Днк-маркер для количественного определения геномной днк картофеля в растительном сырье и в продуктах, получаемых на его основе, в том числе при количественной идентификации гмо

Изобретение относится к области биохимии, в частности к ДНК-маркеру для количественного определения геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе, путем проведения массового анализа методом ПЦР в режиме реального времени по технологии TaqMan. Изобретение позволяет эффективно определять количество геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе. 6 ил., 2 пр.

 

Изобретение относится к области биотехнологии и предназначено для количественного обнаружения продуктов переработки картофеля в растительном сырье и пищевых продуктах, в том числе генетически модифицированных.

Изобретение представляет собой ДНК-маркер для количественного определения геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе, путем проведения массового анализа методом ПЦР в режиме реального времени по технологии TaqMan с использованием оригинальной нуклеотидной последовательности фрагмента гена Stp23 картофеля, кодирующего фермент α-глюкан фосфорилазу, специфичных олигонуклеотидных ПЦР-праймеров и зонда для амплификации этого фрагмента ДНК.

Изобретение предназначено для количественного и качественного обнаружения ДНК картофеля в растительном сырье (в том числе генетически модифицированном) и производимых из него продуктах питания (крупа, чипсы, экстракты и пр.). Использование ДНК-маркера позволяет определить содержание ДНК картофеля в исследуемом образце и избежать возможности получения ложного результата. Оригинальный подбор олигонуклеотидных последовательностей для количественного определения геномной ДНК картофеля в растительном сырье и производимых из него продуктах питания, обеспечивает высокую чувствительность предлагаемого метода и достоверность получаемых результатов. Чувствительность предлагаемого метода составляет не менее 0,05% содержания ДНК картофеля в общей ДНК исследуемого материала. Положительная амплификация наблюдается уже при наличии в тотальной ДНК исследуемого образца не менее 15 копий картофельной ДНК (предел чувствительности, LOD), а количественное определение содержания ДНК картофеля возможно при наличии не менее 25 копий в тотальной ДНК исследуемого образца (предел количественного определения, LOQ).

Особенностью проведения реакции по технологии TaqMan является наличие в реакционной смеси не двух синтетических олигонуклеотов, а трех, причем третий олигонуклеотид - TaqMan зонд - в реакции полимеризации прямо не участвует, а только гибридизуется (специфично связывается) с внутренним участком вновь синтезированной цепи ДНК получаемого в реакции ПЦР-фрагмента. При разрушении в процессе реакции TaqMan-зонда, гибридизовавшегося с целевой нуклеотидной последовательностью, освобождающийся из зонда флуоресцентный краситель под действием возбуждающего лазерного излучения приобретает способность к свечению, регистрация которого свидетельствует о наличии в образце искомой ДНК, в том числе из генетически модифицированного источника (Фиг. 1).

Предлагаемое изобретение представляет собой ДНК-маркер (оригинальная нуклеотидная последовательность фрагмента гена Stp23 картофеля, кодирующего α-глюкан фосфорилазу, последовательность праймеров для амплификации фрагмента и последовательность TaqMan зонда) для количественного определения геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе. В качестве стандарта (образца с известной концентрацией) при количественном определении содержания ДНК картофеля используют ДНК, выделенную из листового материала растений картофеля. Стандарт ДНК может быть выделен из растений любого сорта картофеля вида S. tuberosum.

Альфа-глюкан фосфорилаза (крахмал фосфорилаза) (ЕС 2.4.1.1) является ферментом фосфоролитической деградации крахмала и катализирует обратимую реакцию, в результате которой, α(1→4) глюкозидная связь на нередуцируемом конце боковой цепи глюканов претерпевает фосфоролиз.

По данным секвенирования генома картофеля было показано, что фермент кодируется однокопийным геном Stp23, а его последовательность высокоспецифична для генома картофеля (Potato Genome Sequencing Consortium, 2011). Монокопийное состояние гена, а также высокая специфичность праймерных систем делает ДНК маркер на его основе наиболее эффективными при количественном определении геномной ДНК картофеля методом ПЦР в режиме реального времени (Фиг. 2). На фиг. 2 приведен анализ продуктов амплификации ДНК картофеля и томатов с использованием предложенного ДНК-маркера. (А)- Образцы картофеля сортов Каменский, Матушка, Спиридон, Крепыш, Кортни, Лазурит, Яхонт, Атлант, Bintje; (В)- томатов сортов Чаровница, Дубок, Лотос, Росинка, Гурман, Грот, S.lycopersicum ssp. Humboldti.

Процедуру выявления геномной ДНК картофеля в анализируемом образце проводят одновременно с определением количественного содержания ДНК, что значительно упрощает процедуру выполнения анализа и позволяет повысить пропускную способность лабораторной обработки за счет уменьшения числа технологических операций.

Использование ДНК-маркера для диагностики геномной ДНК картофеля S. tuberosum в растительном сырье и продуктах на его основе позволяет быстро и с высокой точностью провести количественную оценку числа целевых фрагментов ДНК длиной 221 пар оснований.

Количественное определение содержания ДНК картофеля в тотальной ДНК исследуемого образца осуществляют путем сравнения сигнала, полученного в реакции с ДНК анализируемого образца со стандартной кривой, построенной с использованием стандарта - образца ДНК картофеля с известной концентрацией (Фиг. 3).

ДНК-маркер пригоден для массовой количественной и качественной детекции присутствия продуктов переработки картофеля в пищевых продуктах, в том числе и полученных с применением генетически модифицированных источников (Фиг. 5 и 6). На фиг. 5 приведены результаты амплификации ДНК картофеля в растительном сырье и в продуктах переработки картофеля с использованием заявленного ДНК-маркера. 1 - чипсы картофельные «Дон Густо» (ЗАО «Бриджтаун Фудс», РФ), 2 - картофельное пюре (ООО «Импрод», РФ), 3 - клубни картофеля «Ашан-Гагаринский» (РФ, г. Москва), 4 - картофельные чипсы «Лейз» ООО «Фрито Лей Мануфактуринг» (РФ, г. Кашира), 5 - Картофель сорт Елизавета (листья), 6 - Томатная паста «Первым делом» ООО «Бастион» (РФ, Санкт-Петербург). На фиг. 6 показано количественное определение содержания ДНК картофеля в пищевых продуктах с использованием заявленного ДНК-маркера. Где « -контрольные растворы с известным содержанием ДНК картофеля (стандарты); - анализируемые образцы: I (картофельное пюре «Ролтон» ООО «Маревен Фуд Сантрал» (РФ, д. Ивановское), II (картофельные чипсы «Лейз» ООО «Фрито Лей Мануфактуринг» (РФ, г. Кашира).

В области практического применения подобные анализы проводят при определении компонентного состава сложных пищевых продуктов (кулинарные изделия, консервы, диетические продукты). В ряде случаев наличие сырья из картофеля может негативно отражаться на потребительских качествах пищевой продукции. Предлагаемый ДНК-маркер позволяет как количественно, так и качественно установить наличие картофельного сырья в проверяемом пищевом продукте. Чувствительность предлагаемого метода составляет не менее 0,05% содержания ДНК картофеля в общей ДНК исследуемого материала. Положительная амплификация наблюдается уже при наличии в тотальной ДНК исследуемого образца не менее 15 копий картофельной ДНК (предел чувствительности, LOD), а количественное определение содержания ДНК картофеля возможно при наличии не менее 25 копий в тотальной ДНК исследуемого образца (предел количественного определения, LOQ) (Фиг. 4).

В настоящее время для обнаружения ДНК заданного объекта в растительном материале и продуктах на его основе (крупа, экстракты и проч.), в том числе и генетически модифицированных, используют два альтернативных подхода, основанных на качественной идентификации либо чужеродных белков, либо нуклеиновых кислот.

Известен способ идентификации трансгенных белков растений с использованием соответствующих антител (Stave J.W., Food Control, 1999,vol. 10, pp. 367-374), а также способ детекции генетически модифицированных растений, содержащих NPT 11 белок, с использованием канамицина и/или паромомицина (US 2003/0017599 А1). Известен метод обнаружения рекомбинантных чужеродных белков в продуктах питания с использованием специфических антител к данным белкам (патент №WO 0198523 (А2) - DETECTION METHOD OF GENETIC RECOMBINANT FOOD AND DETECTION KIT OF THAT, авторы PARK НЕЕ-YOUNG [KR], GD BIOTECH CO LTD [KR]; PARK НЕЕ YOUNG [KR], 2001). Но так как белки при химических и/или физических воздействиях различного рода способны изменять как свою конформацию, так и вторичную структуру, то обнаружение чужеродных белков в продуктах, прошедших термическую, химическую или микробиологическую обработку, указанными выше способами становится невозможным. Кроме того, эти методы обладают достаточно низкой чувствительностью, занимают много времени и требуют значительных материальных затрат.

Известен способ идентификации последовательностей ДНК в растительном материале и продуктах на его основе с использованием специфических праймеров и флуоресцентно меченых зондов, комплементарных последовательностям чужеродной (трансгенной) ДНК (заявка на патент 2008146091/13, СПОСОБ ИДЕНТИФИКАЦИИ ТРАНСГЕННЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ ДНК В РАСТИТЕЛЬНОМ МАТЕРИАЛЕ И ПРОДУКТАХ НА ЕГО ОСНОВЕ, авторы - Абрамов Д.Д., Кузнецов В.В., Митрохин И.А., Цыдендамбаев В.Д. 24.11.2008. Заявка 2009123913/10 на патент СПОСОБ ВЫЯВЛЕНИЯ ГЕННО-ИНЖЕНЕРНО-МОДИФИЦИРОВАННЫХ ОРГАНИЗМОВ И ИСТОЧНИКОВ РАСТИТЕЛЬНОГО ПРОИСХОЖДЕНИЯ, НЕ ЗАРЕГИСТРИРОВАННЫХ В "ГОСУДАРСТВЕННОМ РЕЕСТРЕ ПИЩЕВЫХ ПРОДУКТОВ, МАТЕРИАЛОВ И ИЗДЕЛИЙ, РАЗРЕШЕННЫХ ДЛЯ ИЗГОТОВЛЕНИЯ НА ТЕРРИТОРИИ РОССИЙСКОЙ ФЕДЕРАЦИИ ИЛИ ВВОЗА НА ТЕРРИТОРИЮ РОССИЙСКОЙ ФЕДЕРАЦИИ И ОБОРОТА", ГЕНОМ КОТОРЫХ СОДЕРЖИТ ПРОМОТОР 35S И/ИЛИ ТЕРМИНАТОР NOS, авторы - Абрамов Д.Д., Кузнецов В.В., Колин В.В, Митрохин И.А., Цыдендамбаев В.Д., 24.06.2009).

Таким образом, в патентных базах были выявлены патенты и заявки как на белковые, так и ДНК-маркеры для идентификации ГМО в объектах растительного происхождения, мониторинга пищевых продуктов и других товаров массового потребления, получаемых из различных культурных растений.

Белковые маркеры, как правило, нестабильны и методы детекции с их использованием не отличаются достаточной чувствительностью. В свою очередь, ДНК маркеры высокоспецифичны. Но известные в настоящее время ДНК-маркеры, как правило, относятся либо к другим культурам, и не распространяют свое действие на картофель, либо базируются на последовательностях чужеродных ДНК, входящих в конструкцию (последовательностей crylAb, EPSPS, 35S промотора и др.), в то время как никаких специфичных референсных маркеров на присутствие геномной ДНК Solarium tuberosum ГМО описано не было. Кроме того, использование фрагментов ДНК фитопатогенов как маркеров может приводить к ложно-позитивным результатам в случае, если исходные растения были заражены соответствующими вирусами и/или бактериями.

В настоящее время известен метод количественного и качественного анализа генетически модифицированных растений (бобы, кукуруза) и продуктов их переработки на основе масс-спектрометрии и проведения rcPCR (real-competitive PCR) с использованием наборов специфических праймеров (патент № KR20110126306, А METHOD FOR ANALYZING GMO USING COMPETITIVE PCR, авторы Lee Myung Hoon; Han Sang Mi; Lee Soo Bin; Lee Hyun Chul, D & AMP P BIOTECH LTD).

Также известен метод качественной и количественной детекции генетически модифицированного картофеля в продуктах его переработки с помощью праймеров и стандартной плазмиды. Для детекции используют наборы праймеров NLL, Cry3A, UGP-pb, в том числе праймеры на основе гена UDP-glucose phosphorylase (патент № KR20040079053, PRIMER SETS AND PROBES FOR DETECTION OF GMO, AND STANDARD PLASMID FOR QUALITATIVE AND QUANTITATIVE DETECTION OF GMO TO EFFECTIVELY CARRY OUT QUALITATIVE AND QUANTITATIVE DETECTION OF GMO IN AGRICULTURAL PRODUCTS AND FOODS, авторы AHN IL PYEONG; KANG SANG HO; KIM TAE SAN; KIM YEONG MI; LEE THERESA; NOH JAE GYUN; PARK YONG HWAN, REPUBLIC KOREA MAN RURAL DEV., 2004).

Также известен метод качественной и количественной детекции ДНК картофеля в продуктах его переработки с помощью праймеров, специфичных для гена UDP-glucose phosphorylase картофеля (Savini С, Foti N., Mazzara M., Charles Delobel С, Van Den Eede G.; "Event-specific Method for the Quantification of Event EH92-527-1 Potato Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Potato" Online Publication (2006), DOI 10.2788/30418), однако, релевантность этого метода является невысокой, так как маркер был разработан на основании последовательности геномной ДНК единственного генетического варианта картофеля -линии Lemhi 10.

Также известен метод качественной и количественной детекции пластидной ДНК картофеля (Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005), ISO 34614), однако этот метод обладает еще более низкой релевантностью, так как содержание пластидной ДНК в клубнях картофеля крайне низкое по сравнению с геномной ДНК.

Наиболее близким к предлагаемой системе обнаружения геномной ДНК заданного объекта в растительном сырье и продуктах его переработки является анализ ДНК с применением метода полимеразной цепной реакции (ПЦР) со специфическими олигонуклеотидными праймерами для ДНК картофеля (патент №2539756 ВЫСОКОСПЕЦИФИЧНЫЙ ДНК-МАРКЕР, ИСПОЛЬЗУЕМЫЙ В КАЧЕСТВЕ ЭНДОГЕННОГО РЕФЕРЕНСНОГО КОНТРОЛЯ ДЛЯ ОБНАРУЖЕНИЯ ГЕНОМНОЙ ДНК КАРТОФЕЛЯ В РАСТИТЕЛЬНОМ МАТЕРИАЛЕ И ПИЩЕВЫХ ПРОДУКТАХ, В ТОМ ЧИСЛЕ ПРИ ИДЕНТИФИКАЦИИ ГМО. Авторы Кочиева Е.З., Сухачева М.В., Рыжова Н.Н., Борис К.В., Кузнецов Б.Б.). Однако описанный выше метод идентификации не позволяет провести количественное определение ДНК картофеля в биологическом образце. Методы анализа, основанные на проведении качественной полимеразной цепной реакции (ПЦР), не обладают достаточной чувствительностью и не пригодны для детекции следовых количеств ДНК объекта в исследуемом материале. Применение метода ПЦР в реальном времени позволяет преодолеть указанный недостаток. Предлагаемый ДНК-маркер для количественного определения геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе, позволяет не только детектировать присутствие ДНК картофеля в анализируемом образце, но и количественно определить ее содержание. Причем чувствительность предлагаемого ДНК-маркера составляет не менее 0,05% от тотальной ДНК исследуемого образца.

Задачей заявляемого изобретения является количественная идентификация геномной ДНК картофеля S. tuberosum в растительном сырье, в том числе генетически модифицированном, продуктах питания, получаемых на его основе, а также в увеличении пропускной способности лабораторной диагностики за счет уменьшения числа технологических операций при проведении анализа.

Для количественного определения геномной ДНК картофеля S. tuberosum в растительном сырье и продуктах питания предложен ДНК-маркер, включающий оригинальную нуклеотидную последовательность фрагмента гена Stp23 картофеля, используемую в качестве стандарта, разработанные специфичные олигонуклеотидные праймеры и зонд для проведения ПЦР в режиме реального времени по технологии TaqMan. Использование ДНК-маркера позволяет количественно с высокой точностью (не менее 0,05%) определить содержание ДНК картофеля в исследуемом образце и избежать возможности получения ложного результата. В этом отношении высокоспецифичные для картофеля Solarium tuberosum последовательности гена Stp23 представляют определенный интерес. Монокопийное состояние гена, а также высокая специфичность делает ДНК маркеры на его основе наиболее эффективными при количественном определении геномной ДНК картофеля методом ПЦР в режиме реального времени. Кроме того, предлагаемый ДНК-маркер прост в применении и не требует больших временных, трудовых и денежных затрат.

Техническими результатами заявленного изобретения являются:

- возможность количественной оценки присутствующей в биологических образцах ДНК заданного объекта;

- высокая чувствительность метода (не менее 0,05%);

- выявления ДНК заданного объекта в исследуемых образцах любой консистенции;

- увеличение пропускной способности лабораторной диагностики за счет уменьшения числа технологических операций при проведении анализа.

Указанные технические результаты достигаются следующим образом: Количественное определение содержания ДНК картофеля в тотальной ДНК исследуемого образца осуществляют путем сравнения сигнала, полученного в анализируемом образце, со стандартной кривой, построенной с использованием так называемого стандарта - образца ДНК картофеля с известной концентрацией. Чувствительность предлагаемого метода составляет не менее 0,05% от общей ДНК исследуемого образца. Положительная амплификация идет при наличии в тотальной ДНК исследуемого образца не менее 15 копий картофельной ДНК, а точное количественное определение содержания ДНК картофеля возможно при наличии не менее 25 копий в тотальной ДНК исследуемого образца.

Таким образом, данное изобретение должно быть представлено:

а) специфическими праймерами и TaqMan-зондом, позволяющим количественно определять геномные копии целевой (картофельной) ДНК в растительном материале, в том числе и генетически модифицированном, а также в продуктах переработки картофеля;

SEQ ID №1 5' - TTATTAATTGGAATGCTACGTATGATA

SEQ ID №2 5' - CTCTCATGTGTAACAGTAAATATACA

Зонд SEQ ID №3 FAM-5'GTATGACTGTGCAGAGTGACCTTAAAT3'-RTQ1

б) стандартным образцом - последовательностью фрагмента гена альфа-глюкан фосфорилазы Stp23 с известной концентрацией, позволяющем оценить концентрацию искомой последовательности ДНК в исследуемом образце и избежать возможности получения ложного результата.

Предлагаемый метод позволяет быстро и с высокой точностью провести количественную оценку геномных копий ДНК картофеля в растительном сырье и продуктах на его основе, причем в образцах любой консистенции (Фиг. 5 и 6).

Регистрация результатов ПЦР осуществляется с помощью программного модуля CFX Manager, что дает возможность количественно интерпретировать полученные результаты.

Программный модуль предназначен для построения кривой титрования образцов с известным содержанием ДНК методом наименьшего среднего, определения математической зависимости порога детектирования Ct от концентрации целевого гена и последующего количественного определения содержания целевого гена в опытных образцах. Он рассчитан на анализ 96-луночного ПЦР планшета, в котором одновременно могут находиться соответствующие разведения стандарта, негативный контроль и анализируемые образцы, причем в нескольких повторностях.

ДНК-маркер применим для массового скрининга целевой ДНК картофеля в любых видах пищевых продуктов, и других товаров массового потребления, включая ГМО.

Примеры

Пример 1. Построение калибровочных кривых для количественного определения геномной ДНК картофеля в растительном сырье и продуктах, получаемых на его основе.

Реакционная смесь для проведения ПЦР в режиме реального времени содержит следующие компоненты:

Амплификацию проводили на программируемом термоциклере РТС 1000 с модулем RT-ПЦР CFX96 (BioRad, USA). Протокол проведения ПЦР в режиме реального времени:

Для приготовления стандартов (контрольных растворов с известным содержанием ДНК картофеля - 0,1%, 0,4%, 1%, 2%, 5%, 10% и т.д.) стандартный образец, представляющий собой оригинальную нуклеотидную последовательность фрагмента гена Stp23 картофеля, кодирующего фермент α-глюкан фосфорилазы, разводили в растительной ДНК (томатов) следующим образом:

Измерение концентрации ДНК в водном растворе стандартного образца проводили спектрофотометрически с помощью системы Qubit (Invitrogen). Результатом измерений является среднее значение, вычисленное по результатам проведения пяти измерений.

Анализ результатов проводили с помощью программного модуля CFX Manager. Величина наклона стандартной кривой составляет - 3,012, достоверность линейной аппроксимации - 0,998, что свидетельствует о высокой эффективности ПЦР (Фиг. 3).

Положительная амплификация идет при наличии в тотальной ДНК исследуемого образца не менее 15 копий картофельной ДНК, а точное количественное определение содержания ДНК картофеля возможно при наличии не менее 25 копий в тотальной ДНК исследуемого образца. Чувствительность предлагаемого метода составляет не менее 0,05% ДНК картофеля в общей ДНК исследуемого образца (Фиг. 4).

Пример 2. Количественное определение содержания геномной ДНК картофеля в анализируемых образцах с использованием разработанного ДНК-маркера.

Для осуществления метода рекомендуется проводить экстракцию ДНК из исследуемых образцов согласно (Булыгина и др., 2009) или с применением любых наборов, предназначенных для выделения ДНК. Образцы с повышенным содержанием жиров (>20%) следует предварительно обработать хлороформом. Концентрация ДНК в получаемых препаратах должна составлять 50-150 мкг/мл. При этом РНК в препаратах должна присутствовать в следовых количествах - менее 1%, согласно данным электрофоретического анализа. Оценку качества и количества экстрагированной ДНК производят путем измерения оптической плотности раствора ДНК на спектрофотометре (Bio Photometer, Eppendorf или SmartSpec 3000, Bio-Rad, США, Qubit, Invitrogen) или при помощи аналитического электрофореза.

Для выявления геномной ДНК картофеля S. tuberosum в растительном сырье и в получаемых на его основе продуктах с использованием заявленного ДНК-маркера были взяты чипсы картофельные «Дон Густо» (ЗАО «Бриджтаун Фудс», РФ), картофельное пюре (ООО «Импрод», РФ), клубни картофеля «Ашан - Гагаринский» (РФ, г. Москва), картофельные чипсы «Лейз» ООО «Фрито Лей Мануфактуринг» (РФ, г. Кашира) и томатная паста «Первым делом» ООО «Бастион» (РФ, Санкт-Петербург) (фиг. 5).

При количественном определении содержания ДНК картофеля в пищевых продуктах с использованием предложенного ДНК-маркера установлено, что образец I (картофельное пюре «Ролтон» ООО «Маревен Фуд Сантрал» (РФ, д. Ивановское)) содержит 6% картофельной ДНК от тотальной ДНК исследуемого образца, а образец II (картофельные чипсы «Лейз» ООО «Фрито Лей Мануфактуринг» (РФ, г. Кашира))-40% (Фиг. 6).

Литература

1. Potato Genome Sequencing Consortium, Xu X, Pan S, Cheng S, Zhang B, Mu D, Ni P, Zhang G, Yang S, Li R, Wang J, Orjeda G, Guzman F, Torres M, Lozano R, Ponce O, Martinez D, De la Cruz G, Chakrabarti SK, Patil VU, Skryabin KG, Kuznetsov BB, Ravin NV, Kolganova TV, Beletsky AV, Mardanov AV, Di Genova A, Bolser DM, Martin DM, Li G, Yang Y, Kuang H, Hu Q, Xiong X, Bishop GJ, Sagredo B, Mejia N, Zagorski W, Gromadka R, Gawor J, Szczesny P, Huang S, Zhang Z, Liang C, He J, Li Y, He Y, Xu J, Zhang Y, Xie B, Du Y, Qu D, Bonierbale M, Ghislain M, Herrera Mdel R, Giuliano G, Pietrella M, Perrotta G, Facella P, K, Feingold SE, Barreiro LE, Massa GA, Diambra L, Whitty BR, Vaillancourt B, Lin H, Massa AN, Geoffroy M, Lundback S, DellaPenna D, Buell CR, Sharma SK, Marshall DF, Waugh R, Bryan GJ, Destefanis M, Nagy I, Milbourne D, Thomson SJ, Fiers M, Jacobs JM, Nielsen KL, Sonderkaer M, Iovene M, Torres GA, Jiang J, Veilleux RE, Bachem CW, de Boer J, Borm T, Kloosterman B, van Eck H, Datema E, Hekkert Bt, Goverse A, van Ham RC, Visser RG. Genome sequence and analysis of the tuber crop potato. Nature. 2011 Jul 10; 475(7355):189-95. Altschul, S; Gish, W; Miller, W; Myers, E; Lipman, D (October 1990). "Basic local alignment search tool". Journal of Molecular Biology 215 (3):403-410.

2. Булыгина E.C., Колганова T.B., Сухачева M.B., Пантелеева А.Н., Патутина Е.О., Кузнецов Б.Б. Выделение ДНК из различных пищевых продуктов с помощью модифицированного щелочного метода. Биотехнология. №2, с. 83-90, 2009.

ДНК-маркер для количественного определения геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе, путем проведения массового анализа методом ПЦР в режиме реального времени по технологии TaqMan включает:

- оригинальную нуклеотидную последовательность фрагмента гена Stp23 картофеля длиной 221 п. н., используемую в качестве стандартного образца с известной концентрацией и позволяющей количественно оценить содержание целевой картофельной ДНК в исследуемом материале и избежать возможности получения ложного результата

TTATTAATTGGAATGCTACGTATGATATTTATGAAAAGCTGAACATGAAGCAA

GCGTACTATCTATCCATGGAATTTCTGCAGGTATCTCATTATTCTTACTTTCTCT

TTTGCTCTTTTGTATGACTGTGCAGAGTGACCTTAAATTATATCTAGTAAGAAA

TTAATCCGTTTGATATTTGCTGACAAATTAGACTGTATATTTACTGTTACACAT

GAGAG

- олигонуклеотидные праймеры - затравки полимеразной цепной реакции

SEQ ID №1 5' - TTATTAATTGGAATGCTACGTATGATA и SEQ ID №2 5' -CTCTCATGTGTAACAGTAAATATACA, позволяющие амплифицировать фрагмент гена Stp23 у культурного картофеля S. tuberosum и родственных дикорастущих видов рода Solarium sect. Petota, а также в продуктах переработки картофеля

- зонд SEQ ID №3 FAM-5'GTATGACTGTGC AGAGTGACCTTAAAT3'-RTQ1, позволяющий количественно определять фрагмент гена Stp23 у культурного картофеля S. tuberosum и родственных дикорастущих видов рода Solanum sect. Petota, а также в продуктах переработки картофеля.



 

Похожие патенты:

Изобретение относится к биохимии. Описан способ ПЦР диагностики смешанных хронических рецидивирующих инфекций глаз.

Изобретение относится к области медицины и предназначено для прогнозирования наличия хромосомных аномалий в эмбрионах удовлетворительного и плохого качества в программе экстракорпорального оплодотворения (ЭКО).

Предложенная группа изобретений относится к области медицины. Предложен способ диагностики и/или определения у субъекта предрасположенности к развитию острого повреждения почек, включающий определение уровня экспрессии по меньшей мере miR-26b и сравнение указанного уровня экспрессии с контрольным значением, где снижение экспрессии является показателем острого повреждения почек или предрасположенности к развитию острого повреждения почек.

Изобретение относится к области биохимии, в частности к способу диагностики и мониторирования течения церебральных глиом, включающему определение уровней экспрессии генов микроРНК.

Изобретение относится к биотехнологии. Описан способ оценки риска сердечно-сосудистых событий у субъекта, включающий стадии определения в образце, выделенном от указанного субъекта, страдающего хроническим заболеванием почек, присутствия полиморфизмов в положении 27 в последовательностях нуклеиновой кислоты из SEQ ID NO:1-8, или в последовательности, находящейся в сильном неравновесном сцеплении с последовательностью из любой из SEQ ID NO:1-8, где присутствие в положении 27 С в SEQ ID NO:1, С в SEQ ID NO:2, T в SEQ ID NO:3, С в SEQ ID NO:4, С в SEQ ID NO:5, A в SEQ ID N0:6, T в SEQ ID NO:7 и G в SEQ ID NO:8, что соответствует номеру доступа в db SNP rs17465637, rs6725887, rs9818870, rs12526453, rs1333049, rs501120, rs9982601, rs10455872, соответственно, или присутствие полиморфизма в последовательности любого другого rs, который находится в сильном неравновесном сцеплении с любым из этих упомянутых rs, является показателем риска наличия сердечно-сосудистого события.

Изобретение относится к области медицины, в частности к медицинской генетике, и предназначено для ранней генетической диагностики риска развития сахарного диабета (СД) 2 типа.

Изобретение относится к молекулярной биологии. Предложен способ разделения молекул ДНК, предусматривающий негативную селекцию целевых молекул ДНК в растворе от нецелевых молекул ДНК, предусматривающий взаимодействие нецелевых молекул ДНК, содержащих сайт узнавания рекомбиназы Cre бактериофага P1 LoxP, с рекомбиназой Cre бактериофага Р1, дефектной по способности ковалентно модифицировать ДНК, которое обеспечивает перевод нецелевых молекул ДНК из раствора на твердую фазу.

Группа изобретений относится к области биохимии. Предложена система и способ для сбора нуклеиновой кислоты из образца текучей среды организма, а также стерильная съемная крышка для приемника для сбора отходов.

Изобретение относится к области биохимии, в частности к способу предсказания исхода рака молочной железы в положительной по рецептору эстрогена и отрицательной по HER2 опухоли у пациента с раком молочной железы, предусматривающему определение в образце опухоли от указанного пациента величины уровня экспрессии РНК генов UBE2C, BIRC5, DHCR7, STC2, AZGP1, RBBP8, IL6ST и MGP или генов UBE2C, RACGAP1, DHCR7, STC2, AZGP1, RBBP8, IL6ST и MGP, математическое комбинирование величин уровней экспрессии, где более высокий комбинированный показатель указывает на более худший прогноз у указанного пациента по сравнению с более низким комбинированным показателем.

Предложены способ и устройство для детектирования хромосомных структурных аномалий. Представленный способ включает сегментирование хромосомного образца от целевого индивидуума, то есть множество пар прочтений, расположенных с двух концов исследуемых хромосомных фрагментов; выравнивание результата секвенирования с референсной последовательностью для получения набора аномальных соответствий, причем набор аномальных соответствий включает пары прочтений, которые имеют две последовательности прочтений, соответствующие, соответственно, различным хромосомам референсной последовательности; кластеризацию последовательностей прочтений в наборе аномальных соответствий на основании соответствующих им положений; и фильтрацию получаемых в результате кластеров с использованием, например, заранее заданных требований, связанных с компактностью, и других требований; и получение отфильтрованных итоговых кластеров для определения наличия хромосомной структурной аномалии транслокационного типа.

Изобретение относится к биохимии. Описан способ ПЦР диагностики смешанных хронических рецидивирующих инфекций глаз.

Изобретение относится к биохимии. Описан способ ПЦР диагностики смешанных хронических рецидивирующих инфекций глаз.

Изобретение относится к области медицины и предназначено для прогнозирования наличия хромосомных аномалий в эмбрионах удовлетворительного и плохого качества в программе экстракорпорального оплодотворения (ЭКО).

Предложенная группа изобретений относится к области медицины. Предложен способ диагностики и/или определения у субъекта предрасположенности к развитию острого повреждения почек, включающий определение уровня экспрессии по меньшей мере miR-26b и сравнение указанного уровня экспрессии с контрольным значением, где снижение экспрессии является показателем острого повреждения почек или предрасположенности к развитию острого повреждения почек.

Предложенная группа изобретений относится к области медицины. Предложен способ диагностики и/или определения у субъекта предрасположенности к развитию острого повреждения почек, включающий определение уровня экспрессии по меньшей мере miR-26b и сравнение указанного уровня экспрессии с контрольным значением, где снижение экспрессии является показателем острого повреждения почек или предрасположенности к развитию острого повреждения почек.

Изобретение относится к области биохимии, в частности к способу диагностики и мониторирования течения церебральных глиом, включающему определение уровней экспрессии генов микроРНК.

Изобретение относится к области биохимии, в частности к способу диагностики и мониторирования течения церебральных глиом, включающему определение уровней экспрессии генов микроРНК.

Изобретение относится к биотехнологии. Описан способ оценки риска сердечно-сосудистых событий у субъекта, включающий стадии определения в образце, выделенном от указанного субъекта, страдающего хроническим заболеванием почек, присутствия полиморфизмов в положении 27 в последовательностях нуклеиновой кислоты из SEQ ID NO:1-8, или в последовательности, находящейся в сильном неравновесном сцеплении с последовательностью из любой из SEQ ID NO:1-8, где присутствие в положении 27 С в SEQ ID NO:1, С в SEQ ID NO:2, T в SEQ ID NO:3, С в SEQ ID NO:4, С в SEQ ID NO:5, A в SEQ ID N0:6, T в SEQ ID NO:7 и G в SEQ ID NO:8, что соответствует номеру доступа в db SNP rs17465637, rs6725887, rs9818870, rs12526453, rs1333049, rs501120, rs9982601, rs10455872, соответственно, или присутствие полиморфизма в последовательности любого другого rs, который находится в сильном неравновесном сцеплении с любым из этих упомянутых rs, является показателем риска наличия сердечно-сосудистого события.

Изобретение относится к биотехнологии. Описан способ оценки риска сердечно-сосудистых событий у субъекта, включающий стадии определения в образце, выделенном от указанного субъекта, страдающего хроническим заболеванием почек, присутствия полиморфизмов в положении 27 в последовательностях нуклеиновой кислоты из SEQ ID NO:1-8, или в последовательности, находящейся в сильном неравновесном сцеплении с последовательностью из любой из SEQ ID NO:1-8, где присутствие в положении 27 С в SEQ ID NO:1, С в SEQ ID NO:2, T в SEQ ID NO:3, С в SEQ ID NO:4, С в SEQ ID NO:5, A в SEQ ID N0:6, T в SEQ ID NO:7 и G в SEQ ID NO:8, что соответствует номеру доступа в db SNP rs17465637, rs6725887, rs9818870, rs12526453, rs1333049, rs501120, rs9982601, rs10455872, соответственно, или присутствие полиморфизма в последовательности любого другого rs, который находится в сильном неравновесном сцеплении с любым из этих упомянутых rs, является показателем риска наличия сердечно-сосудистого события.

Изобретение относится к области медицины, в частности к медицинской генетике, и предназначено для ранней генетической диагностики риска развития сахарного диабета (СД) 2 типа.

Изобретение относится к области биохимии, в частности к ДНК-маркеру для количественного определения геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе, путем проведения массового анализа методом ПЦР в режиме реального времени по технологии TaqMan. Изобретение позволяет эффективно определять количество геномной ДНК картофеля S. tuberosum в растительном сырье, а также в продуктах, получаемых на его основе. 6 ил., 2 пр.

Наверх