Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования



Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
Средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена р4на1 и/или уменьшением количества белка пролил 4- гидрокислазы альфа 1 на основе генно-терапевтических субстанций с геном р4на1, способ получения и использования
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2658428:

ДАРМИНА ДЕСИГН ЛТД (BZ)
Общество с ограниченной ответственностью "Медсервис" (RU)

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и представляет собой средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, на основе генно-терапевтических субстанций с геном Р4НА1, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена Р4НА1, с кодирующей последовательностью белка пролил 4-гидроксилазы альфа 1, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка немодифицированной кДНК гена Р4НА1 SEQ ID No: 1, или модифицированной кДНК гена Р4НА1, при этом в качестве модифицированной кДНК гена Р4НА1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена Р4НА1 в эукариотических клетках. Изобретение позволяет эффективно увеличить количество белка пролил 4-гидроксилазы альфа 1 в эукариотических клетках и получить высокоэффективное средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1. 3 н. и 4 з.п. ф-лы, 20 ил., 18 пр.

 

Область, к которой относится изобретение

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и может быть использовано для коррекции патологических состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением уровня экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, в частности, в терапевтических целях.

Предшествующий уровень.

Гликопротеин коллаген является самым распространенным белком не только во внеклеточном матриксе, но и во всем организме человека. Он составляет одну треть от всех белков тела и 70% всех белков кожи. Коллаген является основой соединительной ткани, структурной основой кожи, хрящей, синовиальной жидкости суставов, бронхов, легочной ткани, сосудистой стенки, межпозвонковых дисков, стенок кишечника и желудка. В коллагене одна треть аминокислотных остатков приходится на глицин и еще одна треть на пролин и гидроксипролин. Гидроксипролин, представленный в коллагене весьма большим числом остатков, стабилизирует тройную спираль коллагена по отношению к действию протеаз. В связи с чем, коллаген обеспечивает структурную поддержку ткани, придает ей твердость и стойкость.

Коллаген синтезируется в фибробластах в виде высокомолекулярного предшественника - проколлагена. Полипептидные цепи коллагенов синтезируются на мембраносвязанных рибосомах и поступают в просвет эндоплазматического ретикулума в форме предшественников большего размера (про-альфа-цепи), имеющих дополнительные аминокислотные остатки (пропептиды) на N- и С-концах, а также короткий N-концевой сигнальный пептид, необходимый для поступления образующегося полипептида внутрь эндоплазматического ретикулума. Далее некоторые остатки пролина и лизина гидроксилируются. Гидроксильные группы данных аминокислот, образуют межспиральные водородные связи, что необходимо для правильного трехмерного складывания вновь синтезированных цепочек проколлагена.

Образование гидроксипролила и гидроксилизила катализируют железосодержащие ферменты - пролилгидроксилаза и лизилгидроксилаза, находящиеся в микросомальной фракции многих тканей (кожи, печени, легких, сердца, скелетной мышцы, гранулирующих раневых поверхностей). Эти ферменты являются пептидилгидроксилазами, поскольку гидроксилирование происходит только после включения пролина или лизина в полипептидную цепь.

Пролил-4-гидроксилаза - фермент класса оксидоредуктаз, который катализирует гидроксилирование в положении 4 конкретных остатков пролина в зарождающихся цепях проколлагена. Фермент требует активности Fe2+, аскорбата и α-кетоглутарата для активности, и реакция необходима для термической стабильности тройной спиральной структуры коллагена. Фермент представляет собой тетрамер, содержащий 2α- и 2β-цепи; β-цепь в мономерной форме представляет собой фермент дисульфидизомеразу белков. При этом α-субъединица содержит каталитические и пептид-субстратные связывающие домены, но неактивна в отсутствие β-субъединицы. Фермент является оксигеназой со смешанной функцией и функционирует при участии молекулярного кислорода.

Экспрессия in vitro активной рекомбинантной пролил-4-гидроксилазы из ее субъединиц была успешно получена путем коинфекции клеток насекомых Spodoptera frugiperda и Trichoplusia ni (Vuori, K., et al. (1992) Proc Natl Acad Sci USA 89, 7467-7470) с рекомбинантными бакуловирусами или котрансфекцией с экспрессирующими векторами в клеточных линиях млекопитающих COS-1 (John, DC и Bulleid, NJ (1996) Biochem J 317 (Pt 3), 659-665) и HEK293 (Wagner, K., et al. (2000) Biochem J352 Pt 3, 907-911), в дрожжах Pichia pastoris (Vuorela, A., et al. (1997) Embo J16, 6702-6712) и Saccharomyces cerevisiae (Toman, P.D. и др. (2000) J Biol Chem 275, 23303-23309).

Системами экспрессии для получения рекомбинантных коллагенов являются также клетки Е. coli, трансгенные животные и растения. Однако почти все вышеназванные системы экспрессии имеют свои недостатки. Например, система экспрессии Е. coli не имеет посттрансляционной модификации, а система экспрессии дрожжей не обладает пролил-4-гидроксилазной активностью, хотя выход коллагенов в Pichia pastoris является самым высоким среди этих экспрессионных систем. Система экспрессии клеточной линии млекопитающих имеет низкий выход и пределы для конкретных типов тканей, а система экспрессии клеток насекомых имеет низкую активность пролил-4-гидроксилазы. Что касается трансгенных животных (шелковый червь или мыши) или растений (табак), в них продукты коллагена были чрезмерно «сшиты». Кроме того, трудно восстановить или очистить рекомбинантные коллагены из-за клеточного лизиса. Поэтому создание эффективной системы экспрессии для получения коллагенов с высоким выходом очень актуально.

Известен ген Р4НА1 пролил 4-гидроксилазы альфа-полипептида I Homo sapiens, кодирующий каталитическую α (I) субъединицу основного изофермента С-Р4Н (С-Р4Н-I) (https://cgwb.nci.nih.gov/cgi-bin/hgGene?hgg_gene=uc001jth.3&hgg_prot=Q5VSQ6&hgg_chrom=chr10&hgg_start=74766979&hgg_end=74856732&hgg_type=knownGene&db=hg19&hgsid=1030298). Ген P4HA1 находится в положении 10q22.1 хромосомы, имеет длину более 69 кБ, и состоит из 16 экзонов. Белок гена Р4НА1 катализирует образование 4-гидроксипролина, который необходим для правильного трехмерного складывания вновь синтезированных цепочек проколлагена.

Были исследованы мутации человеческого биаллельного гена Р4НА1 в семье с врожденным расстройством соединительной ткани, которое проявлялось как ранняя суставная гипермобильность, суставные контрактуры, мышечная слабость и дисплазия кости, также и высокая миопия, с подтверждением клинического улучшения двигательной функции с течением времени у выжившего пациента. Как и у нулевых мышей P4ha1, которые умирают пренатально, мышечная ткань из поколений Р1 и Р2 обнаружила пониженную иммунореактивность коллагена IV на мембране базального мышц. Пациенты были гетерозиготными по мутантному гену, что приводило к уменьшению, но не отсутствию уровня белка Р4НА1 и активности пролил-4-гидроксилазы С-Р4Н в дермальных фибробластах по сравнению с контрольными образцами. Дифференциальная сканирующая калориметрия показала уменьшенную термическую стабильность коллагена в дермальных фибробластах, полученных из пациентов, по сравнению с контрольными образцами. Мутации, влияющие на семейство белков C-P4Hs и, в частности, C-P4H-I, следует учитывать у пациентов с врожденными нарушениями соединительной ткани / миопатии с совместной гипермобильностью, контрактурами, легкой скелетной дисплазией и высокой миопией (Yaqun Zou, Sandra Donkervoort et al. Молекулярная генетика человека, том 26, выпуск 12, 15 июня 2017 г., страницы 2207-2217, https://doi.org/10.1093/hmg/ddx110).

В заявке WO 2014170460 (А2) описан метод получения коллагена из морских губок (Chondrosia reniformis) в дрожжах Pichia pastoris. В частности, было создано три векторные конструкции:

- с кДНК, кодирующей альфа-субъединицу пролил-4-гидроксилазы (pPinkHC \ <хо pPinkLC \ а векторы),

- с кДНК, кодирующей бета-субъединицу пролил-4-гидроксилаза (pPIC6B \ PDI-вектор),

- с кДНК, кодирующей нефибриллярный коллагеновый белок С. Reniformis (pPICZB \ ColCH).

В заявке описан способ, который предусматривает совместную трансформацию дрожжевого штамма с двумя различными векторами, содержащими: первый - кодирующую последовательность для альфа-субъединицы, второй - кодирующую последовательность бета-субъединицы фермента пролил-4-гидроксилазы, с последующей трансформацией с помощью вектора, содержащего одну кодирующую последовательность коллагенового белка морской губки.

Недостатком данного подхода является то, что для экспрессии генов субъединиц пролил-4-гидроксилазы морской губки выбрана система экспрессии дрожжевых клеток, которая согласно литературным данным не обладает значимой пролил-4-гидроксилазной активностью. В данной патентной заявке не рассматривается возможность экспрессии в клетках человека в качестве генно-терапевтического средства с учетом индивидуальных характеристик пациента, в связи с которыми может понадобиться группа вариаций для данного средства.

За прототип авторами было принято решение по патенту US 7759090 (В2), в котором описана экспрессионная система для получения коллагена. В частности, показаны стабильно трансфицированные клеточные линии насекомых, содержащие кДНК, кодирующие α и β-субъединицы пролил-4-гидроксилазы человека в клетках Trichoplusia ni и Drosophila melanogaster S2. Дополнительно охарактеризовано участие пролил-4-гидроксилазы в сборке трех альфа-цепей с образованием миниколлагена XXI тримерного типа, который содержит интактный С-терминальный неколлагеновый домен (NC1) и коллагеновый домен (COL1) в системе Drosophila. Миниколлаген XXI, коэкспрессированный пролил-4-гидроксилазой, содержал достаточное количество гидроксипролина для образования термостойких устойчивых к пепсину тройных спиралей.

Один из вариантов осуществления изобретения описывает рекомбинантную клетку насекомого, включающую трансфицированный ген, кодирующий пролил-4-гидроксилазу. Этот ген включает α-субъединицу и/или β-субъединицу пролил-4-гидроксилазы. Рекомбинантная клетка насекомого дополнительно включает трансфицированный ген, кодирующий коллагеновый (COL1) домен и С1-терминальный домен (NC1) коллагена типа XXI.

Гены кодирующие α-субъединицу и β-субъединицу пролил-4-гидроксилазы человека были клонированы совместно в векторе экспрессии pIZ / V5-His под контролем промотора OplE2, полученного из вируса полипептида многояде (в системе InsectSelect), а в системе Drosophila inducible expression (DES®) (Invitrogen) гены кодирующие α-субъединицу и β-субъединицу пролил-4-гидроксилазы были клонированы раздельно в векторе экспрессии рМТ / V5-HisA под контролем промотора металлотионеина, который индуцируется добавлением ионов меди или кадмия.

Показано, что Р4Нα- и Р4Нβ-субъединицы способны собираться в активный тетрамер α2β2. Полученная пролил-4-гидроксилаза обеспечивает синтез коллагена с устойчивыми тройными спиралями. Общая активность пролил-4-гидроксилазы в стабильно трансфицированных клетках Trichoplusia ni Р4Н увеличивалась только в 2 раза по сравнению с эндогенным ферментом в контроле без трансфекции клеток, а в системе Drosophila S2, была в 3-4 раза выше, чем в системе Trichoplusia ni. Это объясняется более высокой копийностью рекомбинантных плазмидных векторов, которые были использованы для трансфекции генома клеток Drosophila S2. Сравнение уровней экспрессии Р4Нα и Р4Нβ в лизатах клеток Trichoplusia ni показало, что уровень экспрессии белка Р4Нα примерно в 5 раз меньше, чем Р4Нβ. Для экспрессии Р4Н в индуцибельной Drosophila системе экспрессии клетки Drosophila S2 были совместно трансфицированы рМТ / Р4Нα, рМТ / Р4Нβ и pCoHygro в соотношении 10:10:1 с использованием реагента для трансфекции Effectene (Qiagen). Домены коллагена были введены в клетки путем трансформации вектором рМТ / BiP-mC21. Таким образом, рекомбинантный коллаген получен с использованием системы экспрессии трех генов в клетках Drosophila melanogaster.

Недостатком данного подхода является то, что для экспрессии генов субъединиц пролил-4-гидроксилазы человека выбрана система экспрессии клеток насекомых, которая согласно литературным данным имеет низкую активность пролил-4-гидроксилазы. Также не рассматривается возможность экспрессии в клетках человека в качестве генно-терапевтического средства с учетом индивидуальных характеристик пациента, в связи с которыми может понадобиться группа вариаций для данного средства.

Раскрытие изобретения

Задачей данного изобретения является создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, на основе генно-терапевтических субстанций с геном Р4НА1, представляющих собой группу генно-терапевтических субстанций, при использовании которых с учетом индивидуальных особенностей пациента, происходит повышение уровня экспрессии гена Р4НА1 и/или повышение количества белка пролил 4-гидроксилазы альфа 1, в клетках органов и тканей и/или органах и тканях организма

Указанная задача решается за счет того, что создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, на основе генно-терапевтических субстанций с геном Р4НА1, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена Р4НА1, с кодирующей последовательностью белка пролил 4-гидроксилазы альфа 1, с делециями 5'- и 3'-нетранслируемых областей, а именно, полученной на основе участка немодифицированной кДНК гена Р4НА1 SEQ ID No: 1, или модифицированной кДНК гена Р4НА1, при этом в качестве модифицированной кДНК гена Р4НА1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена Р4НА1 в эукариотических клетках, в частности в клетках органов и тканей человека, и способную увеличить количество белка пролил 4-гидроксилазы альфа 1, в клетках органов и тканей и/или органах и тканях человека, в частности в гемопоэтических клетках, или мезенхимальных стволовых клетках, или хондробластах, или миоцитах, или миобластах, или фибробластах, или остеобластах, или кератоцитах, или эпителиальных клетках, или клетках роговицы, или эндотелиальных клетках, или эпителиальных клетках, в сочетании с транспортной молекулой или без нее при трансфекции этими генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в соединительно-тканных структурах, или коже, или суставах, или хрящевой ткани, или костной ткани, или мышечной ткани, или сухожилиях, или связках, или кровеносных сосудах, или стенке артерий, или роговице глаза, или склере, или плаценте, или дентине, или строме внутренних органов в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека. При этом генетическая конструкция с модифицированной кДНК гена Р4НА1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена Р4НА1, которая несет модификации, не затрагивающие структуру белка пролил 4-гидроксилазы альфа 1, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи. Или генетическая конструкция с модифицированной кДНК гена Р4НА1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена Р4НА1, которая несет модификации, затрагивающие структуру белка пролил 4-гидроксилазы альфа 1, а именно: нуклеотидные замены, приводящие к аминокислотным заменам или обрыву аминокислотной цепи. Или генетическая конструкция с модифицированной кДНК гена Р4НА1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена Р4НА1, которая несет модификации, не затрагивающие структуру белка пролил 4-гидроксилазы альфа 1, а именно: нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, в комбинации с модификациями, затрагивающими структуру белка пролил 4-гидроксилазы альфа 1, а именно: нуклеотидные замены, приводящие к аминокислотным заменам или обрыву аминокислотной цепи. В качестве транспортной молекулы используют липосомы или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры, или transfection reagent на основе Polyethylenimine (PEI).

Способ получения средства для лечения состояний человеческого организма связанного с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, заключается в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций, при этом получают кДНК гена Р4НА1, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена Р4НА1 с кодирующей последовательностью белка пролил 4-гидроксилазы альфа 1, с делециями 5'- и 3'-нетранслируемых областей, а именно, полученной на основе участка немодифицированной кДНК гена Р4НА1 SEQ ID No: 1, или модифицированной кДНК гена Р4НА1, при этом в качестве модифицированной кДНК гена Р4НА1 используют, или SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, заключающийся в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций, клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной / выбранных из группы созданных генно-терапевтических субстанций по п. 1., или сочетанием обозначенных способов.

Перечень фигур

На фиг. 1

Представлена нуклеотидная последовательность немодифицированной кДНК гена Р4НА1, последовательность которой гомологична приводимой в базе данных GenBank под номером NM_000917 P4HA1SEQ ID No: 1.

На фиг. 2

Представлена нуклеотидная последовательность модифицированной кДНК гена Р4НА1, SEQ ID No: 2, которая

содержит 2 нуклеотидные замены G>C в позициях 730, 790; 3 нуклеотидных замены T>G в позициях 511, 649, 1123; 4 нуклеотидных замены A>G в позициях 487, 502, 646, 727; 2 нуклеотидных замены Т>С в позициях 500, 644, не приводящие к изменениям в аминокислотной последовательности белка пролил 4-гидроксилазы альфа 1.

На фиг. 3

Представлена нуклеотидная последовательность модифицированной кДНК гена Р4НА1, SEQ ID No: 3, которая

содержит 3 нуклеотидных замены G>C в позициях 730,790,1828; 6 нуклеотидных замен T>G в позициях 511, 649, 1123, 1192, 1249, 1801; 8 нуклеотидных замен A>G в позициях 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 нуклеотидных замены Т>С в позициях 500, 644, не приводящие к изменениям в аминокислотной последовательности белка пролил 4-гидроксилазы альфа 1.

На фиг. 4

Представлена нуклеотидная последовательность модифицированной кДНК гена Р4НА1, SEQ ID No: 4, которая

содержит 28 несинонимических нуклеотидных замен 1324 C>G, 1330 Т>С, 1333 А>С, 1334 G>A, 1336 А>Т, 13370Т, 1338 А>С, 1339 Т>А, 1340 G>A,1345 Т>А, 1346 G>A, 1347 А>Т, 1348 G>A, 1351 Т>А, 1355 A>G, 1357 А>С, 1361 A>G, 1362 С>А, 1363 C>G, 1366 A>G, 1368 C>Т, 1372 G>T, 1379 G>A, 1381 А>Т, 1382 Т>А, 1383 C>G, 1384 Т>С, 1387 G>A, приводящих к изменениям в аминокислотной последовательности белка пролил 4-гидроксилазы альфа 1.

На фиг. 5

Представлена нуклеотидная последовательность модифицированной кДНК гена Р4НА1, SEQ ID No: 5, которая содержит 28 несинонимических нуклеотидных замен 1324 C>G, 1330 Т>С, 1333 А>С, 1334 G>A, 1336 А>Т, 1337 С>Т, 1338 А>С, 1339 Т>А, 1340 G>A, 1345 Т>А, 1346 G>A, 1347 А>Т, 1348 G>A, 1351 Т>А, 1355 A>G, 1357 А>С, 1361 A>G, 1362 C>A, 1363 C>G, 1366 A>G, 1368 C>Т, 1372 C>Т, 1379 G>A, 1381 А>Т, 1382 Т>А, 1383 C>G, 1384 Т>С, 1387 G>A, приводящих к изменениям в аминокислотной последовательности белка пролил 4-гидроксилазы альфа 1, а также-3 нуклеотидных замены G>C в позициях 730, 790, 1828; 6 нуклеотидных замен T>G в позициях 511, 649, 1123, 1192, 1249, 1801; 6 нуклеотидных замен A>G в позициях 487, 502, 646, 727, 1429, 1816; 2 нуклеотидных замены Т>С в позициях 500, 644.

На фиг. 6

Представлена нуклеотидная последовательность модифицированной кДНК гена Р4НА1, SEQ ID No: 6, которая

содержит делецию с 1490 по 1544 н.п., приводящую к изменениям в аминокислотной последовательности белка пролил 4-гидроксилазы альфа 1.

На фиг. 7

Представлена нуклеотидная последовательность модифицированной кДНК гена Р4НА1, SEQ ID No: 7, которая

содержит 3 нуклеотидных замены G>C в позициях 730, 790, 1828; 6 нуклеотидных замен T>G в позициях 511, 649, 1123, 1192, 1249, 1801; 8 нуклеотидных замен A>G в позициях 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 нуклеотидных замены Т>С в позициях 500, 644; делецию с 1490 по 1544 н.п., приводящие к изменениям в аминокислотной последовательности белка пролил 4-гидроксилазы альфа 1.

На фиг. 8

С целью последующего корректного определения генно-терапевтического эффекта после трансфекции фибробластов генно-терапевтической субстанцией с кДНК гена Р4НА1 проводили анализ эндогенной экспрессии гена Р4НА1 в культуре первичных фибробластов. На фигуре представлены графики накопления продуктов полимеразной цепной реакции (ПЦР), соответствующих:

1 - кДНК гена Р4НА1, фибробласты со сниженной экспрессией гена Р4НА1

2 - кДНК гена Р4НА1, фибробласты с нормальной экспрессией гена Р4НА1

3 - кДНК гена В2М, фибробласты со сниженной экспрессией гена Р4НА1

4 - кДНК гена В2М, фибробласты с нормальной экспрессией гена Р4НА1

В качестве референтного гена использовали ген В2М (Бета-2-микроглобулин) приведенного в базе данных GenBank под номером NM 004048.2.

На фиг. 9

С целью подтверждения увеличения экспрессии гена Р4НА1 в клеточной культуре фибробластов со сниженной экспрессией гена Р4НА1 при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена Р4НА1 представлены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена Р4НА1 в фибробластах с нормальной экспрессией гена Р4НА1,

2 - кДНК гена Р4НА1 в фибробластах со сниженной экспрессией гена Р4НА1 до трансфекции ГТС с кДНК гена Р4НА1

3 - кДНК гена Р4НА1 в фибробластах со сниженной экспрессией гена Р4НА1 после трансфекции ГТС с кДНК гена Р4НА1

4 - кДНК гена Р4НА1 в фибробластах со сниженной экспрессией гена Р4НА1 после трансфекции вектором без кДНК гена Р4НА1

5- кДНК гена В2М в фибробластах с нормальной экспрессией гена Р4НА1,

6- кДНК гена В2М в фибробластах со сниженной экспрессией гена Р4НА1 до трансфекции ГТС с кДНК гена Р4НА1

7- кДНК гена В2М в фибробластах со сниженной экспрессией гена Р4НА1 после трансфекции ГТС с кДНК гена Р4НА1

8 - кДНК гена В2М в фибробластах со сниженной экспрессией гена Р4НА1 после трансфекции вектором без кДНК гена Р4НА1

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена Р4НА1 уровень кДНК гена Р4НА1 в фибробластах не изменился, а в случае трансфекции вектором с кДНК Р4НА1- уровень кДНК фибробластов со сниженной экспрессией гена Р4НА1 многократно увеличился (до уровня выше, чем уровень кДНК гена Р4НА1в нормальных фибробластах).

На фиг. 10

С целью подтверждения увеличения количества белка пролил 4-гидроксилазы альфа 1 в клеточной культуре фибробластов с нормальной экспрессией гена Р4НА1 при трансфекции данных клеток генно-терапевтической субстанцией содержащей кДНК гена Р4НА1 представлен график изменения количества белка пролил 4-гидроксилазы альфа 1 нетрансфицированных фибробластов (культура А), трансфицированных вектором pCDNA 3.1 (+) не содержащим кДНК Р4НА1 (культура В) и трансфицированных генно-терапевтической субстанцией на базе генетической конструкции pCDNA 3.1-P4HA1SEQ ID No: 1 (культура С). Из графика следует, что при трансфекции фибробластов генно-терапевтической субстанцией с кДНК гена Р4НА1 происходит увеличение количества белка пролил 4-гидроксилазы альфа 1 в клеточном лизате.

На фиг. 11

С целью подтверждения увеличения количества белка пролил 4-гидроксилазы альфа 1 в коже человека при введении в кожу клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией представлен анализ изменения количества белка пролил 4-гидроксилазы альфа 1 в коже пациентов. При этом пациентам вводили три варианта культуры аутологичных фибробластов - нетрансфицированные (А), трансфицированные вектором pCMV6-XL5 (Б) и трансфицированные генно-терапевтической субстанцией на базе pCMV6- P4HA1SEQ ID No: 7 (С) - в кожу предплечья. Также анализировали количественный уровень белка пролил 4-гидроксилазы альфа 1 в интактной коже. Показано повышение количества белка пролил 4-гидроксилазы альфа 1 в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией с кДНК гена Р4НА1(С).

На фиг. 12

С целью подтверждения увеличения количества белка пролил 4-гидроксилазы альфа 1 до различного индивидуального уровня в клеточных культурах фибробластов пациентов при трансфекции данных клеток генно-терапевтическими субстанциями с модифицированными и немодифицированной кДНК гена Р4НА1 в зависимости от наличия и типа в них той или иной модификации кДНК гена Р4НА1 представлен анализ изменения количественного уровня белка пролил 4-гидроксилазы альфа 1 в культурах фибробластов кожи человека в зависимости от наличия и типа модификаций в кДНК гена Р4НА1, используемой для трансфекции фибробластов.

Культуры фибробластов 28 пациентов делили на 8 частей каждую с (А) по (Н); первые части (А) клеточных культур пациентов трансфицировали генно-терапевтической субстанцией pCMV6-P4HA1SEQ ID No: 1, части (В) трансфицировали генно-терапевтической субстанцией pCMV6-P4HA1SEQ ID No: 2, части (С) трансфицировали генно-терапевтической субстанцией pCMV6-P4HA1SEQ ID No: 3, части (D) трансфицировали генно-терапевтической субстанцией pCMV6-P4HA1SEQ ID No: 4, части (Е) трансфицировали генно-терапевтической субстанцией pCMV6-P4HA1SEQ ID No: 5, части (F) трансфицировали генно-терапевтической субстанцией pCMV6-P4HA1SEQ ID No: 6, части (G) трансфицировали генно-терапевтической субстанцией pCMV6-P4HA1SEQ ID No: 7, части (Н) трансфицировали векторной плазмидой, не содержащей кДНК гена Р4НА1.

По итогам анализа количественного уровня белка пролил 4-гидроксилазы альфа 1 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие наибольшее количество белка пролил 4-гидроксилазы альфа 1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при трансфекции pCMV6-P4HA1SEQ ID No: 1,

в группе 2 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при трансфекции pCMV6-P4HA1 SEQ ID No: 2,

в группе 3 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при трансфекции pCMV6-P4HA1 SEQ ID No: 3,

в группе 4 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при трансфекции pCMV6-P4HA1 SEQ ID No: 4,

в группе 5 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при трансфекции pCMV6-P4HA1 SEQ ID No: 5,

в группе 6 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при трансфекции pCMV6-P4HA1 SEQ ID No: 6,

в группе 7 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при трансфекции pCMV6-P4HA1 SEQ ID No: 7.

Ни в одной из клеточных культур не наблюдалось того, что наибольшее количество белка пролил 4-гидроксилазы альфа 1 присутствует при трансфекции вектором без вставки кДНК гена Р4НА1.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей концентрации белка пролил 4-гидроксилазы альфа 1 (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и немодифицированной кДНК гена Р4НА1.

Из фигуры следует, что достижение наибольшего количества белка пролил 4-гидроксилазы альфа 1 в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена Р4НА1, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование пациента.

Обозначения:

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 1 (A)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 2 (B)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 3 (С)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 4 (D)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 5 (Е)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 6 (F)

части клеточных культур, трансфицированных ГТС Р4НА1 SEQ ID No: 7 (G)

части клеточных культур, трансфицированных плацебо (Н)

На фиг. 13

С целью подтверждения увеличения экспрессии гена Р4НА1 в клеточной культуре кератоцитов и эпителиальных клеток роговицы глаза при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена Р4НА1 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена Р4НА1, кератоциты до трансфекции

2 - кДНК гена Р4НА1, эпителий роговицы до трансфекции

3 - кДНК гена Р4НА1, кератоциты после трансфекции

4 - кДНК гена Р4НА1, эпителий роговицы после трансфекции

5 - кДНК гена В2М, кератоциты до трансфекции

6 - кДНК гена В2М, эпителий роговицы до трансфекции

7 - кДНК гена В2М, кератоциты после трансфекции

8 - кДНК гена В2М, эпителий роговицы после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена Р4НА1 в культуре кератоцитов и в культуре эпителия многократно вырос.

На фиг. 14

С целью подтверждения увеличения экспрессии гена Р4НА1 в клеточной культуре хондробластов при трансфекции данных клеток генно-терапевтической субстанцией с кДНК гена Р4НА1 приведены графики накопления ПЦР-продуктов, соответствующих:

1 - кДНК гена Р4НА1, до трансфекции

2 - кДНК гена Р4НА1, после трансфекции

3 - кДНК гена В2М, до трансфекции

4 - кДНК гена В2М, после трансфекции

Ген В2М использовали в качестве референтного.

Из фигуры следует, что в результате трансфекции уровень специфической кДНК гена Р4НА1 вырос многократно.

На фиг. 15

С целью подтверждения увеличения количества белка пролил 4-гидроксилазы альфа 1 в коже человека при введении в кожу генно-терапевтической субстанции представлен анализ изменения количественного уровня белка пролил 4-гидроксилазы альфа 1 в коже. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию pCMV6-P4HA1 SEQ ID No: 4 (В) с транспортной молекулой и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды pCMV-XL5 не содержащей кДНК гена Р4НА1 с транспортной молекулой (А) - в кожу предплечья. Показано увеличение количества белка пролил 4-гидроксилазы альфа в биоптате кожи пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена Р4НА1, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 16

С целью подтверждения увеличения количества белка пролил 4-гидроксилазы альфа 1

в хрящевой ткани человека при введении в хрящевую ткань генно-терапевтической субстанции представлен анализ изменения количественного уровня белка пролил 4-гидроксилазы альфа 1 в хрящевой ткани. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена P4HA1pCDNA 3.1 P4HA1SEQ ID No: 5 (В) с транспортной молекулой и параллельно вводили плацебо pCDNA 3.1(+), представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена Р4НА1 с транспортной молекулой (А) - в хрящевую ткань.

Показано увеличение количественного уровня белка пролил 4-гидроксилазы альфа в лизате биоптата хрящевой ткани пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена Р4НА1, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 17

С целью подтверждения увеличения количества белка пролил 4-гидроксилазы альфа 1 в мышечной ткани человека при введении в мышечную ткань генно-терапевтической субстанции представлен анализ изменения количества белка пролил 4-гидроксилазы альфа 1 в мышечной ткани. При этом пациенту вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена Р4НА1- pCMV6-Kan/Neo P4HA1SEQ ID No: 6 (В) с транспортной молекулой и параллельно вводили плацебо pCMV6-Kan/Neo, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена Р4НА1 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья. Показано увеличение количества белка пролил 4-гидроксилазы альфа 1 в биоптате мышечной ткани пациента 1В, которому вводились генно-терапевтическая субстанция, содержащая генетическую конструкцию с кДНК гена Р4НА1, что говорит об эффективности генно-терапевтической субстанции.

Обозначения:

пациент 1А

пациент 1В

пациент 1В до введения ГТС

На фиг. 18

С целью подтверждения увеличения количества белка пролил 4-гидроксилазы альфа 1 до различного индивидуального уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными и немодифицированной кДНК гена Р4НА1 анализировали количественный уровень белка пролил 4-гидроксилазы альфа 1в коже человека в зависимости от наличия и типа модификаций в кДНК гена Р4НА1.

Каждому из 24-х пациентов, отобранных в случайном порядке, вводили в кожу предплечья 7 генно-терапевтических субстанций pCMV6- SEQ ID No: 1, pCMV6- SEQ ID No: 2, pCMV6-SEQ ID No: 3, pCMV6-SEQ ID No: 4, pCMV6- SEQ ID No: 5, pCMV6-SEQ ID No: 6, pCMV6-SEQ ID No: 7, и плацебо pCMV6- XL5.

По итогам анализа количества белка пролил 4-гидроксилазы альфа 1 в биоптатах выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие наибольшие количественные уровни белка пролил 4-гидроксилазы альфа 1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при введении pCMV6-P4HA1 SEQ ID No: 1,

в группе 2 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при введении pCMV6-P4HA1 SEQ ID No: 2,

в группе 3 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при введении pCMV6-P4HA1 SEQ ID No: 3,

в группе 4 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при введении pCMV6-P4HA1 SEQ ID No: 4,

в группе 5 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при введении pCMV6-P4HA1 SEQ ID No: 5,

в группе 6 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при введении pCMV6-P4HA1 SEQ ID No: 6,

в группе 7 наибольшее количество белка пролил 4-гидроксилазы альфа 1 наблюдалась при введении pCMV6-P4HA1 SEQ ID No: 7.

Ни в одном из биоптатов не наблюдалось того, что наибольшее количество белка пролил 4-гидроксилазы альфа 1 присутствует в случае введения плацебо.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентрации белка пролил 4-гидроксилазы альфа 1 (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после введения пациентам этих генно-терапевтических субстанций, содержащих модифицированные и немодифицированной кДНК гена Р4НА1.

Из данного примера следует, что достижение увеличения количества белка пролил 4-гидроксилазы альфа 1 в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена Р4НА1, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей, необходимо предварительное персонализированное исследование пациента.

Обозначения:

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 1 (А)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 2 (B)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 3 (С)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 4 (D)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 5 (Е)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 6 (F)

биоптаты пациентов после введения ГТС Р4НА1 SEQ ID No: 7(G)

биоптаты пациентов после введения плацебо (Н)

На фиг. 19

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количественный уровень белка пролил 4-гидроксилазы альфа 1 в клеточных лизатах фибробластов этого пациента, трансфицированных разными генетическими конструкциями, содержащими немодифицированную или модифицированные кДНК гена Р4НА1.

По итогам анализа количества белка пролил 4-гидроксилазы альфа 1 в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой выявляется наибольшая концентрация белка пролил 4-гидроксилазы альфа 1 в лизате клеточной культуры. В данном эксперименте наибольшая концентрация белка пролил 4-гидроксилазы альфа 1 в лизате наблюдается при трансфекции генно-терапевтической субстанцией на базе pCMV6-P4HA1SEQ ID No: 3, содержащей модифицированную кДНК Р4НА1, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Обозначения:

1 - клеточный лизат после трансфекции ГТС P4HA1SEQ ID No: 1 (А)

2 - клеточный лизат после трансфекции ГТС P4HA1SEQ ID No: 2 (В)

3 - клеточный лизат после трансфекции ГТС P4HA1SEQ ID No: 3 (С)

4 - клеточный лизат после трансфекции ГТС P4HA1SEQ ID No: 4 (D)

5 - клеточный лизат после трансфекции ГТС P4HA1SEQ ID No: 5 (Е)

6 - клеточный лизат после трансфекции ГТС P4HA1SEQ ID No: 6 (F)

7 - клеточный лизат после трансфекции ГТС P4HA1SEQ ID No: 7 (G)

8 - клеточный лизат после трансфекции плацебо (Н)

На фиг. 20

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка пролил 4-гидроксилазы альфа 1 в лизатах биоптатов кожи этого пациента, после введения ему генно-терапевтических субстанций, содержащих немодифицированную или модифицированные кДНК гена Р4НА1.

По итогам анализа количества белка пролил 4-гидроксилазы альфа 1 в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой выявляется наибольшая концентрация белка пролил 4-гидроксилазы альфа 1 в лизате биоптата. В данном эксперименте наибольшая концентрация белка пролил 4-гидроксилазы альфа 1 отмечена при введении генно-терапевтической субстанции на базе pCMV6 P4HA1SEQ ID No: 4, содержащей модифицированную кДНК P4HA1, что показано на фигуре 20.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Обозначения:

1 - лизат биоптата после введения ГТС Р4НА1 SEQ ID No: 1 (А)

2 - лизат биоптата после введения ГТС Р4НА1 SEQ ID No: 2 (В)

3 - лизат биоптата после введения ГТС Р4НА1 SEQ ID No: 3 (С)

4 - лизат биоптата после введения ГТС Р4НА1 SEQ ID No: 4 (D)

5 - лизат биоптата после введения ГТС Р4НА1 SEQ ID No: 5 (Е)

6 - лизат биоптата после введения ГТС Р4НА1 SEQ ID No: 6 (F)

7 - лизат биоптата после введения ГТС Р4НА1 SEQ ID No: 7 (G)

8 - лизат биоптата после введения плацебо (Н)

Реализация изобретения.

При снижении экспрессии генов, кодирующих белки синтеза коллагена, например, гена Р4НА1, происходит снижение качества структуры органов и тканей организма. Так мыши, гомозиготные по нулевой мутации, демонстрируют высокий уровень летальности во время органогенеза в эмбриональном периоде развития, наличие капиллярных разрывов, и нарушение формирования базальной мембраны. http://www.jbc.org/content/282/4/2512.

Преимущества использования генетической конструкции с геном Р4НА1 для коррекции экспрессии гена Р4НА1 и количества белка пролил 4-гидроксилазы альфа 1 в клетках органов и тканей человека:

1) легче обеспечить более высокий и стабильный уровень целевого белка в клетках,

2) обеспечивается транспортировка генно-терапевтической субстанции в больший спектр клеток органов и тканей человека, а также более эффективная внутриклеточная транспортировка генно-терапевтической субстанции.

3) учитываются индивидуальные характеристики пациента.

Таким образом, для создания группы генно-терапевтических субстанций по данному изобретению был выбран ген Р4НА1, а не белок пролил 4-гидроксилаза альфа 1, кодируемый этим геном.

Для получения группы генно-терапевтических субстанций осуществляют следующие действия:

1. Получение участка немодифицированной кДНК гена Р4НА1, содержащей белок-кодирующую область гена Р4НА1 и делеции 5'-нетранслируемых областей или делеции 3'-нетранслируемых областей, клонирование его в промежуточную плазмиду, переклонирование его в экспрессионные векторные плазмиды под контроль эукариотических регуляторных элементов для экспрессии целевого гена таким образом, что полученные генетические конструкции содержат кодирующую нуклеотидную последовательность кДНК белка пролил 4-гидроксилазы альфа 1, которая является участком немодифицированной кДНК гена Р4НА1 и которая используется для дальнейших модификаций.

2. Внесение в последовательность нуклеотидов кДНК гена Р4НА1 модификаций с целью создания ряда кДНК гена Р4НА1, обеспечивающих достаточный для борьбы с патологическими проявлениями уровень трансляции белка пролил 4-гидроксилазы альфа 1.

3. Клонирование участка немодифицированной кДНК гена Р4НА1 и полученных на его основе модифицированных кДНК гена Р4НА1 в векторные плазмиды, способные обеспечить эффективную экспрессию этой кДНК в клетках органов и тканей человека.

4. Трансформация каждой из полученных генетических конструкций бактериальных клеток E.coli, анализ трансформированных клонов на предмет наличия, ориентации и копийности вставки кДНК и наращивание отобранных клонов для получения необходимого для дальнейшей работы количества вариантов плазмидной ДНК.

5. Выделение ряда генетических конструкций, содержащих модифицированные кДНК гена Р4НА1 и участок немодифицированной кДНК гена Р4НА1 для создания на их базе группы генно-терапевтических субстанций.

6. Создание группы генно-терапевтических субстанций, каждая из которых включает генетическую конструкцию с модифицированными кДНК гена Р4НА1 и участок немодифицированной кДНК гена Р4НА1, или комбинацию такой конструкции с транспортной молекулой для эффективной трансфекции различных типов клеток органов и тканей и/или введения в органы и ткани человека.

Для доказательства эффективности созданных генно-терапевтических субстанций, приводящих к увеличению экспрессии гена Р4НА1, проводят следующие исследования:

A) Выращивание культур различных типов клеток из биоптатов различных органов и тканей человека, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы.

B) Выделение РНК из культуры клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, и анализ экспрессии гена Р4НА1 из генома этих клеток.

C) Трансфекция культуры клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, генно-терапевтическими субстанциями содержащими немодифицированную и/или модифицированные кДНК гена Р4НА1 и параллельная трансфекция культуры этих же клеток векторной плазмидой, не содержащей кДНК гена Р4НА1 в различных комбинациях.

D) Сравнительный анализ изменения уровня кДНК и/или изменения количества белка пролил 4-гидроксилаза альфа 1 после трансфекции в различных комбинациях клеток, например, фибробластов кожи человека, или хондробластов, или кератоцитов, или эпителиальных клеток роговицы, генно-терапевтическими субстанциями содержащими немодифицированную и/или модифицированные кДНК гена Р4НА1 и параллельной трансфекции культуры этих же клеток векторной плазмидой, не содержащей кДНК гена Р4НА1. Данный анализ проводят, в частности, перед предполагаемой терапией с целью определения наиболее эффективной для пациента генно-терапевтической субстанции.

E) Введение пациентам в органы и ткани культуры клеток с кДНК гена Р4НА1, например, введение, в кожу человека, аутологичных фибробластов, трансфицированных генно-терапевтической субстанцией с кДНК гена Р4НА1 и параллельное введение пациентам в органы и ткани, например, в кожу, культур этих же клеток нетрансфицированных и трансфицированных вектором без вставки кДНК гена Р4НА1 и/или введение пациентам в органы и ткани генно-терапевтических субстанций, например, введение в кожу человека генно-терапевтических субстанций, содержащих немодифицированную и/или модифицированные кДНК Р4НА1, а также плацебо в различных комбинациях.

F) Сравнительный анализ количества белка пролил 4-гидроксилаза альфа 1 в органах и тканях человека, в частности в коже человека, после введения клеток нетрансфицированных и трансфицированных генно-терапевтическими субстанциями, содержащими кДНК гена Р4НА1 и векторными плазмидами, не содержащими кДНК генаР4НА1 и/или генно-терапевтических субстанций, содержащих немодифицированную или модифицированные кДНК гена Р4НА1, а также плацебо.

G) Введение пациентам в органы и ткани, например, хрящевую ткань, или мышечную ткань генно-терапевтических субстанций, содержащих немодифицированную и/или модифицированные кДНК гена Р4НА1, а также плацебо.

H) Сравнительный анализ количества белка пролил 4-гидроксилаза альфа 1 в органах и тканях человека, в частности в хрящевой ткани, или мышечной ткани человека, после введения генно-терапевтических субстанций, содержащих немодифицированную и/или модифицированные кДНК Р4НА1 а также плацебо.

I) Введение пациентам в органы и ткани, например, введение в кожу пациента генно-терапевтических субстанций, содержащих немодифицированную и модифицированные кДНК гена Р4НА1.

J) Сравнительный анализ количества белка пролил 4-гидроксилаза альфа 1 в органах и тканях пациента, в частности в коже, после введения генно-терапевтических субстанций, содержащих немодифицированную и модифицированные кДНК гена Р4НА1. Данный анализ проводят, в частности, перед предполагаемой терапией с целью выбора наиболее эффективной для пациента генно-терапевтической субстанции из группы генно-терапевтических субстанций.

Пример 1.

Получение и клонирование немодифицированной кДНК гена Р4НА1.

Немодифицированная кДНК гена Р4НА1 представляет собой последовательность нуклеотидов, которая имеет высокую гомологию с нуклеотидной последовательностью гена и мРНК Р4НА1, приведенной в базе данных GenBank под номером NM_000917; нуклеотиды с 242 по 1846 транслируются в аминокислотную последовательность белка пролил 4-гидроксилазы альфа 1, соответствующую приведенной в GenBank под номером NP_000908.2.

Суммарную РНК получают из клеток человеческой крови с помощью набора PAXGeneBlood RNA Kit (Qiagen, Germany) и используют для получения суммарной кДНК путем обратной транскрипции с помощью обратной транскриптазы RevertAid (ThermoScientific, USA) и случайных 9-нуклеотидных праймеров по методике производителя обратной транскриптазы. Затем, используя суммарную кДНК в качестве матрицы и специфичные, предварительно кинированные праймеры, комплементарные нуклеотидам 162-181 5' GGCGACTGGGGGCTGAAGAG 3' (P4HA1-F1) и 2336-2314 5' AGGGCAATCACATGGAACCCAGT 3' (P4HA1-R1) из последовательности мРНК Р4НА1 (GenBank NM_ NM_000917), получают участок немодифицированной кДНК гена Р4НА1, содержащий кодирующую последовательность белка пролил 4-гидроксилазы альфа 1, и частичные делеции 5'- и 3'-нетранслируемых областей. Полимеразную цепную реакцию (ПЦР) проводят с помощью ДНК-полимеразы Phusion (ThermoScientific, USA), дающей продукты с тупыми концами, на амплификаторе Master CyclerGradient (Eppendorf, USA) в 50 мкл. реакционной смеси, содержащей 0,5 мкл суммарной кДНК первой цепи, по 0,1 мкМ каждого праймера Р4НА1 F1 и Р4НА1 R1, 250 мкМ каждого дезоксинуклеотидтрифосфата (дАТФ, дЦТФ, дТТФ и дГТФ), 100 мМ трис-HCl (рН 8,85 при 20°С), 50 мМ сульфата аммония, 250 мМ хлористого калия, 0,01% Твин-20 и 5 ед. Pfu ДНК-полимеразы (PhusionThermoScientific, USA) при следующих условиях: первоначальная денатурация при +98°С в течение 30 с, 35 циклов, включающих денатурацию при +98°С в течение 10 с, отжиг праймеров при +64°С в течение 30 с и элонгацию при +68°С течение 4 минут.

Продукт амплификации выделяют из агарозного геля с помощью набора QIAquickGelExtractionKit (Qiagen, Germany)

Амплифицированный фрагмент кДНК длиной 2175 н.п., несущий участок немодифицированной кДНК гена Р4НА1, клонируют в плазмидном векторе pUC19 (NEB, USA, кат номер N3041S). ДНК векторной плазмиды pUC19 (NEB, USA, кат. номер N3041S) гидролизуют рестриктазой, дающей тупые концы, например, Smal (NEB, USA) и обрабатывают щелочной фосфатазой. Амплифицированный фрагмент кДНК и линеаризованную плазмиду pUC19 лигируют с помощью ДНК-лигазы фага Т4 400000 ед./мл. (NEB, USA, кат номер M0202S) из расчета 1 мкл фермента на 1 мкг ДНК. Лигирование проводят в объеме 20 мкл в присутствии 2 мМ АТФ, 50 мМ трис -HCl, рН 7,6, 10 мМ MgCl2, 10 мМ DTT в течение 10 ч при +16°С.

Полученной смесью трансформируют компетентные клетки Е.coli Тор 10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки Петри с L-агаром, содержащих 100 мкг/мл ампициллина и по 40 мкл на чашку растворов 100 мМ ИПТГ и 2% X-gal. Отдельные колонии анализируют на наличие вставки с помощью ПЦР с праймерами P4HA1--F1 и P4HA1--R1 и подтверждают секвенированием по методу Сэнгера.

Пример 2.

Получение генетических конструкций с участком немодифицированной кДНК гена Р4НА1

Для экспрессии участка немодифицированной кДНК гена Р4НА1 в клетках органов и тканей человека вариант кДНК гена Р4НА1 по Примеру 1 помещают в векторную плазмиду, при выборе которой используют следующие критерии выбора:

1) плазмида должна обязательно реплицироваться в E.coli, желательно с высокой копийностью;

2) в плазмиде должен быть бактериальный фактор селекции, либо другой фактор селекции не содержащий генов резистентности к антибиотикам;

3) в плазмиде должно быть наличие эукариотических регуляторных элементов - обязательных промотора и терминатора (сигнала полиаденилирования), например, энхансер и интронный(е) элемент(ы);

4) в плазмиде должно быть наличие удобного полилинкера для клонирования.

5) Плазмида может содержать нуклеотидные последовательности с регуляторными элементами для репликации в клетках млекопитающих, например, такие как SV40 ori из вируса обезьян SV40 или ori P/EBNA-1 из вируса Эпштейн-Барра человека.

6) Плазмида также может содержать дополнительные регуляторные элементы, усиливающие трансляцию белка, например, участки связывания с транскрипционным фактором NFkB, обеспечивающим активный транспорт плазмидной ДНК в клеточное ядро для более эффективной транскрипции целевого гена. Примерами таких плазмид могут быть pCMV6-XL5, pCMV6-Kan/Neo (OriGene, USA), VTvaf17 (Cell and Gene Therapy Ltd, UK) или pCDNA 3.1 (+) (ThermoFisherScientific, USA), либо плазмидные векторы вирусного происхождения - например, аденовирус человека 5-го серотипа.

При клонировании участка немодифицированой кДНК гена Р4НА1 в pCDNA 3.1 (+) кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена бычьего гормона роста. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину, и эукариотическим фактором селекции - геном устойчивости к неомицину.

При клонировании участка немодифицированой кДНК гена Р4НА1 в pCMV6-XL5, pCMV6-Kan/Neo кодирующая нуклеотидная последовательность помещается под контроль промотора цитомегаловируса человека CMV, эффективного в эукариотических клетках, и сигнала полиаденилирования гена гормона роста человека. Также данная плазмида обладает бактериальным фактором селекции - геном устойчивости к ампициллину.

При клонировании участка немодифицированной кДНК гена Р4НА1 в VTvaf17 кодирующая нуклеотидная последовательность помещается под контроль промотора гена человеческого фактора элонгации EF1A с собственным энхансером, эффективного в эукариотических клетках и сигнала полиаденилирования гена фактора роста человека. Также данная плазмида обладает фактором селекции, обеспечивающим возможность положительной селекции без использования антибиотиков.

Для получения генетических конструкций с участком немодифицированной кДНК гена Р4НА1 векторную плазмиду pUC19-P4HA1 по Примеру 1 с участком немодифицированной кДНК Р4НА1, содержащим белок-кодирующую область гена Р4НА1 и частичные делеции 5'- и 3'-нетранслируемых областей, используют в качестве матрицы для амплификации со следующими парами праймеров:

Амплификацию проводят при условиях, приведенных в Примере 1. Далее продукты амплификации переосаждают этиловым спиртом, осадки промывают 70% этанолом и растворяют в 1х ТЕ буфере, после чего подвергают рестрикции с эндонуклеазами Kpn I и Eco RV.

Продукты рестрикции разделяют с помощью электрофореза в геле 1% агарозы, окрашивают раствором бромистого этидия и фрагменты ДНК, соответствующие гену-вставке KpnI -Р4НА1-EcoRV, и линеаризованной плазмиде pCMV6-XL5 и pCMV6-Kan/Neo и pCDNA 3.1 (+) вырезают, выделяют из геля с помощью набора для выделения из геля QIAquickGelExtractionKit (Qiagen, Germany) и смешивают. Полученную смесь рестрикционных фрагментов лигируют с помощью ДНК-лигазы фага T4. Лигирование проводят в течение 10-15 мин при комнатной температуре, а затем - при 12°С в течение 10 ч. Лигированную ДНК используют для трансформации клеток Е. coli по стандартной методике с использованием хлористого кальция (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984). Трансформированные клетки отбирают на агаризованной среде LB с ампициллином (100 мкг/мл). Плазмидную ДНК из ампициллин-устойчивых колоний выделяют с помощью набора для выделения плазмид QiagenSpinMiniprepKit (Qiagen, Germany), анализируют с помощью гидролиза рестриктазами KpnI и EcoRV и отбирают генетическую (ие) конструкцию (ии) с помощью секвенирования ДНК генетических конструкций по методу Сэнгера.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Таким образом, получают экспрессионные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), которые содержат нуклеотидную последовательность длиной 1605 н.п., которая включает белок-кодирующую область гена Р4НА1 и не содержит нетранслируемые 5' и 3' области гена с первичной структурой, приведенной на фиг. 1 Seq ID No1.

Пример 3.

Модификации кДНК гена Р4НА1 в генетических конструкциях для получения на их основе генно-терапевтических субстанций.

Модификации Seq ID: 2, 3 проводят таким образом, чтобы не затрагивать первичную структуру белка пролил 4-гидроксилазы альфа 1, а именно, выполняются нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, и, соответственно, не влияющие на кодируемую этой последовательностью аминокислотную последовательность. Модификации Seq ID: 5, 7 проводят таким образом, что, выполняются делеции и/или нуклеотидные замены, приводящие к комбинации вариантов не содержащих аминокислотных замен или обрыва аминокислотной цепи с вариантами, содержащие аминокислотные замены или обрыв аминокислотной цепи, и, соответственно, влияющие на кодируемую этой последовательностью аминокислотную последовательность и затрагивающие первичную структуру белка пролил 4-гидроксилазы альфа 1. Модификации Seq ID: 4, 6 проводят таким образом, что затрагивается первичная структура белка пролил 4-гидроксилазы альфа 1, а именно, выполняются нуклеотидные замены или делеции приводящие к аминокислотным заменам или обрыву аминокислотной цепи, и, соответственно, влияющие на кодируемую этой последовательностью аминокислотную последовательность.

В частности для получения модифицированных кДНК гена Р4НА1 с целью повышения эффективности транскрипции и трансляции белка пролил 4-гидроксилазы альфа 1, в клетках тканей и органов человека в участок немодифицированной последовательности кДНК гена Р4НА1, используя принцип оптимизации кодонов, вносят модификации путем замены минорных кодонов на синонимичные мажорные таким образом, чтобы замены не привели к изменениям в аминокислотной последовательности белка или обрыву аминокислотной цепи при трансляции, не ухудшили процессы транскрипции и трансляции.

Все модификации осуществляют в несколько этапов методом ПЦР мутагенеза набором QuikChP4HA1e II XL kit или QuikChP4HA1e Multi Site-Directed Mutagenesis Kit (AgilentTechnologies, USA,) согласно рекомендациям производителя.

http://www.agilent.com/cs/library/usermanuals/Public/200513.

К плазмидной ДНК, полученной по Примеру 2, в количестве 10-50 нг добавляют 50-100 нг праймера, содержащего необходимую замену, инсерцию или делецию длиной 19-45 н.п. и проводят ПЦР в буфере QuikChP4HA1e Multi reaction buffer (AgilentTechnologies, USA) со смесью ферментов QuikChP4HA1e Multi mix (AgilentTechnologies, USA) при следующих условиях: 95°C, 1 мин; далее от 30 до 35 циклов: 95°С 1 минута, 55°С 1 минута, 65°С 2 минуты/1000 н.п. После проведения ПЦР к амплификационной смеси добавляют 1-2 мкл рестриктазы Dpn I и инкубируют 1-2 часа при 37°С. Полученной смесью трансформируют компетентные клетки E.coli Тор 10 (http://molbiol.ru/protocol/03_04.html), которые высевают на чашки с L-агаром, содержащих 100 мкг/мл ампициллина. Трансформированные колонии анализируют на содержание мутаций секвенированием плазмидной ДНК по методу Сэнгера.

Для получения модифицированной кДНК гена Р4НА1 SEQ ID No 2 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan/Neo-P4HA1 Seq ID No1 и pCDNA 3.1(+)- P4HA1 Seq ID No1 с праймерами, комплементарными участкам немодифицированной кДНК гена Р4НА1, приведенной в GenBank под номером NM_000917:

Р4НА1 476-520 F:

Комплементарный нуклеотидам 476-520, с заменами А>G в позициях 487,502; заменой Т>С в позиции 500 и заменой T>G в позиции 511;

Р4НА1 626-666 F:

Комплементарный нуклеотидам 626-666, с заменой A>G в позиции 646; заменой Т>С в позиции 644 и заменой T>G в позиции 649;

Р4НА1 710-748 F:

Комплементарный нуклеотидам 710-748, с заменой A>G в позиции 727 и заменой G>C в позиции 730;

Р4НА1 774-805 F:

Комплементарный нуклеотидам 774-805, с заменой G>C в позиции 790;

Р4НА1 1009-1142 F:

Комплементарный нуклеотидам 1009-1142, с заменой Т>G в позиции 1123;

Модифицированная таким образом нуклеотидная последовательность кДНК Р4НА1 SEQ ID No: 2 длиной 1605 н.п. содержит 2 нуклеотидных замены G>C в позициях 730,790; 3 нуклеотидных замены T>G в позициях 511, 649, 1123; 4 нуклеотидных замены A>G в позициях 487, 502, 646, 727; 2 нуклеотидных замены Т>С в позициях 500, 644; не приводящие к изменениям в аминокислотной последовательности белка, кодируемого последовательностью гена Р4НА1 и имеет первичную структуру, приведенную на фиг. 2.

Для получения модифицированной кДНК гена Р4НА1 SEQ ID No 3 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan/Neo-P4HA1 Seq ID No1 и pCDNA 3.1(+)- P4HA1 Seq ID No1 с праймерами, комплементарными участкам немодифицированной кДНК гена Р4НА1, приведенной в GenBank под номером NM_000917:

1. Р4НА1 476-520 F:

Комплементарный нуклеотидам 476-520, с заменами А>G в позициях 487,502; заменой Т>С в позиции 500 и заменой T>G в позиции 511;

2. Р4НА1 626-666 F:

Комплементарный нуклеотидам 626-666, с заменой A>G в позиции 646; заменой Т>С в позиции 644 и заменой T>G в позиции 649;

3. Р4НА1 710-748 F:

Комплементарный нуклеотидам 710-748, с заменой A>G в позиции 727 и заменой G>C в позиции 730;

4. Р4НА1 774-805 F:

Комплементарный нуклеотидам 774-805, с заменой G>C в позиции 790;

5. Р4НА1 1009-1142 F:

Комплементарный нуклеотидам 1009-1142, с заменой Т>G в позиции 1123;

6. Р4НА1 1177-1210 F:

Комплементарный нуклеотидам 1177-1210, с заменой T>G в позиции 1192;

7. Р4НА1 1240-1267 F:

Комплементарный нуклеотидам 1240-1267, с заменой T>G в позиции 1249;

8. Р4НА1 1316-1357 F:

Комплементарный нуклеотидам 1316-1357, с заменами A>G в позиции 1327, 1336;

9. Р4НА1 1418-1450 F:

Комплементарный нуклеотидам 1418-1450, с заменой A>G в позиции 1429;

10. Р4НА1 1794-1841 F:

Комплементарный нуклеотидам 1794-1841, с заменой T>G в позиции 1801; с заменой A>G в позиции 1816; с заменой G>C в позиции 1828;

Модифицированная таким образом нуклеотидная последовательность кДНК Р4НА1 SEQ ID No: 3 длиной 1605 н.п. содержит 3 нуклеотидных замены G>C в позициях 730, 790, 1828; 6 нуклеотидных замен T>G в позициях 511, 649, 1123, 1192, 1249, 1801; 8 нуклеотидных замен A>G в позициях 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 нуклеотидных замены Т>С в позициях 500, 644; не приводящие к изменениям в аминокислотной последовательности белка, кодируемого последовательностью гена Р4НА1 и имеет первичную структуру, приведенную на фиг. 3

Для получения модифицированной кДНК гена Р4НА1 SEQ ID No 4 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan/Neo-P4HA1 Seq ID No1 и pCDNA 3.1(+)- P4HA1 Seq ID No1 с синтезированным фрагментом ДНК длиной 182 н.п.:

Модифицированная таким образом нуклеотидная последовательность кДНК Р4НА1 SEQ ID No: 4 длиной 1605 н.п.содержит 28 несинонимических нуклеотидных замен 1324 C>G, 1330 Т>С, 1333 А>С, 1334 G>A, 1336 А>Т, 1337С>Т, 1338 А>С, 1339 Т>А, 1340 G>A, 1345 Т>А, 1346 G>A, 1347 А>Т, 1348 G>A, 1351 Т>А, 1355 A>G, 1357 А>С, 1361 A>G, 1362 C>A, 1363 C>G, 1366 A>G, 1368 C>Т, 1372 G>T, 1379 G>A, 1381 A>T, 1382 T>A, 1383 C>G, 1384 T>C, 1387 G>A, приводящих к 10 аминокислотным заменам и имеет первичную структуру, приведенную на фиг. 4.

Для получения модифицированной кДНК гена Р4НА1 SEQ ID No 5 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan/Neo-P4HA1 Seq ID No1 и pCDNA 3.1(+)- P4HA1 Seq ID No1 сначала с двухцепочечным фрагментом ДНК длиной 182 н.п.

а затем со следующими праймерами:

1. Р4НА1 476-520 F:

Комплементарный нуклеотидам 476-520, с заменами А>G в позициях 487,502; заменой Т>С в позиции 500 и заменой T>G в позиции 511;

2. Р4НА1 626-666 F:

Комплементарный нуклеотидам 626-666, с заменой А>G в позиции 646; заменой Т>С в позиции 644 и заменой T>G в позиции 649;

3. Р4НА1 710-748 F:

Комплементарный нуклеотидам 710-748, с заменой А>G в позиции 727 и заменой G>C в позиции 730;

4. Р4НА1 774-805 F:

Комплементарный нуклеотидам 774-805, с заменой G>C в позиции 790;

5. Р4НА1 1009-1142 F:

Комплементарный нуклеотидам 1009-1142, с заменой Т>G в позиции 1123;

6. Р4НА1 1177-1210 F:

Комплементарный нуклеотидам 1177-1210, с заменой T>G в позиции 1192;

7. Р4НА1 1240-1267 F:

Комплементарный нуклеотидам 1240-1267, с заменой T>G в позиции 1249;

8. Р4НА1 1418-1450 F:

Комплементарный нуклеотидам 1418-1450, с заменой A>G в позиции 1429;

9. Р4НА1 1794-1841 F:

Комплементарный нуклеотидам 1794-1841, с заменой T>G в позиции 1801; с заменой A>G в позиции 1816; с заменой G>C в позиции 1828;

Модифицированная таким образом нуклеотидная последовательность кДНК Р4НА1 SEQ ID No: 5 длиной 1602 н.п. содержит 3 нуклеотидных замены G>C в позициях 730, 790, 1828; 6 нуклеотидных замен T>G в позициях 511, 649, 1123, 1192, 1249, 1801; 6 нуклеотидных замен A>G в позициях 487, 502, 646, 727, 1429, 1816; 2 нуклеотидных замены Т>С в позициях 500, 644; не приводящие к изменениям в аминокислотной последовательности белка, а также 28 несинонимических нуклеотидных замен 1324 C>G, 1330 Т>С, 1333 А>С, 1334 G>A, 1336 А>Т, 13370Т, 1338 А>С, 1339 Т>А, 1340 G>A, 1345 Т>А, 1346 G>A, 1347 А>Т, 1348 G>A, 1351 Т>А, 1355 A>G, 1357 А>С, 1361 A>G, 1362 C>A, 1363 C>G, 1366 A>G, 1368 C>Т, 1372 G>T, 1379 G>A, 1381 A>T, 1382 T>A, 1383 C>G, 1384 T>C, 1387 G>A, приводящих к 10 аминокислотным заменам и имеет первичную структуру, приведенную на фиг. 5.

Для получения модифицированной кДНК гена Р4НА1 SEQ ID No 6 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan/Neo-P4HA1 Seq ID No1 и pCDNA 3.1(+)- P4HA1 Seq ID No1 с синтезированным фрагментом ДНК длиной 90 н.п.:

Модифицированная таким образом нуклеотидная последовательность кДНК Р4НА1 SEQ ID No: 6 длиной 1551 н.п. содержит делецию с 1490 по 1544 н.п. и имеет первичную структуру, приведенную на фиг. 6.

Для получения модифицированной кДНК гена Р4НА1 SEQ ID No 7 проводят последовательный ПЦР-мутагенез на плазмидах pCMV6-XL5-P4HA1 Seq ID No1, pCMV6-Kan/Neo-P4HA1 Seq ID No1 и pCDNA 3.1(+)- P4HA1 Seq ID No1 сначала с двухцепочечным фрагментом ДНК длиной 90 н.п.

а затем с праймерами, комплементарными участкам немодифицированной кДНК Р4НА1, приведенной в GenBank под номером NM_000917:

1. Р4НА1 476-520 F:

Комплементарный нуклеотидам 476-520, с заменами А>G в позициях 487, 502; заменой Т>С в позиции 500 и заменой T>G в позиции 511;

2. Р4НА1 626-666 F:

Комплементарный нуклеотидам 626-666, с заменой А>G в позиции 646; заменой Т>С в позиции 644 и заменой T>G в позиции 649;

3. Р4НА1 710-748 F:

Комплементарный нуклеотидам 710-748, с заменой А>G в позиции 727 и заменой G>C в позиции 730;

4. Р4НА1 774-805 F:

Комплементарный нуклеотидам 774-805, с заменой G>C в позиции 790;

5. Р4НА1 1009-1142 F:

Комплементарный нуклеотидам 1009-1142, с заменой Т>G в позиции 1123;

6. Р4НА1 1177-1210 F:

Комплементарный нуклеотидам 1177-1210, с заменой T>G в позиции 1192;

7. Р4НА1 1240-1267 F:

Комплементарный нуклеотидам 1240-1267, с заменой T>G в позиции 1249;

8. Р4НА1 1316-1357 F:

Комплементарный нуклеотидам 1316-1357, с заменами A>G в позиции 1327, 1336;

9. Р4НА1 1418-1450 F:

Комплементарный нуклеотидам 1418-1450, с заменой A>G в позиции 1429;

10. Р4НА1 1794-1841 F:

Комплементарный нуклеотидам 1794-1841, с заменой T>G в позиции 1801; с заменой A>G в позиции 1816; с заменой G>C в позиции 1828;

Модифицированная таким образом нуклеотидная последовательность кДНК Р4НА1 SEQ ID No: 7 длиной 1551 н.п. содержит 3 нуклеотидных замены G>C в позициях 730,790,1828; 6 нуклеотидных замен T>G в позициях 511, 649, 1123, 1192, 1249, 1801; 8 нуклеотидных замен A>G в позициях 487, 502, 646, 727, 1327, 1336, 1429, 1816; 2 нуклеотидных замены Т>С в позициях 500, 644; делецию с 1490 по 1544 н.п. и имеет первичную структуру, приведенную на фиг. 7.

Таким образом, получают экспрессионные векторы на базе плазмид pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), в которых клонированы участок немодифицированной кДНК гена Р4НА1 (SEQ ID No: 1) и модифицированные нуклеотидные последовательности кДНК гена Р4НА1 (SEQ ID No: 2, 3, 4, 5, 6, 7), кодирующие белок пролил 4- гидроксилазу альфа 1.

Бактерии, содержащие полученные генетические конструкции на базе векторов pCMV6-XL5, pCMV6-Kan/Neo и pCDNA 3.1(+), выращивают на жидкой среде LB с ампициллином, лизируют и выделяют плазмидную ДНК для трансфекции специальным набором для выделения плазмид QiagenMaxiKit для получения соответствующих генно-терапевтических субстанций.

Полученные экспрессионные векторы используют для создания на их основе генно-терапевтических субстанций, которые в дальнейшем применяют для трансфекции эукариотических клеток органов и тканей и/или введения в органы и ткани человека. В качестве контрольных плазмид используют исходный вектор pCMV6 - XL5, (pCMV6-Kan/Neo) или pCDNA 3.1 (+) без вставки кДНК гена Р4НА1.

Пример 4.

Наращивание генетической конструкции в бактериальной культуре.

Для получения препаративных количеств векторной плазмиды, содержащей один из вариантов кДНК гена Р4НА1, полученными конструкциями по примеру 3 трансформируют бактериальные клетки E.coli (Маниатис Т., и др. Молекулярное клонирование. М., Мир, 1984) и выращивают полученные клоны бактерий, содержащие конструкцию, в присутствии бактериального фактора селекции - устойчивости к ампициллину.

Лигазную смесь по примеру 3 используют для трансформации компетентных клеток E.coli штамма XLblue. Предварительный отбор клонов, содержащих вставку кДНК гена Р4НА1 в правильной ориентации и единичной копии, осуществляют путем гидролиза плазмидной ДНК рестриктазами Kpn I и Eco RV и анализа продуктов рестрикции путем электрофореза в 1.2% агарозном геле. Отобранные клоны используют для препаративного наращивания плазмидной ДНК с целью дальнейшей трансфекции в культуры фибробластов (клеток эпителия слизистой оболочки полости рта, или клеток эпителия роговицы глаза и др.).

Для получения препаративных количеств генетических экспрессионных конструкций по Примеру 3 выращивали 20 мл ночной культуры E.coli в LB-среде с 150 мкг/мл ампициллина. Этой культурой инокулировали 500 мл LB-среды с 100 мкг/мл ампициллина, рост осуществляли в шейкере-инкубаторе в течение 16 часов при 37°С и 200 об/мин. Выделение плазмидной ДНК проводили с помощью набора EndoFreePlasmidMaxiKit (Qiagen, Germany). Выход составил 350 мкг ДНК.

Пример 5.

Культивирование эукариотических клеток, например, фибробластов для последующих трансфекции генно-терапевтической субстанцией и анализа экспрессии гена Р4НА1.

Для последующей трансфекции генно-терапевтической субстанцией содержащей один из вариантов кДНК гена Р4НА1 по примеру 3, выращивают первичные культуры фибробластов человека из биоптатов кожи пациентов.

Используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL) берут образец биоптата кожи из зоны, защищенной от действия ультрафиолета, например, за ушной раковиной или с боковой внутренней поверхности в зоне локтевого сустава, объемом не менее 10 куб. мм, массой - не менее 11 мг. Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Выращивание первичной культуры клеток осуществляют на чашках Петри при 37°С в атмосфере, содержащей 5% CO2 в среде DMEM с 10% фетальной телячьей сывороткой и ампициллином 100 Ед/мл. Трипсинизацию и пересев производят каждые 5 дней, для трипсинизации клетки промывали раствором PBS и инкубировали 30 минут при 37°С в растворе, содержащем 0.05% трипсина и 1 мМ ЭДТА. Для нейтрализации трипсина к клеткам добавляли 5 мл культуральной среды и центрифугировали суспензию при 600 об/мин 5 минут. Рост культуры фибробластов после 4-5 пассажей осуществляли в культуральных флаконах емкостью 75 мл в среде, содержащей 10 г/л DMEM, 3.7 г/л Na2CO3, 2.4 г/л HEPES, 10% фетальной сыворотки и 100 Ед/мл ампициллина. Смену культуральной среды осуществляли каждые 2 дня. Общая продолжительность роста культуры не превышала 25-30 дней. Из культуры клеток отбирали аликвоту, содержащую 106 клеток.

Часть культуры фибробластов, предназначенную для выделения РНК с последующим анализом транскрипции гена Р4НА1, центрифугировали при 1000 об/мин 20 минут и дважды отмывали в буферном растворе PBS центрифугированием при 600 об/мин в течение 5 минут. Затем клетки ресуспендировали в 1.5 мл стабилизирующего реагента RNAlater и хранили при 4°С в течение 10 дней для последующего выделения РНК.

Выделение РНК проводили с помощью набора RNeasyMiniKit. (Qiagen, Germany). Выделенную РНК анализировали спектрофотометрически, измеряя соотношение оптической плотности при 260 и 280 нм, а также с помощью капиллярного электрофореза на приборе QIAxcel (Qiagen, Germany), используя картридж RNA Qiality Control. Для дальнейшей работы использовали только те образцы, для которых общее количество выделенной РНК было не менее 50 мкг РНК, соотношение D260: D280 - не менее 1,8, а соотношение полос 28S: 18S на капиллярном электрофорезе - не ниже 1:1.

Синтез суммарной кДНК первой цепи проводили, используя обратную транскриптазу RevertAid (Thermo Scientific, USA), согласно рекомендациям изготовителя. 1-2 мкг суммарной РНК использовали в качестве матрицы для синтеза первой цепи кДНК. В реакционную смесь для проведения обратной транскрипции вносили 100-200 ед. обратной транскриптазы и 10 пМ случайного 9-нуклеотидного праймера.

Пример 6.

Анализ эндогенной экспрессии гена Р4НА1 в культуре первичных фибробластов.

Анализ экспрессии гена Р4НА1 из генома фибробластов проводят с целью последующего корректного определения генно-терапевтического эффекта после трансфекции этих клеток генетическими конструкциями с кДНК гена Р4НА1.

Для анализа используют клеточные линии фибробластов кожи, фибробласты с низкой экспрессией гена Р4НА1 и фибробласты с нормальной экспрессией гена Р4НА1, из которых выделяют РНК по стандартной методике (Маниатис Т. и др. Молекулярное клонирование. М., Мир, 1984).

Выделенную РНК анализируют методом ПЦР в режиме реального времени (SYBR GreenRealTimePCR). Для амплификации кДНК (542-642 н.п.), специфичной для гена Р4НА1, используют прямой праймер Р4НА1 FA1

и обратный праймер Р4НА1 -RA1

Длина продукта амплификации -68 нуклеотид. В качестве референтного гена используют ген бета-2-микроглобулина В2М, уровень экспрессии которого в фибробластах сопоставим с таковым в норме для гена Р4НА1.

ПЦР-амплификацию проводят с помощью набора реагентов SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) или другого набора для ПЦР в режиме реального времени в 20 мкл амплификационной смеси, содержащей: 25 мкл QuantiTect SYBR Green RT-PCR MasterMix, 2,5 mM хлорида магния, по 0,5 мкМ каждого праймера, 5 мкл суммарной РНК. Реакцию осуществляют на амплификаторе CFX96 (Bio-Rad, USA) при следующих условиях: 1 цикл обратной транскрипции при 50°С - 30 минут, денатурация 98°С - 15 мин., затем 40 циклов, включающих денатурацию 94°С -15 с, отжиг праймеров 59°С - 30 с и элонгацию 72°С - 30 с

В качестве положительного контроля используют концентрацию ампликонов, получаемых при ПЦР на матрицах, представляющих собой плазмиды в известных концентрациях, содержащие последовательности кДНК генов Р4НА1 и В2М. В качестве отрицательного контроля используют деионизированную воду (кривые накопления ПЦР продуктов отрицательного и положительных контролей для упрощения визуализации на фигуре 8 не показаны). Количество ПЦР продуктов - кДНК генов Р4НА1 и В2М, полученных в результате амплификации, оценивают в режиме реального времени с помощью программного обеспечения амплификатора Bio-RadCFXManager 2.1.

По итогам анализа экспрессии гена Р4НА1 в разных культурах фибробластов (с низкой экспрессией гена Р4НА1 и с нормальной экспрессией гена Р4НА1) были отобраны клоны от пациентов одного возраста и одного типа старения, в которых количество ПЦР-продукта, соответствующего кДНК гена Р4НА1, была в 10-20 раз ниже таковой кДНК гена В2М. Кривые накопления специфических ПЦР-продуктов приведены на фигуре 8.

Пример 7.

Трансфекция клеточной культуры фибробластов со сниженной экспрессией гена Р4НА1 генно-терапевтической субстанцией с целью подтверждения увеличения экспрессии гена Р4НА1 в культуре данных клеток.

Для оценки эффективности генно-терапевтической субстанции, содержащей немодифицированную кДНК гена Р4НА1 по примеру 2, этой генно-терапевтической субстанцией трансфицируют первичную культуру фибробластов человека со сниженной экспрессией гена Р4НА1, отобранную по примеру 6.

Данную культуру фибробластов выращивают в культуральных флаконах (25 см2) до момента, когда клетки покрывают 50-70% поверхности флакона. Полученные клетки трансфицируют генно-терапевтической субстанцией на основе pCMV6- Р4НА1 SEQ ID No: 1 в присутствии транспортной молекулы (например, дендримера) и вектором pCMV6-XL5 в качестве контроля.

6-луночный планшет с DMEM-средой с 10% фетальной телячьей сывороткой (1.6 мл в лунке) засевали фибробластами из расчета 1-4×105 клеток на лунку. Инкубировали клетки в течение 18 часов при 37°С и в атмосфере, содержащей 5% CO2. Затем 2 мкг плазмидной ДНК растворяли в среде DMEM без сыворотки с буфером Трис-HCl 20 мМ с 1 мМ ЭДТА, рН 7-8 (минимальная концентрация ДНК - 0.1 мкг/мкл). Конечный объем смеси составлял 100 мкл.

В качестве транспортной молекулы использовали раствор дендримера SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия).

Приготовление комплекса ДНК-дендример проводили по методике производителя (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) с некоторыми изменениями: к 15 мкл раствора дендримера (с концентрацией 3 мкг/мкл) добавляли 5 мкл (с концентрацией 0,5 мкг/мкл) раствора плазмидной ДНК и тщательно перемешивали. Затем инкубировали смесь ДНК с дендримером в течение 5-10 минут при температуре 15-25°С.

Из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-дендример, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С и в атмосфере, содержащей 5% CO2, после чего оценивали уровень кДНК гена Р4НА1 и контрольной кДНК гена В2М с помощью амплификации в режиме реального времени как описано в примере 6. Результаты анализа приведены на фигуре 9.

Из графиков следует, что в случае трансфекции вектором без вставки кДНК гена Р4НА1 уровень кДНК гена Р4НА1 в фибробластах не изменился, а в случае трансфекции вектором с кДНК гена Р4НА1 - уровень кДНК фибробластов со сниженной экспрессией гена Р4НА1 многократно увеличился (до уровня выше, чем уровень кДНК гена Р4НА1 в нормальных фибробластах).

Показано, что в клетках трансфицированных генно-терапевтической субстанцией на основе pCMV6- Р4НА1 SEQ ID No: 1 наблюдается усиление экспрессии целевого гена Р4НА1.

Пример 8.

Трансфекция клеточной культуры фибробластов с нормальной экспрессией гена Р4НА1 генно-терапевтической субстанцией с кДНК гена Р4НА1 с целью подтверждения увеличения количества белка пролил 4-гидроксилазы альфа 1 в культуре данных клеток.

Для оценки изменения количества белка пролил 4-гидроксилазы альфа 1, использовали культуру фибробластов кожи человека по Примеру 5, в качестве транспортной молекулы - дендримеры SuperFect Transfection Reagent 6-го поколения (Qiagen, Германия), в качестве контроля - водный раствор дендримеров без плазмидной ДНК (А), векторную плазмиду pCDNA 3.1(+), не содержащую кДНК гена Р4НА1 (В), в качестве трансфицируемых агентов - генно-терапевтическую субстанцию на основе векторной плазмиды pCDNA 3.1(+), содержащую кДНК гена Р4НА1 - pCDNA 3.1 Р4НА1 EQ ID No: 1(C), Приготовление комплекса ДНК-дендример и трансфекцию фибробластов проводили согласно Примеру 7.

После трансфекции к 0,5 мл культуральной жидкости приливали 0,1 мл 1N HCl, тщательно перемешивали и инкубировали 10 минут при комнатной температуре. Затем нейтрализовывали смесь, добавляя 0,1 мл 1.2N NaOH/0.5M HEPES (рН 7-7,6) и тщательно перемешивали.

Отбирали супернатант и использовали его для количественного определения целевого белка. Количественное определение продукта кДНК гена Р4НА1 проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Human Р4НА1 ELISA Kit (MyBioSource, США), согласно методике производителя https://www.mvbiosource.com/imaqes/tds/protocol manuals/000000-799999/MBS763203.pdf

Оптическая плотность измерялась при длине волны 450 нм при помощи автоматического биохимического и иммуноферментного анализатора ChemWell (Awareness TechNology Inc., США) и пропорциональна концентрации белка в пробе. Численное значение концентрации определяется с помощью калибровочной кривой, построенной по калибраторам с известной концентрацией белка гена Р4НА1, входящим в состав набора. Разница между значениями оптической плотности (ОП) калибраторов поставленных в трех повторностях не превышала 10%.

Статистическую обработку полученных результатов, осуществляли с помощью программного обеспечения для статистической обработки и визуализации данных R, версия 3.0.2 (https://www.r-project.org/). Таким образом, показано, что транфекция фибробластов полученной генно-терапевтической субстанцией, несущей кДНК гена Р4НА1, приводит к увеличению количества белка пролил 4-гидроксилазы альфа 1 в клетках фибробластов. Результаты показаны на фигуре 10.

Пример 9.

Введение в кожу человека клеточной культуры фибробластов, трансфицированной генно-терапевтической субстанцией с кДНК гена Р4НА1 с целью подтверждения увеличения после этого количества белка пролил 4-гидроксилазы альфа 1 в биоптате кожи человека.

С целью анализа изменения количества белка пролил 4-гидроксилазы альфа 1 в тканях человека, пациентам в кожу предплечья вводили три варианта культуры аутологичных фибробластов - нетрансфицированных (А), трансфицированных вектором без вставки, например, pCMV6-XL5 (В) и трансфицированных генно-терапевтической субстанцией на основе pCMV6- Р4НА1 SEQ ID No: 7(C) в комбинации с транспортными молекулами - липосомами TRANSFAST ТМ Transfection Reagent (PROMEGA, USA),

Приготовление суспензии липосом проводили по методике производителя (Promega, TransFast Transfection Reagent, Instruction for Use of Product, E2431) с некоторыми изменениями: к 0,4 мг порошка липосом добавляли 0,4 мл стерильной воды степени очистки Nuclease-Free. Суспензию хорошо перемешивали взбалтыванием. Полученный полупродукт суспензии липосом выдерживали в течение 18 часов при температуре - 20°С, затем оттаивали при комнатной температуре, ресуспендировали встряхиванием или на настольном миксере типа «ВОРТЕКС».

Для приготовления комплекса ДНК-липосомы к 400 мкл раствора липосом (с концентрацией 1 мг/мл) добавляли 400 мкл раствора плазмидной ДНК (с концентрацией 150 мкг/мл) и тщательно перемешивали. Затем инкубировали смесь ДНК с липосомами в течение 5-10 минут при температуре 15-25°С и использовали далее в качестве генно-терапевтической субстанции.

Для последующей трансфекции клеток генно-терапевтической субстанцией выращивали первичные культуры фибробластов человека из биоптатов кожи пациентов по примеру 5.

Для трансфекции из лунок планшета с клеточной культурой осторожно отбирали среду (не нарушая клеточного слоя) и промывали клетки 3 мл буфера PBS. К раствору, содержащему комплексы ДНК-липосимы, добавляли 600 мкл среды DMEM с фетальной сывороткой и переносили эту смесь в лунки планшета с клетками. Клетки инкубировали с комплексами 2-3 часа при 37°С и в атмосфере, содержащей 5% CO2. Затем осторожно удаляли среду и промывали клеточный слой 3 мл буфера PBS. Затем добавляли культуральную среду и инкубировали 24-48 часов при 37°С в атмосфере, содержащей 5% CO2.

Часть клеточной культуры центрифугировали при 700 об/мин, дважды отмывали клетки физиологическим раствором, ресуспендировали в физиологическом растворе из расчета 1 млн клеток в 200 мкл и использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Очаги введения культур фибробластов располагались на расстоянии 3-5 см друг от друга.

Определение количества белка пролил 4-гидроксилазы альфа 1 проводили в лизатах биоптатов кожи пациента проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Р4НА1 elisa kit (MyBioSource, США.), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения суспензии фибробластов. Взятие биопсии осуществляли из участков введения суспензии фибробластов, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (MedaxSRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Объем биопсийного образца - не менее 10 куб. мм, массой - не менее 11 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид, и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Как видно из фигуры 11, в коже пациента в области введения фибробластов, трансфицированных генно-терапевтической субстанцией на основе pCMV6- Р4НА1 SEQ ID No: 7, произошло увеличение количества белка пролил 4- гидроксилазы альфа 1, что может свидетельствовать об усилении экспрессии гена Р4НА1. Тогда как при введении контрольных культур фибробластов (нетрансфицированных и трансфицированных вектором без вставки кДНК гена Р4НА1 pCMV6-XL5) количество пролил 4-гидроксилазы альфа 1, в коже не изменялась.

Таким образом, показана эффективность генно-терапевтической субстанции при введении в кожу человека клеточной культуры фибробластов, трансфицированных полученной генно-терапевтической субстанцией, несущей модифицированную кДНК гена Р4НА1, что приводит к повышению уровня экспрессии гена Р4НА1, а именно - к увеличению количества белка пролил 4- гидроксилазы альфа 1 в коже в зоне введения.

Пример 10.

Трансфекция культур фибробластов из биоптатов группы различных пациентов генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена Р4НА1 и участок немодифицированной кДНК гена Р4НА1.

С целью подтверждения индивидуального характера увеличения экспрессии гена Р4НА1 до различного уровня при трансфекции клеточных культур фибробластов пациентов генно-терапевтическими субстанциями с модифицированными кДНК гена Р4НА1 и участком немодифицированной кДНК гена Р4НА1 анализировали количественный уровень белка пролил 4-гидроксилазы альфа 1 в клеточных лизатах фибробластов, трансфицированных разными генно-терапевтическими субстанциями по примеру 3, содержащими модифицированные кДНК гена Р4НА1 и участок немодифицированной кДНК гена Р4НА1 в группе пациентов в зависимости от наличия и типа модификаций в кДНК гена Р4НА1.

Последовательности участка немодифицированной кДНК гена Р4НА1 приведена на фигуре 1, SEQ ID No: 1., последовательности модифицированных кДНК гена Р4НА1 приведены на фигурах 2-7 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7).

Вырастили культуры фибробластов из однотипных биоптатов кожи, отобранных из зоны внутренней боковой поверхности в зоне локтевого сустава 28 пациентов, выбранных случайным образом по примеру 5, отобрали аликвоты и оценили уровень белка пролил 4-гидроксилазы альфа 1, в клеточных лизатах. Клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 MMNaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин, концентрацию белка в супернатанте определяли методом Брэдфорда ([Bradford М.М. (1976) Anal. Biochem. 72: 248-254.]).

Затем каждую из 18-ти культур фибробластов разделили на 8 частей. Одну часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 1, содержащей немодифицированную кДНК гена Р4НА1 (SEQ ID No: 1.) по примеру 2 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 2, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

3-ю часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 3, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

4-ю часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 4, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

5-ю часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 5, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

6-ю часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 6, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

7-ю часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 7, содержащей вариант модифицированную кДНК гена Р4НА1 (SEQ ID No: 7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

8-ю часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена Р4НА1 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Количественное определение продукта кДНК гена Р4НА1 проводили методом твердофазного иммуноферментного анализа (ELISA), используя набор Human Р4НА1 ELISA Kit (MyBioSource, США), как описано в Примере 8.

По итогам определения количественного уровня белка пролил 4-гидроксилазы альфа 1 выбрали показатели, касательно каждой части клеточной культуры от каждого пациента, продемонстрировавшие наибольшие количественные уровни белка и объединили их в семь групп, исходя из следующего критерия:

В группе 1 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при трансфекции немодифицированной кДНК гена Р4НА1 SEQ ID No: 1. В эту группу вошло 7 культуры из 28.

В группе 2 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при трансфекции модифицированной кДНК гена Р4НА1 SEQ ID No: 2. В эту группу вошло 3 культуры из 28.

В группе 3 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при трансфекции модифицированной кДНК гена Р4НА1 SEQ ID No: 3. В эту группу вошло 6 культуры из 28.

В группе 4 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при трансфекции модифицированной кДНК гена Р4НА1 SEQ ID No: 4. В эту группу вошли 4 культуры из 28.

В группе 5 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при трансфекции модифицированной кДНК гена Р4НА1 SEQ ID No: 5. В эту группу вошло 3 культуры из 28.

В группе 6 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при трансфекции модифицированной кДНК гена Р4НА1 SEQ ID No: 6. В эту группу вошли 3 культуры из 28.

В группе 7 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при трансфекции модифицированной кДНК гена Р4НА1 SEQ ID No: 7. В эту группу вошло 2 культуры из 28.

Ни в одной из клеточных культур, трансфицированных генно-терапевтической субстанцией с векторной плазмидой, не содержащей кДНК гена Р4НА1 не был обнаружен наибольший количественный уровень белка пролил 4-гидроксилазы альфа 1, в отличие от клеточных культур, трансфицированных генно-терапевтическими субстанциями с генетическими конструкциями, содержащими кДНК гена Р4НА1.

На фигуре 12 для каждой группы клеточных культур приведены диаграммы показателей количества белка пролил 4-гидроксилазы альфа 1, (усредненных в рамках группы, в случае, если в группу входит более одной клеточной культуры) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после трансфекции этих клеточных культур генно-терапевтическими субстанциями, содержащими модифицированные и участок немодифицированной кДНК гена Р4НА1.

Из данного примера следует, что достижение наибольшего количества белка пролил 4-гидроксилазы альфа 1 в культурах фибробластов кожи различных пациентов при их трансфекции генно-терапевтическими субстанциями, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена Р4НА1, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет наибольшей эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 11.

Трансфекции клеточной культуры кератоцитов и эпителиальных клеток глаза генно-терапевтической субстанцией без транспортной молекулы с целью подтверждения при этом увеличения экспрессии гена Р4НА1 в данных культурах клеток.

С целью выяснения эффективности генно-терапевтической субстанции, содержащей кДНК Р4НА1, в различных типах клеток, трансфицировали кератоциты и эпителиальные клетки роговицы человека, без использования транспортных молекул.

Биопсийный материал из области лимба в виде круга диаметром 1-1.5 мм помещали в чашку Петри в сбалансированный солевой раствор Хэнкса, добавляли диспазу (20 мкл 25 ед/мл) и гентамицин и инкубировали 24 часа при +4. Затем отделяли эпителиальный слой от стромы и нарезали обе ткани кусочками 1-2 мм3.

Суспензию эпителиальных клеток получали путем инкубирования кусочков тканей в растворе Трипсин-ЭДТА в течение 15 минут при +37°С. Трипсинизацию останавливали добавлением соевого ингибитора трипсина в PBS. Клеточные суспензии отмывали центрифугированием при 700 об/мин и ресуспендировали в бессывороточной среде DMEM с гентамицином. Клетки растили в 25 см2 флаконах с 5 мл среды при 37°С и в атмосфере, содержащей 5% СО2. Через 24 часа среду с не прикрепившимися клетками удаляли и добавляли 5 мл свежей среды. Пересев производили каждые 7 дней в соотношении 1:2 - 1:3.

Суспензию кератоцитов получали путем инкубирования в среде RPMI-1640 с коллагеназой 300 ед/мл в течение 2 часов. Затем отмывали клетки и ресуспендировали в среде DMEM с 20% телячьей сывороткой и антибиотиком-антимикотиком. Клетки растили в 25 см2 флаконах с 1 мл среды при +37°С и в атмосфере, содержащей 5% CO2. Пересев производили каждые 7 дней в соотношении 1:4.

Поскольку эффективность трансфекции кератоцитов низкая, использовали генно-терапевтическую субстанцию на основе плазмиды pCMV6-Kan/Neo Р4НА1 SEQ ID No: 2, содержащую дополнительный фактор селекции - ген neor, придающий устойчивость к антибиотику генетицину.

Генно-терапевтическую субстанцию добавляли к клеткам и инкубировали клетки 1 час при 37оС. После инкубации добавляли бессывороточную среду DMEM к эпителиальным клеткам и среду DMEM, содержащую 10% фетальной телячьей сыворотки к кератоцитам и продолжали инкубировать 24 часа. После 24-часового инкубирования клетки высевали в новую среду DMEM, содержащую 400 μg/mL фактора селекции - антибиотика G418 (Geneticin). Выжившие клетки культивировали в течение 2 недель в 25 см3 флаконах с 5 мл среды с G418. Всего выращивали 24 образца культур эпителиальных клеток и 24 образца культур кератоцитов.

Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК проводили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК гена Р4НА1 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-RadUSA) и программное обеспечение Bio-RadCFXManager 2.1. Наибольшее увеличение экспрессии (транскрипции) гена Р4НА1 наблюдали на 3 сутки для эпителиальных клеток и на 5 сутки - для кератоцитов.

На фигуре 13 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена Р4НА1, в кератоцитах и эпителиальных клетках роговицы.

Показано, что в кератоцитах и эпителиальных клетках роговицы человека, трансфицированных генно-терапевтической субстанцией на основе pCMV6- Kan/Neo Р4НА1 SEQ ID No: 2, без транспортной молекулы, наблюдается усиление экспрессии целевого гена Р4НА1.

Пример 12.

Трансфекции клеточной культуры хондробластов генно-терапевтической субстанцией с целью подтверждения при этом увеличения экспрессии гена Р4НА1 в данных культуре клеток.

С целью выяснения эффективности генно-терапевтической субстанции, содержащей кДНК гена Р4НА1, в различных типах клеток, а также с целью оценки влияния транспортной молекулы на успешность трансфекции этой субстанцией - трансфицировали хондробласты человека, используя в качестве транспортной молекулы амфифильные блок-сополимеры.

Биоптаты хрящевой ткани массой 50-150 мг измельчали на фрагменты до 10 мм3 и инкубировали в буферном растворе с коллагеназой II, гиалуронидазой и трипсином в течение 48 часов при +37°С. Клетки отмывали бессывороточной средой DMEM, ресуспендировали в той же среде с гентамицином и выращивали при +37°С и в атмосфере, содержащей 5% CO2 во флаконах 75 см2 с 15 мл среды. Рост осуществлялся в бессыворотчной среде, так как в монослойной культуре хондроциты меняют форму и биохимические свойства. Пересев производили каждые 4 дня в соотношении 1:3, клетки снимали с поверхности флакона раствором трипсин-ЭДТА с 0.02% раствором Версена.

Для трансфекции клеток генно-терапевтической субстанцией содержащей кДНК гена Р4НА1 использовали амфифильные блок-сополимеры. Применяли методику по (IntJPharm, 2012, 427, 80-87) или в (Macromol. Biosci. 2011, 11, 652-661), с некоторыми изменениями. Блок-сополимер синтезировали из смеси линейного полиэтиленимина (ПЭИ) (Polyscience Inc., США) и бифункционального полиэтиленгликоля (ПЭГ) N-гидроксисукцинимидил-75-N-(3-малеимидопропионил)-амидо-4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73 - тетракосаоксапента-гептаконтаноата (MAL-dPEG™-NHS ester, Quanta BioDesign, Ltd., США) в боратном буфере. Полиплекс готовили за 1 час до введения в клетки, смешивая раствор блок-сополимера с ДНК генетической конструкции pCMV6- Kan/Neo P4HA1SEQ ID No: 3 с модифицированной кДНК P4HA1SEQ ID No: 3. Смесь для трансфекции добавляли к суспензии клеток в 1 мл культуральной среды DMEM с 10% фетальной сывороткой и ампициллином.

Так как для трансфекции использовали конструкцию, содержащую фактор селекции (устойчивость к генетицину), то клетки после трансфекции выращивали в 25 см3 флаконах с 5 мл среды с генетицином в течение 12 дней, меняя среду каждые 4 дня. Каждые 24 часа из каждой культуры отбирали аликвоту по 500 мкл суспензии с целью выделения РНК и анализа уровня специфической кДНК. Выделение РНК производили с помощью набора RNeasyMiniKit (Qiagen, Germany). Образцы РНК были сгруппированы в 3 группы по 8 образцов с близкой концентрацией и объединены. Анализ уровня специфической кДНК Р4НА1 проводили с помощью амплификации в режиме реального времени по методике и с праймерами по примеру 6, используя набор реагентов iTaqUniversalSYBRGreenSupermix (Bio-Rad, USA), амплификатор CFX96 (Bio-Rad, USA) и программное обеспечение Bio-RadCFXManager 2.1. Наибольшее увеличение транскрипции Р4НА1 наблюдали на 5 сутки. На фигуре 14 приведены кривые накопления специфического продукта амплификации, соответствующего кДНК гена Р4НА1.

Показано, что в хондробластах трансфицированных генно-терапевтической субстанцией на основе pCMV6- Kan/Neo P4HA1SEQ ID No: 3, используя в качестве транспортной молекулы амфифильные блок-сополимеры, наблюдается усиление экспрессии целевого гена Р4НА1.

Пример 13.

Введение в кожу человека генно-терапевтической субстанции с кДНК гена Р4НА1 с целью подтверждения при этом увеличения количества белка пролил 4-гидроксилазы альфа 1 в коже человека.

С целью анализа увеличения количественного уровня белка пролил 4-гидроксилазы альфа 1 пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена Р4НА1 (В) с транспортной молекулой и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена Р4НА1 с транспортной молекулой (А) - в кожу предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANS FAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6 Р4НА1 SEQ ID No: 4, которая содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 4) и плазмиду pCMV6-XL5, используемую в качестве плацебо - которая не содержит кДНК гена Р4НА1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,3 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 3-5 см друг от друга.

Количество белка пролил 4-гидроксилазы альфа 1 оценивали в лизатах биоптатов кожи пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Р4НА1 ELISA Kit (MyBioSource, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков кожи в зоне введения генно-терапевтической субстанции и плацебо, а также из интактной кожи, используя устройство для взятия биопсии Epitheasy 3.5 (Medax SRL) далее, как описано в примере 9.

Показано, что в коже пациента в области введения генно-терапевтической субстанции с кДНК гена Р4НА1, произошло увеличение количества белка пролил 4-гидроксилазы альфа 1, тогда как при введении плацебо, количество белка пролил 4-гидроксилазы альфа 1 в коже не изменялась. Результат свидетельствует об усилении экспрессии гена Р4НА1 при использовании генно-терапевтической субстанции с кДНК гена Р4НА1 и соответственно - об эффективности генно-терапевтической субстанции с кДНК гена Р4НА1. Результаты отражены на фигуре 15.

Пример 14.

Введение в хрящевую ткань человека генно-терапевтической субстанции с кДНК гена Р4НА1 с целью подтверждения при этом увеличения количества белка пролил 4-гидроксилазы альфа 1 в хрящевой ткани человека.

С целью анализа изменения количества белка пролил 4-гидроксилазы альфа 1 пациентам вводили генно-терапевтическую субстанцию, содержащую генетическую конструкцию с кДНК гена Р4НА1 (В) с транспортной молекулой и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена Р4НА1 с транспортной молекулой (А) - в хрящевую ткань ушных раковин с тыльной стороны.

Генетическую конструкцию pCDNA 3.1 Р4НА1 SEQ ID No: 5, которая содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 5), и плазмиду pCDNA 3.1, используемую в качестве плацебо, которая не содержит кДНК гена Р4НА1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free. В качестве транспортной системы использовали transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France- USA). Для получения генно-терапевтических субстанций готовили комплексы ДНК- cGMP grade in-vivo-jetPEI в соответствие с рекомендациями производителя.

Расчет количества реагента осуществляли по формуле, предложенной производителем:

V(мкл)=(pDNA (мкг)×3×N/Р)/150

где N/P - соотношение между количеством азотистых остатков в jetPEI и количеством фосфатных групп нуклеиновых кислот. В данном эксперименте было использовано соотношение N/P=6, то есть на 20 мкг pDNA - 2,4 мкл jetPEI.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 1-2 мм в хрящевую ткань ушных раковин с тыльной стороны. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,2 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 2-3 см друг от друга.

Количество белка пролил 4- гидроксилазы альфа 1 оценивали в лизатах биоптатов хрящевой ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Р4НА1 ELISA Kit (MyBioSource, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков хрящевой ткани в зоне введения генно-терапевтической субстанции, а также из интактных участков и в зоне введения плацебо, методом чрескожной пункционного биопсии при помощи одноразовой ручной биопсийной иглы, далее по примеру 9.

Показано, что в хрящевой ткани пациента в области введения генно-терапевтической субстанции с кДНК гена Р4НА1, произошло увеличение количества белка пролил 4-гидроксилазы альфа 1, тогда как при введении плацебо количество белка пролил 4-гидроксилазы альфа 1 в хрящевой ткани не изменялось. Результат свидетельствует об усилении экспрессии гена Р4НА1 при использовании генно-терапевтической субстанции с кДНК гена Р4НА1 и соответственно - об эффективности генно-терапевтической субстанции с кДНК гена Р4НА1. Результаты отражены на фигуре 16.

Пример 15.

Введение в мышечную ткань человека генно-терапевтической субстанции с кДНК гена Р4НА1 с целью подтверждения при этом увеличения количества белка пролил 4-гидроксилазы альфа 1 в мышечной ткани человека.

С целью анализа изменения количества белка пролил 4-гидроксилазы альфа 1 пациентам вводили генно-терапевтическую субстанцию, содержащую векторную плазмиду с кДНК гена Р4НА1 (В) с транспортной молекулой и параллельно вводили плацебо, представляющее собой комбинацию векторной плазмиды не содержащей кДНК гена Р4НА1 с транспортной молекулой (А) - в мышечную ткань в зоне предплечья.

В качестве транспортной молекулы использовали порошок липосом TRANSFAST ТМ Transfection Reagent (PROMEGA, USA) по примеру 9. Далее генетическую конструкцию pCMV6-Kan/Neo Р4НА1 SEQ ID No: 6, которая содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 6), и плазмиду pCMV6-Kan/Neo, используемую в качестве плацебо, которая не содержит кДНК гена Р4НА1, каждую из которых растворяли в стерильной воде степени очистки Nuclease-Free.

Для получения генно-терапевтических субстанций готовили комплексы ДНК-липосомы по примеру 9.

Полученные генно-терапевтическую субстанцию и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 15-20 мм. Объем вводимого раствора генно-терапевтической субстанции и плацебо - около 0,5 мл для каждого. Очаги введения генно-терапевтической субстанции и плацебо располагались на расстоянии 5-7 см друг от друга

Количество белка пролил 4-гидроксилазы альфа 1 измеряли в лизатах биоптатов мышечной ткани пациента методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Р4НА1 ELISA Kit (MyBioSource, США), как описано в Примере 8.

Биопсийные образцы брали на 3 сутки после введения генно-терапевтической субстанции. Взятие биопсии осуществляли из участков мышечной ткани в зоне введения генно-терапевтической субстанции, а также из интактных участков мышцы и в зоне введения плацебо, используя автоматическое устройство для взятия биопсии MAGNUM (компания BARD, USA), далее по примеру 9.

Показано, что, в мышечной ткани пациента в области введения генно-терапевтической субстанции с кДНК гена Р4НА1, произошло увеличение количества белка пролил 4-гидроксилазы альфа 1, тогда как при введении плацебо количество белка пролил 4-гидроксилазы альфа 1 в мышечной ткани не изменялось. Результат свидетельствует об усилении экспрессии гена Р4НА1 при использовании генно-терапевтической субстанции с кДНК гена Р4НА1 и соответственно - об эффективности генно-терапевтической субстанции с кДНК гена Р4НА1. Результаты отражены на фигуре 17

Пример 16.

Введение группе различных пациентов генно-терапевтических субстанций содержащих модифицированные кДНК гена Р4НА1 и участок немодифицированной кДНК гена Р4НА1.

С целью подтверждения индивидуального характера увеличения уровня экспрессии целевого гена Р4НА1 до различного уровня при введении в кожу пациентов генно-терапевтических субстанций с модифицированными и немодифицированной кДНК гена Р4НА1 анализировали уровень количества белка пролил 4-гидроксилазы альфа 1 в лизате биоптатов кожи группы пациентов в зависимости от наличия и типа модификаций в кДНК гена Р4НА1.

Последовательность участка немодифицированной кДНК гена Р4НА1 приведена на фигуре 1, SEQ Р4НА1 ID No: 1, последовательности модифицированных кДНК гена Р4НА1 приведены на фигурах 2-7 (SEQ Р4НА1 ID No: 2, SEQ Р4НА1 ID No: 3, SEQ P4HA1 ID No: 4, SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

При этом генетические конструкции, одна из которых содержит участок немодифицированной кДНК гена Р4НА1 (SEQ ID No: 1), вторая генетическая конструкция содержит участок модифицированной кДНК гена Р4НА1 (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 4), пятая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 7), восьмая генетическая конструкция (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК в сочетании с транспортными молекулами - липосомами по примеру 9.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения в кожу пациентам. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Каждому из 24-х пациента, которые были отобраны в случайном порядке, вводили 7 генно-терапевтических субстанций и плацебо в кожу предплечья.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи, используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Объем каждого биопсийного образца - не менее 10 куб. мм, масса - не менее 11 мг. Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

А - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 1, содержащий немодифицированную кДНК гена Р4НА1 (SEQ ID No: 1.) по примеру 2 в сочетании с транспортными молекулами - липосомами по примеру 9.

В - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 2, содержащий модифицированную кДНК гена Р4НА1 (SEQ ID No: 2.) по примеру 3 в сочетании с транспортными молекулами -липосомами по примеру 9.

С - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 3, содержащий модифицированную кДНК гена Р4НА1 (SEQ ID No: 3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

D - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 4, содержащий модифицированную кДНК гена Р4НА1 (SEQ ID No: 4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Е - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 5, содержащий модифицированную кДНК гена Р4НА1 (SEQ ID No: 5) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

F - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 6, содержащий модифицированную кДНК гена Р4НА1 (SEQ ID No: 6) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

G - биоптат, полученный после введения генно-терапевтической субстанции на базе pCMV6- SEQ ID No: 7, содержащий модифицированную кДНК гена Р4НА1 (SEQ ID No: 7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Н - биоптат, полученный после введения векторной плазмиды pCMV6-XL5, не содержащей кДНК гена Р4НА1 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Количество белка пролил 4-гидроксилазы альфа 1 определяли в девяти биоптатах кожи от каждого пациента (от А до Н и в биоптате интактной кожи) через 72 часа после введения генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Р4НА1 ELISA Kit (MyBioSource, США), как описано в Примере 8.

По итогам количественного анализа белка пролил 4-гидроксилазы альфа 1, выбрали показатели, касательно каждого биоптата от каждого пациента, продемонстрировавшие наибольшие уровни количества белка пролил 4-гидроксилазы альфа 1 и объединили их в семь групп, исходя из следующего критерия:

В группе 1 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при введении немодифицированной кДНК гена Р4НА1 SEQ ID No: 1. В эту группу вошел 3 биоптат из 24.

В группе 2 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при введении модифицированной кДНК гена Р4НА1 SEQ ID No: 2. В эту группу вошли 3 биоптата из 24.

В группе 3 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при введении модифицированной кДНК гена Р4НА1 SEQ ID No: 3. В эту группу вошли 4 биоптата из 24

В группе 4 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при введении модифицированной «ДНК гена Р4НА1 SEQ ID No: 4. В эту группу вошли 4 биоптата из 24.

В группе 5 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при введении модифицированной кДНК гена Р4НА1 SEQ ID No: 5. В эту группу вошли 3 биоптата из 24

В группе 6 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при введении модифицированной кДНК гена Р4НА1 SEQ ID No: 6. В эту группу вошли 4 биоптата из 24.

В группе 7 наибольшее количество белка пролил 4-гидроксилазы альфа 1, наблюдалось при введении модифицированной кДНК гена Р4НА1 SEQ ID No: 7. В эту группу вошли 3 биоптата из 24.

Ни в одном из биоптатов, в которые были введены генно-терапевтические субстанции плацебо - векторной плазмидой, не содержащей кДНК гена Р4НА1, не была обнаружено наибольшее количество белка пролил 4-гидроксилазы альфа 1, в отличие от биоптатов, в которые были введены генно-терапевтические субстанции с генетическими конструкциями, содержащими кДНК гена Р4НА1.

На фигуре 18 для каждой группы биоптатов приведены диаграммы показателей концентраций белка (усредненных в рамках группы, в случае, если в группу входит более одного биоптата) применительно ко всем, участвующим в эксперименте генно-терапевтическим субстанциям, после введения пациентам этих генно-терапевтических субстанций, содержащих модифицированные и участок немодифицированной кДНК гена Р4НА1.

Из данного примера следует, что достижение наибольшего уровня количества белка пролил 4-гидроксилазы альфа 1 в биоптатах кожи различных пациентов при введении им в кожу генно-терапевтических субстанций, связано с индивидуальными особенностями пациентов и зависит от наличия и типа модификаций в кДНК гена Р4НА1, входящих в генно-терапевтические субстанции.

Каждая генно-терапевтическая субстанция из группы генно-терапевтических субстанций является эффективной в некоторой значительной группе пациентов. Следовательно, для выбора наиболее эффективной генно-терапевтической субстанции из группы генно-терапевтических субстанций для терапевтических целей необходимо предварительное персонализированное исследование биоптатов пациента, либо клеток, выращенных из этих биоптатов на предмет наибольшей эффективности терапевтического воздействия, созданных генно-терапевтических субстанций в рамках группы генно-терапевтических субстанций.

Пример 17.

Трансфекция клеточной линии фибробластов пациента разными генно-терапевтическими субстанциями, содержащими модифицированные кДНК гена Р4НА1 и участок немодифицированной кДНК гена Р4НА1 с целью персонализированного выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующей трансфекции этой субстанцией клеток пациента в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка пролил 4-гидроксилазы альфа 1, в клеточных лизатах фибробластов этого пациента, трансфицированных разными генно-терапевтическими субстанциями, содержащими участок немодифицированной кДНК гена Р4НА1 и/или модифицированные кДНК гена Р4НА1.

Последовательность участка немодифицированной кДНК гена Р4НА1 приведена на фигуре 1, SEQ Р4НА1 ID No: 1, последовательности модифицированных кДНК гена Р4НА1 приведены на фигурах 2-7 (SEQ Р4НА1 ID No: 2, SEQ Р4НА1 ID No: 3, SEQ P4HA1 ID No: 4, SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

Культуры фибробластов из биоптата пациента вырастили по примеру 5, отобрали аликвоты и провели клеточный лизис: клеточный осадок, соответствующий 2×106 клеток, промывали фосфатным буфером и ресуспендировали во льду в лизирующем буфере, содержащем 25 мМ ХЕПЕС рН 7.9, 100 мМ NaCl, 1 мМ ЭДТА, 1% Тритон Х-100, 10% глицерин и 1 мМ фенилметилсульфонилфторид. Лизат центрифугировали 5 минут при 14000 об/мин.

Затем культуру фибробластов пациента разделили на 8 частей. Первую часть, обозначенную (А), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 1, содержащей участок немодифицированной кДНК гена Р4НА1 (SEQ ID No: 1.) по примеру 2 в сочетании с транспортными молекулами - липосомами по примеру 9.

Вторую часть, обозначенную (В), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 2, содержащей участок модифицированной кДНК гена Р4НА1 (SEQ ID No: 2.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Третью часть, обозначенную (С), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 3, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 3.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Четвертую часть, обозначенную (D), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 4, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 4.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Пятую часть, обозначенную (Е), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 5, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 5.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Шестую часть, обозначенную (F), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 6, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 6.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Седьмую часть, обозначенную (G), трансфицировали по примеру 7 генно-терапевтической субстанцией на базе вектора pCMV6- SEQ ID No: 7, содержащей модифицированную кДНК гена Р4НА1 (SEQ ID No: 7.) по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Восьмую часть, обозначенную (Н), трансфицировали по примеру 7 векторной плазмидой pCMV6-XL5, не содержащей кДНК гена Р4НА1 по примеру 3 в сочетании с транспортными молекулами - липосомами по примеру 9.

Определение количества белка пролил 4-гидроксилазы альфа 1, в клеточных лизатах фибробластов пациента проводили через 72 часа после трансфекции методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Р4НА1 ELISA Kit (MyBioSource, США), как описано в Примере 8.

По итогам определения количества белка пролил 4-гидроксилазы альфа 1, в культуре фибробластов пациента выделили вариант генно-терапевтической субстанции, при трансфекции которой наблюдается наибольшее количество белка пролил 4-гидроксилазы альфа 1 в лизате клеточной культуры, что в итоге свидетельствует о наибольшей экспрессии гена Р4НА1. В данном эксперименте наибольшее количество белка пролил 4-гидроксилазы альфа 1 в лизате отмечена при трансфекции генно-терапевтической субстанцией на базе pCMV6 Р4НА1 SEQ ID No: 3, содержащей немодифицированную кДНК гена Р4НА1, что показано на фигуре 19.

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для последующей трансфекции клеток пациента в рамках терапевтической процедуры.

Пример 18.

Введение в кожу пациента различных генно-терапевтических субстанций, содержащих модифицированные кДНК гена Р4НА1 и участок немодифицированной кДНК гена Р4НА1 с целью выбора из группы генно-терапевтических субстанций наиболее эффективной генно-терапевтической субстанции применительно к данному пациенту для последующего введения этой субстанции пациенту в рамках терапевтической процедуры.

С целью определения наиболее эффективной применительно к конкретному пациенту генно-терапевтической субстанции анализировали количество белка пролил 4-гидроксилазы альфа 1, в лизатах биоптатов кожи этого пациента, после введения ему в кожу генно-терапевтических субстанций, содержащих модифицированные кДНК гена Р4НА1 и/или участок немодифицированной кДНК гена Р4НА1.

Последовательность участка немодифицированной кДНК гена Р4НА1 приведена на фигуре 1, SEQ Р4НА1 ID No: 1, последовательности модифицированных кДНК гена Р4НА1 приведены на фигурах 2-7 (SEQ Р4НА1 ID No: 2, SEQ Р4НА1 ID No: 3, SEQ P4HA1 ID No: 4, SEQ P4HA1 ID No: 5, SEQ P4HA1 ID No: 6, SEQ P4HA1 ID No: 7).

Пациенту вводили 7 генно-терапевтических субстанций и плацебо в кожу предплечья.

Первая генно-терапевтическая субстанция (А) на базе pCMV6- SEQ ID No: 1, содержащая участок немодифицированной кДНК гена Р4НА1 (SEQ ID No: 1.) по примеру 2 в сочетании с транспортной молекулой - дендримером по примеру 7.

Вторая генно-терапевтическая субстанция (В) на базе pCMV6-SEQ ID No: 2, содержащая модифицированную кДНК гена Р4НА1 (SEQ ID No: 2.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Третья генно-терапевтическая субстанция (С) на базе pCMV6-SEQ ID No: 3, содержащая модифицированную кДНК гена Р4НА1 (SEQ ID No: 3.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Четвертая генно-терапевтическая субстанция (D) на базе pCMV6- SEQ ID No: 4, содержащая модифицированную кДНК гена Р4НА1 (SEQ ID No: 4.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Пятая генно-терапевтическая субстанция (Е) на базе pCMV6-SEQ ID No: 5, содержащая модифицированную кДНК гена Р4НА1 (SEQ ID No: 5.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Шестая генно-терапевтическая субстанция (F) на базе pCMV6- SEQ ID No: 6, содержащая модифицированную кДНК гена Р4НА1 (SEQ ID No: 6.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Седьмая генно-терапевтическая субстанция (G) на базе pCMV6- SEQ ID No: 7, содержащая модифицированную кДНК гена Р4НА1 (SEQ ID No: 7.) по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

Восьмая векторная плазмида pCMV6-XL5, не содержащая кДНК гена Р4НА1 по примеру 3 в сочетании с транспортной молекулой - дендримером по примеру 7.

При этом генетические конструкции, одна из которых содержит участок немодифицированной кДНК гена Р4НА1 (SEQ ID No: 1), вторая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 2), третья генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 3), четвертая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 4), пятая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 5), шестая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 6), седьмая генетическая конструкция содержит модифицированную кДНК гена Р4НА1 (SEQ ID No: 7), восьмая плазмида (плацебо), представляет собой вектор pCMV6 XL5, растворяли в стерильной воде степени очистки Nuclease-Free. Для получения генно-терапевтических субстанций готовили комплексы ДНК-дендример по примеру 7.

Полученные семь вариантов генно-терапевтических субстанций и плацебо использовали для введения пациенту. Введение осуществляли тоннельным методом иглой 30G на глубину 3 мм. Объем вводимого раствора каждой генно-терапевтической субстанции составлял около 0,3 мл. Очаги введения генно-терапевтических субстанций и плацебо располагались на расстоянии 3-5 см друг от друга.

Биопсийные образцы брали через 72 часа после введения генно-терапевтических субстанций. Взятие биопсии осуществляли из участков введения генно-терапевтических субстанций, плацебо, а также из интактной кожи используя устройство для взятия биопсии кожи Epitheasy 3.5 (Medax SRL). Кожу пациента предварительно промывали стерильным физиологическим раствором и анестезировали раствором лидокаина. Размер каждого биопсийного образца был не менее 10 куб. мм, масса - не менее 11 мг.

Образец помещали в буферный раствор, содержащий 50 мМ Трис-HCl рН 7.6, 100 мМ NaCl, 1 мМ ЭДТА и 1 мМ фенилметилсульфонилфторид и гомогенизировали до получения однородной суспензии. Полученную суспензию центрифугировали в течение 10 минут при 14000 об/мин. Отбирали супернатант и использовали его для количественного определения целевого белка.

Определение количества белка пролил 4-гидроксилазы альфа 1 проводили в девяти биоптатах кожи пациента через 72 часа после введения генно-терапевтических субстанций методом твердофазного иммуноферментного анализа (ИФА ELISA), используя набор Human Р4НА1 ELISA Kit (MyBioSource, США), как описано в Примере 8.

По итогам определения количества белка пролил 4-гидроксилазы альфа 1, в лизате биоптатов кожи пациента выделили вариант генно-терапевтической субстанции, при введении которой в кожу наблюдается наибольшее количество белка пролил 4-гидроксилазы альфа 1 в лизате клеточной культуры, что в итоге свидетельствует о наибольшей экспрессии гена Р4НА1. В данном эксперименте наибольшее количество целевого белка пролил 4-гидроксилазы альфа 1 в лизате биоптата кожи отмечена при введении генно-терапевтической субстанции на базе pCMV6 Р4НА1 SEQ ID No: 4, содержащей модифицированную кДНК гена Р4НА1, что показано на фигуре 20

Таким образом, выбрана наиболее эффективная применительно к данному пациенту генно-терапевтическая субстанция для ее последующего введения пациенту в рамках терапевтической процедуры.

Создано средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, возникших вследствие недостаточной экспрессии гена Р4НА1, способ его получения и использования.

Созданное средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, состоящее из одной или нескольких генно-терапевтических субстанций из группы генно-терапевтических субстанций с использованием одной из модифицированных кДНК гена Р4НА1 или участка немодифицированной кДНК гена Р4НА1 позволяет на практике использовать входящие в группу генно-терапевтические субстанции для повышения до необходимого уровня белка пролил 4-гидроксилазы альфа 1, в различных клетках органов и тканей и/или органах и тканях человека путем увеличения экспрессии гена Р4НА1.

В результате проведения предварительных исследований биоптата пациента, либо клеток, выращенных из этих биоптатов, определяют, какой вариант генно-терапевтической субстанции из созданной группы генно-терапевтических субстанций необходимо выбрать для данного пациента для того, чтобы повысить количество белка пролил 4-гидроксилазы альфа 1, в клетках этих органов и тканей и/или органах и тканях до необходимого уровня применительно к конкретному пациенту. В тех случаях, когда использование генно-терапевтической субстанции с участком немодифицированной кДНК гена Р4НА1 не приводит к желаемому изменению уровня количества белка пролил 4-гидроксилазы альфа 1, в клетках органов и тканей и/или органах и тканях, необходимо применять субстанцию на основе модифицированной кДНК гена Р4НА1, приводящей к более эффективной экспрессии гена Р4НА1.

При использовании заявленной генно-терапевтической субстанции не происходит встраивания экзогенного генетического материала в геном клетки.

Группа генно-терапевтических субстанций обеспечивает высокий уровень экспрессии гена Р4НА1, повышая количество белка пролил 4-гидроксилазы альфа 1, в клетках органов и тканей и/или органах и тканях человека в частности, в гемопоэтических клетках, или мезенхимальных стволовых клетках, или хондробластах, или миоцитах, или миобластах, или фибробластах, или остеобластах, или кератоцитах, или эпителиальных клетках, или клетках роговицы, или эндотелиальных клетках, или эпителиальных клетках, в сочетании с транспортной молекулой или без нее при трансфекции этими генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека в частности, в соединительно-тканных структурах, или коже, или суставах, или хрящевой ткани, или костной ткани, или мышечной ткани, или сухожилиях, или связках, или кровеносных сосудах, или стенке артерий, или роговице глаза, или склере, или плаценте, или дентине, или строме внутренних органов в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

Таким образом, приведенные примеры подтверждают выполнение поставленной задачи, а именно, создание высокоэффективного средства для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, на основе генно-терапевтических субстанций с геном Р4НА1, представляющего собой группу генно-терапевтических субстанций, при использовании которых с учетом индивидуальных особенностей пациента, происходит повышение уровня экспрессии гена Р4НА1 и/или повышение количества белка пролил 4-гидроксилазы альфа 1, в клетках органов и тканей и/или органах и тканях организма.

Кроме этого при введении генетических конструкций в отличие от введения непосредственно белка, снижается требуемая частота их введения в связи с пролонгированным действием, а также облегчается внутриклеточная доставка.

Повышение эффективности коррекции уровня количества белка пролил 4-гидроксилазы альфа 1, в клетках органов и тканей человека достигают за счет того, что при недостаточном количестве этого белка вследствие дефекта гена Р4НА1 используют не белок, а генетическую конструкцию с кДНК гена Р4НА1, кодирующую этот белок.

Промышленная применимость.

Все приведенные примеры по созданию и использованию созданной группы генно-терапевтических субстанций подтверждают ее промышленную применимость.

Перечень сокращений

ДНК - дезоксирибонуклеиновая кислота

кДНК - комплементарная дезоксирибонуклеиновая кислота

РНК - рибонуклеиновая кислота

мРНК - матричная рибонуклеиновая кислота

ПЦР - полимеразная цепная реакция

мл - миллилитр, мкл - микролитр

л - литр

куб. мм - кубический миллиметр

мкг - микрограмм

мг - миллиграмм

г - грамм

мкМ - микромоль

мМ - миллимоль

об/мин - обороты в минуту

нм - нанометр

см - сантиметр

мВт - милливатт

о.е.ф. - относительная единица флуоресценции

ГТС - генно-терапевтическая субстанция

1. Средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, на основе генно-терапевтических субстанций с геном Р4НА1, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена Р4НА1, с кодирующей последовательностью белка пролил 4-гидроксилазы альфа 1, с делециями 5-' и 3'-нетранслируемых областей, а именно полученной на основе участка немодифицированной кДНК гена Р4НА1 SEQ ID No: 1, или модифицированной кДНК гена Р4НА1, при этом в качестве модифицированной кДНК гена Р4НА1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена Р4НА1 в эукариотических клетках, в частности в клетках органов и тканей человека, и способную увеличить количество белка пролил 4-гидроксилазы альфа 1, в клетках органов и тканей и/или органах и тканях человека, в частности в гемопоэтических клетках, или мезенхимальных стволовых клетках, или хондробластах, или миоцитах, или миобластах, или фибробластах, или остеобластах, или кератоцитах, или эпителиальных клетках, или клетках роговицы, или эндотелиальных клетках, или эпителиальных клетках, в сочетании с транспортной молекулой или без нее при трансфекции этими генно-терапевтическими субстанциями клеток органов и тканей человека и/или в органах и тканях человека, в частности в соединительно-тканных структурах, или коже, или суставах, или хрящевой ткани, или костной ткани, или мышечной ткани, или сухожилиях, или связках, или кровеносных сосудах, или стенке артерий, или роговице глаза, или склере, или плаценте, или дентине, или строме внутренних органов, в сочетании с транспортной молекулой или без нее при введении этих генно-терапевтических субстанций в органы и ткани человека.

2. Средство по п. 1, отличающееся тем, что генетическая конструкция с модифицированной кДНК гена Р4НА1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена Р4НА1, которая несет модификации, не затрагивающие структуру белка пролил 4-гидроксилазы альфа 1, а именно нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи.

3. Средство по п. 1, отличающееся тем, что генетическая конструкция с модифицированной кДНК гена Р4НА1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена Р4НА1, которая несет модификации, затрагивающие структуру белка пролил 4-гидроксилазы альфа 1, а именно нуклеотидные замены, приводящие к аминокислотным заменам или обрыву аминокислотной цепи.

4. Средство по п. 1, отличающееся тем, что генетическая конструкция с модифицированной кДНК гена Р4НА1 содержит последовательность нуклеотидов, включающую в себя белок-кодирующую область кДНК гена Р4НА1, которая несет модификации, не затрагивающие структуру белка пролил 4-гидроксилазы альфа 1, а именно нуклеотидные замены, не приводящие к аминокислотным заменам или обрыву аминокислотной цепи, в комбинации с модификациями, затрагивающими структуру белка пролил 4-гидроксилазы альфа 1, а именно нуклеотидные замены, приводящие к аминокислотным заменам или обрыву аминокислотной цепи.

5. Средство по п. 1, отличающееся тем, что в качестве транспортной молекулы используют липосомы или дендримеры 5-го и выше поколений, или амфифильные блоксополимеры, или transfection reagent на основе Polyethylenimine (PEI).

6. Способ получения средства для лечения состояний человеческого организма, связанного с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, по п. 1, заключающийся в получении каждой генно-терапевтической субстанции из группы генно-терапевтических субстанций по п. 1, при этом получают кДНК гена Р4НА1, затем помещают кДНК в векторную плазмиду, способную обеспечить высокий уровень экспрессии этой кДНК в клетках различных органов и тканей человека, наращивают и выделяют необходимое количество генетической конструкции, затем комбинируют генетическую конструкцию с транспортной молекулой для трансфекции полученной генно-терапевтической субстанцией клеток органов и тканей и/или введения полученной генно-терапевтической субстанции в органы и ткани человека, при этом используют кДНК гена Р4НА1 с кодирующей последовательностью белка пролил 4-гидроксилазы альфа 1, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка немодифицированной кДНК гена Р4НА1 SEQ ID No: 1, или модифицированной кДНК гена Р4НА1, при этом в качестве модифицированной кДНК гена Р4НА1 используют или SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций.

7. Способ использования средства для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, заключающийся в трансфекции генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, клеток органов и тканей пациента и/или во введении в органы и ткани пациента аутологичных клеток пациента, трансфицированных генно-терапевтической субстанцией, выбранной из группы созданных генно-терапевтических субстанций по п. 1, и/или во введении в органы и ткани пациента генно-терапевтической субстанции или нескольких субстанций, выбранной/выбранных из группы созданных генно-терапевтических субстанций по п. 1, или сочетанием обозначенных способов.



 

Похожие патенты:

Изобретение относится к области биохимии. Предложен комплекс реагентов для количественного анализа аденозин-5'-трифосфата (АТР).

Группа изобретений относится к биотехнологии, в частности к способу получения сесквитерпенового спирта, в том числе α-синенсола, β-синенсола, α-санталола, β-санталола, α-транс-бергамотола, эпи-β-санталола, ланцелола или их смеси.

Изобретение относится к области генной инженерии, конкретно к получению микробных продуцентов, и может быть использовано для получения микробного масла. Сконструирована жирообразующая клетка дрожжей, способная к конверсии источника углерода в жирную кислоту, производное жирной кислоты и/или триацилглицерин.

Изобретение относится к биотехнологии. Способ получения лакказ предусматривает погружное культивирование Rhizoctonia solani F-895 в минеральной питательной среде с добавлением в качестве натурального источника углерода и энергии по крайней мере одного компонента, выбранного из ряда: белокочанная капуста, горох, фасоль, картофель, томатная паста, до получения максимальной активности лакказ в культуральной жидкости с последующим отделением культуральной жидкости от мицелия центрифугированием.

Группа изобретений относится к получению 2,4-дигидроксимасляной кислоты (2,4-ДГМ). Предложен способ получения 2,4-ДГМ, включающий первую стадию превращения малата в 4-фосфомалат с использованием фермента, способного осуществить подобное превращение, вторую стадию превращения 4-фосфомалата в малат-4-полуальдегид с использованием фермента, способного осуществить подобное превращение, и третью стадию превращения малат-4-полуальдегида в 2,4-ДГМ с использованием фермента, способного осуществить подобное превращение.

Изобретение относится к области биотехнологии, конкретно к получению производных фактора свертывания крови VII и VIIa, их конъюгатов с полимерами, способными увеличивать время полувыведения из кровотока, комплексов с ними, полученных путем связывания носителя с конъюгатом, к генам, кодирующим производные, к экспрессирующим векторам, содержащим эти гены, трансформантам с введенными экспрессирующими векторами, к способам их получения, фармацевтическим композициям и способам лечения, и может быть использовано в медицине для предупреждения или лечения гемофилии или улучшения свертываемости крови.

Группа изобретений относится к области биотехнологии. Представлен выделенный генно-модифицированный организм для получения сквалена или производного сквалена, в котором по сравнению с соответствующим организмом дикого типа уменьшена или устранена активность обоих паралогов ARE1 и ARE2 ацил-СоА:стерол ацилтрансферазы/стерол О-ацилтрансферазы (ЕС 2.3.1.26), а активность HMG-CoA-редуктазы (ЕС 1.1.1.34) повышена.

Предложены варианты бактерий Escherichia coli, являющихся продуцентами янтарной кислоты. Бактерия Escherichia coli модифицирована таким образом, что гены асkА, pta, рохВ, ldhA, adhE, ptsG в ней инактивированы, экспрессия генов galP и glk усилена, и бактерия обладающий активностью пируват карбоксилазы.

Группа изобретений относится к области биохимии. Предложен метод выявления люциферазы в биологических образцах с использованием 3-гидроксигиспидина или 3-гидроксибиснориангонина в качестве люциферина.

Группа изобретений относится к области генной инженерии, в целом к трансгенным конструкциям, трансгенным животным, отличным от человека, способам количественного анализа активации GPCR лигандов неинвазивно в интактных животных, тканевых срезах или в нативных клетках, используя трансгенную модель, содержащую систему биолюминесцентного трансгена-репортера, которая является чувствительной к модуляции путей после связывания лиганда с рецепторами GPCR.

Группа изобретений относится к вариантам дрожжевой клетки рода сахаромицетов, способной к размножению в аэробных условиях на субстрате, содержащем по меньшей мере один C5-сахар, и применению такой клетки.

Изобретение относится к молекулярной биологии. Предложен способ разделения молекул ДНК, предусматривающий негативную селекцию целевых молекул ДНК в растворе от нецелевых молекул ДНК, предусматривающий взаимодействие нецелевых молекул ДНК, содержащих сайт узнавания рекомбиназы Cre бактериофага P1 LoxP, с рекомбиназой Cre бактериофага Р1, дефектной по способности ковалентно модифицировать ДНК, которое обеспечивает перевод нецелевых молекул ДНК из раствора на твердую фазу.

Группа изобретений относится к биотехнологии, в частности к способу получения сесквитерпенового спирта, в том числе α-синенсола, β-синенсола, α-санталола, β-санталола, α-транс-бергамотола, эпи-β-санталола, ланцелола или их смеси.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к генетической конструкции для обеспечения экспрессии целевых гомологичного и гетерологичного генов в клетках реципиентного гриба Penicillium verruculosum.

Настоящее изобретение относится к области биотехнологии, в частности к новым вариантам глюкозооксидазы из Aspergillus niger с улучшенными свойствами, а именно термостабильностью и собственной глюкозооксидазной активностью.

Изобретение относится к области генной инженерии, конкретно к получению микробных продуцентов, и может быть использовано для получения микробного масла. Сконструирована жирообразующая клетка дрожжей, способная к конверсии источника углерода в жирную кислоту, производное жирной кислоты и/или триацилглицерин.

Группа изобретений относится к области биотехнологии. Предложено применение полипептида с аминокислотной последовательностью SEQ ID NO: 1 в качестве гомосеринсукцинилтрансферазы или кодирующего его полинуклеотида, имеющего нуклеотидную последовательность SEQ ID NO: 2 или 3, для получения О-сукцинилгомосерина.

Группа изобретений относится к области биотехнологии. Предложено применение полипептида с аминокислотной последовательностью SEQ ID NO: 1 в качестве гомосеринсукцинилтрансферазы или кодирующего его полинуклеотида, имеющего нуклеотидную последовательность SEQ ID NO: 2 или 3, для получения О-сукцинилгомосерина.

Группа изобретений относится к области биотехнологии. Предложен способ ферментативного получения серусодержащих аминокислот, включающий стадии, на которых: а) получают микроорганизм семейства Enterobacteriaceae или микроорганизм семейства Corynebacteriaceae, в котором происходит сверхэкспрессия гена, кодирующего полипептид с активностью тиосульфат-сульфотрансферазы; б) ферментируют микроорганизм, полученный на стадии а), в среде, которая содержит неорганический источник серы, выбранный из группы, включающей соль тиосерной кислоты или смесь соли тиосерной кислоты и соли серной кислоты, получая ферментационный бульон, и в) концентрируют серусодержащую аминокислоту в ферментационном бульоне, полученном на стадии б).

Изобретение относится к области биохимии, в частности к нуклеиновой кислоте, кодирующей белок слияния из многих субъединиц гликолатдегидрогеназы, а также трансгенной клетке растения, трансгенному растению и трансгенному семени, содержащим вышеуказанную нуклеиновую кислоту.

Группа изобретений относится к биотехнологии, в частности к способу получения сесквитерпенового спирта, в том числе α-синенсола, β-синенсола, α-санталола, β-санталола, α-транс-бергамотола, эпи-β-санталола, ланцелола или их смеси.

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и представляет собой средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 иили уменьшением количества белка пролил 4-гидроксилазы альфа 1, на основе генно-терапевтических субстанций с геном Р4НА1, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена Р4НА1, с кодирующей последовательностью белка пролил 4-гидроксилазы альфа 1, с делециями 5- и 3-нетранслируемых областей, а именно полученной на основе участка немодифицированной кДНК гена Р4НА1 SEQ ID No: 1, или модифицированной кДНК гена Р4НА1, при этом в качестве модифицированной кДНК гена Р4НА1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена Р4НА1 в эукариотических клетках. Изобретение позволяет эффективно увеличить количество белка пролил 4-гидроксилазы альфа 1 в эукариотических клетках и получить высокоэффективное средство для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена Р4НА1 иили уменьшением количества белка пролил 4-гидроксилазы альфа 1. 3 н. и 4 з.п. ф-лы, 20 ил., 18 пр.

Наверх