифицированной кДНК гена IL-11, при этом в качестве модифицированной кДНК гена IL-11 используют SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, в сочетании с транспортной молекулой или без нее.

Изобретение относится к области биотехнологии, конкретно к получению вектора экспрессии, содержащего (а) нуклеотидную последовательность С68 и (б) мультиантигенную конструкцию ДНК, кодирующую иммуногенные полипептиды простатоассоциированных антигенов (РАА), что может быть использовано в медицине.

Представленная группа изобретений касается полинуклеотида, кодирующего вариант хоминг-эндонуклеазы (ХЭ) I-OnuI, экспрессионного вектора, содержащего такой полинуклеотид, полипептида эндонуклеазы, композиции для лечения гемоглобинопатии и клетки, содержащей указанные полинуклеотид, вектор или полипетид эндонуклеазы.

Настоящее изобретение относится к биотехнологии, в частности к выделенной молекуле нуклеиновой кислоты, кодирующей химерный рецептор антигена (CAR), направленный против антигена созревания В-клеток (ВСМА).

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена САТ и/или уменьшением активности белка каталазы, на основе генно-терапевтических субстанций с геном CAT, где клетки органов и тканей выбраны из фибробластов, эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CAT, с кодирующей последовательностью белка каталазы, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1 или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

Настоящее изобретение относится к биотехнологии, в частности к композиции для продукции целевого полипептида в клетке или ткани млекопитающего и способу получения указанного полипептида в клетке или ткани млекопитающего in vitro с применением такой композиции.

Изобретение относится к области биохимии. Описана группа изобретений, включающая фармацевтическую композицию для экспрессии полипептида в клетке млекопитающего и применение композиции для получения лекарственного средства для повышения уровня интересующего полипептида у млекопитающего.

Изобретение относится к области биотехнологии, конкретно к новым иммуногенам на основе перекрывающихся пептидов (OLP), и может быть использовано в медицине для предупреждения или лечения ВИЧ инфекции.

Изобретение относится к медицине и может быть использовано для стимуляции восстановления мужской фертильности, в том числе при врожденном или приобретенном нарушении функции сперматогенной ткани семенников. Способ стимуляции сперматогенеза включает инъекционное введение под белочную оболочку яичка суспензии мультипотентных мезенхимных стромальных клеток жировой ткани человека в бессывороточной среде роста, лишенной ксеногенных компонентов, в количестве 500-600 тысяч клеток, содержащихся в 400±100 мкл суспензии. Способ обеспечивает высокую степень стимуляции сперматогенеза за счет активации эндогенных тканеспецифичных стволовых, прогениторных клеток и клеток, поддерживающих сперматогенез, с обеспечением пролонгированного эффекта до 3-х месяцев и более после проведения однократной инъекции. 1 з.п. ф-лы, 3 пр., 4 табл., 4 ил.

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена LIF иили уменьшением количества белка фактора, ингибирующего лейкемию, на основе генно-терапевтических субстанций с геном LIF, где клетки органов и тканей выбраны из фибробластов, клеток эндометрия матки, эпителиальных клеток; органы и ткани выбраны из кожи, слизистой оболочки рта или мышечной ткани, представляющего собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена LIF, с кодирующей последовательностью белка фактора, ингибирующего лейкемию, с делениями 5 и 3-нетранслируемых областей, в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека. Группа изобретений также касается способа получения указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF иили уменьшением количества белка фактора, ингибирующего лейкемию; способа использования указанного средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена LIF иили уменьшением количества белка фактора, ингибирующего лейкемию. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 20 ил., 18 пр.

Наверх