Линейка биологически активных генно-терапевтических субстанций на основе гена gpx1 для коррекции патологических состояний клеток органов и тканей и органов и тканей человека, связанных с оксидативным стрессом, способ получения и использования

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена GPX1, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеткок глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта или мышечной ткани, представляющего собой совокупность генотерапевтических субстанций, каждая из которых представляет генотерапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена GPX1, с кодирующей последовательностью белка глутатионпероксидазы-1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена GPX1 SEQ ID No: 1, или модифицированной кДНК гена GPX1, при этом в качестве модифицированной кДНК гена GPX1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена GPX1. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и может быть использовано для усиления защиты клеток различных органов и тканей, а также собственно органов и тканей человека от оксидативного стресса, в частности, в терапевтических целях.

Предшествующий уровень.

Оксидативный стресс - нарушение баланса между процессами образования активных форм кислорода (свободных радикалов) и процессами их нейтрализации. Он приводит к повреждениям клеток, тканей и органов живого организма, в частности, к преждевременному старению кожи, поскольку из всех систем живого организма именно кожа наиболее подвержена воздействию активных форм кислорода.

Кроме того, наиболее предрасположены к оксидативному стрессу дыхательная система (воздействие большого количества кислорода), мозг (высокая метаболическая активность и низкий уровень эндогенных антиоксидантов), глаза (постоянное УФ-облучение), система кровообращения (колебания уровней кислорода и оксида азота) и репродуктивная система (высокая метаболическая активность сперматозоидов).

Активные формы кислорода могут быть эндогенными, т.е. продуктами различных метаболических процессов в организме. Например, наиболее распространенный окислитель в организме - гидроксид-анион (ОН-) - образуется при многих аэробных процессах. Также активные формы кислорода могут иметь экзогенное происхождение. Они образуются под воздействием ультрафиолетового, ионизирующего и электромагнитного излучения, а также в результате взаимодействия с окислителями из окружающей среды, например, с озоном.

Другой распространенной активной формой кислорода является супероксид-анион (O2.-). В отличие от гидроксильного радикала, супероксид-анион менее активен, но обладает большим временем жизни. Кроме того, он сам может быть источником образования гидроксид-анионов. В нормальных условиях супероксид-анион, как и другие свободные радикалы, быстро нейтрализуется естественными антиоксидантами - внутриклеточными, мембранными и внеклеточными. К внутриклеточным антиоксидантам относятся белки супероксиддисмутазы, пероксидазы и белок каталазы.

Супероксиддисмутазы катализируют превращение супероксид-аниона в кислород и перекись водорода, которая затем утилизируется глутатионпероксидазами и каталазой.

Следовательно, при сниженной активности глутатионпероксидазы, в частности - глутатионпероксидазы-1, или при повышенной скорости образования активных форм кислорода повышается вероятность и интенсивность оксидативного повреждения клеток и тканей.

Для усиления нейтрализации действия активных форм кислорода и снижения влияния оксидативного стресса существует несколько подходов.

Известно использование органических веществ природного происхождения, обладающих антиоксидантной активностью. Этот принцип положен в основу при производстве косметических средств.

В патенте US 8926965, было предложено использовать белок рекомбинантной супероксиддисмутазы-2, который является родственным белком по отношению к глутатионпероксидазе и значимым в такой же степени в аспекте снижения оксидативного стресса в клетках, тканях и органах.

В этом патенте было заявлено использование рекомбинантного модифицированного варианта супероксиддисмутазы-2, у которой за счет созданных мутаций в нуклеотидной последовательности произошли изменения аминокислотной структуры белка. Была показана ферментативная активность модифицированной супероксиддисмутазы-2. Было заявлено, что модифицированный пептид можно использовать для уменьшения оксидативного стресса и/или окислительного повреждения клетки как собственно лекарственное средство, так и в композиции с другими активными и вспомогательными компонентами.

Известно также использование в качестве лекарственных средств собственно белков - антиоксидантов.

Так в патенте US 6045809 для нейтрализации токсического действия активных форм кислорода было предложено использовать композиции фермента - антиоксиданта супероксиддисмутазы и, по крайней мере, одного из липидов (на примере керамидов) или белков (на примере проламинов). Новые фармацевтические композиции предназначены для перорального введения. Недостаток данного подхода состоит в том, что при данном методе введения желаемый терапевтический эффект может оказаться недостигнутым, а также - при недостаточной степени очистки возможны побочные реакции.

В патенте US 8916373 было предложено использовать рекомбинантные модифицированные варианты супероксиддисмутазы-1, у которых за счет созданных мутаций в нуклеотидной последовательности произошли изменения аминокислотной структуры белка (степень идентичности модифицированных вариантов белка и нативного белка не менее 80%). Рекомбинантными плазмидами были транфицированы культуры эмбриональных клеток почек человека (HEK клетки, линия HEK293FT) или эмбриональных фибробластов мыши (3T3s, линии NIH 3Т3), в которых наличие модифицированных белков определяли методом иммуноблоттинга, после чего определяли их ферментативную активность. Было выявлено, что активность некоторых вариантов увеличилась более чем в 3 раза по сравнению с белком дикого типа. Недостатком данного подхода является то, что внесение модификаций в аминокислотную последовательность природного белка может привести к образованию структур, являющихся антигенными детерминантами.

За прототип авторами было принято решение по заявке WO 1988007541 А1, в которой предлагается использовать белок рекомбинантной глутатионпероксидазы человека для снижения оксидативного стресса в клетках, тканях и органах. Глутатионпероксидаза катализирует процесс разложения пероксида водорода и органических перекисей с одновременным окислением глутатиона, что и придает этому ферменту первоочередное значение в антиоксидатной защите организма.

Этот белок является одним из немногих белков, известных у высших позвоночных, который содержит селеноцистеин, который находится в активном центре глутатионпероксидазы. Обнаружены несколько изоформ фермента, которые образуются в результате альтернативного сплайсинга. Глутатионпероксидаза формирует высокоактивный интермедиант - селеновую кислоту, селеновая кислота при этом защищена белковым окружением от активных групп внутри самого белка. Механизм действия глутатионпероксидазы базируется на реакции селеновой кислоты с амидами или аминами другого белка, формируя селеноамидные связи.

Продукт гена GPX является фактором в развитии ишемической болезни сердца. Недостаток этого фермента может способствовать возникновению повреждений в эндотелиальной выстилке сосудов, что может привести к преждевременному старению эритроцитов. Снижение активности гена GPX может приводить к формированию катаракты. Глутатионпероксидаза помогает предотвратить нарушение функции сердца в результате реперфузионного синдрома при ишемии. Глутатионпероксидаза человека может быть использована для терапии различных расстройств, обусловленных появлением пероксидов как продуктов метаболизма клетки.

Изобретение по прототипу предлагает способ синтеза глутатионпероксидазы человека в большом количестве с использованием методов рекомбинантной ДНК. В патенте представлен полинуклеотид, с последовательностью кДНК гена GPX человека. Последовательность полинуклеотида или его модифицированные формы были встроены в векторы для экспрессии в эукариотических клетках рекомбинантных продуктов: глутатионпероксидаза человека, фрагменты глутатионпероксидазы человека, аналоги глутатионпероксидазы человека и аналоги фрагментов глутатионпероксидазы человека. Эти рекомбинантные полипептидные продукты имеют потенциальную терапевтическую пользу. Кроме того, они могут быть использованы для получения моноклональных и поликлональных антител к продукту гена GPX человека. Данные антитела применимы для диагностики недостатка продукта гена GPX у человека. Кроме того, аналог глутатионпероксидазы человека, активные фрагменты глутатионпероксидазы человека и моноклональные антитела к глутатионпероксидазе человека могут применяться для определения взаимодействия фермента с различными субстратами на основе взамодействия фермента с гидрофильными и гидрофобными участками.

Недостатком данного подхода является высокая стоимость получения чистого рекомбинантного белка, более частое его введение при терапии (что увеличивает стоимость терапии и повышает риск побочных явлений) и сложность внутриклеточной доставки препарата. Кроме того, внесение модификаций в аминокислотную последовательность природного белка может привести к образованию структур, являющихся антигенными детерминантами. Также при создании терапевтического средства по прототипу не учтены индивидуальные характеристики пациента

Раскрытие изобретения

Задачей данного изобретения является создание линейки высокоэффективных биологически активных генно-терапевтических субстанций, способных препятствовать снижению антиоксидантной активности белка глутатионпероксидазы-1 в клетках органов и тканей и/или органах и тканях человека путем повышения уровня экспрессии гена GPX1 в клетках органов и тканей и/или органах и тканях человека, и/или повышения активности белка глутатионпероксидазы-1, ответственного за поддержание окислительно-восстановительного баланса в клетках органов и тканей и/или органах и тканях организма с учетом индивидуальных особенностей пациента.

Указанная задача решается за счет того, что создана линейка биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с оксидативным стрессом, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена GPX1 SEQ ID No:1 или одну из модифицированных кДНК гена GPX1, и содержащей также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, в частности в клетках органов и тканей человека и способную обеспечить высокий уровень экспрессии гена GPX1 и увеличить активность белка глутатионпероксидазы-1 в клетках органов и тканей и/или органах и тканях человека, в частности, в гемопоэтических клетках, или гепатоцитах, или мезенхимальных стволовых клетках, или хондробластах, или клетках поджелудочной железы (например, в клетках панкреатических островков), или миоцитах или фибробластах кожи, или кератоцитах, или эпителиальных клетках роговицы, или в нейронах, ганглиях, Шванновских клетках, астроцитах, олигодендроцитах, микроглии, или в сперматозоидах, или в нефронах, или эндотелиальных клетках, или эпителиальных клетках в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в коже, суставах, печени, надпочечниках, почках, головном и спинном мозге, легких, сердце, сосудах, желудочно-кишечном тракте, простате, поджелудочной железе, глазе, роговице, слизистой оболочке, хрящевой ткани, мышечной ткани в сочетании с транспортной молекулой или без нее при введении этих биологически активных генно-терапевтических субстанций в органы и ткани человека. При этом генетическая конструкция с кДНК гена GPX1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена GPX1, которая несет модификации не затрагивающие структуру белка глутатионпероксидазы-1, а именно: делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность. В качестве модифицированной кДНК гена GPX1 используют SEQ ID No:2. Или в качестве модифицированной кДНК гена GPX1 используют SEQ ID No:3. Или в качестве модифицированной кДНК гена GPX1 используют SEQ ID No:4. Или в качестве модифицированной кДНК гена GPX1 используют SEQ ID No:5. Или в качестве модифицированной кДНК гена GPX1 используют SEQ ID No:6. Или в качестве модифицированной кДНК гена GPX1 используют SEQ ID No:7. При этом в качестве транспортной молекулы используют липосомы или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры.

Способ получения биологически активной генно-терапевтической субстанции для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с оксидативным стрессом, заключающийся в том, что получают кДНК гена GPX1, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека.

Или способ получения биологически активной генно-терапевтической субстанции для коррекции патологических состояний клеток различных органов и тканей человека, связанных с оксидативным стрессом, заключающийся в том, что получают кДНК гена GPX1, модифицируют его по п.п. 3, или 4, или 5 или 6 или 7 или 8, затем помещают модифицированную кДНК в векторную конструкцию, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека.

Способ использования каждой из созданных и представленных в линейке биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с оксидативным стрессом, заключается в трансфекции созданной биологически активной генно-терапевтической субстанцией, выбранной из линейки с учетом индивидуальных особенностей каждого конкретного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, клеток органов и тканей человека.

Или способ использования каждой из созданных и представленных в линейке биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с оксидативным стрессом, заключается во введении одной из созданных биологически активных генно-терапевтической субстанций, выбранной из линейки именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, в органы и ткани этого пациента, и/или во введении аутологичных клеток пациента, трансфицированных одной из созданных биологически активных генно-терапевтической субстанций, выбранной именно для данного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в линейке биологически активных генно-терапевтических субстанций, в органы и ткани этого пациента.

Перечень фигур

На фиг. 1

Представлена нуклеотидная последовательность немодифицированной кДНК гена GPX1, последовательность которой идентична приводимой в базе даных GenBank под номером М_21304.1 SEQ ID No:1.

На фиг. 2

Представлена нуклеотидная последовательность модифицированной кДНК гена GPX1, SEQ ID No:2, которая

содержит 4 нуклеотидных замены G→C в позициях 80, 95, 191, 461, не приводящие к изменениям в аминокислотной последовательности белка глутатионпероксидазы-1.

На фиг. 3

Представлена нуклеотидная последовательность модифицированной кДНК гена GPX1, SEQ ID No:3, которая

содержит 8 нуклеотидных замен G→C в позициях 80, 95, 98, 104, 191, 395, 401, 461; 2 нуклеотидных замены A→G в позициях 152, 155, не приводящие к изменениям в аминокислотной последовательности белка глутатионпероксидазы-1.

На фиг. 4

Представлена нуклеотидная последовательность модифицированной кДНК гена GPX1, SEQ ID No:4, которая содержит 11 нуклеотидных замен G→C в позициях 62, 65, 80, 95, 98, 104, 191, 395, 401, 461, 497; 2 нуклеотидных замены A→G в позициях 152, 155, не приводящие к изменениям в аминокислотной последовательности белка глутатионпероксидазы-1.

На фиг. 5

Представлена нуклеотидная последовательность модифицированной кДНК гена GPX1, SEQ ID No:5, которая содержит 12 нуклеотидных замен G→C в позициях 62, 65, 80, 95, 98, 104, 173, 191, 395, 401, 461, 497; 3 нуклеотидных замены A→G в позициях 152, 155, 563, не приводящие к изменениям в аминокислотной последовательности белка глутатионпероксидазы-1.

На фиг. 6

Представлена нуклеотидная последовательность модифицированной кДНК гена GPX1, SEQ ID No:6, которая

содержит 14 нуклеотидных замен G→C в позициях 62, 65, 68, 71, 80, 95, 98, 104, 173, 191, 395, 401, 461, 497; 3 нуклеотидных замены A→G в позициях 152, 155, 563, не приводящие к изменениям в аминокислотной последовательности белка глутатионпероксидазы-1.

На фиг. 7

Представлена нуклеотидная последовательность модифицированной кДНК гена GPX1, SEQ ID No:7, которая

не содержит нетранслируемые 5' и 3' области гена и содержит 14 нуклеотидных замен G→C в позициях 62, 65, 68, 71, 80, 95, 98, 104, 173, 191, 395, 401, 461, 497; 3 нуклеотидных замены A→G в позициях 152, 155, 563, не приводящие к изменениям в аминокислотной последовательности белка глутатионпероксидазы-1.

На фиг. 8

С целью последующего корректного определения генно-терапевтического эффекта после трансфекции фибробластов биологически активной генно-терапевтической субстанции с кДНК гена GPX1 проводили анализ эндогенной экспрессии гена GPX1 в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена GPX1, фибробласты со сниженной экспрессией гена GPX1

2 - кДНК гена GPX1, фибробласты с нормальной экспрессией гена GPX1

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена GPX1

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена GPX1

В качестве референтного гена использовали ген В2М (Бета-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

На фиг. 9

С целью подтверждения увеличения экспрессии гена GPX1 в клеточной культуре фибробластов со сниженной экспрессией гена GPX1 при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена GPX1 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена GPX1 в фибробластах с нормальной экспрессией гена GPX1,

2 - кДНК гена GPX1 в фибробластах со сниженной экспрессией гена GPX1 до трансфекции БАГТС с кДНК гена GPX1.

3 - кДНК гена GPX1 в фибробластах со сниженной экспрессией гена GPX1 после трансфекции БАГТС с кДНК гена GPX1.

4 - кДНК гена GPX1 в фибробластах со сниженной экспрессией гена GPX1 после трансфекции вектором без кДНК гена GPX1.

5 - кДНК гена В2М в фибробластах с нормальной экспрессией гена GPX1.

6 - кДНК гена В2М в фибробластах со сниженной экспрессией гена GPX1 до трансфекции БАГТС с кДНК гена GPX1.

5 - кДНК гена В2М в фибробластах со сниженной экспрессией гена GPX1 после трансфекции БАГТС с кДНК гена GPX1.

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена GPX1 после трансфекции вектором без кДНК гена GPX1.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена GPX1 уровень кДНК гена GPX1 в фибробластах не изменился, а в случае трансфекции вектором с кДНК GPX1-уровень кДНК фибробластов со сниженной экспрессией гена GPX1 многократно увеличился (до уровня выше, чем уровень кДНК гена GPX1 в нормальных фибробластах).

На фиг. 10

С целью подтверждения увеличения активности белка глутатионпероксидазы-1 в клеточной культуре фибробластов с нормальной экспрессией гена GPX1 при трансфекции данных клеток биологически активной генно-терапевтической субстанцией содержащим кДНК GPX1 представлен график изменения активности белка глутатионпероксидазы-1 в зависимости от разведения клеточного лизата нетрансфицированных фибробластов (культура А), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК GPX1 (культура В) и трансфицированных биологически активной генно-терапевтической субстанцией на базе вектора pCDNA 3.1, содержащего GPX1 SEQ ID No:1 (культура С). Из графика следует, что при трансфекции фибробластов биологически активной генно-терапевтической субстанцией с кДНК гена GPX1 происходит увеличение активности глутатионпероксидазы-1 в клеточном лизате.

Обозначения:

культура А

культура В

культура С

На фиг. 11

С целью подтверждения увеличения активности глутатионпероксидазы-1 в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной биологически активной генно-терапевтической субстанцией представлен анализ изменения активности глутатионпероксидазы-1 в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (Б) и трансфицированные биологически активной генно-терапевтической субстанцией на базе pCMV6- GPX1 SEQ ID No:7 (С) - в кожу предплечья. Также анализировали активность глутатионпероксидазы-1 в интактной коже. Показано повышение активности глутатионпероксидазы-1 в коже пациента в области введения фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией кДНК гена GPX1. (С)

Обозначения:

культура А

культура В

культура С

контрольная биопсия

На фиг. 12

С целью подтверждения увеличения активности глутатионпероксидазы-1 до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток биологически активными генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена GPX1 в зависимости от наличия и типа в них той или иной модификации кДНК гена GPX1 представлен анализ изменения активности глутатионпероксидазы-1 в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена GPX1, используемой для трансфекции фибробластов.

Культуры фибробластов 19 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-GPX1 SEQ ID No:1, части (В) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-GPX1 SEQ ID No:2, части (С) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-GPX1 SEQ ID No:3, части (D) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-GPX1 SEQ ID No:4, части (Е) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-GPX1 SEQ ID No:5, части (F) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-GPX1 SEQ ID No:6, части (G) трансфицировали биологически активной генно-терапевтической субстанцией pCMV6-GPX1 SEQ ID No:7, части (Н) трансфицировали векторной плазмидой, не содержащей кДНК гена GPX1.

По итогам анализа уровня активности глутатионпероксидазы-1 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни активности глутатионпероксидазы-1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальная активность глутатионпероксидазы-1 наблюдалась при трансфекции pCMV6-GPX1 SEQ ID No:1,

в группе 2 максимальная активность глутатионпероксидазы-1 наблюдалась при трансфекции pCMV6-GPX1 SEQ ID No:2,

в группе 3 максимальная активность глутатионпероксидазы-1 наблюдалась при трансфекции pCMV6-GPX1 SEQ ID No:3,

в группе 4 максимальная активность глутатионпероксидазы-1 наблюдалась при трансфекции pCMV6-GPX1 SEQ ID No:4,

в группе 5 максимальная активность глутатионпероксидазы-1 наблюдалась при трансфекции pCMV6-GPX1 SEQ ID No:5,

в группе 6 максимальная активность глутатионпероксидазы-1 наблюдалась при трансфекции pCMV6-GPX1 SEQ ID No:6,

в группе 7 максимальная активность глутатионпероксидазы-1 наблюдалась при трансфекции pCMV6-GPX1 SEQ ID No:7.

Ни в одной из клеточных культур не наблюдалось того, что максимальная активность глутатионпероксидазы-1 присутствует при трансфекции вектором без вставки кДНК гена GPX1.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей ингибирования цветной реакции (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена GPX1

Из фигуры следует, что достижение максимальной активности глутатионпероксидазы-1 в культурах фибробластов кожи различных пациентов при их трансфекции биологически активными генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена GPX1, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных БАГТС GPX1 SEQ ID No:1 (A)

части клеточных культур, трансфицированных БАГТС GPX1 SEQ ID No:2 (В)

части клеточных культур, трансфицированных БАГТС GPX1 SEQ ID No:3 (С)

части клеточных культур, трансфицированных БАГТС GPX1 SEQ ID No:4 (D)

части клеточных культур, трансфицированных БАГТС GPX1 SEQ ID No:5 (E)

части клеточных культур, трансфицированных БАГТС GPX1 SEQ ID No:6 (F)

части клеточных культур, трансфицированных БАГТС GPX1 SEQ ID No:7 (G)

части клеточных культур, трансфицированных плацебо (Н)

На фиг. 13

С целью подтверждения увеличения экспрессии гена GPX1 в клеточной культуре кератоцитов и эпителиальных клеток глаза при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена GPX1 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена GPX1, кератоциты до трансфекции

2 - кДНК гена GPX1, эпителий роговицы до трансфекции

3 - кДНК гена GPX1, кератоциты после трансфекции

4 - кДНК гена GPX1, эпителий роговицы после трансфекции

5 - кДНК гена В2М, кератоциты до трансфекции

6 - кДНК гена В2М, эпителий роговицы до трансфекции

7 - кДНК гена В2М, кератоциты после трансфекции

6 - кДНК гена В2М, эпителий роговицы после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена GPX1 в культуре кератоцитов и в культуре эпителия многократно вырос.

На фиг. 14

С целью подтверждения увеличения экспрессии гена GPX1 в клеточной культуре хондробластов при трансфекции данных клеток биологически активной генно-терапевтической субстанцией с кДНК гена GPX1 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена GPX1, до трансфекции

2 - кДНК гена GPX1, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена GPX1 вырос многократно.

На фиг. 15

С целью подтверждения увеличения активности глутатионпероксидазы-1 в коже человека при введении в кожу биологически активной генно-терапевтической субстанции представлен анализ изменения активности глутатионпероксидазы-1 в коже. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена GPX1 pCMV6-GPX1 SEQ ID No:4 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена GPX1 с транспортной молекулой (А) - в кожу предплечья. Показано увеличение активности глутатионпероксидазы-1 в биоптате кожи пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена GPX1, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения БАГТС

На фиг. 16

С целью подтверждения увеличения активности глутатионпероксидазы-1 в слизистой оболочке рта человека при введении в слизистую оболочку рта биологически активной генно-терапевтической субстанции представлен анализ изменения активности глутатионпероксидазы-1 в слизистой оболочке рта. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена GPX1 pCDNA 3.1 GPX1 SEQ ID No:5 (В) и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена GPX1 с транспортной молекулой (А) - в слизистую оболочку рта.

Показано увеличение активности глутатионпероксидазы-1 в лизате биоптата слизистой оболочки рта пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена GPX1, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения БАГТС

На фиг. 17

С целью подтверждения увеличения активности глутатионпероксидазы-1 в мышечной ткани человека при введении в мышечную ткань биологически активной генно-терапевтической субстанции представлен анализ изменения активности глутатионпероксидазы-1 в мышечной ткани. При этом пациенту вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена GPX1 - pCMV6-Kan/Neo GPX1 SEQ ID No:6 (В) и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена GPX1 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение активности глутатионпероксидазы-1 в биоптате мышечной ткани пациента 1В, которому вводились биологически активная генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена GPX1, что говорит об эффективности биологически активной генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения БАГТС

На фиг. 18

С целью подтверждения увеличения активности глутатионпероксидазы-1 до различного индивидуального уровня при введении в кожу пациентов биологически активных генно-терапевтических субстанций с модифицированными и нативной кДНК гена GPX1 анализировали уровень активности глутатионпероксидазы-1 в коже человека в зависимости от наличия и типа модификаций в кДНК гена GPX1.

Каждому из 16-ти пациентов, отобранных в случайном порядке, вводили в кожу предплечья 7 биологически активных генно-терапевтических субстанций pCMV6- SEQ ID No:1, pCMV6- SEQ ID No:2, pCMV6- SEQ ID No:3, pCMV6- SEQ ID No:4, pCMV6- SEQ ID No:5, pCMV6- SEQ ID No:6, pCMV6- SEQ ID No:7, и плацебо pCMV6- XL5.

По итогам анализа уровня активности глутатионпероксидазы-1 в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни активности глутатионпероксидазы-1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальная активность глутатионпероксидазы-1 наблюдалась при введении pCMV6-GPX1 SEQ ID No:1.

В группе 2 максимальная активность глутатионпероксидазы-1 наблюдалась при введении pCMV6-GPX1 SEQ ID No:2.

В группе 3 максимальная активность глутатионпероксидазы-1 наблюдалась при введении pCMV6-GPX1 SEQ ID No:3.

В группе 4 максимальная активность глутатионпероксидазы-1 наблюдалась при введении pCMV6-GPX1 SEQ ID No:4.

В группе 5 максимальная активность глутатионпероксидазы-1 наблюдалась при введении pCMV6-GPX1 SEQ ID No:5.

В группе 6 максимальная активность глутатионпероксидазы-1 наблюдалась при введении pCMV6-GPX1 SEQ ID No:6.

В группе 7 максимальная активность глутатионпероксидазы-1 наблюдалась при введении pCMV6-GPX1 SEQ ID No:7.

Ни в одном из биоптатов не наблюдалось того, что максимальная активность глутатионпероксидазы-1 присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей ингибирования цветной реакции (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена GPX1.

Из данного примера следует, что достижение максимальной активности глутатионпероксидазы-1 в биоптатах кожи различных пациентов при введении им в кожу биологически активных генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена GPX1, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента.

Обозначения:

биопаты пациентов после введения БАГТС GPX1 SEQ ID No:1 (A)

биопаты пациентов после введения БАГТС GPX1 SEQ ID No:2 (В)

биопаты пациентов после введения БАГТС GPX1 SEQ ID No:3 (С)

биопаты пациентов после введения БАГТС GPX1 SEQ ID No:4 (D)

биопаты пациентов после введения БАГТС GPX1 SEQ ID No:5 (E)

биопаты пациентов после введения БАГТС GPX1 SEQ ID No:6 (F)

биопаты пациентов после введения БАГТС GPX1 SEQ ID No:7 (G)

биопаты пациентов после введения плацебо (Н)

На фиг. 19

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали активность глутатионпероксидазы-1 в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими нативную или модифицированные кДНК гена GPX1.

По итогам анализа активности глутатионпероксидазы-1 в культуре фибробластов пациента выделили вариант биологически активной генно-терапевтической субстанции, при трансфекции которой происходит максимальное ингибирование в лизате клеточной культуры и соответственно наблюдается максимальная активность глутатионпероксидазы-1. В данном эксперименте максимальное ингибирование в лизате наблюдается при трансфекции биологически активной генно-терапевтической субстанцией на базе pCMV6 GPX1 SEQ ID No:7, содержащей модифицированную кДНК GPX1, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Обозначения:

1 - клеточный лизат после трансфекции БАГТС GPX1 SEQ ID No:1 (A)

2 - клеточный лизат после трансфекции БАГТС GPX1 SEQ ID No:2 (В)

3 - клеточный лизат после трансфекции БАГТС GPX1 SEQ ID No:1 (С)

4 - клеточный лизат после трансфекции БАГТС GPX1 SEQ ID No:4 (D)

5 - клеточный лизат после трансфекции БАГТС GPX1 SEQ ID No:5 (E)

6 - клеточный лизат после трансфекции БАГТС GPX1 SEQ ID No:6 (F)

7 - клеточный лизат после трансфекции БАГТС GPX1 SEQ ID No:7 (G)

8 - клеточный лизат после трансфекции плацебо (Н)

На фиг. 20

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали активность глутатионпероксидазы-1 в лизатах биоптатов кожи этого пациента, после введения ему биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена GPX1.

По итогам анализа активности глутатионпероксидазы-1 в лизате биоптатов кожи пациента выделили вариант биологически активной генно-терапевтической субстанции, при введении которой происходит максимальное ингибирование в лизате биоптата кожи и соответственно наблюдается максимальная активность глутатионпероксидазы-1. В данном эксперименте максимальное ингибирование в лизате отмечено при введении биологически активной генно-терапевтической субстанции на базе pCMV6 GPX1 SEQ ID No:3, содержащей модифицированную кДНК GPX1, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения БАГТС GPX1 SEQ ID No:1 (А)

2 - лизат биоптата после введения БАГТС GPX1 SEQ ID No:2 (B)

3 - лизат биоптата после введения БАГТС GPX1 SEQ ID No:3 (C)

4 - лизат биоптата после введения БАГТС GPX1 SEQ ID No:4 (D)

5 - лизат биоптата после введения БАГТС GPX1 SEQ ID No:5 (Е)

6 - лизат биоптата после введения БАГТС GPX1 SEQ ID No:6 (F)

7 - лизат биоптата после введения БАГТС GPX1 SEQ ID No:7 (G)

8 - лизат биоптата после введения плацебо (Н)

Реализация изобретения.

При снижении экспрессии генов, кодирующих белки окислительно-восстановительного баланса, например гена GPX1, происходит снижение антиоксидантной активности белка в организме.

У нокаутных мышей по GPX1 гену наблюдается увеличение продукции форм активного кислорода по сравнению с диким типом, и повышенная чувствительность к агентам оксидативного стресса, пероксиду водорода, склонность к развитию реперфузионного синдрома, и холодовым повреждениям мозга. А также повышенный уровень окислительного повреждения мтДНК, структурные аномалии в миоцитах и митохондриях сердца. Предполагается, что GPX1 играет важную роль в защите митохондрий сердца от повреждений при реоксигенации in vivo. У мутантов также наблюдали брадикинин-индуцированную вазоконстрикцию. Отсутствие GPX1 аллеля у трансгенных мышей усиливает определенные аспекты старения, а именно уровень эндотелиальной дисфункции, ремоделирования сосудов, и инвазии лейкоцитов в сердечно-сосудистые ткани.

[PMID: 12429206], [PMID: 11579147], [PMID: 14732290], [PMID: 10754271], [PMID: 18760274]

Преимущества использования генетической конструкции с геном GPX1 для коррекции уровня активности белка глутатионпероксидазы-1 в клетках органов и тканей человека, по сравнению с использованием белка рекомбинантной глутатионпероксидазы человека, решение по заявке WO 1988007541 (прототип) следующие:

1) легче обеспечить более высокий и стабильный уровень белка в клетках,

2) не требуется сложная и дорогостоящая процедура рефолдинга и очистки белкового препарата,

3) обеспечивается транспортировка биологически активной генно-терапевтической субстанции в больший спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка биологически активной генно-терапевтической субстанции.

4) учтены индивидуальные особенности пациентов.

Таким образом, для создания линейки биологически активных генно-терапевтических субстанций по данному изобретению был выбран ген GPX1, а не белок, кодируемый этим геном.

Для получения линейки биологически активных генно-терапевтических субстанций осуществляют следующие действия:

1. Получение нативной кДНК гена GPX1, содержащей белок-кодирующую область гена GPX1, клонирование ее в промежуточную плазмиду для дальнейших модификаций этой кДНК

2. Внесение в последовательность нуклеотидов кДНК гена GPX1 модификаций с целью создания линейки кДНК гена GPX1, обеспечивающих достаточный для борьбы с оксидативным стрессом уровень трансляции белка глутатионпероксидазы-1.

3. Клонирование нативной и модифицированных кДНК гена GPX1 в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E. coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение линейки генетических конструкций, содержащих модифицированные и нативную кДНК гена GPX1 для создания на ее базе линейки биологически активных генно-терапевтических субстанций.

6. Создание линейки биологически активных генно-терапевтических субстанций, каждая из которых включает генетическую конструкцию с модифицированной или нативной кДНК гена GPX1, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных биологически активных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена GPX1, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, и анализ транскрипции гена GPX1 из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, биологически активными генно-терапевтическими субстанциями содержащими нативную и/или модифицированные кДНК гена GPX1 и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена GPX1 в различных комбинациях.

D) Сравнительный анализ изменения уровня кДНК и/или изменения активности белка глутатионпероксидазы-1, после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, биологически активными генно-терапевтическими субстанциями содержащими нативную и/или модифицированные кДНК гена GPX1 и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена GPX1. Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента биологически активной генно-терапевтической субстанции.

Е) Введение пациентам в органы и ткани культуры клеток с кДНК гена GPX1, например, введение, в кожу человека, аутологичных фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией с кДНК гена GPX1 и параллельное введение пациентам в органы и ткани, например, в кожу культур этих же клеток не трансфицированных и трансфицированных вектором без вставки кДНК гена GPX1 и/или введение пациентам в органы и ткани биологически активных генно-терапевтических субстанций, например, введение в кожу человека биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК GPX1, а также плацебо в различных комбинациях.

F) Сравнительный анализ активности белка глутатионпероксидазы-1 в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных биологически активными генно-терапевтическими субстанциями, содержащими кДНК гена GPX1 и векторными плазмидами, не содержащими кДНК гена GPX1 и/или биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена GPX1, а также плацебо.

G) Введение пациентам в органы и ткани, например, слизистую оболочку рта, или мышечную ткань биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК гена GPX1, а также плацебо.

Н) Сравнительный анализ активности белка глутатионпероксидазы-1 в органах и тканях человека, в частности в слизистой оболочке рта, или мышечной ткани человека, после введения биологически активных генно-терапевтических субстанций, содержащих нативную и/или модифицированные кДНК GPX1 а также плацебо.

I) Введение пациентам в органы и ткани, например, введение в кожу пациента биологически активных генно-терапевтических субстанций, содержащих нативную и модифицированные кДНК гена GPX1.

J) Сравнительный анализ изменения активности белка глутатионпероксидазы-1 в органах и тканях пациента, в частности в коже, после введения биологически активных генно-терапевтических субстанций, содержащих нативную и модифицированные кДНК гена GPX1. Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций.

Пример 1.

Получение нативной (немодифицированной) кДНК гена GPX1.

Немодифицированная кДНК гена GPX1 представляет собой последовательность нуклеотидов, идентичную приводимой в базе даных GenBank под номером М_21304.1; нуклеотиды с 42 по 647 транслируются в аминокислотную последовательность, соответствующую приведенной в GenBank под номером ААА75389.2.

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) ииспользуют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно кинированные праймеры, комплементарные нуклеотидам 13-32 5' GCTCCGCTGGCTTCTTGGAC 3' (GPX1 F1) и 673-654 5' CAAGCAGCCGGGGTAGGAGG 3' (GPX1 R1) из последовательности мРНК GPX1 (GenBank M_21304.1), получают кДНК GPX1. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами. ПЦР проводят с помощью амплификатора Master CyderGradient (Eppendorf, USA) в 50 мкл. реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера GPX1 F1 и GPX1 R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (рН 8,85 при 20°С), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific, USA) при следующих условиях: первоначальная денатурация при +98°С в течение 30 сек., 35 циклов, включающих денатурацию при +98°С в течение 10 сек., отжиг праймеров при +64°С в течение 30 сек. и элонгацию при +68°С в течение 90 секунд.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany)

Амплифицированный фрагмент кДНК, несущий ген GPX1, клонируют в плазмидном векторе pUC19 (NEB, USA, кат номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, кат. номep N3041S) гидролизуют рестриктазой SmaI (NEB, USA), (или другой рестриктазой, дающей тупые концы) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага Т4 400000 ед./ мл. (NEB, USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис -HCl, рН 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°С.

Полученной смесью трансформируют компетентные клетки Е.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки Петри с L-агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами GPX1 F1 и GPX1 R1 и подтверждают секвенированием по методу Сэнгера, которое показывает наличие клонов с разной ориентацией целевого гена: SacI -5'NTR-кДНК GPX1-3'NTRHindIII и HindIII--5'NTRкДНК GPX1-3'NTR-SacI

Полученная таким образом клонированная частичная (с 13 по 673 н.п) нативная (немодифицированная) последовательность гена GPX1 длиной 661 н.п. в плазмиде pUC19-GPX1 SEQ ID No:1 имеет первичную структуру, приведенную на фиг. 1.

Пример 2.

Получение модифицированных кДНК гена GPX1.

Модификации проводят таким образом, чтобы не затрагивать первичную структуру белка глутадионпероксидазы-1, а именно, делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей, или нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности для получения линейки кДНК гена GPX1 с целью повышения эффективности транскрипции и трансляции глутадионпероксидазы-1 в клетках тканей и органов человека в нативную последовательность кДНК GPX1, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные, а также проводят делеции 5' нетранслируемых областей или делеции 3'-нетранслируемых областей таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChange II XL kit или QuikChange Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA,) согласно рекомендациям производителя.

http://www.agilent.com/cs/library/usermanuals/Public/200513.

К плазмидной ДНК pUC 19-GPX1 SEQ ID No:1 по Примеру 1 (вариант pUC 19-GPX1 SEQ ID No 1 с ориентацией целевого гена SacI -5'NTR-кДНК GPX1-3'NTRHindIII и вариант pUC 19-GPX1 SEQ ID No 1 с ориентацией целевого гена HindIII--5'NTR- кДНК GPX1-3'NTR- SacI) в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 25-45 н.п. и проводят ПЦР в буфере QuikChange Multi reaction buffer (AgilentTechnologies, USA) со смесью ферментов QuikChange Multi mix (AgilentTechnologies, USA) при следующих условиях: 95°С, 1 мин; далее от 30 до 35 циклов : 95°С 1 минута, 55°С 1 минута, 65°С 2 минуты/1000 н.п. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°С. Полученной смесью трансформируют компетентные клетки E.coliTop10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L-агаром, содержащих 100 мкг/мл ампициллина. Трансформированнные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК GPX1 SEQ ID No:2 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК GPX1 SEQ ID No:1 (вариант pUC 19-GPX1 SEQ ID No:1 с ориентацией целевого гена SacI -5'NTR-кДНК GPX1-3'NTRHindIII и вариант pUC 19-GPX1 SEQ ID No:1 сориентацией целевого гена HindIII--5'NTR- кДНК GPX1-3'NTR- SacI), используемой в качестве матрицы:

1. GPX1 71-108 F:

5' GGCCCAGTCCGTGTATGCCTTCTCCGCGCGCCCGTTGG 3',

Комплементарный нуклеотидам 71-108, с заменами G→C в позициях 80 и 95;

2. GPX1 179-204 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 179-204, с заменой G→C в позиции 191;

3. GPX1 443-472 F:

5' CAGCGACGACGCCACCGCCCTTATGACCGA 3',

Комплементарный нуклеотидам 443-472, с заменой G→C в позиции 461.

Модифицированная таким образом нуклеотидная последовательность кДНК GPX1 SEQ ID No:2 содержит 4 нуклеотидных замены G→C в позициях 80, 95, 191, 461, не приводящие к изменениям в аминокислотной последовательности белка глутадионпероксидазы-1 и имеет первичную структуру, приведенную на фиг. 2.

Для получения модифицированной кДНК GPX1 SEQ ID No:3 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК GPX1 SEQ ID No:1 (вариант pUC 19-GPX1 SEQ ID No:1 с ориентацией целевого гена SacI -5'NTR-кДНК GPX1-3'NTRHindIII и вариант pUC 19-GPX1 SEQ ID No:1 сориентацией целевого гена HindIII--5'NTR- кДНК GPX1-3'NTR- SacI), используемой в качестве матрицы:

1. GPX1 71-108 F:

5' GGCCCAGTCCGTGTATGCCTTCTCCGCGCGCCCGTTGG 3',

Комплементарный нуклеотидам 71-108, с заменами G→C в позициях 80 и 95;

2. GPX1 179-204 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 179-204, с заменой G→C в позиции 191;

3. GPX1 443-472 F:

5' CAGCGACGACGCCACCGCCCTTATGACCGA 3',

Комплементарный нуклеотидам 443-472, с заменой G→C в позиции 461.

4. GPX185-119 F:

5' ATGCCTTCTCCGCGCCCCCCTTGGCCGGCGGGGAG 3',

Комплементарный нуклеотидам 85-119, с заменами G→C в позициях 95, 98 и 104;

5. GPX1 142-166 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 142-166, с заменами A→G в позициях 152, 155;

6. GPX1 381-404 F:

5' GAGGTGAACGGTGCCGGGGCCCACCCTCTCTTCG 3',

Комплементарный нуклеотидам 381-404, с заменами G→C в позициях 395, 401.

Модифицированная таким образом нуклеотидная последовательность кДНК GPX1 SEQ ID No 3 содержит 8 нуклеотидных замен G→C в позициях 80, 95, 98, 104, 191, 395, 401, 461; 2 нуклеотидных замены A→G в позициях 152, 155, не приводящие к изменениям в аминокислотной последовательности белка глутадионпероксидазы-1 и имеет первичную структуру, приведенную на фиг 3.

Для получения модифицированной кДНК GPX1 SEQ ID No:4 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК GPX1 SEQ ID No:1 (вариант pUC 19-GPX1 SEQ ID No:1 с ориентацией целевого гена SacI -5'NTR-кДНК GPX1-3'NTRHindIII и вариант pUC 19-GPX1 SEQ ID No:1 сориентацией целевого гена HindlII--5'NTR- кДНК GPX1-3'NTR- SacI), используемой в качестве матрицы:

1. GPX1 71-108 F:

5' GGCCCAGTCCGTGTATGCCTTCTCCGCGCGCCCGTTGG 3',

Комплементарный нуклеотидам 71-108, с заменами G→C в позициях 80 и 95;

2. GPX1 179-204 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 179-204, с заменой G→C в позиции 191;

3. GPX1 443-472 F:

5' CAGCGACGACGCCACCGCCCTTATGACCGA 3',

Комплементарный нуклеотидам 443-472, с заменой G→C в позиции 461.

4. GPX1 85-119 F:

5' ATGCCTTCTCCGCGCCCCCCTTGGCCGGCGGGGAG 3',

Комплементарный нуклеотидам 85-119, с заменами G→C в позициях 95, 98 и 104;

5. GPX1 142-166 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 142-166, с заменами A→G в позициях 152, 155;

6. GPX1 381-404 F:

5' GAGGTGAACGGTGCCGGGGCCCACCCTCTCTTCG 3',

Комплементарный нуклеотидам 381-404, с заменами G→C в позициях 395, 401.

7. GPX1 48-79 F:

5' GCTGCTCGGCTAGCCGCCGCGGCGGCCCAGTC 3',

Комплементарный нуклеотидам 48-79, с заменами G→C в позициях 62, 65;

8. GPX1 485-511 F:

5' CACCTGGTCTCCCGTGTGTCGCAACGA 3',

Комплементарный нуклеотидам 485-511, с заменой G→C в позиции 497.

Модифицированная таким образом нуклеотидная последовательность кДНК GPX1 SEQ ID No:4 содержит 11 нуклеотидных замен G→C в позициях 62, 65, 80, 95, 98, 104, 191, 395, 401, 461, 497; 2 нуклеотидных замены A→G в позициях 152, 155, не приводящие к изменениям в аминокислотной последовательности белка глутадионпероксидазы-1 и имеет первичную структуру, приведенную на фиг. 4.

Для получения модифицированной кДНК GPX1 SEQ ID No:5 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК GPX1 SEQ ID No:1 (вариант pUC 19-GPX1 SEQ ID No:1 с ориентацией целевого гена SacI -5'NTR-кДНК GPX1-3'NTRHindIII и вариант pUC 19-GPX1 SEQ ID No:1 сориентацией целевого гена HindIII--5'NTR- кДНК GPX1-3'NTR- SacI), используемой в качестве матрицы:

1. GPX1 71-108 F:

5' GGCCCAGTCCGTGTATGCCTTCTCCGCGCGCCCGTTGG 3',

Комплементарный нуклеотидам 71-108, с заменами G→C в позициях 80 и 95;

2. GPX1 179-204 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 179-204, с заменой G→C в позиции 191;

3. GPX1 443-472 F:

5' CAGCGACGACGCCACCGCCCTTATGACCGA 3',

Комплементарный нуклеотидам 443-472, с заменой G→C в позиции 461.

4. GPX1 85-119 F:

5' ATGCCTTCTCCGCGCCCCCCTTGGCCGGCGGGGAG 3',

Комплементарный нуклеотидам 85-119, с заменами G→C в позициях 95, 98 и 104;

5. GPX1 142-166 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 142-166, с заменами A→G в позициях 152, 155;

6. GPX1 381-404 F:

5' GAGGTGAACGGTGCCGGGGCCCACCCTCTCTTCG 3',

Комплементарный нуклеотидам 381-404, с заменами G→C в позициях 395, 401.

7. GPX1 48-79 F:

5' GCTGCTCGGCTAGCCGCCGCGGCGGCCCAGTC 3',

Комплементарный нуклеотидам 48-79, с заменами G→C в позициях 62, 65;

8. GPX1 485-511 F:

5' CACCTGGTCTCCCGTGTGTCGCAACGA 3',

Комплементарный нуклеотидам 485-511, с заменой G→C в позиции 497.

9. GPX1 162-184 F:

5' GAGAATGTGGCCTCCCTCTGAGG 3',

Комплементарный нуклеотидам 162-184, с заменой G→C в позиции 173;

10. GPX1 551-580 F:

5' CGGTGTGCCCCTGCGCAGGTACAGCCGCCG 3',

Комплементарный нуклеотидам 551-580, с заменой A→G в позиции 563.

Модифицированная таким образом нуклеотидная последовательность кДНК GPX1 SEQ ID No:5 содержит 12 нуклеотидных замен G→C в позициях 62, 65, 80, 95, 98, 104, 173, 191, 395, 401, 461, 497; 3 нуклеотидных замены A→G в позициях 152, 155, 563, не приводящие к изменениям в аминокислотной последовательности белка глутадионпероксидазы-1 и имеет первичную структуру, приведенную на фиг 5.

Для получения модифицированной кДНК GPX1 SEQ ID No:6 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК GPX1 SEQ ID No:1 (вариант pUC 19-GPX1 SEQ ID No:1 с ориентацией целевого гена SacI -5'NTR-кДНК GPX1-3'NTRHindIII и вариант pUC 19-GPX1 SEQ ID No:1 сориентацией целевого гена HindIII--5'NTR- кДНК GPX1-3'NTR- SacI), используемой в качестве матрицы:

1. GPX1 71-108 F:

5' GGCCCAGTCCGTGTATGCCTTCTCCGCGCGCCCGTTGG 3',

Комплементарный нуклеотидам 71-108, с заменами G→C в позициях 80 и 95;

2. GPX1 179-204 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 179-204, с заменой G→C в позиции 191;

3. GPX1 443-472 F:

5' CAGCGACGACGCCACCGCCCTTATGACCGA 3',

Комплементарный нуклеотидам 443-472, с заменой G→C в позиции 461.

4. GPX1 85-119 F:

5' ATGCCTTCTCCGCGCCCCCCTTGGCCGGCGGGGAG 3',

Комплементарный нуклеотидам 85-119, с заменами G→C в позициях 95, 98 и 104;

5. GPX1 142-166 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 142-166, с заменами A→G в позициях 152, 155;

6. GPX1 381-404 F:

5' GAGGTGAACGGTGCCGGGGCCCACCCTCTCTTCG 3',

Комплементарный нуклеотидам 381-404, с заменами G→C в позициях 395, 401.

7. GPX1 48-79 F:

5' GCTGCTCGGCTAGCCGCCGCGGCGGCCCAGTC 3',

Комплементарный нуклеотидам 48-79, с заменами G→C в позициях 62, 65;

8. GPX1 485-511 F:

5' CACCTGGTCTCCCGTGTGTCGCAACGA 3',

Комплементарный нуклеотидам 485-511, с заменой G→C в позиции 497.

9. GPX1 162-184 F:

5' GAGAATGTGGCCTCCCTCTGAGG 3',

Комплементарный нуклеотидам 162-184, с заменой G→C в позиции 173;

10. GPX1 551-580 F:

5' CGGTGTGCCCCTGCGCAGGTACAGCCGCCG 3',

Комплементарный нуклеотидам 551-580, с заменой A→G в позиции 563.

11.GPX1 51-87 F:

5' GCTCGGCTAGCCGCCGCCGCCGCCCAGTCCGTGTATG 3',

Комплементарный нуклеотидам 51-87, с заменами G→C в позициях 68, 71 и G→C в позициях 62, 65, 80.

Модифицированная таким образом нуклеотидная последовательность кДНК GPX1 SEQ ID No:6 содержит 14 нуклеотидных замен G→C в позициях 62, 65, 68, 71, 80, 95, 98, 104, 173, 191, 395, 401, 461, 497; 3 нуклеотидных замены A→G в позициях 152, 155, 563, не приводящие к изменениям в аминокислотной последовательности белка глутадионпероксидазы-1 и имеет первичную структуру, приведенную на фиг 6.

Для получения модифицированной кДНК GPX1 SEQ ID No:7 проводят последовательный ПЦР-мутагенез с праймерами, комплементарными участкам нативной кДНК GPX1 SEQ ID No:1 (вариант pUC 19-GPX1 SEQ ID No:1 с ориентацией целевого гена SacI -5'NTR-кДНК GPX1-3'NTRHindIII и вариант pUC 19-GPX1 SEQ ID No:1 сориентацией целевого гена HindIII--5'NTR- кДНК GPX1-3'NTR- SacI), используемой в качестве матрицы:

1. GPX1 71-108 F:

5' GGCCCAGTCCGTGTATGCCTTCTCCGCGCGCCCGTTGG 3',

Комплементарный нуклеотидам 71-108, с заменами G→C в позициях 80 и 95;

2. GPX1 179-204 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 179-204, с заменой G→C в позиции 191;

3. GPX1 443-472 F:

5' CAGCGACGACGCCACCGCCCTTATGACCGA 3',

Комплементарный нуклеотидам 443-472, с заменой G→C в позиции 461.

4. GPX1 85-119 F:

5' ATGCCTTCTCCGCGCCCCCCTTGGCCGGCGGGGAG 3',

Комплементарный нуклеотидам 85-119, с заменами G→C в позициях 95, 98 и 104;

5. GPX1 142-166 F:

5' CTGAGGCACCACCGTCCGGGACTACA 3',

Комплементарный нуклеотидам 142-166, с заменами A→G в позициях 152, 155;

6. GPX1 381-404 F:

5' GAGGTGAACGGTGCCGGGGCCCACCCTCTCTTCG 3',

Комплементарный нуклеотидам 381-404, с заменами G→C в позициях 395, 401.

11. GPX1 48-79 F:

5' GCTGCTCGGCTAGCCGCCGCGGCGGCCCAGTC 3',

Комплементарный нуклеотидам 48-79, с заменами G→C в позициях 62, 65;

12. GPX1 485-511 F:

5' CACCTGGTCTCCCGTGTGTCGCAACGA 3',

Комплементарный нуклеотидам 485-511, с заменой G→C в позиции 497.

13. GPX1 162-184 F:

5' GAGAATGTGGCCTCCCTCTGAGG 3',

Комплементарный нуклеотидам 162-184, с заменой G→C в позиции 173;

14. GPX1 551-580 F:

5' CGGTGTGCCCCTGCGCAGGTACAGCCGCCG 3',

Комплементарный нуклеотидам 551-580, с заменой А→G в позиции 563.

22. GPX1 51-87 F:

5' GCTCGGCTAGCCGCCGCCGCCGCCCAGTCCGTGTATG 3',

Комплементарный нуклеотидам 51-87, с заменами G→C в позициях 68, 71 и G→C в позициях 62, 65, 80.

23. а также для удаления 5' -нетранслируемой области гена GPX1 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером:

5' GACTCTAGAGGATCCCCGCCACCATGTGTGCTGCTCGGCT

AG 3'

для варианта с ориентацией целевого гена HindIII--5'NTR-кДНК GPX1-3'NTR-SacI

24. а также для удаления 3' -нетранслируемой области гена GPX1 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером:

5' AAGGGCCCAGCTGTGCCTAGGGGTACCGAGCTCGAATTCACT

GG 3'

для варианта с ориентацией целевого гена HindIII--5'NTR-кДНК GPX1-3'NTR-SacI

25. а также для удаления 5' -нетранслируемой области гена GPX1 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером:

5' GAATTCGAGCTCGGTACCCGCCACCATGTGTGCT

GCTCGGCTAG 3'

для варианта с ориентацией целевого гена SacI-5'NTR-кДНК GPX1-3'NTRHindIII

26. а также для удаления 3' -нетранслируемой области гена GPX1 из последовательности с внесенными заменами с помощью ПЦР мутагенеза с праймером:

5' AAGGGCCCAGCTGTGCCTAGGGGGATCCTCTAGAG

TCGACCTG 3'

для варианта с ориентацией целевого гена SacI -5'NTR-кДНК GPX1-3'NTRHindIII

Модифицированная таким образом нуклеотидная последовательность кДНК GPX1 SEQ ID No:7, не содержит нетранслируемые 5' и 3' области гена и содержит 14 нуклеотидных замен G→C в позициях 62, 65, 68, 71, 80, 95, 98, 104, 173, 191, 395, 401, 461, 497; 3 нуклеотидных замены A→G в позициях 152, 155, 563, не приводящие к изменениям в аминокислотной последовательности белка глутадионпероксидазы-1 и имеет первичную структуру, приведенную на фиг 7.

Таким образом, получают линейку из 7 векторов на базе плазмиды pUC19, в которой клонированы кодирующие нативная и модифицированные нуклеотидные последовательности гена GPX1, (при этом каждый вектор из линейки получен в двух вариантах и содержит целевой ген с ориентацией SacI -5'NTR-кДНК GPX1-3'NTRHindIII и целевой ген с ориентацией HindIII--5'NTR- кДНК GPX1-3'NTR- SacI для создания генетических экспрессионных конструкций на базе разных векторов) для создания линейки биологически активных генно-терапевтических субстанций.

Пример 3.

Создание генетических конструкций с модифицированными и нативной кДНК гена GPX1 для получения на их базе биологически активных генно-терапевтических субстанций.

Для экспрессии кДНК гена GPX1 в клетках органов и тканей человека полученные варианты кДНК GPX1 по Примеру 1 и Примеру 2 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E. coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции;

3) в векторе должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) наличие удобного полилинкера для клонирования. Примером такой плазмиды может быть pCMV6-XL5, pCMV6-Kan/Neo (OriGene, USA) или pCDNA 3.1(+) (ThermoFisherScientific, USA).

При клонировании кДНК гена GPX1 в pCDNA 3.1(+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину. При клонировании учитывают последовательность расположения сайтов HindIII и SacI в полилинкере pCDNA 3.1(+) и поэтому для клонирования в данный вектор используют HindIII-5'NTR-кДНК GPX1-3'NTR- SacI ориентированный фрагмент в pUC19 по примеру 1.

При клонировании кДНК гена GPX1 в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину. При клонировании учитывают последовательность расположения сайтов SacI и HindIII в полилинкере pCMV6-XL5 (pCMV6-Kan/Neo) и поэтому для клонирования в данный вектор используют SacI -5'NTR-кДНК GPX1-3'NTR- HindIII ориентированный фрагмент в pUC19 по примеру 1.

Векторные плазмиды pUC19-GPX1 SEQ ID No:1 с частичной нативной (немодифицированной) последовательностью гена GPX1 (с 13 по 673 н.п.), pUC19-GPX1 SEQ ID No:2, pUC19-GPX1 SEQ ID No:3, pUC19-GPX1 SEQ ID No:4, pUC19-GPX1 SEQ ID No:5, pUC19-GPX1 SEQ ID No:6, с частичной модифицированной путем замены оснований нуклеотидной последовательностью гена GPX1 (с 13 по 673 н.п.) и pUC19-GPX1 SEQ ID No:7 с модифицированной кДНК гена GPX1 и лишенной нетранслируемыех 5' и 3' областей данного гена, а также векторные плазмиды pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+) для дальнейшей экспрессии гена GPX1 в эукариотических клетках, гидролизуют рестриктазами SacI и HindIII(NEB, USA) при 37°С в соответствующем буфере (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984).

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке HindIII-5'NTR-кДНК GPX1-3'NTR- SacI, либо SacI -5'NTR-кДНК GPX1-3'NTR-HindIII и линеаризованной плазмиде pCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1(+), вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit из примера 1 и смешивают. Полученную смесь рестрикционных фрагментов лигируют с помощью ДНК-лигазы фага Т4. Лигирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°С в течение 10 ч. Лигированную ДНК используют для трансформации клеток Е. coli по стандартной методике с использованием хлористого кальция. Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit, анализируют с помощью гидролиза рестриктазами т SacI и HindIII и отбирают генетическую (ие) конструкцию (ии), содержащую (ие) в своем составе кодирующую последовательность гена GPX1 под контролем промотора цитомегаловируса CMV, и сигналом полиаденилирования гена гормона роста, обозначаемую как pCMV6 GPX1 SEQ ID No:(1-7) или pCMV6-Kan/Neo GPX1 SEQ ID No:(1-7) или pCDNA 3.1GPX1 SEQ ID No:(1-7). Наличие вставки кДНК гена GPX1, ее последовательность и ориентацию также подтверждают с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих биологически активных генно-терапевтических субстанций.

Полученные генетические экспрессионные конструкции используют для получения на их базе биологически активных генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6 - XL5, (pCMV6-Kan/Neo) или pCDNA 3.1(+) без вставки кДНК гена GPX1.

Пример 4.

Наращивание генетической конструкции в бактериальной культуре.

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена GPX1, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E. coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена GPX1 в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами SacI и HindIII и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (хондробластов, кератоцитов и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E. coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°С и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5.

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции биологически активной генно-терапевтической субстанцией и анализа экспрессии гена GPX1.

Для последующей трансфекции биологически активной генно-терапевтической субстанцией содержащей один из вариантов кДНК GPX1 по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например за ушной раковиной или с боковой внутренней поверхности в зоне локтевого сустава, размером около 3 мм, массой - до 20 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°С в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°С в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена GPX1, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAIater и хранили при 4°С в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260 : D280 - не менее 1,8, а соотношение полос 28S : 18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК. В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6.

Анализ эндогенной экспрессии гена GPX1 в культуре первичных фибробластов.

Анализ транскрипции гена GPX1 из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена GPX1.

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена GPX1 и фибробласты с нормальной экспрессией гена GPX1, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК, специфичной для гена GPX1, используют прямой праймер:

GPX1 FA1 5' CTGCGGGGCAAGGTACTACTTATCG 3'

и обратный праймер:

GPX1-RA1 5' TCGTTCTTGGCGTTCTCCTGATG 3'

Длина продукта амплификации - 167 нуклеотидов. В качестве референтного гена используют ген бета-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена GPX1.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого примера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°С 30 минут, денатурация 98°С - 15 мин., затем 40 циклов, включающих денатурацию 94°С - 15 сек., отжиг праймеров 60°С - 30 сек. и элонгацию 72°С - 30 сек.

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов GPX1 и В2М. Количество ПЦР продуктов - кДНК генов GPX1 и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.MM. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны).

По итогам анализа экспрессии гена GPX1 в разных культурах фибробластов (с низкой экспрессией гена GPX1 и с нормальной экспрессией гена GPX1) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена GPX1, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7.

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена GPX1 биологически активной генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена GPX1 в культуре данных клеток.

Для оценки эффективности биологически активной генно-терапевтической субстанции, содержащей немодифицированную кДНК гена GPX1 по примеру 3, этой биологически активной генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена GPX1, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют биологически активной генно-терапевтической субстанцией на основе pCMV6- GPX1 SEQ ID No:1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4×105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°С и в атмосфере, содержащей 5% CO2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, рН 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°С.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С и в атмосфере, содержащей 5% CO2, после чего оценивали уровень кДНК гена GPX1 и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена GPX1 уровень кДНК гена GPX1 в фибробластах не изменился, а в случае трансфекции вектором с кДНК GPX1 - уровень кДНК фибробластов со сниженной экспрессией гена GPX1 многократно увеличился (до уровня выше уровня кДНК гена GPX1 в нормальных фибробластах).

Показано, что в клетках трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6-GPX1 SEQ ID No:1 наблюдается усиление экспрессии целевого гена GPX1

Пример 8.

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена GPX1 биологически активной генно-терапевтической субстанцией с кДНК гена GPX1 с целью подтверждения увеличения при этом активности белка глутатионпероксидазы-1 в культуре данных клеток.

Для оценки изменения уровня активности белка глутатионпероксидазы-1 в культуре фибробластов, использовали три варианта клеточной культуры - нетрансфицированные фибробласты, обработанные водным раствором дендримеров (А), трансфицированные векторной плазмидой, например, pCDNA 3.1(+), не содержащей кДНК гена GPX1 (В) и трансфицированные биологически активной генно-терапевтической субстанцией на основе той же самой векторной плазмиды, содержащей кДНК гена GPX1 - pCDNA 3.1 GPX1 SEQ ID No:1 (С). Трансфекцию клеток биологически активной генно-терапевтической субстанцией на основе pCDNA 3.1 GPX1 SEQ ID No:1 и вектором pCDNA 3.1(+) в присутствии транспортных молекул (дендримеров) проводят как описано в примере 7.

Клеточный осадок, соответствующий 2×106 клеток промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Активность белка глутатионпероксидазы-1 определяли непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit, Catalog Number CGP1 (Sigma-Aldrich, USA). Принцип метода состоит в том, что глутатионпероксидаза воздействует на ферментативные реакции, в результате чего снижается концентрация NADPH (восстановленного никотинамидадениндинуклеотидфосфата), что в конечном итоге приводит к уменьшению оптической плотности раствора, которая измеряется при длине волны 340 нм. Анализ проводили по методике (Technocal Bulletin 2012), рекомендуемой производителем. Из графика, приведенного на фигуре 10, следует, что лизат культуры клеток, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCDNA 3.1 GPX1 SEQ ID No:1, ингибирует цветную реакцию полностью без разведения и при разведении 1:10.

Таким образом показано, что транфекция фибробластов полученной биологически активной генно-терапевтической субстанцией, несущей кДНК гена GPX1, приводит к повышению активности глутатионпероксидазы-1 в клетках фибробластов.

Пример 9.

Введение в кожу человека клеточной культуры фибробластов, трансфицированной биологически активной генно-терапевтической субстанцией с кДНК гена GPX1 с целью подтверждения увеличения после этого активности белка глутатионпероксидазы-1 в биоптате кожи человека.

С целью анализа изменения активности белка глутатионпероксидазы-1 в тканях человека пациентам в кожу предплечья вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных биологически активной генно-терапевтической субстанцией на основе рСМV6- GPX1 SEQ ID No:7 (C) в комбинации с транспортными молекулами - липосомами TRANSFAST ТМ Transfection Reagent (PROMEGA, USA),

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°С, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°С и использовали далее в качестве биологически активной генно-терапевтической субстанции.

Для последующей трансфекции биологически активной генно-терапевтической субстанцией выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосомы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга. Активность глутатионпероксидазы-1 оценивали в лизатах биоптатов кожи пациента непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit (Sigma-Aldrich, USA), как описано в примере 8. Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- GPX1 SEQ ID No:7, произошло увеличение активности белка глутатионпероксидазы-1, тогда как при введении контрольных культур фибробластов (трансфицированных и нетрансфицированных вектором без вставки кДНК гена GPX1 pCMV6-XL5) активность белка глутатионпероксидазы-1 в коже не изменялась.

Таким образом показана эффективность биологически активной генно-терапевтической субстанции, несущей модифицированную кДНК гена GPX1: трансфекция фибробластов полученной биологически активной генно-терапевтической субстанцией несущей модифицированную кДНК гена GPX1, приводит к повышению активности белка глутатионпероксидазы-1 в клетках фибробластов.

Пример 10.

Трансфекция культур фибробластов из биоптатов группы различных пациентов биологически активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК GPX1.

С целью подтверждения индивидуального характера увеличения активности белка глутатионпероксидазы-1 до различного уровня при трансфекции клеточных культур фибробластов пациентов биологически активными генно-терапевтическими субстанциями с модифицированными и нативной кДНК гена GPX1 анализировали уровень активности белка глутатионпероксидазы-1 в клеточных лизатах фибробластов, трансфицированных разными биологически активными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные и нативную кДНК GPX1 в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена GPX1.

Последовательность нативной кДНК GPX1 приведена на фигуре 1, SEQ ID No:1., последовательности модифицированных кДНК GPX1 приведены на фигурах 2-7 (SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в области локтевого сустава 19 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень глутатионпероксидазы-1 в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford M.M. (1976) Anal. Biochem. 72: 248-254.]).

Затем каждую из 19-ти культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:1, содержащей немодифицированную кДНК GPX1 (SEQ ID No:1.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру

9. Вторую часть, обозначенную (В), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:2, содержащей вариант 1 модифицированной кДНК GPX1 (SEQ ID No:2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (С), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:3, содержащей вариант 2 модифицированной кДНК GPX1 (SEQ ID No:3.) по примеру 3 в сочетании с транспортными молекулами - липосомами попримеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:4, содержащей вариант 3 модифицированной кДНК GPX1 (SEQ ID No:4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:5, содержащей 4 вариант модифицированной кДНК GPX1 (SEQ ID No:5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:6, содержащей вариант 5 модифицированной кДНК GPX1 SEQ ID No:6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:7, содержащей вариант 6 модифицированной кДНК GPX1 (SEQ ID No:7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК GPX1 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Активность глутатионпероксидазы-1 определяли через 72 часа после трансфекции непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit (Sigma-Aldrich, USA). Анализ проводили по методике, рекомендуемой производителем. Предварительно проводили оценку степени ингибирования цветной реакции в зависимости от концентрации чистого препарата глутатионпероксидазы-1. Исходя из данных предыдущих экспериментов, описанных в примере 8, лизат разводили в 5 раз.

По итогам анализа уровня активности глутатионпероксидазы-1 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие максимальные уровни активности глутатионпероксидазы-1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное ингибирование в лизате, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при трансфекции немодифицированной кДНК GPX1. В эту группу вошло 2 культуры из 19.

В группе 2 максимальное ингибирование в лизате, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при трансфекции 1 вариантом модифицированной кДНК GPX1. В эту группу вошла 1 культура из 19.

В группе 3 максимальное ингибирование в лизате, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при трансфекции 2 вариантом модифицированной кДНК GPX1. В эту группу вошло 4 культуры из 19.

В группе 4 максимальное ингибирование в лизате, что соответствует максимальной активности глутатионпероксидазы-1 наблюдалось при трансфекции 3 вариантом модифицированной кДНК GPX1. В эту группу вошла 1 культура из 19.

В группе 5 максимальное ингибирование в лизате, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при трансфекции 4 вариантом модифицированной кДНК GPX1. В эту группу вошли 2 культуры из 19.

В группе 6 максимальное ингибирование в лизате, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при трансфекции 5 вариантом модифицированной кДНК GPX1. В эту группу вошли 5 культур из 19.

В группе 7 максимальное ингибирование в лизате, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при трансфекции 6 вариантом модифицированной кДНК GPX1. В эту группу вошло 4 культуры из 19.

Ни в одной из клеточных культур не наблюдалось того, что максимальное ингибирование в лизате, соответствующее максимальной активности глутатионпероксидазы-1, присутствует при трансфекции вектором, не содержащим кДНК гена GPX1.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей ингибирования цветной реакции (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после трансфекции этих клеточных культур активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК гена GPX1.

Из данного примера следует, что достижение максимальной активности глутатионпероксидазы-1 в культурах фибробластов кожи различных пациентов при их трансфекции биологически активными генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена GPX1, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных биологически активных генно-терапевтических субстанций в рамках линейки биологически активных генно-терапевтических субстанций.

Пример 11.

Трансфекции клеточной культуры кератоцитов и эпителиальных клеток глаза биологически активной генно-терапевтической субстанцией без транспортной молекулы с целью подтверждения при этом увеличения экспрессии гена GPX1 в данных культурах клеток.

С целью выяснения эффективности биологически активной генно-терапевтической субстанции, содержащей кДНК GPX1, в различных типах клеток, трансфицировали кератоциты и эпителиальные клетки роговицы человека, без использования транспортных молекул.

Биопсийный материал из области лимба в виде круга диаметром 1-1.5 мм помещали в чашку Петри в сбалансированный солевой раствор Хэнкса, добавляли диспазу (20 мкл 25 ед/мл) и гентамицин и инкубировали 24 часа при +4. Затем отделяли эпителиальный слой от стромы и нарезали обе ткани кусочками 1-2 мм3.

Суспензию эпителиальных клеток получали путем инкубирования кусочков тканей в растворе Трипсин-ЭДТА в течение 15 минут при +37°С. Трипсинизацию останавливали добавлением соевого ингибитора трипсина в PBS. Клеточные суспензии отмывали центрифугированием при 700 об/мин и ресуспендировали в бессывороточной среде DMEM с гентамицином. Клетки растили в 25 см2 флаконах с 5 мл среды при 37°С и в атмосфере, содержащей 5% CO2. Через 24 часа среду с не прикрепившимися клетками удаляли и добавляли 5 мл свежей среды. Пересев производили каждые 7 дней в соотношении 1:2-1:3.

Суспензию кератоцитов получали путем инкубирования в среде RPMI-1640 с коллагеназой 300 ед/мл в течение 2 часов. Затем отмывали клетки и ресуспендировали в среде DMEM с 20% телячьей сывороткой и антибиотиком-антимикотиком. Клетки растили в 25 см2 флаконах с 1 мл среды при +37°С и в атмосфере, содержащей 5% CO2. Пересев производили каждые 7 дней в соотношении 1:4.

Поскольку эффективность трансфекции кератоцитов низкая, использовали биологически активную генно-терапевтическую субстанцию на основе плазмиды pCMV6-Kan/Neo GPX1 SEQ ID No:2, содержащую дополнительный фактор селекции - ген neor придающий устойчивость к антибиотику генетицину.

Биологически активную генно-терапевтическую субстанцию добавляли к клеткам и инкубировали клетки 1 час при 37°С. После инкубации добавляли бессывороточную среду DMEM к эпителиальным клеткам и среду DMEM, содержащую 10% фетальной телячьей сыворотки к кератоцитам и продолжали инкубировать 24 часа. После 24-часового инкубирования клетки высевали в новую среду DMEM, содержащую 400 μg/mL фактора селекции - антибиотика G418 (Geneticin). Выжившие клетки культивировали в течение 2 недель в 25 см3 флаконах с 5 мл среды с G418. Всего выращивали 24 образца культур эпителиальных клеток и 24 образца культур кератоцитов.

Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК проводили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена GPX1 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-RadUSA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение экспрессии (транскрипции) гена GPX1 наблюдали на 3 сутки для эпителиальных клеток и на 5 сутки - для кератоцитов.

На фигуре 13 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена GPX1, в кератоцитах и эпителиальных клетках роговицы.

Показано, что в кератоцитах и эпителиальных клетках роговицы человека, трансфицированных биологически активной генно-терапевтической субстанцией на основе pCMV6- Kan/Neo GPX1 SEQ ID No:2, без транспортной молекулы, наблюдается усиление экспрессии целевого гена GPX1

Пример 12.

Трансфекции клеточной культуры хондробластов биологически активной генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена GPX1 в данных культуре клеток.

С целью выяснения эффективности биологически активной генно-терапевтической субстанции, содержащей кДНК гена GPX1, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали хондробласты человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биоптаты хрящевой ткани массой 50-150 мг измельчали на фрагменты до 10 мм3 и инкубировали в буферном растворе с коллагеназой II, гиалуронидазой и трипсином в течение 48 часов при +37°С. Клетки отмывали бессывороточной средой DMEM, ресуспендировали в той же среде с гентамицином и выращивали при +37°С и в атмосфере, содержащей 5% CO2 во флаконах 75 см2 с 15 мл среды. Рост осуществлялся в бессыворотчной среде, так как в монослойной культуре хондроциты меняют форму и биохимические свойства. Пересев производили каждые 4 дня в соотношении 1:3, клетки снимали с поверхности флакона раствором трипсин-ЭДТА с 0.02% раствором Версена.

Для трансфекции клеток биологически активной генно-терапевтической субстанцией содержащей кДНК гена GPX1 использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci. 2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-N-(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6- Kan/Neo GPX1 SEQ ID No:3 с модифицированной кДНК GPX1 SEQ ID No:3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit(Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК GPX1 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Максимальное увеличение транскрипции GPX1 наблюдали на 5 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена GPX1.

Показано, что в хондробластах трансфицированных биологически активной генно-терапевтической субстанцией на основе рСМV6- Kan/Neo GPX1 SEQ ID No:3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается усиление экспрессии целевого гена GPX1

Пример 13.

Введение в кожу человека биологически активной генно-терапевтической субстанции с кДНК гена GPX1 с целью подтверждения при этом увеличения активности глутатионпероксидазы-1 в коже человека.

С целью анализа изменения активности белка глутатионпероксидазы-1 пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена GPX1 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена GPX1 с транспортной молекулой (А) - в кожу предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST TM Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6 GPX1 SEQ ID No:4, которая содержит модифицированную кДНК гена GPX1 (SEQ ID No:4), и плазмиду pCMV6-XL5, используемую в качестве плацебо - которая не содержит кДНК гена GPX1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Активность глутатионпероксидазы-1 оценивали в лизатах биоптатов кожи пациента непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit (Sigma-Aldrich, USA) по примеру 8. Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения биологически активной генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее как описано в примере 9.

Показано, что в коже пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена GPX1, произошло увеличение активности глутатионпероксидазы-1, тогда как при введении плацебо активность глутатионпероксидазы-1 в коже не изменялась. Результаты отражены на фигуре 15

Пример 14.

Введение в слизистую оболочку рта человека биологически активной генно-терапевтической субстанции с кДНК гена GPX1 с целью подтверждения при этом увеличения активности глутатионпероксидазы-1 в слизистой оболочке рта человека.

С целью анализа изменения активности белка глутатионпероксидазы-1 пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена GPX1 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена GPX1 с транспортной молекулой (А) - в слизистую оболочку рта.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST TM Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCDNA 3.1 GPX1 SEQ ID No:5, которая содержит модифицированную кДНК гена GPX1 (SEQ ID No:5), и плазмиду pCDNA 3.1(+), используемую в качестве плацебо, которая не содержит кДНК гена GPX1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1-2 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 2-4 см друг от друга.

Активность глутатионпероксидазы-1 оценивали в лизатах биоптатов слизистой оболочки рта пациента непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit (Sigma-Aldrich, USA).

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков слизистой оболочки рта в зоне введения биологически активной генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL), далее по примеру 9.

Показано, что в слизистой оболочке рта пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена GPX1, произошло увеличение активности глутатионпероксидазы-1, тогда как при введении плацебо активность глутатионпероксидазы-1 в слизистой оболочке рта не изменялась. Результаты отражены на фигуре 16.

Пример 15.

Введение в мышечную ткань человека биологически активной генно-терапевтической субстанции с кДНК гена GPX1 с целью подтверждения при этом увеличения активности глутатионпероксидазы-1 в мышечной ткани человека.

С целью анализа изменения активности белка глутатионпероксидазы-1 пациентам вводили биологически активную генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена GPX1 (В) и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена GPX1 с транспортной молекулой (А) - в мышечную ткань икроножной мышцы.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST TM Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo GPX1 SEQ ID No:6, которая содержит модифицированную кДНК гена GPX1 (SEQ ID No:6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена GPX1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные биологически активную генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора биологически активной генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения биологически активной генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга

Активность глутатионпероксидазы-1 оценивали в лизатах биоптатов мышечной ткани пациента непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit (Sigma-Aldrich, USA).

Биопсийные образцы брали на 3 сутки после введения биологически активной генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения биологически активной генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компания BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения биологически активной генно-терапевтической субстанции с кДНК гена GPX1, произошло увеличение активности глутатионпероксидазы-1, тогда как при введении плацебо активность глутатионпероксидазы-1 в мышечной ткани не изменялась. Результаты отражены на фигуре 17.

Пример 16.

Введение группе различных пациентов биологически активных генно-терапевтическиих субстанций содержащих модифицированные и нативную кДНК GPX1.

С целью подтверждения индивидуального характера увеличения активности белка глутатионпероксидазы-1 до различного уровня при введении в кожу пациентов биологически активных генно-терапевтических субстанций с модифицированными и нативной кДНК гена GPX1 анализировали уровень активности белка глутатионпероксидазы-1 в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена GPX1.

Последовательность нативной кДНК GPX1 приведена на фигуре 1, GPX1 SEQ ID No:1, последовательности модифицированных кДНК GPX1 приведены на фигуре 2-7 (GPX1 SEQ ID No:2, GPX1 SEQ ID No:3, GPX1 SEQ ID No:4, GPX1 SEQ ID No:5, GPX1 SEQ ID No:6, GPX1 SEQ ID No:7).

При этом генетические конструкции, одна из которых содержит нативную кДНК гена GPX1 (SEQ ID No:1), вторая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:2), третья генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:3), четвертая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:4)), пятая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:5), шестая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:6), седьмая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов биологически активных генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой биологически активной генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения биологически активных генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 16-ти пациентов, отобранных в случайном порядке, вводили 7 биологически активных генно-терапевтических субстанций и плацебо в кожу предплечья.

Биопсийные образцы брали через 72 часа после введения биологически активных генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения биологически активных генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин.

А - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:1, содержащий немодифицированную кДНК GPX1 (SEQ ID No:1.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

В - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:2, содержащий вариант 1 модифицированной кДНК GPX1 (SEQ ID No:2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

С - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:3, содержащий вариант 2 модифицированной кДНК GPX1 (SEQ ID No:3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

D - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:4, содержащая вариант 3 модифицированной кДНК GPX1 (SEQ ID No:4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Е - - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:5, содержащая 4 вариант модифицированной кДНК GPX1 (SEQ ID No:5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

F - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе на базе pCMV6- SEQ ID No:6, содержащая вариант 5 модифицированной кДНК GPX1 SEQ ID No:6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

G - биоптат, полученный после введения биологически активной генно-терапевтической субстанции на базе pCMV6- SEQ ID No:7, содержащий вариант 6 модифицированной кДНК GPX1 (SEQ ID No:7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащая кДНК гена GPX1 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Активность белка глутатионпероксидазы-1 определяли в девяти биоптатах кожи от каждого пациента (от А до Н и в биоптате интактной кожи) через 72 часа после введения биологически активных генно-терапевтических субстанций непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit (Sigma-Aldrich, USA). Анализ проводили по методике, рекомендуемой производителем. Предварительно проводили оценку степени ингибирования цветной реакции в зависимости от концентрации чистого препарата глутатионпероксидазы-1. Исходя из данных предыдущих экспериментов, описанных в примере 8, лизат разводили в 5 раз.

По итогам анализа уровня активности глутатионпероксидазы-1 выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие максимальные уровни активности глутатионпероксидазы-1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 максимальное ингибирование в лизате биоптата, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при введении немодифицированной кДНК GPX1. В эту группу вошло 4 биоптата из 16.

В группе 2 максимальное ингибирование в лизате биоптата, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при введении 1 варианта модифицированной кДНК GPX1. В эту группу вошел 1 биоптат из 16.

В группе 3 максимальное ингибирование в лизате биоптата, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при введении 2 варианта модифицированной кДНК GPX1. В эту группу вошли 3 биоптата из 16.

В группе 4 максимальное ингибирование в лизате биоптата, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при введении 3 варианта модифицированной кДНК GPX1. В эту группу вошли 2 биоптата из 16.

В группе 5 максимальное ингибирование в лизате биоптата, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при введении 4 варианта модифицированной кДНК GPX1. В эту группу вошли 2 биоптата из 16.

В группе 6 максимальное ингибирование в лизате биоптата, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при введении 5 варианта модифицированной кДНК GPX1. В эту группу вошел 1 биоптат из 16.

В группе 7 максимальное ингибирование в лизате биоптата, что соответствует максимальной активности глутатионпероксидазы-1, наблюдалось при введении 6 варианта модифицированной кДНК GPX1. В эту группу вошло 3 биоптата из 16.

Ни в одном из биоптатов не наблюдалось того, что максимальное ингибирование цветной реакции, соответствующее максимальной активности глутатионпероксидазы-1, присутствует при введении плацебо - векторной плазмиды, не содержащей кДНК гена GPX1.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей ингибирования цветной реакции (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте активным генно-терапевтическим субстанциям, после введения пациентам этих активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена GPX1.

Из данного примера следует, что достижение максимальной активности глутатионпероксидазы-1 в биоптатах кожи различных пациентов при введении им в кожу биологически активных генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена GPX1, входящих в биологически активные генно-терапевтические субстанции.

Каждая биологически активная генно-терапевтическая субстанция из линейки биологически активных генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно для выбора наиболее эффективной биологически активной генно-терапевтической субстанции из линейки биологически активных генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет максимальной эффективности терапевтического воздействия, созданных биологически активных генно-терапевтических субстанций в рамках линейки биологически активных генно-терапевтических субстанций.

Пример 17.

Трансфекция клеточной линии фибробластов пациента разными биологически активными генно-терапевтическими субстанциями, содержащими модифицированные и нативную кДНК GPX1 с целью персонализированного выбора из линейки биологически активных генно-терапевтических субстанций наиболее эффективной биологически активной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали активность глутатионпероксидазы-1 в клеточных лизатах фибробластов этого пациента, трансфицированных разными биологически активными генно-терапевтическими субстанциями, содержащими нативную или модифицированные кДНК GPX1. Последовательность нативной кДНК GPX1 приведена на фигуре 1, SEQ ID No:1., последовательности модифицированных кДНК GPX1 приведены на фигурах 2-7 (SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7).

Вырастили культуры фибробластов из биоптата пациента по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда.

Активность глутатионпероксидазы-1 определяли непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit (Sigma-Aldrich, USA). Анализ проводили по методике, рекомендуемой производителем. Предварительно проводили оценку степени ингибирования цветной реакции в зависимости от концентрации чистого препарата глутатионпероксидазы-1.

Затем культуру фибробластов пациента разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:1, содержащей немодифицированную кДНК GPX1 (SEQ ID No:1.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. Вторую часть, обозначенную (В), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:2, содержащей вариант 1 модифицированной кДНК GPX1 (SEQ ID No:2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 3-ю часть, обозначенную (С), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:3, содержащей вариант 2 модифицированной кДНК GPX1 (SEQ ID No:3.) по примеру 3 в сочетании с транспортными молекулами - липосомами попримеру 9. 4-ю часть, обозначенную (D), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:4, содержащей вариант 3 модифицированной кДНК GPX1 (SEQ ID No:4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 5-ю часть, обозначенную (Е), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:5, содержащей 4 вариант модифицированной кДНК GPX1 (SEQ ID No:5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 6-ю часть, обозначенную (F), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:6, содержащей вариант 5 модифицированной кДНК GPX1 SEQ ID No:6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 7-ю часть, обозначенную (G), трансфицировали по примеру 7 биологически активной генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No:7, содержащей вариант 6 модифицированной кДНК GPX1 (SEQ ID No:7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9. 8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК GPX1 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Активность глутатионпероксидазы-1 определяли через 72 часа после трансфекции. Исходя из данных предыдущих экспериментов, описанных в примере 8, лизат разводили в 5 раз.

По итогам анализа активности глутатионпероксидазы-1 в культуре фибробластов пациента выделили вариант биологически активной генно-терапевтической субстанции, при трансфекции которой происходит максимальное ингибирование в лизате клеточной культуры и соответственно наблюдается максимальная активность глутатионпероксидазы-1. В данном эксперименте максимальное ингибирование в лизате отмечено при трансфекции биологически активной генно-терапевтической субстанцией на базе pCMV6 GPX1 SEQ ID No:7, содержащей модифицированную кДНК GPX1, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18.

Введение в кожу пациента различных биологически активных генно-терапевтических субстанций, содержащих модифицированные и нативную кДНК гена GPX1 с целью персонализированного выбора из линейки биологически активных генно-терапевтических субстанций наиболее эффективной биологически активной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту биологически активной генно-терапевтической субстанции анализировали активность глутатионпероксидазы-1 в лизатах биоптатов кожи этого пациента, после введения ему в кожу биологически активных генно-терапевтических субстанций, содержащих нативную или модифицированные кДНК гена GPX1. Последовательность нативной кДНК GPX1 приведена на фигуре 1, SEQ ID No:1., последовательности модифицированных кДНК GPX1 приведены на фигурах 2-7 (SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7)

Пациенту вводили 7 биологически активных генно-терапевтических субстанций и плацебо в кожу предплечья.

Первая биологически активная генно-терапевтическоая субстанция(А) на базе pCMV6- SEQ ID No:1, содержащая немодифицированную кДНК GPX1 (SEQ ID No:1.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая биологически активная генно-терапевтическая субстанция (В) на базе pCMV6- SEQ ID No:2, содержащая вариант 1 модифицированной кДНК GPX1 (SEQ ID No:2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

3-я биологически активная генно-терапевтическая субстанция (C) на базе pCMV6- SEQ ID No:3, содержащая вариант 2 модифицированной кДНК GPX1 (SEQ ID No:3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

4-я биологически активная генно-терапевтическая субстанция (D) на базе pCMV6- SEQ ID No:4, содержащая вариант 3 модифицированной кДНК GPX1 (SEQ ID No:4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

5-я биологически активная генно-терапевтическая субстанция (Е) на базе pCMV6- SEQ ID No:5, содержащая 4 вариант модифицированной кДНК GPX1 (SEQ ID No:5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

6-я биологически активная генно-терапевтическая субстанция (F) на базе pCMV6- SEQ ID No:6, содержащая вариант 5 модифицированной кДНК GPX1 SEQ ID No:6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

7-я биологически активная генно-терапевтическая субстанция (G) на базе pCMV6- SEQ ID No: 7, содержащая вариант 6 модифицированной кДНК GPX1 (SEQ ID No:7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

8-я - векторная плазмида pCMV6-XL5, не содержащая кДНК GPX1 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит нативную кДНК гена GPX1 (SEQ ID No:1), вторая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:2), третья генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:3), четвертая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:4), пятая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:5), шестая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:6), седьмая генетическая конструкция содержит модифицированную кДНК гена GPX1 (SEQ ID No:7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения биологически активных генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов биологически активных генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой биологически активной генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения биологически активных генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения биологически активных генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения биологически активных генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был около 3 мм, масса - до 20 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин.

Активность глутатионпероксидазы-1 определяли в девяти биоптатах кожи пациента через 72 часа после введения биологически активных генно-терапевтических субстанций непрямым колориметрическим методом с помощью набора Glutathione Peroxidase Cellular Activity Assay Kit (Sigma-Aldrich, USA). Анализ проводили по методике, рекомендуемой производителем. Предварительно проводили оценку степени ингибирования цветной реакции в зависимости от концентрации чистого препарата глутатионпероксидазы-1. Исходя из данных предыдущих экспериментов, описанных в примере 8, лизат разводили в 5 раз.

По итогам анализа активности глутатионпероксидазы-1 в лизате биоптатов кожи пациента выделили вариант биологически активной генно-терапевтической субстанции, при введении которой в кожу происходит максимальное ингибирование в лизате биоптата кожи и соответственно наблюдается максимальная активность глутатионпероксидазы-1. В данном эксперименте максимальное ингибирование в лизате биптатата кожи отмечено при введении биологически активной генно-терапевтической субстанции на базе pCMV6 GPX1 SEQ ID No:3, содержащей модифицированную кДНК GPX1, что показано на фигуре 20.

Таким образом выбрана наиболее эффективная применительно к данному пациенту биологически активная генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создана линейка биологически активных генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, связанных с оксидативным стрессом вследствие недостаточной экспрессии гена GPX1, способ ее получения и использования.

Созданная линейка биологически активных генно-терапевтических субстанций с использованием одной из модифицированных или нативной кДНК гена GPX1 позволяет на практике использовать входящие в линейку биологически активные генно-терапевтические субстанции для повышения до необходимого уровня активности белка глутатионпероксидазы-1 в различных клетках органов и тканей и/или органах и тканях человека.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант биологически активной генно-терапевтической субстанции из созданной линейки биологически активных генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить активность белка глутатионпероксидазы-1 клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование биологически активной генно-терапевтической субстанции с нативной кДНК гена GPX1 не приводит к желаемому изменению уровня активности белка глутатионпероксидазы-1 в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена GPX1, приводящей к более эффективной экспрессии гена GPX1.

При использовании заявленной биологически активной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Линейка биологически активных генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена GPX1, повышая активность белка глутатионпероксидазы-1 в клетках органов и тканей и/или органах и тканях человека в частности, в гемопоэтических клетках, или гепатоцитах, или мезенхимальных стволовых клетках, или хондробластах, или клетках поджелудочной железы (например, в клетках панкреатических островков), или миоцитах или фибробластах кожи, или кератоцитах, или эпителиальных клетках роговицы, или в нейронах, ганглиях, Шванновских клетках, астроцитах, олигодендроцитах, микроглии, или в сперматозоидах, или в нефронах, или эндотелиальных клетках, или эпителиальных клетках в сочетании с транспортной молекулой или без нее при трансфекции этими биологически активными генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в коже, суставах, печени, надпочечниках, почках, головном и спинном мозге, легких, сердце, сосудах, желудочно-кишечном тракте, простате, поджелудочной железе, глазе, роговице, слизистой оболочке, хрящевой ткани, мышечной ткани в сочетании с транспортной молекулой или без нее при введении этих биологически активных генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание линейки биологически активных генно-терапевтических субстанций, при использовании которых применительно к клеткам органов и тканей и/или органам и тканям человека компенсируются дефекты гена GPX1, влияющие на экспрессию этого гена или на уровень активности белка глутатионпероксидазы-1, кодируемого этим геном, а также компенсируется недостаточная активность белка глутатионпероксидазы-1, вызванная факторами, влияющими на экспрессию гена GPX1.

Повышение эффективности коррекции уровня активности белка глутатионпероксидазы-1 в клетках органов и тканей человека достигают за счет того, что при недостаточной активности этого белка вследствие дефекта гена GPX1 используют не белок, а генетическую конструкцию с кДНК гена GPX1, кодирующую этот белок. При введении генетических конструкций в отличие от введения непосредственно белка, как в прототипе, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Промышленная применимость.

Все приведенные примеры по созданию и использованию созданной линейки биологически активных генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр, мкл - микролитр

л - литр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е. ф-относительная единица флуоресценции

БАГТС - биологически активная генно-терапевтическая субстанция

1. Средство для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена GPX1, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеткок глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта или мышечной ткани, представляющее собой совокупность генотерапевтических субстанций, каждая из которых представляет генотерапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена GPX1, с кодирующей последовательностью белка глутатионпероксидазы-1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена GPX1 SEQ ID No: 1, или модифицированной кДНК гена GPX1, при этом в качестве модифицированной кДНК гена GPX1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в клетках органов и тканей человека и способную обеспечить высокий уровень экспрессии гена GPX1 и увеличить активность белка глутатионпероксидазы-1 в клетках органов и тканей и/или органах и тканях человека, в сочетании с транспортной молекулой или без нее.

2. Средство по п. 1, отличающееся тем, что генетическая конструкция с кДНК гена GPX1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена GPX1, которая несет модификации, не затрагивающие структуру белка глутатионпероксидазы-1, а именно нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, или комбинации вышеперечисленных модификаций и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность.

3. Средство по п. 1, отличающееся тем, что в каждой биологически активной генно-терапевтической субстанции в качестве транспортной молекулы используют липосомы, или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры.

4. Способ получения средства по п. 1, заключающийся в том, что получают кДНК гена GPX1, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной биологически активной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной биологически активной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена GPX1 SEQ ID No: 1, или кДНК гена GPX1 SEQ ID No: 2, или кДНК гена GPX1 SEQ ID No: 3, или кДНК гена GPX1 SEQ ID No: 4, или кДНК гена GPX1 SEQ ID No: 5, или кДНК гена GPX1 SEQ ID No: 6, или кДНК гена GPX1 SEQ ID No: 7.

5. Способ использования средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена GPX1 по п. 1, заключающийся в трансфекции созданной биологически активной генно-терапевтической субстанцией, выбранной с учетом индивидуальных особенностей каждого конкретного пациента на основе предварительного эксперимента по определению наиболее эффективного варианта из созданных и представленных в совокупности биологически активных генно-терапевтических субстанций, клеток органов и тканей человека, и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из совокупности созданных генно-терапевтических субстанций, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/выбранных из группы созданных генно-терапевтических субстанций, или сочетанием обозначенных способов.



 

Похожие патенты:

Изобретения касаются способа доставки или переноса гетерологичной полинуклеотидной последовательности в печень млекопитающему и способа лечения млекопитающего с недостаточностью экспрессии фактора свертывания крови или функции.

Настоящее изобретение относится к области биотехнологии, конкретно к конъюгату антисмыслового олигомера, и может быть использовано в медицине. Изобретение направлено на получение конструкции, позволяющей улучшить терапевтический индекс представляющего интерес антисмыслового олигонуклеотида и его высвобождение в клетках вследствие конъюгации олигонуклеотида с расщепляемой фосфодиэфирной областью и направляющей группой, способствующей доставке полученного конструкта в нужное место в клетке и обеспечивающей направленный захват действующего антисмыслового олигомера целевыми клетками.

Изобретение относится к области биохимии, в частности к одноцепочечному антителу, которое связывается с раково-эмбриональным антигеном (РЭА). Также раскрыты химерный мономолекулярный Т-клеточный рецептор, включающий указанное антитело, вектор для экспрессии указанного рецептора, клетка-хозяин, продуцирующая указанный рецептор.

Изобретение относится к области биохимии и биотехнологии, в частности к способу создания и селекции библиотеки модифицированных аптамеров для различных мишеней, в частности к человеческому клеточному рецептору CD47.

Изобретение относится к области молекулярной иммунологии, биотехнологии и медицины, конкретно к получению антител, специфически блокирующих опухолеассоциированный MUC1, и может быть использовано в медицине.

Изобретение относится к биотехнологии, а именно к генной инженерии. Описан РНК-проводник (направляющих РНК) для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 1 и SEQ ID NO: 2, и вторую нуклеотидную последовательность SEQ ID NO: 5, фланкирующую первую последовательность с 3´-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность содержит РАМ-мотив, способный распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus pyogenes с обеспечением элиминации вируса гепатита B.

Изобретение относится к области биохимии. Описан набор олигонуклеотидных проб для определения генотипа митохондриальной ДНК человека, характеризующийся тем, что данный набор позволяет определить генотип митохондриальной ДНК человека в 38 однонуклеотидных сайтах, расположенных в различных участках митохондриального генома и полиморфных в популяциях населения России различного этнического происхождения, с помощью метода ферментативного однонуклеотидного удлинения гибридизированной пробы, причем структура олигонуклеотидных проб учитывает вариабельность ДНК в близлежащих сайтах и группировку генотипируемых сайтов в 3 панели для мультиплексных реакций.

Изобретение относится к области генной инженерии, конкретно к получению микробных продуцентов, и может быть использовано для получения микробного масла. Сконструирована жирообразующая клетка дрожжей, способная к конверсии источника углерода в жирную кислоту, производное жирной кислоты и/или триацилглицерин.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена SOD1, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена SOD1, с кодирующей последовательностью белка супероксиддисмутазы-1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена SOD1 SEQ ID No: 1, или модифицированной кДНК гена SOD1, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена TGFBR2, связанных с количественным снижением белка TGFBR2, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генотерапевтическую субстанцию, выбранную из группы генотерапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена TGFBR2, с кодирующей последовательностью белка TGFBR2, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена GPX3, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, причем каждая из совокупности биологически активных генно-терапевтических субстанций представляет собой генетическую конструкцию на основе векторной плазмиды, включающую участок кДНК гена GPX3 и содержащую также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, а именно в клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена SOD2, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена SOD2, с кодирующей последовательностью белка супероксиддисмутазы-1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена SOD2 SEQ ID No: 1, или модифицированной кДНК гена SOD2, при этом в качестве модифицированной кДНК гена SOD2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, органов и тканей человека, в сочетании с транспортной молекулой или без нее.

Изобретение относится к водорастворимому комплексу каррагинан-гистохром при весовом соотношении указанных компонентов 5:1, обладающему пролонгированным гастропротекторным, кардиопротекторным и антиоксидантным действием.

Изобретение относится к фармацевтической промышленности, в частности к средству, обладающему антиоксидантным действием. Средство, обладающее антиоксидантным действием, полученное из корневищ куркумы длинной путем циркуляционной экстракции 100,0 г суховоздушного сырья с влажностью не более 8%, 96% этиловым спиртом, подкисленным 0,1 М раствором хлороводородной кислоты в соотношении: 1,0 мл раствора хлороводородной кислоты на 100,0 мл экстрагента, в течение 3,0 часов, с последующим сгущением извлечения на ротационном испарителе под вакуумом до остаточной влаги в продукте не более 25%.

Изобретение относится к производным 9-дизамещенных имидазо[1,2-а]бензимидазолов общей формулы I ,где R=(C1-С6) алкил, (С1-С6)диалкиламино(С1-С6)алкил, морфолино(С1-С6)алкил, и их фармацевтически приемлемым солям.

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена САТ и/или уменьшением активности белка каталазы, на основе генно-терапевтических субстанций с геном CAT, где клетки органов и тканей выбраны из фибробластов, эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CAT, с кодирующей последовательностью белка каталазы, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена CAT SEQ ID No: 1 или модифицированной кДНК гена CAT, при этом в качестве модифицированной кДНК гена CAT используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

Изобретение относится к медицине, а именно к фармацевтике, и может быть использовано для подавления окислительного стресса у млекопитающих. Антиоксидантный комплекс по изобретению представляет собой комплекс карнозина с α-липоевой кислотой, полученный путем смешивания α-липоевой кислоты с водным раствором карнозина в эквимолярном соотношении.

Изобретение относится к медицине, а именно к онкологии, и может быть использовано для лечения лучевых повреждений органов малого таза. Для этого системно и местно воздействуют лекарственным средством на область патологического очага, при этом трансвагинально или трансректально вводят ультразвуковой датчик с адаптером, затем через канал адаптера в область патологического процесса проводят инъекционную иглу и вводят однородную жидкую смесь рексода в дозировке от 6,4 млн ЕД до 12,8 млн ЕД совместно с дексаметазоном в дозировке от 6,0 мг до 10,0 мг.

Изобретение относится к фармацевтической, косметической промышленности, а именно к фармацевтической композиции, обладающей антиоксидантной активностью. Фармацевтическая композиция, обладающая антиоксидантной активностью против свободных радикалов, содержащая: a) экстракт семян или семян и листьев Vitis vinifera, содержащий комбинацию флавоноидов катехина и кверцетина в молярном соотношении в диапазоне соответственно от 6:1 до 3:1, или а') экстракт семян или семян и листьев Vitis vinifera, содержащий комбинацию флавоноидов катехина и кверцетина в молярном соотношении в диапазоне соответственно от 7:1 до 4:1, или а'') смесь экстрактов Vitis vinifera а) и а'), или а''') смесь катехина и кверцетина в молярном соотношении в диапазоне соответственно от 7:1 до 3:1, вместе с b) экстрактом листьев маслин Olea europaea L., содержащим гидрокситирозол в количестве в диапазоне от 1% до 30% по массе экстракта, или b') гидрокситирозол в количестве, равном количеству, содержащемуся в экстракте b), в которой отношение а'), или а''), или а''') к b) или b') находится в диапазоне между от 6:1 до 6:3.

Изобретение относится к экспериментальной медицине и может найти применение в космонавтике для поддержания на высоком уровне операторской деятельности космонавтов в условиях не прогнозированного воздействия радиации, а также реабилитации пациентов после протонной терапии опухолей головного мозга.

Изобретение относится к области фармакологии, косметологии и дерматологии и представляет собой антиоксидантную композицию, содержащую по меньшей мере одно подходящее для местного применения силиконовое масло в комбинации с эффективным количеством витамина С, витамина Е и одним или более полифенольными антиоксидантами, причем указанная композиция содержит креатин и по меньшей мере одно производное хромана или хромена с низкой молекулярной массой, обладающее антиоксидантными свойствами, и где один или более полифенольные антиоксиданты выбраны из катехинов. Изобретение обеспечивает высокую антиоксидантную активность, меньшее время реакции антиоксиданта, а также стабильность композиции. 7 н. и 22 з.п. ф-лы. 7 пр., 3 табл., 7 ил.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей иили органов и тканей человека на основе гена GPX1, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеткок глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта или мышечной ткани, представляющего собой совокупность генотерапевтических субстанций, каждая из которых представляет генотерапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена GPX1, с кодирующей последовательностью белка глутатионпероксидазы-1, с делециями 5 и 3-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена GPX1 SEQ ID No: 1, или модифицированной кДНК гена GPX1, при этом в качестве модифицированной кДНК гена GPX1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для коррекции патологических состояний клеток органов и тканей иили органов и тканей человека, на основе гена GPX1. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

Наверх