Подавление экспрессии генов у насекомых-вредителей



Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
Подавление экспрессии генов у насекомых-вредителей
C12N2310/14 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2653752:

ДЕВГЕН НВ (BE)

Настоящее изобретение относится к области биотехнологии. Предложена интерферирующая рибонуклеиновая кислота (РНК). Также рассмотрены: полинуклеотид, содержащий последовательность, кодирующую интерферирующую РНК, экспрессирующая ДНК-конструкция, клетка-хозяин, композиции, корпус и ловушка для борьбы с насекомыми-вредителями. Описано применение предложенных изобретений для предотвращения и/или борьбы с нападением вредителя и в качестве пестицида для растения или для материала для размножения репродуктивного материала растения; а также комбинация интерферирующей РНК и другого активного средства, в частности гербицида, и способ подавления экспрессии гена-мишени у вида насекомого-вредителя. Предложенная интерферирующая РНК обеспечивает эффективное подавление экспрессии гена-мишени у насекомого-вредителя, выбранного из Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens и Acyrthosiphon pisum, и может найти дальнейшее применение в генетическом контроле указанных насекомых. 12 н. и 18 з.п. ф-лы, 11 ил., 23 табл., 6 пр.

 

Область изобретения

Настоящее изобретение относится в целом к генетическому контролю нападения видов насекомых-вредителей, в частности предотвращению и/или борьбе с нападением вредителей на растения. Более конкретно, настоящее изобретение относится к подавлению экспрессии генов-мишеней у видов насекомых-вредителей с помощью интерферирующих молекул рибонуклеиновой кислоты (РНК). Также предлагаются композиции и комбинации, содержащие интерферирующие молекулы РНК по настоящему изобретению для использования в местных применениях, например, в форме инсектицидов.

Предпосылки изобретения

Существует множество видов насекомых-вредителей, которые могут поражать или нападать на большое множество местообитаний и организмов-хозяев. Насекомые-вредители включают разнообразные виды из отрядов насекомых Hemiptera (клопы), Coleoptera (жуки), Siphonaptera (блохи), Dichyoptera (тараканы и богомолы), Lepidoptera (моли и бабочки), Orthoptera (например, кузнечики) и Diptera (настоящие мухи). Нападение вредителей может приводить к значительному ущербу. Насекомые-вредители, которые нападают на виды растений, вызывают особые проблемы в сельском хозяйстве, поскольку они могут приводить к серьезному повреждению сельскохозяйственных культур и значительно снижать урожайность растений. Большое разнообразие различных типов растений, включая товарные культуры, такие как рис, хлопок, соя, картофель и кукуруза, чувствительны к нападению вредителей.

Традиционно, нападение насекомых-вредителей предотвращают или контролируют посредством применения химических пестицидов. Однако данные химические вещества не всегда пригодны для применения в обработке сельскохозяйственных культур, так как они могут являться токсичными для других видов и могут наносить значительный ущерб окружающей среде. За последние десятилетия исследователи разработали более экологически безопасные способы контроля нападения вредителей. Например, применялись микроорганизмы, такие как бактерии Bacillus thuringiensis, которые в естественных условиях экспрессируют белки, токсичные для насекомых-вредителей. Ученые также выделили гены, кодирующие эти инсектицидные белки, и использовали их для создания трансгенных культур, устойчивых к насекомым-вредителям, например, растения кукурузы и хлопчатника, генетически сконструированные для продуцирования белков семейства Cry.

Хотя бактериальные токсины являлись весьма успешными в борьбе с определенными типами вредителей, они не эффективны против всех видов вредителей. Исследователи, следовательно, искали другие, более целенаправленные подходы к борьбе с вредителями и, в частности, к РНК-интерференции или «сайленсингу генов» в качестве средств для борьбы с вредителями на генетическом уровне.

РНК-интерференция или «RNAi» является процессом, посредством которого экспрессия генов в отношении клетки или всего организма подавляется последовательность-специфическим образом. RNAi является в настоящее время общепризнанным методом в данной области для ингибирования или подавления экспрессии генов у самых разнообразных организмов, включая организмы-вредители, такие как грибы, нематоды и насекомые. Кроме того, предыдущие исследования показали, что подавление экспрессии генов-мишеней у видов насекомых-вредителей можно использовать в качестве средства для борьбы с нападением вредителей.

WO2007/074405 описывает способы ингибирования экспрессии генов-мишеней у беспозвоночных вредителей, включая колорадского жука. Кроме того, WO2009/091864 описывает композиции и способы подавления генов-мишеней у видов насекомых-вредителей, включая вредителей из рода Lygus.

Хотя применение RNAi для подавления экспрессии генов у видов вредителей в данной области известно, успех данного метода в применении в качестве меры борьбы с вредителями зависит от выбора наиболее подходящих генов-мишеней, а именно тех, у которых потеря функции приводит к значительному нарушению жизненно важного биологического процесса и/или гибели организма. Настоящее изобретение, таким образом, направлено на подавление конкретных генов-мишеней у насекомых-вредителей в качестве средства достижения более эффективного предотвращения и/или борьбы с нападением насекомых-вредителей, в частности на растения.

Краткое описание изобретения

Авторы настоящего изобретения пытались идентифицировать улучшенные средства для предотвращения и/или борьбы с нападением насекомых-вредителей с применением генетических подходов. В частности, они исследовали применение RNAi для подавления генов таким образом, чтобы снизить способность насекомых-вредителей выживать, расти, колонизировать специфические места обитания и/или нападать на организмы-хозяева, и таким образом ограничить ущерб, наносимый вредителем.

Таким образом, в соответствии с одним аспектом настоящего изобретение предлагается интерферирующая рибонуклеиновая кислота (РНК или двуцепочечная РНК), которая функционирует при поглощении видами насекомых-вредителей с подавлением экспрессии гена-мишени у указанного насекомого-вредителя,

при этом РНК содержит по меньшей мере один сайленсирующий элемент, при этом сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или имеющую такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(iv) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной соответствующему указанному фрагменту любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(v) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99%, идентична любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или

(vi) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая, при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389.

В конкретном аспекте настоящего изобретения молекулы интерферирующей РНК по настоящему изобретению, содержат по меньшей мере одну двухцепочечную область, как правило, сайленсирующий элемент интерферирующей РНК, содержащий смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, где смысловая цепь молекулы dsRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени.

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК или двухцепочечной РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или комплементарную ей последовательность, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или комплементарную ей последовательность, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарную ей последовательность, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, указанная нуклеотидная последовательность указанного фрагмента является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или комплементарную ей последовательность, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75% предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233.

Эти гены-мишени кодируют белки, входящие в состав комплекса тропонин/миофиламент.

В дополнительном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК или двухцепочечной РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 указанная нуклеотидная последовательность указанного фрагмента является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или комплементарную ей последовательность или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75% предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из последовательностей, представленных в SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или,

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273.

Эти гены-мишени кодируют рибосомальные белки насекомых.

В некоторых вариантах осуществления настоящее изобретение относится к интерферирующей РНК, которая содержит по меньшей мере одну двухцепочечную область, как правило, сайленсирующий элемент молекулы интерферирующей РНК, содержащий смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, где смысловая цепь молекулы dsRNA содержит последовательность по меньшей мере из 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98%, 99% или 100% комплементарной последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени из комплекса тропонин/миофиламент.

В одном варианте осуществления ген-мишень кодирует белок wings up A (тропонин I) насекомых (например, у насекомых ортолог белка CG7178 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 1 и 2. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 79. В одном варианте осуществления ген-мишень кодирует белок upheld (например, у насекомых ортолог белка CG7107 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 121 и 130. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 330. В одном варианте осуществления ген-мишень кодирует белок тропомиозин 1 (например, у насекомых ортолог белка CG4898 Dm), или белок тропомиозин 2 (например, у насекомых ортолог белка CG4843 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 123 и 132. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 332. В одном варианте осуществления ген-мишень кодирует тяжелую цепь миозина (например, у насекомых ортолог белка CG17927 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 122 и 131. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 331. В одном варианте осуществления ген-мишень кодирует цитоплазматический белок легкой цепи миозина (например, у насекомых ортолог белка CG3201 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 124 и 133. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 333. В одном варианте осуществления ген-мишень кодирует белок spaghetti squash (например, у насекомых ортолог белка CG3595 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 125 и 134. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 334. В одном варианте осуществления ген-мишень кодирует белок zipper (например, у насекомых ортолог белка CG15792 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 126 и 135. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 335. В одном варианте осуществления ген-мишень кодирует тропонин C (например, у насекомых ортолог белка CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 или CG6514 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 127 и 136. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 336 и 337.

Согласно другому варианту осуществления настоящее изобретение относится к интерферирующей РНК, которая содержит по меньшей мере одну двухцепочечную область, как правило, сайленсирующий элемент молекулы интерферирующей РНК, содержащий смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, где смысловая цепь молекулы dsRNA содержит последовательность по меньшей мере из 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98%, 99% или 100% комплементарной последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени, который кодирует рибосомный белок насекомых. В одном варианте осуществления ген-мишень кодирует рибосомный белок S3A (например, у насекомых ортолог белка CG2168 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 11 и 12. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 84. В одном варианте осуществления ген-мишень кодирует рибосомный белок LP1 (например, у насекомых ортолог белка CG4087 Dm), при этом указанный ген-мишень представлен посредством SEQ ID NO: 3 и 4. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 80. В одном варианте осуществления ген-мишень кодирует рибосомный белок S3 (например, у насекомых ортолог белка CG6779 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 7 и 8.В одном варианте осуществления ген-мишень кодирует рибосомный белок L10Ab (например, у насекомых ортолог белка CG7283 Dm), представленный с помощью SEQ ID NO: 9 и 10. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 83. В одном варианте осуществления ген-мишень кодирует рибосомный белок S18 (например, у насекомых ортолог белка CG8900 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 13 и 14. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 85. В одном варианте осуществления ген-мишень кодирует рибосомный белок L4 (например, у насекомых ортолог белка CG5502 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 5 и 6. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 81. В одном варианте осуществления ген-мишень кодирует рибосомный белок S27 (например, у насекомых ортолог белка CG10423 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 15 и 16. В одном варианте осуществления ген-мишень кодирует рибосомный белок L6 (например, у насекомых ортолог белка CG11522 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 17 и 18. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 87. В одном варианте осуществления ген-мишень кодирует рибосомный белок S13 (например, у насекомых ортолог белка CG13389 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 19 и 20. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 88. В одном варианте осуществления ген-мишень кодирует рибосомный белок L12 (например, у насекомых ортолог белка CG3195 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 21 и 22. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 89. В одном варианте осуществления ген-мишень кодирует рибосомный белок L26 (например, у насекомых ортолог белка CG6846 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 158 и 159. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 343. В одном варианте осуществления ген-мишень кодирует рибосомный белок L21 (например, у насекомых ортолог белка CG12775 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 165, 166 и 167. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 347 и 348. В одном варианте осуществления ген-мишень кодирует рибосомный белок S12 (например, у насекомых ортолог белка CG11271 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 156 и 157. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 342. В одном варианте осуществления ген-мишень кодирует рибосомный белок S28b (например, у насекомых ортолог белка CG2998 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 160 и 161. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 344. В одном варианте осуществления ген-мишень кодирует рибосомный белок L13 (например, у насекомых ортолог белка CG4651 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 154 и 155. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 341. В одном варианте осуществления ген-мишень кодирует рибосомный белок L10 (например, у насекомых ортолог белка CG17521 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 163 и 164. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 345. В одном варианте осуществления ген-мишень кодирует рибосомный белок L5 (например, у насекомых ортолог белка CG17489 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 152 и 153. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 340. В одном варианте осуществления ген-мишень кодирует рибосомный белок S15Aa (например, у насекомых ортолог белка CG2033 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 150 и 151. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 339. В одном варианте осуществления ген-мишень кодирует рибосомный белок L19 (например, у насекомых ортолог белка CG2746 Dm) или рибосомный белок L27 (например, у насекомых ортолог белка CG4759 Dm). В одном варианте осуществления ген-мишень кодирует белок субъединицы II митохондриальной цитохром-с-оксидазы (например, у насекомых ортолог белка CG34069 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 25 и 26. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 91. В одном варианте осуществления ген-мишень кодирует γ-цепь АТФ-синтазы (например, у насекомых ортолог белка CG7610 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 129 и 138. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 338. В одном варианте осуществления ген-мишень кодирует убиквитин-5E (например, у насекомых ортолог белка CG32744 Dm). В одном варианте осуществления ген-мишень кодирует протеасомную субъединицу бета-типа (например, у насекомых ортолог белка CG17331 Dm), белок, который является у насекомых ортологом белка CG13704 Dm; и белок Rpn12 (например, у насекомых ортолог белка CG4157 Dm).

В соответствии со вторым аспектом настоящего изобретения предусматривается композиция для предотвращения и/или борьбы с нападением насекомых-вредителей, содержащая по меньшей мере одну интерферирующую рибонуклеиновую кислоту (РНК) и по меньшей мере один подходящий носитель, наполнитель или разбавитель, причем интерферирующая РНК функционирует при поглощении насекомым с подавлением экспрессии гена-мишени у указанного вредителя,

при этом РНК содержит по меньшей мере один сайленсирующий элемент, при этом сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей по меньшей мере на 75% идентична любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или имеющую такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75% идентичной любому соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75% идентична любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389.

Композицию по настоящему изобретению можно применять для предотвращения и/или борьбы с нападением вредителя. В некоторых вариантах осуществления композицию можно применять в качестве пестицида для растения или для материала для размножения или репродуктивного материала растения. В дополнительном аспекте предусматривается комбинация для предотвращения и/или борьбы с нападением насекомых-вредителей, содержащая композицию по настоящему изобретению и по меньшей мере одно активное средство.

В дополнительном аспекте в данном документе предусматривается способ подавления экспрессии гена-мишени у вида насекомого-вредителя с целью предотвращения и/или борьбы с нападением вредителей, включающий приведение в контакт указанного вида вредителя с эффективным количеством по меньшей мере одной интерферирующей рибонуклеиновой кислоты (РНК), причем интерферирующая РНК функционирует при поглощении вредителем с подавлением экспрессии гена-мишени у указанного вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 указанная нуклеотидная последовательность являлась бы по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 указанная нуклеотидная последовательность указанного фрагмента являлась бы по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, при этом два ортологических гена являются подобными в последовательности до такой степени, что, при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389.

В соответствии с дополнительным аспектом настоящего изобретения предусматривается выделенный полинуклеотид, выбранный из группы, состоящей из:

(i) полинуклеотида, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, которая представлена любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательностью, или

(ii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(iii) полинуклеотида, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, которая представлена в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, таким образом, чтобы при оптимальном выравнивании и сравнении двух последовательностей указанный полинуклеотид являлся по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичным любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или

(iv) полинуклеотида, который содержит фрагмент по меньшей мере, из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, и при этом указанный фрагмент или указанная комплементарная последовательность обладают такой нуклеотидной последовательностью, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, или

(v) полинуклеотида, который содержит фрагмент по меньшей мере, из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, и при этом указанный фрагмент или указанная комплементарная последовательность обладают такой нуклеотидной последовательностью, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарную ей последовательность, или

(vi) полинуклеотида, кодирующий аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 и

при этом указанный полинуклеотид составляет не более, чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов.

Аминокислотные последовательности, кодируемые генами-мишенями по настоящему изобретению представлены SEQ ID NO: 79, 349, 352, 356, 80, 326, 81, 327, 82, 83, 328, 84, 329, 85, 86, 359, 87-91, 330, 350, 353, 331, 351, 332-336, 337, 354, 338-344, 346, 345, 347, 348, 357, 355, 358, 390-393, соответственно.

В конкретном аспекте по настоящему изобретению выделенный полинуклеотид является частью молекулы интерферирующей РНК, как правило, частью сайленсирующего элемента, содержащего по меньшей мере одну двухцепочечную область, содержащую смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, где смысловая цепь молекулы dsRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени. Более конкретно, выделенный полинуклеотид клонирован в конструкцию ДНК в смысловой и антисмысловой ориентации так, что при транскрипции смыслового и антисмыслового полинуклеотида формируется молекула dsRNA, которая функционирует при поглощении вредителем с ингибированием или подавлением экспрессии гена-мишени в указанном вредителе.

В одном варианте осуществления настоящее изобретение относится к выделенному полинуклеотиду, который клонирован в конструкцию ДНК в смысловой и антисмысловой ориентации так, что при транскрипции смыслового и антисмыслового полинуклеотида формируется молекула dsRNA, которая функционирует при поглощении насекомым с ингибированием или подавлением экспрессии гена-мишени в пределах комплекса тропонин/миофиламент.

В одном варианте осуществления ген-мишень кодирует белок wings up A (тропонин I) насекомых (например, у насекомых ортолог белка CG7178 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 1 и 2. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 79. В одном варианте осуществления ген-мишень кодирует белок upheld (например, у насекомых ортолог белка CG7107 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 121 и 130. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 330. В одном варианте осуществления ген-мишень кодирует белок тропомиозин 1 (например, у насекомых ортолог белка CG4898 Dm), или белок тропомиозин 2 (например, у насекомых ортолог белка CG4843 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 123 и 132. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 332. В одном варианте осуществления ген-мишень кодирует тяжелую цепь миозина (например, у насекомых ортолог белка CG17927 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 122 и 131. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 331. В одном варианте осуществления ген-мишень кодирует цитоплазматический белок легкой цепи миозина (например, у насекомых ортолог белка CG3201 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 124 и 133. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 333. В одном варианте осуществления ген-мишень кодирует белок spaghetti squash (например, у насекомых ортолог белка CG3595 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 125 и 134. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 334. В одном варианте осуществления ген-мишень кодирует белок zipper (например, у насекомых ортолог белка CG15792 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 126 и 135. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 335. В одном варианте осуществления ген-мишень кодирует тропонин C (например, у насекомых ортолог белка CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 или CG6514 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 127 и 136. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 336 и 337.

В соответствии с другими вариантами осуществления настоящее изобретение относится к выделенному полинуклеотиду, который клонирован в конструкцию ДНК в смысловой и антисмысловой ориентации так, что при транскрипции смыслового и антисмыслового полинуклеотида формируется молекула dsRNA, которая функционирует при поглощении насекомым с ингибированием или подавлением экспрессии гена-мишени, который кодирует рибосомный белок насекомых.

В одном варианте осуществления ген-мишень кодирует рибосомный белок S3A (например, у насекомых ортолог белка CG2168 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 11 и 12. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичностью с SEQ ID NO: 84. В одном варианте осуществления ген-мишень кодирует рибосомный белок LP1 (например, у насекомых ортолог белка CG4087 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 3 и 4. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 80. В одном варианте осуществления ген-мишень кодирует рибосомный белок S3 (например, у насекомых ортолог белка CG6779 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 7 и 8. В одном варианте осуществления ген-мишень кодирует рибосомный белок L10Ab (например, у насекомых ортолог белка CG7283 Dm), представленный с помощью SEQ ID NO: 9 и 10. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 83. В одном варианте осуществления ген-мишень кодирует рибосомный белок S18 (например, у насекомых ортолог белка CG8900 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 13 и 14. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 85. В одном варианте осуществления ген-мишень кодирует рибосомный белок L4 (например, у насекомых ортолог белка CG5502 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 5 и 6. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 81. В одном варианте осуществления ген-мишень кодирует рибосомный белок S27 (например, у насекомых ортолог белка CG10423 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 15 и 16. В одном варианте осуществления ген-мишень кодирует рибосомный белок L6 (например, у насекомых ортолог белка CG11522 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 17 и 18. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 87. В одном варианте осуществления ген-мишень кодирует рибосомный белок S13 (например, у насекомых ортолог белка CG13389 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 19 и 20. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 88. В одном варианте осуществления ген-мишень кодирует рибосомный белок L12 (например, у насекомых ортолог белка CG3195 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 21 и 22. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 89. В одном варианте осуществления ген-мишень кодирует рибосомный белок L26 (например, у насекомых ортолог белка CG6846 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 158 и 159. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 343. В одном варианте осуществления ген-мишень кодирует рибосомный белок L21 (например, у насекомых ортолог белка CG12775 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 165, 166 и 167. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 347 и 348. В одном варианте осуществления ген-мишень кодирует рибосомный белок S12 (например, у насекомых ортолог белка CG11271 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 156 и 157. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 342. В одном варианте осуществления ген-мишень кодирует рибосомный белок S28b (например, у насекомых ортолог белка CG2998 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 160 и 161. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 344. В одном варианте осуществления ген-мишень кодирует рибосомный белок L13 (например, у насекомых ортолог белка CG4651 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 154 и 155. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 341. В одном варианте осуществления ген-мишень кодирует рибосомный белок L10 (например, у насекомых ортолог белка CG17521 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 163 и 164. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 345. В одном варианте осуществления ген-мишень кодирует рибосомный белок L5 (например, у насекомых ортолог белка CG17489 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 152 и 153. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 340. В одном варианте осуществления ген-мишень кодирует рибосомный белок S15Aa (например, у насекомых ортолог белка CG2033 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 150 и 151. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 339. В одном варианте осуществления ген-мишень кодирует рибосомный белок L19 (например, у насекомых ортолог белка CG2746 Dm) или рибосомный белок L27 (например, у насекомых ортолог белка CG4759 Dm).

Предпочтительно, способы по настоящему изобретению находят практическое применение в предотвращении и/или борьбе с нападением насекомых-вредителей, в частности, борьбе с нападением вредителей сельскохозяйственных культур, таких как, но без ограничений, хлопчатник, картофель, рис, клубника, люцерна, соя, помидор, канола, подсолнечник, сорго, просо, кукуруза, баклажан, перец и табак. В дополнение, интерферирующую РНК по настоящему изобретению можно вводить в растения, подлежащие защите, с помощью обычных методов генной инженерии.

Во всех аспектах настоящего изобретения в предпочтительных вариантах осуществления ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 указанная нуклеотидная последовательность указанного фрагмента является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75% предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233.

Эти гены-мишени кодируют белки, входящие в состав комплекса тропонин/миофиламент.

Во всех аспектах настоящего изобретения в предпочтительных вариантах осуществления ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 указанная нуклеотидная последовательность указанного фрагмента является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75% предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из последовательностей, представленных в SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или,

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273.

Эти гены-мишени кодируют рибосомальные белки насекомых.

Во всех аспектах настоящего изобретения в предпочтительных вариантах осуществления ген-мишень (i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313.

Краткое описание таблиц и фигур

Таблица 1: Новые мишени Lygus hesperus, идентифицированные из первого анализа.

Таблица 1B: Новые мишени Lygus hesperus в пути Lh594.

Таблица 1C: Новые мишени Lygus hesperus, идентифицированные из второго цикла анализа.

Таблица 2: Полинуклеотидные последовательности генов-мишеней, идентифицированные у Lygus hesperus.

Таблица 3: Аминокислотные последовательности генов-мишеней, идентифицированные у Lygus hesperus.

Таблица 4: dsRNA (смысловая цепь, представленная эквивалентной последовательностью ДНК), соответствующие генам-мишеням Lygus hesperus и праймерам для продуцирования dsRNA.

Таблица 5: Ранжирование мишеней Lygus hesperus в соответствии с кривыми дозовой зависимости (DRC) и по сравнению с исходными мишенями Lh423 и Lh105.

Таблица 6: Мишени Lygus hesperus из второго цикла анализа-ранжирования в соответствии с DRC и по сравнению с исходными мишенями Lh423 и Lh594.

Таблица 7: Полинуклеотидные последовательности генов-мишеней, идентифицированные у колорадского жука (CPB).

Таблица 8: Аминокислотные последовательности генов-мишеней, идентифицированные у CPB.

Таблица 9: dsRNA (смысловая цепь, представленная эквивалентной последовательностью ДНК), соответствующие CPB генам-мишеням и праймерам для продуцирования dsRNA.

Таблица 10: Полинуклеотидные последовательности генов-мишеней, идентифицированные у коричневого дельфацида (BPH).

Таблица 11: Аминокислотные последовательности генов-мишеней, идентифицированные у BPH.

Таблица 12: dsRNA (смысловая цепь, представленная эквивалентной последовательностью ДНК), соответствующие BPH генам-мишеням и праймерам для продуцирования dsRNA.

Таблица 13: Праймеры, используемые для амплификации cDNA тлей, на основе геномной последовательности гороховой тли.

Таблица 14: Полинуклеотидные последовательности генов-мишеней, идентифицированные у тлей.

Таблица 15: Аминокислотные последовательности генов-мишеней, идентифицированные у тлей.

Таблица 16: dsRNA (смысловая цепь, представленная эквивалентной последовательностью ДНК), соответствующие генам-мишеням тлей и праймерам для продуцирования dsRNA.

Таблица 17: Вырожденные праймеры, используемые для амплификации CPB Ld594 cDNA.

Таблица 18: Вырожденные праймеры, используемые для амплификации BPH cDNA.

Таблица 19: Новые мишени Leptinotarsa decemlineata из данного теста.

Таблица 20: Новые идентифицированные мишени Nilaparvata lugens.

Таблица 21: Новые идентифицированные мишени Acyrthosiphon pisum.

Фигура 1: Полоски Lh001_009 второго подтверждающего анализа. Темные полосы: смертность в день 3-6, светлые полосы: смертность в день 6-8. Кандидатные клоны названы с применением «Lygxxx» скрининговых кодов и «Lhxxx» номенклатурных кодов мишеней.

Фигура 2: Полоски Lh010_020 второго подтверждающего анализа. Темные полосы: смертность в день 3-6, светлые полосы: смертность в день 6-8. Кандидатные клоны названы с применением «Lygxxx» скрининговых кодов и «Lhxxx» номенклатурных кодов мишеней.

Фигура 3: Анализ смертности новых мишеней Lygus из полосок Lh001-Lh009, выражен в % смертности за 10-дневный период. Контроли обозначены пунктирными линиями. Положительный контроль: Lh423 dsRNA (RpL19). Отрицательные контроли: GFP dsRNA и только корм (контроль).

Фигура 4: Анализ смертности новых мишеней Lygus из полосок Lh010-Lh020, выражен в % смертности за 10-дневный период. Контроли обозначены пунктирными линиями. Положительный контроль: Lh423 (RpL19). Отрицательные контроли: GFP и только корм (контроль).

Фигуры 5-9: Новые мишени Lygus hesperus - кривые дозовой зависимости при концентрациях очищенной синтетической dsRNA в диапазоне от 0,4 до 0,025 мкг/мкл (на фигуре единица измерения «мкг/мкл» не отображена). GFP dsRNA и воду milliQ применяли как отрицательные контроли. dsRNA мишеней получали с использованием праймеров, как описано в примерном разделе 1.1.

Фигура 10: Lh594 кривая дозовой зависимости, при концентрациях dsRNA в диапазоне от 0,05 до 0,001 мкг/мкл. GFP dsRNA и воду milliQ применяли как отрицательные контроли.

Фигура 11 A: dsRNA активность в биопробе Lygus hesperus в отсутствие tRNA. Lh594 (5 мкг/мкл); положительный контроль: Lh423 (5 мкг/мкл); отрицательные контроли: GFP dsRNA (5 мкг/мкл) и вода milliQ; B: Идентификация Lh594 предела активности с использованием уменьшающейся концентрации dsRNA (от 5 мкг до 0,25 мкг). Отрицательные контроли: GFP dsRNA (5 мкг/мкл) и вода milliQ.

Подробное описание настоящего изобретения

Авторы настоящего изобретения обнаружили, что подавление экспрессии конкретных генов-мишеней у видов насекомых-вредителей с помощью RNAi можно применять для эффективного предотвращения и/или борьбы с нападением указанного насекомого-вредителя.

Применяемый в данном документе термин «борьба» с нападением вредителей относится к любому воздействию на вредителя, которое служит для ограничения и/или уменьшения количества организмов вредителей и/или повреждения, вызываемого вредителем. Предпочтительные гены-мишени являются, следовательно, жизненно важными генами, которые контролируют или регулируют одну или более жизненно важные биологические функции у насекомых-вредителей, например, деление клеток, размножение, энергетический обмен, пищеварение, неврологическая функция и тому подобное. Подавление данных жизненно важных генов с помощью RNAi методов может вести к гибели насекомого или иным образом значительно замедлять рост и развитие, или нарушать способность вредителей колонизировать место обитания или нападать на организмы-хозяева.

Авторы настоящего изобретения в настоящее время идентифицировали лучшие гены-мишени видов насекомых-вредителей, принадлежащих к Lygus, Leptinotarsa, Nilaparvata и Acyrthosiphum родам, чьи мишени предусматриваются для применения в отдельности или в комбинации в качестве эффективных средств для RNAi-опосредованной борьбы с нападением насекомых на, например, агрономически важные культуры. Ортологи этих недавно идентифицированных генов-мишеней можно использовать у других видов насекомых для борьбы с нападением насекомых на соответствующие значимые культуры.

Более конкретно, авторы настоящего изобретения описывают в данном документе, что гены, кодирующие белки комплекса тропонин/миофиламент, образуют отличные гены-мишени для подавления с помощью методики РНК-ингибирования. Один из данных генов-мишеней кодировал белок тропонин I (wings up A) насекомых, который является ортологом белка CG7178 дрозофилы. Данный белок участвует в мышечных сокращениях и принадлежит к физиологическому пути, который еще не полностью исследован для борьбы с (насекомыми) вредителями посредством РНК-ингибирования. Кроме того, поскольку данный белковый комплекс является специфичным для животных, не известен ни один гомолог или ортолог генов растений, что снижает риск нетипичных фенотипов растений при экспрессии dsRNA-мишени в растениях. В дополнение, у дрозофилы тропонин I описывается как гаплонедостаточный ген, проявляющий мутантный фенотип в гетерозиготном состоянии. Такие гены особенно восприимчивы к снижению уровней экспрессии mRNA, и как таковые могут считаться идеальными мишенями RNAi.

Дополнительные вызывающие интерес гены-мишени в данном комплексе тропонин/миофиламент перечислены ниже.

ID аннотации Цитология Dm идентификатор
up upheld CG7107
Tm1 тропомиозин 1 CG4898
Tm2 тропомиозин 2 CG4843
Mhc тяжелая цепь миозина CG17927
Mlc-c цитоплазматическая легкая цепь миозина CG3201
sqh spaghetti squash CG3595
zip zipper CG15792

Таким образом, в соответствии с одним вариантом осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 указанная нуклеотидная последовательность указанного фрагмента является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75% предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233.

В предпочтительном варианте осуществления ген-мишень кодирует белок насекомых, выбранный из комплекса тропонин/миофиламент, выбранный из группы, включающей тропонин I (например, у насекомых ортолог белка CG7178 Dm), белок upheld (например, у насекомых ортолог белка CG7107 Dm), белок тропомиозин 1 (например, у насекомых ортолог белка CG4898 Dm), белок тропомиозин 2 (например, у насекомых ортолог белка CG4843 Dm), тяжелая цепь миозина (например, у насекомых ортолог белка CG17927 Dm), цитоплазматический белок легкой цепи миозина (например, у насекомых ортолог белка CG3201 Dm), белок spaghetti squash (например, у насекомых ортолог белка CG3595 Dm), белок zipper (например, у насекомых ортолог белка CG15792 Dm), тропонин C (например, у насекомых ортолог белка CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 или CG6514 Dm).

В других вариантах осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 указанная нуклеотидная последовательность указанного фрагмента является по меньшей мере на 75%, предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75% предпочтительно по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из последовательностей, представленных в SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273.

В предпочтительном варианте осуществления ген-мишень кодирует рибосомный белок насекомых, выбранный из группы, содержащей рибосомный белок S3A (например, у насекомых ортолог белка CG2168 Dm), рибосомный белок LP1 (например, у насекомых ортолог белка CG4087 Dm), рибосомный белок S3 (например, у насекомых ортолог белка CG6779 Dm), рибосомный белок L10Ab (например, у насекомых ортолог белка CG7283 Dm), рибосомный белок S18 (например, у насекомых ортолог белка CG8900 Dm), рибосомный белок L4 (например, у насекомых ортолог белка CG5502 Dm), рибосомный белок S27 (например, у насекомых ортолог белка CG10423 Dm), рибосомный белок L6 (например, у насекомых ортолог белка CG11522 Dm), рибосомный белок S13 (например, у насекомых ортолог белка CG13389 Dm), и рибосомный белок L12 (например, у насекомых ортолог белка CG3195 Dm), рибосомный белок L26 (например, у насекомых ортолог белка CG6846 Dm), рибосомный белок L21 (например, у насекомых ортолог белка CG12775 Dm), рибосомный белок S12 (например, у насекомых ортолог белка CG11271 Dm), рибосомный белок S28b (например, у насекомых ортолог белка CG2998 Dm), рибосомный белок L13 (например, у насекомых ортолог белка CG4651 Dm), рибосомный белок L10 (например, у насекомых ортолог белка CG17521 Dm), рибосомный белок L5 (например, у насекомых ортолог белка CG17489 Dm), рибосомный белок S15Aa (например, у насекомых ортолог белка CG2033 Dm), рибосомный белок L19 (например, у насекомых ортолог белка CG2746 Dm), рибосомный белок L27 (например, у насекомых ортолог белка CG4759 Dm).

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313.

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 141, 11 12, или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 141, 11 12, или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 141, 11 12, или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 141, 11 12, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 141, 11 12, или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 141, 11, 12 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 141, 11, 12 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 141, 11, 12 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 141, 11 12, или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 141, 11 12, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 141, 11 12.

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 17, 18, или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 17, 18, или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 17, 18 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 17, 18 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 17, 18 или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 17, 18 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 17, 18 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 17, 18 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 17, 18, или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 17, 18, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 17, 18.

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 19, 20, или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 19, 20, или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 19, 20 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 19, 20, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 19, 20, или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 19, 20 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 19, 20 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 19, 20 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 19, 20, или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 19, 20, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 19, 20.

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 165, 166, 167 или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 165, 166, 167 или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 165, 166, 167 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 165, 166, 167 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 165, 166, 167 или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 165, 166, 167 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 17, 18 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 165, 165, 167 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 165, 166, 167 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 165, 166, 167, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 165, 166, 167.

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183, или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183, или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183.

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 145, 122, 144, 178, 131, 179 или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 145, 122, 144, 178, 131, 179 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 145, 122, 144, 178, 131, 179, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 145, 122, 144, 178, 131, 179.

В одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 128, 149, 184, 137 или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 128, 149, 184, 137 или комплементарной ей последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 128, 149, 184, 137 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 128, 149, 184, 137 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 128, 149, 184, 137 или комплементарной ей последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 128, 149, 184, 137 или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 128, 149, 184, 137 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 128, 149, 184, 137 или комплементарной ей последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 128, 149, 184, 137 или комплементарную ей последовательность, где два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 128, 149, 184, 137 или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 128, 149, 184, 137.

В еще одном варианте осуществления настоящее изобретение относится к интерферирующей рибонуклеиновой кислоте (РНК или двухцепочечной РНК), которая подавляет экспрессию гена-мишени, кодирующего белок субъединицы II митохондриальной цитохром-с-оксидазы (например, у насекомых ортолог белка CG34069 Dm).

Таким образом, в одном аспекте настоящее изобретение предлагает интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя.

Применяемый в данном документе термин «ген-мишень» включает любой ген у насекомого-вредителя, который предполагается подавить. В предпочтительном варианте осуществления ген-мишень подавляется так, чтобы бороться с нападением вредителя, например, путем нарушения жизненно важного биологического процесса, происходящего у вредителя, или путем уменьшения патогенности вредителя. Предпочтительные гены-мишени, следовательно, включают, но без ограничений, те, которые играют ключевую роль в регуляции питания, выживания, роста, развития, размножения, нападения и способности вызывать поражение. В соответствии с одним вариантом осуществления ген-мишень является таковым, что при подавлении или ингибировании его экспрессии насекомое-вредитель погибает. В соответствии с другим вариантом осуществления ген-мишень является таковым, что при подавлении или ингибировании его экспрессии рост вредителя предотвращается или замедляется, или останавливается, или задерживается, или затрудняется, размножение вредителя предотвращается, или предотвращается переход через жизненные циклы вредителя. В соответствии еще с другим вариантом осуществления настоящего изобретения ген-мишень является таковым, что при подавлении или ингибировании его экспрессии повреждение, вызванное вредителем и/или способностью вредителя поражать или нападать на место обитания, поверхности и/или растение, или сельскохозяйственную культуру уменьшается; или вредитель прекращает питаться из своих природных пищевых ресурсов, таких как растения и растительные продукты. Термины «нападать» и «поражать» или «нападение» и «поражение», как правило, используются взаимозаменяемо повсеместно.

Гены-мишени могут экспрессироваться во всех или некоторых клетках насекомых-вредителей. Кроме того, гены-мишени могут экспрессироваться насекомым-вредителем только на определенной стадии его жизненного цикла, например, зрелой стадии имаго, незрелой нимфы или личиночной стадии, или стадии яйца.

Применяемые в данном документе виды «вредителей» предпочтительно являются видами насекомых, которые вызывают поражение или нападают, предпочтительно на растения. Виды насекомых могут включать и виды, принадлежащие к отрядам Coleoptera, Lepidoptera, Diptera, Dichyoptera, Orthoptera, Hemiptera или Siphonaptera.

Предпочтительными насекомыми, патогенными для растений, в соответствии с настоящим изобретением, являются вредители растений, выбранные из группы, включающей Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук), или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Laodelphax spp. (например, L. striatellus (малый коричневый дельфацид)); Nephotettix spp. (например, N. virescens, или N. cincticeps (зеленая рисовая цикадка), или N.nigropictus (рисовая цикадка)); Sogatella spp. (или S. furcifera (белоспинный рисовый дельфацид)); Chilo spp. (например, C. suppressalis (огневка азиатская стеблевая), C. auricilius (огневка Chilo auricilius), или C. polychrysus (темноголовая рисовая огневка)); Sesamia spp. (например, S. inferens (розовый сверлильщик)); Tryporyza spp. (например, T. innotata (огневка Tryporyza innotata), или T. incertulas (желтый рисовый сверлильщик)); Anthonomus spp. (например, A. grandis (долгоносик хлопковый)); Phaedon spp. (например, P. cochleariae (хреновый листоед)); Epilachna spp. (например, E. varivetis (зерновка бобовая мексиканская)); Tribolium spp. (например, T. castaneum (хрущак каштановый)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук), D. virgifera zeae (мексиканский кукурузный корнегрыз); Ostrinia spp. (например, O. nubilalis (огневка кукурузная)); Anaphothrips spp. (например, A. obscrurus (трипс злаковый)); Pectinophora spp. (например, P. gossypiella (розовый коробочный червь хлопчатника)); Heliothis spp. (например, H. virescens (табачная листовертка)); Trialeurodes spp. (например, T. abutiloneus (белокрылка Trialeurodes abutiloneus) T. vaporariorum (белокрылка тепличная)); Bemisia spp. (например, B. argentifolii (белокрылка магнолиевая)); Aphis spp. (например, A. gossypii (тля хлопковая)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Euschistus spp. (например, E. conspersus (клоп Euschistus conspersus)); Chlorochroa spp. (например, C. sayi (клоп Сэя)); Nezara spp. (например, N. viridula (зеленый овощной клоп)); Thrips spp. (например, T. tabaci (трипс луковый)); Frankliniella spp. (например, F. fusca (трипс табачный), или F. occidentalis (западный цветочный трипс)); Acheta spp. (например, A. domesticus (сверчок домовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Macrosiphum spp. (например, M. euphorbiae (тля картофельная большая)); Blissus spp. (например, B. leucopterus leucopterus (клоп-черепашка пшеничный североамериканский)); Acrosternum spp. (например, A. hilare (клоп-щитник Acrosternum hilare)); Chilotraea spp. (например, C. polychrysa (огневка Chilotraea polychrysa)); Lissorhoptrus spp. (например, L. oryzophilus (долгоносик рисовый водяной)); Rhopalosiphum spp. (например, R. maidis (тля кукурузная)); и Anuraphis spp. (например, A. maidiradicis (тля кукурузная корневая)).

В соответствии с более конкретным вариантом осуществления настоящее изобретение применимо к видам, принадлежащим к семейству Chrysomelidae или листоеды. Жуки листоеды, такие как колорадские жуки, блошки, кукурузные корневые жуки, и долгоносики, такие как долгоносик люцерновый, являются особенно важными вредителями. Конкретные виды рода Leptinotarsa, контролируемые в соответствии с настоящим изобретением, включают колорадского жука (Leptinotarsa decemlineata (Say)) и ложного картофельного жука (Leptinotarsa juncta (Say)). CPB является (серьезным) вредителем нашего домашнего картофеля, других культурных и диких клубненосных и неклубненосных видов картофеля и других видов растений семейства Solanaceous (пасленовых), включая сельскохозяйственные культуры помидоров, баклажанов, перцев, табака (виды рода Nicotiana, включая декоративные), физалиса, риса, кукурузы или хлопка; и виды сорняков/травянистых растений, паслен каролинский, черный паслен, дурман обыкновенный, белену и паслен клювообразный. Кукурузные корневые жуки включают виды, основывающие род Diabrotica (например, D. undecimpunctata undecimpunctata, D. undecimpunctata howardii, D. longicornis, D. virgifera и D. balteata). Кукурузные корневые жуки причиняют существенный вред кукурузе и тыквенным.

В соответствии с более конкретным вариантом осуществления настоящее изобретение применимо к видам, принадлежащим к отряду Hemipterans (семейство Aphidoidea), таким как Myzus persicae (тля персиковая зеленая), Aphis fabae (тля свекловичная), Acyrthosiphum pisum (тля гороховая), Brevicoryne brassicae (тля капустная), Sitobion avenae (тля большая злаковая), Cavariella aegopodii (тля зонтичная), Aphis craccivora (тля арахисовая), Aphis gossypii (тля хлопковая), Toxoptera aurantii (тля померанцевая), Cavariella spp (тля тминная), Chaitophorus spp (тли рода Chaitophorus), Cinara spp.(тли рода Cinara), Drepanosiphum platanoides (тля яворовая), Elatobium spp (тли рода Elatobium), которые вызывают повреждение растений, таких как деревья рода слива, в частности, персик, абрикос и слива; деревьев, которые в основном культивируются для производства древесины, таких как ивы и тополя, пропашных культур, таких как кукуруза, хлопок, соя, пшеница и рис, овощных культур из семейств Solanaceae, Chenopodiaceae, Compositae, Cruciferae и Cucurbitaceae, включая, но без ограничений, артишок, спаржу, фасоль, свеклу, брокколи, брюссельскую капусту, кочанную капусту, морковь, цветную капусту, мускусную дыню, сельдерей, кукурузу, огурцы, укроп, капусту кормовую, кольраби, репу, баклажан, салат, горчицу, бамию, петрушку, пастернак, горох, перец, картофель, редис, шпинат, тыкву, помидор, репу, кресс водяной и арбуз; или полевых культур, таких как, но без ограничений, табак, сахарная свекла и подсолнечник; цветочных культур или других декоративных растений, таких как сосны и хвойные деревья. Другие Hemipterans относятся к Nilaparvata ssp (например, N. lugens, Sogatella furcifera) и причиняют вред растениям риса. Другие Hemipterans относятся к Lygus ssp (например, Lygus hesperus, Lygus rugulipennis, Lygus lineolaris, Lygus sully) и другим видам растительноядных насекомых в семействе Miridae, и причиняют вред хлопку, растениям картофеля, клубнике, хлопку, люцерне, каноле, персику, сливам, винограду, латуку, баклажану, луку, зеленым бобам. А также некоторым средиземноморским деревьям и некоторым декоративным деревьям, таким как вяз (Ulmus spp.), кедровый орех (Pinus Pinea), платан кленолистный (Platanus Acerifolia), яблоня (Malus alba). Другие Hemipterans относятся к семейству Pentatomoidea, их обычно называют щитники, лесные клопы и клопы-вонючки (например, коричневый мраморный щитник (Halyomorpha halys), клоп-щитник (Euschistus conspersus), зеленый овощной клоп (Nezara viridula), щитник красноногий (Pentatoma rufipes), клоп капустный (Murgantia histrionica), клоп (Oebalus pugnax)), и они наносят ущерб плодам, включая яблоки, персики, инжир, шелковицу, плодам цитрусовых и хурме, ежевике, и овощам, включая сахарную кукурузу, помидоры, соевые бобы, фасоль лимскую и паприку, капусту, цветную капусту, репу, хрен, капусту кормовую, горчицу, брюссельскую капусту, картофель, баклажаны, бамию, бобы, спаржу, свеклу, сорняки, фруктовые деревья и полевые культуры, такие как полевая кукуруза и соевые бобы. Щитники также являются вредителями трав, сорго и риса.

Растение для применения в способах по настоящему изобретению или трансгенное растение в соответствии с настоящим изобретением охватывает любое растение, но предпочтительно является растением, которое является восприимчивым к нападению насекомых, патогенных для растения.

Соответственно, настоящее изобретение распространяется на растения и на способы, описываемые в данном документе, где растение выбирают из следующей группы растений (или сельскохозяйственных культур): люцерна, яблоня, абрикос, артишок, спаржа, авокадо, банан, ячмень, бобы, свекла, ежевика, черника, брокколи, брюссельская капуста, капуста, канола, морковь, маниока, цветная капуста, зерновые, сельдерей, вишня, цитрусы, клементины, кофе, кукуруза, хлопок, огурцы, баклажаны, эндивий, эвкалипт, инжир, виноград, грейпфрут, арахис, физалис, киви, латук, лук-порей, лимон, лайм, сосна, кукуруза, манго, дыня, просо, грибы, орехи, овес, бамия, лук, апельсин, декоративное растение или цветок, или дерево, папайя, петрушка, горох, персики, арахис, торфяной мох, перец, хурма, ананас, подорожник, слива, гранат, картофель, тыква, красный эндивий, редис, рапсовое семя, малина, рис, рожь, сорго, соя, соевые бобы, шпинат, клубника, сахарная свекла, сахарный тростник, подсолнечник, сладкий картофель, мандарин, чай, табак, помидоры, виноград культурный, арбуз, пшеница, ямс и кабачок.

В конкретных вариантах осуществления настоящее изобретение предусматривает гены-мишени, которые кодируют белки, участвующие в функции белка wings up A (тропонина I), субъединицы II митохондриальной цитохром-с-оксидазы или одного из рибосомных белков, как указано в таблице 1.

В предпочтительных вариантах осуществления настоящее изобретение предусматривает гены-мишени, которые выбраны из группы генов (i) имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, или (ii) имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, или (iii) имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарной ей последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, или (iv) имеющих нуклеотидную последовательность, содержащую фрагмент из, по меньшей мере, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно по меньшей мере 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, или (v) имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или (vi) ген которой у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что, при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389,

и где нуклеотидная последовательность указанного гена составляет не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов.

Аминокислотные последовательности, кодируемые генами-мишенями по настоящему изобретению, представлены SEQ ID NO: 79, 349, 352, 356, 80, 326, 81, 327, 82, 83, 328, 84, 329, 85, 86, 359, 87-91, 330, 350, 353, 331, 351, 332-336, 337, 354, 338-344, 346, 345, 347, 348, 357, 355, 358, 390-393.

Применяемый в данном документе термин «обладающий» имеет такое же значение, как «содержащий».

Применяемый в данном документе термин «идентичность последовательностей» используется для описания сходства последовательностей между двумя или более нуклеотидными или аминокислотными последовательностями. Процент «идентичности последовательностей» между двумя последовательностями определяется путем сравнения двух оптимально выровненных последовательностей в окне сравнения (определенное число положений), при этом часть последовательности в окне сравнения может содержать присоединения или делеции (т.е. пробелы) по сравнению с контрольной последовательностью с целью достижения оптимального выравнивания. Процент идентичности последовательностей рассчитывается путем определения числа положений, в которых идентичное нуклеотидное основание или аминокислотный остаток встречается в обеих последовательностях, с получением числа «совпадающих» положений, деления числа совпадающих положений на общее число положений в окне сравнения и умножения результата на 100. Способы и программное обеспечение для определения идентичности последовательностей доступны в данной области и включают программное обеспечение Blast и GAP-анализ. Для нуклеиновых кислот, процент идентичности рассчитывают предпочтительно с помощью инструмента выравнивания BlastN, посредством чего процент идентичности рассчитывают по всей длине запросной нуклеотидной последовательности.

Специалисту в данной области будет понятно, что гомологи или ортологи (гомологи, существующие у различных видов) генов-мишеней, представленные любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, могут быть идентифицированы. Данные гомологи и/или ортологи вредителей также находятся в рамках настоящего изобретения. Предпочтительные гомологи и/или ортологи являются генами, подобными в нуклеотидной последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов гомолог и/или ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80% или 85%, более предпочтительно, по меньшей мере на 90% или 95%, и наиболее предпочтительно, по меньшей мере приблизительно 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности. Аналогично, также предпочтительными гомологами и/или ортологами являются белки, которые подобны в аминокислотной последовательности до такой степени, что при оптимальном выравнивании и сравнении двух аминокислотных последовательностей гомолог и/или ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80% или 85%, более предпочтительно, по меньшей мере на 90% или 95%, и наиболее предпочтительно, по меньшей мере приблизительно 99% идентичной любой из SEQ ID NO: 79, 349, 352, 356, 80, 326, 81, 327, 82, 83, 328, 84, 329, 85, 86, 359, 87-91, 330, 350, 353, 331, 351, 332-336, 337, 354, 338-344, 346, 345, 347, 348, 357, 355, 358, 390-393.

Другие гомологи являются генами, которые являются аллелями гена, содержащего последовательность, которая представлена любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389. Дополнительные предпочтительные гомологи являются генами, содержащими по меньшей мере один однонуклеотидный полиморфизм (SNP) по сравнению с геном, содержащим последовательность, которая представлена любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389.

«Интерферирующая рибонуклеиновая кислота (РНК)» по настоящему изобретению охватывает любой тип молекулы РНК, способной подавлять или подвергать «сайленсингу» экспрессию гена-мишени, включая, но без ограничений, смысловую РНК, антисмысловую РНК, короткую интерферирующую РНК (siRNA), микроРНК (miRNA), двухцепочечную РНК (dsRNA), шпилечную РНК (RNA) и тому подобное. Способы анализа функциональных молекул интерферирующих РНК хорошо известны в данной области и описаны в данном документе в других местах.

Молекулы интерферирующей РНК по настоящему изобретению обеспечивают последовательность-специфическое подавление экспрессии гена-мишени путем связывания с целевой нуклеотидной последовательностью в пределах гена-мишени. Связывание происходит в результате спаривания оснований между комплементарными областями интерферирующей РНК и целевой нуклеотидной последовательности. Применяемый в данном документе термин «сайленсирующий элемент» относится к части или области интерферирующей РНК, содержащей или состоящей из последовательности нуклеотидов, которая комплементарна или, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и которая функционирует как активная часть интерферирующей РНК с непосредственным подавлением экспрессии указанного гена-мишени. В одном варианте осуществления настоящего изобретения сайленсирующий элемент содержит или состоит из последовательности по меньшей мере из 17 последовательных нуклеотидов, предпочтительно, по меньшей мере 18 или 19 последовательных нуклеотидов, более предпочтительно, по меньшей мере 21 последовательного нуклеотида, еще более предпочтительно, по меньшей мере 22, 23, 24 или 25 последовательных нуклеотидов, комплементарных целевой нуклеотидной последовательности в пределах гена-мишени.

Применяемое в данном документе выражение «экспрессия гена-мишени» относится к транскрипции и накоплению РНК-транскрипта, кодируемого геном-мишенью, и/или трансляции mRNA в белок. Термин «подавлять» предназначен для обозначения любого из способов, известных в данной области, с помощью которого молекулы интерферирующей РНК снижают уровень первичных транскриптов РНК, mRNA или белка, полученного из гена-мишени. В определенных вариантах осуществления подавление относится к ситуации, когда уровень РНК или белка, полученного из гена, уменьшается по меньшей мере на 10%, предпочтительно, по меньшей мере на 33%, более предпочтительно, по меньшей мере на 50%, еще более предпочтительно, по меньшей мере на 80%. В особенно предпочтительных вариантах осуществления подавление относится к снижению уровня РНК или белка, полученного из гена по меньшей мере на 80%, предпочтительно, по меньшей мере на 90%, более предпочтительно, по меньшей мере на 95% и наиболее предпочтительно, по меньшей мере на 99% в клетках насекомого-вредителя по сравнению с соответствующим контрольным насекомым-вредителем, которое, например, не подвергалось воздействию интерферирующей РНК или подвергалось воздействию контрольной молекулы интерферирующей РНК. Способы выявления снижения уровней РНК или белка хорошо известны в данной области и включают гибридизацию РНК в растворе, нозерн гибридизацию, обратную транскрипцию (например, количественный анализ ОТ-ПЦР (RT-PCR)), микроматричный анализ, связывание антител, иммуноферментный твердофазный анализ (ELISA) и вестерн-блоттинг. В другом варианте осуществления настоящего изобретения подавление относится к снижению уровней РНК или белка, достаточному для получения выявляемого изменения фенотипа вредителя, по сравнению с соответствующей мерой борьбы с вредителями, например, гибелью клеток, прекращением роста или тому подобное. Подавление, таким образом, можно измерить с помощью фенотипического анализа насекомого-вредителя с использованием методов, обычных в данной области.

В предпочтительном варианте осуществления настоящего изобретения интерферирующая РНК подавляет экспрессию гена с помощью РНК-интерференции или RNAi. RNAi является процессом последовательность-специфической генной регуляции, как правило, опосредованной молекулами двухцепочечной РНК, такими как короткие интерферирующие РНК (siRNA). siRNA содержат смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК. Смысловая цепь или «направляющая цепь» молекулы siRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенных в пределах РНК-транскрипта гена-мишени. Смысловая цепь siRNA, следовательно, способна соединяться с РНК-транскриптом посредством спаривания оснований по Уотсон-Крику, и направлять РНК на деградацию в пределах клеточного комплекса, известного как индуцируемый RNAi сайленсирующий комплекс или RISC. Таким образом, в отношении предпочтительных молекул интерферирующей РНК по настоящему изобретению сайленсирующий элемент, как изложено в данном документе, может являться двухцепочечной областью, содержащей соединенные комплементарные цепи, из которых по меньшей мере одна цепь содержит или состоит из последовательности нуклеотидов, комплементарной или, по меньшей мере, частично комплементарную целевой нуклеотидной последовательности в пределах гена-мишени. В одном варианте осуществления двухцепочечная область составляет в длину по меньшей мере 21, 22, 23, 24, 25, 30, 35, 40, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 пар оснований.

Более длинные двухцепочечные молекулы РНК (dsRNA), содержащие один или более функциональных двухцепочечных сайленсирующих элементов, которые описаны в данном документе в других местах, и способные к сайленсингу генов посредством RNAi, также рассматриваются в рамках настоящего изобретения. Такие более длинные молекулы dsRNA содержат по меньшей мере 80, 200, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 пар оснований. Данные молекулы dsRNA могут служить в качестве предшественников активных молекул siRNA, которые направляют РНК-транскрипт к комплексу RISC для последующей деградации. Молекулы dsRNA, присутствующие в среде, окружающей организм или его клетки, могут поглощаться организмом и перерабатываться ферментом, называемым Dicer, с получением молекул siRNA. Альтернативно, dsRNA может быть получена in vivo, т.е. транскрибирована из полинуклеотида или полинуклеотидов, кодирующих dsRNA, присутствующих в клетке, например, бактериальной клетке или растительной клетке, и впоследствии обработана с помощью Dicer, либо в пределах клетки-хозяина, либо, предпочтительно, в пределах клеток насекомого-вредителя после поглощения более длинной dsRNA-предшественника. dsRNA может образовываться из двух отдельных (смысловой и антисмысловой) цепей РНК, которые соединяются посредством комплементарного спаривания оснований. Альтернативно, dsRNA может являться одной цепью, способной складываться назад на себя с образованием шпилечной РНК (РНК) или структуры стебель-петля. В случае РНК, двухцепочечная область или «стебель» образована из двух областей или сегментов РНК, которые являются существенно инвертированными повторами друг друга и обладают достаточной комплементарностью для обеспечения образования двухцепочечной области. Один или более функциональных двухцепочечных сайленсирующих элементов могут присутствовать в данной «области стебля» молекулы. Области инвертированных повторов, как правило, разделены областью или сегментом РНК, известным как область «петли». Данная область может содержать любую нуклеотидную последовательность, придающую достаточную гибкость для обеспечения осуществления самоспаривания между фланкирующими комплементарными областями РНК. В общем, область петли является по существу одноцепочечной и действует как разделительный элемент между инвертированными повторами.

Все молекулы интерферирующей РНК по настоящему изобретению обеспечивают последовательность-специфическое подавление экспрессии гена-мишени путем связывания с целевой нуклеотидной последовательностью в пределах гена-мишени. Связывание происходит в результате комплементарного спаривания оснований между сайленсирующим элементом интерферирующей РНК и целевой нуклеотидной последовательностью. Молекулы интерферирующей РНК по настоящему изобретению содержат по меньшей мере один или по меньшей мере два сайленсирующих элемента. В одном варианте осуществления настоящего изобретения целевая нуклеотидная последовательность содержит последовательность нуклеотидов, которая представлена РНК-транскриптом гена-мишени или его фрагментом, при этом фрагмент составляет предпочтительно по меньшей мере 17 нуклеотидов, более предпочтительно, по меньшей мере 18, 19 или 20 нуклеотидов или наиболее предпочтительно, по меньшей мере 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 нуклеотидов. В предпочтительном варианте осуществления настоящего изобретения целевая нуклеотидная последовательность содержит последовательность нуклеотидов, эквивалентную РНК-транскрипту, кодируемому любым из полинуклеотидов, который выбирают из группы, включающей (i) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100 или 1115 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарной ей последовательностью, или (ii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарной ей последовательности,

или (iii) полинуклеотида, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, которая представлена в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении двух последовательностей указанный полинуклеотид являлся по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичным любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, или (iv) полинуклеотид, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательностью, и при этом указанный фрагмент или указанная комплементарная последовательность обладает нуклеотидной последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарной ей последовательности,

или (v) полинуклеотид, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательностью, и при этом указанный фрагмент или указанная комплементарная последовательность обладает нуклеотидной последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарной ей последовательности, или (vi) полинуклеотид, кодирующий аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389. В более предпочтительном варианте осуществления вышеупомянутого указанный полинуклеотид составляет в длину не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов.

Предпочтительно, молекулы интерферирующей РНК по настоящему изобретению содержат по меньшей мере одну двухцепочечную область, как правило, сайленсирующий элемент интерферирующей РНК, содержащий смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, при этом смысловая цепь молекулы dsRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени.

Сайленсирующий элемент или по меньшей мере одна его цепь, при этом сайленсирующий элемент является двухцепочечным, может являться полностью комплементарным или частично комплементарным целевой нуклеотидной последовательности гена-мишени. Применяемый в данном документе термин «полностью комплементарный» означает, что все основания нуклеотидной последовательности сайленсирующего элемента являются комплементарными или «соответствуют» основаниям целевой нуклеотидной последовательности. Термин «по меньшей мере, частично комплементарный» означает, что существует менее чем 100% совпадения между основаниями сайленсирующего элемента и основаниями целевой нуклеотидной последовательности. Специалисту в данной области будет понятно, что сайленсирующий элемент должен являться лишь, по меньшей мере, частично комплементарным целевой нуклеотидной последовательности для опосредования подавления экспрессии гена-мишени. Как известно в данной области, последовательности РНК со вставками, делециями и нарушениями комплементарности относительно целевой последовательности все же могут являться эффективными при RNAi. В соответствии с настоящим изобретением предпочтительно, чтобы сайленсирующий элемент и целевая нуклеотидная последовательность гена-мишени обладали по меньшей мере 80% или 85% идентичности последовательности, предпочтительно, по меньшей мере 90% или 95% идентичности последовательности или более предпочтительно, по меньшей мере 97% или 98% идентичности последовательности, и еще более предпочтительно по меньшей мере 99% идентичности последовательности. Альтернативно, сайленсирующий элемент может содержать 1, 2 или 3 нарушения комплементарности по сравнению с целевой нуклеотидной последовательностью на каждом отрезке из 24 частично комплементарных нуклеотидов.

Специалисту в данной области будет очевидным, что степень комплементарности между сайленсирующим элементом и целевой нуклеотидной последовательностью может варьировать в зависимости от гена-мишени, подлежащего подавлению, или в зависимости от вида насекомого-вредителя, у которого экспрессия гена подлежит контролю.

В другом варианте осуществления настоящего изобретения сайленсирующий элемент содержит последовательность нуклеотидов, которая является эквивалентом РНК любого из полинуклеотидов, выбранных из группы, включающей полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100 или 1115 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательностью, или (ii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении двух последовательностей указанный полинуклеотид являлся по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичным любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарной ей последовательности, или (iii) полинуклеотид, который содержит фрагмент по меньшей мере, из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, и при этом указанный фрагмент или указанная комплементарная последовательность обладают такой нуклеотидной последовательностью, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO:s 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, при этом указанный полинуклеотид составляет не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов. Следует понимать, что в таких вариантах осуществления сайленсирующий элемент может содержать или состоять из области двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых, смысловая цепь, содержит последовательность нуклеотидов, по меньшей мере, частично комплементарную целевой нуклеотидной последовательности в пределах гена-мишени.

Целевую нуклеотидную последовательность можно выбирать из любой подходящей области или нуклеотидной последовательности гена-мишени или его РНК-транскрипта. Например, целевая нуклеотидная последовательность может располагаться в пределах 5’UTR или 3’UTR гена-мишени или РНК транскрипта или в пределах экзонной или интронной областей гена.

Специалисту в данной области известны способы идентифицирования наиболее подходящих целевых нуклеотидных последовательностей в рамках полноразмерного гена-мишени. Например, множество сайленсирующих элементов, воздействующих на различные области гена-мишени, можно синтезировать и тестировать. Альтернативно, расщепление РНК-транскрипта с помощью ферментов, таких как РНКаза Н, можно использовать для определения сайтов в РНК, которые находятся в конформации, восприимчивой к сайленсингу гена. Сайты-мишени также можно идентифицировать с применением in silico подходов, например, использование компьютерных алгоритмов, предназначенных для прогнозирования эффективности сайленсинга генов на основе воздействия на различные сайты в пределах гена полной длины.

Интерферирующие РНК по настоящему изобретению могут содержать один сайленсирующий элемент или несколько сайленсирующих элементов, при этом каждый сайленсирующий элемент содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии указанного гена-мишени. Конкатемерные конструкции РНК данного типа описаны в WO2006/046148, который включен в данном документе в качестве ссылки. В контексте настоящего изобретения термин «несколько» означает по меньшей мере два, по меньшей мере три, по меньшей мере четыре и т.д., и по меньшей мере до 10, 15, 20 или по меньшей мере 30. В одном варианте осуществления интерферирующая РНК содержит несколько копий одного сайленсирующего элемента, т.е. повторов сайленсирующего элемента, который связывается с конкретной целевой нуклеотидной последовательностью в пределах определенного гена-мишени. В другом варианте осуществления сайленсирующие элементы в пределах интерферирующей РНК содержат или состоят из различных последовательностей нуклеотидов, комплементарных различным целевым нуклеотидным последовательностям. Должно быть ясно, что комбинации нескольких копий одного и того же сайленсирующего элемента, комбинированные с сайленсирующими элементами, связывающимися с различными целевыми нуклеотидными последовательностями, находятся в рамках настоящего изобретения.

Различные целевые нуклеотидные последовательности могут происходить из одного гена-мишени у вида насекомого-вредителя для достижения улучшения подавления конкретного гена-мишени у вида насекомого-вредителя. В этом случае сайленсирующие элементы можно комбинировать в интерферирующей РНК в исходном порядке, в котором целевые нуклеотидные последовательности встречаются в гене-мишени, или сайленсирующие элементы можно смешивать и комбинировать случайно в любом порядке ранжирования в рамках интерферирующей РНК по сравнению с порядком целевых нуклеотидных последовательностей в гене-мишени.

Альтернативно различные целевые нуклеотидные последовательности представляют один ген-мишень, но происходят из различных видов насекомых-вредителей.

Альтернативно различные целевые нуклеотидные последовательности могут происходить из различных генов-мишеней. Если интерферирующая РНК предназначена для использования для предупреждения и/или борьбы с нападением вредителей, предпочтительно выбирать различные гены-мишени из группы генов, регулирующих жизненно важные биологические функции вида насекомого-вредителя, включая, но без ограничений, выживание, рост, развитие, размножение и патогенность. Гены-мишени могут регулировать одинаковые или различные биологические пути или процессы. В одном варианте осуществления по меньшей мере один из сайленсирующих элементов содержит или состоит из последовательности нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, при этом ген-мишень выбран из группы генов, которая описана ранее.

В дополнительном варианте осуществления настоящего изобретения различные гены, на которые воздействуют различные сайленсирующие элементы, происходят из одного вида насекомого-вредителя. Данный подход предназначен для достижения усиленного воздействия на один вид насекомого-вредителя. В частности, различные гены-мишени могут экспрессироваться дифференциально на различных стадиях жизненного цикла насекомого, например, зрелого имаго, незрелой личиночной и стадии яйца. Интерферирующую РНК по настоящему изобретению можно использовать для предотвращения и/или борьбы с нападением насекомых-вредителей на более чем одной стадии жизненного цикла насекомого.

В альтернативном варианте осуществления настоящего изобретения различные гены, на которые воздействуют различные сайленсирующие элементы, происходят из различных видов насекомых-вредителей. Интерферирующую РНК по настоящему изобретению можно, таким образом, использовать для предотвращения и/или борьбы с нападением более чем одного вида насекомых-вредителей одновременно.

Сайленсирующие элементы могут располагаться в виде одной непрерывной области интерферирующей РНК или могут разделяться присутствием линкерной последовательности. Линкерная последовательность может содержать короткую случайную нуклеотидную последовательность, которая не комплементарна ни одной из целевых нуклеотидных последовательностей или генов-мишеней. В одном варианте осуществления линкер является при определенных условиях самостоятельно расщепляющейся последовательностью РНК, предпочтительно pH-чувствительным линкером или гидрофобно-чувствительным линкером. В одном варианте осуществления линкер содержит последовательность нуклеотидов, эквивалентную интронной последовательности. Линкерные последовательности по настоящему изобретению могут находиться в диапазоне длины от приблизительно 1 пары оснований до приблизительно 10000 пар оснований, при условии, что линкер не ухудшает способности интерферирующей РНК подавлять экспрессию гена(генов)-мишени.

В дополнение к сайленсирующему элементу(элементам) и любым линкерным последовательностям интерферирующая РНК по настоящему изобретению может содержать по меньшей мере одну дополнительную полинуклеотидную последовательность. В различных вариантах осуществления настоящего изобретения дополнительную последовательность выбирают из (i) последовательности, способной защитить интерферирующую РНК от РНК процессинга, (ii) последовательности, влияющей на стабильность интерферирующей РНК, (iii) последовательности, обеспечивающей связывание белков, например, для облегчения поглощения интерферирующей РНК клетками вида насекомого-вредителя, (iv) последовательности, облегчающей крупномасштабное производство интерферирующей РНК, (v) последовательности, которая является аптамером, который связывается с рецептором или молекулой на поверхности клеток насекомого-вредителя для облегчения поглощения, или (vi) последовательности, которая катализирует процессинг интерферирующей РНК в клетках насекомого-вредителя и тем самым повышает эффективность интерферирующей РНК. Структуры для повышения стабильности молекулы РНК хорошо известны в данной области и описаны дополнительно в WO2006/046148, который включен в данный документ в качестве ссылки.

Длина интерферирующей РНК по настоящему изобретению должна являться достаточной для поглощения клетками вида насекомого-вредителя и подавления генов-мишеней у вредителя, как описано в данном документе в других местах. Однако верхний предел длины может зависеть от (i) требования к интерферирующей РНК поглощаться клетками вредителя, и (ii) требования к интерферирующей РНК подвергаться процессингу в клетках вредителя для опосредования сайленсинга генов путем RNAi. Длина также может зависеть от способа получения и состава для доставки интерферирующей РНК к клеткам. Предпочтительно, интерферирующая РНК по настоящему изобретению составляет от 21 до 10000 нуклеотидов в длину, предпочтительно от 50 до 5000 нуклеотидов или от 100 до 2500 нуклеотидов, более предпочтительно от 80 до 2000 нуклеотидов в длину.

Интерферирующая РНК может содержать основания ДНК, неприродные основания или неприродные связи остова, или модификации сахарофосфатного остова, например, для повышения стабильности во время хранения или повышения устойчивости к деградации нуклеазами. Дополнительно, интерферирующая РНК может быть получена химически или ферментативно специалистом в данной области с помощью управляемых вручную или автоматизированных реакций. Альтернативно, интерферирующая РНК может транскрибироваться из полинуклеотида, кодирующего таковую. Таким образом, в настоящем документе предусматривается выделенный полинуклеотид, кодирующий любую из интерферирующих РНК по настоящему изобретению.

Также в настоящем документе предусматривается выделенный полинуклеотид, выбранный из группы, включающей (i) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательностью, или (ii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100 или 1115 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательностью, или (iii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности так, что при оптимальном выравнивании и сравнении двух последовательностей указанный полинуклеотид является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичным любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, или (iv) полинуклеотид, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, и при этом указанный фрагмент или указанная комплементарная последовательность обладают такой нуклеотидной последовательностью, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, или (v) полинуклеотид, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или комплементарной ей последовательности, и при этом указанный фрагмент или указанная комплементарная последовательность обладают такой нуклеотидной последовательностью, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или комплементарной ей последовательности, или (vi) полинуклеотид, кодирующий аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, и при этом указанный полинуклеотид составляет не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов.

В предпочтительных вариантах осуществления выделенный полинуклеотид является частью молекулы интерферирующей РНК, как правило, частью сайленсирующего элемента, содержащего по меньшей мере одну двухцепочечную область, содержащую смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, при этом смысловая цепь молекулы dsRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени. Смысловая цепь dsRNA, следовательно, способна соединяться с РНК-транскриптом и воздействовать на РНК для деградации в пределах RNAi-индуцируемого сайленсирующего комплекса или RISC.

Полинуклеотиды по настоящему изобретению можно вставлять с помощью рутинных методов молекулярного клонирования в конструкции ДНК или векторы, известные в данной области. Следовательно, в соответствии с одним вариантом осуществления предусматривается конструкция ДНК, содержащая любые из полинуклеотидов по настоящему изобретению. Предпочтительно, в данном документе предусматривается конструкция ДНК, содержащая полинуклеотид, кодирующий по меньшей мере одну из интерферирующих РНК по настоящему изобретению. Конструкция ДНК может являться рекомбинантным ДНК-вектором, например, бактериальным, вирусным или дрожжевым вектором. В предпочтительном варианте осуществления настоящего изобретения конструкция ДНК является экспрессирующей конструкцией, и полинуклеотид функционально связан с по меньшей мере одной регуляторной последовательностью, способной управлять экспрессией полинуклеотидной последовательности. Термин «регуляторная последовательность» следует рассматривать в широком контексте, и он предназначен для обозначения любой нуклеотидной последовательности, способной воздействовать на экспрессию полинуклеотидов, с которыми она функционально связана, включая, но без ограничений, промоторы, энхансеры и другие природные или синтетические элементы-активаторы транскрипции. Регуляторная последовательность может располагаться на 5'- или 3'-конце полинуклеотидной последовательности. Термин «функционально связанный» относится к функциональной связи между регуляторной последовательностью и полинуклеотидной последовательностью, такой, что регуляторная последовательность управляет экспрессией полинуклеотида. Функционально связанные элементы могут являться смежными или несмежными.

Предпочтительно, регуляторная последовательность является промотором, выбранным из группы, включающей, но без ограничений, конститутивные промоторы, индуцируемые промоторы, тканеспецифические промоторы и промоторы, специфичные для стадии роста/развития. В одном варианте осуществления полинуклеотид находится под контролем сильного конститутивного промотора, такого как любой, выбранный из группы, включающей CaMV35S промотор, двойной CaMV35S промотор, убиквитиновый промотор, актиновый промотор, rubisco промотор, GOS2 промотор, промотор 34S вируса мозаики норичника.

Необязательно одну или более последовательностей терминации транскрипции можно включать в экспрессирующую конструкцию по настоящему изобретению. Термин «последовательность терминации транскрипции» охватывает управляющую последовательность в конце транскрипционной единицы, которая сигнализирует о терминации транскрипции, 3’ процессинге и полиаденилировании первичного транскрипта. Дополнительные регуляторные последовательности, включая, но без ограничений, энхансеры транскрипции или трансляции, можно включать в экспрессионную конструкцию, например, как с усиленным двойным промотором CaMV35S.

Настоящее изобретение также охватывает способ создания любой из интерферирующих РНК по настоящему изобретению, включающий этапы: (i) контакта полинуклеотида, кодирующего указанную интерферирующую РНК, или ДНК-конструкции, содержащей полинуклеотид, с бесклеточными компонентами; или (ii) введения в клетку (например, путем трансформации, трансфекции или инъекции) полинуклеотида, кодирующего указанную интерферирующую РНК, или ДНК-конструкции, содержащей полинуклеотид.

Настоящее изобретение, таким образом, также относится к любому двухцепочечному рибонуклеотиду, полученному при экспрессии полинуклеотида, описанного в данном документе.

Соответственно, также в данном документе предусматривается клетка-хозяин, трансформированная любым из полинуклеотидов, описанных в данном документе. Дополнительно настоящим изобретением охватываются клетки-хозяева, содержащие любую из интерферирующих РНК по настоящему изобретению, любой из полинуклеотидов по настоящему изобретению или ДНК-конструкцию, содержащую любой из полинуклеотидов. Клетка-хозяин может являться прокариотической клеткой, включая, но без ограничений, грамположительные и грамотрицательные бактериальные клетки, или эукариотической клеткой, включая, но без ограничений, клетки дрожжей или клетки растений. Предпочтительно, указанная клетка-хозяин является бактериальной клеткой или растительной клеткой. Бактериальную клетку можно выбирать из группы, включающей, но без ограничений, грамположительные и грамотрицательные клетки, включающие Escherichia spp. (например, E. coli), Bacillus spp. (например, B. thuringiensis), Rhizobium spp., Lactobacillus spp., Lactococcus spp., Pseudomonas spp. и Agrobacterium spp. Полинуклеотид или ДНК-конструкция по настоящему изобретению может существовать или поддерживаться в клетке-хозяине как внехромосомный элемент, или может являться стабильно включенным в геном клетки-хозяина. Характеристики, представляющие особый интерес при выборе клетки-хозяина для целей настоящего изобретения, включают простоту, с которой полинуклеотид или ДНК-конструкцию, кодирующую интерферирующую РНК, можно ввести в хозяина, доступность совместимых экспрессионных систем, эффективность экспрессии и стабильность интерферирующей РНК в хозяине.

Предпочтительно, интерферирующие РНК по настоящему изобретению экспрессируются в растительных клетках-хозяевах. Предпочтительные растения, представляющие интерес, включают, но без ограничений, хлопок, картофель, рис, помидор, канолу, сою, подсолнечник, сорго, просо, кукурузу, люцерну, землянику, баклажаны, перец и табак.

В ситуациях, где интерферирующая РНК экспрессируется в клетке-хозяине и/или применяется для предотвращения и/или борьбы с нападением вредителя на организм-хозяин, предпочтительно, чтобы интерферирующая РНК не демонстрировала значительных «нецелевых» эффектов, т.е. интерферирующая РНК не влияла на экспрессию генов в хозяине. Предпочтительно, сайленсирующий элемент не демонстрирует значительной комплементарности с нуклеотидными последовательностями, кроме заданной целевой нуклеотидной последовательности гена-мишени. В одном варианте осуществления настоящего изобретения сайленсирующий элемент демонстрирует менее 30%, более предпочтительно менее 20%, более предпочтительно менее 10% и еще более предпочтительно менее 5% идентичности последовательности с любым геном клетки-хозяина или организма. Если известны данные геномной последовательности для организма-хозяина, можно перепроверить идентичность с сайленсирующим элементом, применяя стандартные инструменты биоинформатики. В одном варианте осуществления отсутствует идентичность последовательности между сайленсирующим элементом и геном из клетки-хозяина или организма-хозяина в области из 17, более предпочтительно, в области из 18 или 19 и наиболее предпочтительно, в области из 20 или 21 последовательных нуклеотидов.

При практическом применении настоящего изобретения интерферирующие РНК по настоящему изобретению можно использовать для предотвращения и/или борьбы с любым насекомым вредителем, принадлежащим к отрядам Coleoptera, Lepidoptera, Diptera, Dichyoptera, Orthoptera, Hemiptera и Siphonaptera.

Кроме того, в соответствии с другим аспектом настоящего изобретения в настоящем документе предусматривается композиция для предотвращения и/или борьбы с нападением насекомых-вредителей, содержащая по меньшей мере одну интерферирующую рибонуклеиновую кислоту (РНК) и необязательно по меньшей мере один подходящий носитель, наполнитель или разбавитель, причем интерферирующая РНК функционирует при поглощении насекомым с подавлением экспрессии гена-мишени у указанного вредителя. Интерферирующей РНК может являться любая из тех, которые раскрыты в других разделах данного документа. Предпочтительно, интерферирующая РНК содержит или состоит по меньшей мере из одного сайленсирующего элемента, при этом указанный сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых (смысловая цепь) содержит последовательность нуклеотидов, которая, по меньшей мере, частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени. «Геном-мишенью» может являться любой ген-мишень, раскрываемый в разделах настоящего документа, включая, но без ограничений, гены, участвующие в регуляции выживании, росте, развитии, размножении и патогенности вредителя. Альтернативно, композиция содержит по меньшей мере одну клетку-хозяина, содержащую по меньшей мере одну интерферирующую молекулу РНК или конструкцию ДНК, кодирующую тот же самый, и необязательно по меньшей мере один подходящий носитель, наполнитель или разбавитель, причем интерферирующая РНК функционирует при поглощении клетки-хозяина насекомым с подавлением экспрессии гена-мишени у указанного вредителя.

При практическом применении настоящего изобретения композицию можно использовать для предотвращения и/или борьбы с любым насекомым вредителем, принадлежащим к отрядам Coleoptera, Lepidoptera, Diptera, Dichyoptera, Orthoptera, Hemiptera и Siphonaptera. Таким образом, композиция может быть представлена в любой форме, подходящей для применения по отношению к насекомым-вредителям или для применения к субстратам и/или организмам, в частности растений, чувствительных к нападению указанного насекомого-вредителя. В одном варианте осуществления композиция предназначена для применения в предотвращении и/или борьбы с нападением вредителей растений, или материала для размножения, или репродуктивного материала растения и, таким образом, направлена на виды насекомых-вредителей, которые нападают на растения. Композиция по настоящему изобретению особенно эффективна, если насекомое-вредитель относится к категории «грызущих» насекомых, которые наносят значительное повреждение растениям, поедая растительные ткани, такие как корни, листья, цветы, почки, ветки и т.п. Примеры из этой большой категории насекомых включают жуков и их личинок.

Композицию по настоящему изобретению можно применять для борьбы с насекомыми-вредителями на всех этапах их жизненного цикла, например, этапе половозрелой особи, этапах личинки и яйца.

В контексте композиции по настоящему изобретению интерферирующая РНК может быть получена из ДНК-конструкции, в частности экспрессионной конструкции, которые описаны в других разделах данного документа, содержащей полинуклеотид, который ее кодирует. В предпочтительных вариантах осуществления интерферирующая РНК может быть произведена внутри клетки-хозяина или организма, сконструированного для экспрессии указанной интерферирующей РНК с полинуклеотидом, который ее кодирует.

Подходящие организмы-хозяева для применения в композициях по настоящему изобретению включают, но без ограничений, композиции, которые известны как колонизирующие среду на и/или вокруг вызывающих интерес растений или культурных растений, т.е. растений или культурных растений, чувствительных к нападению видов насекомых-вредителей. Такие микроорганизмы включают, но без ограничений, микроорганизмы, которые заселяют филлоплану (поверхность листьев растений) и/или ризосферу (почву, окружающую корни растений). Эти микроорганизмы отбирают так, чтобы они были способны успешно конкурировать с организмами дикого типа, присутствующими в среде растения. Подходящие микроорганизмы для применения в качестве хозяев включают различные виды бактерий, дрожжей и грибов. Понятно, что выбираемые микроорганизмы не должны быть токсичными для растений. Такие композиции, применяемые по отношению к растениям, чувствительным к нападению видов насекомых-вредителей, будут поглощаться насекомыми-вредителями при кормлении на обработанных растениях.

Организмы-хозяева, которые в естественных условиях не заселяют растение и/или их среду, также находятся в рамках настоящего изобретения. Такие организмы могут служить лишь в качестве средства для получения интерферирующей РНК композиции. Например, в одном варианте осуществления интерферирующая РНК ферментируется/продуцируется в бактериальном хозяине и бактерии после этого инактивируются/погибают. Полученные бактерии могут быть обработаны и использованы в качестве инсектицидного спрея таким же способом, как были использованы штаммы Bacillus thuringiensis в качестве инсектицида для нанесения распылением. В некоторых вариантах осуществления бактериальный экстракт или лизат может быть подходящим образом очищен с тем, чтобы оставить экстракт, содержащий, по сути, чистую интерферирующую РНК, который затем составляют в одну из композиций по настоящему изобретению. Стандартные методики экстракции/очистки будут известны специалисту в данной области.

Композиции по настоящему изобретению могут находиться в любой подходящей физической форме для применения по отношению к насекомым. Например, композиция может быть в твердой форме (порошок, таблетка или приманка), жидкой форме (в том числе форма, вводимая в качестве распыляемого инсектицида) или форме геля. В конкретном варианте осуществления композиция может представлять собой покрытие, пасту или порошок, который можно нанести на субстрат с целью защиты указанного субстрата от нападения насекомых. В данном варианте осуществления композицию можно применять для защиты любого субстрата или материала, который чувствителен к нападению насекомых или повреждению, наносимому насекомыми.

Природа наполнителей и физической формы композиции может варьировать в зависимости от природы субстрата, который необходимо обрабатывать. Например, композиция может представлять собой жидкость, которую наносят кистью или распыляют на подлежащий обработке материал или субстрат или впечатывают в него, или покрытие или порошок, который наносят на подлежащий обработке материал или субстрат.

В одном варианте осуществления композиция находится в форме приманки. Приманка предназначена для привлечения насекомого войти в контакт с композицией. После вхождения в контакт с нею, композиция поглощается насекомым путем, например, переваривания, и опосредует RNAi, таким образом убивая насекомое. Указанная приманка может содержать пищевой продукт, такой как белковый продукт питания, например, рыбную муку. В качестве приманки также можно применять борную кислоту. Приманка может зависеть от вида, являющегося мишенью. Также можно применять аттрактант. Аттрактантом может быть феромон, такой как, например, феромон самца или самки. Как, например, в настоящем изобретении можно применять феромоны, приведенные в книге «Insect Pheremones and their use in Pest Management» (Howse et al., Chapman and Hall, 1998). Аттрактант действует как привлекающий насекомого к приманке и может быть направлен на конкретное насекомое или может привлекать целый спектр насекомых. Приманка может быть в любой подходящей форме, такой как твердая, пастообразная форма, форма таблетки или порошковая форма.

Приманка также может быть принесена насекомым обратно в колонию. Затем приманка может играть роль источника питания для других членов колонии, обеспечивая, таким образом, эффективную борьбу с большим количеством насекомых и, потенциально, всей колонией насекомых-вредителей. Это является преимуществом, связанным с применением двухцепочечной РНК по настоящему изобретению, поскольку замедленное действие RNAi-опосредованных эффектов на вредителей делает возможным перенос приманки обратно в колонию, таким образом доставляя максимальный эффект в смысле воздействия на насекомых.

Кроме того, композиции, которые контактируют с насекомыми, могут оставаться на кутикуле насекомого. При очистке, независимо от того, чистится ли отдельное насекомое самостоятельно, или насекомые чистят друг друга, композиции могут быть поглощены и, таким образом, могут опосредовать свои эффекты на насекомых. Для этого необходимо, чтобы композиция была достаточно стабильной с тем, чтобы интерферирующая РНК оставалась интактной и была способна опосредовать RNAi даже при воздействии внешних условий среды в течение длительного периода времени, который может представлять собой, например, период длительностью несколько дней.

Приманки могут быть представлены в подходящем «корпусе» или «ловушке». Такие корпуса и ловушки коммерчески доступны, а существующие ловушки могут быть адаптированы для включения композиций по настоящему изобретению. Любой корпус или ловушка, которые могут заманивать насекомого зайти, включены в объем настоящего изобретения. Корпус или ловушка могут иметь форму, например, коробки, и могут быть представлены в заранее сформированном состоянии или могут быть, например, в форме складываемого картона. Подходящие материалы для корпуса или ловушки включают пластмассу и картон, в частности, гофрированный картон. Подходящими размерами для такого корпуса или ловушки являются, например, ширина 7-15 см, длина 15-20 см и высота 1-5 см. Внутренние поверхности ловушек могут быть оклеены липким веществом с тем, чтобы ограничить движение насекомого после попадания в ловушку. Корпус или ловушка могут иметь внутри подходящее углубление, которое может удерживать на месте приманку. Ловушка отличается от корпуса, поскольку насекомое после входа не может легко покинуть ловушку, в то время как корпус играет роль «кормушки», которая обеспечивает насекомому предпочтительную среду, в которой они могут кормиться и чувствовать себя в безопасности от хищников.

Соответственно, в дополнительном аспекте настоящее изобретение предлагает корпус или ловушку для насекомых, которые содержат композицию по настоящему изобретению, которая может включать любой из признаков описываемой в данном документе композиции.

В дополнительном альтернативном варианте осуществления композиция может быть представлена в форме спрея. Таким образом, человек-пользователь может непосредственно опрыскивать композицией вредителя. Композиция затем усваивается насекомым, откуда она может опосредовать РНК-интерференцию, таким образом борясь с насекомым. Предпочтительно, спрей представляет собой распыляемый под давлением спрей/спрей в виде аэрозоля или спрей для пульверизатора. Частицы могут иметь подходящий размер так, чтобы они прикреплялись к насекомому, например, к экоскелету, и могли поглощаться оттуда. Размер частиц может быть измерен известными способами, такими как применение Mastersizer, который является коммерчески доступным устройством.

В еще одном дополнительном варианте осуществления носитель представляет собой электростатически заряженный порошок или частицу, которая прикрепляется к насекомому. Подходящие порошки и частицы, которые могут прикрепляться к насекомому и, таким образом, доставлять РНК-конструкции по настоящему изобретению, описаны подробно в WO 94/00980 и WO 97/33472, обе из которых включены в данный документ в качестве ссылки.

Альтернативно, носитель может содержать магнитные частицы, которые прикрепляются к кутикуле насекомого. Подходящие магнитные частицы, которые могут прикрепляться к насекомому и, таким образом, доставлять РНК-конструкции по настоящему изобретению, описаны подробно в WO 00/01236, ссылка на которую включена в данный документ.

В еще одном дополнительном варианте осуществления носитель композиции содержит металлические частицы, которые изначально не намагничены, но которые могут стать магнитно поляризованными под воздействием электрического поля, производимым организмом насекомого. Этот механизм действия подробно описан в WO 2004/049807 и включен в данный документ в качестве ссылки.

Предпочтительно, композиция включает носитель, который увеличивает поглощение интерферирующей РНК насекомым-вредителем. Такой носитель может представлять собой липидный носитель, предпочтительно содержащий одно или несколько из следующего: эмульсии типа масла в воде, мицеллы, холестерин, липополиамины и липосомы. Другие средства, которые способствуют поглощению конструкций по настоящему изобретению, хорошо известны специалистам в данной области и включают поликатионы, декстраны и (трис)-катионные липиды, такие как CS096, CS102 и т.п. Коммерчески доступные липосомы включают LIPOFECTIN® и CELLFECTIN® и т.п. Ряд подходящих носителей перечислены под заголовком «усиливающее трансфекцию средство» в патентной заявке WO 03/004644, а каждый из приведенных примеров, таким образом, включен в качестве ссылки.

В дополнительном предпочтительном варианте осуществления носитель представляет собой конденсирующее нуклеиновую кислоту средство. Предпочтительно, конденсирующее нуклеиновую кислоту средство включает спермидин или протамина сульфат или его производное.

Если композиция по настоящему изобретению предназначена для применения в предотвращении и/или борьбе с нападением насекомых на растение, то композиция может содержать подходящий с точки зрения сельского хозяйства носитель. Таким носителем может быть любой материал, который переносит подлежащее обработке растение, который не причиняет ненадлежащий вред для среды или других находящихся в ней организмов и который позволяет интерферирующей РНК оставаться эффективной по отношению к видам насекомых-вредителей. В частности, композиции по настоящему изобретению могут быть составлены для доставки растениям согласно установившихся сельскохозяйственных методик, применяемых в биоинсектицидной промышленности. Композиция может содержать дополнительные компоненты, способные осуществлять другие функции, включая, но без ограничений, (i) усиление или повышение поглощения интерферирующей РНК клетками вредителя и (ii) стабилизацию активных компонентов композиции. Конкретными примерами таких дополнительных компонентов, содержащихся в композиции, включающей интерферирующую РНК, являются tRNA дрожжей или общая РНК дрожжей.

Композиции могут быть составлены для непосредственного применения или в виде концентрата основной композиции, который необходимо разбавить перед применением. Альтернативно, композиция может поставляться в виде набора, содержащего интерферирующую РНК или клетку-хозяина, ее содержащую или экспрессирующую, в одной емкости и подходящий разбавитель или носитель для РНК или клетки-хозяина в отдельной емкости. При конкретном применении настоящего изобретения композицию можно применять по отношению к растению или любой части растения на любом этапе развития растения. В одном варианте осуществления композицию применяют по отношению к надземным частям растения, например, при культивировании растительных культур в полевых условиях. В дополнительном варианте осуществления композицию применяют по отношению к семенам растения либо пока они находятся в хранилище, либо сразу после высадки в почву. Обычно важно хорошо осуществлять борьбу с вредителями на ранних стадиях этапов роста растения, поскольку это время, когда растение может быть наиболее тяжело повреждено видами вредителей.

Композицию можно вносить в среду насекомых-вредителей при помощи различных методик, включая, но без ограничений, опрыскивание, распыление, опыление, рассеивание, полив, нанесение покрытия на семена, обработку семян, внесение в почву и введение в поливную воду. При обработке растений, чувствительных к нападению вредителей, композиция может быть доставлена на растение или часть растения до появления вредителя (с целью предотвращения) или после начала появления признаков нападения вредителя (с целью борьбы с вредителем).

В дополнительном варианте осуществления настоящего изобретения композиции по настоящему изобретению могут быть составлены так, чтобы они содержали по меньшей мере одно дополнительное активное средство. Таким образом, композиция может быть представлена в виде «набора частей», включающего композицию, содержащую интерферирующую РНК, в одной емкости и один или несколько подходящих активных ингредиентов, например, химический или биологический пестицид, в отдельной емкости. Альтернативно, композиции могут быть представлены в виде смесей, которые стабильны и подлежат применению в сочетании друг с другом.

Подходящие активные ингредиенты, которые могут действовать дополняющим образом по отношению к интерферирующим молекулам РНК по настоящему изобретению, включают, но без ограничений, следующие: хлорпирофос, аллетрин, ресметрин, тетрабромэтил, диметол-циклопропанкарбоновая кислота (которую обычно включают в жидкие композиции); и гидраметилнон, авермектин, хлорпирофос, сульфурамид, гидропрен, фипронил (рецептор GABA), изопропилфенилметилкарбамат, индоксакарб (PARA), новифлумурон (ингибитор синтеза хитина), имипротрин (PARA), абамектин (глутамат-зависимый канал для ионов хлора), имидаклоприд (ацетилхолиновый рецептор) (которые включены в композиции приманок).

В предпочтительном варианте осуществления активный ингредиент известен как предпочтительный инсектицид в плане проблем, связанных со здравоохранением и окружающей средой, такой как, например, гидраметилнон и авермектин.

В следующем варианте осуществления настоящего изобретения композицию составляют так, чтобы она содержала по меньшей мере одно агрономическое средство, например, гербицид или дополнительный пестицид. Применяемое в данном документе выражение «второй пестицид» или «дополнительный пестицид» относится к пестициду, отличному от первой или изначальной интерферирующей молекулы РНК композиции. Альтернативно, композиция по настоящего изобретению может быть доставлена в комбинации по меньшей мере с одним другим агрономическим средством, например, гербицидом или вторым пестицидом. В одном варианте осуществления композиция представлена в комбинации с гербицидом, выбранным из любого известного из уровня техники, например, глифосатом, имидазолиноном, сульфонилмочевиной и бромоксинилом. В следующем варианте осуществления композиция представлена в комбинации по меньшей мере с одним дополнительным пестицидом. Дополнительный пестицид может быть выбран из любых известных из уровня техники пестицидов и/или может включать интерферирующую рибонуклеиновую кислоту, которая функционирует при поглощении вредителем с подавлением экспрессии гена-мишени указанного вида вредителя. В одном варианте осуществления целевым вредителем является вид насекомого-вредителя, а интерферирующая РНК выбрана из любой из описанных в данном документе интерферирующих РНК. В следующем варианте осуществления дополнительный пестицид включает интерферирующую РНК, которая функционирует с подавлением экспрессии известного гена у любого целевого вида вредителя, но не ограничиваясь вредителями-насекомыми. Изначальная интерферирующая молекула РНК композиции и второй или дополнительный пестицид(ы) могут целенаправленно воздействовать на один вид насекомого-вредителя или могут быть направлены на воздействие на различные виды насекомых-вредителей. Например, изначальная интерферирующая РНК и второй пестицид могут целенаправленно воздействовать на различные виды насекомых-вредителей или может целенаправленно воздействовать на различные семейства или классы организмов-вредителей, например, грибы, или нематоды, или насекомые. Специалисту в данной области будет понятно, как протестировать комбинации интерферирующих молекул РНК и других агрономических средств в отношении синергических эффектов. В предпочтительном варианте осуществления композиция содержит первую интерферирующую молекулу РНК, описанную в других разделах данного документа, и один или несколько дополнительных пестицидов, каждый из которых токсичен для одного и того же насекомого-вредителя, причем один или несколько дополнительных пестицидов выбраны из пататина, инсектицидного белка Bacillus thuringiensis, инсектицидного белка Xenorhabdus, инсектицидного белка Photorhabdus, инсектицидного белка Bacillus laterosporous, инсектицидного белка Bacillus spaericus и лигнина, и при этом указанный инсектицидный белок Bacillus thuringiensis выбран из группы, состоящей из Cry1Ab, Cry1C, Cry2Aa, Cry3, TIC851, CryET70, Cry22, VIP, TIC901, TIC1201, TIC407, TIC417, бинарного инсектицидного белка, выбранного из CryET33 и CryET34, CryET80 и CryET76, TIC100 и TIC101 и PS149B1, и инсектицидных химер любого из перечисленных инсектицидных белков.

Различные компоненты описанных в данном документе комбинаций можно вводить, например, организму-хозяину, чувствительному к нападению вредителя, в любом порядке. Компоненты на подлежащую обработке территорию или организм можно доставлять одновременно или последовательно.

Также в данном документе предусматривается способ предотвращения и/или борьбы с нападением вредителей, при котором вид насекомого-вредителя контактирует с эффективным количеством по меньшей мере одной интерферирующей РНК, при этом РНК функционирует при поглощении указанным вредителем с подавлением экспрессии жизненно важного гена-мишени вредителя. Жизненно важным геном-мишенью может являться любой ген вредителя, участвующий в регуляции жизненно важного биологического процесса, необходимого вредителю для инициирования или поддержания нападения, включая, но без ограничений, выживание, рост, развитие, размножение и патогенность. В частности, ген-мишень может являться любым из генов вредителя, как описано в данном документе в других местах.

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297 или 310-313, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297 или 310-313, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук),

где ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 79, 349, 352 или 356 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 141, 11, 12, 47-50, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 141, 11, 12, 47-50, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 328 или 84 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 17, 18, 59-62, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 17, 18, 59-62, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в SEQ ID NO: 87 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 19, 20, 63-66, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 19, 20, 63-66, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в SEQ ID NO: 88 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 165, 167, 166, 270-273, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 165, 167, 166, 270-273, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 347 или 348 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 330, 350 или 353 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 145, 122, 144, 178, 131, 179, 210-213, 290-293, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 145, 122, 144, 178, 131, 179, 210-213, 290-293, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в SEQ ID NO: 331 или 351 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 128, 149, 184, 137, 185, 234-237, 302-305, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 128, 149, 184, 137, 185, 234-237, 302-305, или комплементарной ей последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы, включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 337 или 354 (при оптимальном выравнивании указанных кодируемых белков).

Кроме того, в данном документе предусматривается способ предотвращения и/или борьбы с нападением вредителей в поле культурных растений, при этом указанный способ включает экспрессию в указанных растениях эффективного количества интерферирующей РНК, описываемой в данном документе.

В способе, предназначенном для борьбы с нападением вредителя, фраза «эффективное количество» распространяется на количество или концентрацию интерферирующей РНК, необходимые для получения фенотипического эффекта у вредителя таким образом, чтобы уменьшались количества организмов-вредителей, поражающих организм-хозяин, и/или уменьшалось количество повреждений, вызванных вредителем. В одном варианте осуществления фенотипическим эффектом является гибель вредителя, и интерферирующая РНК используется для достижения по меньшей мере 20%, 30%, 40%, предпочтительно, по меньшей мере 50%, 60%, 70%, более предпочтительно, по меньшей мере 80% или 90% смертности вредителей по сравнению с контрольными насекомыми-вредителями. В дополнительном варианте осуществления, фенотипические эффекты включают, но без ограничений, остановку роста вредителя, прекращение питания и уменьшение яйцекладки. Общее количество организмов-вредителей, поражающих организм-хозяин, можно таким образом уменьшить по меньшей мере на 20%, 30%, 40%, предпочтительно, по меньшей мере на 50%, 60%, 70%, более предпочтительно, по меньшей мере на 80% или 90% по сравнению с контрольными вредителями. Альтернативно, ущерб, наносимый насекомыми-вредителями, можно уменьшить по меньшей мере на 20%, 30%, 40%, предпочтительно, по меньшей мере на 50%, 60%, 70%, более предпочтительно, по меньшей мере на 80% или 90% по сравнению с контрольными насекомыми-вредителями. Таким образом, способ по настоящему изобретению можно применять для достижения по меньшей мере 20%, 30%, 40%, предпочтительно, по меньшей мере 50%, 60%, 70%, более предпочтительно, по меньшей мере 80% или 90% эффективности при борьбе с вредителями.

Применяемый в данном документе термин «растение» может содержать любой репродуктивный материал или материал для размножения растения. Ссылка на растение также может включать клетки растений, протопласты растений, культуры тканей растений, растительные каллусы, маточные корневища растений и растительные клетки, которые являются интактными в растениях или частях растений, такие как зародыши, пыльца, семяпочки, семена, листья, цветы, ветки, фрукты, ядра, колосья, початки, шелуха, стебли, корни, кончики корней и тому подобное.

Также в данном документе предусматривается применение интерферирующей рибонуклеиновой кислоты (РНК), описываемой в данном документе, или ДНК-конструкции, описываемой в данном документе, для предотвращения и/или борьбы с нападением насекомых-вредителей, предпочтительно нападением насекомых-вредителей на растения.

Настоящее изобретение будет дополнительно понятно со ссылкой на следующие неограничивающие примеры.

Примеры

Пример 1: Идентификация генов-мишеней у видов насекомых вредителей

1.1. Нормализованная cDNA-библиотека Lygus hesperus и получение dsRNA в многолуночных планшетах для скрининговых исследований

Нуклеиновые кислоты выделили из нимф Lygus hesperus различных стадий жизни, включая только что вылупившихся нимф 2, 4, 6 и 9 дневных нимф и взрослых. Библиотеку cDNA получали, с использованием ПЦР-набора для синтеза cDNA SMARTer™, следуя инструкциям производителя (Clontech кат. № 634925). Библиотеку cDNA нормализовали с использованием набора Trimmer (Evrogen кат. № NK001) и клонировали в векторе PCR4-TOPO (Invitrogen). Нормализация введенных в клоны адаптеров M2 (Trimmer Kit, Evrogen, SEQ ID NO: 92: AAGCAGTGGTATCAACGCAG), противоположно ориентированных на каждом конце клонов. Рекомбинантные конструкции векторов трансформировали в клетки Escherichia coli, штамм TOP10 (Invitrogen). Трансформированные клетки затем разбавляли и высевали с целью получения отдельных колоний или клонов. Клоны проверяли для подтверждения того, что избыточность клонов для библиотеки не превышает 5%. Отдельные клоны отбирали в жидкую LB (бульон Лурия) среду, в 96-луночные планшеты с глубокими лунками, и выращивали в течение ночи при 37°C. Планшеты также включали положительные (Lh423) и отрицательные (FP) контрольные клоны.

Для создания dsRNA с помощью ПЦР создали смысловой и антисмысловой фрагменты ДНК, содержащие последовательность промотора T7. Вкратце, помещали по 1 мкл бактериальной суспензии на клон в многолуночные ПЦР-планшеты, содержащие REDTaq® (Sigma кат. № D4309) и праймеры oGCC2738 (SEQ ID NO: 93: AAGCAGTGGTATCAACGCAG) и oGCC2739 (SEQ ID NO: 94: GCGTAATACGACTCACTATAGGAAGCAGTGGTATCAACGCAG) на основе M2 и T7-M2 последовательностей, соответственно. За ПЦР-реакцией следовала in vitro транскрипция, где добавляли 6 мкл продукта ПЦР на клон к 9 мкл RiboMAX™ Large Scale RNA Production System-T7 (Promega кат. № P1300) и инкубировали в течение ночи при 37°C. Конечный раствор dsRNA разбавляли в 2 раза в L. hesperus сахарозной пище, содержащей 15% сахарозы и 5 мкг/мкл дрожжевой tRNA (Invitrogen кат. № 15401-029) и использовали для скрининга. dsRNA, соответствующей положительному контрольному клону Lh423, является SEQ ID NO: 101, и отрицательному FP контрольному клону, является SEQ ID NO: 104 (см. таблицу 4).

1.2. Скрининг на новые и эффективные гены-мишени Lygus hesperus с использованием cDNA-библиотеки экспрессируемых dsRNA

Разработали новое скрининговое исследование на эффективные мишени Lygus hesperus. Постановка анализа являлась следующей: каждая лунка 96-луночного планшета содержит однодневную L. hesperus нимфу под действием саше из парафильма, содержащего сахарозную пищу, которая включает либо тестируемую dsRNA, либо контрольную dsRNA в присутствии tRNA. Каждый планшет содержал dsRNA из 90 различных клонов, 3×Lh423 (положительный контроль) и 3×FP (флуоресцентный белок; отрицательный контроль). Каждый клон (тестируемая dsRNA) реплицировали на трех планшетах. После трех дней воздействия зарегистрировали число выживших нимф и заменили пищу на свежую пищу (комплексной) для выращивания, не содержащую dsRNA. Смертность оценивали в дни 4, 6 и 8. Идентичную постановку использовали для подтверждающих анализов первого и второго цикла, соответственно с 8 и 20 насекомыми, с одной нимфой на лунку.

Систему анализа проверяли с использованием dsRNA, соответствующей мишени Lh423, в качестве положительного контроля и dsRNA флуоресцентного белка в качестве отрицательного контроля: более 90% являлись истинно положительными и менее 5% являлись ложноположительными, соответственно.

Протестировали двадцать 96-луночных планшетов, поименованных Lh001-Lh020 (см. нижнюю линию на фигурах 1 и 2), содержащих 1800 отдельных клонов. 205 кандидатов идентифицировали и протестировали в первом подтверждающем анализе. Устанавливая пороговую величину на показателе ≥50% смертности, 41 отдельный клон идентифицировали и продвинули во второй цикл подтверждения. В анализе клоны сравнивали с положительными контролями Lh423 (RpL19) и Lh105.2 (Sec23) и отрицательным контролем Pt (кодирующим флуоресцентный белок коралла). dsRNA, соответствующей положительному контрольному клону (Lh423), является SEQ ID NO: 101, соответствующей положительному контрольному клону Lh105.2, является SEQ ID NO: 102 и отрицательному контрольному клону (Pt), является SEQ ID NO: 104 (см. таблицу 4).

Подтверждающие анализы второго цикла, тестирующие 20 насекомых/тестируемых dsRNA, начали для всех тестируемых dsRNA, показывающих ≥50% смертности в первом подтверждении (фигуры 1 и 2). Подходящие мишени, соответствующие подтвержденным тестируемым dsRNA, обозначили с помощью «Lhxxx число» (см. таблицу 1). Применяя то же пороговое значение при ≥50% смертности, в первом скрининге подтвердили 15 мишеней.

Выполнили второй скрининг для идентификации новых мишеней Lygus hesperus. Результаты подтверждающих анализов второго цикла представлены. Применяя то же пороговое значение при ≥50% смертности, несколько мишеней подтвердили во втором скрининге (см. таблицу 1).

1.3. Идентификация мишеней Lygus

Одновременно с подтверждающими анализами на насекомых, вставки, соответствующие положительным клонам, секвенировали, и для подтверждения идентичности мишеней использовали BlastX поиски по сравнению с базами данных белков Drosophila и Triboliu. В таблице 1 приводится краткое изложение биоинформационного анализа и текущая аннотация новых идентифицированных целевых последовательностей L. hesperus.

Пятнадцать новых мишеней L. hesperus идентифицировали в первом скрининге и 11 новых мишеней L. hesperus идентифицировали во втором скрининге. Все мишени проявляют высокую эффективность против нимф L. hesperus, указывая на то, что cDNA, кодирующие двухцепочечные РНК, содержащиеся в них, являются существенно важными для выживания вредителя, и таким образом представляют гены-мишени, представляющие интерес в целях борьбы с вредителями. Последовательности ДНК и предсказанные аминокислотные последовательности данных генов-мишеней, следовательно, определили и представили в таблицах 2 и 3, соответственно.

Lh594, ортолог Lygus hesperus к тропонину I Drosophila, участвующему в сокращении мышц и, следовательно, отсутствующего у растений, представляет новый класс мишеней, относящихся к специфическому для животных физиологическому пути, еще не изученному на GM-RNAi. У плодовой мушки тропонин I описан как гаплонедостаточный ген, проявляющий мутантный фенотип в гетерозиготном состоянии. Такие гены могут являться особенно восприимчивыми к снижению уровней экспрессии mRNA и таким образом могут рассматриваться как идеальные мишени для RNAi.

В данном пути Lh594, отобрали восемь мишеней (см. таблицу 1B). Для каждой мишени до 4 пар вырожденных праймеров ПЦР сконструировали на основе выравнивания последовательностей различных насекомых, включая пчелу, Tribolium и тлю. Данные праймеры применяют для амплификации фрагментов из мишеней Lygus hesperus. Последовательности ДНК и предсказанные аминокислотные последовательности данных генов-мишеней определили и представили в таблицах 2 и 3, соответственно.

Таблица 1
Новые мишени Lygus hesperus, ранжированные по % смертности в соответствии с результатами второго подтверждающего анализа (первый скрининг)
ID мишени Позиция во 2-м подтверждении Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Lh594 1 CG7178 wings up A (тропонин I) wupA
Lh618 2 CG2168 рибосомный белок S3A RpS3A
Lh609 3 CG4087 рибосомный белок LP1 RpLP1
Lh595 4 - не обнаружено попаданий для Drosophila, специфическая мишень/последовательность Lygus
Lh611 5 CG6779 рибосомный белок S3 RpS3
Lh560 6 CG10423 рибосомный белок S27 RpS27
Lh596 7 - не обнаружено попаданий для Drosophila, специфическая мишень/последовательность Lygus RpL34b
Lh615 8 CG11522 рибосомный белок L6 RpL6
Lh617 9 CG7283 рибосомный белок L10Ab RpL10Ab
Lh612 10 CG13389 рибосомный белок S13 RpS13
Lh246 11 CG3195 рибосомный белок L12 RpL12
Lh429 12 CG8900 рибосомный белок S18 RpS18
Lh610 13 CG5502 рибосомный белок L4 RpL4
Lh597 14 не обнаружено попаданий
Lh598 15 CG34069 субъединица II митохондриальной цитохром-с-оксидазы mt:CoII
Lh614 - CG7610 γ-цепь ATP синтазы ATPsyn-γ

Таблица 1B
Новые мишени Lygus hesperus в пути Lh594
ID мишени Лучшее попадание (попадания) НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Lh619 CG7107 тропонин T (upheld) up
Lh620 CG17927 тяжелая цепь миозина Mhc
Lh621 CG4843 Тропомиозин2 (Tm2) Tm2
Lh622 CG3201 цитоплазматическая легкая цепь миозина Mlc-c
Lh623 CG3595 spaghetti squash sqh
Lh624 CG15792 zipper zip
Lh625 *CG2981,CG7930,CG9073,CG6514,CG12408 тропонин C
Lh626 *CG9073,CG7930,CG2981,CG12408,CG6514 тропонин C
* неясно: несколько попаданий в семействе ранжированы в соответствии с собственным значением

Таблица 1C
Новые мишени Lygus hesperus, ранжированные по % смертности в соответствии с результатами второго подтверждающего анализа (второй скрининг)
ID мишени позиция
во 2-м подтверждении
Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Lh631 1 CG6846 Рибосомный белок L26 RpL26
Lh634.2 2 CG12775 Рибосомный белок L21 RpL21
Lh634.1 3 CG12775 Рибосомный белок L21 RpL21
Lh630 4 CG11271 Рибосомный белок S12 RpS12
Lh632 5 CG2998 Рибосомный
белок S28b
RpS28b
Lh618.2 6 CG2168 Рибосомный белок S3A RpS3A
Lh629 7 CG4651 Рибосомный белок L13 RpL13
Lh633.2 8 CG17521 Рибосомный белок L10 RpL10
Lh628 9 CG17489 Рибосомный белок L5 RpL5
Lh633 10 CG17521 Рибосомный белок L10 RpL10
Lh627 11 CG2033 Рибосомный белок S15Aa RpS15A

1.4. Клонирование полноразмерной cDNA с помощью RACE (быстрая амплификация концов cDNA)

Для клонирования полноразмерной cDNA, начиная от известного клона внутреннего фрагмента из самых эффективных мишеней, использовали набор 5’/3’ RACE (Roche, кат. № 1734792; на основе Sambrook, J. & Russell, D.M). Следовали стандартному протоколу, описанному в руководстве по эксплуатации. Вкратце, для 5’ RACE сконструировали антисмысловой праймер, специфический для целевой последовательности, на известной последовательности, и применяли для синтеза первой цепи cDNA, применяя РНК Lygus в качестве матрицы. К первой цепи cDNA добавили хвост и использовали в качестве якоря для синтеза второй цепи и амплификации неизвестной концевой части транскрипта. Для 3’ RACE применяли якорный олиго-dT праймер для синтеза первой цепи cDNA. Для 5’ и 3’ RACE во второй реакции ПЦР применяли вложенные праймеры, специфические для целевой последовательности. Фрагменты ПЦР анализировали на агарозном геле, очищали, клонировали и секвенировали для подтверждения.

Последовательности полноразмерной cDNA, соответствующие мишеням, собрали в VectorNTi, полностью интегрированном пакете программного обеспечения для анализа последовательности, с целью анализа последовательности ДНК (Invitrogen).

Пример 2: In vitro получение двухцепочечных РНК для сайленсинга генов

2.2. Получение dsRNA, соответствующих частичным последовательностям генов-мишеней Lygus hesperus

Двухцепочечную РНК синтезировали в миллиграммовых количествах. Сначала, две отдельные матрицы 5' T7 РНК-полимеразного промотора (смысловая матрица и антисмысловая матрица) создали с помощью ПЦР. ПЦР разрабатывали и проводили таким образом, чтобы получить смысловой и антисмысловой матричные полинуклеотиды, каждый из которых обладает T7 промотором в различной ориентации по отношению к целевой последовательности, подлежащей транскрибированию.

Для каждого из генов-мишеней создали смысловую матрицу, применяя мишень-специфический T7 прямой праймер и мишень-специфический обратный праймер. Антисмысловые матрицы создали, применяя мишень-специфический прямой праймер и мишень-специфический T7 обратный праймер. Последовательности соответствующих праймеров для амплификации смысловой и антисмысловой матриц посредством ПЦР для каждого из генов-мишеней приведены в таблице 4. ПЦР-продукты анализировали с помощью электрофореза в агарозном геле и очистили. Полученные смысловую и антисмысловую T7 матрицы смешали и транскрибировали путем добавления T7 РНК-полимеразы. Одноцепочечным РНК, полученным путем транскрипции с матриц, предоставили возможность соединиться, обработали с помощью ДНКазы и РНКазы и очистили осаждением. Смысловая цепь образующейся в результате dsRNA, полученная от каждого из генов-мишеней, приведена в таблице 4.

2.2. Испытания анализа выживаемости для новых мишеней Lygus hesperus

Для создания возможности ранжирования в соответствии с эффективностью, in vitro dsRNA, соответствующие новым мишеням, синтезировали и применили к L. hesperus в 10-дневных биопробах анализа выживаемости. Вкратце, однодневных нимф L. hesperus поместили в 96-луночные планшеты с сахарозными пленками, содержащими 0,5 мкг/мкл dsRNA-мишени, с добавлением 5 мкг/мкл дрожжевой tRNA. Планшеты инкубировали в течение 3 дней в стандартных условиях выращивания Lygus. В дни 3, 6 и 8 пищевые пленки обновляли пленками, содержащими только пищу Lygus. Lh423 (RpL19) использовали в качестве положительного контроля, а GFP dsRNA и сахарозную пищу использовали в качестве отрицательного контроля.

Результаты анализа выживаемости подтвердили данные первого и второго подтверждающих анализов. Lh594 установили в качестве высокоэффективной мишени с активностью и скоростью поражения, более сильной, чем сильный контроль Lh423.

До сих пор скрининг Lygus на новые мишени идентифицировал новые мишени с активностями более высокими или находящимися в диапазоне положительного контроля Lh423, которые включают Lh429, Lh594, Lh609, Lh610, Lh611, Lh617 и Lh618. Смертность, вызванная данными мишенями, показана на фигурах 3 и 4.

Для обеспечения более точного ранжирования мишеней в соответствии с их активностью выполнили анализы концентрации в зависимости от дозы. Новые мишени тестировали в in vitro анализах при концентрации в диапазоне от 0,4 до 0,025 мкг/мкл. Согласно условию, 24-дневных нимф тестировали в постановке с 96-луночным планшетом, в сахарозной пище с добавлением dsRNA и носителя tRNA. Результаты представлены в виде % выживаемости в течение 10-дневного эксперимента (фигуры 5-9) и суммированы в таблице 5.

На основе анализа кривой концентрации мишени ранжировали путем сравнения с исходными контролями Lh423 и Lh105 (таблица 5).

Таблица 5
Ранжирование новых мишеней Lygus в соответствии с DRC и по сравнению с исходными мишенями Lh423 и Lh105
ID
мишени
Эффективность, выраженная в мкг/мкл dsRNA, необходимая для достижения 90% уничтожения в день 7
Lh594 0,025 (в день 6)
Lh618 0,05-0,1
Lh612 0,05
Lh615 0,05
Lh423 0,1
Lh595 0,1
Lh560 0,1
Lh610 0,1
Lh617 0,1
Lh105 0,2
Lh614 0,2 (в день 6)
Lh611 0,2
Lh596 0,3
Lh609 Не определено
Lh429 Не определено

Эффективность Lh594 подтвердили дополнительно. Эффект данной мишени отчетливо наблюдается по меньшей мере за один день до эффекта других мишеней и исходного положительного контроля Lh105 и Lh423. Так как Lh594 являлась высокоэффективной, в стандартном DRC эксперименте с концентрацией в диапазоне от 0,4 до 0,025 мкг/мкл dsRNA LD50 не достигли (фигура 6), следовательно, Lh594 эксперимент повторили, включая более низкие концентрации в диапазоне от 0,05 до 0,001 мкг/мкл dsRNA (фигура 10). В заключение, активность Lh594 наблюдали при такой низкой концентрации, как 0,0025 мкг/мкл, и получили примерно 90% уничтожение (что соответствует примерно 10% выживаемости) в день 6 при 0,025 мкг dsRNA.

Для дополнительного изучения эффективности Lh594 и роли носителя tRNA в ответе на RNAi у Lygus hesperus, дополнительные in vitro анализы питания подготовили в отсутствие носителя tRNA. Lh594, Lh423 (исходный контроль) и GFP (отрицательный контроль) dsRNA получили in vitro, применяя стандартный способ. dsRNA очистили и тестировали при 5 мкг/мкл в отсутствие tRNA (фигура 11 A).

В отсутствие tRNA, мишени Lh594 и Lh423 индуцировали высокую летальность у нимф Lygus. Результаты данного эксперимента были воспроизведены позднее. dsRNA-мишень обладала способностью индуцировать эффекты RNAi-путем-кормления у нимф Lygus в отсутствие tRNA.

Для исследования активности dsRNA при более низких концентрациях в отсутствие носителя tRNA, поставили дополнительные эксперименты, применяя уменьшение количеств dsRNA (фигура 11 B).

Аналогичный подход применялся для мишеней Lygus, которые идентифицировали во втором скрининге. Для обеспечения ранжирования мишеней в соответствии с их активностью выполнили анализы концентрации в зависимости от дозы. Новые мишени тестировали в in vitro анализах при концентрациях в диапазоне от 0,5 до 0,05 мкг/мкл. Согласно условию, 24-дневных нимф тестировали в постановке с 96-луночным планшетом, в сахарозной пище с добавлением dsRNA и носителя tRNA. Результаты представлены в виде % выживаемости в течение 9-дневного эксперимента. Lh594 и Lh423 включили в анализ в качестве эталонных мишеней. Результаты суммированы в таблице 6. На основе анализа кривой концентрации мишени ранжировали путем сравнения с исходным контролем Lh423.

Таблица 6
новые мишени Lygus из второго скрининга, ранжирование в соответствии с DRC и по сравнению с исходными мишенями Lh423 и Lh594
ID мишени Эффективность, выраженная в мкг/мкл dsRNA, необходимая для достижения 90% уничтожения в день 7
Lh594 0,025 (в день 6)
Lh634 0,1
Lh423 0,1
Lh631 0,4
Lh633 0,4
Lh627 0,5
Lh628 0,5
Lh630 0,5
Lh632 0,5
Lh629 Не определено

Пример 3: Скрининг пути тропонина

Для создания возможности тестирования мишеней пути тропонина, in vitro полученные dsRNA, соответствующие Lh619, Lh620, Lh621, Lh622, Lh622, Lh623, Lh624, Lh625 и Lh626, синтезировали и применили к L. hesperus в 10-дневных биопробах анализа выживаемости. Вкратце, однодневных нимф L. hesperus поместили в 96-луночные планшеты с сахарозными пленками, содержащими 0,5 мкг/мкл dsRNA-мишени, с добавлением 5 мкг/мкл дрожжевой tRNA. Планшеты инкубировали в течение 3 дней в стандартных условиях выращивания Lygus. В дни 3, 6 и 8 пищевые пленки обновляли пленками, содержащими только пищу Lygus. Lh594 (тропонин I) использовали в качестве положительного контроля и GFP dsRNA и сахарозную пищу использовали в качестве отрицательных контролей. Четыре мишени затем включили в анализы кривой дозовой зависимости в in vitro анализе, с концентрациями в диапазоне от 0,4 до 0,025 мкг/мкл. Согласно условию, 24-дневных нимф тестировали в постановке с 96-луночным планшетом, в сахарозной пище с добавлением dsRNA и носителя tRNA. Результаты представлены в виде % выживаемости в течение 10-дневного эксперимента.

Пример 4: Идентификация генов-мишеней у Leptinotarsa decemlineata

4.1. Нормализованная cDNA-библиотека Leptinotarsa decemlineata и получение dsRNA в многолуночных планшетах для скрининговых исследований

Нуклеиновые кислоты выделили из личинок Leptinotarsa decemlineata различных стадий. Библиотеку cDNA получали с использованием ПЦР-набора для синтеза cDNA SMARTer™, следуя инструкциям производителя (Clontech кат. № 634925). Библиотеку cDNA нормализовали, применяя набор Trimmer (Evrogen кат. No NK001), и клонировали в PCR®-BLUNTII-TOPO® вектор (Invitrogen). При нормализация клонов вводили M2 адаптеры (Trimmer Kit, Evrogen, SEQ ID NO: 92: AAGCAGTGGTATCAACGCAG), противоположно ориентированные на каждом конце клонов. Рекомбинантные конструкции векторов трансформировали в клетки Escherichia coli, штамм TOP10 (Invitrogen). Трансформированные клетки затем разбавляли и высевали с целью получения отдельных колоний или клонов. Клоны проверяли для подтверждения того, что избыточность клонов для библиотеки не превышает 5%. Отдельные клоны инокулировали в жидкую LB (бульон Лурия) среду, в 96-луночные планшеты, и выращивали в течение ночи при 37°C. Планшеты также включали положительный (Ld513) и отрицательный (FP) контрольные клоны.

Для создания dsRNA с помощью ПЦР создали смысловой и антисмысловой фрагменты ДНК, содержащие последовательность T7 промотора. Вкратце, на клон, 1 мкл бактериальной суспензии помещали в многолуночные ПЦР-планшеты, содержащие REDTaq® (Sigma кат. № D4309) и праймеры oGCC2738 (SEQ ID NO: 93: AAGCAGTGGTATCAACGCAG) и oGCC2739 (SEQ ID NO: 94: GCGTAATACGACTCACTATAGGAAGCAGTGGTATCAACGCAG) на основе последовательностей M2 и T7-M2, соответственно. За ПЦР реакцией следовала in vitro транскрипция, при этом на клон использовали 6 мкл ПЦР-продукта в 20 мкл реакционного объема, содержащего реагенты для транскрипции, обеспеченные набором RiboMAX™ Large Scale RNA Production System-T7 (Promega кат. № P1300), и инкубировали в течение ночи при 37°C. Конечный раствор dsRNA разбавляли стерильной водой Milli-Q и использовали для скрининга. dsRNA, соответствующей положительному Ld513 контрольному клону, является SEQ ID NO: 400 (см. таблицу 9), и отрицательному FP контрольному клону, является SEQ ID NO: 104 (см. таблицу 4).

4.2. Скрининг на новые и эффективные гены мишени Leptinotarsa decemlineata с использованием cDNA-библиотеки экспрессируемых dsRNA

Каждая лунка 48-луночного планшета содержала 0,5 мл искусственной пищи, предварительно обработанной с помощью наружного покрытия 25 мкл (или 1 мкг) тестируемой или контрольной dsRNA. Одну L2 личинку помещали в каждую лунку, и на клон тестировали 3 личинки. Количества выживших CPB оценивали в дни 4, 7 и 10.

Во второй биопробе личинок CPB кормили пищей, обработанной наружно наносимой тестируемой dsRNA, полученной из клонов, полученных из нормализованной библиотеки cDNA. Одну личинку помещали в лунку 48-луночного мультипланшета, содержащего 0,5 мл пищи, предварительно обработанной с помощью наружного покрытия 25 мкл 40 нг/мкл dsRNA раствора. Всего на обработку (клон) тестировали двадцать четыре личинки. Количество выживших насекомых оценивали в дни 4, 5, 6, 7, 8 и 11. Процент смертности личинок рассчитывали относительно дня 0 (начало исследования).

4.3. Идентификация мишеней у L. decemlineata жуков

Новые целевые последовательности из скрининга в 5.2. и целевые последовательности, соответствующие мишеням пути тропонина, ортологическим Lygus Lh594, Lh619 и Lh620 последовательностям, идентифицировали у L. decemlineata. Праймеры, которые обеспечили соответствующие фрагменты cDNA для Ld594, перечислены в таблице 17. Последовательности cDNA и предсказанные аминокислотные последовательности данных генов-мишеней определили и представили в таблицах 7 и 9, соответственно.

4.4. Получение dsRNA, соответствующих частичным последовательностям L. decemlineata генов-мишеней

dsRNA синтезировали с использованием праймеров, которые указаны в таблице 9. Смысловая цепь полученной в результате dsRNA, полученная из генов-мишеней, приведена в таблице 9.

4.5. Испытания анализа выживаемости для новых L. decemlineata мишеней

Ранний личиночный анализ

Синтетические dsRNA получили для 3 мишеней, Ld594, Ld619 и Ld620, и тестировали в анализе с питанием на личинках CPB. 10-дневный анализ проводили в 48-луночных планшетах, на искусственной пище (на основе Gelman et al., J Ins Sc,1:7, 1-10: Artificial diets for rearing the Colorado Potato Beetle), с добавлением 1 мкг dsRNA/лунку с 12 личинками согласно условиям.

Наблюдали четкий эффект на развитие личинок. Второй анализ поставили для изучения эффекта данных dsRNA в течение окукливания и метаморфоза (см. анализ окукливания ниже).

Анализ окукливания

Анализ окукливания CPB поставили для изучения эффекта RNAi нокдауна Ld594, Ld619 и Ld620 в течение окукливания и метаморфоза. Личинок четвертой возрастной стадии кормили 1 мкг in vitro синтезированной dsRNA, распределенной на листовых дисках картофеля, и затем переносили в коробку с необработанными свежими листьями картофеля. Через четыре дня выживших насекомых помещали на вермикулит для обеспечения окукливания. Обработанные с помощью Lh594 насекомые были медленными, более мелкими и, в основном, не способными пройти окукливание. Вылупление куколки оценивали в конце эксперимента. Для необработанного контроля 24 личинки окуклились и все вылупились в здоровых имаго. Для Ld620 наблюдали снижение численности личинок, прогрессирующих в окукливание. Для трех протестированных мишеней отсутствовали личинки, развившиеся в здоровые куколки, и ни одна не вылупилась в имаго. Мертвые насекомые, извлеченные из вермикулита, демонстрировали различную степень пороков развития.

Ld594, Ld619 и Ld620 вначале предстали в качестве несмертельных мишеней в анализе личинок CPB, хотя снижение жизнеспособности отчетливо наблюдалось у насекомых, обработанных dsRNA. С другой стороны, в анализе окукливания все 3 мишени индуцировали сильные эффекты и ингибировали вхождение в окукливание и/или метаморфоз.

Анализ имаго

Для оценки активности Ld594, Ld619 и Ld620 у имаго CPB поставили анализ листовых дисков. Листовые диски картофеля (1,7 см в диаметре) покрыли dsRNA или контролями и поместили в 3,5 см чашки Петри с одним взрослым жуком. На следующий день насекомым предоставили свежий обработанный листовой диск. На третий день имаго перенесли в коробку, содержащую достаточно свежих, необработанных листьев картофеля для поддержания выживания необработанных контролей. На обработку тестировали 6 имаго и подсчитывали количества выживших и умирающих насекомых с регулярными интервалами от дня 6 до дня 13. Насекомые считались умирающими, если они не могли перевернуться после укладывания на спину.

Несмотря на относительно высокий уровень фона в отрицательном контроле в данном конкретном анализе, наблюдали четкие эффекты на насекомых, которых подвергли воздействию Ld594 или Ld619 dsRNA.

Пример 5: Идентификация генов-мишеней у Nilaparvata lugens

5.1. Идентификация мишеней Nilaparvata lugens

Новые целевые последовательности, соответствующие мишеням пути тропонина и названные Nl594 (тропонин I), Nl619 (тропонин T) и Nl626 (тропонин C), идентифицировали у коричневого дельфацида, Nilaparvata lugens. Ортологические последовательности генов Lygus, названные Nl594 (тропонин I), Nl619 (тропонин T) и Nl625/626 (тропонин C), клонировали посредством ПЦР с вырожденными праймерами с использованием BPH cDNA в качестве матрицы. В дополнение, полноразмерную cDNA идентифицировали для Nl594, применяя RACE (см. способ выше). ПЦР-систему AmpliTaq Gold (Applied Biosystems) применяли, следуя инструкциям производителя и в стандартных условиях для реакции ПЦР с вырожденными праймерами, как правило, следующим образом: 1 цикл в 10 минут при 95°C, с последующими 40 циклами по 30 секунд при 95°C, 1 минуту при 50°C и 1 минуту при 72°C, с последующими 10 минутами при 72°C. Для увеличения степени успеха до 10 различных вырожденных праймеров, прямых и обратных, разработали на основе выравниваний ортологических последовательностей у других видов и использовали в различных комбинациях. Полученные ПЦР-фрагменты очищали из геля с помощью набора для экстракции геля (Qiagen Cat. No 28706) и клонировали в TOPO TA вектор (Invitrogen). Клоны секвенировали и консенсусные последовательности использовали в Blast поисках в отношении различных доступных баз данных последовательностей насекомых для подтверждения значимости вставки. Вырожденные праймеры, которые привели к успешной амплификации, перечислены в таблице 18.

Последовательности ДНК и предсказанные аминокислотные последовательности данных генов-мишеней и еще одного гена-мишени (Nl537) определили и представили в таблицах 10 и 11, соответственно.

5.2. Получение dsRNA, соответствующих частичным последовательностям генов-мишеней Nilaparvata lugens

dsRNA синтезировали с использованием праймеров, которые указаны в таблице 12. Смысловая цепь образующейся в результате dsRNA, полученная от каждого из генов-мишеней, приведена в таблице 12.

5.3. Испытания анализа выживаемости для новых мишеней Nilaparvata lugens

dsRNA синтезировали и тестировали в предварительно оптимизированных анализах RNAi-путем-кормления у BPH, в присутствии цвиттерионного детергента, CHAPSO, при 0,1% конечной концентрации. dsRNA тестировали при 0,5 мкг/мкл конечной концентрации. Nl537, эффективную мишень в анализах BPH, использовали в качестве исходной мишени в данном анализе. Выживаемость насекомых оценивали на протяжении 9 дней.

Результаты биопробы показали, что у BPH Nl594, Nl619 и Nl626 также являлись эффективными мишенями RNAi у BPH.

Пример 6: Идентификация генов-мишеней у Acyrthosiphon pisum

6.1. Идентификация мишеней Acyrthosiphon pisum

Новые целевые последовательности идентифицировали у тлей и назвали Ap423, Ap537, Ap560 и Ap594, следуя той же номенклатуре: «Apxxx», где «Ap» соответствует Acyrthosiphon pisum и «xxx» соответствует ID мишени. Праймеры разрабатывали на основе открытого источника предсказания генов в AphidBase (ref: http://www.aphidbase.com/) (таблица 13).

Последовательности ДНК и предсказанные аминокислотные последовательности данных генов-мишеней определили и представили в таблицах 14 и 15, соответственно.

6.2. Получение dsRNA, соответствующих частичным последовательностям генов-мишеней тли

dsRNA синтезировали с использованием праймеров, которые указаны в таблице 16. Смысловая цепь образующейся в результате dsRNA, полученная от каждого из генов-мишеней, приведена в таблице 16.

6.3. Испытания анализа выживаемости для новых мишеней у тлей

RNAi-путем-кормления тестировали у Acyrthosiphon pisum (гороховая тля) с 4 мишенями Ap594, Ap423, Ap560, Ap537. Последовательности амплифицировали с помощью ПЦР с использованием праймеров, разработанных на основе открытого источника информации о последовательностях (http://www.aphidbase.com), и cDNA, полученной из тлей. Синтетические dsRNA получали и тестировали в конечной концентрации 0,5 мкг/мкл в присутствии 5 мкг/мкл дрожжевой tRNA в сахарозной пище. Десять новорожденных нимф гороховой тли поместили в маленькую чашку Петри (32 мм). Пятьдесят мкл пищи (с tRNA и dsRNA) наносили пипеткой на верхнюю часть первого слоя парафильма. Второй слой парафильма покрывал пищу и создавал пакетик для кормления, где тли могли питаться. На каждую мишень подготовили пять повторов 10 новорожденных нимф. GFP dsRNA использовали в качестве отрицательного контроля. Пищу обновляли в дни 4 и 7 анализов и оценивали выживаемость.

Таблица 2
ID мишени Последовательность cDNA (смысловая цепь) 5’→3’
Lh594 SEQ ID NO: 1
Lh609 SEQ ID NO: 3
Lh610 SEQ ID NO: 5
Lh610 (b) SEQ ID NO: 139
Lh611 SEQ ID NO: 7
Lh611 (b) SEQ ID NO: 140
Lh617 SEQ ID NO: 9
Lh618 SEQ ID NO: 11
Lh618 (b) SEQ ID NO: 141
Lh429 SEQ ID NO: 13
Lh423 SEQ ID NO: 95
Lh105.2 SEQ ID NO: 96
Lh560 SEQ ID NO: 15
Lh615 SEQ ID NO: 17
Lh612 SEQ ID NO: 19
Lh246 SEQ ID NO: 21
Lh597 SEQ ID NO: 23
Lh598 SEQ ID NO: 25
Lh619 SEQ ID NO: 121
Lh619 (b) SEQ ID NO: 142
Lh619 (c) SEQ ID NO: 143
Lh620 SEQ ID NO: 122
Lh620 (b) SEQ ID NO: 144
Lh620 (c) SEQ ID NO: 145
Lh621 SEQ ID NO: 123
Lh622 SEQ ID NO: 124
Lh623 SEQ ID NO: 125
Lh623 (b) SEQ ID NO: 146
Lh624 SEQ ID NO: 126
Lh624 (b) SEQ ID NO: 147
Lh625 SEQ ID NO: 127
Lh625 (b) SEQ ID NO: 148
Lh626 SEQ ID NO: 128
Lh626 (b) SEQ ID NO: 149
Lh614 SEQ ID NO: 129
Lh627 SEQ ID NO: 150
Lh628 SEQ ID NO: 152
Lh629 SEQ ID NO: 154
Lh630 SEQ ID NO: 156
Lh631 SEQ ID NO: 158
Lh632 SEQ ID NO: 160
Lh633.1 SEQ ID NO: 162
Lh633.2 SEQ ID NO: 163
Lh634.1 SEQ ID NO: 165
Lh634.2 SEQ ID NO: 167
Lh595.1 SEQ ID NO: 168
Lh595.2 SEQ ID NO: 170
Lh596 SEQ ID NO: 172

Таблица 3
ID мишени Соответствующая аминокислотная последовательность
cDNA клона, представленного в таблице 2
Lh594 SEQ ID NO: 79
Lh609 SEQ ID NO: 80
Lh610 SEQ ID NO: 81
Lh610 (b) SEQ ID NO: 326
Lh611 SEQ ID NO: 82
Lh611 (b) SEQ ID NO: 327
Lh617 SEQ ID NO: 83
Lh618 SEQ ID NO: 84
Lh618 (b) SEQ ID NO: 328
Lh429 SEQ ID NO: 85
Lh429 (b) SEQ ID NO: 329
Lh423 SEQ ID NO: 99
Lh105.2 SEQ ID NO: 100
Lh560 SEQ ID NO: 86
Lh615 SEQ ID NO: 87
Lh612 SEQ ID NO: 88
Lh246 SEQ ID NO: 89
Lh597 SEQ ID NO: 90
Lh598 SEQ ID NO: 91
Lh619 SEQ ID NO: 330
Lh620 SEQ ID NO: 331
Lh621 SEQ ID NO: 332
Lh622 SEQ ID NO: 333
Lh623 SEQ ID NO: 334
Lh624 SEQ ID NO: 335
Lh625 SEQ ID NO: 336
Lh626 SEQ ID NO: 337
Lh614 SEQ ID NO: 338
Lh627 SEQ ID NO: 339
Lh628 SEQ ID NO: 340
Lh629 SEQ ID NO: 341
Lh630 SEQ ID NO: 342
Lh631 SEQ ID NO: 343
Lh632 SEQ ID NO: 344
Lh633.1 SEQ ID NO: 345
Lh633.2 SEQ ID NO: 346
Lh634.1 SEQ ID NO: 347
Lh634.2 SEQ ID NO: 348

Таблица 4
ID мишени Прямые праймеры
5’→3’
Обратные праймеры
5’→3’
dsRNA: смысловая цепь, представленная эквивалентной последовательностью ДНК 5’→3’
Lh594 SEQ ID NO: 27
SEQ ID NO: 29
SEQ ID NO: 28
SEQ ID NO: 30
SEQ ID NO: 2
Lh609 SEQ ID NO: 31
SEQ ID NO: 33
SEQ ID NO: 32
SEQ ID NO: 34
SEQ ID NO: 4
Lh610 SEQ ID NO: 35
SEQ ID NO: 37
SEQ ID NO: 36
SEQ ID NO: 38
SEQ ID NO: 6
Lh611 SEQ ID NO: 39
SEQ ID NO: 41
SEQ ID NO: 40
SEQ ID NO: 42
SEQ ID NO: 8
Lh617 SEQ ID NO: 43
SEQ ID NO: 45
SEQ ID NO: 44
SEQ ID NO: 46
SEQ ID NO: 10
Lh618 SEQ ID NO: 47
SEQ ID NO: 49
SEQ ID NO: 48
SEQ ID NO: 50
SEQ ID NO: 12
Lh429 SEQ ID NO: 51
SEQ ID NO: 53
SEQ ID NO: 52
SEQ ID NO: 54
SEQ ID NO: 14
Lh423 SEQ ID NO: 105
SEQ ID NO: 107
SEQ ID NO: 106
SEQ ID NO: 108
SEQ ID NO: 101
Lh105.2 SEQ ID NO: 109
SEQ ID NO: 111
SEQ ID NO: 110
SEQ ID NO: 112
SEQ ID NO: 102
GFP SEQ ID NO: 113
SEQ ID NO: 115
SEQ ID NO: 114
SEQ ID NO: 116
SEQ ID NO: 103
Pt SEQ ID NO: 117
SEQ ID NO: 119
SEQ ID NO: 118
SEQ ID NO: 120
SEQ ID NO: 104
Lh560 SEQ ID NO: 55
SEQ ID NO: 57
SEQ ID NO: 56
SEQ ID NO: 58
SEQ ID NO: 16
Lh615 SEQ ID NO: 59
SEQ ID NO: 61
SEQ ID NO: 60
SEQ ID NO: 62
SEQ ID NO: 18
Lh612 SEQ ID NO: 63
SEQ ID NO: 65
SEQ ID NO: 64
SEQ ID NO: 66
SEQ ID NO: 20
Lh246 SEQ ID NO: 67
SEQ ID NO: 69
SEQ ID NO: 68
SEQ ID NO: 70
SEQ ID NO: 22
Lh597 SEQ ID NO: 71
SEQ ID NO: 73
SEQ ID NO: 72
SEQ ID NO: 74
SEQ ID NO: 24
Lh598 SEQ ID NO: 75
SEQ ID NO: 77
SEQ ID NO: 76
SEQ ID NO: 78
SEQ ID NO: 26
Lh619 SEQ ID NO: 206
SEQ ID NO: 208
SEQ ID NO: 207
SEQ ID NO: 209
SEQ ID NO: 130
Lh620 SEQ ID NO: 210
SEQ ID NO: 212
SEQ ID NO: 211
SEQ ID NO: 213
SEQ ID NO: 131
Lh621 SEQ ID NO: 214
SEQ ID NO: 216
SEQ ID NO: 215
SEQ ID NO: 217
SEQ ID NO: 132
Lh622 SEQ ID NO: 218
SEQ ID NO: 220
SEQ ID NO: 219
SEQ ID NO: 221
SEQ ID NO: 133
Lh623 SEQ ID NO: 222
SEQ ID NO: 224
SEQ ID NO: 223
SEQ ID NO: 225
SEQ ID NO: 134
Lh624 SEQ ID NO: 226
SEQ ID NO: 228
SEQ ID NO: 227
SEQ ID NO: 229
SEQ ID NO: 135
Lh625 SEQ ID NO: 230
SEQ ID NO: 232
SEQ ID NO: 231
SEQ ID NO: 233
SEQ ID NO: 136
Lh626 SEQ ID NO: 234
SEQ ID NO: 236
SEQ ID NO: 235
SEQ ID NO: 237
SEQ ID NO: 137
Lh614 SEQ ID NO: 238
SEQ ID NO: 240
SEQ ID NO: 239
SEQ ID NO: 241
SEQ ID NO: 138
Lh627 SEQ ID NO: 242
SEQ ID NO: 244
SEQ ID NO: 243
SEQ ID NO: 245
SEQ ID NO: 151
Lh628 SEQ ID NO: 246
SEQ ID NO: 248
SEQ ID NO: 247
SEQ ID NO: 249
SEQ ID NO: 153
Lh629 SEQ ID NO: 250
SEQ ID NO: 25
SEQ ID NO: 251
SEQ ID NO: 253
SEQ ID NO: 155
Lh630 SEQ ID NO: 254
SEQ ID NO: 256
SEQ ID NO: 255
SEQ ID NO: 257
SEQ ID NO: 157
Lh631 SEQ ID NO: 258
SEQ ID NO: 260
SEQ ID NO: 259
SEQ ID NO: 261
SEQ ID NO: 159
Lh632 SEQ ID NO: 262
SEQ ID NO: 264
SEQ ID NO: 263
SEQ ID NO: 265
SEQ ID NO: 161
Lh633.2 SEQ ID NO: 266
SEQ ID NO: 268
SEQ ID NO: 267
SEQ ID NO: 269
SEQ ID NO: 164
Lh634.1 SEQ ID NO: 270
SEQ ID NO: 272
SEQ ID NO: 271
SEQ ID NO: 273
SEQ ID NO: 166
Lh595 SEQ ID NO: 274
SEQ ID NO: 276
SEQ ID NO: 275
SEQ ID NO: 277
SEQ ID NO: 169
Lh596 SEQ ID NO: 278
SEQ ID NO: 280
SEQ ID NO: 279
SEQ ID NO: 281
SEQ ID NO: 173

Таблица 7
ID мишени Последовательность cDNA (смысловая цепь) 5’→3’
Ld594 SEQ ID NO: 174
Ld619 SEQ ID NO: 176
Ld620 SEQ ID NO: 178
Ld583 SEQ ID NO: 386
Ld584 SEQ ID NO: 387
Ld586 SEQ ID NO: 388
Ld588 SEQ ID NO: 389
Ld513 SEQ ID NO: 394

Таблица 8
ID мишени Соответствующая аминокислотная последовательность cDNA клона, представленного в таблице 9
Ld594 SEQ ID NO: 349
Ld619 SEQ ID NO: 350
Ld620 SEQ ID NO: 351
Ld583 SEQ ID NO: 390
Ld584 SEQ ID NO: 391
Ld586 SEQ ID NO: 392
Ld588 SEQ ID NO: 393
Ld513 SEQ ID NO: 395

Таблица 9
ID мишени Прямые праймеры
5’→3’
Обратные праймеры
5’→3’
dsRNA: смысловая цепь, представленная эквивалентной последовательностью
ДНК 5’→3’
Ld594 SEQ ID NO: 282
SEQ ID NO: 284
SEQ ID NO: 283
SEQ ID NO: 285
SEQ ID NO: 175
Ld619 SEQ ID NO: 286
SEQ ID NO: 288
SEQ ID NO: 287
SEQ ID NO: 289
SEQ ID NO: 177
Ld620 SEQ ID NO: 290
SEQ ID NO: 292
SEQ ID NO: 291
SEQ ID NO: 293
SEQ ID NO: 179
Ld513 SEQ ID NO: 396
SEQ ID NO: 398
SEQ ID NO: 397
SEQ ID NO: 399
SEQ ID NO: 400

Таблица 10
ID мишени Последовательность cDNA (смысловая цепь) 5’→3’
Nl594 SEQ ID NO: 180
Nl619 SEQ ID NO: 182
Nl626 SEQ ID NO: 184
Nl537 SEQ ID NO: 186

Таблица 11
ID мишени Соответствующая аминокислотная последовательность cDNA клона, представленного в таблице 12
Nl594 SEQ ID NO: 352
Nl619 SEQ ID NO: 353
Nl626 SEQ ID NO: 354
Nl537 SEQ ID NO: 355

Таблица 12
ID мишени Прямые праймеры 5’→3’ Обратные праймеры 5’→3’ dsRNA: смысловая цепь, представленная эквивалентной последовательностью ДНК
5’→3’
Nl594 SEQ ID NO: 294
SEQ ID NO: 296
SEQ ID NO: 295
SEQ ID NO: 297
SEQ ID NO: 181
Nl619 SEQ ID NO: 298
SEQ ID NO: 300
SEQ ID NO: 299
SEQ ID NO: 301
SEQ ID NO: 183
Nl626 SEQ ID NO: 302
SEQ ID NO: 304
SEQ ID NO: 303
SEQ ID NO: 305
SEQ ID NO: 185
Nl537 SEQ ID NO: 306
SEQ ID NO: 308
SEQ ID NO: 307
SEQ ID NO: 309
SEQ ID NO: 187

Таблица 13
Мишень Прямой праймер Обратный праймер
Ap594 SEQ ID NO: 369 SEQ ID NO: 370
Ap423 SEQ ID NO: 371 SEQ ID NO: 372
Ap537 SEQ ID NO: 373 SEQ ID NO: 374
Ap560 SEQ ID NO: 375 SEQ ID NO: 376

Таблица 14
ID мишени Последовательность cDNA (смысловая цепь) 5’→3’
Ap594 SEQ ID NO: 188
Ap423 SEQ ID NO: 200
Ap537 SEQ ID NO: 202
Ap560 SEQ ID NO: 204

Таблица 15
ID мишени Соответствующая аминокислотная последовательность cDNA клона, представленного в таблице 16
Ap594 SEQ ID NO: 356
Ap423 SEQ ID NO: 357
Ap537 SEQ ID NO: 358
Ap560 SEQ ID NO: 359

Таблица 16
ID мишени Прямые праймеры
5’→3’
Обратные праймеры
5’→3’
dsRNA: смысловая цепь, представленная эквивалентной последовательностью ДНК
5’→3’
Ap594 SEQ ID NO: 310
SEQ ID NO: 312
SEQ ID NO: 311
SEQ ID NO: 313
SEQ ID NO: 189
Ap423 SEQ ID NO: 314
SEQ ID NO: 316
SEQ ID NO: 315
SEQ ID NO: 317
SEQ ID NO: 201
Ap537 SEQ ID NO: 318
SEQ ID NO: 320
SEQ ID NO: 319
SEQ ID NO: 321
SEQ ID NO: 203
Ap560 SEQ ID NO: 322
SEQ ID NO: 324
SEQ ID NO: 323
SEQ ID NO: 325
SEQ ID NO: 205

Таблица 17
Мишень Прямой праймер Обратный праймер
Ld594 SEQ ID NO: 377 SEQ ID NO: 378

Таблица 18
Мишень Прямой праймер Обратный праймер
Nl594 SEQ ID NO: 379 SEQ ID NO: 380
Nl619 SEQ ID NO: 381 SEQ ID NO: 382
Nl626 SEQ ID NO: 383 SEQ ID NO: 384

Таблица 19
ID мишени Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Ld583 CG4759 Рибосомный белок L27 RpL27
Ld584 CG 17331 Протеасома, субъединица бета-типа
Ld586 CG13704 неизвестный
Ld588 CG4157 Rpn12

Таблица 20
ID мишени Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Nl594 CG7178 wings up A (тропонин I) wupA
Nl619 CG7107 тропонин T (upheld) up
Nl626 *CG9073, CG7930, CG2981, CG12408, CG6514, CG2981, CG7930, CG9073, CG6514, CG12408 тропонин C
Nl537 CG32744 Убиквитин-5E; способ модификации белка
* неясно: несколько попаданий в семействе

Таблица 21
ID мишени Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Ap594 CG7178 wings up A (тропонин I) wupA
Ap423 CG2746 рибосомный белок L19 RpL19
Ap537 CG32744 Убиквитин-5E; способ модификации белка
Ap560 CG10423 рибосомный белок S27 RpS27

Специалистам в данной области будет очевидно, что многочисленные изменения и/или модификации можно внести в вышеупомянутые анализы без отступления от сущности или объема данного анализа, который описан в общем. Специалисты в данной области обнаружат или смогут установить, применяя не более чем обычное экспериментирование, многие эквиваленты конкретных примеров, и такие эквиваленты охватываются настоящим изобретением. Настоящий пример, таким образом, следует рассматривать во всех отношениях как иллюстративный, а не ограничительный.

1. Интерферирующая рибонуклеиновая кислота (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, где указанный сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая комплементарна

(i) любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или комплементарной ей последовательности, или такой нуклеотидной последовательности, которая при оптимальном выравнивании и сравнении двух последовательностей идентична любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или комплементарной ей последовательности, или

(ii) нуклеотидной последовательности, содержащей фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или комплементарной ей последовательности, или такой нуклеотидной последовательности, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, указанная нуклеотидная последовательность являлась идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или комплементарной ей последовательности, или

(iii) нуклеотидной последовательности, содержащей фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или комплементарной ей последовательности, и при этом при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, указанная нуклеотидная последовательность является идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или комплементарной ей последовательности,

и где в случае SEQ ID NO: 1, 2, их фрагментов из 21 нуклеотида или комплементарных им последовательностей вид насекомого-вредителя представляет собой Lygus hesperus, в случае SEQ ID NO: 174, 175, их фрагментов из 21 нуклеотида или комплементарных им последовательностей вид насекомого-вредителя представляет собой Leptinotarsa decemlineata, в случае SEQ ID NO: 180, 181, их фрагментов из 21 нуклеотида или комплементарных им последовательностей вид насекомого-вредителя представляет собой Nilaparvata lugens, и в случае SEQ ID NO: 188, 189, их фрагментов из 21 нуклеотида или комплементарных им последовательностей вид насекомого-вредителя представляет собой Acyrthosiphon pisum.

2. Интерферирующая РНК по п. 1, где указанный сайленсирующий элемент содержит или состоит из последовательности по меньшей мере из 21 последовательного нуклеотида, которая комплементарна целевой нуклеотидной последовательности в пределах указанного гена-мишени.

3. Интерферирующая РНК по п. 1 или 2, где РНК содержит по меньшей мере два сайленсирующих элемента, где каждый сайленсирующий элемент содержит или состоит из последовательности нуклеотидов, которая комплементарна целевой нуклеотидной последовательности в пределах гена-мишени.

4. Интерферирующая РНК по любому из пп. 1-3, где указанный вид насекомого-вредителя является вредителем растения.

5. Интерферирующая РНК по любому из пп. 1-4, где указанный ген-мишень кодирует белок насекомых тропонин I или ортолог белка насекомых CG7178 Dm.

6. Интерферирующая РНК по любому из пп. 1-5, где подавление экспрессии указанного гена-мишени вызывает снижение роста, развития, размножения или выживания указанного вредителя по сравнению с видом вредителя, подверженного воздействию интерферирующей рибонуклеиновой кислотой, воздействующей на несущественный ген, или интерферирующей рибонуклеиновой кислотой, которая не подавляет какие-либо гены у вида-вредителя.

7. Полинуклеотид, содержащий последовательность нуклеотидов, кодирующую интерферирующую РНК по любому из пп. 1-6.

8. Экспрессирующая ДНК-конструкция, содержащая полинуклеотид по п. 7, где последовательность указанного полинуклеотида, кодирующая указанную интерферирующую РНК, функционально связана с по меньшей мере одной регуляторной последовательностью, способной обеспечивать экспрессию указанной нуклеотидной последовательности.

9. Клетка-хозяин для получения интерферирующей РНК по п. 1, содержащая полинуклеотид по п. 7 или ДНК-конструкцию по п. 8.

10. Клетка-хозяин по п. 9, где указанная клетка-хозяин является прокариотической или эукариотической клеткой.

11. Клетка-хозяин по п. 10, где указанная клетка-хозяин является бактериальной клеткой.

12. Композиция для предотвращения и/или борьбы с нападением насекомых-вредителей, выбранных из группы, включающей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens, Acyrthosiphon pisum, содержащая эффективное количество по меньшей мере одной интерферирующей рибонуклеиновой кислоты (РНК) по любому из пп. 1-6 и по меньшей мере один подходящий носитель, наполнитель или разбавитель.

13. Композиция для предотвращения и/или борьбы с нападением насекомых-вредителей, выбранных из группы, включающей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens, Acyrthosiphon pisum, содержащая клетку-хозяина, экспрессирующую эффективное количество интерферирующей РНК по любому из пп. 1-6.

14. Композиция по п. 13, где указанная клетка-хозяин является бактериальной клеткой.

15. Композиция по любому из пп. 12-14, где указанная композиция находится в твердой, жидкой или гелеобразной форме.

16. Композиция по любому из пп. 12-15, где указанная композиция составлена в виде инсектицидного спрея.

17. Композиция по п. 16, где спрей представляет собой распыляемый под давлением спрей/спрей в виде аэрозоля или спрей для пульверизатора.

18. Композиция по любому из пп. 12-17, где указанная композиция дополнительно содержит по меньшей мере одно пестицидное средство, выбранное из группы, состоящей из химического инсектицида, пататина, инсектицидного белка Bacillus thuringiensis, инсектицидного белка Xenorhabdus, инсектицидного белка Photorhabdus, инсектицидного белка Bacillus laterosporus и инсектицидного белка Bacillus sphaericus.

19. Композиция по п. 18, где указанный инсектицидный белок Bacillus thuringiensis выбран из группы, состоящей из Cry1, Cry3, TIC851, CryET170, Cry22, TIC901, TIC201, TIC407, TIC417, бинарного инсектицидного белка CryET80 и CryET76, бинарного инсектицидного белка TIC100 и TIC101, комбинации инсектицидного белка ЕТ29 или ЕТ37 с инсектицидным белком TIC810 или TIC812 и бинарного инсектицидного белка PS149B1.

20. Корпус или ловушка для борьбы с насекомыми-вредителями, выбранными из группы, включающей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens, Acyrthosiphon pisum, который(ая) содержит композицию по любому из пп. 12-19.

21. Применение композиции по любому из пп. 12-19 для предотвращения и/или борьбы с нападением вредителя, выбранного из группы, включающей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens, Acyrthosiphon pisum.

22. Применение композиции по любому из пп. 12-19 в качестве пестицида для растения или для материала для размножения репродуктивного материала растения.

23. Комбинация для предотвращения и/или борьбы с нападением вредителя, выбранного из группы, включающей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens, Acyrthosiphon pisum, содержащая композицию по любому из пп. 12-19 и по меньшей мере одно другое активное средство.

24. Комбинация по п. 23 для предотвращения и/или борьбы с нападением вредителя на растение, где другое активное средство включает гербицид.

25. Комбинация по п. 24, где гербицид выбран из глифосат-нечувствительного варианта 5-енолпирувилшикимат-3-фосфатсинтазы (EPSPS), катаболического фермента, который способен разрушать дикамбу, такого как дикамба-монооксигеназа, или гена фосфинотрицинацетилтрансферазы, которая способна катаболизировать глюфосинат аммония.

26. Способ подавления экспрессии гена-мишени у вида насекомого-вредителя, выбранного из группы, включающей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens, Acyrthosiphon pisum, с целью предотвращения и/или борьбы с нападением вредителей, включающий приведение в контакт указанного вида вредителя с эффективным количеством по меньшей мере одной интерферирующей рибонуклеиновой кислоты (РНК) по любому из пп. 1-6.

27. Способ по п. 26, где подавление экспрессии указанного гена-мишени у указанного вида насекомого-вредителя применяют с целью получения по меньшей мере 20% эффективности борьбы с вредителями или по меньшей мере 20% смертности вредителей по сравнению с борьбой с насекомыми-вредителями, проконтактировавшими с интерферирующей рибонуклеиновой кислотой (РНК), воздействующей на несущественный ген вредителя или ген-мишень, не экспрессирующийся у указанного вредителя.

28. Способ по любому из пп. 26 или 27, где способ применяют для предотвращения и/или борьбы с нападением вредителя на растение.

29. Способ по п. 28, где растение выбирают из группы, включающей хлопчатник, картофель, рис, канолу, подсолнечник, сорго, просо, кукурузу, землянику, сою, люцерну, помидор, баклажан, перец и табак.

30. Применение интерферирующей рибонуклеиновой кислоты (РНК) по любому из пп. 1-6, ДНК-конструкции по п. 8 или композиции по любому из пп. 12-19 для предотвращения и/или борьбы с нападением насекомого-вредителя, выбранного из группы, включающей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens, Acyrthosiphon pisum.



 

Похожие патенты:

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к способу получения гетеротетрамерного рекомбинантного стрептавидина. Настоящий способ предусматривает создание двух плазмид, одна из которых кодирует стрептавидин мутантного типа, а другая – стрептавидин дикого типа, трансформацию указанными плазмидами клеток E.coli, индукцию синтеза стрептавидинов, выделение периплазматической фракции клеток и очистку гетеротетрамерного стрептавидина на аффинном сорбенте.

Изобретения касаются способа доставки или переноса гетерологичной полинуклеотидной последовательности в печень млекопитающему и способа лечения млекопитающего с недостаточностью экспрессии фактора свертывания крови или функции.

Настоящее изобретение относится к области биотехнологии, конкретно к конъюгату антисмыслового олигомера, и может быть использовано в медицине. Изобретение направлено на получение конструкции, позволяющей улучшить терапевтический индекс представляющего интерес антисмыслового олигонуклеотида и его высвобождение в клетках вследствие конъюгации олигонуклеотида с расщепляемой фосфодиэфирной областью и направляющей группой, способствующей доставке полученного конструкта в нужное место в клетке и обеспечивающей направленный захват действующего антисмыслового олигомера целевыми клетками.

Настоящее изобретение относится к биотехнологии и генетической инженерии, в частности к генетически модифицированным грызунам, таким как мышь и крыса, которые экспрессируют химерный человеческий/не относящийся к человеку полипептид МНС I и/или человеческий полипептид β2 микроглобулина, а также к клеткам таких грызунов.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к генетической конструкции для обеспечения экспрессии целевых гомологичного и гетерологичного генов в клетках реципиентного гриба Penicillium verruculosum.

Изобретение относится к области медицинской вирусологии и касается штамма вируса гриппа. Вакцинный штамм A/17/Нью Йорк/15/5364 (H1N1) pdm09 - реассортант, полученный путем скрещивания «дикого» вируса А/Нью Йорк/61/2015 (H1N1) pdm09 с холодоадаптированным температурочувствительным вирусом А/Ленинград/134/17/57 (H2N2) - донором аттенуации, безвредным для людей.

Изобретение относится к области биохимии. Описан набор олигонуклеотидных проб для определения генотипа митохондриальной ДНК человека, характеризующийся тем, что данный набор позволяет определить генотип митохондриальной ДНК человека в 38 однонуклеотидных сайтах, расположенных в различных участках митохондриального генома и полиморфных в популяциях населения России различного этнического происхождения, с помощью метода ферментативного однонуклеотидного удлинения гибридизированной пробы, причем структура олигонуклеотидных проб учитывает вариабельность ДНК в близлежащих сайтах и группировку генотипируемых сайтов в 3 панели для мультиплексных реакций.

Изобретение относится к области биотехнологии, в частности к гибридомной технологии, и представляет собой штамм гибридных клеток mus musculus α - продуцент моноклональных антител к раково-тестикулярному антигену человека GAGE.

Изобретение относится к биотехнологии, медицине, в частности к применению подкожного ксенографта клеточной линии беспигментной меланомы кожи человека mel Rac с мутацией гена NRAS и с адаптацией к росту со стабильной кинетикой у иммунодефицитных мышей Balb/c nude для доклинического изучения таргетных противоопухолевых средств.

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Синергетический эффект, обусловленный наличием 3'-UTR гена альбумина и 3’-некодирующей области матричной РНК, уложенной во вторичную структуру типа «стебель-петля», в структуре искусственной нуклеиновой кислоты, позволяет повысить стабильность и продлить экспрессию кодируемого белка.

Данное изобретение относится к области биотехнологии. Предложены способы продуцирования антитела против альфа-цепи рецептора интрелейкина-7 (IL-7Rα).

Изобретение относится к области биохимии, в частности к одноцепочечному антителу, которое связывается с раково-эмбриональным антигеном (РЭА). Также раскрыты химерный мономолекулярный Т-клеточный рецептор, включающий указанное антитело, вектор для экспрессии указанного рецептора, клетка-хозяин, продуцирующая указанный рецептор.

Данное изобретение относится к иммунологии. Предложена выделенная молекула антитела, которая является селективной в отношении связывания человеческого бета-амилоидного 1-42 пептида (Aβ1-42), а не человеческого бета-амилоидного 1-40 пептида (Aβ1-40).

Группа изобретений относится к биотехнологии и касается получения рекомбинантной барназы. Предложена рекомбинантная плазмида pET-STII-Ba, обеспечивающая синтез в клетках Escherichia coli барназы, имеющей аминокислотную последовательность SEQ ID №3.

Изобретение относится к области иммунологии. Предложено одноцепочечное антитело к раково-эмбриональному антигену, а также включающий его химерный мономолекулярный Т-клеточный рецептор, вектор и клетка-хозяин для получения химерного мономолекулярного Т-клеточного рецептора.

Настоящее изобретение относится к области биотехнологии, конкретно к молекуле мРНК, содержащей кодирующую область, кодирующую содержащий опухолевый антиген белок, по меньшей мере, одну гистоновую структуру типа «стебель-петля» и поли(A)-последовательность или сигнал полиаденилирования, и может быть использовано в медицине.

Изобретение относится к биохимии. Описано рекомбинантное антитело или его антигенсвязывающий фрагмент.

Настоящее изобретение относится к области биотехнологии и фармацевтики, в частности к конъюгатам антитела для лечения ревматоидного артрита у пациента. Антитело, входящее в состав указанных конъюгатов, специфически связывает Экстра-Домен-A (ED-A) фибронектина и конъюгировано с интерлейкином-10.

Изобретение относится к области биохимии, в частности к антителу или его антигенсвязывающему фрагменту c биспецифическим связыванием с CD40. Также раскрыты иммуноконъюгат, включающий указанное антитело или антигенсвязывающий фрагмент, молекула нуклеиновой кислоты, кодирующая указанное антитело или его фрагмент, экспрессионный вектор, содержащий указанную нуклеиновую кислоту, клетка-хозяин, содержащая указанный вектор, фармацевтическая композиция, содержащая указанное антитело или его фрагмент.

Изобретение относится к области биотехнологии, конкретно к новым иммуногенам на основе перекрывающихся пептидов (OLP), и может быть использовано в медицине для предупреждения или лечения ВИЧ инфекции.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к способу получения гетеротетрамерного рекомбинантного стрептавидина. Настоящий способ предусматривает создание двух плазмид, одна из которых кодирует стрептавидин мутантного типа, а другая – стрептавидин дикого типа, трансформацию указанными плазмидами клеток E.coli, индукцию синтеза стрептавидинов, выделение периплазматической фракции клеток и очистку гетеротетрамерного стрептавидина на аффинном сорбенте.

Настоящее изобретение относится к области биотехнологии. Предложена интерферирующая рибонуклеиновая кислота. Также рассмотрены: полинуклеотид, содержащий последовательность, кодирующую интерферирующую РНК, экспрессирующая ДНК-конструкция, клетка-хозяин, композиции, корпус и ловушка для борьбы с насекомыми-вредителями. Описано применение предложенных изобретений для предотвращения иили борьбы с нападением вредителя и в качестве пестицида для растения или для материала для размножения репродуктивного материала растения; а также комбинация интерферирующей РНК и другого активного средства, в частности гербицида, и способ подавления экспрессии гена-мишени у вида насекомого-вредителя. Предложенная интерферирующая РНК обеспечивает эффективное подавление экспрессии гена-мишени у насекомого-вредителя, выбранного из Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens и Acyrthosiphon pisum, и может найти дальнейшее применение в генетическом контроле указанных насекомых. 12 н. и 18 з.п. ф-лы, 11 ил., 23 табл., 6 пр.

Наверх