Получение вирусного вектора


C12N2710/24122 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)

Владельцы патента RU 2658487:

СЕМЕНТИС ЛИМИТЕД (AU)

Изобретения касаются модифицированной клетки СНО и способа размножения ортопоксвируса при ее использовании. Представленная клетка модифицирована таким образом, чтобы включать последовательность, кодирующую CP77 под контролем конститутивного промотора, и последовательность, кодирующую D13L и/или K1L также под контролем конститутивного промотора. Клетка поддерживает размножение поксвируса, который способен в меньшей степени или не способен размножаться в немодифицированной клетке CHO. Изобретения могут быть использованы для получения лекарственных средств на основе поксвирусов (вирусов оспы). 2 н. и 3 з.п. ф-лы, 11 табл., 14 пр.

 

РОДСТВЕННЫЕ ЗАЯВКИ

[0001] Эта заявка является родственной, и по ней испрашивается приоритет австралийской патентной заявки № 2013904242, поданной 1-го ноября 2013 года, и австралийской патентной заявке № 2014900370, поданной 7-го февраля 2014 года, причем полное содержание каждой из этих заявок включено в настоящее описание путем ссылки.

ОБЛАСТЬ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

[0002] Настоящее изобретение относится к получению клеток и клеточных линий, пригодных для размножения и, следовательно, получения лекарственных средств на основе поксвирусов (вирусов оспы). В частности, описание относится к рекомбинантным модифицированным клеточным субстратам для размножения таких поксвирусов для получения терапевтических или профилактических средств.

УРОВЕНЬ ТЕХНИКИ

[0003] Библиографические данные ссылок в описании изобретения приведены в конце описания.

[0004] Ссылка в этом описании на какую-либо предшествующую публикацию (или информацию, полученную из нее) или на любые известные данные не является и не должна приниматься в качестве подтверждения или принятия или в какой-либо форме предположения о том, что предшествующая публикация (или информация, полученная из нее) или известные данные образуют часть общих сведений в области деятельности, к которой относится это описание.

[0005] Все публикации, указанные в этом описании, полностью включены в него путем ссылки.

[0006] Семейство поксвирусов включает два подсемейства, Chordopoxvirinae и Entomopaxvirnae. Подсемейство Chordopoxvirinae включает восемь родов, в том числе род Orthopoxviridae, включающий виды, которые инфицируют человека (например, вирус натуральной оспы, являющийся возбудителем оспы, вирус коровьей оспы (который являлся основой первой осповакцины, созданной Дженнером в 1796 году), вирус осповакцины (используемый в качестве вакцины второго поколения против оспы) и вирус оспы обезьян), и вирусы рода Avipoxviridae, включающего виды, которые инфицируют птиц, такие как вирусы оспы домашней птицы и оспы птиц. В дополнение к их использованию в качестве антигенов в осповакцине большой интерес проявляется к использованию рекомбинантных вирусов на основе осповакцины и вирусов оспы птиц в качестве «каркасных» векторов. В качестве цитоплазматических векторов вирусы Orihopoxviridae, в частности, способны доставлять чужеродные антигены в цитоплазму хозяина и к путям процессинга антигенов, которые процессируют антигены до пептидов для представления на поверхности клетки. Такие векторы, экспрессирующие чужеродные антигены, используются в создании вакцин против таких болезней, как СПИД, туберкулез, малярия и рак, которые, как показала практика, трудно поддаются лечению с помощью других стратегий вакцинации.

[0007] Подсемейство Chordopoxvirinae имеет двухцепочечные ДНК-геномы с размером в диапазоне от 130 т.п.о. у парапоксвирусов до более чем 300 т.п.о. у авипоксивирусов, и их жизненный цикл в хозяине полностью проходит в цитоплазме клетки-хозяина. Поксвирусы существуют по существу независимо от их клетки-хозяина и молекул клетки-хозяина, особенно, в отношении процессов, участвующих в синтезе ранних мРНК. Однако молекулы клетки-хозяина, по-видимому, используются в инициации или терминации промежуточной и поздней вирусной транскрипции. Поксвирусы продуцируют структурно разнообразные «факторы видоспецифичности (определяющие диапазон хозяев)», которые специально направлены на сигнальные пути хозяина и манипулируют ими, обеспечивая условия в клетке, позволяющие репликацию вируса. Большинство поксвирусов может связываться и заражать клетки млекопитающих, но является ли инфекция пермиссивной (способной к продукции инфекционных вирионов) или непермиссивной (по существу не в состоянии продуцировать инфекционные вирионы) зависит от конкретных поксвируса и типа клеток. В настоящее время существует относительно мало информации о взаимодействии на молекулярном уровне между вирусами оспы и клеткой-хозяином, в частности, о генах видоспецифичности и о том, какие факторы необходимы для регуляции взаимодействий, чтобы облегчить размножение и вируса и клеток. Обзор видоспецифичных генов приведен в статье Werden et al. 2008, полностью включенной в это описание.

[0008] Данные о штаммах осповакцины, важные в отношении применения в качестве противооспенных вакцин и впоследствии в качестве вирусных векторов, публикуются с начала 1960 гг. до наших дней. Некоторые штаммы вируса осповакцины, включая штаммы, используемые в качестве противооспенных вакцин, способны размножаться в клетках человека и поэтому представляют опасность для здоровья, например, вследствие развития вирусного энцефалита. С целью разработки более безопасной вакцины штамм осповакцины из Анкары (названный «CVA») был перепассирован более 500 раз в клетках, не принадлежащих человеку. В ходе этого процесса геном вируса осповакцины существенно изменился, включая возникновение по меньшей мере шести крупных делеций по сравнению с первоначальным геномом CVA. Модифицированный вирус стал менее патогенным для человека, но все еще в состоянии индуцировать защитный иммунный ответ. Этот аттенуированный вирус осповакцины указывается как MVA (модифицированный вирус осповакцины Анкара) и также классифицируются по количеству пассажей, поскольку было установлено, что вирусы с различным числом пассажей генетически и фенотипически отличаются. Однако, к 515-му пассажу стало понятно, что MVA515 является генетически стабильным. В начале 1990-х годов было отмечено, что штаммы MVA, такие MVA572 и его производное, MVA F6, могли экспрессировать белки вируса осповакцины и гетерологичные (рекомбинантные) белки на высоком уровне в непермиссивных клетках (в которых вирус не будет размножаться), позволяя разрабатывать MVA в качестве вектора для гетерологичных молекул, представляющих интерес, таких, как молекулы, кодирующие антигены для вакцин или для терапевтической доставки.

[0009] Позднее были предприняты попытки получения модифицированного вируса осповакцины с характеристиками MVA путем введения шести больших известных делеций MVA в CVA. Следует отметить, что они не дали вируса с аттенуированными свойствами MVA. Было высказано предположение, что отсутствие видоспецифичных генов может отвечать за наблюдаемую аттенуацию, однако это не было обосновано (см., например, Meyer et al., Journal of General Virology (1991) 72:1031-1038).

[0010] Поксвирусы составляют большое семейство вирусов, характеризующееся большим линейным дцДНК-геномом, размножением в цитоплазме и сложной морфологией вириона. Вирус осповакцины является типичным представителем этой группы вирусов и наиболее изученным с точки зрения вирусного морфогенеза. Вирионы вируса осповакцины появляются в виде «прямоугольных» или «овальных» мембраносвязанных частиц со сложной внутренней структурой, включающей окруженное стенкой двояковыпуклое ядро, с расположенными по бокам «боковыми тельцами». Путь сборки вирионов включает образование мембраносодержащих полумесяцев, из которых развиваются незрелые вирионы (IV), а затем превращаются в зрелые вирионы (MV). Более 70 уникальных генных продуктов содержатся в вирионе вируса осповакцины, для которых теперь описаны действие на сборку вируса осповакцины мутаций более чем в 50 генах.

[0011] Вирус осповакцины проникает в клетки путем слияния своих поверхностных мембран с плазматической мембраной клетки-хозяина, высвобождая ядро (и боковые тельца) в цитоплазму, и активируя транскрипционную программу вируса. Ядра вирионов содержат полный набор кодируемых вирусом ферментов, необходимых для синтеза и модификации ранней мРНК. Ранние гены кодируют ферменты, необходимые для размножения ДНК, и поэтому, по мере достижения максимума экспрессии ранних генов начинается размножение вирусной ДНК в цитоплазматических сайтах, называемых «фабриками». Ранние гены также кодируют промежуточные факторы транскрипции, а промежуточные гены, в свою очередь, кодируют поздние факторы транскрипции, так что промежуточные и поздние гены экспрессируются последовательно после уже начавшегося размножения вирусной ДНК. Таким образом, полный набор вирусных генов транскрибируются по определенной схеме, в которой ранние, промежуточные и поздние классы генов отличаются класс-специфичными промоторами и кодируемыми вирусом факторами транскрипции. Кроме того, только размножающиеся геномы является подходящими матрицами для событий промежуточной и поздней транскрипции. Эти два класса генов совместно кодируют структурные белки вириона, ферменты вириона, а также факторы, участвующие в сборке частиц и необходимые для сборки новых вирусных частиц.

[0012] Вскоре после поглощения клеткой вируса и ранней экспрессии внутри клетки образуются специфичные для инфекции цитоплазматические домены, имеющие однородную плотность и иногда окруженные цистернами, образуемыми эндоплазматическим ретикулумом (ER), которые со временем увеличиваются в размерах. Эти домены представляют собой участки размножения вирусной ДНК и часто называются «вирусными фабриками».

[0013] Сборка вируса начинается с образования жестких серповидных структур (чашеобразных) в вирусных фабриках. На электронных микрофотографиях с высоким разрешением видно, что внешний слой этих серповидных структур состоит из регулярно расположенных выступов, называемых «спикулами». Полумесяцы, по-видимому, увеличиваются в длину, сохраняя ту же степень кривизны, пока они не станут замкнутыми кольцами (сферами в пространстве), называемыми незрелыми вирионами (IV). IV заполнены «вироплазматическим» веществом, которое является однородным по плотности, но ощутимо более электроноплотным по сравнению с окружающей фабрикой. По мере образования IV также происходит поглощение инкапсулированной ДНК: она видна на электронных микрофотографиях как электронноплотный круглый или яйцевидный субдомен в IV, называемый «нуклеоидом». IV, которые содержат нуклеоиды из конденсированной ДНК часто называются «IVN». Для морфогенеза IVN в созревшие вирионы (MV) требуется созревание нескольких предшественников вирионных белков посредством протеолитического расщепления. Большинство зрелых вирионов находятся вне фабрик и могут существовать в кластерах либо на периферии фабрики либо, по-видимому, на значительном расстоянии от ближайшей фабрики.

[0014] Поксвирусные вирионы существуют в трех инфекционных формах: созревшие вирионы (MV), вирионы в оболочке (WV) и внеклеточные вирионы (EV). MV, самая простая форма вируса, представляют собой окруженные мембраной частицы, содержащие двояковыпуклое ядро, с расположенными по бокам «боковыми тельцами», которые заполняют впадины ядра. В норме MV находятся исключительно внутри клеток и высвобождаются только в результате лизиса клеток. WV состоят из MV, которые окружены двумя дополнительными липидными бислоями, образующимися из транс-Гольджи цистерн. WV, чьи внешние мембраны содержат характеристические вирусные белки, являются предшественниками EV и также находятся внутри клетки. EV состоят из WV, которые выделяются из клетки путем экзоцитоза посредством слияния внешней мембраны WV с плазматической мембраной, оставляя MV, заключенные в еще одну дополнительную мембрану. Часть EV прикреплена к клеточной поверхности, тогда как некоторые из них обнаруживаются свободными во внеклеточной среде. Полагают, что EV важны для распространения вируса в организме.

[0015] Удаление из вирусов необходимых генов и компенсация их в клетках-хозяевах известны в данной области техники в качестве предлагаемой общей стратегии создания безопасных и эффективных вирусных векторов для лечения и терапии. Существует потребность в улучшенных аттенуированных ортопоксвирусных векторах с усиленными безопасностью, экспрессией и/или иммуногенностью и равная потребность в безопасных и экономичных способах размножения и производства таких ортопоксвирусных векторов.

[0016] Ряд линий клеток млекопитающих используется для производства рекомбинантных белков в исследовательских целях. К ним относятся линии клеток кролика, хомяка, приматов и человека, такие как, без ограничения, известные в данной области клетки HEK293, 293T, 143B, CHO, HeLa, Vero и ВНК, HepG2 и 3Т3. Однако следует отметить, что GMP-производство большинства рекомбинантных терапевтических белков было осуществлено в клетках СНО, что делает эту клеточную линию наиболее хорошо изученной и одобренной для терапии человека клеточной линией. Клетки СНО могут вырастать до очень высокой плотности в суспензионных культурах, а последующие способы очистки продуктов очень хорошо разработаны. Следует отметить, что никакой вирус осповакцины, такой как вирус осповакцины-СОР или вирус осповакцины-WR, ни его производные, такие как MVA и NYVAC не будут размножаться в клетках СНО.

[0017] Экспрессия генов видоспецифичности вируса в вирусе оспы под контролем локальных вирусных промоторов и с использованием РНК-полимеразы вируса оспы известна в данной области техники.

[0018] Контролируемая во времени экспрессия определенных видоспецифичных генов вируса с генома клетки млекопитающего, чтобы восстановить или разрешить репликацию вируса и разрешить выживаемость клеток-хозяев, не была описана ранее.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

[0019] В настоящем описании описаны in vitro культивируемые клетки млекопитающих, трансформированные для экспрессии фактора видоспецифичности поксвируса, и способ размножения вирусных векторов, включающий культивирование таких клеток.

[0020] В первом аспекте настоящее изобретение относится к модифицированной клетке млекопитающего, в которой геном клетки, модифицирован для включения последовательности, кодирующей CP77 под контролем промотора такого, что модифицированная клеточная линия поддерживает размножение поксвируса, который способен в меньшей степени или не способен размножаться в немодифицированной клетке.

[0021] Во втором аспекте настоящее изобретение относится к способу размножения ортопоксвируса, который не размножается в клетках CHO, причем способ включает размножение поксвируса in vitro в линии клеток млекопитающего, где клеточную линию модифицируют, чтобы она кодировала и экспрессировала CP77 под контролем промотора.

[0022] В различных альтернативных вариантах осуществления модифицированные клетки дополнительно модифицируют, чтобы они содержали последовательности, кодирующие D13L под контролем промотора, и/или они содержали последовательность, кодирующую K1L под контролем промотора.

[0023] Ссылка в настоящем описании на «CP77», «K1L» и «D13L» включает функциональные ортологи и функциональные варианты.

ПОДРОБНОЕ ОПИСАНИЕ КОНКРЕТНЫХ ВАРИАНТОВ ОСУЩЕСТВЛЕНИЯ

[0024] Настоящее изобретение не ограничивается конкретными процедурами или агентами, определенными составами агентов и различными медицинскими методиками, поскольку они могут варьировать. Используемая в настоящем описании терминология предназначена для описания конкретных вариантов осуществления и не предназначена для ограничения. Если не указано иное, все технические и научные термины, используемые в настоящем описании, имеют такие же значения, которые обычно понятны среднему специалисту в области, к которой принадлежит данное изобретение.

[0025] Любые материалы и способы, аналогичные или эквивалентные описанным в настоящем описании, могут быть использованы при практическом применении или тестировании настоящего изобретения. Использующим изобретение на практике особенно рекомендуются: Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainsview, N.Y.; Ausubel et al. (1999) Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York; Murphy et al. (1995) Virus Taxonomy Springer Verlag:79-87, Mahy Brian WJ and Kangro O Hillar (Eds): Virology Methods Manual 1996, Academic Press; и Davison AJ and Elliott RM (Eds): Molecular Virology, A practical Approach 1993, IRL Press at Oxford University Press; Perkus et al., Virology (1990) 179(1):276-86 или определения и термины в данной области и другие способы, известные специалистам в данной области техники.

[0026] Хотя любые способы и материалы, подобные или эквивалентные описанным в настоящем описании, могут быть использованы при практическом применении или тестировании настоящего изобретения, описаны предпочтительные способы и материалы. Применительно к целям настоящего изобретения ниже приведено определение следующих терминов.

[0027] В этом описании, если контекст не требует иного, слова «содержать», «содержит» и «содержащий» следует понимать как подразумевающие включение указанной стадии или элемента или группы стадий или элементов, но не исключение любой другой стадии или элемента или группы стадий или элементов. Таким образом, использование термина «содержащий» и аналогичных терминов указывает на то, что перечисленные элементы необходимы или обязательными, но другие элементы являются необязательными и могут присутствовать или не присутствовать. В контексте аттенуированных ортопоксвирусных векторов, указанные векторы модифицируются для аттенуации (ослабления) путем включения делеции необходимого для созревания или сборки гена, однако охвачена дополнительная модификация, например, векторного антигена или другого белка.

[0028] Под «состоящим из» подразумевается включение и ограничение тем, что следует за фразой «состоящий из». Таким образом, фраза «состоящий из» указывает на то, что перечисленные элементы необходимы или обязательны, и что никакие другие элементы не могут присутствовать. «По существу состоящий из» означает включение любых элементов, перечисленных после фразы, и ограниченное другими элементами, которые не мешают или способствуют активности или действию, указанным в описании для перечисленных элементов. Таким образом, фраза «по существу состоящий из» указывает на то, что, перечисленные элементы необходимы или обязательны, но другие элементы являются необязательными и могут присутствовать или не присутствовать в зависимости от того, влияют ли они на активность или действие перечисленных элементов.

[0029] Используемые в настоящем описании формы единственного числа включают множественное число, если контекст явно не указывает иное. Таким образом, например, ссылка на «клетку» включает одну клетку, а также две или несколько клеток; ссылка на «организм» включает в себя один организм, а также два или несколько организмов; и т.п. В некоторых вариантах осуществления единственное число означает «один или более одного».

[0030] В рамках изобретения «и/или» относится к и охватывает любые и все возможные комбинации одного или нескольких из связанных перечисленных пунктов, а также отсутствие комбинаций при интерпретации как чередование (или).

[0031] «Аттенуация» или «аттенуированный» в контексте данного изобретения означает снижение вирулентности вирусного вектора. Вирулентность определяется как способность вируса вызывать болезнь у конкретного хозяина. Поксвирусный вектор, который неспособен продуцировать инфекционные вирусы, первоначально может инфицировать клетки, но не способен по существу полностью реплицироваться или размножаться в хозяине или вызвать заболевание. Это является желательным, поскольку вектор доставляет свой белок или нуклеиновую кислоту в цитоплазму клетки-хозяина, но не наносит вреда.

[0032] Под «регуляторным элементом» или «регуляторной последовательностью» подразумеваются последовательности нуклеиновых кислот (например, ДНК), которые необходимы для экспрессии функционально связанной кодирующей последовательности в конкретных поксвирусе, векторе, плазмиде или клетке. Регуляторные последовательности, которые подходят для эукариотических клеток, включают транскрипционные регуляторные последовательности, такие как промоторы, сигналы полиаденилирования, энхансеры транскрипции, трансляционные регуляторные последовательности, такие как энхансеры трансляции и внутренние сайты связывания рибосомы (IRES), нуклеотидные последовательности, которые модулируют стабильность мРНК, а также сигнальные последовательности, которые направляют продукт, кодируемый транскрибируемым полинуклеотидом, в внутриклеточный компартмент в клетке или во внеклеточную среду.

[0033] Если предусмотрены последовательности, то охвачены соответствующие последовательности. Под «соответствует», «соответствующий» или «соответствующий чему-либо» подразумевается последовательность нуклеиновой кислоты, которая имеет значительную идентичность по последовательности с эталонной нуклеотидной последовательностью (например, по меньшей мере примерно 50, 51, 52, 53, 54, 55, 56 , 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 97, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% или даже 100% идентичности по последовательности со всей или с участком эталонной нуклеотидной последовательности), или аминокислотная последовательность, которая имеет значительные сходство или идентичность по последовательности с эталонной аминокислотной последовательностью (например, по меньшей мере 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 , 60, 61, 62, 63. 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 , 85, 86, 97. 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% или даже 100% сходства или идентичности по последовательности со всей или участком эталонной аминокислотной последовательности).

[0034] Под «эффективным количеством» в контексте лечения или профилактики заболевания или в контексте модуляции иммунного ответа на антиген-мишень или организм понимается введение количества агента (например, аттенуированного ортопоксвирусного вектора, описанного в настоящем описании) или содержащей его композиции индивидууму, нуждающемуся в таком лечении или профилактике, либо в виде однократной дозы или в виде части из серии доз, которое является эффективным для предупреждения проявления симптома, контроля таких симптомов и/или для лечения существующих симптомов заболевания или для модуляции иммунного ответа на антиген-мишень или организм. Эффективное количество будет варьировать в зависимости от состояния здоровья и физического состояния индивидуума, подлежащего лечению, таксономической группы подлежащего лечению индивидуума, состава композиции, оценки медико-санитарной обстановки и других значимых факторов. Ожидается, что количество будет иметь относительно широкий диапазон, который может быть определен с помощью обычных испытаний.

[0035] Используемые в рамках изобретения термины «кодировать», «кодирующий» и т.п. относятся к способности нуклеиновой кислоты обеспечивать синтез другой нуклеиновой кислоты или полипептида. Например, говорят, что нуклеотидная последовательность «кодирует» полипептид, если она может транскрибироваться и/или транслироваться с получением полипептида, или если она может быть переведена в форму, которая может транскрибироваться и/или транслироваться с получением полипептида. Такая нуклеотидная последовательность может включать в себя кодирующую последовательность или обе кодирующую и некодирующую последовательности. Таким образом, термины «кодировать», «кодирующий» и т.п. включают РНК-продукт, возникающий в результате транскрипции молекулы ДНК, белок, возникающий в результате трансляции РНК-молекулы, белок, возникающий в результате транскрипции ДНК-молекулы с образованием РНК-продукта и последующей трансляции РНК-продукта, или белок, возникающий в результате транскрипции ДНК-молекулы с получением РНК-продукта, процессинга РНК-продукта с получением процессированного РНК-продукта (например, мРНК) и последующей трансляции процессированного РНК-продукта.

[0036] Термин «эндогенный» относится к гену или последовательности нуклеиновой кислоты или фрагменту, которые обычно присутствуют в организме-хозяине.

[0037] Термины «способный экспрессироваться», «экспрессированный» и их вариации относятся к способности клетки транскрибировать нуклеотидную последовательность в РНК и, необязательно, транслировать мРНК для синтеза пептида или полипептида, который обеспечивает биологическую или биохимическую функцию.

[0038] Используемый в рамках изобретения термин «ген» включает молекулу нуклеиновой кислоты, которая может быть использована для получения мРНК, необязательно, с добавлением элементов, которые помогают в этом процессе. Гены подходят или не подходят для использования для получения функционального белка. Гены могут включать как кодирующие, так и некодирующие области (например, интролы, регуляторные элементы, промоторы, энхансеры, последовательности терминации и 5'- и 3'-нетранслируемые области).

[0039] Термины «гетерологичная последовательность нуклеиновой кислоты», «гетерологичная нуклеотидная последовательность», «гетерологичный полинуклеотид», «чужеродный полинуклеотид», «экзогенный полинуклеотид» и т.п. используются взаимозаменяемо для обозначения любой нуклеиновой кислоты {например, нуклеотидной последовательности, содержащей IRES), которую вводят в геном организм с помощью экспериментальных манипуляций, и которая может включать в себя последовательности генов, найденные в этом организме, при условии что вводимый ген содержит некоторые модификации (например, точечную мутацию, делецию, замену или добавление по меньшей мере одного нуклеотида, присутствие сайта расщепления эндонуклеазой, присутствие сайта loxP и т.д.) относительно вирусной геномной последовательности до модификации.

[0040] Термины «гетерологичный полипептид», «чужеродный полипептид» и «экзогенный полипептид» используются взаимозаменяемо для обозначения любого пептида или полипептида, который кодируется «гетерологичной последовательностью нуклеиновой кислоты», «гетерологичный нуклеотидной последовательностью», «гетерологичным полинуклеотидом», «чужеродным полинуклеотидом» и «экзогенным полинуклеотидом», определение которых приведено выше.

[0041] Термин «клетка млекопитающего» означает клетку, в которую вектор, включая аттенуированный ортопоксвирусный вектор по изобретению, может быть введен с целью размножения поксвирусного вектора. В одном из вариантов осуществления клетка представляет собой непрерывную линию клеток. Менее необходимо, чтобы модифицированная клеточная линия была способна непрерывно делиться. Клетки млекопитающих или высших эукариот могут быть модифицированы по настоящему изобретению, и впоследствии трансформированы или иммортализованы, чтобы стать непрерывно делящейся клеточной линией. Однако было бы удобно, чтобы клетки до модификации представляли собой хорошо охарактеризованную и биотехнологически совместимую непрерывную клеточную линию, известную в данной области. Такие клетки обычно доступны в депозитариях, таких, как Американская коллекция типовых культур (АТСС) или Европейская коллекция клеточных культур (ЕСАСС).

[0042] Подходящие клеточные линии млекопитающих включают, но не ограничиваются ими, RK18, BHK, VERO, HBOC-143B, HaCat, HepG2, HeLa, HT1080, HEK-293, RD, COS-7, CHO, Jurkat, HUT, SUPT, C8166, MOLT4/клон 8, MT-2, MT-4, H9, PM1, CEM, клетки миеломы (например, клетки SB20) и CEMX174, доступные, например, от АТСС.

[0043] Для получения модифицированных клеточных линий, экспрессирующих гетерологичные гены, может быть использован любой признанный в данной области способ инженерии геномов. Приведена ссылка на использование транспозонной технологии для вставки генов в клеточный геном с использованием векторов piggyBac. Однако для введения гена в клетки известно множество способов, включая, без ограничения, трансдукцию ретровирусами (например, MoMLV и т.д.), трансдукцию лентивирусами, трансфекцию и интеграцию плазмид, другие вирусные системы для трансдукции клеточных линий, такие как, аденовирусная, AAV (аденовирус-ассоциированный вирус), EBV и методы редактирования генома для сайт-специфичного встраивания путем гомологичной рекомбинации с линейной ДНК с использованием сконструированных мегануклеаз, эффекторных нуклеаз, подобных транскрипционным активаторам (TAL-нуклеаз), содержащих цинковые-пальцы нуклеаз (ZFN) и CRISPR.

[0044] В одном варианте осуществления клеткой млекопитающего является клетка СНО. Известные клеточные линии СНО, которые не кодируют гены видоспецифичности вируса, не поддерживают производство вируса осповакцины или его производных, которые по существу не могут размножаться в клетках человека. Как известно специалистам в данной области, клетки яичника китайского хомячка (CHO), полученные из яичника хомячка Cricetulus griseus, являются наиболее часто используемыми клетками млекопитающих для биопромышленного и GMP-производства рекомбинантных белковых терапевтических препаратов, включая антитела. Популярность клеток CHO в этой области обусловлена отчасти их быстрым ростом и высоким уровнем продукции белка. В результате, клеточные линии CHO хорошо охарактеризованы. Подходящие клеточные линии CHO включают, без ограничения, линии A2, A2H, XrS6, CHO-K1, CHO/dhfr, RR-CHO-K1, UT-I, P22, CHO-1C6, Lec1, Lec2, Lec8, Pro-5 и CDKXB1. Часто используется клеточная линия CHO-K1, депонированная в АТСС под номерами ATCC CLL-61 или ATCC CRL-9618. Линия клеток СНО-K1 была получена как субклон из родительской клеточной линии СНО, выведенной из образца биопсии яичника взрослого китайского хомячка ученым Puck Т. (1957). В настоящей спецификации описаны модифицированные клетки помимо модифицированных клеток СНО.

[0045] В некоторых вариантах осуществления настоящего изобретения клетка млекопитающего представляет собой клетку человека, клетку примата, клетку хомячка или клетку кролика.

[0046] Клетки могут представлять собой одиночные клетки или могут быть выращены в культуре в виде жидких культур, монослоев и т.п. Клетки-хозяева могут быть также получены напрямую или непрямым образом из тканей или могут существовать в организме, включая животных.

[0047] Следует понимать, что «индукция» иммунного ответа, предусмотренная в настоящем изобретении, включает инициацию или стимуляцию иммунного ответа и/или усиление ранее существующего иммунного ответа.

[0048] Используемый в рамках изобретения термин «внутренний сайт связывания рибосомы» или «IRES» относится к вирусной, клеточной или синтетической (например, рекомбинантной) нуклеотидной последовательности, которая позволяет инициацию трансляции мРНК на внутреннем сайте в кодирующей области в пределах той же мРНК или на сайте, расположенном после 5'-конца мРНК, обеспечивая трансляцию функционально связанной кодирующей области, расположенной после (то есть, в 3'-направлении от) внутреннего сайта связывания рибосомы. Это делает трансляцию независимой от структуры 5'-кэпа и от 5'-конца мРНК. Последовательность IRES обеспечивает необходимые cis-действующие последовательности, необходимые для инициации трансляции функционально связанной кодирующей области.

[0049] Используемый в рамках изобретения термин «выделенный» предназначен для описания клетки, представляющего интерес соединения (например, рекомбинантного поксвируса, молекулы нуклеиновой кислоты, такой как геном, полипептида и т.д.), которые находятся в окружении, отличающемся от того, в котором соединение находится в природе. «Выделенный» подразумевает включение соединений, находящихся в образцах, которые по существу обогащены по представляющему интерес соединению, и/или, в которых представляющее интерес соединение является частично или по существу очищенным.

[0050] Термин «функционально связанный» или «функционально соединенный», используемый в рамках изобретения, относится к соединению, в котором компоненты, описанные таким образом, связаны друг с другом, что позволяет им функционировать предназначенным образом. Например, «транскрипционная регуляторная последовательность функционально связана с кодирующей последовательностью» относится к позиционированию и/или ориентации транскрипционный регулирующей последовательности относительно кодирующей последовательности, которые позволяют экспрессию кодирующей последовательности в условиях, совместимых с транскрипционной регуляторной последовательностью. В другом примере «IRES функционально связан с ортопоксвирусной кодирующей последовательностью» относится к позиционированию и/или ориентации IRES относительно ортопоксвирусной кодирующей последовательности, позволяющим кэп-независимую трансляцию ортопоксвирусной кодирующей последовательности.

[0051] Используемый в настоящем описании термины «открытая рамка считывания» и «ORF» используются взаимозаменяемо в настоящем описании для обозначения аминокислотной последовательности, кодируемой между кодонами инициации и терминации трансляции в кодирующей последовательности. Термины «кодон инициации» (например, ATG) и «кодон терминации» (например, TGA, ТАА, TAG) относятся к единице из трех непрерывных нуклеотидов («кодону») в кодирующей последовательности, которая определяет инициацию и терминацию цепи, соответственно, при синтезе белка (трансляции мРНК).

[0052] Используемый в рамках изобретения термин «родительский вирус» следует понимать, как ссылку на вирус, который был модифицирован для включения гетерологичной последовательности нуклеиновой кислоты с образованием рекомбинантного вируса по настоящему изобретению.

[0053] Термины «полинуклеотид», «полинуклеотидная последовательность», «нуклеотидная последовательность», «нуклеиновая кислота» или «последовательность нуклеиновой кислоты», используемые в данном описании, обозначают мРНК, РНК, кРНК, кДНК или ДНК. Термины, как правило, относятся к полимерной форме нуклеотидов, имеющей в длину по меньшей мере 10 оснований, из рибонуклеотидов или дезоксирибонуклеотидов или из модифицированной формы любого типа нуклеотида. Термин включает в себя одно- и двухцепочечные формы РНК или ДНК.

[0054] «Полипептид», «пептид», «белок» и «белковая молекула» используются в настоящем описании взаимозаменяемо для обозначения молекул, содержащих или состоящих из полимера из аминокислотных остатков и из их вариантов и синтетических аналогов. Таким образом, эти термины применяются к аминокислотным полимерам, в которых один или несколько аминокислотных остатков представляют собой синтетические аминокислоты, не встречающиеся в природе, такие как химический аналог соответствующей природной аминокислоты, а также к природным аминокислотным полимерам.

[0055] В рамках изобретения под термином «рекомбинантный» применительно к «молекулам нуклеиновых кислот», «полинуклеотидам» и т.п. понимаются искусственные структуры нуклеиновых кислот (т.е., не реплицирующиеся кДНК или РНК, или репликоны, самореплицирующиеся кДНК или РНК), которые могут транскрибироваться и/или транслироваться в клетках-хозяевах или бесклеточных системах, описанных в настоящем описании. Рекомбинантные молекулы нуклеиновых кислот или полинуклеотиды могут быть вставлены в вектор. Могут использоваться невирусные векторы, такие как плазмидные экспрессионные векторы, или вирусные векторы. Тип векторов и методика вставки конструкции нуклеиновой кислоты по данному изобретению известны специалисту в данной области. Молекула нуклеиновой кислоты или полинуклеотид по настоящему изобретению не встречаются в природе в конструкции, описанной в настоящем изобретении. Другими словами, гетерологичная нуклеотидная последовательность в природе не объединена с элементами генома родительского вируса (например, промотором, ОRF, сигналом полиаденилирования, рибозимом).

[0056] Используемый в рамках изобретения термин «рекомбинантный вирус» следует понимать, как ссылку на «родительский вирус», содержащий по меньшей мере одну гетерологичную последовательность нуклеиновой кислоты.

[0057] Термин «идентичность последовательностей», используемый в рамках изобретения, относится к степени, в которой последовательности идентичны по нуклеотидной или аминокислотной основе на протяжении окна сравнения. Таким образом, «процент идентичности последовательностей» рассчитывают путем сравнения двух оптимально выровненных последовательностей в окне сравнения, определения количества положений, в которых присутствуют идентичные нуклеотидные основания (например, А, Т, С G, I) или идентичные аминокислотные остатки (например, Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys и Met) в обеих последовательностях, получая число совпадающих положений, деления числа совпадающих положений на общее число положений в окне сравнения (т.е. размер окна) и умножения результата на 100 для получения процента идентичности последовательностей. Для целей настоящего изобретения «идентичность последовательностей» будет означать «процент совпадений», рассчитываемый с помощью компьютерной программы DNASIS (версия 2.5 для Windows; доступна от Hitachi Software Engineering Co., Ltd., South San Francisco, California, USA) с использованием стандартных значений по умолчанию, используемых в справочном руководстве, прилагаемом к программе.

[0058] Термины «сигнальная последовательность» или «сигнальный пептид» относятся к короткому (длинной от примерно 3 до примерно 60 аминокислот) пептиду, который управляет переносом белка во время или после трансляции из цитоплазмы в некоторые органеллы, такие как, например, ядро, митохондриальный матрикс и эндоплазматическая сеть. В случае белков, имеющих ER-направленный сигнальный пептид, сигнальные пептиды, как правило, отщепляются от белка-предшественника с помощью сигнальной пептидазы после переноса белков в ER, а полученные белки перемещаются по секреторным путям к своему внутриклеточному (например, в аппарат Гольджи, клеточную мембрану или клеточную стенку) или внеклеточному местоположению. «ER-направленные сигнальные пептиды» в контексте данного изобретения включают аминоконцевые гидрофобные последовательности, которые, как правило, ферментативно удаляются после перехода части или всего белка через ER-мембрану в просвет ER. Таким образом, в данной области известно, что последовательность сигнального пептида может присутствовать в виде части предшественника белка, но, как правило, отсутствует в зрелой форме белка.

[0059] «Сходство» относится к процентному количеству аминокислот, которые являются идентичными или представляют собой консервативные замены, определенные в таблице А ниже. Сходство может определяться с помощью программ сравнения последовательностей, таких как GAP (Deveraux et al. 1984, Nucleic Acids Research12: 387-395). Таким образом, последовательности с аналогичной или существенно отличающийся длиной относительно приведенных в данном описании можно сравнить путем вставки разрывов при выравнивании, причем такие разрывы определяются, например, с помощью алгоритма сравнения, используемого в GAP.

Таблица A: типовые консервативные аминокислотные замены

Исходный остаток Типовые замены
Ala Ser
Arg Lys
Asn Gln, His
Asp Glu
Cys Ser
Gln Asn
Glu Asp
Gly Pro
His Asn, Gln
Ile Leu, Val
Leu Ile, Val
Lys Arg, Gln, Glu
Met Leu, Ile,
Phe Met, Leu, Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp, Phe
Val Ile, Leu

[0060] Оптимальное выравнивание последовательностей для выравнивания окна сравнения может быть проведено с помощью компьютеризованных реализаций алгоритмов (GAP, BESTFIT, FASTA и TFASTA в Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) или путем анализа и лучшего выравнивания (то есть, дающего в результате наибольший процент гомологии в окне сравнения), получаемого любым из предложенных различных способов. Также можно упомянуть семейство программ BLAST, например, раскрытых в Altschul et al., 1997, Nucl. Acids Res.25:3389. Подробное обсуждение анализа последовательностей можно найти в Unit 19.3 of Ausubel et al., "Current Protocols in Molecular Biology", John Wiley & Sons Inc, 1994-1998, Chapter 15.

[0061] Термины «субъект»» «пациент», «хозяин» или «индивидуум», используемые в настоящем описании взаимозаменяемо, относятся к любому субъекту, в частности, позвоночному субъекту и, еще более конкретно, к млекопитающему субъекту, для которых желательно проведение терапии или профилактики. Подходящие позвоночные животные, которые попадают в объем изобретения, включают, но не ограничиваются ими, любого члена подтипа Хордовые, включая приматов (например, человека, хвостатых обезьян и бесхвостых обезьян, и включает виды хвостатых обезьян, например, из рода Macaca (например, яванского макака, такого как Macaca fascicularis, и/или резус-макака (Macaca mulatta)) и бабуина (Papio ursinus), а также мармозеток (вид из рода Callithrix), беличьих обезьян (вид из рода Saimiri) и тамаринов (вид из рода Saguinus), а также видов бесхвостых обезьян, таких как шимпанзе (Pan troglodytes)), грызунов (например, мышей, крыс, морских свинок), зайцеобразных (например, кроликов, зайцев), бычьих (например, коров), овечьих (например, овец), козьих (например, коз), представителей семейства свиней (например, свиней), лошадиных (например, лошадей), собачьих (например, собак), кошачьих (например, кошек), птичьих (например, кур, индеек, уток, гусей, птиц-компаньонов, таких как канарейки, волнистые попугайчики и т.д.), морских млекопитающих (например, дельфинов, китов), рептилий (змей, лягушек, ящериц и т.д.), и рыб. Предпочтительным субъектом является человек, нуждающийся в лечении или профилактике заболевания. Однако следует понимать, что указанные выше термины не подразумевают присутствие симптомов.

[0062] Термин «трансген» используется в настоящем описании для описания генетического материала, который искусственно введен или будет введен в геном организма-хозяина, и который передается потомству этого хозяина. В некоторых вариантах осуществления он придает желаемое свойство клетке млекопитающего или ортопоксвирусному вектору, в который он введен, или иным образом приводит к желаемому терапевтическому или диагностическому результату.

[0063] В рамках изобретения термины «лечение», «обработка» и т.п. относятся к получению желаемого фармакологического и/или физиологического эффекта. Эффект может быть профилактическим с точки зрения полного или частичного предупреждения заболевания или симптомов, и/или может быть терапевтическим с точки зрения частичного или полного избавления от заболевания и/или неблагоприятного эффекта, возникающего вследствие заболевания. «Лечение», в контексте настоящего изобретения охватывает любое лечение заболевания у млекопитающего, в частности у человека, и включает; (а) предупреждение возникновения заболевания у пациента, который может быть предрасположен к заболеванию, но у которого оно еще не диагностировано; (b) остановку заболевания, т.е. прекращение его развития; и (c) ослабление заболевания, то есть регрессию заболевания.

[0064] Термины «дикого типа», «природный», «нативный» и т.п. в отношении организма, полипептида или нуклеотидной последовательности означают, что полипептид, организм или нуклеотидная последовательность существуют в природе или доступны по меньшей мере в одном природном организме, который не изменен, мутирован или иным образом модифицирован человеком.

[0065] Варианты включают молекулы нуклеиновых кислот, достаточно близкие с указанной молекулой или ее комплементарными формами по всей длине или ее части, так что они могут селективно гибридизоваться в условиях средней или высокой жесткости, или которые имеют примерно от 60% до 90% или от 90 до 98% идентичности по последовательности с нуклеотидными последовательностями, определяющими указанный фактор видоспецифичности поксвируса, в окне сравнения, включающем по меньшей мере около 15 нуклеотидов. Предпочтительно, чтобы область гибридизации составляла в длину от 12 до примерно 18 нуклеотидов или более. Предпочтительно, чтобы процент идентичности между конкретной нуклеотидной последовательностью и эталонной последовательностью составлял по меньшей мере около 80% или 85% или более, предпочтительно, около 90% идентичности или более, например, около 95%, 96%, 97%, 98%, 99% или более. В изобретении охвачен процент идентичности между 80% и 100%. Длина нуклеотидной последовательности зависит от ее предполагаемой функции. Гомологи охвачены изобретением. Термин «гомолог» «гомологичные гены» или «гомологи» относится в широком смысле к функционально и структурно родственным молекулам, включая молекулы из других видов. Гомологи и ортологи являются примерами вариантов.

[0066] Идентичность нуклеотидных последовательностей может быть определена следующим образом. Целевую нуклеотидную последовательность используют для поиска по базе данных нуклеотидных последовательностей, такой как база данных GenBank (доступная на веб-сайте http://www.ncbi.nln.nih.gov/blast/), с использованием программы BLASTM version 2.1 (на основе Altschul et al. (1997) Nucleic Acids Research 25:3389-3402). Программа используется в не вносящем разрывы режиме. Фильтрация по умолчанию используется для удаления гомологий по последовательности из-за областей низкой сложности. Используются параметры, принятые по умолчанию в BLASTM.

[0067] Идентичность аминокислотных последовательностей может быть определена следующим образом. Целевую полипептидную последовательность используют для поиска по базе данных полипептидных последовательностей, такой как базы данных GenBank (доступна на веб-сайте http://www.ncbi.nln.nih.gov/blast/), с использованием программы BLASTP. Программа используется в не вносящем разрывы режиме. Фильтрация по умолчанию используется для удаления гомологий по последовательности из-за областей низкой сложности. Используются параметры, принятые по умолчанию в BLASTP. Для фильтрации последовательностей низкой сложности могут использовать программу SEG.

[0068] Предпочтительные последовательности будут гибридизоваться в жестких условиях с эталонной последовательностью или ее комплементом. Термин «гибридизуется в жестких условиях» и его грамматические эквиваленты относятся к способности молекулы нуклеиновой кислоты гибридизоваться с молекулой нуклеиновой кислоты-мишени (например, молекулой нуклеиновой кислоты-мишени, иммобилизованной на ДНК или РНК-блоте, таком как Саузерн-блот или Нозерн-блот) при определенных условиях, температуре и концентрации соли. В отношении молекул нуклеиновых кислот больше 100 оснований в длину типичными жесткими условиями гибридизации являются температура не более чем на 25°C-30°C (например, 10°C) ниже температуры плавления (Tm) нативного дуплекса (см. в общем, Sambrook et al., (supra); Ausubel et al., (1999)). Tm для молекул нуклеиновых кислот больше 100 оснований в длину можно рассчитать по формуле Tm=81,5+0,41%⋅(G+C-log(Na+)). В отношении молекул нуклеиновых кислот, имеющих длину менее 100 оснований, примерными жесткими условиями гибридизации является температура на 5°C-10°C ниже Tm.

[0069] Термин «делеция» в контексте настоящего изобретения означает удаление всей или части кодирующей области гена-мишени. Термин также охватывает любую форму мутации или трансформации, которые подавляют экспрессию гена гена-мишени или подавляют или значительно снижают уровень или активность кодируемого белка.

[0070] Ссылка на «ген» включает в себя ДНК, соответствующую экзонам или открытой рамке считывания гена. Ссылка в настоящем описании на «ген» также подразумевает включение: классического геномного гена, состоящего из транскрипционных и/или трансляционных регуляторных последовательностей и/или кодирующей области и/или нетранслируемых последовательностей (т.е. интронов, 5'- и 3'-нетранслируемых последовательностей); или мРНК или кДНК, соответствующие кодирующим областям (т.е. экзонам) и 5'- и 3'-нетранслируемым последовательностям гена.

[0071] Под «регуляторным элементом» или «регуляторной последовательностью» подразумеваются нуклеотидные последовательности (например, ДНК), которые необходимы для экспрессии функционально связанной последовательности в конкретной клетке-хозяине. Регуляторные последовательности, которые подходят для прокариотических клеток, например, включают промотор и, необязательно, цис-действующие последовательности, такие как операторная последовательность и сайт связывания рибосомы. Регуляторные последовательности, которые подходят для эукариотических клеток, включают промоторы, сигналы полиаденилирования, транскрипционные энхансеры, трансляционные энхансеры, лидерные или завершающие последовательности, которые модулируют стабильность мРНК, а также направляющие последовательности, которые направляют продукт, кодируемый транскрибируемы полинуклеотидом, во внутриклеточный компартмент в клетке или во внеклеточную среду.

[0072] Химерные конструкции, подходящие для создания модифицированных клеток млекопитающих по настоящему изобретению, содержат последовательность нуклеиновой кислоты, кодирующей фактор видоспецифичности ортопоксвируса, которая функционально связана с регуляторной последовательностью. Регуляторная последовательность, соответственно, содержит транскрипционные и/или трансляционные регуляторные последовательности, которые будут совместимы с процессом экспрессии в данной клетке. Как правило, транскрипционные и трансляционные регуляторные последовательности включают в себя, но не ограничиваются ими, промоторную последовательность, 5'-некодирующую область, цис-регуляторную область, такую как функциональный сайт связывания для регулирующего транскрипцию белка или регулирующего трансляцию белка, вышележащую открытую рамку считывания, связывающиеся с рибосомой последовательности, сайт инициации транскрипции, сайт инициации трансляции и/или нуклеотидную последовательность, которая кодирует лидерную последовательность, кодон терминации, сайт остановки трансляции и 3'-нетранслируемую область. Предусмотрены конститутивные или индуцируемые промоторы, известные в данной области. Промоторами могут являться либо природные промоторы, либо гибридные промоторы, которые сочетают в себе элементы более чем одного промотора.

[0073] Предусмотренные промоторные последовательности могут быть нативными для клетки млекопитающего или могут быть получены из другого источника, если промоторная область функционирует в выбранном организме. Выбор промотора будет отличаться в зависимости от предполагаемой клетки-хозяина. Например, промоторы, которые могут быть использованы для экспрессии в клетках млекопитающих, включают среди прочего промотор металлотионеина, который может индуцироваться в ответ на добавление тяжелых металлов, таких как кадмий, β-актиновый промотор, а также вирусные промоторы, такие как промотор большого Т-антигена вируса SV40, немедленный ранний (IE) промотор цитомегаловируса человека (CMV), LTR-промотор вируса саркомы Рауса, LTR-промотор мышиного вируса опухоли молочной железы, основной поздний промотор аденовируса (Ad MLP), промотор вируса простого герпеса и HPV-промотор, в частности, верхнюю регуляторную область (URR) HPV. Все эти промоторы подробно описаны и легко доступны в данной области.

[0074] В настоящем изобретении также могут использоваться энхансерные элементы для повышения уровня экспрессии с конструкций для экспрессии в млекопитающих. Примеры включают в себя энхансер раннего гена SV40, описанный, например, в Dijkema et al. (1985) EMBO J. 4:761, энхансер/промотор, полученный из длинного концевого повтора (LTR) вируса саркомы Рауса, описанный, например, в Gorman et al., (1982) Proc. Natl. Acad. Sci. USA 79:6777, и элементы, полученные из CMV человека, описанные, например, в Boshart et al. (1985) Cell 41:521, такие как элементы, включенные в последовательность интрона А CMV.

[0075] Химерная конструкция может также содержать 3’-нетранслируемую последовательность. 3’-нетранслируемая последовательность относится к такому участку гена, который содержит сегмент ДНК, содержащий сигнал полиаденилирования и любые другие регуляторные сигналы, способные осуществлять процессинг мРНК или экспрессию гена. Сигнал полиаденилирования характеризуется осуществлением добавления цепочки полиадениловой кислоты к 3’—концу предшественника мРНК. Сигналы полиаденилирования обычно распознаются по наличию гомологии с канонической формой 5'-ААТААА-3', хотя вариации не являются редкостью. 3'-нетранслируемая регуляторная последовательность ДНК, предпочтительно, включает примерно от 50 до 1000 нуклеотидов и может содержать последовательности терминации транскрипции и трансляции в дополнение к сигналу полиаденилирования и любые другие регуляторные сигналы, способные осуществлять процессинг мРНК или экспрессию гена.

[0076] В некоторых вариантах осуществления настоящего изобретения химерная конструкция дополнительно содержит селективный маркерный ген, позволяющий отбор клеток, содержащих конструкцию. Селективные гены хорошо известны в данной области и будут совместимы с экспрессией в клетке, представляющей интерес.

[0077] В одном варианте осуществления экспрессия ортопоксвирусного структурного или участвующего в сборке вируса гена находится под контролем промотора. В одном неограничивающем варианте осуществления промотор представляет собой клеточный конститутивный промотор, такой как EF1-альфа-промотор человека (промотор гена фактора элонгации 1 альфа человека), DHFR-промотор (промотор гена дигидрофолатредуктазы) или PGK-промотор (промотор гена фосфоглицераткиназы), которые обеспечивают экспрессию CP77 на уровне, достаточном для поддержания размножения вируса в отсутствии значительного токсического действия на клетку-хозяина. Промоторы могут также быть индуцируемыми, такими как клеточный индуцируемый промотор, ΜΤΉ (гена металлотионеина), а также в клетках млекопитающих используются вирусные промоторы, такие как промоторы CMV, RSV,SV-40 и MoU3.

[0078] В первом аспекте настоящее изобретение относится к модифицированной клетке млекопитающего, в которой геном клетки модифицируют для включения последовательности, кодирующей CP77 под контролем такого промотора, что модифицированная клеточная линия поддерживает размножение поксвируса, который способен в меньшей степени или не способен размножаться в немодифицированной клетке.

[0079] Во втором аспекте настоящее изобретение относится к способу размножения ортопоксвируса, который не размножается в клетках CHO, причем способ включает размножение поксвируса in vitro в линии клеток млекопитающего, где клеточную линию модифицируют, чтобы она кодировала и экспрессировала CP77 под контролем промотора.

[0080] В одном варианте осуществления геном клетки дополнительно содержит последовательность, кодирующую D13L под контролем промотора, и/или дополнительно содержит последовательность, кодирующую K1L под контролем промотора.

[0081] В другом варианте осуществления клетка представляет собой непрерывную линию клеток, предпочтительно, клетки СНО.

[0082] В других вариантах осуществления клетка может быть клеткой человека, клеткой примата, клеткой хомячка или клеткой кролика.

[0083] В другом варианте осуществления изобретения ген CP77, ген D13L и/или ген K1L находится под контролем промотора млекопитающего.

[0084] В другом варианте осуществления, экспрессия гена CP77 поддерживает размножение вируса, чтобы получить выход вируса, равный наблюдаемому в пермиссивной линии клеток, и, предпочтительно, поддерживает коэффициент амплификации репликации вируса более 500.

[0085] В другом варианте осуществления CP77, D13L и/или K1L кодируются непрерывной последовательностью нуклеотидных кодонов, оптимизированных для экспрессии в клетках млекопитающих.

[0086] Пример последовательности K1L приведен в SEQ ID NO: 6 и SEQ ID NO: 7.

[0087] Изобретение относится в широком смысле к модифицированным (рекомбинантные или трансформированным) клеткам и к способу производства in vitro вирусных векторов в культивируемых клетках-хозяевах высших эукариот, где клетку генетически модифицируют таким образом, чтобы усилить или облегчить размножение вирусного вектора в популяции клеток или посредством популяции клеток in vitro. В одном неограничивающем варианте осуществления изобретение предусматривает размножение посквирусов на основе вируса осповакцины в модифицированных клетках яичников китайского хомячка (СНО).

[0088] Как известно специалистам в данной области, клетки яичника китайского хомячка (CHO), полученные из яичника хомяка, Cricetulus griseus, являются наиболее часто используемыми клетками млекопитающих для биопромышленного и GMP-производства рекомбинантных белковых терапевтических препаратов, включая антитела. Популярность клеток CHO в этой области обусловлена отчасти их быстрым ростом и высоким уровнем продукции белка. В результате, клеточные линии CHO хорошо охарактеризованы. Подходящие клеточные линии CHO включают, без ограничения, линии A2, A2H, XrS6, CHO-K1, CHO/dhfr, RR-CHO-K1, UT-I, P22, CHO-1C6, Lec1, Lec2, Lec8, Pro-5 и CDKXB1. Часто используется клеточная линия CHO-K1, депонированная в АТСС под номерами ATCC CLL-61 или ATCC CRL-9618. Линия клеток СНО-K1 была получена как субклон из родительской клеточной линии СНО, выведенной из образца биопсии яичника взрослого китайского хомячка ученым Puck Т. (1957). В настоящей спецификации описаны модифицированные клетки помимо модифицированных клеток СНО.

[0089] Для достижения максимального выхода вируса, клеточные линии, такие как клетки СНО, могут быть адаптированы к суспензионной культуре с использованием стандартных методик. Ссылка на рекомбинантную или модифицированную клетку включает ее потомство. Клетки могут продаваться в любой форме, включая замороженную форму или жидкую суспензионную форму. Клетки могут продаваться зараженными поксвирусным вектором.

[0090] Ссылка в настоящем описании на CP77 обозначает ген видоспецифичности вируса коровьей оспы, описанный в Sphener et al. (1988) и Hsiao et al. (2006), и функциональные ортологи и модифицированные формы, способные по определению в настоящем описании поддерживать рост осповирусов при экспрессии в качестве гетерологичного гена в геноме клетки-хозяина млекопитающего. Ссылка на «модифицированные формы» включает в себя изменение (например, делецию, замену или добавление) относительно последовательности дикого типа или эталонной последовательности. Эталонная нуклеотидная последовательность представлена в SEQ ID NO: 1. Модифицированные формы имеют по меньшей мере 80% идентичности по последовательности в кодирующей области или в одном или нескольких ее участках, содержащих по меньшей мере 200 непрерывных пар оснований. Модифицированные формы включают кодон-оптимизированные формы, описанные в настоящем описании, которые оптимизированы для экспрессии в клетках млекопитающих или других высших эукариот, включая клетки СНО. Ссылка на CP77 включает ортологи, то есть гены с той же функцией, присутствующие в других видах, или идентифицированные под разными названиями. Фактор видоспецифичности вируса коровьей оспы, CF77, также упоминается как VHR1, CHOhr и CPXV025. Ген CHOhr/CP77 в штамме Western Reserve (WR) вируса осповакцины существенно фрагментирован и не способен продуцировать функциональный фактор. CP77 отсутствует в MVA и штамме Copenhagen.

[0091] Ссылка в настоящем описании на «CP77», «D13L» и «K1L» включает в себя функциональные ортологи и функциональные варианты. «Функциональный» относится к описанному в настоящем описании качеству экспрессии (то есть, транскрипции и трансляции), управляемой из генома культивируемой клетки млекопитающего, для поддержания размножения поксвирусов в цитоплазме экспрессирующей клетки. Термин «размножаться» включает внутриклеточное размножение и внеклеточное размножение и охватывает производство зрелых вирусных частиц.

[0092] В одном варианте осуществления популяция модифицированных клеток поддерживает размножение поксвируса, который способен в меньшей степени или практически не способен размножаться в немодифицированной контрольной клетке. Невозможность размножения означает, что передачи из клетки в клетку или от субъекта к субъекту, как правило, не происходит.

[0093] Ссылка на «немодифицированную контрольную клетку» включает в себя модифицированную клетку в том виде, в котором она существовала до модификации для кодирования по меньшей мере одного вирусного фактора видоспецифичности, выбранного из группы, состоящей из CP77, K1L и SPI-1, и для экспрессии их же из своего генома под контролем промотора, а также другие подходящие контрольные клетки, известные в данной области.

[0094] Например, поксвирусы, такие как MVA и вирус осповакцины, не могут размножаться в клетках СНО. Однако, как неожиданно было выяснено в настоящем изобретении, клетки СНО, рекомбинантно модифицированные для экспрессии CP77 из своего генома под контролем промотора, способны поддерживать размножение не только вируса осповакцины, но также и его производных, таких как вирус осповакцины MVA. После размножения в указанных модифицированных клетках СНО-CP77, MVA и вирус осповакцины по-прежнему не могут размножаться в немодифицированных клетках СНО или в других подходящих контрольных клетках.

[0095] Ссылка в настоящем описании на «поксвирус» включает рекомбинантный поксвирусный вектор, кодирующий гетерологичную молекулу, представляющую интерес (например, представляющий интерес антиген), в качестве лекарственного, профилактического, диагностического или терапевтического агента. Такие рекомбинантные поксвирусные векторы, как правило, предназначены для использования в качестве вакцин против заболеваний и патологических состояний, вызываемых другими вирусами (не осповирусами). Также термин поксвирус включает в себя выделенные поксвирусы и их производные, предложенные для применения в качестве терапевтической или профилактической вакцины против поксвирусной инфекции, такой как заражение вирусом оспы.

[0096] Ссылка в настоящем описании на «на основе вируса осповакцины» включает вирус осповакцины и производные и модифицированные формы вируса осповакцины. Производные на основе вируса осповакцины включают, но никаким образом не ограничиваются ими, MVA и NYVAC. Ссылка на MVA и NYVAC включает в себя штаммы или производные этих поксвирусов, известных в данной области. Модифицированные формы могут иметь модификации в одном и до десяти или более генов. Термин «модификация» означает изменение (например, делецию, замену или добавление) относительно последовательности дикого типа или эталонной последовательности. Ссылка на «аттенуированный» включает поксвирус, который не размножается или размножается в значительно меньшей степени в организме соответствующем пациента по сравнению с неаттенуированной формой того же вируса. Термин также включает вирусы, которые являются непатогенными для пациента.

[0097] В одном из вариантов осуществления клетка представляет собой непрерывную линию клеток. Менее необходимо, чтобы модифицированная клетка представляла собой клеточную линию, способную делиться непрерывно. Клетки млекопитающих или высших эукариот могут быть модифицированы в соответствии с настоящим изобретением, а затем трансформированы или иммортализованы, для того чтобы стать непрерывно делящейся клеточной линией. Однако клетки до модификации обычно представляют собой хорошо изученные и непрерывно делящиеся биотехнологически совместимые клеточные линии, известные в данной области. Такие клетки обычно доступны в депозитариях, таких, как Американская коллекция типовых культур (АТСС) или Европейская коллекция клеточных культур (ЕСАСС).

[0098] Подходящие клеточные линии млекопитающих включают, но не ограничиваются ими, RK18, BHK, VERO, HBOC-143B, HaCat, HepG2, HeLa, HT1080, HEK-293, RD, COS-7, CHO, Jurkat, HUT, SUPT, C8166, MOLT4/клон 8, MT-2, MT-4, H9, PM1, CEM, клетки миеломы (например, клетки SB20) и CEMX174, доступны, например, от АТСС.

[0099] В одном варианте осуществления клетка представляет собой клетку CHO. Известные клеточные линии СНО, которые не кодируют гены видоспецифичности вируса, не поддерживают производство вируса осповакцины или его производных, которые по существу не могут размножаться в человеке.

[0100] В некоторых вариантах осуществления клетка представляет собой клетку человека, клетку примата, клетку хомячка или клетку кролика.

[0101] Химерные конструкции, подходящие для создания модифицированных клеток млекопитающих по настоящему изобретению, содержат последовательность нуклеиновой кислоты, кодирующую фактор видоспецифичности ортопоксвируса, которая функционально связана с регуляторной последовательностью. Регуляторная последовательность, соответственно, содержит транскрипционные и/или трансляционные регуляторные последовательности, которые будут совместимы с процессом экспрессии в данной клетке. Как правило, транскрипционные и трансляционные регуляторные последовательности включают в себя, но не ограничиваются ими, промоторную последовательность, 5'-некодирующую область, цис-регуляторную область, такую как функциональный сайт связывания для регулирующего транскрипцию белка или регулирующего трансляцию белка, вышележащую открытую рамку считывания, связывающиеся с рибосомой последовательности, сайт инициации транскрипции, сайт инициации трансляции и/или нуклеотидную последовательность, которая кодирует лидерную последовательность, кодон терминации, сайт остановки трансляции и 3'-нетранслируемую область. Предусмотрены конститутивные или индуцируемые промоторы, известные в данной области. Промоторами могут являться либо природные промоторы, либо гибридные промоторы, которые сочетают в себе элементы более чем одного промотора.

[0102] Предусмотренные промоторные последовательности могут быть нативными для клетки млекопитающего или могут быть получены из другого источника, если промоторная область функционирует в выбранном организме. Выбор промотора будет отличаться в зависимости о предполагаемой клетки-хозяина. Например, промоторы, которые могут быть использованы для экспрессии в клетках млекопитающих, включают среди прочего промотор металлотионеина, который может индуцироваться в ответ на добавление тяжелых металлов, таких как кадмий, β-актиновый промотор, а также вирусные промоторы, такие как промотор большого Т-антигена вируса SV40, немедленный ранний (IE) промотор цитомегаловируса человека (CMV), LTR-промотор вируса саркомы Рауса, LTR-промотор мышиного вируса опухоли молочной железы, основной поздний промотор аденовируса (Ad MLP), промотор вируса простого герпеса и HPV-промотор, в частности, верхнюю регуляторную область (URR) HPV. Все эти промоторы подробно описаны и легко доступны в данной области.

[0103] В настоящем изобретении также могут использоваться энхансерные элементы для повышения уровня экспрессии с конструкций для экспрессии в млекопитающих. Примеры включают в себя энхансер раннего гена SV40, описанный, например, в Dijkema et al. (1985) EMBO J. 4:761, энхансер/промотор, полученный из длинного концевого повтора (LTR) вируса саркомы Рауса, описанный, например, в Gorman et al., (1982) Proc. Natl. Acad. Sci. USA 79:6777, и элементы, полученные из CMV человека, описанные, например, в Boshart et al. (1985) Cell 41:521, такие как элементы, включенные в последовательность интрона А CMV.

[0104] Химерная конструкция может также содержать 3’-нетранслируемую последовательность. 3’-нетранслируемая последовательность относится к тому участку гена, который содержит сегмент ДНК, содержащий сигнал полиаденилирования и любые другие регуляторные сигналы, способные осуществлять процессинг мРНК или экспрессию гена. Сигнал полиаденилирования характеризуется осуществлением добавления цепочки полиадениловой кислоты к 3’—концу предшественника мРНК. Сигналы полиаденилирования обычно распознаются по наличию гомологии с канонической формой 5'-ААТААА-3', хотя вариации не являются редкостью. 3'-нетранслируемая регуляторная последовательность ДНК, предпочтительно, включает примерно от 50 до 1000 нуклеотидов и может содержать последовательности терминации транскрипции и трансляции в дополнение к сигналу полиаденилирования и любые другие регуляторные сигналы, способные осуществлять процессинг мРНК или экспрессию гена.

[0105] В некоторых вариантах осуществления настоящего изобретения химерная конструкция дополнительно содержит селективный маркерный ген, позволяющий отбор клеток, содержащих конструкцию. Селективные гены хорошо известны в данной области и будут совместимы с экспрессией в клетке, представляющей интерес.

[0106] В одном варианте осуществления экспрессия гена видоспецифичности вируса находится под контролем промотора. В одном неограничивающем варианте осуществления промотор представляет собой клеточный конститутивный промотор, такой как EF1-альфа-промотор человека (промотор гена фактора элонгации 1 альфа человека), DHFR-промотор (промотор гена дигидрофолатредуктазы) или PGK-промотор (промотор гена фосфоглицераткиназы), которые обеспечивают экспрессию CP77 на уровне, достаточном для поддержания размножения вируса в отсутствии значительного токсического действия на клетку-хозяина. Промоторы могут также быть индуцируемыми, такими как клеточный индуцируемый промотор, ΜΤΉ (из гена металлотионеина), а также в клетках млекопитающих используются вирусные промоторы, такие как промоторы CMV, RSV,SV-40 и MoU3.

[0107] Соответственно, в одном варианте осуществления экспрессия гена видоспецифичности вируса поддерживает размножение вируса, чтобы получить выход вируса, равный наблюдаемому в пермиссивной линии клеток, и, предпочтительно, поддерживает коэффициент амплификации репликации вируса более 500. Экспрессия гена видоспецифичности вируса поддерживает размножение вирусов при отсутствии значительной токсичности для клетки-хозяина. Значительная токсичность для клетки-хозяина относится к уровню экспрессии гена видоспецифичности вируса, который снижает выход вируса из-за преждевременной смерти или неспособности к делению клетки-хозяина. Опытному специалисту хорошо известны способы качественной или количественной оценки параметров клеток-хозяев, таких как жизнеспособность и размножение, а также параметров вирусов, таких как экспрессия гена видоспецифичности вируса, репликация вируса и выход вируса.

[0108] В одном варианте осуществления поксвирус представляет собой поксвирус позвоночных, помимо ортопоксвируса, который кодирует функциональный CP77 или ортолог CP77. Вирус коровьей оспы кодирует CP77 и поэтому не охвачен в этом аспекте. Ортопоксвирусы включают в себя вирус буйволиной оспы, вирус коровьей оспы, вирус верблюжьей оспы, вирус мышиной оспы, вирус обезьяньей оспы, вирус кроличьей оспы, вирус оспы енотов, teterapox вирус, вирус осповакцины, вирус оспы полевок, вирус оспы скунсов и вирус болезни Уазин-Гишу лошадей. Другие рода включают парапоксвирусы, авипоксвирусы, каприпоксвирусы, лепорипоксвирусы, вирусы оспы свиней, вирусы контагиозного моллюска и вирусы рода Yatapoxvirus.

[0109] В одном варианте осуществления поксвирусом является MVA или производное MVA, которые по существу не могут реплицироваться в человеке/субъекте.

[0110] В одном варианте осуществления поксвирусом является вирус осповакцины или производное вируса осповакцины, которые по существу не реплицируются in vivo в человеке.

[0111] В другом варианте осуществления поксвирус пригоден для использования в качестве противооспенной вакцины.

[0112] В одном дополнительном варианте осуществления поксвирус представляет собой рекомбинантный поксвирусный вектор, который кодирует и экспрессирует гетерологичную представляющую интерес молекулу, такую как антиген, представляющий медицинский интерес, где рекомбинантный поксвирусный вектор предназначается для использования в качестве диагностического, терапевтического или профилактического агента у субъекта.

[0113] Ссылка в настоящем описании на K1L обозначает ген, описанный Shisler and Jin (2004) и его ортологи или модифицированные формы.

[0114] Ссылка в настоящем описании на SPI-1 обозначает ген видоспецифичности вируса, описанный Brookes et al. (1995), или его ортологи и модифицированные формы.

[0115] В некоторых вариантах осуществления и во избежание сомнений настоящий способ размножения вирусов не требует добавления генов в геном поксвируса. Это, конечно, не исключает модификации вирусных векторов для других целей, таких как, без ограничения, кодирование гетерологичных молекул в качестве антигенов, представляющих интерес для целей вакцинации или вызывающих иммунный ответ у пациента.

[0116] Транскрипция гена видоспецифичности вируса в ядре клетки-хозяина и трансляция кодируемого продукта происходят в инфицированной клетке и являются достаточными для размножения поксвирусов в цитоплазме клетки-хозяина. Без ограничения каким-либо конкретным способом действия, предполагается, что CP77 представляет собой вирусный защитный агент.

[0117] В одном иллюстративном варианте осуществления геном видоспецифичности поксвируса, экспрессируемым зараженной клеточной линией, является CP77. Как показано в примере 4, когда ядро клетки СНО модифицировано для кодирования и экспрессии CP77, клетка способна выдержать амплификацию вируса, как будто она является пермиссивной линией клеток, такой как 143В. Как правило, слитые бляшки наблюдаются в течение двух дней с момента заражения.

[0118] В другом варианте осуществления степень размножения вирусов в модифицированной клетке дает коэффициент амплификации по меньшей мере от 10 до 5000. Коэффициенты амплификации составляют в некоторых вариантах осуществления от 500 до 3000 или от 1000 до 4000.

[0119] В другом варианте осуществления промотор, запускающий экспрессию гетерологичного гена видоспецифичности поксвируса, обеспечивает уровень экспрессии гетерологичного гена видоспецифичности поксвируса в клетке. Уровень экспрессии CP77 может быть аналогичным или может превышать уровень, продуцируемый вирусом коровьей оспы в пермиссивных клетках.

[0120] В другом варианте осуществления промотор, запускающий экспрессию гетерологичного гена видоспецифичности поксвируса, обеспечивает уровень экспрессии гетерологичного гена в клетке, достаточный для размножения вирусов по меньшей мере на уровне размножения вирусов в пермиссивной клетке.

[0121] В одном варианте осуществления продукция поксвируса в клеточной линии СНО равна или превышает уровень продукции поксвируса в положительной контрольной клетке.

[0122] В одном варианте осуществления уровень продукции вируса MVA в клетках СНО по существу равен или превышает уровень продукции вируса MVA в клетках CEF.

[0123] В одном варианте осуществления, CP77, K1L и/или SPI-1 кодируются непрерывной последовательностью нуклеотидов, кодоны которой оптимизированы для экспрессии в клетках млекопитающих.

[0124] Как описано далее, кодон-оптимизированная нуклеотидная последовательность, кодирующая CP77, может иметь менее 80% или менее 75% идентичности по нуклеотидной последовательности с последовательностью, кодирующей секретируемый белок CP77 из штамма Brighton Red вируса коровьей оспы (UniprotKB/Swiss-Prot: P12932.1). В некоторых вариантах осуществления кодон-оптимизированная последовательность имеет последовательность, представленную в SEQ ID NO: 1, или представляет собой функциональный вариант, содержащий нуклеотидную последовательность, которая имеет по меньшей мере 70% идентичности по последовательности с последовательностью, представленной в SEQ ID NO: 1. В некоторых вариантах осуществления фактор видоспецифичности вируса, CP77, имеет аминокислотную последовательность, представленную в SEQ ID NO: 2, или имеет по меньшей мере 70% идентичности по аминокислотной последовательности с аминокислотной последовательностью, представленной в SEQ ID NO: 2.

[0125] В некоторых вариантах осуществления предусмотрен набор, содержащий или состоящий в основном из популяции (такой как клональная популяция) модифицированных клеток млекопитающих, экспрессирующих CP77 в своем геноме, как описано в настоящем описании. В некоторых вариантах осуществления модифицированная клетка не содержит вирус осповакцины.

[0126] В настоящем описании далее описан процесс или способ производства поксвируса, который не размножается в клетках СНО, причем способ включает размножение поксвируса in vitro в линии клеток млекопитающих, где клеточная линия модифицирована, чтобы она кодировала и экспрессировала CP77 под контролем промотора. Способ может дополнительно включать в себя выделение вирусных частиц.

[0127] Клеточная линия обычно представляет собой линию клеток млекопитающих, известную специалистам в данной области техники, как подходящая для получения лекарственного препарата или терапевтического, диагностического или профилактического агента.

[0128] В спецификации описана модифицированная клетка CHО, где клетка СНО модифицирована таким образом, чтобы она кодировала CP77 и экспрессировала его со своего генома под контролем промотора.

[0129] В одном варианте осуществления модифицированная клеточная линия CHO поддерживает размножение вируса, который способен в меньшей степени или не способен размножаться в немодифицированной клетке СНО, которая является клеткой, не экспрессирующей CP77.

[0130] В одном варианте осуществления вирус представляет собой ортопоксвирус, отличающийся от ортопоксвируса, который кодирует CP77. Как известно в данной области, вирус коровьей оспы представляет собой вирус оспы, который кодирует CP77.

[0131] В некоторых вариантах осуществления вирус представляет собой вирус осповакцины или производное вируса осповакцины, который по существу не реплицируется in vivo в организме человека/пациента.

[0132] В некоторых вариантах осуществления настоящего изобретения вирус представляет собой MVA.

[0133] В другом варианте осуществления описание относится к способу размножения поксвируса, который по существу не реплицируется в человеке, причем способ включает: (i) культивирование клеток СНО, трансформированных для экспрессии CP77, и (ii) инфицирование культивируемых клеток CHO по п.(i) поксвирусом, который по существу не реплицируется в человеке.

[0134] В другом варианте осуществления описание относится к способу размножения поксвируса, который по существу не реплицируется в человеке, причем способ включает: (i) культивирование клеток СНО, трансформированных для экспрессии CP77 и D13L и/или K1L, и (ii) инфицирование культивируемых клеток CHO по п.(i) поксвирусом, который по существу не реплицируется в человеке.

[0135] В другом варианте осуществления описание относится к способу размножения MVA, включающему: (i) культивирование клеток СНО, трансформированных для экспрессии CP77 и D13L и/или K1L, и (ii) инфицирование культивируемых клеток CHO по п.(i) вирусом MVA.

[0136] В другом варианте осуществления описание относится к способу размножения производного вируса осповакцины, который по существу не реплицируется в человеке, причем способ включает: (i) культивирование клеток СНО, трансформированных для экспрессии CP77 и D13L и/или K1L, и (ii) инфицирование культивируемых клеток CHO по п.(i) производным вируса осповакцины.

[0137] В другом варианте осуществления описание относится к способу размножения MVA, кодирующего гетерологичный белок, причем указанный способ включает: (i) культивирование клеток СНО, трансформированных для экспрессии CP77 и D13L и/или K1L, и (ii) инфицирование культивируемых клеток CHO по п.(i) вирусом MVA.

[0138] В другом варианте осуществления описание относится к способу размножения производного вируса осповакцины, кодирующего гетерологичный белок, который по существу не реплицируется в человеке, причем способ включает: (i) культивирование клеток СНО, трансформированных для экспрессии CP77 и D13L и/или K1L, и (ii) инфицирование культивируемых клеток CHO по п.(i) производным вируса осповакцины.

[0139] В другом варианте осуществления настоящее описание относится к искусственно созданному вектору, полинуклеотиду или плазмиде, содержащим нуклеотидную последовательность гена видоспецифичности вируса, функционально связанную с регуляторными элементами, такими как промотор для экспрессии в линии клеток млекопитающих. В некоторых вариантах осуществления вирусным геном является ген содержащего домен анкириновых повторов белка CP77 вируса коровьей оспы (UniProtKBSwiss-Prot P12932.1 [025LBR, белок CP77]). В одном варианте осуществления ген видоспецифичности вируса, например, CP77, содержит кодоны, оптимизированные для экспрессии в линии клеток млекопитающих. Подходящие векторы и плазмиды известны в данной области техники.

[0140] В одном варианте осуществления полинуклеотид кодирует CP77. В некоторых вариантах осуществления полинуклеотид содержит нуклеотидную последовательность, представленную в SEQ ID NO: 1 (с оптимизированными кодонами для экспрессии в клетках млекопитающих, таких как CHO). В некоторых вариантах осуществления выделенный полинуклеотид включает нуклеотидную последовательность, представленную в SEQ ID NO: 1, или ее вариант, который кодирует аминокислотную последовательность, представленную в SEQ ID NO: 2.

[0141] В другом варианте осуществления настоящее описание описывает транспозонный вектор для стабильного введения гена видоспецифичности вируса в клетку млекопитающего.

[0142] Настоящее описание также относится к способу трансформации культуры клеток млекопитающих или высших эукариот, который являются по существу не пермиссивными для вируса, в клетки, которые является пермиссивными для вируса, причем указанный способ включает трансформацию клеток для экспрессии CP77.

[0143] В некоторых вариантах осуществления способ включает трансфекцию клетки вектором, способным осуществлять экспрессию кодируемого CP77 под контролем промотора млекопитающего.

[0144] В некоторых вариантах осуществления вектор представляет собой транспозонный вектор, кодирующий CP77 под контролем промотора млекопитающих.

[0145] В одном не ограничивающем варианте осуществления промотор представляет собой клеточный конститутивный промотор, такой как EF1-альфа-промотор человека (промотор гена фактора элонгации 1 альфа человека), DHFR-промотор (промотор гена дигидрофолатредуктазы) или PGK-промотор (промотор гена фосфоглицераткиназы), которые обеспечивают экспрессию CP77 на уровне, достаточном для поддержания размножения вирусов в отсутствии значительного токсического действия на клетку-хозяина. Промоторы могут также быть индуцируемыми, такими как клеточный индуцируемый промотор, ΜΤΉ (из гена металлотионеина), а также в клетках млекопитающих используются вирусные промоторы, такие как промоторы CMV, RSV,SV-40 и MoU3.

[0146] В некоторых вариантах осуществления клетка представляет собой клетку CHO.

[0147] В некоторых вариантах осуществления вирус представляет собой поксвирус.

[0148] В некоторых вариантах осуществления поксвирус представляет собой производное вируса осповакцины, который является непатогенным или не реплицируется в человеке.

[0149] Под термином «выделенный» подразумевают вещество, которое является по существу или практически свободным от компонентов, которые обычно сопровождают в его природном состоянии. Например «выделенный полинуклеотид» или «выделенный полипептид» и т.п. в контексте настоящего изобретения относятся к in vitro выделению и/или очистке молекулы полинуклеотида или полипептида от их природного клеточного окружения, а также от ассоциации с другими компонентами клетки. Без ограничения, выделенные композиция, комплекс, полинуклеотид, пептид или полипептид могут относиться к нативной последовательности, которую выделяют путем очистки, или к последовательности, которую получают рекомбинантными или синтетическими средствами.

[0150] Варианты включают молекулы нуклеиновых кислот, достаточно близкие с указанной молекулой или ее комплементарными формами по всей длине или ее части, так что они могут селективно гибридизоваться в условиях средней или высокой жесткости, или которые имеют примерно от 60% до 90% или от 90 до 98% идентичности по последовательности с нуклеотидными последовательностями, определяющими указанный фактор видоспецифичности поксвируса, в окне сравнения, включающем по меньшей мере около 15 нуклеотидов. Предпочтительно, чтобы область гибридизация составляла в длину от 12 до примерно 18 нуклеотидов или более. Предпочтительно, чтобы процент идентичности между конкретной нуклеотидной последовательностью и эталонной последовательностью составлял по меньшей мере около 80% или 85% или более, предпочтительно, около 90% идентичности или более, например, около 95%, 96%, 97%, 98%, 99% или более. В изобретении охвачен процент идентичности между 80% и 100%. Длина нуклеотидной последовательности зависит от ее предполагаемой функции. Гомологи охвачены изобретением. Термин «гомолог» «гомологичные гены» или «гомологи» относится в широком смысле к функционально и структурно родственным молекулам, включая молекулы из других видов. Гомологи и ортологи являются примерами вариантов.

[0151] Идентичность нуклеотидных последовательностей может быть определена следующим образом. Целевую нуклеотидную последовательность используют для поиска по базе данных нуклеотидных последовательностей, такой как база данных GenBank (доступная на веб-сайте http://www.ncbi.nln.nih.gov/blast/), с использованием программы BLASTM version 2.1 (на основе Altschul et al. (1997) Nucleic Acids Research 25:3389-3402). Программа используется в не вносящем разрывы режиме. Фильтрация по умолчанию используется для удаления гомологий по последовательности из-за областей низкой сложности. Используются параметры, принятые по умолчанию в BLASTM.

[0152] Идентичность аминокислотных последовательностей может быть определена следующим образом. Целевую полипептидную последовательность используют для поиска по базе данных полипептидных последовательностей, такой как базы данных GenBank (доступна на веб-сайте http://www.ncbi.nln.nih.gov/blast/), с использованием программы BLASTP. Программа используется в не вносящем разрывы режиме. Фильтрация по умолчанию используется для удаления гомологий по последовательности из-за областей низкой сложности. Используются параметры, принятые по умолчанию в BLASTP. Для фильтрации последовательностей низкой сложности могут использовать программу SEG.

[0153] Термин «гибридизуется в жестких условиях» и его грамматические эквиваленты относятся к способности молекулы нуклеиновой кислоты гибридизоваться с молекулой нуклеиновой кислоты-мишени (например, молекулой нуклеиновой кислоты-мишени, иммобилизованной на ДНК или РНК-блоте, таком как Саузерн-блот или Нозерн-блот) при определенных условиях, температуре и концентрации соли. В отношении молекул нуклеиновых кислот больше 100 оснований в длину типичными жесткими условиями гибридизации являются температура не более чем на 25°C-30°C (например, 10°C) ниже температуры плавления (Tm) нативного дуплекса (см. в общем, Sambrook et al., (supra); Ausubel et al., (1999)). Tm для молекул нуклеиновых кислот больше 100 оснований в длину можно рассчитать по формуле Tm=81,5+0,41%⋅(G+C-log(Na+)). В отношении молекул нуклеиновых кислот, имеющих длину менее 100 оснований, примерными жесткими условиями гибридизации является температура на 5°C-10°C ниже Tm.

[0154] Термин «вектор» обозначает молекулу нуклеиновой кислоты, предпочтительно, молекулу ДНК, полученную, например, из плазмиды, бактериофага, дрожжей, вируса, млекопитающего, птицы, рептилии или рыбы, в которую можно встроить или клонировать полинуклеотид. Вектор, предпочтительно, содержит один или несколько уникальных сайтов рестрикции и может быть способен к автономной репликации в определенных клетках-хозяевах, включая клетку-мишень или ткань-мишень, или их прародительские клетки или ткани, или может интегрироваться в геном определенного хозяина так, чтобы клонированная последовательность стала воспроизводиться. Соответственно, вектор может представлять собой автономно реплицируемый вектор, то есть вектор, существующий в виде внехромосомной самостоятельной единицы, репликация которой не зависит от репликации хромосомы, например, линейной или замкнутой кольцевой плазмиды, внехромосомного элемента, минихромосомы или искусственной хромосомы. Вектор может содержать любые элементы, обеспечивающие саморепликацию. В альтернативном варианте, вектор может после введения в клетку интегрироваться в геном клетки-реципиента и реплицироваться вместе с хромосомой (или хромосомами), в которую он встроился. Векторная система может включать один вектор или плазмиду, два или несколько векторов или плазмид, которые вместе содержат суммарную ДНК, которая должна быть введена в геном клетки-хозяина, или транспозон. Выбор вектора обычно зависит от совместимости вектора и клетки, в которую этот вектор должен быть введен. Вектор также может включать в себя селективный маркер, такой как ген устойчивости к антибиотику, который может быть использован для отбора подходящих трансформантов. Примеры таких генов, обеспечивающих устойчивость к антибиотикам, хорошо известны специалистам в данной области.

[0155] Ссылка на «ген» включает кДНК, соответствующую экзонам гена. Ссылка в настоящем описании на «ген» также включает: классический геномный ген, состоящий из транскрипционных и/или трансляционных регуляторных последовательностей, и/или кодирующей области, и/или нетранслируемых последовательностей (т.е. интронов, 5'- и 3'- нетранслируемых последовательностей); или мРНК или кДНК, соответствующие кодирующим областям (т.е. экзонам) и 5'- и 3'- нетранслируемым последовательностями гена.

[0156] Под «регуляторным элементом» или «регуляторной последовательностью» подразумеваются нуклеотидные последовательности (например, ДНК), которые необходимы для экспрессии функционально связанной последовательности в конкретной клетке-хозяине. Регуляторные последовательности, которые подходят для прокариотических клеток, например, включают промотор и, необязательно, цис-действующие последовательности, такие как операторная последовательность и сайт связывания рибосомы. Регуляторные последовательности, которые подходят для эукариотических клеток, включают промоторы, сигналы полиаденилирования, транскрипционные энхансеры, трансляционные энхансеры, лидерные или завершающие последовательности, которые модулируют стабильность мРНК, а также направляющие последовательности, которые направляют продукт, кодируемый транскрибируемы полинуклеотидом, во внутриклеточный компартмент в клетке или во внеклеточную среду.

[0157] Изобретение охватывает комплементарные последовательности и части этих последовательностей. Термин «комплемент» и «комплементарный» при использовании в связи с молекулой нуклеиновой кислоты относится к комплементарной последовательности нуклеиновой кислоты, определенной с помощью спаривания оснований по Уотсону-Крику. Например, комплементом нуклеотидной последовательности 5'CCATG3' является 5'СATGG3'.

10158] Фраза «специфично гибридизуется с» и т.п. относится к связыванию, образованию дуплексов или гибридизации молекулы только с определенной нуклеотидной последовательностью в жестких условиях, когда эта последовательность присутствует в комплексной смеси (например, общеклеточной) ДНК или РНК.

[0159] Термины «субъект» или «индивидуум» или «пациент», используемые в настоящем описании взаимозаменяемо, относятся к любому субъекту, в частности, позвоночному субъекту и, еще более конкретно, к млекопитающему субъекту, для которых желательна терапия или профилактика. Подходящие позвоночные животные, которые входят в объем настоящего изобретения, включают, но не ограничены ими, приматов, птиц, домашний скот (например, овец, коров, лошадей, ослов, свиней), лабораторных животных (например, кроликов, мышей, крыс, морских свинок, хомячков), животных-компаньонов (например, кошек, собак) и содержащихся в неволе диких животных (например, лис, оленей, динго). Предпочтительным субъектом является примат, такой как человек, нуждающийся в лечении или профилактике. Однако следует понимать, что указанные выше термины не подразумевают присутствие симптомов.

[0160] Различные варианты осуществления, включенные в данный документ, далее описаны с помощью нижеследующих неограничивающих примеров.

ПРИМЕР 1

VACV-COP не способен расти в клетках CHO

Материалы и реактивы

- VACV-СОР, VSS02, SEM120213, титр: 1,6×108 БОЕ/мл

- Vero: WHO-VERO-MCB, пассаж № 141, 08/08/2005, Virax Holdings Limited

- CHO: SA-Pathology 7.05.2004

- Ростовая среда: RPMI, 10% FBS, пенициллин/стрептомицин

- Поддерживающая среда: RPMI, 2%FBS, пенициллин/стрептомицин

[0161] Клетки CHO и Vero культивировали до конфлюентности в одном 6-луночном планшете на одну клеточную линию. Каждую лунку инфицировали 4×104 БОЕ VACV-СОР VSS02 в течение 45 минут при комнатной температуре, а затем инкубировали далее при 37°C и 5% CО2. Для каждой клеточной линии содержимое 2 лунок собирали и объединяли через 24 ч, 48 ч и 72 ч после заражения. Вирусные экстракты получали тремя циклами замораживания-оттаивания и хранили на -80°С до процедуры титрования. Каждый экстракт титровали с использованием клеток Vero, как описано в протоколе из примера 4.

[0162] После замораживания-оттаивания можно использовать гомогенизирующую иглу, чтобы разбить крупные нерастворимые комки. Каждая собираемая лунка содержала 2 мл ММ. Для каждой временной точки объединяли 2 лунки, чтобы получить общий объем 4 мл на одну временную точку. Чтобы получить общий объем 6 мл на временную точку может быть добавлен ТЕ-буфер.

[0163] Результаты титрования, выход вируса и выход продукции приведены в таблице 1. Результаты показывают, что VACV-СОР не может размножаться с низкой MOI (множественность заражения) в клетках СНО, в отличие от клеток Vero, где продукция вируса увеличивается со временем. VACP-СОР является непермиссивным в клетках СНО.

ПРИМЕР 2

Многостадийный рост VACV + PH22 [CP77] в СНО относительно Vero - СP77 активен в VACV

[0164] Возможность размножения в СНО рекомбинантного VACV-COP, экспрессирующего ген BR025L вируса коровьей оспы, кодирующий CP77 (VACV-PH22 [CP77]), была определена в сравнении с клетками Vero в исследовании многостадийного роста.

[0165] VACV-PH22 представляет собой рекомбинантный штамм Copenhagen вируса осповакцины, экспрессирующий ORF нативного 025L из штамма Brighton вируса коровьей оспы, который кодирует белок CHO-видоспецифичности, CP77. Эта ORF в вирусе осповакцины также находится под контролем нативного промотора BR025L. Нативный ген BR025L (нативный промотор и ORF) клонировали для создания pPH22, которая также кодирует красный флуоресцентный белок DsRed-Express2. pPH22 представляет собой интеграционный вектор, который будет встраивать ген BR025L и ген DsRed в ORF B19R из VACV-СОР, который кодирует растворимый и находящийся на клеточной поверхности белок рецептора альфа/бета-интерферона. Встраивание BR025L и DsRed в VACV-СОР достигалось с помощью гомологичной рекомбинации в результате заражения CHO с низкой множественностью инфекции VACV-СОР и трансфекции pPH22. Только вирус, содержащий ген BR025L, будет далее амплифицироваться в клетках CHO, что может быть визуально подтверждено присутствием красных флуоресцентных инфицированных клеток или бляшек.

[0166] Вирус, выделенный через 3 дня после гомологичной рекомбинации, амплифицировали три раза в CHO, а затем титровали в клетках Vero перед использованием в этом исследовании многоступенчатого роста в клетках СНО.

Материалы и реактивы

- VACV-СОР, VSS02, SEM120213, титр: 1,6×108 БОЕ/мл

- VACV-PH22 [CP77], титр: 8×106 БОЕ/мл

- Vero: WHO-VERO-MCB, пассаж № 141, 08/08/2005

- CHO: SA-Pathology 7.05.2004

- Ростовая среда: RPMI, 10% FBS, пенициллин/стрептомицин для СНО и Vero

- Поддерживающая среда: RPMI, 2%FBS, пенициллин/стрептомицин для СНО и Vero

[0167] Клетки СНО и Vero культивировали до конфлюентности в 2 флаконах Т25 на одну клеточную линию. 1 флакон каждой клеточной линии инфицировали 1×105 БОЕ VACV-СОР VSS02 и один инфицировали 1×105 БОЕ VACV-PH22 в течение 45 минут при комнатной температуре, а затем инкубировали далее при 37°C и 5% CО2. Для каждой клеточной линии содержимое каждого флакона собирали через 96 ч после инфекции. Вирусные экстракты получали тремя циклами замораживания-оттаивания и хранили на -80°С до процедуры титрования. Каждый экстракт титровали с использованием клеток Vero, как описано в протоколе из примера 4, в 24—луночном формате.

[0168] Заражение проводили в флаконах T25, по 2 флакона на клеточную линию, где флакон 1 инфицировали VACV-СОР, а флакон 2 инфицировали VACV-PH22. Сбор вируса проводили только через 96 ч после заражения. Результаты приведены в таблице 2. Из таблицы 2 можно видеть, что клетки CHO не могут поддерживать продукцию вирусного потомства VACV-COP. Это подтверждает результаты, описанные в примере 1. Кроме того, VACV-СОР был жизнеспособным при инфекции пермиссивной клеточной линии Vero в данном исследовании, увеличивая уровень инокулята более чем в 200 раз, поэтому, результаты, наблюдаемые в CHO, являлись следствием ограничений клетки—хозяина. Однако при экспрессии CP77 с помощью рекомбинантного вируса осповакцины, VACV-PH22, получали амплификацию инокулята примерно в 700 раз. Экспрессия CP77 не ограничивает видоспецифичность вируса осповакцины только клетками СНО, поскольку инфекция клеток Vero с использованием VACV-PH22 также амплифицировала инокулят. Однако уровень амлификации не может быть столь же высок как для вируса осповакцины без CP77. Так как стандартная ошибка результатов титрования является настолько большой, то разница в выходе может быть недостоверной.

[0169] Эти результаты показывают, что CP77, экспрессированный из вирусного генома, более чем достаточен для обеспечения амплификации VACV-СОР в непермиссивной клеточной линии СНО, поскольку дает выход аналогичный ожидаемому от пермиссивного клеточного субстрата, такого как Vero.

[0170] Возможная функция белка CP77 во время инфекции вирусом осповакцины клеток CHO была опубликована Hsiao et al . (2006). Они полагают, что CP77 связывает и удаляет HMG20A из новосинтезированного генома вируса осповакцины, находящегося в вирусных фабриках, таким образом, позволяя продолжать жизненный цикл вируса осповакцины в клетках СНО. Авторы изобретения утверждают, что CP77 обеспечивает доступность новосинтезированного генома для упаковки, который в противном случае не будет доступен в клетках СНО вследствие связывания HMG20A с геномом и его «запирания». Поскольку функция CP77 не требуется для вирусной амплификации в пермиссивных клеточных линиях, таких как Vero, авторы изобретения предполагают, что существует альтернативный эквивалентный белок, возможно даже клеточный белок, который несет эту функцию, который, возможно, является неактивным или отсутствует по меньшей мере в клетках СНО, но является активным или присутствует в пермиссивных клеточных линиях. Альтернативный белок мог убрать необходимость в CP77, и, таким образом, в ходе эволюции вируса осповакцины, он впоследствии был удален или перегруппирован, так как потеря его функции была не важна для широкой видоспецифичности вируса.

ПРИМЕР 3

Конструирование p-LL07-CHO (поликлональной клеточной линии, экспрессирующей CP77)

[0171] Была сконструирована линия клеток СНО, экспрессирующая белок CP77. Рекомбинантный вирус VACV-СОР, экспрессирующий зеленый флюоресцентный белок (EGFP), образует бляшки, которые развиваются в конфлюентную инфекцию в течение нескольких дней после заражения.

[0172] Vaccinia-COP (SCV401C) представляет собой рекомбинантный вирус штамма Copenhagen (VACV-СОР), который имеет встроенную ORF A39R экспрессионную кассету, состоящую из сильного раннего/позднего промотора вируса осповакцины, функционально связанного с кодирующей белок последовательностью усиленного зеленого флуоресцентного белка (EGFP) и терминируемую ранней последовательностью остановки транскрипции поксвируса. При заражении непермиссивных и пермиссивных клеток EGFP будет экспрессироваться в инфицированных клетках, которые могут быть визуализированы с помощью флуоресцентного микроскопа. В пермиссивных клетках можно увидеть, что зеленая флуоресценция распространяется от клетки к клетке по мере распространения вируса по всей популяции клеток.

[0173] Кодирующая последовательность белка CP77 была синтезировала в GeneArt GmbH (Германия) путем воссоздания (обратной трансляции) последовательности ДНК из аминокислотной последовательности CP77, кодируемого ORF 025L штамма Brighton Red вируса коровьей оспы (UniProtKB/Swiss-Prot: P12932.1), и оптимизации кодонов для экспрессии в клетках млекопитающих (СНО). Оптимизированную по кодонам нуклеотидную последовательность для экспрессии последовательности, кодирующей белок CP77, см. в SEQ ID NO: 1.

[0174] Оптимизированную по кодонам последовательность, кодирующую белок CP77, из pPH51 (клонирующей плазмиды, несущей оптимизированную по кодонам последовательность, кодирующую белок CP77) ПЦР-амплифицировали с использованием ПЦР-праймеров, где 5'-праймер был создан, чтобы добавить последовательность Козака к стартовому кодону, а 3'-праймер был создан, чтобы добавить последовательность Flag-тега перед стоп-кодоном. Амплифицированный ПЦР-продукт субклонировали в транспозонный вектор PiggyBac pJ507-2 (Hyg+), приобретенный у DNA2.0 Inс (США) через сайт клонирования Bsa I. Клонирование в Bsa I эффективно замещает кодирующую последовательность GPF кодирующей последовательностью белка CP77, создавая pLL07. CP77 теперь становится под контролем промотора конститутивного фактора элонгации 1-альфа человека (EF1a) и экспрессируется совместно с геном устойчивости к гигромицину после их стабильной интеграции в геном трансфецированных клеток.

[0175] Трансдукция CHO путем транспозонной вставки экспрессионных кассет CP77 и гигромициновой устойчивости: клетки СНО высевали в лунки 6-луночных планшетов, чтобы после инкубации в течение ночи они имели конфлюентность около 50%. С использованием трансфекционного реагента Effectene от Qiagen 1 мкг pLL07 трансфицировали 1 лунку клеток CHO с 50%-й конфлюентностью, следуя инструкциям изготовителя. Трансфицированные клетки затем инкубировали в течение ночи в ростовой среде. На следующий день среду заменяли ростовой средой, содержащей 500 мкг/мл гигромицина B для отбора трансдуцированных клеток. Среду для отбора меняли каждые 2-3 дня, и когда число трансдуцированных клетки начинало расти, их собирали с помощью TrypLE Select (Life Technologies) и высевали в флакон Т25 для дальнейшего размножения клеток.

Проверка экспрессии CP77 с помощью Вестерн-блоттинга (на Flag-тег)

[0176] Получение кроличьей анти-CP77 сыворотки: кроликов иммунизировали инъекцией связанного с KLH-белком 15-аминокислотного пептида, который представлял внутреннюю аминокислотную последовательность белка CP77. Этой аминокислотной последовательностью являлась SGSDVNIRSNNGYTC, аминокислоты 481 до 495 в SEQ ID NO: 2 (UniPratKBSwiss-Prot P12932.1 [025LBR, белок CP77]).

[0177] Для получения антител к конъюгированной с KLH аминокислотной последовательности в общей сложности были сделаны три инъекции с интервалами в 1 месяц. Кровь от иммунизированного кролика проверяли с помощью Вестерн-блоттинга против экспрессированного в бактериях и очищенного на Ni-NTA His-меченого с N-конца белка CP77. Было показано, что кроличья анти-CP77 сыворотка хорошо распознает рекомбинантный белок CP77.

[0178] Проверка экспрессии CP77 клетками р-LL07-CHО: в два флакона T25 высевали клетки СНО и р-LL07-CHO и культивировали до тех пор, пока монослои клеток в каждом флаконе не достигали 100%-й конфлюентности. Клетки из каждой колбы собирали, промывали PBS, а затем повторно ресуспендировали в 200 мкл. К этому объему добавляли по 50 мкл из 5× буфера для нанесения на ДСН-ПААГ в каждую из пробирок с ресуспендированными клетками, а затем инкубировали при 98°С в течение 5 мин. По 15 мкл каждого клеточного белкового экстракта наносили на два 10%-х ДСН-полиакриамидных геля, проводили электрофорез, а затем переносили на нитроцеллюлозу Hybond ECL с помощью электроблоттинга.

[0179] Мембраны после электроблоттинга затем обрабатывали 5%-м сухим обезжиренным молоком, растворенным в Трис-солевом буфере, содержащем Tween 20 (TBST), в течение 1 часа при комнатной температуре, чтобы блокировать все доступные участки неспецифического связывания антител на мембране. Затем мембраны несколько раз промывали в TBST перед окрашиванием антителами. Мембрану 1 окрашивали разведенными 1:5000 анти-DDDDK-тег антителами M2, конъюгированными с HRP (кат. № аb49763, Sapphire Bioscience), течение ночи при температуре 4°С. Мембрану 2 окрашивали разведенной 1:100 анти-CP77 антисывороткой в течение ночи при 4°C, промывали 3 раза TBST, а затем окрашивали вторичными антителами – разведенными 1:5000 конъюгированными с HRP антителам против антител кролика (GE Healthcare) в течение 2 часов. Обе мембраны затем промывали 3 раза в TBST, обрабатывали реагентами для детекции ECL (GE Healthcare) и экспонировали с рентгеновской пленкой в соответствии с указаниями пользовательской инструкции.

[0180] Анализ бляшек в клетках СНО и р-LL7-CHO: клетки CHO и р-LL7-CHO высевали на несколько 6-луночных планшетов и культивировали до достижения монослоями клеток 100%-й конфлюентности.

[0181] Для инфицирования клеток использовали рекомбинантный вирус осповакцины (штамм Copenhagen), несущий кассету для экспрессии EGFP (зеленого флуоресцентного белка) под контролем раннего/позднего промотора вируса осповакцины (SCV401C). Из-за неизвестного титра SCV401C 10 мкл концентрированного вируса сначала разводили в 1 мл среды ММ (разведение 1 - 1:100), а затем инфицировали каждую лунку 500 мкл разведенного вируса. Через день после инфицирования была отмечена высокая MOI инфекции, где большинство клеток флуоресцировали зеленым. Было принято решение провести еще одно разведение 1:20 из разведения 1 путем добавления 100 мкл разведения 1 в 2 мл среды ММ (разведение 2). Затем его в количестве 500 мкл использовали для заражения каждой лунки.

[0182] Заражение вирусом наблюдали с помощью флуоресцентного микроскопа (Olympus IX51) с GFP-фильтром (кат. № U-MGFPHQ, Olympus). Снимки были сделаны с использованием cellSens Digital Imaging Software (Olympus).

[0183] Из результатов было очевидно, что VACV-СОР, экспрессирующий зеленый флуоресцентный белок (SCV401C), не размножается в клетках СНО, как и ожидалось. Отдельные клетки, флуоресцирующие зеленым, являются результатом вхождения вируса в клетку, экспрессии его генов, включая EGFP, его неспособности производить новые инфекционные вирусные частицы и, следовательно, неспособности распространять инфекцию на соседние клетки. Однако в клеточной линии СНО, экспрессирующей CP77, вирус осповакцины способен производить новые вирусы, которые, распространяясь на соседние клетки, образуют очаги инфекции в течение 1 дня после инфекции. Эти очаги инфекции становились конфлюентной инфекцией в течение следующих двух дней после заражения, и на 3-й день весь клеточный монослой был инфицирован SCV401C. Клетки СНО, экспрессирующие белок видоспецифичности, CP77, являются пермиссивными в отношении заражения вирусом осповакцины в отличие от родительских (нативных) клеток СНО.

[0184] HMG20A принадлежит к семейству белков, содержащих HMG-бокс домен. HMG-белки являются ремоделирующими хромосомы белками, которые распознают искаженные структуры ДНК, такие как крестообразные структуры. Они могут также вызывать изгиб ДНК путем связывания с малой бороздкой ДНК. Содержащие HMG-бокс белки, таким образом, считаются важными для ремоделирования хромосом в процессе репликации ДНК, рекомбинации или восстановления. Кроме того, некоторые содержащие HMG-бокс белки могут влиять на транскрипцию генов, взаимодействуя с факторами транскрипции на участке промотора.

[0185] В работе, опубликованной Hsiao et al. 2006, было показано, что CP77 связывает HMG20A в клетках CHО-K1. Этот белок клетки-хозяина, HMG20A, по-видимому, связывает вирусную ДНК в вирусных фабриках инфицированных вирусом осповакцины клеток CHO, и было высказано предположение, что этот белок клетки-хозяина «запирает» ДНК в вирусных фабриках, блокируя очередной этап жизненного цикла вируса осповакцины и, таким образом, предотвращая продукцию инфекционного вирусного потомства. Экспрессия CP77 вирусом коровьей оспы, по-видимому, удаляет хозяйский HMG20A от вирусной ДНК и позволяют жизненному циклу вируса возобновиться с последующей продукций потомства инфекционных вирусных частиц.

[0186] Однако при экспрессии CP77 в CHO в отсутствие вирусной инфекции можно было бы ожидать, что этот белок будет инактивировать новосинтезированный HMG20A, присутствующий в цитоплазме до его транслокации в ядро. Если бы это было так, то функция HMG20A в ядре была бы потеряна, и так как он играет важную роль в процессе репликации, рекомбинации и восстановления ДНК в дополнение к функции при транскрипции генов, можно было бы ожидать, что экспрессия CP77 может нанести ущерб целостности клетки СНО во время деления и жизни клеток. Это неожиданно не составило проблему, так как клеточная линия СНО, экспрессирующая CP77, легко поддерживалась в виде непрерывной культуры без заметного воздействия на ее способность к репликации в течение многих поколений по сравнению с исходной клеточной линией СНО.

ПРИМЕР 4

Исследование многостадийного роста

[0187] Исследование кинетики многостадийного роста проводили на р-LL07-CHO: оценивали пермиссивный характер клеточной линии СНО, экспрессирующей ген видоспецифичности CP77, в отношении инфекции вируса осповакцины и сравнивали уровень продукции вируса с уровнем продукции, достигаемым в природной пермиссивной линии клеток человека — 143В.

[0188] Цель состояла в сравнении характеристик распространения VACV-CОP в клеточных линиях р-LL07-СНО, CHO и 143В. В этом исследовании функциональность экспрессированного CP77 в р-LL07-CHО тестировали путем изучения характеристик амплификации VACV-СОР в этой клеточной линии по сравнению с характеристиками его амплификации в клетках СНО (непермиссивных) и 143В (пермиссивных).

Материалы и способы

Культивирование клеточных линий

[0189] Культивирование СНО: на один 6-луночный планшет высевали клетки СНО и культивировали до конфлюэнтности в ростовой среде (RPMI + 10% FBS).

[0190] Культивирование 143В: на один 6-луночный планшет высевали клетки 143В и культивировали до конфлюэнтности в ростовой среде (RPMI + 10% FBS).

[0191] Культивирование р-LL07-СНО: на 6-луночный планшет высевали клетки р-LL07-СНО и культивировали до конфлюэнтности в ростовой среде (RPMI + 10% FBS + 500 мкг/мл гигромицина В).

[0192] Разведение VACV-СОР: каждую лунку каждого 6-луночного планшета инфицировали 0,01 БОЕ в общем объеме 500 мкл. Предполагалось, что количество клеток на лунку при 100%-й конфлюентности составляло 4×106 клеток. При уровне инфекции 0,01 БОЕ /клетку на лунку требовалось 4×104 БОЕ, и, поэтому, концентрированный вирус разводили до 4×104 БОЕ/мл в поддерживающей среде (RPMI/2% FBS).

[0193] Инфекция: культуральную среду удаляли из каждой лунки каждого планшета, куда добавляли по 500 мкл разбавленного вируса и оставляли инкубироваться при комнатной температуре в течение 1 часа для того, чтобы клетки адсорбировали вирус. Вирусную инфекционную среду затем удаляли и каждую инфицированную лунку хорошо промывали один раз 1 мл стерильного PBS, а затем инкубировали в 2 мл ММ на лунку при 37°C и 5% CО2.

[0194] Сбор вируса: собирали по две лунки с каждого планшета в следующие временные точки после заражения: 24 ч, 48 ч и 72 ч. В день сбора клетки соскабливали в питательную среду, где две лунки из каждой клеточной линии объединяли, и клетки осаждали центрифугированием при 1000 g в течение 5 мин. Каждый клеточный осадок ресуспендировали в 1 мл 10 мМ Tris*HCl, pH 8. Ресуспендированный клеточный осадок затем пропускали через три цикла замораживания-оттаивания и хранили при -80°С до проведения титрования.

[0195] Титрование проводили на клетках Vero и 143В, культивируемых до 100%-й конфлюентности в 24-луночных планшетах.

[0196] Разведение: вирусные экстракты доставали из заморозки, размораживали и обрабатывали ультразвуком до получения однородной массы без каких—либо видимых комков. Вирусные экстракты серийно разводили до 10-8 в поддерживающей среде.

[0197] Инфицирование: из каждой лунки удаляли ростовую среду и заражали по 1 мл каждого разведения (4 лунки на разведение, один планшет для каждого вируса, начиная с разведения 10-2) в течение 1 ч при комнатной температуре. После инкубации каждый планшет переносили в инкубатор и инкубировали при 37°C и 5% CО2 в течение 3 дней для развития бляшек.

[0198] Расчет титра: в разведении, которое давало от 20 до 50 бляшек, подсчитывали бляшки, а затем усредняли. Это среднее число умножали на число, обратное разведению, и поскольку для инфекции использовали 1 мл, полученная в результате цифра будет являться титром в БОЕ/мл.

[0199] Расчет стандартной ошибки: стандартную ошибку (SE) с доверительным интервалом 95% рассчитывали из 4 значений титрования, составляющих среднее, с использованием следующей формулы: 1,95×(SD/√n), где: SD - стандартное отклонение для маленького образца, n - число повторов титрования (4 в данном случае).

[0200] Расчет выхода: это общее количество вируса в вирусном экстракте, который титровали: средний титр (БОЕ/мл × общий объем вирусного экстракта = выход в БОЕ).

[0201] Расчет коэффициента амплификации: эта цифра представляет собой кратность амплификации относительно количества, используемого для заражения: выход в БОЕ/используемое для заражения количество в БОЕ.

[0202] Исследование кинетики многостадийного роста проводили в 6—луночных планшетах — по две лунки на временную точку на одну клеточную линию. Каждую лунку инфицировали 4×104 БОЕ VACV-СОР, и при сборе по 2 лунки на каждую клеточную линию и временную точку собирали и объединяли, из которых получали вирусный экстракт. Этот вирусный экстракт с общим объемом 1 мл, представляющий собой 2 объединенных инфекции с используемым для заражения количеством 8×104 БОЕ (4×104 БОЕ × 2), затем титровали. Титрование проводили с использованием двух индикаторных клеточных линий, 143В и Vero.

[0203] Результаты титрования и выхода вируса приведены в таблицах 3 и 4, соответственно. VACV-СОР не амплифицируется в непермиссивных клетках CHO, то есть они производили меньше вируса, чем количество используемое для заражения. Однако амплификация вируса в клеточной линии СНО, экспрессирующей ген видоспецифичности CP77, превышала примерно в 2000 раз количество вируса, используемое для заражения (на основе результатов титрования с использованием клеток 143B в качестве индикаторной клеточной линии). Амплификация в пермиссивных клетках была примерно в 3000 раз выше количества вируса, используемого для заражения. Поскольку стандартные ошибки перекрываются, то разница в амплификации между клетками р-LL07-СНО и 143В не является статистически значимой.

[0204] Если амплификацию вируса сравнивать между двумя клеточными линиями с использованием результатов титрования с индикаторными клетками Vero, кажется, что амплификация была незначительно выше в р-LL07-CHO, чем в клетках 143B, однако это не было статистически значимым.

[0205] В этом исследовании было дополнительно подтверждено, что вирус осповакцины не является пермиссивным в клетках СНО, поскольку уровень продукции вируса был значительно меньше количества вируса, используемого в качестве инокулята. Однако, если линия СНО экспрессирует ген видоспецифичности вируса коровьей оспы, кодирующий белок CP77, она теперь становится пермиссивной для вируса осповакцины и поддерживает продукцию вируса на том же уровне, который наблюдается в пермиссивной клеточной линии. Следует также отметить, что требуется экспрессия только одного гена видоспецифичности, CP77, чтобы превратить эту клеточную линию в «полезный» пермиссивный клеточный субстрат для производства осповакцины. Производство осповакцины в CHO является весьма желательным, так как клеточная линия СНО является биотехнологически удобной клеточной линией тем, что она растет так же быстро, как и бактерии, ее можно культивировать в определенной культуральной синтетической среде без необходимости в биологических добавках, таких как фетальная бычья сыворотка, и ее можно выращивать в виде суспензии клеток в биореакторе. СНО также уже использовалась для производства биомедицинских продуктов, является хорошо охарактеризованной, а также известна и хорошо принимается контролирующими биомедицинские продукты структурами, такими как FDA и EMEA.

[0206] Трансгенная клеточная линия СНО, экспрессирующая белок CP77 под контролем конститутивного клеточного промотора, является пермиссивной для репликации и размножения вируса осповакцины на том же уровне, который наблюдается в природных пермиссивных клеточных линиях, что дает высокий уровень потомства вируса.

ПРИМЕР 5

Размножение MVA в клетках CHO-CP77

Размножение MVA + GFP в СНО, 143B и р-LL07-CHO

Материалы и способы

[0207] Ростовая среда (GM): RPMI-1640, с добавлением 10% FBS, 2 мМ L-глутамина, пенициллина и гентамицина, Hepes

[0208] Поддерживающая среда (ММ): RPMI-1640, с добавлением 2% FBS, 2 мМ L- глутамина, пенициллина и гентамицина, Hepes

[0209] Заметки о культивировании р-LL07-CНО: общее размножение и подержание клеток р-LL07-CHO проводили в GM плюс 500 мкг/мл гигромицина B, но однако для посева и культивирования до 100%-й конфлюентности перед инфицированием клетки культивировали в GM без гигромицина B.

[0210] Культивирование клеток: клетки 143В, СНО и р-LL07-CHO высевали на несколько 6-луночных планшетов и культивировали в ростовой среде (GM) при 37°C и 5% СО2 до достижения клеточными монослоями 100%-й конфлюентности. Культивировали по одному планшету на одну клеточную линию.

Инфекция

• Рекомбинантный MVA, несущий кассету для экспрессии GFP (зеленого флуоресцентного белка), использовали для инфицирования клеток, культивируемых в 6-луночных планшетах. Из-за неизвестного титра MVA-GFP вирус серийно разводили в поддерживающей среде (ММ) следующим образом:

• Разведение 1: 20 мкл концентрированного вируса разводили в 2 мл среды MM (разведение 1:100) и смешивали путем интенсивного встряхивания.

• Разведение 2: 500 мкл разведения 1 добавляли к 4,5 мл ММ (разведение 1:103) и смешивали путем интенсивного встряхивания.

• Разведение 3: 500 мкл разведения 2 добавляли к 4,5 мл ММ (разведение 1:104) и смешивали путем интенсивного встряхивания.

• Разведение 4: 500 мкл разведения 3, добавляли к 4,5 мл ММ (разведение 1:105) и смешивали путем интенсивного встряхивания.

• Одну лунку каждого планшета заражали по 500 мкл следующих вирусных разведений: разведения 2, разведения 3 и разведения 4.

• Каждый планшет инкубировали в течение 5-дневного периода и изучали на предмет развития и распространения очагов флуоресцентных клеток. В этом исследовании разведение 4 давало различимые очаги флуоресцирующих клеток в течение трехдневного периода. Неинфицированные лунки в каждом планшете были средством контроля автофлуоресценции.

Наблюдения под микроскопом

[0211] За вирусной инфекцией наблюдали под флуоресцентным микроскопом (Olympus IX51) с GFP-фильтром (кат. № U-MGFPHQ, Olympus). Снимки были сделаны с использованием cellSens Digital Imaging Software (Olympus).

Результаты

[0212] Результаты показали, что MVA, экспрессирующий зеленый флуоресцентный белок (GFP), не размножается в клетках CHO и 143В, как и ожидалось. Одиночные клетки, флуоресцирующие зеленым, являются результатом того, что вирус проникает в клетку, экспрессирует свои гены, включая GFP, но не может создавать новые инфекционные вирусные частицы и, следовательно, не в состоянии распространить инфекцию на соседние клетки. Однако в клеточной линии СНО, экспрессирующей CP77, MVA способен производить новые инфекционные вирусы, которые распространяются на соседние клетки с образованием очагов инфекции через день после заражения с дальнейшим развитием инфекции на 3-й день.

ПРИМЕР 6

Подтверждение ограничений по видоспецифичности у MVA, собранного после заражения р-LL07-CНО

Культивирование клеток

[0213] Клетки 143В, СНО и ВНК-21 высевали на несколько 6-луночных планшетов и культивировали в ростовой среде (GM) при 37°C и 5% СО2 до достижения клеточными монослоями 100%-й конфлюентности. Культивировали по одному планшету на одну клеточную линию.

Сбор вируса из примера 5

[0214] MVA + GFP из инфицированных разведением 3 лунки р-LL07-СНО в примере 5 собирали через 5 дней после заражения следующим образом:

• Супернатант и клетки собирали из лунки и центрифугировали в течение 5 мин при 1000 g для осаждения инфицированных клеток.

Клеточный осадок ресуспендировали в 500 мкл 100 мМ буфера Tris-HCl, рН 8.

• Ресуспендированный клеточный осадок замораживали и оттаивали по меньшей мере три раза, чтобы высвободить вирус из зараженных клеток.

Инфекция

• Из-за неизвестного титра неочищенного вирусного экстракта вирус серийно разводили в среде ММ таким же образом, как в примере 5.

• Одну лунку каждого планшета заражали по 500 мкл следующих вирусных разведений: разведения 2, разведения 3 и разведения 4.

• Каждый планшет инкубировали в течение 5-дневного периода и изучали на предмет развития и распространения очагов флуоресцентных клеток. В этом исследовании разведение 3 давало различимые очаги флуоресцирующих клеток в течение трехдневного периода. Неинфицированные лунки в каждом планшете были средством контроля автофлуоресценции.

Наблюдения под микроскопом

[0215] За вирусной инфекцией наблюдали под флуоресцентным микроскопом (Olympus IX51) с GFP-фильтром (кат. № U-MGFPHQ, Olympus). Снимки были сделаны с использованием cellSens Digital Imaging Software (Olympus).

Результаты

[0216] MVA, который был собран из клеточной линии СНО, экспрессирующей CP77, по-прежнему сохраняет свою видоспецифичность, будучи не в состоянии размножаться в непермиссивной клеточной линии СНО (хомяк) и клетках 143B (человек). Отсутствие очагов зеленой флуоресценции в течение трехдневного периода после заражения клеток CHO и 143B показывает, что вирус не продуцирует инфекционное потомство в этих клеточных линиях. Однако данный MVA по-прежнему сохраняет видоспецифичность в отношении клеток ВНК21 (хомяк), поскольку зеленые флуоресцирующие очаги инфекции можно было наблюдать через день после инфицирования, которые росли в размерах в течение следующих 3 дней.

Выводы

• Клетки СНО, экспрессирующие белок видоспецифичности CP77, являются пермиссивными для инфекции MVA в отличие от родительских (нативных) клеток СНО.

• MVA, который размножается в клеточной линии СНО, экспрессирующей CP77, не увеличивал его видоспецифичность в отношении непермиссивных клеточных линий, таких как CHO и 143B (человека).

ПРИМЕР 7

Конструирование pLL07

[0217] Предпосылки: ПЦР-продукт кодирующей последовательности CP77 (оптимизированной по кодонам для СНО) на ДНК-матрице pPH51 клонировали в вектор pJ507-2(Hyg+) из системы PiggyBac с помощью системы клонирования InFusion от Clontech для создания pLL07. Последовательность CP77 с Flag-тегом была вставлена по сайту BsaI в pJ507-2, удаляя тем самым последовательность GFP (SEQ ID NO 3).

[0218] Пара ПЦР-праймеров, используемая для амплификации гена CP77-CHO из ДНК-плазмиды pPH51:

AACACGTCTCGGGGGgccgccaccATGTTCGACTACCTGGAAAATGAGGAAGTG (SEQ ID NO: 4) и

CAGGAAGACGCTTTTtcaCTTGTCATCGTCATCCTTGTAATCCTGCTGCTCGAAGATCTTGTACT (SEQ ID NO: 5). Последовательность Flag-тега показана жирным шрифтом в праймере Inf-LL07-CP77-Rv.

[0219] Вставка в плазмиду/конфигурация кассеты выглядят следующим образом. Карта вставки/кассеты. Клон #3 pLL7 был послан для секвенирования.

[0220] 15 ABI файлов c данными по секвенированию совместно с эталонным файлом для рLL07 «pLLD7_ref.sbd» были введены в компьютерную программу DNAstar Seqman от Lasergene и собраны в 1 консенсусный контиг. Выровненные последовательности были укорочены, чтобы соответствовать началу и концу эталонной последовательности, после чего эталонная последовательность была удалена из выравнивания так, чтобы не оказывать никакого влияния на установление консенсусной последовательности. Консенсусная последовательность контига была сохранена в виде файла последовательности ДНК под названием «pLL07_#3 consensus.seq». В контиге было определено направление считывания, и было найдено, что оно представляет то же самое направление считывания, как в эталонной последовательности. С использованием Megalign (DNASTAR) последовательность «pLL07_#3 consensus» была вручную выровнена с эталонной последовательностью «pLL07_ref.sbd», чтобы помочь определить расхождения между эталонной последовательностью и последовательностью pLL07_#3. Сборка 15 ABI-файлов для pLL07Clone#3 от службы секвенирования AGRF с использованием Seqman (настройки по умолчанию) дала в результате один консенсусный контиг, который перекрывает всю длину встраиваемой эталонной последовательности pLL07. Несоответствий между последовательностью в pLL07_#3 и эталонной последовательностью не было найдено. Встраиваемые последовательности в консенсусе контига pLL07_#3 идентичны эталонной последовательности.

ПРИМЕР 8

Экспрессия G1L и I7L в клетках млекопитающих

[0221] Экспрессионные плазмиды, кодирующие Flag-меченый-G1L или Flag-меченый-I7L, были сконструированы и использовались для создания трансгенных клеточных линий 143В, экспрессирующих эти белки. Даже несмотря на то, что эти клетки амплифицируются в присутствии генетицина для положительного отбора трансдуцированных клеток, и ПЦР-анализ подтвердил наличие последовательностей, кодирующих эти белки в геномах этих клеточных линий, с помощью Вестерн-блот-анализа не удалось обнаружить присутствие экспрессированных белков с Flag-тегом при окрашивании анти-DDDDK антителом.

[0222] Последовательности, кодирующие белки COP-G1L и COP-I7L с Flag-тегом на C-конце были синтезированы GeneArt (Life Technologies) и субклонированы по сайту Bsa I в pJ503-2 (PiggyBac — отбор на антибиотике неомицине), приобретенной у DNA2.0 Inc (USA). Эта процедура клонирования заменяет cometGFP на последовательности, кодирующие COP-G1L и COP-I7L с Flag-тегом на C-конце. Полученные клоны были названы pLL08 для piggyBac-вектора G1L и pLL10 для piggyBac вектора I7L.

[0223] Ключевыми особенностями этих двух плазмидных векторов являются следующие: последовательности, кодирующие белок с Flag-тегом, находятся под контролем конститутивного промотора EF1-альфа человека; и эти экспрессионные кассеты вместе с экспрессионной кассетой NPT II (гена устойчивости к неомицину) фланкированы левой и правой границей транспозона, образуя искусственный транспозонный элемент. Внешней по отношению к искусственному транспозонному элементу, но содержащейся в той же плазмиде, является экспрессионная кассета транспозонного фермента, который опосредует необратимую интеграцию транспозонного элемента в геном хозяина. Клетки, несущие эти транспозонные элементы, могут быть положительно отобраны путем включения G418 (генетицина) в ростовую среду для клеток.

[0224] Плазмидными векторами pLL08 (Flag-меченый-G1L) и pLL10 (Flag-меченый-I7L) трансфицировали клетки 143В, чтобы создать две трансдуцированные трансгенные клеточные линии: G1L-143B (содержащей кассету для экспрессии G1L) и I7L-143B (содержащей кассету для экспрессии I7L). Клетки с успешной интеграцией транспозонов амплифицировали до рабочих количеств путем включения генетицина в ростовую среду. Для проверки успешной интеграции общую клеточную ДНК выделяли из этих трансгенных клеток с использованием набора для экстракции ДНК из Dneasy от Qiagen, следуя пользовательской инструкции из набора. Выделенную ДНК затем использовали в качестве матрицы для реакции ПЦР-амплификации с использованием пары ПЦР-праймеров, специфичных для ПЦР-амплификации GIL и I7L. Обе линии клеток были положительными на наличие последовательностей ДНК G1L и I7L в своих геномах

[0225] Для проверки экспрессии G1L и F7L этими клеточными линиями проводили Вестерн-блот-анализ, обнаруживая присутствие каждого Flag-меченого белка помощью антитела к Flag-тегу [M2], конъюгированного с HRP (анти-DDDDK антитело, Abcam, кат. № ab49763). Результаты этого Вестерн-блот-анализа с использованием общего белка, выделенного из клеточных линий G1L-143B и I7L-143B, показали, что анти-Flag антитело, как и ожидалось, не распознает никаких белков, выделенных из 143B, но оно может распознавать белок CP77 с Flag-тегом, проэкспрессированный в трансгенной клеточной линии СНО (CP77-CHO), подтверждая, что антитело к Flag-тегу может распознавать Flag меченые белки. Однако никакого Flag-меченого белка G1L не обнаруживалось в белковом экстракте из образца G1L-143B. Проэкспрессированный в бактериях Flag-меченый I7L обнаруживается с помощью анти-Flag антитела, но оно не может обнаружить экспрессию Flag-меченого I7L в клеточной линии I7L-143B.

[0226] Поскольку кассеты для экспрессии G1L и I7L можно обнаружить в соответствующих клеточных линиях, можно заключить, что либо экспрессируемые белки быстро деградируют после синтеза в отсутствие заражения вирусом осповакцины, то есть, оба белка G1L и I7L представляют собой вирусоспецифичные ферменты и могут являться нестабильными без своих специфичных ферментных субстратов из вируса осповакцины, либо промоторы, управляющие экспрессией в этих двух кассетах, являются дефектными. Другая гипотеза заключается в том, что экспрессия этих белков в отсутствие инфекции вируса осповакцины является «токсичной» для клеток, и в процессе отбора на генетицине клетки, которые подавили экспрессионные кассеты трансгенных G1L и I7L, но не экспрессионную кассету NPT II, обеспечили возможность амплификации резистентных к генетицину клеток, которые не экспрессируют белки G1L или I7L. Поскольку плазмида pJ503-2 piggyBac была успешно использована в лаборатории авторов для экспрессии СОР-D13L в клетках 143В, предположили, что промотор EF1-альфа был функциональным, а данные белки были нестабильными в отсутствии инфекции вирусом осповакцины, или же промотор, управляющий экспрессией этих белков избирательно подавлялся для предупреждения экспрессии «токсичных» белков в процессе амплификации клеток в присутствии генетицина.

ПРИМЕР 9

D13L в качестве примера белка, необходимого для структурного созревания или сборки, экспрессируется в клетках млекопитающих и восстанавливает жизнеспособность вируса осповакцины с делецией гена D13L, и вирус осповакцины с удаленным D13L экспрессирует белок в инфицированных клетках

[0227] Создание D13-восстанавливающей линии клеток: в качестве примера аттенуирования вируса осповацины путем блокирования процесса сборки/созревании, для удаления была выбрана QRF белка D13L из штамма Copenhagen. Для этого сначала должна быть создана клеточная линия, экспрессирующая этот белок, чтобы вирус с удаленным D13L мог размножаться. Для создания восстанавливающей клеточной линии была выбрана линия клеток яичника китайского хомячка, часто указываемая как CHO, поскольку эта клеточная линия является «биотехнологически» удобной. Для того, чтобы восстановить жизнеспособность инфекционного вируса осповакцины СОР с делецией D13L, эта клеточная линия должна экспрессировать белок D13L со своего ядерного генома с использованием транскрипционного аппарата клетки, на не вируса осповакцины. Аминокислотная последовательность экспрессируемого клеткой белка D13, включающего на С-конце тег-последовательность DYKDDDDK (Flag-тег, Hopp et al. 1988), была оптимизирована по кодонам под СНО, чтобы получить соответствующую нуклеотидную последовательность. Стабильная интеграция этой кассеты для экспрессии меченого D13L с оптимизированными под CHO кодонами, состоящей из промотора млекопитающих и последовательности сигнала полиаденилирования млекопитающих в ядерную ДНК была достигнута с помощью технологии транспозонной интеграции, подобной описанной в Urschitz et al. 2010 и Matasci et al. 2011. Трансдукцию CHO осуществляли, используя векторную систему piggy Bac, приобретенную у DNA2.0 Inc (USA).

[0228] Конструирование последовательности, кодирующей белок D13L: последовательность, кодирующая белок D13L, была синтезирована в GeneArt (LifeTechnoIogies) путем воссоздания ДНК-последовательности из аминокислотной последовательности D13, кодируемой ORF D13L штамма Copenhagen вируса осповакцины, и оптимизирована по кодонам для экспрессии в клетках СНО. Кодирующая белок последовательность VACV-COP D13L ORF приведена в списке последовательностей.

[0229] Конструирование вектора для трансдукции клеток белком D13L: оптимизированную по кодонам последовательность, кодирующую белок D13 (D13LchoTagged), из рLL17 амплифицировали с помощью ПЦР и переклонировали в транспозонный вектор pJ503-2 piggyBac (вектор для экспрессии в клетках млекопитающих, pHULK piggyBac, с CometGFP и Neo+), приобретенный у DNA.2.0 Inc (кат.№ pJ503-2) по сайтам клонирования BsaI, получая pLL19. Клонирование между BsaI с помощью системы клонирования In-Fusion (Clontech: безлигазное клонирование) удаляет последовательность, кодирующую CometGFP, и заменяет ее последовательностью, кодирующей белок D13 с тегом, с помощью гомологичной рекомбинации in vitro. Теперь последовательность, кодирующая белок D13LchoTagged, находится под контролем промотора фактора элонгации 1-альфа человека (EF1а) и будет экспрессироваться совместно с геном устойчивости к неомицину после стабильной интеграции обоих в геном трансфицированных клеток. Стабильная интеграция в геном хозяина опосредована транспозонной интеграцией последовательности ДНК, связанной между левой и правой границами транспозона в векторе piggyBaс.

[0230] ПЦР-амплификацию последовательности D13LchoTagged проводили с использованием следующей пары праймеров:

Последовательность прямого праймера:

Inf-LL19-D13LC-Fw: 5’-AACACGTCTCGGGGGgccgccaccATGAACAACACCATCATCAA-3’

[0231] Последовательность, выделенная прописными буквами, полужирным шрифтом и подчеркиванием, представляют собой последовательность, гомологичную сайту BsaI выше cometGFP в плазмиде pJ503-2 (Neo+), необходимую для клонирования In-fusion. Последовательность, выделенная красными строчными буквами и подчеркиванием, представляет собой модифицированную последовательность Козака. Последовательность, представленная обычными прописными буквами, гомологична 5'-концу последовательности D13LchoTagged в pLL17.

Последовательность обратного праймера:

Inf-LL19-D13LC-Rv: 5’-CAGGAAGACGCTTTTTCACTTGTCGTCGTCGTCCTTGTAG-3’

[0232] Последовательность, выделенная прописными буквами, полужирным шрифтом и подчеркиванием, представляют собой последовательность, гомологичную сайту BsaI ниже cometGFP в плазмиде pJ503-2 (Neo+), необходимую для клонирования In-fusion. Последовательность, представленная обычными прописными буквами, гомологична 3'-концу последовательности D13LchoTagged в pLL17. Чтобы получить плазмиду pLL19, продукт ПЦР с ожидаемым размером 1719 п.н. был клонирован в расщепленную по BsaI плазмиду pJ503-2 (Neo+) с помощью клонирования IhFuslon (Clontech), следуя инструкциям изготовителя.

[0233] Создание клеточной линии CHO, экспрессирующей белок D13 (p-LL19-CHO): клетки CHО высевали в лунки 6-луночного планшета таким образом, чтобы после инкубации в течение ночи они имели около 50%-й конфлюентности. С помощью трансфекционного реагента Effectene от Qiagen (кат.№ 301425) 1 мкг плазмиды pLL19 трансфецировали 1 лунку клеток CHO с 50%-й конфлюентностью, следуя инструкциям изготовителя. Трансфецированные клетки затем инкубировали в течение ночи в ростовой среде (RPMI 1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин). На следующий день среду заменяли ростовой средой, содержащей 1000 мкг/мл генетицина для отбора трансдуцированных клеток. Отборочную среду меняли каждые 2-3 дня. Когда конфлюентность трансдуцированных клеток превышала 90-100%, их собирали с помощью TrypLE Select (Gibco-Invitrogen Corp, кат. № 12563-029) и высевали во флакон Т25 для дальнейшего размножения клеток.

[0234] Подтверждение экспрессии D13 с помощью Вестерн-блоттинга – получение кроличьей анти-D13 антисыворотки: кроликам вводили с помощью инъекции связанный с KLH 16-аминокислотный пептид, который представляет собой C-концевые аминокислоты нативного белка D13. Этой аминокислотной последовательностью является: CYDQGVSITKIMGDNN. Для получения антител к этой аминокислотной последовательности проводили суммарно три инъекции с интервалом в 1 месяц. Сыворотку от иммунизированного кролика проверяли с помощью Вестерн-блоттинга против следующих клеточных экстрактов: общий клеточный экстракт 143В, общий клеточный экстракт трансгенной клеточной линии 143B, экспрессирующей Flag-меченый-D13L (p-LL06-143b) и экстракт клеток 143В, инфицированных VACV-СОР. Результаты ясно показали, что анти-D13 кроличья сыворотка может специфично распознавать белок D13.

[0235] Получение трансдуцированных клеток СНО: трансдуцированную D13LchoTagged поликлональную размноженную клеточную линию СНО (p-LL19-CHO) культивировали до 100%-й конфлюентности во флаконе T25, как и нормальные клетки СНО. Клетки из каждого флакона собирали с помощью TrypLE Select (Gibco-Invitrogen Corp, кат.№ 12563-029), осаждали центрифугированием на низкой скорости (300 g в течение 5 минут), промывали PBS и ресуспендировали в 200 мкл PBS.

[0236] Вестерн-блот-анализ: в каждую суспензию клеток добавляли по 50 мкл 5× буфера для нанесения на ДСН-ПААГ, а затем инкубировали при 98°С в течение 5 мин. По 15 мкл каждого клеточного белкового экстракта наносили на два 10%-х ДСН-полиакриамидных геля, проводили электрофорез, а затем переносили на нитроцеллюлозу Hybond ECL с помощью электроблоттинга. Мембраны после электроблоттинга затем обрабатывали 5%-м сухим обезжиренным молоком, растворенным в Трис-солевом буфере, содержащем Tween 20 (TBST). в течение 1 часа при комнатной температуре, чтобы блокировать все доступные участки неспецифического связывания антител на мембране. Мембраны несколько раз промывали в TBST перед окрашиванием антителами. Мембрану 1 окрашивали разведенными 1:5000 анти-DDDDK-тег антителами M2, конъюгированными с HRP (Abcam, кат.№ ab49763), течение ночи при температуре 4°С. Мембрану 2 окрашивали разведенной 1:2000 анти-D13 антисывороткой в течение ночи при 4°C, промывали 3 раза TBST, а затем окрашивали вторичными антителами – разведенными 1:5000 конъюгированными с HRP антителам против антител кролика (Abcam, кат.№ ab97069) в течение 2 часов. Обе мембраны затем промывали 3 раза в TBST, обрабатывали реагентами для детекции ECL (GE Healthcare) и экспонировали с рентгеновской пленкой в соответствии с указаниями инструкции для пользователей.

ПРИМЕР 10

Аттенуирование VACV-СОР путем удаления ORF белка D13L

[0237] Для аттенуирования вируса осповакцины, последовательность консервативного позднего промотора совместно с большей частью кодирующей белок последовательностью ORF СОР-D13L была выбрана для удаления путем гомологичной рекомбинации, и на ее месте, селективная/репортерная кассета была вставлена таким образом, что успешное удаление с помощью гомологичной рекомбинации может отбираться по клеточной линии СНО, экспрессирующей D13-белок, а инфекция может быть визуализирована с помощью красной флуоресценции. Селективная/репортерная кассета состоит из экспрессирующего CP77 гена видоспецифичности для СНО и последовательности DsRed-Express2 под контролем промотора вируса осповакцины.

[0238] Конструирование вектора для удаления СОР-D13L с помощью гомологичной рекомбинации: для удаления D13L ORF из VACV-СОР путем гомологичной рекомбинации были подобраны два плеча для гомологичной рекомбинации, фланкирующие с каждой стороны СОР-D13L ORF. Однако поскольку промоторная последовательность для СОР-D12L ORF может находиться в 3’-конце СОР-D13L ORF, приблизительно 200 п.о. с 3'—конца CОP-D13L ORF были оставлены без изменений.

[0239] Конструирование плеч для гомологичной рекомбинации, F1 и F2: плечи для гомологичной рекомбинации были ПЦР-амплифицированы с геномной ДНК VACV-СОР с использованием пары праймеров, приведенной ниже. Жирным шрифтом и подчеркиванием указаны плечи In-Fusion для присоединения плеч F1 и F2 к селективной/репортерной кассете и линеаризованной pUC19, поставляемой в наборе In-Fusion от Clontech. Лигирование In-Fusion даст кольцевую плазмиду, обозначенную pLL09.

Пара ПЦР-праймеров, используемая для ПЦР-амплификации плеча D13L-F1 на ДНК VACV-СОР:

Inf-PCR-D13L-F1-Fw: 5’CGGTACCCGGGGATCACGAAAAATAATAGTAACCA-3’. Полужирным шрифтом и подчеркиванием показана последовательность (15 п.о.), гомологичная левому концу линеаризованной плазмиды pUC19, поставляемой Clontech в наборе In-Fusion.

Inf-PCR-D13L-F1-Rv : 5’- AATTTAGTGTGCGCG TGGAAAAAGCTTACAATAAACTC -3’. Полужирным шрифтом и подчеркиванием показана последовательность (15 п.о.), гомологичная 5'—концу селективной/репортерной кассеты. Ожидаемый размер продукта ПЦР: 657 п.о.

Пара ПЦР-праймеров, используемая для ПЦР-амплификации плеча D13L-F2 на ДНК VACV-СОР:

Inf-PCR-D13L-F2-Fw: 5’-ATATTTAAATGCGCGCAATAATGGAACAAGAACCCT-3’. Полужирным шрифтом и подчеркиванием показана последовательность (15 п.о.), гомологичная 3'—концу селективной/репортерной кассеты.

Inf-PCR-D13L-F2-Rv: 5’-CGACTCTAGAGGATCGCGCTGAGGTCGGCAACTACG-3’. Полужирным шрифтом и подчеркиванием показана последовательность (15 п.о.), гомологичная правому концу линеаризованной плазмиды pUC19, поставляемой Clontech в наборе In-Fusion. Ожидаемый размер продукта ПЦР: 621 п.о.

[0240] Конструирование селективной/репортерной кассеты: экспрессионная селективная/репортерная кассета состоит из гена видоспецифичности для CHO, из 025L ORF вируса коровьей оспы (штамм Brighton Red) и последовательности, кодирующей красный флуоресцентный белок DsRed-Express2. Эта экспрессионная кассета была синтезирована Life Technologies GeneArt таким образом, чтобы последовательность, кодирующая белок CP77, находилась под контролем своего нативного промотора (100 п.о. последовательности перед старт-кодоном ATG белка CP77) и завершалась последовательностью остановки ранней транскрипции поксвируса (T5NT). Последовательность, кодирующая белок DsRed, находится под контролем раннего/позднего промотора вируса осповакцины и также заканчивается последовательностью остановки ранней транскрипции поксвируса.

[0241] Сборка pLL09: для получения плазмиды pLL09 ПЦР-продукты D13L-F1 и D13L-F2 вместе с селективной/репортерной кассетой собирали в pUC19, поставляемой в наборе InFusion от Clontech, с помощью клонирования In-Fusion, следуя инструкциям изготовителя.

[0242] Удаление СОР-D13L путем гомологичной рекомбинации и очистка бляшек для получения SCV104: COP-D13L ORF была инактивирована путем удаления большинства кодирующей белок последовательности и консервативного элемента позднего промотора «TAAAT». СОР-D13L ORF находится под контролем позднего промотора вируса осповакцины, в котором консервативный элемент позднего промотора имеет решающее значение для активности промотора (Moss, 2007) — его удаление приведет к подавлению экспрессии с COP-D13L ORF. Удаление кодирующей последовательности белка и консервативного промоторного элемента осуществляется путем гомологичной рекомбинации между VACV-СОР и pLL09 где результатом гомологичной рекомбинации является вставка кассеты для экспрессии CP77/DsRed в удаленную область. Введение этой экспрессионной кассеты позволяет рекомбинантному вирусу, теперь называемому SCV104, размножаться в клетках СНО, но только в клетках, которые экспрессируют функциональный белок D13, таких как p-LL19-CHO. После гомологичной рекомбинации загрязняющий «переносимый» родительский вирус (VACV-СОР) удаляли путем проведения последовательных раундов очистки бляшек. Присутствие загрязняющего родительского вируса контролировали с помощью ПЦР-анализа сайта встраивания.

[0243] Гомологичная рекомбинация: в три флакона T25, содержащих ростовую среду (RPMI—1640/10% FCS/2 мМ Giutamax/пенициллин-стрептомицин и 1000 мкг/мл генетицина) высевали р-LL19-CHO и культивировали до 100%-й конфлюентности при 37°С/5% СО2. В день заражения, два флакона инфицировали VACV-СОР с MOI 0,01 на клетку, где другой флакон не инфицировали (неинфицированный контроль). После инфицирования флаконов 1 и 2 в течение 45 мин при комнатной температуре удаляли среду с вирусом, и монослой клеток дважды промывали PBS. После промывки в каждый флакон добавляли по 4 мл поддерживающей среды (ММ: RPMI—1640/2% FCS/2 мМ Glulamax/пенициллин-стрептомицин), включая флакон 3, который также проходил через такую же стадию промывки.

[0244] Трансфекцию проводили с использованием трансфекционного реагента Effectene (Qiagen, кат.№ 301425) и следуя инструкциям изготовителя. Кратко, то 16 мкл Enhancer добавляли к 2 мкл линеаризованной pLL09 в 150 мкл буфера EC и оставляли на 5 минут при комнатной температуре после тщательного перемешивания. К этому добавляли 25 мкл трансфекционного реагента Effectene и оставляли при комнатной температуре на 10 минут. В конце к смеси добавляли 1 мл ММ (RPMI-1640/2% FCS/2 мМ Glutamax, пенициллин-стрептомицин) и тщательно и осторожно перемешивали. Эту трансфекционную смесь затем добавляли во флакон 1, который ранее был инфицирован VACV-СОР.

[0245] Флаконы 1 (гомологичная рекомбинация), 2 (контроль — только инфекция), 3 (неинфицированный контроль) инкубировали в течение ночи при 37°С/5% СО2, где на следующий день в каждом флаконе меняли среду на свежую MM (по 5 мл на флакон) и дополнительно инкубировали при 37°С/5% СО2 до появления сильного цитопатического эффекта (СРЕ) только во флаконе 1. Не должно наблюдаться никаких признаков инфекции во флаконе 2, поскольку VACV-СОР не является инфекционным для клеток CHО, и монослой должен выглядеть здоровым во флаконе 3.

[0246] После инфицирования в течение ночи красные флуоресцентные клетки можно ясно увидеть при наблюдении на инвертированном флуоресцентном микроскопе. Было решено собрать клетки в колбе 1, соскребая их в культуральную среду, а затем осадить их центрифугированием при низкой скорости (500 g в течение 5 минут при комнатной температуре) и ресуспендировать клеточный осадок в 1 мл 10 мМ Tris-HCl, pH 8. Вирусный экстракт получали несколькими циклами замораживания и оттаивания, а затем хранили при -80°C, готовым к стадии очистки бляшек. Вирусная конструкция была названа SCV104.

[0247] Процесс очистки бляшек: идея заключалась в серийном разведении экстракта после гомологичной рекомбинации и использовании каждого разбавления для инфицирования одного ряда клеток р-LLl9-СНО, культивируемых в 48-луночном планшете. Цель состояла в том, чтобы разбавить вирус вплоть до множественности инфекции в 1 БОЕ на лунку, а затем искать лунки, которые содержат только одну флуоресцентную бляшку после приблизительно 30 ч инфекции перед сбором вируса.

[0248] Клетки р-LL19-CHO высевали в каждую лунку 48- луночного планшета и культивировали до 100% в ростовой среде ((RPMI-1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин), содержащей 1000 мкг/мл генетицина при 37°С/5% СО2.

[0249] Для заражения экстракт после гомологичной рекомбинации (SCV104) размораживали и быстро обрабатывали ультразвуком, чтобы разбить комки и агрегаты. Используя ММ (RPMI/2% FBS/Glulamax/PenStrep), проводили серию десятикратных разведений до содержания вирусного экстракта 10-5 в объеме 1 мл. Для каждого разведения, в один ряд 48-луночного планшета высевали по 500 мкл разведенного вируса после удаления ростовой среды из каждой лунки и промывали один раз PBS. 48-луночный планшет оставляли при комнатной температуре на 45 мин для прохождения адсорбции вируса. После адсорбции вируса, среду с вирусом осторожно удаляли из каждой лунки, из которых остаток среды с вирусом удаляли путем промывки 500 мкл PBS на лунку. После промывки в каждую лунку добавляли 500 млк ММ (RPMI/2% FBS/Giutamax/пенициллин-стрептомицин) и затем инкубировали при 37°С/5% СО2 до хорошей видимости красных флуоресцентных очагов инфекции под флуоресцентным микроскопом.

[0250] Для сбора вируса были выбраны только лунки, содержащие один флуоресцентный очаг при самом низком разбавлении. Среду из выбранных лунок тщательно удаляли и добавляли 100 мкл Tris*HCl, pH 8. Планшет замораживали и размораживали три раза, а затем извлекали содержимое выбранных лунок. Для каждой выделенной бляшки, процесс очистки бляшек повторяли еще пять раз.

[0251] Выбранный клон затем дополнительно амплифицировали путем инфицирования 1 лунки 6-луночного планшета, содержащего клетки р-LL19-CHО при 100%-й конфлюентности путем удаления ростовой среды из лунки и добавления 10 мкл вирусного экстракта, разбавленного до 500 мкл в PBS. После инкубации в течение 45 мин при комнатной температуре в лунку добавляли 2 мл среды ММ и инкубировали далее при 37°C и 5% CО2 в течение 3 дней, пока большинство клеток не начинали флуоресцировать красным под флуоресцентным микроскопом. Клетки в инфицированной лунке соскабливали в культуральную среду, а затем осаждали при 500 g в течение 5 минут. Осажденные клетки ресуспендировали в 500 мкл из 10 мМ Tris*HCl, pH 8, и быстро обрабатывали ультразвуком, чтобы получить вирусный экстракт.

[0252] ПЦР-проверка встраивания кассеты для экспрессии CP77/DsRed в D13L ORF вируса SCV104: проводили ПЦР-анализ, чтобы определить, действительно ли после гомологичной рекомбинации и очистки бляшек D13L ORF замещена экспрессионной кассетой CP77/DsRed. Была подобрана пара ПЦР-праймеров, связывающихся вне области двух фланкирующих плеч для гомологичной рекомбинации таким образом, чтобы они связывались с последовательностью «нативной» ДНК, а не «вводимой» ДНК. Подобранная таким образом пара праймеров может использоваться для ПЦР-амплификации на обоих VACV-СОР и SCV104 в качестве ДНК-матрицы, а размер ПЦР-продуктов будет показывать вставку экспрессирующей кассеты в D13L ORF или детектировать вирус без вставки, то есть VACV-СОР. Этот ПЦР-анализ не только указывает на присутствие вставки, но также может определить, по-прежнему ли присутствует остаточный загрязняющий родительский вирус (VACV-СОР) после нескольких раундов очистки бляшек. Присутствие следового загрязнения VACV-СОР является крайне нежелательным, так как оно может обеспечить in trans функции D13 для SCV104 и тем самым снизить степень аттенуирования SCV104.

[0253] Выделение ДНК с использованием набора QIAGEN DNeasy Tissue Kit (кат.№ 69504): вирусную ДНК выделяли из 200 мкл вышеуказанного амплифицированного вируса SCY104 с использованием набора DNeasy Tissue, следуя инструкции изготовителя. Кратко, выделение осуществляли путем добавления 20 мкл протеиназы К к 200 мкл вирусного экстракта и хорошего перемешивания. В эту смесь добавляли 200 мкл буфера AL и хорошо перемешивали перед инкубацией при 56°C (в нагревательном блоке) в течение 10 минут. После инкубации добавляли 200 мкл 100%-го этанола и хорошо смешивали, а затем весь объем переносили в центрифужную колонку. Жидкость пропускали через центрифужную колонку с помощью центрифугирования в соответствии с инструкциями изготовителя с последующими промывками центрифужной колонки буферами с AW1 и AW2. ДНК, связавшуюся к центрифужной колонкой, элюировали два раза 100 мкл буфера АЕ. Элюированную ДНК объединяли в одной пробирке, и она была готова для ПЦР-анализа и хранилась при 4°С до его проведения.

[0254] ПЦР-амплификация: ДНК, выделенную из SCV104 (см. раздел 4.2.3.1 выше), использовали в качестве матрицы для ПЦР-амплификации, чтобы определить наличие вставки в D13L ORF. ПЦР-праймеры, описанные ниже, связываются с последовательностями, фланкирующими D13L ORF, так что амплификация на ДНК SCV104 должна давать ПЦР-продукт 4360 п.о., в отличие от ПЦР-продукта 2881 п.о., амплифицируемого с родительского вируса, VACV-СОР. ПЦР-анализ показал, что клоны 6—й очищенной бляшки SCV104 дают амплификацию только продукта, по размеру выше 4000 и ниже 5000 п.о., указывая на то, что SCV104 содержит кассету CP77/DsRed в D13L ORF. Отсутствие ПЦР—продукта с размером около 3000 п.р. означает, что не существует детектируемого уровня загрязнения родительским вирусом в амлифицированных стоках вируса SCV104.

Подробная информация о паре праймеров:

ID_D12L_LL04_Fw: 5’-TACAAAATCAAATAATGGTCGAAAC-3’

ID_A2L_LL04_Rv: 5’-TGCCAAGAAAACACTCCTTCTAAGACAAT-3’

ПРИМЕР 11

Проверка атенурования SCV104 с помощью анализа на инфекционность бляшек

[0255] Поскольку белок, кодируемый D13L ORF, необходим для сборки вируса, можно было бы ожидать, что после вхождения в клетку восстановленный вирус SCV104 не сможет продуцировать инфекционные вирионы в нормальных клетках, пермиссивных для вируса осповакцины, и, следовательно, первоначальная инфекция будет неспособна распространятся на соседние клетки, чтобы сформировать постоянно увеличивающиеся очаги инфекции. Для фактического подтверждения этого описанный в данном изобретении вирус с удаленным D13L (SCV104) серийно разводили до такой точки, когда низкое количество бляшкообразующих единиц можно использовать для заражения клеток, культивируемых в 6-луночном планшете, таким образом, чтобы за распространением инфицирующего вируса от клетки к клетке можно было бы наблюдать в течение нескольких дней. В данном исследовании были изучены три клеточные линии: клетки 143В, которые являются пермиссивными для вируса осповакцины, клетки, CHO, которые не являются пермиссивными для вируса осповакцины, но могут стать, если вирус осповакцины экспрессирует белок CP77, и клетки р-LL19-CHO, которые представляют собой рекомбинантную клеточную линию, экспрессирующую белок D13L. Вирус, описанный в данном изобретении, который содержит экспрессионную кассету CP77/DsRed, вставленную в D13L ORF таким образом, что функциональный белок D13 не может экспрессироваться, должен формировать инфекционные очаги только в клеточной линии р-LL19-CHO. Наличие очагов инфекции в монослое клеток 143B указывает на загрязнение вирусной популяции вирусом осповакцины, поскольку загрязняющий вирус будет обеспечивать вспомогательные функции D13L in trans. Присутствие очагов инфекции в монослое клеток CHO означает, что введение кассеты CP77/DsRed не инактивировало D13L ORF.

[0256] Культивирование клеток: клетки 143В, СНО и р-LL09-CHO высевали на несколько 6-луночных планшетов и культивировали в ростовой среде (RPMI-1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин, и только для р-LL09-CHO 1000 мкг/мл генетицина) при 37°C и 5% СО2 до достижения клеточными монослоями 100%-й конфлюентности.

[0257] Инфицирование: для инфицирования клеток использовали 3-кратно амплифицированный очищенный из бляшек вирусный экстракт. Вследствие неизвестного титра этого вируса приготавливали серии 10-кратных разведений исходного вируса до 10-4 следующим образом: во—первых, 60 мкл исходного вируса разбавляли в 6 мл среды ММ (разведение 1; 1:100), а последующие разведения получали добавлением 800 мкл разведения 1 к 7,2 мл среды ММ (разведение 2; 10-3), а затем повторяли, чтобы получить разведение 10-4. Для заражения добавляли по 500 мкл из каждого разведения в каждую лунку 6-луночного планшета - использовали по одному планшету на одну клеточную линию. Адсорбцию вируса проводили при комнатной температуре в течение 45 мин, где после этого вирусный инфекционный материал удаляли из каждой лунки и каждую лунку промывали PBS перед добавлением 2 мл ММ на лунку. Планшеты инкубировали при 37°C и 5% CО2 и ежедневно наблюдали под флуоресцентным микроскопом. Разведение 10-2 дало лучший для наблюдения уровень вирусный инфекции.

[0258] Наблюдение под микроскопом: за развитием вирусной инфекции наблюдали под флуоресцентным микроскопом (Olympus IX51) с фильтром DsRed (кат.№ U-MRFPHQ, Olympus). Снимки делали с использованием CellSens Digital Imaging Software (Olympus).

[0259] Результаты: инфекция разведением 10-2 давала наилучшие результаты для наблюдения исходной инфекции единичных клеток и распространения инфекции на соседние клетки. Исследование клеток 143В показало наличие инфекции единичных клеток на 1-й день, при которой вирус не смог распространиться на соседние клетки на 2-й день и 3-й день, указывая на то, что имело место вхождение вируса в одиночные клетки, но не продуцировалось инфекционное вирусное потомство на 2-й и на 3-й день. Такая же ситуация была верна и для отдельных инфицированных клеток CHO, т.е. в первоначально инфицированных одиночных клетках не продуцировалось инфекционное вирусное потомство.

[0260] Исследование клеточной линии р-LL19-CHO показало, что первоначальная инфекция одиночных клеток продуцировала инфекционное вирусное потомство, которое было видно в виде мелких очагов инфекции на 1-й день. Эти очаги инфекции быстро увеличивались в размере на 2-й и на 3-й день, указывая на амплификацию вируса со временем.

[0261] Соответственно, удаление кодирующей последовательности функционального каркасного белка серповидных структур вируса осповакцины из любого вируса осповакцины будет сильно аттенуировать этот вирус. Хотя данный вирус не в состоянии производить инфекционное вирусное потомство после первичной инфекции, экспрессия его белков, в частности, DsRed, имеет место в первично инфицированных единичных клетках, о чем свидетельствует наблюдаемая красная флуоресценция. Этот вирус может быть восстановлен в клеточной линии, экспрессирующей каркасный белок серповидных структур вируса осповакцины независимо от инфекции вирусом осповакцины. Конститутивная экспрессия каркасного белка серповидных структур вируса осповакцины трансгенной линией клеток не оказывает отрицательного влияния на рост или физиологию этой клеточной линии.

ПРИМЕР 12

Создание клеточной линии С11-LL19-HeLa, экспрессирующей D13L

[0262] Для того, чтобы титровать нефлуоресцентный SCV с удаленным D13L, была создана восстанавливающая клеточная линия, экспрессирующая белок D13, состоящая из пермиссивной для вируса осповакцины клеточной линии, которая поддерживает образование литических бляшек. В клетках CHO, вирус осповакцины, экспрессирующий CP77, или экспрессия CP77 в клеточной линии не поддерживают образования литических бляшек, которые могут быть окрашены кристаллическим фиолетовым и посчитаны визуально. Для создания титрующейся клеточной линии клетки HeLa трансдуцировали, чтобы получить экспрессию белка D13, путем стабильной интеграции экспрессионной кассеты, состоящей из конститутивного промотора млекопитающего, кодирующей последовательности белка D13, содержащей последовательность Козака вокруг инициирующего кодона и оканчивающейся сигнальной последовательности полиаденилирования. Эту кассету затем клонировали в плазмидный вектор, который давал возможность стабильного переноса гена в геномную ДНК клетки-хозяина и селекции успешной интеграции с помощью селективного антибиотика. Трансдуцированные клетки затем амплифицировали с использованием селективного антибиотика для отбора клеток, содержащих экспрессирующую D13 кассету, а затем проводили анализ бляшек с использованием SCV104 (с удаленной D13L ORF) путем инфицирования монослоев клеток при MOI 0,001 БОЕ на клетку и отбора клона, который продуцировал наибольший размер бляшек за 3-дневный период. В SCV104 его D13L ORF замещена двумя экспрессионными кассетами: одной для экспрессии белка CP77, и другой для экспрессии красного флуоресцентного белка. Заражение SCV104 клеточной линии HeLa, экспрессирующей белок D13, приведет к появлению красных флуоресцентных литических бляшек.

[0263] Конструирование вектора pLL19—D13 для трансдукции клеток: конструирование pLL19 описано выше. В этой плазмиде последовательность, кодирующая меченый Flag-тегом на C-конце белок D13, находится од контролем конститутивного промотора фактора элонгации 1-альфа человека, а стабильный перенос генов в клеточную геномную ДНК опосредован транспозонным переносом. Транспозонный перенос также вставляет экспрессионную кассету для отбора на антибиотике неомицине, так что трансдуцированные клетки можно положительно отбирать путем добавления G418/генетицина в ростовую среду.

[0264] Стабильная вставка в клетки HeLa кассеты для экспрессии D13-Flag путем трансдукции с использованием pLL19: клетки HeLa высевали в флакон T25 и культивировали приблизительно до 50%-й конфлюентности в ростовой среде RPMI-1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин. С помощью трансфекционного реагента Effectene от Qiagen (кат.№ 301425) 1 мкг плазмиды pLL19 трансфицировали флакон Т25 клеток HeLa с 50%-й конфлюентностью, следуя инструкциям изготовителя. Трансфицированные клетки затем инкубировали в течение ночи в ростовой среде (RPMI 1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин). На следующий день среду заменяли ростовой средой, содержащей 1000 мкг/мл генетицина для отбора трансдуцированных клеток. Когда большинство клеток погибали, оставшиеся клетки извлекали, открепляя их от поверхности флакона с помощью TrypLE Select (Gibco-Invitrogen Corp, кат.№ 12563-029), и по одной клетке сортировали их в 96-луночные планшеты, содержащие ростовую среду и 1000 мкг/мл генетицина. Эти планшеты инкубировали при 37°C/5% CО2, пока колонии клеток не становились видимыми в каждой лунке. Селективную среду меняли каждые 2-3 дня. Каждую колонию клеток извлекали и последовательно размножали, пересевая следующим образом: с 48-луночного планшета в 24-луночный планшет, 6-луночный планшет, флакон T75, и поддерживали в флаконе Т75, пересевая в соотношении 1:5, до готовности создания запаса замороженных клеток.

[0265] Поиск моноклональной клеточной линии, которая наилучшим образом поддерживает образования бляшек SCV104: SCV104 представляет собой вирус осповакцины, в котором его D13L ORF заменена промотором 025L вируса коровьей оспы плюс ORF, которая кодирует белок CP77, и экспрессионной кассетой красного флуоресцентного белка ((DsRed Express2). Экспрессия CP77 не важна или не нужна для образования бляшек в клетках HeLa, но этот вирус не будет размножаться в отсутствие клеточной экспрессии белка D13. Однако в клеточной линии HeLa, экспрессирующей белок D13, SCVI04 должен быть в состоянии амплифицироваться и распространяться на другие соседние клетки и при этом образовывать красные флуоресцентные литические бляшки в монослое клеток. Этот вирус был использован в исследовании образования бляшек в клональных клеточных линиях LL19-HeLa для отбора клона, который наилучшим образом поддерживает образование бляшек.

[0266] Культивирование клеточных линий: ряд клонов клеточной линии LL19-HeLa высевали в лунки 6—луночных планшетов и культивировали в ростовой среде, содержащей 1000 мкг/мл генетицина до 100%-й конфлюентности при 37°C/5% CО2.

[0267] Вирусная инфекция: SCV104 использовали для инфицирования клеток при 0,001 БОЕ на клетку путем разбавления вируса в ММ (RPMI-1640/2% FBS/2 мМ Glutamax/пенициллин-стрептомицин) до 10-3 БОЕ/мл. 1 мл разведенного вируса добавляли в каждую лунку для инфекции. Каждая лунка 6-луночного планшета содержит приблизительно 1×106 клеток при конфлюентности, поэтому 1 мл 10-3 БОЕ/мл дает в результате MOI 0,001. MOI 0,001 будет гарантировать образование бляшек из отдельных инфицированных клеток. Все планшеты инкубировали при комнатной температуре в течение 1 часа, чтобы вирус мог адсорбироваться на клетках, и после этого 1 мл ММ добавляли в каждую лунку, и все планшеты затем инкубировали при 37°C/5% CО2, обеспечивая синхронное вхождение вируса в клетки с последующей амплификацией вируса, приводящей к распространению вируса от клетки к клетке с течением времени. Образование красных флуоресцентных бляшек ежедневно наблюдали под флуоресцентным микроскопом.

[0268] Наблюдение под микроскопом: за развитием вирусной инфекции и образованием бляшек наблюдали под флуоресцентным микроскопом (Olympus IX51) с фильтром DsRed (кат.№ U-MRFPHQ, Olympus). Снимки делали с использованием CellSens Digital Imaging Software (Olympus).

[0269] Результаты: на 1-й день после заражения все инфекции дали спорадические мелкие очаги красной флуоресценции. На 3-й день все клональные клеточные линии продуцировали большие флуоресцирующие красным литические бляшки, где клон 11 (Cl1) продуцировал бляшки достоверно максимального размера из всех исследуемых клонов.

[0270] Вывод: эти результаты показывают, что клон C11 (C11-LL19-HeLa) экспрессировал достаточное количество белка D13, чтобы поддерживать образование самых больших бляшек из всех клонов, исследованных на заражение SCV104. Этот клон (C11) отлично подходит для количественной оценки вируса осповакцины с удаленным D13L с использованием метода подсчета литических бляшек, обычно используемого для титрования вируса осповакцины.

ПРИМЕР 13

Создание клеточной линии р-LL07-LL29-CHO, экспрессирующей CP77 и D13L

[0271] Для восстановления жизнеспособности вируса VACV-СОР с делецией D13L ORF в клетках СНО, должна быть создана клеточная линия CHO, экспрессирующая белки D13 и CP77. Это было выполнено путем создания кассеты для экспрессии D13 в клетках млекопитающих и кассеты для экспрессии CP77 в клетках млекопитающих, состоящих из промотора млекопитающего для управления экспрессией, оптимизированных по предпочтительным для СНО кодонам последовательностей ДНК, кодирующих белки D13 или CP77, за которыми следует последовательность сигнала полиаденилирования. Эти кассеты затем клонировали в плазмидные векторы, которые обеспечивают стабильный перенос гена в геномную ДНК клетки-хозяина и селекцию успешной интеграции с помощью селективного антибиотика. Трансдуцированные клетки затем амплифицировали путем селекции на антибиотике для отбора клеток, которые содержат экспрессионные кассеты как для D13, так и для CP77. Для проверки экспрессии CP77, вирус осповакцины, экспрессирующий усиленный зеленый флуоресцентный белок (SCV505), использовали для инфицирования трансгенной линии клеток, где рост флуоресцентных бляшек мониторили в течение 4-дневного периода. Увеличивающийся размер флуоресцирующей зеленым бляшки в течение 4-дневного периода дня подтвердил экспрессию CP77 клеточной линией. Чтобы подтвердить экспрессию белка D13, вирус осповацины с удаленным D13L, экспрессирующий CP77 (SCV104) и флуоресцентный белок DsRed, был использован для заражения трансгенной линии клеток, где рост бляшек мониторили в течение 4-дневного периода. Увеличивающийся размер флуоресцирующей красных бляшек в течение 4-дневного периода подтвердил экспрессию D13 клеточной линией.

Конструирование плазмиды pLL07 для переноса гена СР77

[0272] Конструирование кодирующей последовательности белка CP77: кодирующая последовательность белка CP77 была синтезировала в GeneArt GmbH (Германия) путем воссоздания (обратной трансляции) последовательности ДНК из аминокислотной последовательности CP77, кодируемого ORF 025L штамма Brighton Red вируса коровьей оспы (UniProtKB/Swiss-Prot: P12932.1), и оптимизации кодонов для экспрессии в клетках млекопитающих (СНО).

[0273] Конструирование вектора для трансдукции клеток последовательностью, кодирующей CP77: оптимизированная по кодонам кодирующая последовательность белка CP77 из pPH51 (клонирующий плазмиды, несущей оптимизированную по кодонам последовательность белка CP77) была амплифицирована с помощью ПЦР с использованием пары ПЦР-праймеров, где 5’-праймер был разработан для добавления последовательности Козака вокруг стартового кодона, а 3’-праймер был разработан, чтобы добавить последовательность Flag-тега до начала стоп—кодона. Амплифицированный ПЦР-продукт субклонировали в вектор piggyBac pJ507-2 (Hyg+), приобретенный от DNA2.0 Inc (США), по сайту клонирования BsaI. Клонирование в сайты BsaI эффективно заменяет кодирующую последовательность cometGFP кодирующей последовательностью белка CP77, давая pLL07. CP77 теперь находится под контролем конститутивного промотора фактора элонгации 1-альфа человека (EFLA) и экспрессируется совместно с геном устойчивости к гигромицину после их стабильной интеграции в геном трансфицированных клеток. Стабильная интеграция в геном хозяина опосредована транспозонной интеграцией последовательности ДНК, находящейся между левой и правой транспозонными границами в векторе piggyBac.

Пара ПЦР-праймеров, используемая для амплификации СР77-СНО гена на ДНК плазмиды pPH51:

Последовательность прямого праймера:

AACACGTCTCGGGGGgccgccaccATGTTCGACTACCTGGAAAATGAGGAAGTG (SEQ ID NO: 4)

Последовательность обратного праймера:

CAGGAAGACGCTTTTtcaCTTGTCATCGTCATCCTTGTAATCCTGCTGCTCGAAGATCTTGTACT (SEQ ID NO: 5). Последовательность Flag-тега подчеркнута, за ней следует стоп-кодон (показан строчными буквами)).

Конструирование плазмиды pLL29 для переноса гена D13

[0274] Оптимизированная по кодонам для СНО кодирующая последовательность белка D13 была ПЦР-амплифицирована из pLL19 (описанной выше) для обмена C-концевой последовательности Flag-тега на последовательность HA-тега перед клонированием в pJ503-02 (вектор для экспрессии в клетках млекопитающих, pHULK piggyBac, с CometGFP и Neo+), приобретенный у DNA2.0 Inc (кат.№ pJ503-2), по сайтам клонирования BsaI.

[0275] Конструирование вектора для трансдукции клеток, D13L-HA: оптимизированная по кодонам кодирующая последовательность белка D13 без C-концевой последовательности Flag-тега была ПЦР-амплифицирована на pLL19 и субклонирована в транспозонный PiggyBac-вектор pJ503-2 (вектор для экспрессии в клетках млекопитающих, pHULK piggyBac, с CometGFP и Neo+), приобретенный у DNA2.0 Inc (кат.№ pJ503-2), по сайтам клонирования BsaI для получения pLL29. Клонирование между сайтами BsaI с помощью клонирования In-Fusion (Clontech: безлигазное клонирование) удаляет кодирующую последовательность cometGPF и заменяет ее на HA-меченую кодирующую последовательность белка D13 посредством гомологичной рекомбинации in vitro. Кодирующая последовательность белка D13LchoHA-Tagged находится теперь под контролем конститутивного промотора фактора элонгации 1-альфа человека (EFLA) и экспрессируется совместно с геном устойчивости к гигромицину после их стабильной интеграции в геном трансфицированных клеток. Стабильная интеграция в геном хозяина опосредована транспозонной интеграцией последовательности ДНК, находящейся между левой и правой транспозонными границами в векторе piggyBac. Карта плазмиды pLL29 показана ниже.

ПЦР-амплификацию последовательности D13Lcho-HA tagged проводили с использованием следующей пары праймеров:

Последовательность прямого праймера:

Inf-LL19-D13LC-Fw:

5’-AACACGTCTCGGGGGGCCGCCACCATGAACAACACCATCATCAA-3’

Последовательность обратного праймера:

Inf-LL27-D13L-Rv:

5’-CAGGAAGACGCTTTTttaAGCATAATCTGGAACATCATATGGATAGTTGTTATCGCCCATGATCT-3’

Подчеркнутая последовательность в тексте представляют собой кодирующую последовательность HA. «tta» представляет собой стоп-кодон.

[0276] Стабильное двойное встраивание экспрессионных кассет Flag-меченого CF77 и HA-меченого D13 в клетки СНО путем одновременной трансдукции с использованием pLL07 и pLL29.

[0277] Клетки СНО высевали в флакон T25 и культивировали приблизительно до 50%-й конфлюентности в ростовой среде RPMI-1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин. С использованием трансфекционного реагента Effectene от Qiagen (кат.№ 301425) 1 мкг плазмиды pLL07 и 1 мкг плазмиды pLL29 трансфецировали флакон Т25 клеток СНО с 50%-й конфлюентностью, следуя инструкциям изготовителя. Трансфецированные клетки затем инкубировали в течение ночи в ростовой среде (RPMI 1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин). На следующий день среду заменяли свежей ростовой средой, содержащей 500 мкг/мл генетицина и 250 мкг/мл гигромицина В для отбора трансдуцированных клеток. Селективную среду заменяли каждые 2-3 дня до тех пор, пока большинство клеток не умирали и откреплялись, оставляя колонии клеток, которые возникали из единичных клеток. Когда трансдуцированные клетки дорастали до более чем 90-100% конфлюентности, их собирали с помощью TrypLE Select (Gibco-Invitrogen Corp, кат.№ 12563-029) и высевали в флакон Т75 для дальнейшего размножения клеток. Эта новая поликлональная клеточная линия была названа р—LL07—LL29-CHO.

[0278] Подтверждение экспрессии D13 и CP77 путем восстановления жизнеспособности вируса осповакцины и вируса осповакцины с удаленной D13L ORF.

[0279] SCV505 представляет собой вирус осповакцины, который экспрессирует усиленный зеленый флуоресцентный белок (EGFP) и размножается в клетках СНО только в присутствии белка CP77. Этот вирус был использован в анализе инфекционности бляшек в линии р-LL07-LL29-СНО, чтобы проверить экспрессию CP77 в этой клеточной линии. SCV104 представляет собой вирус осповакцины, в котором его D13L ORF заменена промотором 025L вируса коровьей оспы плюс ORF, которая кодирует белок CP77, и экспрессионной кассетой красного флуоресцентного белка (DsRed Express2). Этот вирус не размножается в отсутствие клеточной линии, экспрессирующей белок D13. Этот вирус был использован в исследовании инфекционности бляшек в р-LL07-LL29-CHO, чтобы проверить экспрессию D13 в этой клеточной линии.

[0280] Исследование инфекционности бляшек в клеточной линии р-LL07-LL29-CHO.

[0281] В этом исследовании были использованы различные клеточные линии, чтобы помочь качественно оценить экспрессию D13 и CP77 линией р-LL07-LL29-CHO после инфекции SCV505 (D13+ CP77- EGFP+) и SCV104 (D13- CP77+ DsRed+). Ожидаемые результаты в следующих клеточных линиях приведены далее:

[0282] Vero: эта клеточная линия в норме является пермиссивной для инфекции вируса осповакцины. Образование бляшек указывает на распространение от клетки к клетке амплифицирующегося вируса со временем, которое обнаруживается по зеленой флуоресценции при заражении SCV505, поскольку этот вирус в норме является инфекционным для этой клеточной линии. Однако отсутствие образования бляшек, обнаруживаемое по отсутствию или по присутствию только одиночных клеток с красной флуоресценцией для инфекции SCV104 следует рассматривать как указание на отсутствие распространения от клетки к клетке амплифицирующегося вируса со временем из-за отсутствия экспрессии белка D13 этой клеточной линией или вирусом.

[0283] C11-LL19-HeLa: она является пермиссивной для вируса осповакцины клеточной линией, экспрессирующей белок D13 в результате трансдукции pLL19. После инфекции SCV505 ожидается образование бляшек, которое указывает на распространение от клетки к клетке амплифицирующегося вируса со временем, обнаруживаемое по зеленой флуоресценции, независимой от экспрессии D13 клеточной линией. В данном случае ожидается образование бляшек после инфекции SCV104, поскольку этот вирус теперь может амплифицироваться в этой клеточной линии вследствие экспрессии белка D13 клеточной линией.

[0284] СНО: эта клеточная линия не является пермиссивной для инфекции вируса осповакцины. Ожидается, что не будет наблюдаться образования бляшек после заражения SCV505 и SCV104, что обнаруживается по отсутствию или присутствию единичных клеток с красной или зеленой флуоресценцией. Это указывает на отсутствие распространения от клетки к клетке амплифицирующегося вируса со временем вследствие отсутствия экспрессии белка D13 клеточной линией, необходимой для восстановления жизнеспособности SCV104, хотя этот вирус может экспрессировать CP77, и вследствие отсутствия экспрессии белка CP77 клеточной линией, необходимой для восстановления жизнеспособности SCV505.

[0285] р-LL07-LL29-СНО: она представляет собой клеточную линию CHO, экспрессирующую белки D13 и CP77. После инфекции SCV505 ожидается образование бляшек, указывающее на распространение от клетки к клетке амплифицирующегося вируса со временем, обнаруживаемое по зеленой флуоресценции, что указывает на экспрессию клеточной линией белка CP77. После инфекции SCV104 ожидается образование бляшек, указывающее на распространение от клетки к клетке амплифицирующегося вируса со временем, обнаруживаемое по красной флуоресценции, что указывает на экспрессию клеточной линией белка D13.

[0286] Культивирование клеток: клеточные линии Vero, CHO, C11-LL19-HeLa и p-LL07-LL29-CHO высевали в два набора из нескольких 6-луночных планшетов (один для инфекции SCV505 и один для инфекции SCV104) и культивировали в ростовой среде (указанной ниже) до 100%-й конфлюентности при 37°C и 5% СО2:

• Vero, CHO: RPMI-1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин;

• C11-LL19-Hela: RPMI-1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин, плюс 1000 мкг/мл генетицина;

• р-LL07-LL29-СНО: RPMI-1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин, плюс 500 мкг/мл генетицина и 250 мкг/мл гигромицина B.

[0287] Вирусная инфекция: для инфицирования клеток использовали SCV104 и SCV505 при 0,001 БОЕ на клетку путем разбавления вируса в ММ (RPMI—1640/2% FBS/2 мМ Glutamax/пенициллин-стрептомицин) до 103 БОЕ/мл. На планшет использовали один вирус: для заражения в каждую лунку добавляли по 1 мл разбавленного вируса. Каждая лунка 6-луночного планшета содержит приблизительно 1x106 клеток при конфлюентности, поэтому 1 мл при 103 БОЕ/мл дает MOI 0,001. MOI 0,001 гарантирует образование бляшек из одиночных инфицированных клеток. Все планшеты инкубировали при комнатной температуре в течение 1 часа, чтобы вирус мог адсорбироваться на клетках, и после этого добавляли по 1 мл ММ в каждую лунку, и все планшеты затем инкубировали при 37°C/5% CО2, обеспечивая синхронное вхождение вируса в клетки с последующей амплификацией вируса, приводящей к распространению вируса от клетки к клетке с течением времени. Образование красных флуоресцентных бляшек ежедневно наблюдали под флуоресцентным микроскопом.

[0288] Наблюдение под микроскопом: за развитием вирусной инфекции и образованием бляшек наблюдали под флуоресцентным микроскопом (Olympus IX51) с фильтром DsRed (кат.№ U-MRFPHQ, Olympus) для SCV104 и GFP-фильтром (кат.№ U-MGFPHQ, Olympus) для SCV505. Снимки делали с использованием CellSens Digital Imaging Software (Olympus).

Результаты:

[0289] Инфицирование клеток СНО вирусами SCV104 и SCV505 при MOI 0,001: в день 1 после заражения можно было увидеть только спорадическую флуоресценцию единичных клеток, указывающую на вхождение обоих вирусов в клетки, но еще не амплифицирующихся, чтобы распространять инфекцию на соседние клетки. Однако эта картина оставалась постоянной на протяжении от 2 до до 4 дня после заражения, т.е. наблюдались только единичные инфицированные клетки и не наблюдалось распространения вируса на соседние клетки со временем.

[0290] Инфицирование клеток Vero вирусами SCV104 и SCV505 при MOI 0,001: инфицирование с использованием SCV505 давало, как и ожидалось, крошечные бляшки, образующиеся в день 1 после инфекции, которые все увеличивались в размерах, пока все бляшки не объединились в одну сливающуюся инфекцию клеточных монослоев на 4-й день. Это указывало на то, что вирус амплифицировался с 1-го дня и далее, распространяя инфекцию до конфлюентности на 4-й день после заражения. Однако это совершенно отличалось от инфекции SCV104. В день 1 после заражения можно было увидеть только спорадические единичные флуоресцирующие клетки, которые оставались такими же в течение следующих 3 дней. Это указывает на то, что SCV104 не способен амплифицироваться и распространяться в этой клеточной линии, поскольку вирус не содержит D13L QRF и не в состоянии инициировать сборку вируса после репликации вирусного генома, и также данная клеточная линия не экспрессирует белок D13, чтобы помочь восстановить амплификацию вируса.

[0291] Инфицирование клеток С11-LL19-HeLa (линии клеток HeLa, экспрессирующей белок D13) вирусами SCVI04 и SCV505 при MOI 0,001: инфицирование SCV505, как и ожидалось, давало небольшие бляшки, образующиеся в день 1 после заражения, которые увеличились в размерах до полного слияния всех бляшек в одну конфлюентную инфекцию клеточных монослоев на 4-й день. Это указывало на то, что вирус амплифицировался с 1-го дня и далее, распространяя инфекцию до конфлюентности на 4-й день после заражения. Заражение SCV104 также давало такие же результаты, демонстрируя, что белок D13, продуцируемый этой клеточной линией, восполняет отсутствие D13L ORF в SCV104 и его количество, продуцируемое этой клеточной линией, является достаточным для поддержания амплификации вируса и распространения инфекции, сравнимых с SCV505, который имеет интактную D13L ORF.

[0292] Инфицирование клеток р-LL07-LL29-CHO (клеточной линии СНО, экспрессирующей белки D13 и CP77) вирусами SCV104 и SCV505 при MOI 0,001: для обоих SCV104 и SCV505 наблюдались маленькие очаги инфекции в день 1 после заражения. В течение следующих 3 дней, эти очаги инфекции расширялись до все более и более крупных бляшек, которые потом сливались в конфлюентную инфекцию на 4-й день после заражения. Это свидетельствует об экспрессии CP77, поскольку он поддерживает амплификацию и распространение SCV505, и также об экспрессии белка D13, поскольку он поддерживает амплификацию и распространение SCV104.

[0293] Вывод: эти результаты демонстрируют, что линия клеток CHO, экспрессирующая белки CP77 и D13, может быть использована в качестве клеточного субстрата для продукции и изготовления вируса осповакцины с удаленным D13L. Во время инфицирования нормальных пермиссивных клеток вирус с удаленным D13L не сможет инициировать сборку вируса и, следовательно, не сможет завершить инфекционный жизненный цикл, что, таким образом, делает его отличным с точки зрения безопасности вирусным вакцинным вектором для вакцинации человека и животных. Однако этот сильно аттенуированный вирус осповакцины может быть изготовлен в биотехнологически удобной клеточной линии СНО, если эта клеточная линия экспрессирует белок видоспецифичности для CHO (CP77) и недостающий для сборки белок (белок D13).

ПРИМЕР 14

Анализ экспрессии белков D13 и CP77 в клеточной линии p-LL07-LL29-CHO с помощью вестерн-блоттинга

Исходная информация

[0294] Белки D13 и CP77, экспрессируемые р-LL07-LL29-CHO, имеют теги и могут быть обнаружены с помощью антител, которые специфично распознают аминокислотную последовательность тега на С-конце белков D13 и CP77. При отсутствии антител, которые специфично распознают белки D13 и CP77, вестерн-блот анализ может быть осуществлен с использованием этих анти-тег антител для подтверждения экспрессии белков D13 и CP77 в клеточной линии р-LL07-LL29-CHO. C-концевая часть белка D13 содержит аминокислотную последовательность HA-тега «YPYDVPDYA», а С-конец белка CP77 содержит аминокислотную последовательность Flag-тега «DYKDDDDK».

Методика анализа вестерн-блоттинга

[0295] Следующие клеточные линии высевали в флаконы T75 и культивировали до 100%-й конфлюентности в ростовой среде (RPMI 1640/10% FBS/2 мМ Glutamax/пенициллин-стрептомицин), содержащей соответствующие селективные антибиотики: СНО без селективных антибиотиков, р-LL07-LL29-CHO с 500 мкл/мл генетицина и 250 мкг/мл гигромицина В, р-LL07-CHО с 250 мкг/мл гигромицина B и C11-LL19-HeLa с 1000 мкг/мл генетицина. Монослой конфлюентных клеток открепляли и разбивали до моноклеточной суспензии с помощью TrypLE Select при 37°C в течение 10 мин. Клетки из каждого флакона извлекали и осаждали центрифугированием при 300 g в течение 5 минут и дважды промывали PBS. После финальной промывки клеточные осадки ресуспендировали в 500 мкл PBS. В белковый экстракт добавляли 4× буфер до конечной концентрации 1× и нагревали при 98°С в течение 2-3 минут. Денатурированные образцы белка разделяли электрофорезом в покупном геле Biorad Mini-PROTEAN® TGX Stain-Free™ Precast Gel (градиентный гель) в течение 30-45 минут при 200 В. После электрофореза разделенные белки переносили на нитроцеллюлозную мембрану с помощью электроблоттинга в течение 1 ч при 100 В.

[0296] Для обнаружения белка нитроцеллюлозную мембрану инкубировали в 5%-м растворе порошкового обезжиренного молока в PBS в течение 1 часа при комнатной температуре, чтобы блокировать сайты неспецифического связывания антител. Для обнаружения HA-меченных белков, мембрану инкубировали в разведении 1:1000 анти-HA антител, конъюгированных HRP, (Abcam, кат.№ АВ1265) в блокирующем буфере в течение ночи при температуре 4°С. Для обнаружения FLAG-меченных белков отдельную нитроцеллюлозную мембрану после электроблоттинга инкубировали в разбавлении 1:1000 анти-Flag антител, конъюгированных с HRP (Abcam, кат.№ AB49763), в блокирующем буфере в течение ночи при 4°C. Мембраны затем промывали три раза по 5 минут в PBS, а затем инкубировали в ECL-субстрате (Thermo Scientific Pierce ECL Western-bot substrate, кат.№ 32106) в течение нескольких минут перед получением изображений с использованием системы гель-документации BioRad XRS.

Результаты

[0297] Обнаружение белка D13 через обнаружение HA-тега: анти-HA-тег антитело обнаруживало белок ожидаемого размера из общего клеточного белкового экстракта, полученного из р-LL07-LL29-CHO, но не обнаруживало белок из общего клеточного белкового экстракта, полученного из клеток СНО. Это ясно указывало на то, что р-LL07-LL29-СНО экспрессировала белок D13.

[0298] Обнаружение белка CP77 через Flag-тег: анти-Flag-тег антитело обнаруживало белок ожидаемого размера из общего клеточного белкового экстракта, полученного из р-LL07-LL29-CHO и п-LL07-CHO (клеточной линии CHO, экспрессирующей только CP77), но не белок из общего клеточного белкового экстракта, полученного из клеток СНО. Это ясно указывало, что р-LL07-LL29-CHO и р-LL07-СНО экспрессируют белок CP77.

[0299] Обнаружение белка D13 через обнаружение Flag-тега: белок D13, экспрессируемый C11-LL19-HeLa, экспрессируется с Flag-тегом на С-конце, и в вестерн-блоттинг общего клеточного белкового экстракта, полученного из этой клеточной линии, с анти-Flag-тег антителом был способен обнаружить белок ожидаемого размера. Это однозначно указывало на то, что C11-LL19-HeLa экспрессировала белок D13.

[0300] Многие модификации будут очевидны специалистам в данной области техники, не выходя за рамки объема настоящего изобретения.

ТАБЛИЦА А-1
Краткое описание идентификаторов последовательностей
SEQUENCE ID NO: ОПИСАНИЕ
1 Нуклеотидная последовательность С77, оптимизированная по кодонам для экспрессии в клетках млекопитающих (СНО)
2 Аминокислотная последовательность CP77, кодируемая SEQ ID NO: 1
3 Нуклеотидная последовательность pLL07
4 Прямой праймер для гена CP77-CHO из плазмиды pPH51
5 Обратный праймер для гена CP77-CHO из плазмиды pPH51
6 Нуклеотидная последовательность гена K1L из штамма Copenhagen вируса осповакцины (получена из Genbank M35027.1)
7 Аминокислотная последовательность белка K1L из штамма Copenhagen вируса осповакцины (получена из Genbank M35027.1), кодируемая SEQ ID NO: 6

ТАБЛИЦА 1
Результаты титрования
24 ч 48 ч 72 ч
CHO 53 БОЕ/мл 0 0
Vero 8,5102 БОЕ/мл 14,25×106 БОЕ/мл 27,7×106 БОЕ/мл

Количество продуцируемого вируса (выход)

Количество вируса, используемое для инфекции (вход), составляло 4×104 БОЕ/мл. Для удобства сравнения, выход выражали в 104. Представленные значения являются средним выходом на момент времени, то есть, выходом на собранные 3 мл (6 мл, разделенные на 2 лунки).

24 ч 48 ч 72 ч
CHO 0,0159×104 БОЕ 0 0
Vero 0,255×104 БОЕ 4275×104 БОЕ 8310×104 БОЕ

Выход продукции (соотношение выходящего и входящего количества вируса)

В приведенной ниже таблице показано продуцируемое количество выходящего вируса относительно входящего уровня для каждой клеточной линии в каждый момент времени сбора вируса, то есть соотношение выходящего/входящего количества.

24 ч 48 ч 72 ч
CHO 0,004 0 0
Vero 0,06 1069 2078

ТАБЛИЦА 2
Результаты титрования в БОЕ/мл
Вирус/Клеточная линия Разведение Число Титр
VACV-COP/CHO 10-1 0 0 БОЕ/мл
0
0
0
Среднее 0
VACV-COP/Vero 10-7 2 2,8×107 БОЕ/мл ± 34%
2
4
3
Среднее 2,8
VACV-PH22/Vero 10-6 8 0,75×107 БОЕ/мл ± 43%
5
12
5
Среднее 7,5
VACV-PH22/CHO 10-7 6 7,3×107 БОЕ/мл ± 20%
9
8
6
Среднее 7,3

Средний выход вируса после инфицирования на лунку (выход)

Объем вирусного экстракта на флакон составлял 1 мл. Посевной объем для титрования составлял 1 мл. Таким образом, выход вируса равен титру в БОЕ/мл, умноженному на 1 мл (посевной объем).

Вирус Клеточная линия Выход на флакон
VACV-COP CHO 0 БОЕ
Vero 2,8×107 БОЕ
VACV-PH22 Vero 0,75×107 БОЕ
CHO 7,3×107 БОЕ

Выход на БОЕ инокулята, т.е. общее количество БОЕ, продуцируемое 1 БОЕ инокулята

Размер инокулята на флакон: 1×105 БОЕ

Вирус Клеточная линия Выход на БОЕ инокулята
VACV-COP CHO 0 БОЕ/входящую БОЕ
Vero 280 БОЕ/входящую БОЕ (280 БОЕ продуцируются на каждую БОЕ, используемую для заражения)
VACV-PH22 Vero 75 БОЕ/входящую БОЕ (75 БОЕ продуцируются на каждую БОЕ, используемую для заражения)
CHO 730 БОЕ/входящую БОЕ (730 БОЕ продуцируются на каждую БОЕ, используемую для заражения)

ТАБЛИЦА 3
Результаты титрования 1 мл каждого вирусного экстракта
Клеточный субстрат Индикаторная клеточная линия
143B Vero
Титрование БОЕ/мл SE %SE Титрование БОЕ/мл SE %SE
CHO 5,38E+03 5,74E+02 10,70% 7,25E+02 2,17E+02 30,00%
p-LL07-CHO 1,88E+08 2,45E+07 13,10% 3,95E+07 1,13E+07 28,50%
143B 2,73E+08 3,95E+07 14,50% 3,73E+07 5,45E+06 14,60%

В таблице 4 представлены общее количество вируса в каждом 1 мл вирусного экстракта.

ТАБЛИЦА 4
Клеточный субстрат Индикаторная клеточная линия
143B Vero
Выход
БОЕ
SE Выход
БОЕ
SE
CHO 5,38E+03 5,74E+02 7,25E+02 2,17E+02
p-LL07-CHO 1,88E+08 2,45E+07 3,95E+07 1,13E+07
143B 2,73E+08 3,95E+07 3,73E+07 5,45E+06

ТАБЛИЦА B
Штамм ORF Геном Белок
Copenhagen COP-D13L M35027 AAA48114
Lister clone 107 List-114 DQ121394 ABD52596
LC16mO mO-149L AY678277 AAW23819
LC16m8 M8-149L AY678275 AAW23537
WR WR-118 NC_006998 YP_233000
Dryvax-3737 VACV-114 DQ377945 ABD57648
Acambis-2000 VACAC2_129 AY313847 AAR17961
Acambis Clone 3 VACCL3-129 AY313848 AAQ93215
CVA CVA-124 AM501482 CAM58288
Tiantan Clone 10 TT10-148 JX489137 AGJ91839
Штамм GRI-90 вируса коровьей оспы CPXV-GRI-E13L X94355 CAD90667
Штамм Brighton Red вируса коровьей оспы CPXV-131 NC_003663 NP_619914

БИБЛИОГРАФИЯ

Altschul et al. (1997) Nucleic Acids Research 25:3389-3402.

Ausubel et al. (1999) Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York.

Boshart et al. (1985) Cell 41:521.

Brooks et al. (1995) J. Virol. 69(12):7688-7698.

Dijkema et al. (1985) EMBO J. 4:761.

Drillien R, et al. (1978) J Virol. 28(3):843-50.

Gorman et al., (1982) Proc. Natl. Acad. Sci. USA 79:6777.

Ham RG. (1965) Proc. Natl. Acad. Sci. USA 53: 288-293.

Hsiao JC, et al. (2006) J. Virol. 80(15):7714-28.

Kibler et al. (2011) PLOSONE 6(11).

Meisinger-Henschel et al. (2007) J. Gen. Virol. 88(12):3249-3259.

Murphy et al. (1995) Virus Taxonomy Springer Verlag: 79-87.

Puck TT, et al. (1958) J. Exp. Med. 108:945-956.

Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainsview, N.Y.

Shisler et al. (2004) J. Virol. 78(7):3553-3560.

Spehner D, et al. (1988) J Virol., 62(4):1297-1304.

Werden SJ, et al. (2008) Chapter 3: Poxvirus Host Range Genes. In: Advances in Virus Research, 71.

1. Модифицированная клетка CHO, в которой геном клетки CHO модифицирован, чтобы включать последовательность, кодирующую CP77 под контролем такого конститутивного промотора, что модифицированная клеточная линия CHO поддерживает размножение поксвируса, который способен в меньшей степени или не способен размножаться в немодифицированной клетке CHO, и причем геном клетки дополнительно включает последовательность, кодирующую D13L и/или K1L под контролем конститутивного промотора.

2. Модифицированная клетка CHO по п.1, где экспрессия гена CP77 поддерживает размножение вируса для получения выхода вируса, эквивалентного наблюдаемому в пермиссивной клеточной линии.

3. Модифицированная клетка CHO по п.1, где экспрессия гена CP77 поддерживает коэффициент амплификации репликации вируса выше 500.

4. Модифицированная клетка CHO по п.1, где CP77 кодируется непрерывной последовательностью нуклеотидов, оптимизированной по кодонам для экспрессии в клетках млекопитающих.

5. Способ размножения ортопоксвируса, который не размножается в клетках СНО, включающий размножение поксвируса in vitro в модифицированной линии клеток CHO, где модифицированная линия клеток CHO модифицирована, чтобы кодировать и экспрессировать CP77 под контролем конститутивного промотора и экспрессировать D13L и/или K1L под контролем конститутивного промотора.



 

Похожие патенты:

Предложенная группа изобретений относится к области биотехнологии. Предложены способы получения вирусоподобной частицы вируса бешенства (VLP) в растении или части растения, вирусоподобные частицы (VLP), полученные с их помощью, композиция, содержащая указанные вирусоподобные частицы (VLP), и способ индукции иммунитета к инфекции, вызванной вирусом бешенства.

Изобретение относится к биотехнологии. Предложены рекомбинантный полипептид гемагглютинин (НА) вируса гриппа для вызова иммунного ответа на вирус гриппа H3N2, молекула нуклеиновой кислоты, его кодирующая, и вектор экспрессии, слитый белок и вирусоподобная частица (VLP), содержащие указанный полипептид НА, и выделенная клетка для выработки и экспрессии указанной VLP, а также композиция, содержащая указанные полипептид, VLP и слитый белок, и способ вызова иммунного ответа в отношении вируса гриппа H3N2.

Изобретения относятся к выделению экспрессированных бакуловирусами вирусоподобных частиц (VLP)безоболочечных вирусов из клеток насекомых и касаются способа выделения экспрессированных бакуловирусом VLP цирковируса свиней 2-го типа (PCV2) в клетках насекомых и способа получения экспрессированных бакуловирусами VLP PCV2.

Группа изобретений относится к биотехнологии и медицине. Предложены химерная вирусоподобная частица (VLP) папилломавируса человека (HPV), способ ее получения и извлечения, способы профилактики или лечения инфекции HPV или рака шейки матк, и индукции иммунного ответа у пациента, включающие введение предложенной HPV VLP, а также применение предложенной HPV VLP в указанных способах и в получении лекарственных средств для осуществления указанных способов.

Группа изобретений относится к биотехнологии и медицине. Предложены химерная вирусоподобная частица (VLP) папилломавируса человека (HPV), способ ее получения и извлечения, способы профилактики или лечения инфекции HPV или рака шейки матк, и индукции иммунного ответа у пациента, включающие введение предложенной HPV VLP, а также применение предложенной HPV VLP в указанных способах и в получении лекарственных средств для осуществления указанных способов.

Группа изобретений относится к области биотехнологии. Предложены рекомбинантный полипептид гемагглютинин (НА) вируса гриппа для вызова иммунного ответа на вирус гриппа H5N1, содержащий аминокислотную последовательность из остатков 2-568 SEQ ID NO: 1, кодирующая его нуклеиновая кислота, содержащие предложенный полипептид слитый белок и вирусоподобная частица (VLP) для вызова ответа на вирус гриппа H5N1, вектор экспрессии, содержащий нуклеиновую кислоту, и выделенная клетка, его содержащая, композиция и способ вызова иммунного ответа против вируса гриппа H5N1, а также способ иммунизации субъекта.

Группа изобретений относится к медицине, в частности к иммунологии, и может быть использована для получения моновакцины против ветряной оспы. Способ получения живой культуральной аттенуированной вакцины для профилактики ветряной оспы включает заражение вирусом ветряной оспы штаммом «ОКА» диплоидных клеток ЛЭЧ-3 с последующей репродукцией и выходом вирусов в культуральную среду.

Изобретения относятся к вирусной частице, высвобождающейся после инфицирования клеток цитомегаловирусом человека (HCMV), ее применения для профилактики или лечения заболевания путем образования нейтрализующих антител к по меньшей мере одному антигенному гетерологичному пептиду или путем индукции CD8+ Т-лимфоцитарного ответа против такого гетерологичного пептида и вакцины, содержащей такую вирусную частицу.

Изобретения касаются живого аттенуированного рекомбинантного полиовируса, его применения для получения вакцины, в качестве посевного материала или для получения лекарственного средства, способа получения такой вакцины и способа вакцинации пациента.

Представленная группа изобретений касается вирусоподобной частицы и способов ее использования и получения. Предложенная вирусоподобная частица, по существу, не содержащая нуклеиновую кислоту вируса, сформирована из слитого белка, включающего белок оболочки растительного вируса и белок-мишень.

Предложенная группа изобретений относится к области биотехнологии. Предложены рекомбинантный вирус птичьего герпеса индейки (rHVT), мультивалентная вакцина его содержащая, набор, содержащий вакцину, предназначенные для вакцинации птиц, а также применение рекомбинантного вируса птичьего герпеса индейки для изготовления вакцинной композиции для иммунизации птиц.

Настоящее изобретение относится к вирусологии и ветеринарии. Предложен штамм вируса инфекционного бронхита кур «ГС-11», семейства Coronaviridae, рода Coronavirus, серотипа 793/В, выделенный из почек клинически больных цыплят-бройлеров из ОАО «Тольяттинская птицефабрика» на развивающихся СПФ эмбрионах кур 9-суточного срока инкубации, и депонированный в Государственной коллекции вирусов в НИИ вирусологии им.

Представлены вакцина для защиты млекопитающих от заражения вирусом свиного гриппа С, вирус свиного гриппа С и способ определения наличия вируса свиного гриппа С. Охарактеризованная вакцина включает иммунологически эффективное количество инактивированного вируса свиного гриппа С.

Предложенная группа изобретений относится к области биотехнологии. Предложены способы получения вирусоподобной частицы вируса бешенства (VLP) в растении или части растения, вирусоподобные частицы (VLP), полученные с их помощью, композиция, содержащая указанные вирусоподобные частицы (VLP), и способ индукции иммунитета к инфекции, вызванной вирусом бешенства.

Изобретение относится к биотехнологии. Предложен способ получения вирусоподобных частиц (VLP) в растении, который включает введение нуклеиновой кислоты, содержащей регуляторную область, активную в растении, и функционально связанную с химерной нуклеотидной последовательностью, в растение или часть растения, последующую инкубацию растения или его части в условиях, обеспечивающих экспрессию нуклеиновой кислоты с получением VLP.

Изобретение относится к области ветеринарной вирусологии и генной инженерии и касается рекомбинантного штамма вируса африканской чумы свиней. Предложен штамм ΔCongoCD2v вируса африканской чумы свиней с делецией гена EP402R (CD2v), содержащий репортерный ген EGFP под контролем р72 промотора.

Изобретение относится к биотехнологии. Предложены рекомбинантный полипептид гемагглютинин (НА) вируса гриппа для вызова иммунного ответа на вирус гриппа H3N2, молекула нуклеиновой кислоты, его кодирующая, и вектор экспрессии, слитый белок и вирусоподобная частица (VLP), содержащие указанный полипептид НА, и выделенная клетка для выработки и экспрессии указанной VLP, а также композиция, содержащая указанные полипептид, VLP и слитый белок, и способ вызова иммунного ответа в отношении вируса гриппа H3N2.

Изобретение относится к области медицинской вирусологии и касается штамма вируса гриппа. Вакцинный штамм A/17/Нью Йорк/15/5364 (H1N1) pdm09 - реассортант, полученный путем скрещивания «дикого» вируса А/Нью Йорк/61/2015 (H1N1) pdm09 с холодоадаптированным температурочувствительным вирусом А/Ленинград/134/17/57 (H2N2) - донором аттенуации, безвредным для людей.

Изобретения относятся к области ветеринарной вирусологии и биотехнологии и касаются вакцины и способа ее получения. Способ изготовления вакцины включает в себя культивирование вирусного антигена в суспензионной культуре клеток ВНК-21, инактивацию, очистку вирусной суспензии от балластных примесей, концентрирование полученного антигена вируса ящура и соединение с адъювантом.

Изобретение относится к области биотехнологии, микробиологии и сельского хозяйства и касается штамма вируса ядерного полиэдроза. Штамм ХСМ 22-А вируса ядерного полиэдроза хлопковой совки Helicoverpa armigera Hbn.

Группа изобретений относится к области биотехнологии. Предложены рекомбинантная плазмидная ДНК pBiPr-ABIgA1FI6-ht, кодирующая человеческое антитело к гемагглютинину вируса гриппа А человека изотипа IgA1, и способ получения указанного человеческого антитела, а также линия эукариотических клеток, содержащая указанную рекомбинантную плазмидную ДНК, и способ получения указанной линии клеток.

Изобретения касаются модифицированной клетки СНО и способа размножения ортопоксвируса при ее использовании. Представленная клетка модифицирована таким образом, чтобы включать последовательность, кодирующую CP77 под контролем конститутивного промотора, и последовательность, кодирующую D13L иили K1L также под контролем конститутивного промотора. Клетка поддерживает размножение поксвируса, который способен в меньшей степени или не способен размножаться в немодифицированной клетке CHO. Изобретения могут быть использованы для получения лекарственных средств на основе поксвирусов. 2 н. и 3 з.п. ф-лы, 11 табл., 14 пр.

Наверх