Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf



Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
Лечение заболеваний, связанных с нейтрофическим фактором головного мозга (bdnf), путем ингибирования природного антисмыслового транскрипта bdnf
C12N2310/11 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2661104:

ДЗЕ СКРИППС РИСЁЧ ИНСТИТЬЮТ (US)
КЁРНА, Инк. (US)

Настоящее изобретение относится к биохимии. Описан способ повышающей регуляции экспрессии полинуклеотида нейротрофического фактора головного мозга (BDNF) в биологической системе. Осуществляют контакт указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, длиной от 10 до 30 нуклеотидов, где указанный по меньшей мере один антисмысловой олигонуклеотид имеет по меньшей мере 90% комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов природного антисмыслового полинуклеотида для полинуклеотида BDNF. Причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, что приводит к повышающей регуляции экспрессии полинуклеотида нейротрофического фактора головного мозга (BDNF), при условии, что по меньшей мере один антисмысловой олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55. Также описан аналогичный способ повышающей регуляции функции полинуклеотида BDNF в биологической системе. Также описаны соответствующие способ повышающей регуляции функции полинуклеотида BDNF в биологической системе и способ повышающей регуляции экспрессии полинуклеотида BDNF в клетках или тканях пациента in vivo или in vitro, в том числе млекопитающего. Представлен олигонуклеотид длиной от 10 до 30 нуклеотидов, имеющий по меньшей мере одну модификацию и/или замещение, причем указанный олигонуклеотид имеет по меньшей мере 90% комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов природного антисмыслового полинуклеотида для полинуклеотида BDNF. Причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, при условии, что олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55, где по меньшей мере одну модификацию, выбранную из: по меньшей мере одного модифицированного остатка сахара, по меньшей мере одного модифицированного межнуклеозидного мостика, по меньшей мере одного модифицированного нуклеотида и любой их комбинации. Кроме того, указанный олигонуклеотид представляет собой антисмысловое соединение, которое гибридизуется с и повышает регуляцию экспрессии гена BDNF in vivo или in vitro по сравнению с стандартным контролем. Описана фармацевтическая композиция для лечения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом BDNF, содержащая по меньшей мере один представленный олигонуклеотид, специфичный к одному или более полинуклеотидам BDNF, и фармацевтически приемлемый эксципиент. Также описан способ профилактики или лечения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом BDNF и/или по меньшей мере одним продуктом, который он кодирует, включающий введение пациенту терапевтически эффективной дозы по меньшей мере одного представленного олигонуклеотида. 9 н. и 18 з.п. ф-лы, 9 ил., 1 табл., 2 пр.

 

Данная заявка претендует на приоритет предварительной заявки США на патент №61/611225, поданной 15 марта 2012 г, и предварительной заявки США на патент №61/614664, поданной 23 марта 2012 г, которые включены полностью в данную заявку посредством отсылки.

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Варианты данного изобретения относятся к олигонуклеотидам, модулирующим экспрессию и/или функцию BDNF и связанных с ним молекул.

УРОВЕНЬ ТЕХНИКИ

Гибридизация ДНК-РНК и РНК-РНК имеет значение во многих аспектах функции, включающих репликацию, транскрипцию и трансляцию ДНК. Гибридизация также является центральным событием в ряде технологий, которые или позволяют обнаружить конкретную нуклеиновую кислоту, или изменить ее экспрессию. Например, антисмысловые олигонуклеотиды подавляют экспрессию генов за счет гибридизации РНК-мишени, участвуя при этом в сплайсинге, транскрипции, трансляции и репликации РНК. Антисмысловая ДНК характеризуется дополнительным признаком, состоящим в том, что гибриды ДНК-РНК служат в качестве субстрата для расщепления рибонуклеазой Н, эта активность имеется в большинстве типов клеток. Антисмысловые молекулы могут быть доставлены в клетки, как это имеет место в случае олигодезоксинуклеотидов (ODNs) или они могут быть экспрессированы из эндогенных генов как молекулы РНК. Недавно FDA одобрила антисмысловое лекарство, VITRAVENE™ (для лечения цитомегаловирусного ретинита), что свидетельствует о том, что антисмысловая терапия имеет смысл.

В заявке WO 2010/093904 и в заявке США 2011/ 0319475 описан белок BDNF в качестве мишени для модуляции с использованием олигонуклеотидов. Необходимо постоянно развивать создание антисмысловых мишеней и новых олигонуклеотидов, которые дополняют такие мишени и модулируют экспрессию белка BDNF для возможного лечения или применения в исследованиях, связанных с лечением заболеваний и состояний, ассоциируемых с BDNF.

РАСКРЫТИЕ ИЗОБРЕТЕНИЯ

В этом разделе изложена сущность изобретения, то есть кратко описаны природа и содержание изобретения. Предполагается, что это описание не будет трактоваться как ограничивающее объем или значение формулы изобретения.

Согласно одному из вариантов данное изобретение предусматривает способы ингибирования действия природного антисмыслового транскрипта путем использования антисмыслового(ых) олигонуклеотида(ов), нацеленного(ых) на любую область природного антисмыслового транскрипта, приводящего к усилению экспрессии соответствующего смыслового гена BDNF в организме млекопитающего. Данное изобретение предусматривает также, что ингибирование природных антисмысловых транскриптов, указанных в данной заявке, может быть достигнуто при помощи короткой интерферирующей РНК, киРНК (siRNA), рибозимов и малых молекул, которые входят в объем данного изобретения.

Один из вариантов данного изобретения предусматривает способ модуляции функции и/или экспрессии полинуклеотида BDNF в биологических системах, включая, но без ограничения, клетки или ткани пациентов in vivo и in vitro, предусматривающий осуществление контакта указанной биологической системы или указанных клеток или тканей с антисмысловым олигонуклеотидом, содержащим от примерно 5 до примерно 30 звеньев нуклеотидов, при этом указанный олигонуклеотид имеет по меньшей мере 50%-ную идентичность последовательности, которая представляет собой обратный комплемент природной антисмысловой последовательности для полинуклеотида, содержащего 5-30 последовательных нуклеотидов в пределах нуклеотидов 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, при этом происходит модуляция функции и/или экспрессии полинуклеотида BDNF в указанной биологической системе, включая указанные клетки и ткани пациентов in vivo или in vitro, при условии, что олигонуклеотиды, содержащие SEQ ID NO: 50-55, исключены.

Согласно одному из вариантов олигонуклеотид, описанный в данной заявке, нацелен на природную антисмысловую последовательность полинуклеотидов в BDNF, имеющихся в биологической системе, например, нуклеотидов в SEQ ID NO: 3-11, и любых вариантов, аллелей, гомологов, мутантов, производных, фрагментов и их комплементарных последовательностей. Примеры таких антисмысловых олигонуклеотидов представлены в SEQ ID NO: 12-49.

Согласно другому варианту настоящее изобретение предусматривает способ модуляции функции или экспрессии полинуклеотида BDNF в биологической системе, предусматривающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на природный антисмысловой транскрипт для полинуклеотида BDNF, содержащий 5-30 последовательных нуклеотидов в пределах нуклеотидов 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 of SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, при этом происходит модуляция функции и/или экспрессии полинуклеотида BDNF в указанной биологической системе.

Согласно еще одному варианту настоящее изобретение предусматривает способ модуляции функции или экспрессии полинуклеотида BDNF в биологической системе, предусматривающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на область природного антисмыслового транскрипта для полинуклеотида BDNF, содержащего 5-30 последовательных нуклеотидов в пределах нуклеотидов 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 of SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, при этом происходит модуляция функции и/или экспрессии полинуклеотида BDNF в указанной биологической системе.

Согласно одному из вариантов данное изобретение предусматривает способ возрастания функции и/или экспрессии полинуклеотида BDNF, содержащего SEQ ID NO: 1 и 2, в биологической системе, предусматривающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на природный антисмысловой транскрипт для полинуклеотида BDNF, содержащий 5-30 последовательных нуклеотидов в пределах нуклеотидов 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 of SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, при этом происходит усиление функции и/или увеличение экспрессии полинуклеотида BDNF в указанной биологической системе.

Согласно одному из вариантов данное изобретение предусматривает способ усиления функции и/или увеличения экспрессии полинуклеотида BDNF, содержащего SEQ ID NO: 1 и 2, в биологической системе, предусматривающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на природный антисмысловой транскрипт для полинуклеотида BDNF, при этом происходит усиление функции и/или увеличение экспрессии полинуклеотида BDNF или его продукта экспрессии, и природные антисмысловые транскрипты выбраны из SEQ ID NO: 3-11.

Согласно одному из вариантов данное изобретение предусматривает способ усиления функции и/или увеличения экспрессии полинуклеотида BDNF, содержащего SEQ ID NO: 1 и 2, в биологической системе, предусматривающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, который нацелен на природный антисмысловой транскрипт полинуклеотида BDNF, при этом происходит усиление функции и/или увеличение экспрессии полинуклеотида BDNF или его продукта экспрессии, и природные антисмысловые транскрипты выбраны из SEQ ID NO: 3-11, и антисмысловые олигонуклеотиды выбраны из по меньшей мере одной из последовательностей соответствующих SEQ ID NO: 12-49.

Согласно одному из вариантов предусмотрена композиция, которая содержит один или более антисмысловых олигонуклеотидов, которые связываются со смысловыми и/или антисмысловыми полинуклеотидами BDNF.

Согласно одному из вариантов олигонуклеотиды содержат один или более модифицированных или замещенных нуклеотидов.

Согласно еще одному варианту олигонуклеотиды содержат одну или более модифицированных связей.

Согласно еще одному варианту олигонуклеотиды содержат модифицированные основания, содержащие фосфоротиоатные, метилфосфонатные мостики, пептидные нуклеиновые кислоты (пептидо-нуклеиновые кислоты), 2'-O-метил-, фтор- или углерод-, метилен- или иначе закрытые ("запертые") молекулы (LNA) нуклеиновой кислоты. Предпочтительно, модифицированные нуклеотиды представляют собой закрытые молекулы нуклеиновых кислот, включая α-L-LNA.

Согласно одному из вариантов олигонуклеотиды вводят пациенту подкожно, внутримышечно, внутривенно или внутрибрюшинно (интраперитонеально).

Согласно одному из вариантов олигонуклеотиды вводят в виде фармацевтической композиции. Схема лечения включает введение пациенту антисмысловых соединений по меньшей мере один раз, однако, это способ лечения может быть модифицирован и может включать введение многократных доз в течение определенного периода времени.

Согласно одному из вариантов применяют олигонуклеотиды, инкапсулированные в липосому или присоединенные к молекуле носителя (например, молекуле холестерина, пептида ТАТ).

Согласно одному из вариантов данное изобретение предусматривает применение SEQ ID NO: 50-55 в качестве олигонуклеотидов, нацеленных на природные антисмысловые транскрипты (NATs) с целью модуляции экспрессии полинуклеотида BDNF, при этом указанные NATs выбраны из группы последовательностей, состоящей из SEQ ID NO. 3-11. Согласно другому варианту данное изобретение предусматривает применение SEQ ID NO 50-55 в качестве олигонуклеотидов, нацеленных на природные антисмысловые транскрипты (NATs) с целью модуляции экспрессии полинуклеотида BDNF, при этом указанные NATs выбраны из группы, состоящей из SEQ ID NO. 3, 4, 5, 7, 8, 9, 10 и 11.

Другие аспекты изобретения описаны ниже.

КРАТКОЕ ОПИСАНИЕ РИСУНКОВ

[0001] На Фигурах 1а-е показана антисенс-опосредованная регуляция смысловой siPHK и белка. Фигура 1а показывает, что после трансфекции нескольких человеческих и мышиных клеточных линий с тремя олигонуклеотидами киРНК, нацеленными на неперекрывающиеся области транскрипта BDNF-AS, происходили нокдаун и стимулирующая регуляция транскрипта BDNF. На Фигуре 1b показаны результаты с течением времени после введения BDNF-AS-нацеленной киРНК при эндогенной экспрессии и транскриптов BDNF, и транскриптов BDNF-AS. Данные показывают, что с течением времени экспрессия BDNF-AS снижается и затем экспрессия BDNF усиливается, и этот процесс обратим. На Фигуре 1с показано, что содержание белка BDNF, анализируемое методом ELISA, значительно увеличивалось с двумя транскриптами BDNF-AS, на которые нацелена киРНК, но не в случае рандомизированных киРНК или контрольной ненацеленной киРНК. Фигура 1d показывает уровень белка BDNF после введения различных киРНК, определенный методом ELISA или вестерн-блоттинга. На Фигуре 1е показано кратное изменение количества BDNF по сравнению с имитирующим контролем в зависимости от увеличивающихся концентраций олигонуклеотида (10-12-10-6 М).

Фигура 2 показывает, что увеличенная экспрессия BDNF приводит к увеличению разрастания нейронов.

Фигура 3 показывает, что BDNF-AS регулирует мРНК (матричную, синоним - информационную) и белка BDNF in vivo.

Фигура 4 показывает, что блокирование BDNF-AS in vivo вызывает увеличение выживаемости и пролиферации нейронов.

Фигура 5 показывает, что нокдаун BDNF-AS приводит к увеличению экспрессии мРНК.

Фигура 6 иллюстрирует пост-трансляционную регуляцию экспрессии BDNF.

Фигура 7 иллюстрирует ингибирование человеческого транскрипта BDNF-AS с помощью антагоNATs hBDNF.

Фигура 8 показывает ингибирование мышиного транскрипта BDNF-AS в клетках N2a с помощью AntagoNATs (aнтагоNATs).

На Фигуре 9 показано, что нокдаун BDNF-AS не меняет ни уровень TrkB, ни уровень соседних генов (Let7C и KIF18A) в обоих направлениях: Let7C и KIF18A представляют собой гены, расположенные в положении 3' в 5'-3' направлении и в положении 5' в 3'-5' направлении, соответственно.

Описание перечня последовательностей: нейротрофический фактор головного мозга Homo sapiens (BDNF), транскрипт, вариант 3, мРНК. (NCBI, номер доступа: NM_170735); SEQ ID NO: 2: нейротрофический фактор головного мозга мыши Mus museums (BDNF), транскрипт, вариант 1, мРНК (NCBI, номер доступа: NM_007540); SEQ ID NO: 3: антисмысловая последовательность природного BDNF (транскрипт, вариант BT1A; NR_033313.1); SEQ ID NO: 4: антисмысловая последовательность природного BDNF (транскрипт, вариант ВТ2А; NR_033314.1); SEQ ID NO: 5: антисмысловая последовательность природного BDNF (транскрипт, вариант ВТ1В; NR_033315.1); SEQ ID NO: 6: антисмысловая последовательность природного BDNF (транскрипт, вариант ВТ2В; NR_002832.2); SEQ ID NO: 7: антисмысловая последовательность природного BDNF (транскрипт, вариант ВТ1С; NR_033312.1); SEQ ID NO: 8: антисмысловая последовательность природного BDNF (BDNF-AS вариант); SEQ ID NO: 9: антисмысловая последовательность природного BDNF; SEQ ID NO: 10:: антисмысловая последовательность мышиного природного BDNF (мышиный BDNF-AS вариант 1); SEQ ID NO: 11: антисмысловая последовательность мышиного природного BDNF (мышиный BDNF-AS variant 2); SEQ ID NO: 12 to 55: антисмысловые олигонуклеотиды; SEQ ID NO: 56 to 59: обратный комплемент антисмысловых олигонуклеотидов 12-15, соответственно; SEQ ID NO: 60-64: обратный комплемент антисмысловых олигонуклеотидов 42-46, соответственно; SEQ ID NO: 65 и 66: последовательности для анализа. LNA (нуклеиновая кислота, закрытая через 2'-O, 4'-С метиленовый мостик): +А* или +Т* или +С* или +G*; 2'OM (2'-O-метил): mU* или mA* или mC* или mG*; PS (фосфоротиоатный мостик): Т* или А* или G* или с*; РНК: rU или rA или rG или rC.

ОСУЩЕСТВЛЕНИЕ ИЗОБРЕТЕНИЯ

Ниже описаны несколько аспектов данного изобретения со ссылкой на примеры осуществления изобретения для его иллюстрации. Следует отметить, что многочисленные конкретные детали, взаимосвязи и методы описаны для полного понимания изобретения. Однако для специалиста в данной области очевидно, что изобретение может быть осуществлено и без использования одной или более конкретных деталей или с помощью других методов. Данное изобретение не ограничено порядком действий или событий, так как некоторые действия могут происходить в другом порядке и/или совместно с другими действиями или событиями. Кроме того, не все описанные действия или события требуются для осуществления настоящего изобретения.

Все гены, названия генов и генные продукты, описанные в данной заявке, соответствуют гомологам любого вида, для которых применимы композиции и способы, описанные в данной заявке. Таким образом, эти термины включают, но без ограничения, гены и генные продукты из организмов людей и мышей. Следует иметь в виду, что когда описан ген или генный продукт из конкретных видов, это описание является только примером, и эти термины не следует интерпретировать как ограничение изобретения, если это явно не следует из контекста описания. Так, например, гены, описанные в данной заявке, которые согласно некоторым вариантам относятся к последовательностям нуклеиновой кислоты или аминокислоты человека, охватывают гомологичные и/или ортологичные гены и генные продукты из организмов других животных, включая, но без ограничения, других млекопитающих, рыб, амфибий, рептилий и птиц. Согласно одному из вариантов гены или последовательности нуклеиновых кислот являются человеческими.

Определения

Термины, используемые в данной заявке, используются с целью описания только конкретных вариантов изобретения и не ограничивают его. Термины, используемые здесь в единственном числе, включают и множественное число, если из контекста не следует иное. Далее, термины "включающий", "включает", "имеющий", "имеет", "с" и их варианты, которые используются или в подробном описании, или в формуле изобретения должны рассматриваться как включающие, в смысле, похожем на термин "содержащий". Термин "около" или "примерно" означает приемлемую ошибку для конкретной величины, определенной специалистом, которая частично зависит от того, каким образом измерена или определена эта величина, то есть ограничения измерительной системы. Например, термин "около" в уровне техники может означать одну или более чем одну единицу стандартного отклонения Альтернативно, термин "около" может означать интервал отклонения до 20%, предпочтительно, до 10%, более предпочтительно, до 5% и, наиболее предпочтительно, до 1% от данной величины. Или же, особенно по отношению к биологическим системам или процессам, этот термин может означать порядок величины, предпочтительно, 5-кратную и, более предпочтительно, 2-кратную величину. Когда в описании или в формуле изобретения данной заявки указаны конкретные величины, термин "около" означает, что нужно предполагать приемлемую ошибку в интервале этой конкретной величины.

Используемый в данной заявке термин "мРНК" означает известный(ые) в настоящее время транскрипт(ы) мРНК гена-мишени и любой другой транскрипт, который может быть выявлен.

Под "антисмысловым олигонуклеотидом" или "антисмысловым соединением" подразумевается молекула РНК или ДНК, которая связывается с другой РНК или ДНК (РНК, ДНК-мишени). Например, если это олигонуклеотид РНК, он связывается с другой РНК или ДНК путем взаимодействий РНК-РНК и изменяет активность РНК-мишени. Антисмысловой олигонуклеотид может приводить к повышающей или понижающей регуляции экспрессии и/или функции конкретного полинуклеотида. Это определение включает любую чужеродную молекулу РНК или ДНК, которая полезна с терапевтической, диагностической или другой точки зрения. Такие молекулы включают, например, молекулы антисмысловых РНК или ДНК, РНК-интерференцию (RNAi), микроРНК, РНК-приманку, киРНК, ферментативную РНК, терапевтически редактированную РНК и РНК - агонисты и антагонисты, антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, внешние вспомогательные последовательности, альтернативные сплайсеры, праймеры, зонды и другие олигомерные соединения, которые гибридизуются с по меньшей мере частью нуклеиновой кислоты-мишени. Как таковые, эти соединения могут вводиться в виде однонитевых, двунитевых, частично однонитевых или кольцевых олигомерных соединений.

В контексте данного изобретения термин "олигонуклеотид" относится к олигомеру или полимеру рибонуклеиновой кислоты (РНК) или дезоксирибонуклеиновой кислоты (ДНК) или к их миметикам. Термин "олигонуклеотид" включает также линейные или кольцевые олигомеры природных и/или модифицированных мономеров или соединений, включая дезоксирибонуклеозиды, рибонуклеозиды, замещенные или альфа-аномерные их формы, пептидо-нуклеиновые кислоты (ПНК), закрытые нуклеиновые кислоты (LNA), фосфоротиоаты, метилфосфонаты и т.п. Олигонуклеотиды способны специфически связываться с полинуклеотидом-мишенью при помощи мономер-мономерных взаимодействий на регулярной основе, таких как спаривание оснований по Уотсону-Крику, хугстиновское спаривание оснований или обратимое хугстиновское спаривание оснований или т.п.

Олигонуклеотид может быть "химерным", то есть состоящим из различных областей. В контексте данного изобретения "химерные" соединения представляют собой олигонуклеотиды, которые содержат две или более химических областей, например, области(ей) ДНК, области(ей) РНК, области(ей) ПНК и т.д. Каждая химическая область состоит из по меньшей мере одного мономерного звена, то есть нуклеотида в случае олигонуклеотидного соединения. Эти олигонуклеотиды обычно содержат по меньшей мере одну область, в которой олигонуклеотид модифицирован с целью придания одного или более желаемых свойств. Желаемые свойства олигонуклеотида включают, но без ограничения, например, повышенную стойкость к расщеплению нуклеазами, повышенное клеточное поглощение и/или повышенное сродство к связыванию для нуклеиновой кислоты-мишени. Поэтому различные области олигонуклеотида могут иметь разные свойства. Химерные олигонуклеотиды согласно данному изобретению могут быть образованы как смешанные структуры двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеозидов и/или аналогов олигонуклеотидов, описанных выше.

Олигонуклеотид может состоять из областей, которые могут быть связаны в "список", то есть мономеры связаны последовательно, как в природной ДНК, или связаны посредством спейсеров. Спейсеры образуют ковалентный "мостик" между областями и в предпочтительных случаях имеют длину, не превышающую 100 атомов углерода. Спейсеры могут содержать различные функциональности, например, иметь положительный или отрицательный заряды, обладать специфическими свойствами к связыванию нуклеиновой кислоты (интеркаляторы, связыватели бороздок, токсины, флуорофоры и т.д.), будучи липофильными, включая особые вторичные структуры, подобно, например, пептидам, содержащим аланин, которые индуцируют альфа-спирали.

Применяемый в данной заявке термин "BDNF" и "нейтрофический фактор головного мозга" включает все члены этого семейства, мутанты, аллели, фрагменты, молекулы, кодирующие и некодирующие последовательности, смысловые и антисмысловые нити полинуклеотидов и т.д.

Используемые в данной заявке термины "нейтрофический фактор головного мозга" и "BDNF" имеют то же значение, что и в литературе, и используются как взаимозаменяемые.

Применяемый в данной заявке термин "олигонуклеотид, специфический по отношению к" или "олигонуклеотид, который направлен (нацелен) на" относится к олигонуклеотиду, содержащему последовательность (i) способную к образованию стабильного комплекса с частью гена-мишени, или (ii) способную к образованию стабильного дуплекса с частью транскрипта мРНК гена-мишени. Стабильность комплексов и дуплексов может быть определена путем теоретических расчетов и/или анализов in vitro. Примеры методов анализа, пригодных для определения стабильности комплексов и дуплексов гибридизации описаны ниже в Примерах.

Применяемый в данной заявке термин "целевая нуклеиновая кислота (мишень)" охватывает ДНК, РНК (содержащие пре-мРНК и мРНК), транскрибированные из таких ДНК, и также кДНК, синтезированную из таких РНК, кодирующие, некодирующие последовательности, смысловые и антисмысловые полинуклеотиды. Специфичная гибридизация олигомерного соединения с его нуклеиновой кислотой-мишенью влияет на нормальную функцию нуклеиновой кислоты. Эту модуляцию функции целевой нуклеиновой кислоты соединениями, которые специфически гибридизуются с ней, обычно называют "антисенс-модуляцией". Функции РНК, которые модулируются, включают, но без ограничения, все жизненно важные функции, такие как, например, транслокацию РНК в место трансляции белка, трансляцию белка из РНК, сплайсинг РНК с получением одного или более видов мРНК и каталитическую активность, которая может быть повышена с помощью РНК. Общий эффект такого действия на функцию целевой нуклеиновой кислоты (мишени) состоит в модулировании экспрессии кодированного продукта или олигонуклеотидов.

РНК-интерференция "RNAi" опосредована молекулами двунитевой РНК (днРНК), которые имеют гомологию, специфичную по последовательности к последовательностям целевой нуклеиновой кислоты. Согласно некоторым вариантам данного изобретения медиаторы представляют собой дуплексы "короткой интерферирующей" РНК (киРНК) длиной 5-25 нуклеотидов. KhRNAs синтезируются путем процессинга днРНК в результате активности фермента РНазы (рибонуклеазы), известного как Dicer. Дуплексные продукты киРНК рекрутируются в мультибелок комплекса киРНК, называемый RISC (комплекс сайленсинга, индуцированный РНК). Не основываясь на какой-либо теории, полагают, что RISC затем направляется в целевую нуклеиновую кислоту (обычно мРНК), где дуплекс киРНК взаимодействует специфически по последовательности, опосредуя расщепление каталитическим образом. Затем короткие интерферирующие РНК, которые могут быть использованы в соответствии с данным изобретением, могут быть синтезированы и применены согласно методикам, хорошо известным из уровня техники и знакомым специалистам в данной области. Короткие интерферирующие РНК, которые могут быть использованы в соответствии с данным изобретением, обычно содержат от примерно 1 до примерно 50 нуклеотидных звеньев (nt). В Примерах согласно неограничивающим вариантам киРНК могут содержать от примерно 5 до примерно 40 nt, от примерно 5 до примерно 30 nt, от примерно 10 до примерно 30 nt, от примерно 15 до примерно 25 nt или примерно 20-25 нуклеотидов.

Выбор подходящих олигонуклеотидов облегчается с помощью компьютерных программ, которые автоматически выравнивают последовательности нуклеиновых кислот и выявляют области идентичности или гомологии. Такие программы применяются для сравнения полученных последовательностей нуклеиновых кислот, например, путем поиска в базах данных, таких как GenBank, или путем секвенирования продуктов ПЦР. Сравнение последовательностей нуклеиновых кислот различных видов позволяет выбрать последовательности, которые проявляют соответствующую степень идентичности между видами. В случае генов, которые не были секвенированы, осуществляли саузерн-блоттинг для определения степени идентичности между генами в целевых видах и других видах. Проводя саузерн-блоттинг в строгих условиях, как хорошо известно из уровня техники, можно получать приблизительную меру идентичности. Эти методы позволяют осуществить выбор олигонуклеотидов, которые обладают высокой степенью комплементарности к последовательностям целевых нуклеиновых кислот у субъекта, которого нужно контролировать, и низкой степенью комплементарности к последовательностям других нуклеиновых кислот. Специалисту в данной области очевидно, что имеется значительный выбор при отборе соответствующих областей генов, которые применяются в данном изобретении.

Под "ферментативной РНК" понимают молекулу РНК с ферментативной активностью (Cech, (1988) J. American. Med. Assoc. 260, 3030-3035). Ферментативные нуклеиновые кислоты (рибозимы) действуют путем первоначального связывания с целевой РНК. Такое связывание происходит через направленную связывающую часть ферментативной нуклеиновой кислоты, которая находится вблизи ферментативной части молекулы, которая расщепляет целевую РНК. Таким образом, ферментативная нуклеиновая кислота первая распознает и затем связывает целевую РНК через спаривание оснований и, будучи связанной с нужным сайтом, действует как фермент, расщепляя целевую РНК.

Под "РНК-приманкой" понимают молекулу РНК, которая имитирует природный связывающий домен для лиганда. Следовательно, РНК-приманка конкурирует с природной мишенью при связывании специфического лиганда. Например, было показано, что при чрезмерной экспрессии транс-активирующего ответа (TAR) ВИЧ РНк может действовать как "приманка" и эффективно связывать белок вируса Тат ВИЧ, тем самым предотвращая его связывание с последовательностями TAR, кодированными в РНК ВИЧ. Это является конкретным примером. Специалистам в данной области является очевидным, что это пример не единственный и могут быть реализованы другие варианты при помощи известных из уровня техники методов.

Применяемый в данной заявке термин "мономер" обычно обозначает мономеры, связанные фосфодиэфирными мостиками или их аналогами с образованием олигонуклеотидов, размер которых может быть в пределах от нескольких мономерных единиц, например, от примерно 3-4 до примерно нескольких сотен мономерных единиц. Аналоги фосфодиэфирных мостиков включают фосфоротиоатные, фосфородитиоатные, метилфосфонатные, фосфороселеноатные, фосфоамидатные мостики и т.п., что более подробно будет описано ниже.

Термин "нуклеотид" охватывает нуклеотиды природного происхождения, а также неприродные нуклеотиды. Специалистам в данной области очевидно, что различные нуклеотиды, которые ранее рассматривались как неприродные, затем были обнаружены в природе. Так, термин "нуклеотиды" включает не только известные молекулы, содержащие пуриновые и пиримидиновые гетероциклы, но также их гетероциклические аналоги и таутомеры. Примерами других типов нуклеотидов являются молекулы, содержащие аденин, гуанин, тимин, цитозин, урацил, пурин, ксантин, диаминопурин, 8-оксо-N6-метиладенин, 7-деазаксантин, 7-деазагуанин, N4-этанцитозин, N6,N6-этан-2,6-диаминопурин, 5-метилцитозин, 5-(С36)-алкинилцитозин, 5-фторурацил, 5-бромурацил, псевдоизоцитозин, 2-гидрокси-5-метил-4-триазолпиридин, изоцитозин, изогуанин, инозин и "неприродные" нуклеотиды, которые описаны в патенте США на имя Benner et al. №5,432,272. Термин "нуклеотид" охватывает каждый и все из этих примеров, а также их аналоги и таутомеры. Особенно интересными являются те нуклеотиды, которые содержат адениновые, гуаниновые, тиминовые, цитозиновые и урациловые звенья, которые считаются нуклеотидами природного происхождения при их применении для лечения и профилактики заболеваний у людей. Нуклеотиды включают природные 2'-дезокси- и 2'-гидрокси-сахара, например, описанные в публикации Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992), а также их аналоги.

Термин "аналоги" по отношению к нуклеотидам включает синтетические нуклеотиды, содержащие модифицированные фрагменты оснований и/или модифицированные фрагменты сахаров (см. например, нуклеотиды, описанные Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier & Altmann, (1997) Nucl. Acid. Res., 25(22), 4429-4443, Toulmé, J.J., (2001) Nature Biotechnology 19: 17-18; Manoharan M., (1999) Biochemica et Biophysica Acta 1489: 117-139; Freier S. M., (1997) Nucleic Acid Research, 25: 4429-4443, Uhlman, E., (2000) Drug Discovery & Development, 3: 203-213, Herdewin P., (2000) Antisense & Nucleic Acid Drug Dev., 10: 297-310); 2'-O, 3`-C-linked [3.2.0] bicycloarabinonucleosides. Такие аналоги включают синтетические нуклеотиды, сконструированные для улучшения способности нуклеотида к связыванию, например, стабильности дуплекса или триплекса, специфичности и т.п.

Применяемый в данной заявке термин "гибридизация" означает соединение комплементарных цепочек олигомерных соединений. Один механизм соединения включает образование водородных связей, которыми могут быть водородные связи Уотсона-Крика, связи Хугстена и обратные водородные связи Хугстена, между комплементарным нуклеозидом или нуклеозидными основаниями (нуклеотидами) цепочек олигомерных соединений. Например, аденин и тимин представляют собой комплементарные нуклеотиды, которые соединяются (спариваются) путем образования водородных связей. Гибридизация может происходить в различных условиях.

Антисмысловое соединение является "специфически гибридизуемым", когда связывание соединения с целевой нуклеиновой кислотой вмешивается в нормальное функционирование целевой нуклеиновой кислоты, вызывая модуляцию этой функции и/или активности и имеется значительная степень комплементарности, чтобы избежать неспецифического связывания антисмыслового соединения с последовательностями нецелевой нуклеиновой кислоты в условиях, когда желательно специфическое связывание, например, в физиологических условиях в случае анализа in vivo или при терапевтическом лечении и в условиях, в которых проводят in vitro анализы.

Применяемое в данной заявке выражение "строгие условия гидридизации" или "строгие условия" относится к условиям, при которых соединение по изобретению будет гибридизоваться с целевой последовательностью, но с минимальным количеством других последовательностей. Строгие условия зависят от вида последовательности и будут разными в различных обстоятельствах, и в контексте данного изобретения "строгие условия", при которых олигомерные соединения гибридизуются с целевой последовательностью, определяются природой и составом олигомерных соединений и видами их анализов. В общем, строгие условия гибридизации включают низкие концентрации (<0.15 М) солей с неорганическими катионами, такими как Na+ или K+ (то есть с низкой ионной силой), и температуру выше 20°С-25°С, но ниже Tm (температуры плавления) комплекса соединение: целевая последовательность, и наличие денатурирующего агента, такого как формамид, диметилформамид, диметилсульфоксид, или поверхностно-активного вещества додецилсульфата натрия (SDS). Например, скорость гибридизации уменьшается на 1.1% с каждым добавлением 1% формамида. Одним из примеров строгих условий гибридизации является применение 0.1 X буферного раствора хлорид натрия-цитрат натрия (SSC)/0.1% (вес/об) SDS при температуре 60°С в течение 30 минут.

Термин "комплементарный", используемый в данной заявке, относится к способности к точному спариванию между двумя нуклеотидами в одной или двух олигомерных цепях. Например, если нуклеооснование в некотором положении антисмыслового соединения способно к связыванию водородными связями с нуклеооснованием в некотором положении целевой нуклеиновой кислоты, причем указанная целевая нуклеиновая кислота является ДНК, РНК или олигонуклеотидом, тогда положение водородной связи между олигонуклеотидом и целевой нуклеиновой кислотой рассматривается как комплементарное положение. Олигомерное соединение и другие ДНК, РНК или олигонуклеотид комплементарны друг другу, когда достаточное количество комплементарных положений в каждой молекуле занято нуклеотидами, которые могут связываться водородными связями друг с другом. Таким образом, термины "специфически гибридизуемый" и "комплементарный" применяются для указания достаточной степени точного спаривания или комплементарности для достаточного количества нуклеотидов таким образом, что образуется стабильное и специфическое связывание между олигомерным соединением и целевой нуклеиновой кислотой.

Из уровня техники известно, что последовательность олигомерного соединения не должна быть на 100% комплементарна последовательности его целевой нуклеиновой кислоты, чтобы считаться специфически гибридизуемой. Более того, олигонуклеотид может гибридизоваться с одним или более сегментами, при этом интроны или соседние сегменты не участвуют в гибридизации (например, структура петли, ошибочное спаривание оснований или шпилькообразная структура). Олигомерные соединения согласно данному изобретению имеют по меньшей мере примерно 70%, или по меньшей мере 75%, или по меньшей мере 80%, или по меньшей мере 85%, или по меньшей мере 90%, или по меньшей мере 95%, или по меньшей мере 99%-ную комплементарность последовательности с целевой областью в целевой нуклеиновой кислоте, на которую они направлены (нацелены). Например, антисмысловое соединение, в котором 18 из 20 нуклеотидов антисмыслового соединения являются комплементарными целевой области, и, следовательно, будут гибридизоваться, будет иметь 90% комплементарность. В этом примере остающиеся некомплементарные нуклеотиды могут входить в состав кластера или рассеиваться вместе с комплементарными нуклеотидами и не должны быть смежными друг другу или комплементарным нуклеотидам. Как таковое, антисмысловое соединение длиной 18 нуклеотидов, содержащее 4 (четыре) некомплементарных нуклеотида, которые фланкированы двумя областями с полной комплементарностью к целевой нуклеиновой кислоте, будет иметь 77.8% полную комплементарность к целевой нуклеиновой кислоте и поэтому будет входить в объем настоящего изобретения. Степень комплементарности антисмыслового соединения к области целевой нуклеиновой кислоты может быть определена стандартными методами с применением компьютерной программы BLAST (основной инструмент поиска локальных выравниваний) и программ PowerBLAST, известных из уровня техники. Степень гомологии, идентичность последовательностей или комплементарность могут быть определены, например, с помощью программы Gap (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), с применением параметров по умолчанию, которая использует алгоритм Смита и Уотермана (Adv. Appl. Math., (1981) 2, 482-489).

Термин "температура плавления", используемый в данной заявке, относится к температуре при определенной ионной силе, величине рН и концентрации нуклеиновой кислоты, при которой 50% олигонуклеотидов комплементарных к целевой последовательности, гибридизуется с целевой нуклеиновой кислотой в равновесном состоянии. Обычно строгие условия будут такими, при которых концентрация соли равна по меньшей мере примерно 0.01-1.0 М иона натрия (или других солей) при рН 7.0-8.3 и температура равна по меньшей мере примерно 30°С для коротких олигонуклеотидов (например, от 10 до 50 звеньев нуклеотидов). Строгие условия могут быть достигнуты путем добавления дестабилизирующих агентов, таких как формамид.

Термин "модуляция", используемый в данной заявке, означает или повышение (стимуляцию), или снижение (ингибирование) уровня экспрессии гена.

Термин "вариант", используемый в контексте данной заявки в отношении полинуклеотидной последовательности, может охватывать полинуклеотидную последовательность, относящуюся к гену дикого типа. Это определение также может включать, например, "аллельные," "сплайсированные," "видовые" или "полиморфные" варианты. Сплайсированный вариант может иметь значительную идентичность референсной молекуле, но обычно имеет большее или меньшее количество полинуклеотидов вследствие альтернирующего сплайсинга экзонов во время процессинга мРНК. Соответствующий полипептид может иметь дополнительные функциональные домены или может их не иметь. Видовые варианты представляют полинуклеотидные последовательности, которые отличаются друг от друга по виду. Особенно полезными в данном изобретении являются варианты генных продуктов дикого типа. Эти варианты могут получиться в результате одной мутации в последовательности нуклеиновой кислоты и могут получиться в альтернирующих мРНК или в полипептидах, структура или функция которых может или не может быть изменена. Любой природный или рекомбинантный ген может иметь 0, одну или много аллельных форм. Обычные мутационные изменения могут привести к образованию вариантов, обусловленных природными делениями, присоединениями или заменами нуклеотидов. Каждый из этих типов изменений может произойти в отдельности или в комбинации с другими видами, один или несколько раз в данной последовательности.

Полученные полипептиды обычно будут иметь значительную аминокислотную идентичность друг другу. Полиморфный вариант является вариацией полинуклеотидной последовательности конкретного гена среди отдельных представителей данного вида. Полиморфные варианты могут также охватывать "однонуклеотидный полиморфизм" (SNPs) или одноосновные мутации, в которых полинуклеотидная последовательность отличается одним основанием. Наличие SNPs может быть, например, показателем некоторой популяции со склонностью к болезненному состоянию.

Производные полинуклеотидов включают нуклеиновые кислоты, которые подверглись химической модификации, например, замещению атома водорода алкильной, ацильной или аминной группой. Эти производные, например, производные олигонуклеотидов, могут содержать части неприродного происхождения, такие как измененные фрагменты сахаров или связи между молекулами сахаров. Примерами являются фосфоротиоатные и другие серосодержащие звенья, которые известны из уровня техники. Производные нуклеиновых кислот могут также содержать метки, включая радионуклиды, ферменты, флуоресцентные агенты, хемилюминесцентные агенты, хромогенные агенты, субстраты, кофакторы, ингибиторы, магнитные частицы и т.п.

"Производное" полипептида или пептида представляет собой соединение, которое модифицировано, например, путем гликозилирования, пэгилирования, фосфорилирования, сульфирования, восстановления/ алкилирования, ацилирования, химического сочетания или обработки формалином в мягких условиях. Производное может быть модифицировано путем введения детектируемой метки или непосредственно, или косвенно, в том числе радиоизотопа, флуоресцентной или ферментной метки.

Термин "животное" или "пациент", используемый в данной заявке, включает, например, людей, овец, оленей, ланей, муловых оленей, норок, млекопитающих, обезьян, лошадей, скот, свиней, коз, собак, кошек, крыс, мышей, птиц, цыплят, рептилий, рыб, насекомых и пауков.

Термин "млекопитающее" охватывает теплокровных млекопитающих, которые обычно находятся под наблюдением врачей (например, людей и домашних животных). Примеры включают кошек, собак, лошадей, коров, а также людей.

Термин "лечащий " или "лечение", используемый в данной заявке, означает лечение заболевания у млекопитающего и включает: (а) профилактику заболевания у млекопитающего, в частности, когда такое млекопитающее предрасположено к заболеванию, но это заболевание еще не было диагностировано; (б) ингибирование заболевания, например, остановку его развития; и/или (в) облегчение болезненного состояния, например, регрессию заболевания до достижения желаемой конечной точки. Лечение также включает уменьшение интенсивности симптома болезни (например, уменьшение боли или дискомфорта), причем такое уменьшение интенсивности может или не может непосредственно влиять на болезнь (например, на причину, передачу, выраженность и т.п.).

Термин "раковое заболевание", используемый в данной заявке, относится ко всем видам рака или новообразований или злокачественных опухолей, обнаруженных у млекопитающих, включая, но без ограничения, лейкозы, лимфомы, меланомы, карциномы и саркомы. Рак проявляет себя в виде "опухоли" или ткани, содержащей злокачественные клетки. Примеры опухолей включают саркомы и карциномы, такие как, но без ограничения, фибросаркома, миксосаркома, липосаркома, хондросаркома, остеогенная саркома, хордома, ангиосаркома, эндотелиосаркома, лимфангиосаркома, лимфангиоэндотелиосаркома, синовиома, мезотелиома, опухоль Эвинга, лейомиосаркома, рабдомиосаркома, рак толстой кишки, рак поджелудочной железы, рак молочной железы, рак яичника, рак простаты, сквамозноклеточная карцинома, карцинома базальных клеток, аденокарцинома, карцинома потовых желез, карцинома сальной железы, папиллярная карцинома, папиллярная аденокарцинома, цистаденокарцинома, медуллярный рак, бронхогенная карцинома, почечноклеточный рак, гепатома, карцинома желчного протока, хориокарцинома, семинома, тератокарцинома, опухоль Вильмса, рак шейки матки, опухоль мужских половых клеток, карцинома легких, мелкоклеточная карцинома легкого, рак мочевого пузыря, эпителиальная карцинома, глиома, астроцитома, медуллобластома, краниофарингиома, эпендимома, пинеалома, гемангиобластома, акустическая невринома, олигодендроглиома, менингиома, меланома, нейробластома и ретинобластома. Кроме того, раковые заболевания, которые можно лечить заявленной композицией, включают, но без ограничения, например, болезнь Ходжкина, лимфому не-Ходжкина, множественную меланому, нейробластому, рак молочной железы, рак яичника, рак легкого, рабдомиосаркому, первичный тромбоцитоз, первичную макроглобулинемию, мелкоклеточный рак легкого, первичные опухоли мозга, рак желудка, рак толстой кишки, злокачественную инсуланому поджелудочной железы, карциноидный синдром, рак мочевого пузыря, рак желудка, предопухолевые поражения кожи, рак яичка, лимфомы, злокачественную опухоль щитовидной железы, нейробластому, рак пищевода, рак мочеполового тракта, злокачественную гиперкальциемию, рак шейки матки, рак эндометрия, рак коры надпочечников и рак простаты.

Используемый в данной заявке термин "неврологическое заболевание или нарушение" относится к любому заболеванию или нарушению нервной системы и/или зрительной системы. "Неврологическое заболевание или нарушение" включает заболевание или нарушение, которое затрагивает центральную нервную систему (мозг, мозговой ствол и мозжечок), периферическую нервную систему (включая черепные нервы) и автономную нервную систему (части которой расположены как в центральной, так и в периферической нервной системе).

Неврологическое заболевание или нарушение включает, но без ограничения, приобретенную эпилептиформную афазию, острый рассеянный энцефаломиелит, адренолейкодистрофию, возрастную дегенерацию макулы, агенезию мозолистого тела, агнозию, синдром Экарди, болезнь Александера, болезнь Альперса, альтернирующую гемиплегию, болезнь Альцгеймера, сосудистую деменцию, боковой амиотрофический склероз, анэнцефалию, синдром Ангельмана, ангиоматоз, гипоксию, афазию, апраксию, арахноидальные кисты, арахноменингит, мальформацию Арнольда-Киари, артериовенозную мальформацию, синдрои Аспергера, атаксию-телеангиэктозию, синдром гиперактивности с дефицитом внимания, аутизм, вегетативную дисфункцию, боли в позвоночнике, болезнь Баттена, болезнь Бехчета, паралич Белла, доброкачественный эссенциальный блефароспазм, амиотрофию, идиопатическую внутричерепную гипертензию, болезнь Бинсвангера, синдром Блоха-Сульцберегера, поражения плечевого сплетения, абсцесс головного мозга, травму головного мозга, опухоли головного мозга (включая мультиформную глиобластому), опухоли спинного мозга, синдром Брауна-Сигварда, болезнь Канавана, синдром канала запястья, каузальгию, таламический синдром, центральный понтинный миелинолиз, цефалический синдром, аневризму сосудов головного мозга, церебральный артериосклероз, церебральную атрофию, церебральный гигантизм, церебральный паралич, болезнь Шарко-Мари-Тута, нейропатию, вызванную химиотерапией, и невротические боли, мальформацию Чиари, хорею, хроническую воспалительную демиелинизирующую полинейропатию, хронические боли, хронический региональный болевой синдром, синдром Коффина-Лоури, кому, включая устойчивое вегетативное состояние, врожденную лицевую дисплегию, кортико-базальную дегенерацию, гигантоклеточный артериит, краниосиностоз, болезнь Крейцфельда-Якобса, кумулятивное травматическое расстройство, синдром Кушинга, цитомегаловирусную инфекцию, синдром дрожащих глаз-дрожащих ног, синдром Денди-Уокера, болезнь Даусона, синдром де Морсье, паралич Дежерин-Клюмпке, деменцию, дерматомиозит, диабетическую нейропатию, рассеянный склероз, вегетативную дистонию, дисграфию, дислексию, дистонию, раннюю младенческую эпилептическую энцефалопатию, синдром пустого турецкого седла, энцефалит, энцефалотригеминальный ангиоматоз, эпилепсию, паралич Эрба, эссенциальное дрожание, болезнь Фабри, синдром Фара, головокружения, семейный спастический паралич, фебрильную судорогу, синдром Фишера, атаксию Фридриха, лобно-височную деменцию, и другие "таутопатии"; болезнь Гаучера, синдром Герстманна, гигантоклеточный артериит, болезнь включений в гигантских клетках, глобоидно-клеточную лейко дистрофию, синдром Джулиана-Барре, HTLV-1-ассоциированную миелопатию, болезнь Галлервордена-Шпатса, травмы головы, головную боль, односторонний спазм лица, наследственную спастическую параплегию, полиневропатическую атаксию, синдром коленчатого узла, опоясывающий лишай, синдром Хирайяма, ВИЧ-ассоциированную деменцию и нейропатию (также неврологические проявления ВИЧ); аринэнцефалию, болезнь Хантингтона и другие повторные заболевания, связанные в уровнем глутамина, гидроанэнцефалию, гидроцефалию, синдром эктопического АКТГ, гипоксию, иммунообусловленный энцефаломиелит, миозит с включенными тельцами, недержание пигмента, болезнь накопления фитановой кислоты младенческого возраста, инфантильные спазмы, воспалительную миопатию, внутричерепные кисты, внутричерепную гипертензию, синдром Жубера, синдром Кирна-Сейра, болезнь Кеннеди, синдром Кинсбурна, синдром Клиппеля-Фейля, болезнь Краббе, болезнь Кугельберга-Веландера, инфекцию куру, болезнь Лафора, миастенический синдром Ламберта-Итона, Синдром Ландау-Клеффнера, латеральный медуллярный синдром (Валленберга), нарушение обучаемости, болезнь Лея, синдром Леннокса-Гасто, синдром Леша-Нихана, лейкодистрофию, деменцию с тельцами Леви, лиссэнцефалию, синдром запертого внутри, болезнь Лу Герига (то есть болезнь двигательного нейрона, боковой амиотрофический склероз), болезнь межпозвонковых дисков, болезнь Лайма, болезнь Мачадо-Джозефа, макроэнцефалию, мегаэнцефалию, синдром Мелкерссона-Розенталя, болезнь Менье, менингит, болезнь Менкеса, метахроматическую лейкодистрофию, микроэнцефалию, мигрень, синдром Миллера-Фишера, мини-инсульты, митохондриальную миопатию, синдром Мебиуса, амиотрофию одной конечности, болезнь двигательных нейронов, болезнь Моямоя, мукополисахаридоз, постинсультную деменцию, мультифокальную двигательную нейропатию, рассеянный склероз и другие демиелинизирующие расстройства, множественную системную атрофию с постуральной гипертензией, мышечную дистрофию, миастению гравис, диффузный миелинокластический склероз, миоклоническую детскую энцефалопатию, миоклонию, миопатию, врожденную миотонию, нарколептическую болезнь, нейрофиброматоз, нейролептический злокачественный синдром, неврологические проявления ВИЧ, неврологические осложнения при волчанке, нейромиотонию, неврональный цероидный липофусциноз, расстройство миграции нейронов, болезнь Нимана-Пика, синдром О'Сюлливана-Маклеода, затылочную невралгию, скрытую дизрафию спинного мозга, синдром Отахара, оливопонтоцеребеллярную атрофию, опсоклонус-миоклонус, неврит зрительного нерва, ортостатическую гипертензию, синдром профессиональной перегрузки, парестезию, нейродегенеративное нарушение или болезнь (болезнь Паркинсона, болезнь Хантингтона, болезнь Альцгеймера, амиотрофический рассеянный склероз (ALS), деменцию, рассеянный склероз и другие заболевания и расстройства, связанные с гибелью нейронных клеток), врожденную парамиотонию, паранеопластические заболевания, пароксизмальные приступы, синдром Парри-Ромберга, болезнь Пелицеуса-Мерцбахера, периодический паралич, периферическую нейропатию, болезненную нейропатию и нейтропатические боли, устойчивое вегетативное состояние, аутистические расстройства, световой чихательный рефлекс, болезнь накопления фитановой кислоты, болезнь Пика, защемление нерва, опухоль гипофиза, полимиозит, порэнцефалию, постполимиелитный синдром, постгерпетическую невралгию, постинфекционный энцефаломиелит, постуральную гипотензию, синдром Прадера-Вилли, первичный латеральный склероз, прионную болезнь, прогрессирующую гемифацеальную атрофию, прогрессирующую мультифокальную лейкоэнцефалопатию, прогрессирующую склерозирующую полиодистрофию, прогрессирующий надъядерный паралич, идиопатическую внутричерепную гипертензию, синдром Рамзая-Ханта (типы I и II), энцефалит Расмуссена, симпатическую рефлекторную дистрофию, болезнь Рефсума, повторяющееся расстройство движения, синдром беспокойных ног, миелопатию, вызванную ретровирусами, синдром Ретта, синдром Рея, пляску святого Витта, Болезнь Сендхофа, болезнь Шидлера, шизэнцефалию, септо-оптическую дисплазию, синдром тряски младенца, опоясывающий лишай, синдром Шая-Драгера, синдром Шегрена, приступы апноэ во сне, синдром Сото, мышечную спастичность, спинно-мозговую грыжу, повреждение спинного мозга, опухоли спинного мозга, спинальную мышечную атрофию, синдром Стиффа-Персона, инсульт, синдром Стурге-Вебера, подострый склерозирующий панэнцефалит, субкортикальную хроническую энцефалопатию, хорею Сиденгама, обмороки, сирингомиелию, позднюю дискинезию, болезнь Тэя-Сакса, височный артериит, скрытую дизрафию спинного мозга, болезнь Томсона, компрессионный синдром верхней апертуры грудной клетки, невралгию тройничного нерва, паралич Тодда, синдром Туретта, преходящее нарушение мозгового кровообращения, трансмиссивные губчатые энцефалопатии, поперечный миелит, травматическое повреждение головного мозга, тремор, тригеминальную невралгию, тропический спастический парапорез, туберозный склероз, сосудистую деменцию (мультиинфарктную деменцию), васкулит, включая темпоральный артериит, болезнь фон Гиппеля-Линдау, синдром Валленберга, болезнь Верднига-Хофманна, синдром Веста, хлыстовую травму, синдром Вильямса, болезнь Вильдона и болезнь Зелльвегера.

"Пролиферативное заболевание или нарушение" включает, но без ограничения, гематопозтические неопластические расстройства, включая расстройства, связанные с гиперпластическими/неопластическими клетками гематопозтического происхождения из миелоидных, лимфоидных или эритроидных ростков или их клеток-предшественников. Эти болезни включают, но без ограничения, эритробластический лейкоз, острый промиелоидный лейкоз (APML), хронический миелогенный лейкоз (CML), лимфонеоплазию, включая, но без ограничения, острый лимфобластический лейкоз (ALL), который включает В-клеточный ALL и Т-клеточный ALL, хронический лимфоцитарный лейкоз (CLL), пролимфоцитарный лейкоз (PLL), лейкоз ворсистых клеток (HLL) и макроглобулинемию Вальденштрема (WM). Дополнительные виды злокачественных лимфом включают, но без ограничения, лимфому не-Ходжкина и ей варианты, периферические Т-клеточные лимфомы, Т-клеточные лейкоз/лимфому у взрослых (ATL), кожную Т-клеточную лимфому (CTCL), лейкоз из больших гранулярных лимфоцитов (LGF), болезнь Ходжкина и болезнь Рида-Штернберга.

Термин "воспаление" относится к системным воспалительным состояниям и состояниям, локально связанными с миграцией и притяжением моноцитов, лейкоцитов и/или нейтрофилов. Примеры воспалительных заболеваний включают, но без ограничения, болезни, возникающие в результате инфекции патогенными организмами (включая грамположительные бактерии, грамотрицательные бактерии, вирусы, грибки и паразиты, такие как простейшие и гельминты), отторжение трансплантатов (включая отторжение твердых органов, таких как почка, печень, сердце, легкое или роговицу, а также отторжение трансплантатов костного мозга, включая болезнь "трансплантат против хозяина" (GVHD)), или в результате острых аутоиммунных или аллергических реакций.

Аутоиммунные болезни включают острый гломерулонефрит, ревматоидные или реактивный артрит, хронический гломерулонефрит, воспаление кишечника, включая такие болезни как болезнь Крона, язвенный колит и некротизирующий энтероколит, гепатит, сепсис, алкогольную болезнь печени, неалкогольный стеатоз, синдромы, связанные с трансфузией гранулоцитов, воспалительные дерматозы, такие как контактный дерматит, атопический дерматит, псориаз, системную эритематозную волчанку (SLE), аутоиммунный тироидит, рассеянный склероз и некоторые формы диабета или любое другое аутоиммунное состояние, когда атака на собственную иммунную систему субъекта приводит к деструкции патологической ткани. Аллергические реакции включают аллергическую астму, хронический бронхит, острую и замедленную гиперчувствительность. Системные воспалительные заболевания включают воспаление, связанное с травмой, ожогами, ишемические события после реперфузии (например, образование тромбов в сердце, в мозгу, кишечнике, или в периферических сосудах, включая инфаркт миокарда и инсульт), сепсис, ARDS (респираторный дистресс-синдром взрослых) или синдром полиорганной недостаточности.

Рекрутмент воспалительных клеток происходит также в атеросклеротических бляшках. Воспаление включает также, но без ограничения, лимфому не-Ходжкина, грануломатоз Вегенера, тироидит Хашимото, гепатоклеточную карциному, атрофию гипофиза, хронический панкреатит, ревматоидный артрит, реактивную лимфоидную гиперплазию, остеоартрит, язвенный колит, папиллярную карциному, болезнь Крона, язвенный колит, острый холецистит, хронический холецистит, цирроз, хронический сиаладенит, перитонит, острый панкреатит, хронический панкреатит, хронический гастрит, аденомиоз, эндометриоз, острый цервицит, хронический цервицит, лимфоидную гиперплазию, рассеянный склероз, гипертрофию после идиопатической тромбоцитопенической пурпуры, первичную IgA-нефропатию, системную эритематозную волчанку, псориаз, эмфизему легких, хронический пиелонефрит и хронический цистит.

Полинуклеотиды и олигонуклеотиды и композиции на их основе

Мишени: Согласно одному из вариантов мишени представляют собой последовательности нуклеиновых кислот нейтрофического фактора головного мозга (BDNF), включая, но без ограничения, смысловые и/или антисмысловые некодирующие и/или кодирующие последовательности, ассоциируемые с BDNF. В международной заявке № WO 2010/093904 и в заявке США на патент №2011/0319475, обе из которых озаглавлены "Treatment of Brain Derived Neurotrophic Factor (BDNF) Related Diseases by Inhibition of Natural Antisense Transcript to BDNF", описано использование BDNF в качестве мишени для модуляции с применением олигонуклеотидов, описанных в данной заявке.

Нейтрофины представляют класс структурно связанных факторов роста, которые промотируют выживаемость и дифференцировку нейронов. Они стимулируют рост аксонов, что дает основание предположить, что они могут промотировать регенерацию поврежденных нейронов и действуют как нейтрофические факторы, стимулирующие коллатеральное разрастание в тканях-мишенях, которое продуцирует нейтрофины.

Нейтрофический фактор головного мозга (BDNF) вначале характеризовали как основной белок, содержащийся в мозговых экстрактах, способный увеличивать выживаемость дорсальных корешковых ганглиев. Когда аксонная связь в теле клетки прерывается при повреждении, шванновские клетки продуцируют нейтрофические факторы, такие как нервный ростовой фактор (NGF) и BDNF. Нейтрофины высвобождаются из шванновских клеток и диффузно диспергируются градиентным образом вокруг регенерирующихся аксонов, которые затем простираются дистально вдоль градиента плотности нейтрофинов. Как было показано, локальное нанесение BDNF на рассеченные нервы у неонатальных крыс предотвращает массовую гибель мотонейронов, которая следует после аксотомии. Титр мРНК BDNF после аксотомии увеличивается в несколько раз по сравнению с нормальным уровнем достигает своего максимума через 4 нед. Более того, сообщалось, что BDNF повышает выживаемость холинергических нейронов в культуре.

Согласно одному из вариантов антисмысловые олигонуклеотиды используются для профилактики или лечения заболеваний или нарушений, ассоциируемых с членами семейства BDNF. Примерами BDNF-опосредованных заболеваний или нарушений, которые можно лечить антисмысловыми олигонуклеотидами согласно данному изобретению, и/или клетками/тканями, регенерированными из стволовых клеток, полученных с применением антисмысловых соединений или содержащих эти соединения, являются заболевание или нарушение, связанные с аномальной функцией и/или экспрессией BDNF, неврологическое заболевание или нарушение, заболевание или нарушение, связанное с дефективным нейрогенезом; нейродегенеративное заболевание или расстройство (например, болезнь Альцгеймера, болезнь Паркинсона, болезнь Хантингтона, амиотрофический боковой склероз и т.п.); психоневрологическое расстройство (депрессия, шизофрения, шизофреноформное расстройство, шизоаффективное расстройство и бредовое расстройство; тревожное расстройство, такое как паническое расстройство, фобии (включая агорафобию), обсессивно-компульсивное расстройство, пост-травматический стресс, биполярное расстройство, нервная анорексия, нервная булимия), аутоиммунное расстройство (например, рассеянный склероз) центральной нервной системы, потеря долговременной памяти или кратковременной памяти, доброкачественная забывчивость, нарушение способности к обучению у детей, травма, близкая к голове, дефицит внимания, нейронная реакция на вирусную инфекцию, травма мозга, нарколептическое расстройство, расстройство сна (например, расстройство суточного ритма, бессонница и нарколепсия); разрыв нервов или повреждение нервов, разрыв пучков спинно-мозговых нервов (CNS) и травма мозга или повреждение нервных клеток, неврологическое расстройство, связанное с ВИЧ, моторное тикозное расстройство, характеризующееся вокализмами и/или моторными тиками (например, синдром Туретта, хроническое моторное тикозное расстройство или вокализмы, транзиторное тикозное расстройство и нарушение стереотипных движений), злоупотребление психотропными веществами (например, злоупотребление психоактивными веществами, злоупотребление психоактивными веществами и последующая зависимость от этих веществ, например, психическое расстройство, вызванное употреблением психотропных веществ, отказ от употребления указанных веществ и деменция в результате такого употребления или амнестический синдром), травматическое повреждение мозга, звон в ушах, невралгия (например, тригеминальная невралгия), боль (например, хроническая боль, хроническая воспалительная боль, боль, связанная с артритом, фибромиалгия, боль в спине, боль, вызванная наличием рака, боль, связанная с пищеварением, боль, связанная с болезнью Крона, боль, связанная с аутоиммунным заболеванием, боль, связанная с эндокринными заболеваниями, боль, связанная с диабетической нейропатией, фантомные боли в ампутированных конечностях, самопроизвольная боль, хроническая боль после операции, височно-челюстной синдром, каузальгия, пост-герпетическая невралгия, боль, связанная с наличием ВИЧ, комплексный региональный болевой синдром I и d II типа, тригеминальная невралгия, хроническая боль в спине, боль, связанная с повреждением пучка спинномозговых нервов, боль, связанная с употреблением лекарств и регулярная острая боль, нейропатическая боль), аномальная нейронная активность, приводящая к нейрострессу болезни, такой как диабет, MS и болезнь двигательного нейрона, ригидность мышц, (мышечная спастичность), дисфункция височно-челюстного сустава, синдром дефицита удовлетворенности (RDS), нейротоксичность, вызванная употреблением алкоголя или психотропных веществ (экстази, метамфетамина и т.п.), задержка в умственном развитии, ухудшение познавательных способностей (например, отставание, вызванное несиндромной ломкостью Х-хромосомы, синдром ломкой Х-хромосомы, синдром Дауна, аутизм), афазия, паралич Белла, болезнь Крейцфельда-Якоба, энцефалит, возрастная дегенерация макулы, синдром "проклятия Ундины", синдром WAGR, потеря слуха, синдром Ретта, эпилепсия, повреждения спинного мозга, инсульт, гипоксия, ишемия, повреждение головного мозга, диабетическая нейропатия, периферическая нейропатия, осложнения после трансплантации нервов, болезнь двигательного нейрона, повреждение периферических нервов, ожирение, метаболический синдром, рак, астма, атопическое заболевание, воспаление, аллергия, экзема, нейроонкологическое заболевание или расстройство, нейроиммунологическое заболевание или расстройство, нейроотологическое заболевание или расстройство и заболевание или расстройство, связанные со старением или дряхлением.

Данное изобретение предусматривает механизм, по которому эндогенные NATs подавляют транскрипцию смысловых частей их генов. Настоящее изобретение предусматривает, что экспрессия эндогенных генов может быть активирована локус-специфическим образом путем удаления или ингибирования NATs,, которые транскрибированы из большинства транскрипционных единиц.

Один вариант данного изобретения предусматривает примеры функциональных нкРНК (некодируемых РНК), которые регулируют выход белка, явление, применимое ко многим другим геномным локусам.

Нейтрофический фактор головного мозга (BDNF) является членом семейства "нейтрофинов", существенных для роста нейронов, дифференцировки и сохранения созревания. BDNF также очень важен для пластичности нейронов и, как показано, участвует в процессах познания и развития памяти. Локус BDNF находится в хромосоме 11 и показывает активную транскрипцию из обеих нитей, что ведет к транскрипции некодирующих NATs.

Данное изобретение характеризует регуляторную роль этой антисмысловой молекулы РНК, BDNF-AS, который проявляет сильное взаимное и динамическое регулирование экспрессии смысловой мРНК BDNF и белка, как in vitro, так и in vivo.

Один вариант данного изобретения предусматривает стратегию повышающей регуляции (активации) экспрессии мРНК с помощью ингибирующих молекул транскрипта антисмысловой РНК, которые называются АнтагоNATs (AntagoNATs). АнтагоNATs описаны, например, в международной заявке WO 2012/068340, которая полностью включена в данную заявку посредством отсылки.

Как было показано, количество нкРНК в геномах эукариот увеличивается как функция эволюционной множественности, и имеется, например, большое количество вариабельности в нкРНК, экспрессированных в нервной системе. В последние несколько лет появились сообщения о функциональных NATs, было показано их возможное участие в развитии заболеваний у людей, включая болезнь Альцгеймера, болезнь Паркинсона и синдром ломкой Х-хромосомы. Более того, сообщалось, что повышающая регуляция (активация) смысловой формы гена CD97 может быть достигнута путем нокдауна транскрипта его антисмысловой РНК. Была описана повышающая регуляция рецептора прогестерона (PR) и других эндогенных транскриптов после нацеливания некодирующих РНК из промоторов. Сообщалось о транскрипционной активации гена р21 и промотора Oct4 после истощения NATs. Ремоделирование хроматина, индуцированного антисмысловой РНК, оказалось возможным и динамическим образом действия для многих NATs с небольшим количеством копий. Если это имеет место, антисмысловая РНК может преимущественно проявлять локальное действие для сохранения или модификации структуры хроматина, в конечном счете, активируя или подавляя экспрессию смысловой формы гена.

PCR2 представляет собой белковый комплекс, который состоит из четырех частей ядра Eed, Suz12, RbAp48 и каталитического Ezh2, который катализирует триметилирование гистон Н3-лизина (H3K27met3). Последние исследования позволили получить доказательство прямого взаимодействия РНК-белок между Ezh2 и многими транскриптами нкРНК.

Другие исследования инактивации хромосомы X и кластера гена НОХ показали, что транскрипты РНК принимают участие в PRC2-опосредованной индукции H3K27met3, репрессивных хроматиновых "ярлыков". Профилирование транскриптома (полного набора транскриптов) PRC2 позволило идентифицировать более 9000 РНК, взаимодействующих с PRC2 в эмбриональных стволовых клетках, многие из них относят к антисмысловым транскриптам РНК. Сообщалось, что эпигенетический сайленсинг генов р15 и DM1 включает образование гетерохроматина его антисмысловой РНК. Традиционное деление хроматина на гетерохроматин и эухроматин не может быть полным, так как последние исследования показали, что имеется пять основных типов хроматина, которые являются более динамичными и гибкими, чем считалось ранее.

Для вероятно большого количества локусов генов можно осуществлять манипуляцию NATs для того, чтобы получить локус-специфичное изменение модификации хроматина. В качестве примеров было показано, что расщепление (при помощи киРНК) или ингибирование (при помощи АнтагоNATs) антисмысловых транскриптов генов BDNF проводит к активации соответствующих мРНК.

Нейтрофины принадлежат к классу секретируемых факторов роста, которые способствуют выживаемости, дифференцировке и функции нейронов, и BDNF представляет собой важный молекулярный медиатор синаптической пластичности. Предполагают, что BDNF синхронизирует созревание нейронов и глиальных клеток, участвует в дифференцировке аксонов и дендритов и защищает и повышает выживаемость нейронных клеток. Уровень экспрессии нейтрофинов снижается при нейродегенеративных и психиатрических заболеваниях. Считается, что активация нейтрофинов оказывает благоприятное действие на некоторые неврологические расстройства. АнтагоNATs могут быть использованы как терапевтическая стратегия для ингибирования BDNF-AS и соответственного увеличения пролиферации нейронов и их выживаемости в случае ряда заболеваний.

Нельзя исключить, что описанный выше подход к активации синтеза эндогенных молекул BDNF, предусматривающий природные модификации и представляющий все известные формы сплайсинга, окажется отличительным и, возможно, превосходящим подход с применением введения синтетических молекул BDNF.

Согласно одному из вариантов модуляция BDNF осуществляется при помощи одного или более антисмысловых олигонуклеотидов, вводимых пациенту, нуждающемуся в этом, для профилактики или лечения любого заболевания или расстройства, связанного с аномальной экспрессией BDNF функцией, а также активностью по сравнению с нормальным контролем.

Согласно одному из вариантов олигонуклеотиды являются специфичными для природных антисмысловых транскриптов BDNF, перечисленных в данной заявке, которые включают, но без ограничения, некодирующие области. BDNF-мишени включают варианты по изобретению, мутанты BDNF, включая SNPs; некодирующие последовательности BDNF; аллели, фрагменты и т.п.Предпочтительно, когда олигонуклеотид представляет собой молекулу антисмысловой РНК.

В соответствии с вариантами данного изобретения молекула целевой нуклеиновой кислоты не ограничена только полинуклеотидами BDNF, но это могут быть любые изоформы, рецепторы, гомологи, некодирующие области и т.п. в BDNF

Согласно одному из вариантов олигонуклеотид нацелен на природную антисмысловую последовательность (природную антисмысловую по отношению к кодирующим и некодирующим областям) BDNF-мишеней, включая, но без ограничения, варианты, аллели, гомологи, производные, фрагменты и их комплементарные последовательности. Предпочтительно, когда олигонуклеотид представляет собой антисмысловую РНК или молекулу ДНК.

Согласно одному из вариантов олигомерные соединения согласно изобретению включают варианты, в которых содержится другое основание в одном или более положениях нуклеотидов в соединении. Например, если первый нуклеотид является аденином, могут быть получены варианты, которые содержат тимидин, гуанозин, цитидин или другой природный или неприродный нуклеотиды в этом положении. Это может быть сделано в любом из положений антисмыслового соединения. Эти соединения затем испытывают, используя способы, описанные в данной заявке, для определения их способности ингибировать экспрессию целевой нуклеиновой кислоты.

Согласно некоторым вариантам гомология, идентичность или комплементарность последовательностей между антисмысловым соединением и мишенью составляют от примерно 50% до примерно 60%. Согласно некоторым вариантам гомология, идентичность или комплементарность последовательностей между антисмысловым соединением и мишенью составляют от примерно 60% до примерно 70%. Согласно некоторым вариантам гомология, идентичность или комплементарность последовательностей между антисмысловым соединением и мишенью составляют от примерно 70% до примерно 80%. Согласно некоторым вариантам гомология, идентичность или комплементарность последовательностей между антисмысловым соединением и мишенью составляют от примерно 80% до примерно 90%. Согласно некоторым вариантам гомология, идентичность или комплементарность последовательностей между антисмысловым соединением и мишенью составляют примерно 90%, примерно 92%, примерно 94%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100%,

Антисмысловое соединение специфически гибридизуется, когда связывание соединения с нуклеиновой кислотой-мишенью мешает нормальной функции нуклеиновой кислоты-мишени вызывать потерю активности, и существует значительная степень комплементарности, чтобы избежать неспецифического связывания антисмыслового соединения с последовательностями нуклеиновой кислоты-мишени в условиях, в которых желательно специфическое связывание, такие условия включают физиологические условия в случае проведения анализов in vivo или терапевтического лечения, и условия, в которых анализы проводятся in vitro.

Антисмысловое соединение, будь то ДНК, РНК, химерное соединение или замещенное соединение и т.д., специфически гибридизуется, когда связывание соединения с ДНК-мишенью или молекулой РНК вмешивается в нормальную функцию ДНК- или РНК-мишени, вызывая потерю полезности, и существует значительная степень комплементарности, чтобы избежать неспецифического связывания антисмыслового соединения с последовательностями нуклеиновой кислоты-мишени в условиях, в которых желательно специфическое связывание, то есть в физиологических условиях, в случае проведения анализов in vivo или терапевтического лечения, и условия, в которых анализы проводятся in vitro.

Согласно одному из вариантов нацеливание на BDNF, включая, но без ограничения, антисмысловые соединения, которые идентифицированы и удлинены (увеличены) с применением, например, ПЦР, гибридизации и т.д., одна или более последовательностей, соответствующих SEQ ID NO: 3-11 и т.п.модулируют экспрессию или функцию BDNF. Согласно одному из вариантов экспрессия или функция активируются по сравнению с контрольным соединением.

Согласно одному из вариантов олигонуклеотиды содержат последовательности нуклеиновых кислот, соответствующие SEQ ID NO: 12-49, включая антисмысловые последовательности, которые идентифицированы и удлинены с применением, например, ПЦР, гибридизации и т.д. Эти олигонуклеотиды могут содержать один или более модифицированных нуклеотидов, более коротких или более длинных фрагментов, модифицированных мостиков и т.п. Примеры модифицированных мостиков или межнуклеотидных мостиков включают фосфоротиоатные, фосфородитиоатные мостики и т.д. Согласно одному из вариантов нуклеотиды содержат фосфорсодержащее производное. Фосфорсодержащее производное (или модифицированная фосфатная группа) которая может быть присоединена к фрагменту сахара или его аналога в модифицированных олигонуклеотидах по изобретению, может быть фосфатной группой, дифосфатной группой, трифосфатной, алкилфосфатной, алканфосфатной, фосфоротиоатной группами и т.п. Получение таких фосфатных аналогов и их введение в состав нуклеотидов и олигонуклеотидов само по себе также известно и нет необходимости описывать эти моменты в данной заявке.

Специфичность и чувствительность антисмысловых соединений используется специалистами в терапевтических целях. Антисмысловые олигонуклеотиды использовались в качестве терапевтических средств для лечения заболеваний у животных и людей. Антисмысловые олигонуклеотиды эффективно и безопасно применялись для людей и в настоящее время используются при проведении многочисленных клинических исследований.

Таким образом, было установлено, что олигонуклеотиды представляют собой терапевтические возможности, которые могут быть адаптированы для применения при лечении клеток, тканей и животных, в особенности, людей.

Согласно некоторым вариантам данного изобретения олигомерные антисмысловые соединения, особенно олигонуклеотиды, связываются с молекулами нуклеиновой кислоты-мишенями и модулируют экспрессию и/или функцию молекул, кодированных целевым геном. Модулируемые функции ДНК включают, например, репликацию и транскрипцию. Модулируемые функции РНК включают все жизненные функции, такие как, например, транслокация РНК к месту трансляции белка, трансляция белка из РНК, сплайсинг РНК с получением одного или более фрагментов мРНК и каталитическая активность, которая может быть вовлечена или облегчена при помощи РНК. Эти функции могут быть активированы или ингибированы в зависимости от желаемых функций.

Антисмысловые соединения включают антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды с внешними вспомогательными последовательностями (EGS), альтернирующие сплайсеры, праймеры, зонды и другие олигомерные соединения, которые гибридизуются с по меньшей мере частью целевой нуклеиновой кислоты. Как таковые, эти соединения могут быть введены в виде однонитевых, двунитевых, частично однонитевых или кольцевых олигомерных соединений.

Нацеливание антисмыслового соединения на молекулу конкретной нуклеиновой кислоты в контексте данного изобретения может представлять собой многостадийный процесс. Этот процесс обычно начинается с идентификации целевой нуклеиновой кислоты, функция которой должна быть модулирована. Эта целевая нуклеиновая кислота может быть, например, клеточным геном (или мРНК, транскрибированной с гена), экспрессия которого связана с конкретным расстройством или заболеванием, или молекулой нуклеиновой кислоты у инфекционного агента. Согласно данному изобретению целевая нуклеиновая кислота кодирует нейтрофический фактор головного мозга (BDNF).

Процесс прицеливания обычно также включает определение по меньшей мере одной области-мишени, сегмента или сайта в составе целевой нуклеиновой кислоты для такого антисмыслового взаимодействия, которое приводит к появлению желаемого эффекта, например, модулированию экспрессии. В контексте данного изобретения термин "область" определяется как часть целевой нуклеиновой кислоты, имеющей, по меньшей мере, одну идентифицируемую структуру, функцию или свойство. В областях целевой нуклеиновой кислоты имеются сегменты. "Сегментами" называются субфрагменты областей в целевой нуклеиновой кислоте. Термин "сайты", используемый в данной заявке, означает положения в целевой нуклеиновой кислоте

Согласно некоторым вариантам данного изобретения антисмысловые олигонуклеотиды связываются с природными антисмысловыми последовательностями нейтрофического фактора головного мозга BDNF и модулируют экспрессию и/или функцию (BDNF) (SEQ ID NO: 1 и 2). Примеры антисмысловых последовательностей включают SEQ ID NO: 3-55.

Согласно одному из вариантов антисмысловые олигонуклеотиды связываются с одной или более сегментами полинуклеотидов нейтрофического фактора головного мозга (BDNF) и модулируют экспрессию и/или функцию BDNF. Сегменты включают по меньшей мере пять последовательных нуклеотидов смысловых и антисмысловых полинуклеотидов BDNF.

Согласно одному из вариантов антисмысловые олигонуклеотиды являются специфичными к природным антисмысловым последовательностям, при этом связывание олигонуклеотидов с природными антисмысловыми последовательностями BDNF модулирует экспрессию и/или функцию BDNF.

Согласно одному из вариантов олигонуклеотидные соединения содержат последовательности соответствующие SEQ ID NO: 12-49, антисмысловые последовательности, которые идентифицируются и удлиняются с применением ПЦР, гибридизации и т.д. Эти олигонуклеотиды могут включать один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п. Примеры модифицированных связей или межнуклеотидных связей включают фосфотиоатные, фосфодитиоатные связи и т.п. Согласно одному из вариантов нуклеотиды содержат фосфорилированное производное. Фосфорилированное производное (или модифицированная фосфатная группа), которое может быть присоединено к фрагменту сахара или аналога сахара в модифицированных олигонуклеотид ах согласно данному изобретению, может представлять собой монофосфат, дифосфат, трифосфат, алкилфосфат, алканфосфат, фосфотиоат и т.п. Получение вышеуказанных фосфатных аналогов и их введение в нуклеотиды, модифицированные нуклеотиды и олигонуклеотиды сами по себе также известны, поэтому нет необходимости их описывать в данной заявке.

Как известно из уровня техники, инициирующий трансляцию кодон обычно представляет собой 5'-AUG (в транскрибированных молекулах мРНК; 5'-ATG в соответствующей молекуле ДНК), инициирующий трансляцию кодон называют также "AUG-кодон", "стартовый кодон" или"AUG-стартовый кодон". Меньшинство генов содержит инициирующий трансляцию кодон, имеющий РНК-последовательность 5'-GUG, 5'-UUG или 5'-CUG; и 5'-AUA, 5'-ACG и 5'-CUG, и, как было показано, функционирует in vivo. Таким образом, термины 'инициирующий трансляцию кодон" и "стартовый кодон" могут охватывать многие последовательности кодонов, хотя инициирующая аминокислота в каждом случае обычно представляет собой метионин (в эукариотах) или формилметионин (в прокариотах). Гены эукариот и прокариот могут иметь два или более альтернирующих стартовых кодонов, любой из которых может быть предпочтительно использован для инициации трансляции в клетке или ткани конкретного типа или в конкретных условиях. В контексте данного изобретения термины "стартовый кодон" или "инициирующий трансляцию кодон" относятся к кодону или кодонам, которые используются in vivo для инициации трансляции мРНК, транскрибированной из гена, кодирующего нейтрофический фактор головного мозга (BDNF) независимо от последовательности (последовательностей) таких кодонов. Терминирующий трансляцию кодон (или "стоп-кодон") гена может содержать одну из трех последовательностей, а именно, 5'-UAA, 5'-UAG и 5'-UGA (соответствующими последовательностями ДНК являются 5'-ТАА, 5'-TAG и 5'-TGA, соответственно).

Термины "область стартового кодона" и "область инициирующего трансляцию кодона" относятся к части такой мРНК или гена, которая охватывает от примерно 25 до примерно 50 последовательных нуклеотидов в любом направлении (то есть 5' или 3') из инициирующего трансляцию кодона. Точно также термины "область стоп-кодона" и "область кодона, терминирующего трансляцию" относятся к части такой мРНК или гена, которая охватывает от примерно 25 до примерно 50 последовательных нуклеотидов в любом направлении (то есть 5' или 3') из терминирующего трансляцию кодона. Соответственно, термины "область стартового кодона" (или "область инициирующего трансляцию кодона") и "область стоп-кодона" и "область кодона, терминирующего трансляцию" означают области, на которые может быть эффективно нацелено антисмысловое соединение согласно данному изобретению.

Открытая рамка считывания (ORF) или "кодирующая область", термин, который, как известно из уровня техники, относится к области между инициирующим трансляцию кодоном и терминирующим трансляцию кодоном, также представляет собой область, на которую может быть эффективно нацелено соединение. В контексте данного изобретения область-мишень является внутригенной областью, охватывающей инициирующий или терминирующий трансляцию кодон открытой рамки считывания (ORF) гена.

Другой областью-мишенью является 5'-нетранслируемая область (5'UTR), которая относится к части мРНК в 5'-направлении от инициирующего трансляцию кодона и поэтому включающая нуклеотиды между 5'-кэп-сайтом и инициирующим трансляцию кодоном мРНК (или соответствующими нуклеотидами гена). Еще одну область-мишень представляет 3'-нетранслируемая область (3'UTR), которая относится к части мРНК в 3'-направлении от терминирующего трансляцию кодона и поэтому включающая нуклеотиды между терминирующим трансляцию кодоном и 3'-концом мРНК (или соответствующими нуклеотид ами гена). 5'-кэп-сайт мРНК включает N7-метилированный остаток гуанозина, присоединенный к 5'-наибольшему остатку мРНК через 5'-5'-трифосфатную связь. Область 5'-кэпа мРНКт включает саму 5'-кэп-структуру, а также первые 50 нуклеотидов, примыкающие к кэп-сайту. Другой областью мишени согласно данному изобретению является кэп-структура.

Хотя некоторые эукариотные транскрипты мРНК транслируются непосредственно, многие содержат одну или более областей, известных как "интроны", которые вырезаются из транскрипта до его трансляции. Оставшиеся (и, следовательно, транслированные) области известны как "экзоны" и они сшиваются вместе с образованием непрерывной последовательности мРНК. Согласно одному из вариантов направленные сайты сплайсинга, а именно, интрон-экзонное сочленение или экзон-интронное сочленение, особенно полезно в ситуациях, когда аберрантный сплайсинг приводит к появлению заболевания или когда чрезмерное образование продукта сплайсинга также связано с возникновением болезни. Аберрантное слияние из-за перегруппировки или делеции является еще одним вариантом целевого сайта.

Транскрипты мРНК, полученные путем сплайсинга двух (или более) мРНК из разных источников генов известны как "транскрипты слияния". Интроны могут быть эффективно нацелены с применением антисмысловых соединений, нацеленных, например, на ДНК или пре-мРНК. Согласно одному из вариантов изобретения антисмысловые олигонуклеотиды связываются с кодирующими и/или некодирующими областями целевого полинуклеотида и модулируют экспрессию и/или функцию молекулы-мишени.

Согласно одному из вариантов антисмысловые олигонуклеотиды связываются с природными антисмысловыми полинуклеотидами и модулируют экспрессию и/или функцию молекулы-мишени.

Согласно одному из вариантов антисмысловые олигонуклеотиды связываются со смысловыми полинуклеотидами и модулируют экспрессию и/или функцию молекулы-мишени.

Альтернативные транскрипты РНК могут быть получены из той же геномной области ДНК. Эти альтернативные транскрипты обычно известны как "варианты". Более конкретно, "варианты пре-мРНК" являются транскриптами, полученными из той же геномной ДНК, которые отличается от других транскриптов, полученных из той же геномной ДНК или их стартовым положением, или стоп-положением и содержат как интронную, так и экзонную последовательность.

После вырезания одной или более экзонной или интронной областей или их частей во время сплайсинга варианты пре-мРНК образуют "варианты мРНК" меньшего размера. Соответственно, варианты мРНК образуют варианты пре-мРНК и каждый единственный в своем роде вариант пре-мРНК всегда должен образовать уникальный вариант мРНК в результате сплайсинга. Эти варианты мРНК известны также как "варианты альтернативного сплайсинга". Если сплайсинг варианта пре-мРНК не происходит, тогда вариант пре-мРНК идентичен варианту мРНК.

Варианты могут быть получены при помощи альтернативных сигналов начала или остановки транскрипции. Пре-мРНК и мРНК могут содержать более одного стартового кодона или стоп-кодона. Варианты, которые происходят из пре-мРНК или мРНК, использующие альтернативные стартовые кодоны, известны как "альтернативные стартовые варианты" этих пре-мРНК или мРНК. Те транскрипты, которые используют альтернативный стоп-кодон, известны как "альтернативные стоп-варианты" этих пре-мРНК или мРНК. Одним специфическим типом альтернативного стоп-варианта является "полиА-вариант", в котором полученные множественные транскрипты получаются в результате альтернативной селекции одного из "полиА-стоп-сигналов" по механизму транскрипции, тем самым образуются транскрипты, которые заканчиваются в уникальных полиА-сайтах. В контексте данного изобретения типы вариантов, описанных в данной заявке, являются также вариантами данного изобретения.

Локализации в нуклеиновой кислоте-мишени, где происходит гибридизация антисмысловых соединений, определяются как по меньшей мере часть целевой области, содержащая по меньшей мере 5 нуклеотидов, на которую направлено активное антисмысловое соединение.

В то время как в данной заявке описаны конкретные последовательности некоторых целевых сегментов, специалисту в данной области является очевидным, что они служат только для целей иллюстрации и описывают конкретные варианты в объеме данного изобретения. Специалисты легко могут идентифицировать другие целевые сегменты с учетом данного описания.

Целевые сегменты длиной 5-100 нуклеотидов, содержащие участок из по меньшей мере пяти (5) последовательных нуклеотидов, выбранных из примерных предпочтительных целевых сегментов, также пригодны для целей данного изобретения.

Целевые сегменты, которые включают последовательности ДНК или РНК, содержащие по меньшей мере пять (5) последовательных нуклеотидов от 5'-конца одного из примерных предпочтительных целевых сегментов (остальные нуклеотиды являются участком той же самой ДНК или РНК, начинающимся сразу же в направлении upstream от 5'-конца целевого сегмента и продолжающегося до тех пор, пока ДНК или РНК не будут содержать от примерно 5 до примерно 100 нуклеотидов). Подобно этому предпочтительные целевые сегменты представлены последовательностями ДНК или РНК, которые содержат по меньшей мере пять (5) последовательных нуклеотидов от 3'-конца одного из примерных предпочтительных целевых сегментов (остальные нуклеотиды являются участком той же самой ДНК или РНК, начинающимся сразу же в направлении downstream от 3'-конца целевого сегмента и продолжающегося до тех пор, пока ДНК или РНК не будут содержать от примерно 5 до примерно 100 нуклеотидов). Специалист в данной области с учетом описанных выше примеров целевых сегментов сможет идентифицировать и другие предпочтительные целевые сегменты.

После того, как одна или более целевых областей, сегментов или сайтов были идентифицированы, выбираются антисмысловые соединения, которые в достаточной степени комплементарны мишени, а именно гибридизуются достаточно легко и с достаточной специфичностью с получением желаемого эффекта.

Согласно некоторым вариантам данного изобретения олигонуклеотиды связываются с антисмысловой цепочкой конкретной цели. Олигонуклеотиды содержат по меньшей мере 5 нуклеотидов и могут быть получены так, что каждый олигонуклеотид нацелен на перекрывающиеся последовательности, чтобы олигонуклеотиды охватывали всю длину целевого полинуклеотида. Мишени включают как кодирующие, так и некодирующие области.

Согласно одному из вариантов предпочтительно нацеливать антисмысловые олигонуклеотиды на целевые конкретные нуклеиновые кислоты. Нацеливание антисмыслового соединения на конкретную нуклеиновую кислоту представляет собой многостадийный процесс. Этот процесс обычно начинается с идентификации последовательности нуклеиновой кислоты, функция которой должна быть модулирована. Это может быть, например, клеточный ген (или мРНК, транскрибированная из этого гена), экспрессия которого связана с определенным заболеванием или расстройством, или некодирующий полинуклеотид, такой как, например, некодирующая РНК (нкРНК).

РНК можно классифицировать на (1) матричные (информационные) РНК (мРНК), которые транслируются в белки и (2) не кодирующие белок РНК (нкРНК). НкРНК включают микроРНК, антисмысловые транскрипты и другие транскрипционные единицы (TU), содержащие высокую плотность стоп-кодонов и не содержащие любой активной "открытой рамки считывания". Оказывается, что многие нкРНК начинаются с инициации сайтов инициации в 3'-нетранслированных областях (3'UTRs) белок-кодирующих локусов. НкРНК часто являются редкими и, по меньшей мере, половина нкРНК, которые были секвенированы международным консорциумом по анализу РНК FANTOM, оказались неаденилированными. Многие исследователи по вполне очевидным причинам сфокусировали свое внимание на полиаденилированных мРНК, которые образуются и экспортируются в цитоплазму. Недавно было установлено, что ряд неаденилированных ядерных РНК может быть очень большим, и что многие такие транскрипты появляются из так называемых внутригенных областей. Механизм, по которому нкРНК могут регулировать экспрессию генов, состоит в спаривании оснований с целевыми транскриптами. РНК, которые функционируют путем спаривания оснований могут быть разделены на группы: (1) цис-кодируемые РНК, которые кодируются в том же самом генетическом положении, но на противоположной к РНК нити они действуют на нее и, следовательно, проявляют превосходную комплементарность к их мишени, и (2) транс-кодируемые РНК, которые кодируются в хромосомах, отличающихся от РНК, на которые они действуют, обычно не обладающие превосходным потенциалом к спариванию оснований с их мишенями.

Не желая ограничиваться какой-либо теорией, полагают, что "нарушение" антисмыслового полинуклеотида антисмысловыми олигонуклеотидами, описанными в данной заявке, может изменить экспрессию соответствующих смысловых информационных РНК. Однако, эта регуляция может быть или дисконкордантной (антисмысловой нокдаун приводит к увеличению информационной РНК) или конкордатной (антисмысловой нокдаун приводит к уменьшению сопутствующей информационной РНК). В этих случаях антисмысловые олигонуклеотиды могут быть нацелены на перекрывающиеся или неперекрывающиеся части антисмыслового транскрипта, что приводит к его нокдауну или секвенированию. Кодирующие, а также некодирующие антисмысловые соединения могут быть нацелены одинаковым образом и любая категория способна к регуляции соответствующих смысловых транскриптов - или конкордантно, или дисконкордантно. Подходы, которые используются при идентификации новых олигонуклеотидов для применения против мишени, могут быть основаны на нокдауне антисмыслового транскрипта РНК антисмысловыми олигонуклеотидами или другими средствами модулирования желаемой мишени.

Подход 1: в случае дисконкордантной регуляции осуществление нокдауна антисмыслового транскрипта повышает экспрессию обычного (смыслового) гена. Если этот последний кодирует известную или предполагаемую мишень-лекарство, тогда нокдаун его антисмысловой части может имитировать действие агониста рецептора или ферментного стимулирующего фактора.

Подход 2: в случае конкордантной регуляции можно сопутствующим образом осуществить нокдаун и антисмысловых, и смысловых транскриптов и тем самым достигнуть синергичного уменьшения экспрессии обычного (смыслового) гена. Если, например, антисмысловой олигонуклеотид применяется для осуществления нокдауна, тогда этот подход может быть использован для нацеливания одного антисмыслового олигонуклеотида на смысловой транскрипт и другого антисмыслового олигонуклеотида на соответствующий антисмысловой транскрипт или один энергетически симметричный антисмысловой олигонуклеотид, который одновременно нацелен на перекрывающиеся смысловой и антисмысловой транскрипты.

В соответствии с данным изобретением антисмысловые соединения включают антисмысловые олигонуклеотиды, рибозимы, олигонуклеотиды с внешними вспомогательными последовательностями, миРНК, соединения одно- и двунитевой РНК-интерференции, такие как миРНК и другие олигомерные соединения, которые гибридизуются с по меньшей мере частью целевой нуклеиновой кислоты и модулируют ее функцию. Как таковые, они могут быть ДНК, РНК, ДНК-подобными олигонуклеотидами и РНК-подобными олигонуклеотидами или их смесями или они могут быть миметиками одного или более указанных выше олигонуклеотидов. Эти соединения могут быть однонитевыми, двунитевыми, кольцевыми или шпилькообразными олигомерными соединениями и могут содержать такие структурные элементы, как внутренние или концевые выпетливания, ошибочные спаривания (мисметчи) или петли.

Антисмысловые соединения обычно получают последовательно, но они могут быть соединены и получены другим путем для образования кольцевой и/или разветвленной структуры. Антисмысловые соединения могут включать конструкты, такие как, например, две нити, гибридизованные с образованием полностью или частично двунитевого соединения или одной нити с достаточной самокомплементарностью для осуществления гибридизации и образования полностью или частично двунитевого соединения. Две нити могут быть соединены внутри, оставляя свободные 3'- или 5'-концы или могут быть соединены с образованием непрерывной шпилькообразной структуры или петли. Шпилькообразная структура может содержать "липкие" нуклеотиды на 3'- или 5'-концах, образующие удлинение однонитевого характера. Двунитевые соединения могут включать "липкие" нуклеотиды на концах. Другие модификации могут включать конъюгированные группы, присоединенные к одному из концов, в выбранных нуклеотидных положениях, положениях сахаров или к одной из внутринуклеозидных связей. Или же две нити могут быть связаны через фрагмент, не являющийся нуклеиновой кислотой, или через группу линкера. При образовании из только одной нити днРНК могут иметь форму самокомплементарной молекулы типа шпильки, которая удваивается сама с образованием дуплекса. Таким образом, днРНК могут быть полностью или частично двунитевыми. Специфическая модуляция экспрессии генов может быть достигнуто путем стабильной экспрессии шпилек днРНК в трансгенных линиях клеток, однако, согласно некоторым вариантам экспрессия генов или функция активируется. При образовании из двух нитей или одной нити, которая принимает форму самокомплементарной молекулы типа шпильки, удваивающейся с образованием дуплекса, две нити (или дуплекс-образующие области одной нити) представляют собой комплементарные нити РНК, в которых спаривание оснований произошло по Уотсону-Крику.

Как только соединения по изобретению вводятся в систему, они могут вызвать действие одного или нескольких ферментов или структурных белков, заключающееся в расщеплении или другой модификации целевой нуклеиновой кислоты или могут действовать по механизму занятости. В общем, нуклеиновые кислоты (включая олигонуклеотиды) могут быть описаны как "ДНК-подобные" (то есть обычно содержащие один или более звеньев 2'-дезоксисахаров, и обычно Т-основания, а не U-основания) или "РНК-подобные" (то есть обычно содержащие один или более звеньев 2'-гидрокси- или 2'-модифицированных сахаров и обычно U-снования, а не Т-основания). Спирали нуклеиновых кислот могут иметь более чем один тип структуры, обычно А- и В-формы. Полагают, что, в общем, олигонуклеотиды, которые имеют В-структуру, являются ДНК-подобными, а олигонуклеотиды, имеющие А-форму, являются РНК-подобными. Согласно некоторым (химерным) вариантам антисмысловое соединение может содержать области как А-формы, так и В-формы.

Согласно одному из вариантов желаемые олигонуклеотиды или антисмысловые соединения содержат, по меньшей мере, одно из следующих соединений: антисмысловую РНК, антисмысловую ДНК, химерные антисмысловые олигонуклеотиды, антисмысловые олигонуклеотиды, содержащие модифицированные связи, интерферирующую РНК (иРНК), короткую (малую) интерферирующую РНК (киРНК), малую интерферирующую РНК (миРНК), малую временную РНК (мвРНК), или короткую шпилькообразную РНК (кшРНК), малые РНК, вызывающие активацию генов (аРНК), малые активирующие РНК (маРНК) или их комбинации. Двунитевая РНК также может активировать экспрессию генов по механизму, который называется "активация генов, вызванная малой РНК", она называется аРНК (активирующая РНК). Двунитевая РНК, нацеленная на промоторы генов, индуцирует сильную транскрипционную активность ассоциированных генов. аРНК использовалась в человеческих клетках с применением синтетических днРНК, называемых "малыми активирующими РНК" (маРНК). В настоящее время не известно, сохраняется ли аРНК в других организмах.

Было установлено, что малые двунитевые РНК (днРНК), такие как короткие интерферирующие РНК (киРНК) и микроРНК (миРНК), запускают эволюционный постоянный механизм, известный как РНК-интерференция (иРНК). Эта иРНК неизменно приводит к сайленсингу (подавлению экспрессии) генов через ремоделирование хроматина с подавлением транскрипции, расщеплением комплементарной мРНК или блокированием трансляции белка. Однако в случаях, описанных подробно в примерах, следующих ниже, было показано, что олигонуклеотиды увеличивают степень экспрессии и/или функцию полинуклеотидов нейтрофического фактора головного мозга (BDNF) и их кодированных продуктов. Двунитевые РНК могут также действовать как малые активирующие РНК (маРНК). Не желая ограничиваться какой-либо теорией, полагают, что путем нацеливания последовательностей в промоторах генов маРНК будут индуцировать экспрессию гена-мишени, явление, которое называется транскрипционной активностью, индуцированной днРНК(аРНК).

Согласно другому варианту "предпочтительные целевые сегменты", идентифицированные в данной заявке, могут быть использованы при скрининге для поиска дополнительных соединений, которые модулируют экспрессию полинуклеотидов нейтрофического фактора головного мозга (BDNF). "Модуляторами" считаются такие соединения, которые уменьшают или увеличивают экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды BDNF и которые содержат по меньшей мере часть, состоящую из 5 нуклеотидов, которая комплементарна предпочтительному целевому сегменту. Способ скрининга включает стадии осуществления контакта предпочтительного целевого сегмента нуклеиновой кислоты, кодирующей смысловые или природные антисмысловые полинуклеотиды BDNF при помощи одного или более модуляторов-кандидатов, и выбора одного или более модуляторов-кандидатов, которые уменьшают или увеличивают экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды BDNF, например, соответствующие SEQ ID NO: 12-49. Однажды было показано, что модулятор-кандидат или модуляторы способны модулировать (или повышать, или снижать) экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды BDNF, затем модулятор может применяться при проведении дальнейших исследований функции полинуклеотидов BDNF или применяться в качестве диагностического, терапевтического, агента или агента для исследований в соответствии с данным изобретением.

Нацеливание природной антисмысловой последовательности предпочтительно модулирует функцию гена-мишени. Например, это может быть ген BDNF. Согласно одному из вариантов антисмысловой олигонуклеотид нацелен на смысловые и/или природные антисмысловые последовательности полинуклеотидов BDNF (например, с номерами доступа NM_170735 и NM_007540), варианты, аллели, изоформы, гомологи, мутанты, производные, фрагменты и их комплементарные последовательности. Предпочтительно, олигонуклеотид представляет собой антисмысловую молекулу, и мишени включают кодирующие и некодирующие области антисмысловых и/или смысловых полинуклеотидов BDNF.

Предпочтительные целевые сегменты согласно данному изобретению могут быть также соединены с их соответствующими комплементарными антисмысловыми соединениями по изобретению с образованием стабилизированных двунитевых (дуплексных) олигонуклеотидов.

Такие фрагменты двунитевых олигонуклеотидов, как было показано в уровне техники, модулируют экспрессию мишени и регулируют трансляцию, а также процессинг РНК по "антисмысловому" механизму. Более того, эти двунитевые фрагменты могут подвергаться химическим модификациям. Например, было показано, что такие двунитевые фрагменты ингибируют мишень путем классической гибридизации антисмысловой нити дуплекса с мишенью, тем самым запуская ферментативное расщепление мишени. Предпочтительно, олигонуклеотид представляет собой антисмысловую молекулу.

Согласно одному из вариантов антисмысловой нуклеотид направлен на полинуклеотида нейтрофического фактора головного мозга (BDNF) (например, с номерами доступа NM_170735 и NM_007540), варианты, аллели, изоформы, гомологи, мутанты, производные, фрагменты и их комплементарные последовательности.

В соответствии с другими вариантами данного изобретения целевая молекула нуклеиновой кислоты не ограничена только одним BDNF, но охватывает его любой полинуклеотидный вариант и любой полинуклеотид, который продуцирует, влияет, воздействует или получается в продукте экспрессии BDNF и/или любой его изоформы или относится к этому продукту.

Согласно одному из вариантов олигонуклеотид нацелен на природную антисмысловую последовательность полинуклеотидов BDNF, например, полинуклеотидов, соответствующих SEQ ID NO: 3-11, их любых вариантов, аллелей, гомологов, мутантов, производных, фрагментов и комплементарных последовательностей. Примеры антисмысловых олигонуклеотидов соответствуют SEQ ID NO: 12-49.

Согласно одному из вариантов олигонуклеотиды комплементарны или связываются с последовательностями нуклеиновых кислот антисенса BDNF, включая, но без ограничения, некодирующие смысловые и/или антисмысловые последовательности, связанные с полинуклеотидами BDNF, и модулируют экспрессию и/или функцию молекул BDNF.

Согласно одному из вариантов олигонуклеотиды комплементарны или связываются с последовательностями нуклеиновых кислот природного антисенса BDNF, соответствующими SEQ ID NO: 3-11, и модулируют экспрессию и/или функцию молекул BDNF.

Согласно одному из вариантов олигонуклеотиды включают последовательности по меньшей мере 5 последовательных нуклеотидов SEQ ID NO: 12-49 и модулируют экспрессию и/или функцию молекул BDNF.

Полинуклеотидные мишени включают BDNF, в том числе члены его семейства, варианты BDNF; мутанты BDNF, включая SNPs; некодирующие последовательности BDNF; аллели BDNF; варианты видов, фрагменты и т.п. Предпочтительно, когда олигонуклеотид представляет собой антисмысловую молекулу.

Согласно одному из вариантов олигонуклеотид, направленный (нацеленный) на полинуклеотиды BDNF, включает антисмысловую РНК, интерферирующую РНК (иРНК), короткую интерферирующую РНК (киРНК), микроинтерферирующую РНК (миРНК), малую временную РНК (мвРНК), или короткую шпилькообразную РНК (кшРНК), малые РНК, вызывающие активацию генов (аРНК), малые активирующие РНК (маРНК).

Согласно одному из вариантов нацеливание на полинуклеотиды нейтрофического фактора головного мозга (BDNF), например, соответствующие SEQ ID NO: 3-55, приводит к модулированию экспрессии и/или функции этих целей (мишеней). Согласно одному из вариантов экспрессия или функция активируются (положительно регулируются) по сравнению с контролем. Согласно одному из вариантов экспрессия или функция подавляются (отрицательно регулируются) по сравнению с контролем.

Согласно одному из вариантов антисмысловые соединения включают последовательности соответствующие SEQ ID NO: 12-49. Эти нуклеотиды могут включать один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п.

Согласно одному из вариантов SEQ ID NO: 12-49 содержат одну или более нуклеотидов LNA. В Таблице 1 приведен перечень антисмысловых олигонуклеотидов, которые могут применяться при осуществлении способов согласно данному изобретению.

Модуляция желаемой целевой нуклеиновой кислоты может быть осуществлена несколькими путями, известными из уровня техники. Например, антисмысловые олигонуклеотиды, киРНК и т.п., биокаталитические нуклеиновые кислоты (например, рибозимы) являются молекулами нуклеиновой кислоты, способными катализировать одну или более различных реакций, включая способность повторного расщепления других отдельных молекул нуклеиновой кислоты в нуклеотидном основании последовательность-специфичным образом. Такие каталитические нуклеиновые кислоты могут быть использованы для нацеливания на практически любой транскрипт РНК.

Благодаря их специфичности к последовательностям транс-расщепляющие биокаталитические нуклеиновые кислоты являются обещающими терапевтическими агентами для лечения заболеваний у людей. Биокаталитические нуклеиновые кислоты могут быть сконструированы так, чтобы они расщепляли специфические РНК-мишени в фенотипе клеточной РНК. Такое расщепление делает мРНК нефункциональной и прекращает экспрессию белка из этой РНК. Таким образом, синтез белка, связанного с болезненным состоянием, может селективно ингибироваться.

В общем, биокаталитические нуклеиновые кислоты с активностью расщеплять РНК действуют путем первого связывания с РНК-мишенью. Такое связывание происходит через часть биокаталитической нуклеиновой кислоты, связывающую РНК-мишень. Таким образом, биокаталитическая нуклеиновая кислота вначале распознает и затем связывает целевую РНК через спаривание комплементарных оснований и, будучи связанной с правильным сайтом, действует ферментативно, "разрезая" целевую РНК. Стратегически важное расщепление такой целевой РНК разрушает ее способность направлять синтез кодированного белка. После того, как биокаталитическая нуклеиновая кислота связала и расщепила целевую РНК, она высвобождается из этой РНК для поиска другой цели и может повторно связывать и расщеплять новые мишени.

Несколько подходов, таких как выбор in vitro (Orgel, (1979) Proc. R. Soc. London, В 205, 435), были использованы для выявления новых каталитических нуклеиновых кислот, способных катализировать различные реакции, такие как расщепление и лигирование фосфородиэфирных связей и амидных связей. Получение рибозимов, которые являются оптимальными по каталитической активности, будет значительным прогрессом в развитии любого подхода, который использует рибозимы, расщепляющие РНК с целью регуляции экспрессии генов. Например, рибозим типа "головки молотка" действует с каталитической скоростью (константой скорости ферментативной реакции) равной примерно 1 мин-1 в присутствии насыщающих (10 мМ) концентраций Mg2+-кофактора. Как было показано, рибозим "РНК-лигаза" катализирует соответствующую реакцию самомодификации со скоростью около 100 мин-1. Кроме того, известно, что некоторые модифицированные рибозимы типа "головки молотка", которые имеют субстрат со связывающими плечами, состоящими из ДНК, катализируют расщепление РНК со скоростями, которые приближаются к величине 100 мин-1. Наконец, замещение определенного остатка каталитическим ядром "головки молотка" некоторыми нуклеотидными аналогами приводит к получению модифицированных рибозимов, которые характеризуются 10-кратным увеличением скорости каталитической реакции. Эти факты демонстрируют, что рибозимы могут ускорять химические превращения с каталитическими скоростями, которые значительно больше, чем скорости, проявляемые in vitro большинством природных саморасщепляющихся рибозимов. Возможно, что структуры некоторых саморасщепляющихся рибозимов могут быть оптимизированы с получением максимальной каталитической активности или что могут быть получены полностью новые фрагменты РНК, которые обладают значительно большими скоростями при расщеплении фосфодиэфирных связей РНК.

Внутримолекулярное расщепление РНК-субстрата каталитической РНК, которое соответствует модели "головки молотка", впервые было описано в 1987 г (Uhlenbeck, О.С. (1987) Nature, 328: 596-600). Каталитическая РНК была выделена и реагировала со многими молекулами РНК, показывая, что она действительно является каталитической.

Каталитические РНК, сконструированные на основе фрагмента "головки молотка", использовали для расщепления специфических целевых последовательностей путем соответствующих изменений оснований в каталитической РНК для сохранения необходимого спаривания оснований с целевыми последовательностями. Это позволило применять каталитическую РНК для расщепления целевых последовательностей и показало, что сконструированные в соответствии с моделью "головки молотка" каталитические РНК могут расщеплять специфический субстрат РНК in vivo.

Интерферирующая РНК стала мощным оружием для модуляции экспрессии генов у млекопитающих и в клетках млекопитающих. Этот подход требует доставки коротких интерферирующих РНК (киРНК) или самой РНК или ДНК с применением экспрессионной плазмиды или вируса и кодирующей последовательности для малых шпилькообразных РНК, которые процессируются в миРНК. Эта система обеспечивает эффективный транспорт пре-миРНКв цитоплазму, где они являются активными и позволяют использовать регулируемые промоторы и промоторы, специфичные для тканей, для экспрессии генов.

Согласно одному из вариантов олигонуклеотид или антисмысловое соединение представляет собой олигомер или полимер рибонуклеиновой кислоты (РНК) и/или дезоксирибонуклеиновой кислоты (ДНК) или их миметик, химеру, аналог или гомолог. Этот термин включает олигонуклеотиды, состоящие из нуклеотидов природного происхождения, сахаров и ковалентных внутринуклеозидных (в остове) связей, а также олигонуклеотиды, содержащие участки неприродного происхождения, которые функционируют подобным образом.

Такие модифицированные или замещенные олигонуклеотиды часто более желательны, чем их нативные формы из-за желательных свойств, таких как, например, клеточное поглощение, повышенное сродство к целевой нуклеиновой кислоте и повышенная стабильность в присутствии нуклеаз.

В соответствии с данным изобретением олигонуклеотиды или "антисмысловые соединения" включают антисмысловые олигонуклеотиды (например, РНК, ДНК, их миметик, химерное соединение, аналог или гомолог, рибозимы, олигонуклеотиды с внешними вспомогательными последовательностями (EGS), РНК, однонитевые или двунитевые интерферирующие РНК (иРНК), такие как киРНК, кaРНК (короткая активирующая РНК), аРНК, и другие олигомерные соединения, которые гибридизуются с по меньшей мере частью целевой нуклеиновой кислоты и модулируют ее функцию.

Как таковые, они могут быть ДНК, РНК, ДНК-подобными, РНК-подобными или их смесями или могут быть миметиками одного или более этих соединений. Эти соединения могут быть однонитевыми, двунитевыми, кольцевыми или шпилькообразными олигомерными соединениями и могут содержать структурные элементы, такие как внутренние или концевые выпетливания, ошибочное спаривание оснований или петли.

Обычно получают линейные антисмысловые соединения, но они могут быть соединены или получены другим образом с получением кольцевой и/или разветвленной структуры. Антисмысловые соединения могут включать конструкты, такие как, например, две нити, которые гибридизованы с образованием полностью или частично двунитевого соединения или однонитевого соединения с достаточной самокомплементарностью, чтобы осуществлялась гибридизация и образование полностью или частично двунитевого соединения. Две нити могут быть соединены внутри, при этом 3'- или 5'-конец остаются свободными или они могут быть соединены с образованием непрерывной шпилькообразной структуры или петли. Шпилькообразная структура может содержать "липкий" конец или в положении 5' или в положении 3', образуя незамкнутую однонитевую цепь. Двунитевые соединения могут включать "липкие" концевые нуклеотиды. Другие модификации могут включать сопряженные группы, присоединенные к одному из концов, выбранным нуклеотидным положениям, положениям сахарных звеньев или к одной из внутринуклеозидных связей. Или же две нити могут быть соединены через фрагмент не нуклеиновой кислоты или через линкерную группу. Когда днРНК образованы только одной нитью, они могут принимать форму самокомплементарной шпилькообразной молекулы, которая сама удваивается с образованием дуплекса. Таким образом, днРНК могут быть полностью или частично двунитевыми. Специфическая модуляция экспрессии гена может быть достигнуто путем стабильной экспрессии днРНК со шпилькообразной структурой в клетках трансгенных линий. Если образование произошло из двух нитей или из одной нити, которая принимает форму самокомплементарной молекулы шпилькообразного типа, которая сама удваивается с образованием дуплекса, две нити (или дуплекс-образующие области одной нити) являются комплементарными нитями РНК, в которых спаривание оснований происходит по Уотсону-Крику.

Будучи введенными в биологическую систему, соединения по изобретению могут вызывать действие одного или более ферментов или структурных белков, состоящее в расщеплении или другой модификации целевой нуклеиновой кислоты или могут действовать по механизму занятости.

В общем, нуклеиновые кислоты (включая олигонуклеотиды) могут быть описаны как "ДНК-подобные" (то есть обычно содержащие одно или более звеньев 2'-дезоксисахаров и обычно Т-основания, а не U-основания) или "РНК-подобные" (а именно, обычно содержащие одно или более звеньев 2'-гидроксилсодержащих или 2'-модифицированных сахаров и обычно U-основания, а не Т-основания).

Спирали нуклеиновых кислот могут принимать более одного вида структуры, наиболее часто А- и В-формы. Полагают, что в общем олигонуклеотиды, которые имеют структуру В-формы, являются "ДНК-подобными" и те, которые имеют структуру А-формы, являются "РНК-подобными". Согласно некоторым (химерным) вариантам антисмысловое соединение может содержать участки А- и В-формы.

Антисмысловые соединения в соответствии с настоящим изобретением могут содержать антисмысловую часть длиной от примерно 5 до примерно 80 нуклеотидов (то есть от примерно 5 до примерно 80 связанных нуклеотидов). Это относится к длине антисмысловой нити или части антисмыслового соединения. Другими словами, однонитевое антисмысловое соединение по изобретению содержит от 5 до примерно 80 нуклеотидов, а двунитевое антисмысловое соединение по изобретению (такое как, например, днРНК содержит смысловую и антисмысловую нить или часть длиной от 5 до примерно 80 нуклеотидов. Специалисту в данной области очевидно, что это охватывает антисмысловые части длиной 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 нуклеотидов или любой интервал из этих чисел.

Согласно одному из вариантов антисмысловые соединения согласно данному изобретению имеют антисмысловые элементы длиной от 10 до 50 нуклеотидов. Специалисту в данной области очевидно, что они охватывают олигонуклеотиды, содержащие антисмысловые части длиной 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 нуклеотидов или любой интервал из этих чисел. Согласно некоторым вариантам длина олигонуклеотидов равна 15 нуклеотидов. Согласно одному из вариантов антисмысловые или олигонуклеотидные соединения по изобретению имеют антисмысловые части длиной от 12 или 13 до 30 нуклеотидов. Специалисту в данной области очевидно, что они охватывают олигонуклеотиды, содержащие антисмысловые части длиной 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов или любой интервал из этих чисел.

Согласно одному из вариантов олигомерные соединения согласно настоящему изобретению включают также варианты, в которых другое основание находится в одном или более положениях нуклеотидов в этом соединении. Например, если первый нуклеотид представляет собой аденозин, могут быть получены варианты, которые в этом положении содержат тимидин, гуанозин или цитидин. Это может быть сделано в любом положении антисмыслового соединения или днРНК. Затем эти соединения испытывают при помощи методов, описанных в данной заявке, для определения их способности ингибировать экспрессию целевой нуклеиновой кислоты.

Согласно некоторым вариантам степень гомологичности, идентичности последовательностей или комплементарности между антисмысловым соединением и мишенью составляет от примерно 40% до примерно 60%. Согласно некоторым вариантам степень гомологичности, идентичности последовательностей или комплементарности между антисмысловым соединением и мишенью составляет от примерно 60% до примерно 70%. Согласно некоторым вариантам степень гомологичности, идентичности последовательностей или комплементарности между антисмысловым соединением и мишенью составляет от примерно 70% до примерно 80%. Согласно некоторым вариантам степень гомологичности, идентичности последовательностей или комплементарности между антисмысловым соединением и мишенью составляет от примерно 80% до примерно 90%. Согласно некоторым вариантам степень гомологичности, идентичности последовательностей или комплементарности составляет примерно 90%, примерно 92%, примерно 94%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100%.

Согласно одному из вариантов антисмысловые олигонуклеотиды, такие как, например, нуклеиновые кислоты, соответствующие SEQ ID NO: 12-49, содержат одну или более замен или модификаций. Согласно одному из вариантов нуклеотиды заменены закрытыми (замкнутыми) нуклеиновыми кислотами (LNA).

Согласно одному из вариантов данного изобретения олигонуклеотиды нацелены на одну или более областей смысловых и/или антисмысловых кодирующих и/или некодирующих последовательностей в молекулах нуклеиновых кислот, связанных с BDNF, и последовательностей, соответствующих SEQ ID NO: 1-11.

Некоторые предпочтительные олигонуклеотиды по изобретению представляют собой химерные олигонуклеотиды. "Химерные олинонуклеотиды" или "химеры" в контексте данного изобретения являются олигонуклеотидами, которые содержат две или более химически отличающихся областей, каждая из которых состоит из по меньшей мере одного нуклеотида. Эти олигонуклеотиды обычно содержат по меньшей мере одну область модифицированных нуклеотидов, которая придает одно или более благоприятных свойств (таких как, например, повышенная устойчивость к нуклеазам, повышенное поглощение в клетках, повышенное сродство к связыванию с мишенью), и область, которая представляет собой субстрат для ферментов, способных расщеплять гибриды РНК:ДНК или РНК:РНК. Например, РНаза Н является клеточной эндонуклеазой, которая расщепляет нить РНК дуплекса РНК:ДНК. Следовательно, активация РНазы приводит к расщеплению целевой РНК, тем самым значительно повышая эффективность антисмыслового модулирования экспрессии генов. Соответственно, сравнимые результаты часто могут быть получены с более короткими олигонуклеотидами, когда применяются химерные олигонуклеотиды, по сравнению с фосфоротиоатными дезоксиолигонуклеотидами, гибридизующимися с той же самой целевой областью. Расщепление целевой РНК можно легко обнаружить методом гелевого электрофореза и, если это необходимо, методами гибридизации ассоциированных нуклеиновых кислот, известными из уровня техники. Согласно одному из вариантов химерный олигонуклеотид содержит, по меньшей мере, одну область, модифицированную для повышения сродства к связыванию с мишенью, и обычно область, которая действует в качестве субстрата для РНазы Н. Сродство олигонуклеотида к мишени (в этом случае нуклеиновая кислота, кодирующая ген ras) обычно определяется путем измерения Tm (температуры плавления) пары олигонуклеотид/мишень, которая является температурой, при которой олигонуклеотид и мишень диссоциируют, и диссоциация обнаруживается методом спектрофотометрии. Чем выше Tm, тем больше сродство олигонуклеотида к мишени.

Химерные антисмысловые соединения согласно данному изобретению могут быть образованы в виде композитных структур двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеозидов и/или олигонуклеотидов-миметиков, как описано выше. Такие соединения также называются в уровне техники гибридами или гэпмерами. Получение таких гибридных структур описано в ряде патентов США, которые включают, но без ограничения, патенты США №№5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356 и 5,700,922, каждый из которых включен в данную заявку посредством отсылки.

Согласно одному из вариантов область олигонуклеотида, которая является модифицированной, содержит по меньшей мере один нуклеотид, модифицированный в 2'-положении сахара, наиболее предпочтительно, 2'-О-алкил-, 2'-O-алкил-O-алкил или 2'-фтор-модифицированный нуклеотид. Согласно другому варианту модификации РНК включают 2'-фтор, 2'-амино и 2'-O-метильную модификации в рибозном фрагменте пиримидинов, основных остатках или в инвертированном основании на 3'-конце РНК. Такие модификации обычно вводятся в олигонуклеотиды, и эти олигонуклеотиды, как было установлено, имеют более высокую Tm (то есть большее сродство к связыванию с данной мишенью), чем 2'-дезоксиолигонуклеотиды. Эффект такого повышенного сродства состоит в значительно более сильном ингибировании иРНК экспрессии генов. РНаза Н представляет собой клеточную эндонуклеазу, которая расщепляет РНК-нить дуплексов РНК:ДНК; следовательно, активация этого фермента приводит к расщеплению целевой РНК и, таким образом, может в значительной степени повысить эффективность ингибирования и РНК. Расщепление целевой РНК можно продемонстрировать при помощи гелевого электрофореза. Согласно одному из вариантов химерный олигонуклеотид также модифицируют для повышения устойчивости к нуклеазе. Клетки содержат различные экзо- и эндонуклеазы, которые могут расщеплять нуклеиновые кислоты. Было показано, что ряд нуклеотидных и нуклеозидных модификаций позволяют получить олигонуклеотид, в который они вводятся, который является более устойчивым к нуклеазам, чем нативный олигодезоксинуклеотид. Устойчивость к нуклеазам обычно определяется путем инкубации олигонуклеотидов с клеточными экстрактами или растворами изолированной нуклеазы и измерения количества оставшегося со временем интактного олигонуклеотида, обычно методом гелевого электрофореза. Олигонуклеотиды, которые были модифицированы для повышения их устойчивости, выживают интактными в течение более длинного периода времени, чем немодифицированные олигонуклеотиды. Были осуществлены различные модификации олигонуклеотидов, которые, как было показано, повышают или придают устойчивость к нуклеазам. Олигонуклеотиды, которые содержат по меньшей мере одну фосфоротиоатную модификацию в настоящее время являются наиболее предпочтительными. В некоторых случаях модификации олигонуклеотидов, которые увеличивают сродство к связыванию с мишенью, также способны независимо повышать устойчивость к нуклеазам.

Конкретные примеры некоторых предпочтительных олигонуклеотидов, предусмотренных данным изобретением, включают олигонуклеотиды, содержащие модифицированный остов, например, фосфоротиоатные, фосфотриэфирные, метилфосфонатные мостики, короткоцепочечные алкильные или циклоалкильные звенья внутри сахаров или короткоцепочечные гетероатомные или гетероциклические звенья внутри сахаров. Наиболее предпочтительными являются олигонуклеотиды с фосфоротиоатными остовами и олигонуклеотиды с остовами, содержащими гетероатомы, в частности, СН2-NH-О-СН2, СН-N(СН3)-O-СН2 [известными как метилен- (метилимино)-содержащие остовы или остовы MMI], СН2-O-N(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2 и O-N(CH3)-CH2-CH2 остовами, в которых нативный фосфодиэфирный остов представлен как О-Р-О-СН.

Предпочтительными являются амидные остовы, описанные De Mesmaeker et al. (1995) Асс. Chem. Res. 28: 366-374. Предпочтительны также олигонуклеотиды, имеющие морфолиновые остовы (Summerton and Weller, U.S. Pat. No. 5,034,506). Согласно другому варианту как и остов пептидильной нуклеиновой кислоты (ПНК), фосфодиэфирный остов олигонуклеотида заменяется полиамидным остовом, при этом нуклеотиды связаны непосредственно или косвенно с аза-атомами азота полиамидного остова.

Олигонуклеотиды могут также один или более замещенных фрагментов сахаров. Предпочтительные олигонуклеотиды содержат в 2'-положении одну из следующих групп: ОН, SH, SCH3, F, OCN, ОСН3, O(CH2)nCH3, O(CH2)nNH2 или O(СН2)nCH3, где n равен от 1 до примерно 10; C110 низший алкил, алкоксиалкокси, замещенный низший алкил, алкарил или аралкил; Cl; Br; CN; CF3, OCF3; О-, S- или N-алкил; О-, S- или N-алкенил; SOCH3; SO2 СН3; ONO2; NO2; N3; NH2; гетероциклоалкил; гетероциклоалкарил; аминоалкиламино; полиалкиламино; замещенный силил; группу, расщепляющую РНК; репортерную группу, группу интеркалятора, группу для улучшения фармакокинетических свойств олигонуклеотида; или группу для улучшения фармакодинамических свойств олигонуклеотида и другие заместители, имеющие похожие свойства

Предпочтительной модифицирующей группой (мостиком) является 2'-метоксиэтокси [2'-O-СН2-СН2ОСН3, известная также как 2'-O-(2-метоксиэтил)]. Другие предпочтительные модифицирующие группы включают 2'-метокси (2'-O-СН3), 2'-пропокси (2'-ОСН2СН2СН3) и 2'-фтор (2'-F). Похожие модификации могут быть осуществлены в других положениях олигонуклеотида, в частности, в 3'-положении сахарного звена 3'-концевого нуклеотида и 5'-положении 5'-концевого нуклеотида. Олигонуклеотиды могут включать звенья миметиков сахаров, такие как циклобутильные группы, вместо пентафуранозильных групп.

Олигонуклеотиды могут также включать, дополнительно или альтернативно, модификации или замены нуклеоснования (часто называемого просто "основанием") Применяемые в данной заявке термины "немодифицированные" или "природные" нуклеотиды включают аденин (А), гуанин (G), тимин (Т), цитозин (С) и урацил (U). Модифицированные нуклеотиды включают нуклеотиды, встречающиеся нечасто или случайно в природных нуклеиновых кислотах, например, гипоксантин, 6-метиладенин, 5-Ме-пиримидины, особенно 5-метилцитозин (называемый также 5-метил-2'-дезоксицитозин и часто называемый 5-Ме-С), 5- гидроксиметилцитозин (НМС), гликозил-НМС и гентобиозил-НМС, а также синтетические нуклеотиды, например, 2-аминоаденин, 2-(метиламино)аденин, 2-(имидазолилалкил)аденин, 2-(аминоалкиламино)аденин или другие гетерозамещенные алкил аденины, 2-тиоурацил, 2-тиотимин, 5-бромурацил, 5-гидроксиметилурацил, 8-азагуанин, 7-деазагуанин, N6 (6-аминогексил)аденин и 2,6-диаминопурин. "Универсальным" основанием, известным из уровня техники, является, например, инозин. 5-Ме-С-замены, как было показано, повышают стабильность дуплекса нуклеиновой кислоты на 0.6-1.2°С и являются в настоящее время предпочтительными заменами оснований.

Другой вид модификаций олигонуклеотидов согласно данному изобретению включает химическое присоединение к олигонуклеотиду одного или более фрагмента или конъюгата, которые повышают активность или клеточное поглощение олигонуклеотида.

Такие фрагменты включают, но без ограничения, липидные звенья, такие как звено холестерина, звено холестерила, алифатической цепочки, например, остатка додекандиола или ундецильного остатка, полиамина или полизтиленгликоля или адамантануксусной кислоты. Олигонуклеотиды, содержащие липофильные фрагменты, и способы получения таких олигонуклеотидов известны из уровня техники, см., например, патенты США №№5,138,045, 5,218,105 и 5,459,255.

Не требуется, чтобы все положения олигонуклеотида были равным образом модифицированы, в действительности в один нуклеотид или даже в один нуклеозид в олигонуклеотиде может быть включена более чем одна из вышеуказанных модификаций. Настоящее изобретение включает также олигонуклеотиды, которые являются химерными олигонуклеотидами по определению, данному выше в данной заявке.

Согласно другому варианту молекула нуклеиновой кислоты по настоящему изобретению конъюгирована с другой молекулой, включая, но без ограничения, нуклеотиды с удаленными азотистыми основаниями, простые полиэфиры, полиамины, полиамиды, пептиды, углеводы (сахара), липиды или полиуглеводороды. Специалисты в данной области техники понимают, что эти молекулы могут быть связаны с одной или более любых нуклеотидных молекул в нескольких положениях по углеводной, основной или фосфатной группе.

Олигонуклеотиды, применяемые в соответствии с данным изобретением, удобно получать хорошо известным стандартным методом твердофазного синтеза. Оборудование для такого синтеза продается несколькими компаниями, включая компанию Applied Biosystems. Можно также применять любые другие методы этого синтеза; фактически применяемый метод синтеза нуклеотидов определяется специалистом в данной области техники. Также хорошо изучено применение аналогичных методов для получения других олигонуклеотидов, таких как фосфоротиоаты и алкилированные производные. Также хорошо известно применение аналогичных методов и коммерчески доступных продуктов на основе модифицированных амидитов и стекла с контролируемыми порами (CPG), таких как модифицированные биотином, флуоресцеином или псораленом амидиты и/или CPG (выпускаемые Glen Research, Sterling VA), для синтеза флуоресцентно меченных, биотинилированных или других модифицированных олигонуклеотидов, таких как холестерин-модифицированные олигонуклеотиды.

Согласно настоящему изобретению модификации, например, модификации с помощью мономеров LNA (закрытой ("запертой") нуклеиновой кислоты), применимы для увеличения активности, специфичности и продолжительности действия и расширения способов введения олигонуклеотидов, содержащих современные химические структуры, такие как МОЕ, ANA, FANA, PS и т.д. Это можно осуществить заменой некоторых мономеров в имеющихся олигонуклеотид ах на LNA мономеры. LNA-модифицированный олигонуклеотид может иметь размер (длину), аналогичный(ую) размеру (длине) исходного соединения, или может быть больше или, предпочтительно, меньше. Предпочтительно, чтобы такие LNA-модифицированные олигонуклеотиды содержали меньше, примерно, 70%, более предпочтительно, меньше, примерно, 60%, наиболее предпочтительно, меньше, примерно, 50% LNA-мономеров и чтобы их длина была примерно от 5 до 25 нуклеотидов, более предпочтительно, примерно от 12 до 20 нуклеотидов.

Предпочтительные модифицированные олигонуклеотиды включают, но без ограничения, фосфоротиоаты, хиральные фосфоротиоаты, фосфородитиоаты, триэфиры фосфорной кислоты, триэфиры аминоалкилфосфорной кислоты, метил- и другие алкил-фосфонаты, включая 3'алкиленфосфонаты, и хиральные фосфонаты, фосфинаты, фосфорамидаты, включая 3'-аминофосфорамидат и аминоалкилфосфорамидаты, тионофосфорамидаты, тионоалкилфосфонаты, триэфиры тионоалкилфосфорных кислот (тионоалкилфосфотриэфиры) и боранофосфаты, имеющие нормальное 3'-5' связывание, их 2'-5' связанные аналоги, и аналоги, имеющие обращенную полярность, в которых связывание соседних пар нуклеозидных звеньев происходит 3'-5' с 5'-3' или 2'-5' с 5'-2'. Также изобретение включает различные соли, смешанные соли и свободные кислоты.

Типичные патенты США, в которых описывается получение вышеуказанных фосфорсодержащих звеньев, включают, но без ограничения, патенты США №№3,687,808; 4,469,863; 4,476,301; 5,023,243; 5, 177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563, 253; 5,571,799; 5,587,361; и 5,625,050, описание каждого из которых включено в настоящее изобретение посредством отсылки.

Остов (скелет) предпочтительных модифицированных олигонуклеотидов, которые не включают атом фосфора, образуется посредством межнуклеозидных мостиков (звеньев) между короткоцепными алкильными или циклоалкильными группами, посредством смешанных межнуклеозидных мостиков между гетероатомами и алкильными или циклоалкильными группами, или посредством коротких межнуклеозидных связей между гетероатомами или гетероциклическими фрагментами нуклеозидов. Эти остовы олигонуклеотидов включают звенья скелета из морфолиногрупп (образующихся, частично, при участии углеводного фрагмента нуклеозида); силоксановые звенья (группы); звенья из сульфидных, сульфоксидных и сульфоновых групп; формацетильные и тиоформацетильные звенья; метиленформацетильные и тиоформацетильные звенья; алкенсодержащие звенья; сульфаматные звенья; звенья из метилениминогрупп и метиленгидразиногрупп; сульфонатные и сульфонамидные звенья; амидные звенья; и другие звенья скелета, имеющие участки, содержащие смешанные N, О, S и СН2 компоненты.

Типичные патенты США, в которых описывается получение вышеуказанных олигонуклеозидов, включают, но без ограничения, патенты США №№5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623, 070; 5,663,312; 5,633,360; 5,677,437; и 5,677,439, описание каждого из которых включено в настоящее изобретение посредством отсылки.

В других предпочтительных миметиках олигонуклеотидов как углеводная, так и межнуклеозидная связь, т.е. фрагмент (скелета, остова) нуклеотидного звена, заменены на новые группы. (Азотистые) основания сохраняются для гибридизации с соответствующим соединением-мишенью нуклеиновой кислоты. Одно такое олигомерное соединение, миметик олигонуклеотида, который, как было показано, обладает превосходными свойствами гибридизации, называется пептидо-нуклеиновой кислотой (PNA, ПНК). В соединениях PNA углеводный фрагмент скелета олигонуклеотида заменен на амидсодержащий фрагмент, в частности, на амноэтилглициновый фрагмент. Нуклеотидные основания сохраняются и связываются, непосредственно или опосредованно, с атомами азота амидного фрагмента (звена) скелета. Типичные патенты США, в которых описывается получение PNA, включают, но без ограничения, патенты США №№5,539,082; 5,714,331; и 5,719,262, описание каждого из которых включено в настоящее изобретение посредством отсылки. Другие сведения о PNA можно найти в статье Nielsen, et al. (1991) Science 254, 1497-1500.

Согласно одному варианту изобретения олигонуклеотиды с фосфоротиоатными звеньями (в скелете) и олигонуклеотиды с гетероатомами в скелете, и в частности, содержащие звенья (мостики) -CH2-NH-O-CH2-, -CH2-N(СН3)-O-СН2-, известны как олигонуклеотиды с метиленовыми (метилимино)- звеньями (мостиками) или MMI-звеньями в скелете (каркасе),- CH2-O-N(CH3)-CH2-, -CH2N(CH3)-N(CH3)СН2- и -O-N(CH3)-CH2-CH2-, где нативные фосфодиэфирные группы в скелете представлены как группы -O-Р-O-СН2- в вышеуказанном патенте США №5,489,677, а амидные звенья в скелете представлены в патенте США №5,602,240. Также предпочтительны олигонуклеотиды, имеющие структуру, содержащую в скелете морфолиновые звенья, представленные в вышеуказанном патенте США №5,034,506.

Модифицированные олигонуклеотиды могут также содержать один или более замещенных углеводных фрагментов (фрагментов сахаров). Предпочтительные олигонуклеотиды содержат одну из следующих групп в положении 2': ОН; F; О-, S- или N-алкил; О-, S- или N-алкенил; О-, S- или N-алкинил; или О алкил-О-алкил, где алкил, алкенил или алкинил может представлять собой замещенный или не замещенный С-СО алкил или С210 алкенил или алкинил. Особенно предпочтительными группами являются О(СН2)nOmCH3, O(CH2)n, OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2 и O(CH2)nON(CH3)2, где n и m могут иметь значение от 1 примерно до 10. Другие предпочтительные олигонуклеотиды содержат в положении 2' одну или более следующих групп: С-СО, низший алкил, замещенный низший алкил, алкарил (алкиларил), аралкил, О-алкарил, О- аралкил, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкил, гетероциклоалкарил, аминоалкиламино, полиалкиламино, замещенную силильную группу, группу, расщепляющую РНК, "репортерную" группу, интеркалятор, группу для улучшения фармакокинетических свойств олигонуклеотида или группу для улучшения фармакодинамических свойств олигонуклеотида и другие заместители, обладающие аналогичными свойствами. Предпочтительная модификация содержит группу 2'-метоксиэтокси (2'-О-СН2СН2ОСН3, также известную как 2'-O-(2-метоксиэтил) или 2'-МОЕ), т.е. алкоксиалкоксигруппу. Другая предпочтительная модификация содержит группу 2'-диметиламинооксизтокси, т.е. группу O(CH2)2ON(CH3)2, также известную как группа 2'-DMAOE, описанную в представленных ниже примерах, и группу 2'-диметиламинозтоксиэтокси (также известную из уровня техники как 2'-O-диметиламиноэтоксиэтильная группа, или 2'-DMAEOE), т.е. группу 2'-O-CH2-O-CH2-N(СН2)2.

Другие предпочтительные модификации содержат группы 2'-метокси (2'-OCH3), 2'-аминопропокси (2'-OCH2CH2CH2NH2) и 2'-фтор (2'-F). Аналогичные модификации можно сделать в других положениях олигонуклеотида, в частности, в положении 3' углевода 3' концевого нуклеотида или в 2'-5'связанных олигонуклеотид ах и положении 5' 5' концевого нуклеотида. Олигонуклеотиды могут также иметь миметики углеводов (сахаров), такие как циклобутильные фрагменты вместо пентофуранозильного сахара. Типичные патенты США, в которых описывается получение таких структур с модифицированным углеводным фрагментом, включают, но без ограничения, патенты США №№4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; и 5,700,920, описание каждого из которых включено в настоящее изобретение посредством отсылки.

Олигонуклеотиды могут также содержать модификации или замены нуклеинового (азотистого) основания (часто в уровне техники называемого просто "основанием"). В данном контексте "немодифицированные" или "природные" нуклеотиды содержат пуриновые основания аденин (А) и гуанин (G) и пиримидиновые основания тимин (Т), цитозин (С) и урацил (U). Модифицированные нуклеотиды представляют собой другие синтетические и природные нуклеотиды, такие как 5-метилцитозин (5-me-С), 5-гидроксиметилцитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метильные и другие алкильные производные аденина и гуанина, 2-пропильные и другие алкильные производные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галогенурацил и 5-галогенцитозин, 5-пропинилурацил и 5-пропинилцитозин, 6-азоурацил, 6-азоцитозин и 6-азотимин, 5-урацил (псевдоурацил), 4-тиоурацил, 8-галоген, 8-амино, 8-тиол, 8-тиоалкил, 8-гидроксил и другие 8-замещенные аденины и гуанины, 5-галоген, в особенности 5-бром, 5-трифторметил и другие 5-замещенные урацилы и цитозины, 7-метилгуанин и 7-метиладенин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин и 3-деазагуанин и 3-деазааденин.

Также нуклеотиды включают нуклеотиды, раскрываемые в патенте США №3,687,808, нуклеотиды, описанные в краткой энциклопедии 'The Concise Encyclopedia of Polymer Science And Engineering', pp.858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, нуклеотиды, описанные в статье Englisch et al., 'Angewandle Chemie, International Edition', 1991, 30, p.613, и нуклеотиды, описанные Sanghvi, Y.S., Chapter 15, Antisense Research and Applications', pp. 289-302, Crooke, S.T. and Lebleu, B. ed., CRC Press, 1993. Некоторые из этих нуклеотидов особенно применимы для повышения аффинности связывания олигомерных соединений по изобретению. Эти нуклеотиды содержат 5-замещенные пиримидины, 6-азапиримидины и N-2, N-6 и 0-6 замещенные пурины, включая 2-аминопропиладенин, 5- пропинилурацил и 5-пропинилцитозин. Было показано, что замены на 5-метилцитозин повышают стабильность нуклеотидных дуплексов на 0.6-1.2°С (Sanghvi, Y.S., Crooke, S.T. and Lebleu, В., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp.276-278), и в настоящее время эти замены являются предпочтительными заменами оснований, а в сочетании с 2'-O-метоксильными модификациями сахаров (углеводов) они являются еще более предпочтительными заменами.

Типичные патенты США, в которых описывается получение вышеуказанных модифицированных нуклеотидов, а также других модифицированных нуклеотидов, включают, но без ограничения, патенты США №№3,687,808, а также 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692 и 5,681,941, каждый из которых вводится в данное изобретение посредством отсылки.

Другая модификация олигонуклеотидов по изобретению включает химическое связывание с олигонуклеотидом одного или более агентов или конъюгатов, которые повышают активность, клеточное распределение или клеточное поглощение олигонуклеотида.

Такие агенты включают, но без ограничения, липидные частицы, такие как холестерин, холевую кислоту, тиоэфир, например, гексил-S-тритилтиол, тиохолестерин, алифатическую цепь, например, остаток додекандиола или ундецильный остаток, фосфолипид, например, дигексадецил-rac-глицерин или триэтил аммония 1,2-ди-О-гексадецил-гас-глицеро-3-Н-фосфонат, полиаминовую или полиэтиленгликолевую цепь, или адамантануксусную кислоту, пальмитильный остаток или остаток октадециламина или гексиламинокарбонил- оксихолестерина.

Типичные патенты США, в которых описывается получение таких олигонуклеотидных конъюгатов, включают, но без ограничения, патенты США №№4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552, 538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 и 5,688,941, каждый из которых вводится в данное изобретение посредством отсылки.

Поиск новых лекарственных средств: Соединения по настоящему изобретению можно применять также для поиска новых лекарственных средств и валидации (подтверждения правильности) цели. Настоящее изобретение охватывает применение соединений и предпочтительных целевых сегментов по данному изобретению для поиска новых лекарственных средств с целью выяснить связь между полинуклеотидами нейротрофического фактора головного мозга (мозгового нейротрофического фактора, BDNF) и течением болезни, фенотипом или патологическим состоянием. Эти методы охватывают детекцию или модулирование полинуклеотидов BDNF и включают контактирование образца, ткани, клетки или организма с соединениями по настоящему изобретению, количественное определение уровня нуклеиновой кислоты или белка BDNF полинуклеотидов и/или связанного с этим уровнем конечного результата фенотипического проявления или химических свойств в определенный момент после обработки и, необязательно, сравнение полученной величины с величиной для необработанного образца или образца, обработанного другим соединением по изобретению. Эти методы можно также осуществлять параллельно или в сочетании с другими экспериментами по определению функции неизвестных генов для валидации цели или для определения пригодности (правильности выбора, валидности) конкретного генного продукта в качестве мишени для лечения или предупреждения конкретного заболевания, состояния или фенотипа.

Оценка активации или ингибирования экспрессии генов:

Перенос экзогенной нуклеиновой кислоты в клетку-хозяина или в организм-хозяин можно оценивать, непосредственно определяя (детектируя) присутствие нуклеиновой кислоты в клетке или в организме. Такую детекцию можно проводить несколькими методами, хорошо известными из уровня техники. Например, присутствие экзогенной нуклеиновой кислоты можно определять методом Саузерн-блоттинга или с помощью полимеразной цепной реакции (PCR, ПЦР), используя праймеры, которые делают возможной специфическую амплификацию нуклеотидных последовательностей, ассоциированных с данной нуклеиновой кислотой. Экспрессию экзогенных нуклеиновых кислот можно также определять количественно, применяя обычные методы, включающие анализ экспрессии генов. Например, мРНК, продуцированную при использовании экзогенной нуклеиновой кислоты, можно детектировать и количественно определить методом Нозерн-блоттинга и методом ПЦР (PCR) с обратной транскрипцией (RT-PCR).

Экспрессию РНК при использовании экзогенной нуклеиновой кислоты можно также детектировать, определяя ферментативную активность или активность репортерного белка. Например, активность антисмыслового модулятора можно измерять опосредованно как уменьшение или увеличение экспрессии целевой нуклеиновой кислоты в качестве свидетельства того, что экзогенная нуклеиновая кислота продуцирует эффекторную молекулу РНК. С учетом сохранения последовательности можно создать праймеры и применять их для амплификации кодирующих областей целевых генов. Сначала кодирующую область из каждого гена с наиболее высокой экспрессией можно использовать для построения модели контрольного гена, хотя можно использовать любую кодирующую или не кодирующую область. Каждый контрольный ген собирают, встраивая каждую кодирующую область между кодирующей областью для репортера и его сигналом полиаденилирования (poly(A)). Эти плазмиды будут продуцировать мРНК с репортерным геном на 5' участке гена и потенциальную мишень для РНК-интерференции в 3' некодирующей области. Эффективность отдельных антисмысловых олигонуклеотидов можно было бы оценивать посредством модуляции репортерного гена. Репортерные гены, применимые в способах по настоящему изобретению, включают гены ацетогидрокси кислой синтазы (AHAS), щелочной фосфатазы (АР), бета галактозидазы (LacZ), бета глюкуронидазы (GUS), хлорамфеникол ацетилтрансферазы (CAT), зеленого флуоресцентного белка (GFP), красного флуоресцентного белка (RFP), желтого флуоресцентного белка (YFP), цианового флуоресцентного белка (CFP), пероксидазы хрена (HRP), люциферазы (Luc), нопалин-синтазы (NO), октопин-синтазы (OCS) и их производные. Существует множество селективных маркеров, которые сообщают резистентность к ампициллину, блеомицину, хлорамфениколу, гентамицину, гигромицину, канамицину, линкомицину, метотрексату, фосфинотрицину, пуромицину и тетрациклину. Методы определения модуляции репортерного гена хорошо известны из уровня техники и включают, но без ограничения, флуорометрические методы (например, флуоресцентную спектроскопию, флуоресцентную активированную сортировку клеток (FACS), флуоресцентную микроскопию), определение резистентности к антибиотикам.

Экспрессию BDNF белка и мРНК можно оценивать, применяя методы, известные специалистам в данной области техники и описанные в другом месте данной заявки. Например, для измерения уровней белка можно применять иммуноанализы, такие как ELISA. В продаже имеются наборы для анализа BDNF ELISA kits, выпускаемые, например, компанией R&D Systems (Minneapolis, MN).

Согласно некоторым вариантам изобретения экспрессию BDNF (например, мРНК или белка) в образце (например, в клетках или тканях in vivo или in vitro), обработанном с применением антисмыслового олигонуклеотида по изобретению, оценивали, сравнивая с экспрессией BDNF в контрольном образце. Например, экспрессию белка или нуклеиновой кислоты можно сравнивать, применяя методы, известные специалистам в данной области техники, с экспрессией в фиктивно обработанном (имитации) или необработанном образце. Или же сравнение с образцом, обработанным контрольным антисмысловым олигонуклеотидом (например, олигонуклеотидом с измененной или другой последовательностью) можно провести в зависимости от заданной информации. Согласно другому варианту изобретения разницу в экспрессии BDNF белка или нуклеиновой кислоты между обработанным и необработанным образцом можно сравнить с разницей в экспрессии другой нуклеиновой кислоты (включая любой эталон, который, по мнению исследователя, является подходящим, например, ген домашнего хозяйства) между обработанным и необработанным образцом.

Для сравнения с контрольным значением полученную разницу можно выражать как угодно, например, в виде частного или в виде дроби. Согласно некоторым вариантам изобретения уровень мРНК или белка BDNF в образце, обработанном антисмысловым олигонуклеотидом по настоящему изобретению, является повышенным или пониженным примерно в 1.25-10 раз по сравнению с необработанным образцом или образцом, обработанным контрольной нуклеиновой кислотой. Согласно некоторым вариантам уровень мРНК или белка BDNF повышен или понижен по меньшей мере примерно в 1.25 раза, по меньшей мере примерно в 1.3 раза, по меньшей мере примерно в 1.4 раза, по меньшей мере примерно в 1.5 раза, по меньшей мере примерно в 1.6 раза, по меньшей мере примерно в 1.7 раза, по меньшей мере примерно в 1.8 раза, по меньшей мере примерно в 2 раза, по меньшей мере примерно в 2.5 раза, по меньшей мере примерно в 3 раза, по меньшей мере примерно в 3.5 раза, по меньшей мере примерно в 4 раза, по меньшей мере примерно в 4.5 раза, по меньшей мере примерно в 5 раз, по меньшей мере примерно в 5.5 раз, по меньшей мере примерно в 6 раз, по меньшей мере примерно в 6.5 раз, по меньшей мере примерно в 7 раз, по меньшей мере примерно в 7.5 раз, по меньшей мере примерно в 8 раз, по меньшей мере примерно в 8.5 раз, по меньшей мере примерно в 9 раз, по меньшей мере примерно в 9.5 раз или по меньшей мере примерно в 10 раз или более.

Наборы, реагенты для исследования, средства для диагностики и терапии

Соединения по настоящему изобретению можно применять для диагностики, терапии и профилактики и в качестве реагентов для исследований и компонентов наборов. Помимо этого, специалисты в данной области техники часто применяют антисмысловые олигонуклеотиды, способные ингибировать экспрессию генов с превосходной специфичностью, чтобы выяснить функцию (роль) конкретных генов или провести различие между функциями различных членов биологического пути.

В наборах, и в диагностике, и в различных биологических системах соединения по настоящему изобретению применяются, самостоятельно или в комбинации с другими соединениями или терапевтическими средствами, в качестве средства в дифференциальном и/или комбинаторном анализе, чтобы определить паттерны экспрессии части или целого набора генов, экспрессируемых в клетках или в тканях.

В данном контексте термин "биологическая система" или "система" определяется как любой организм, любая клетка, культура клеток или ткань, которые экспрессируют, или которых делают способными экспрессировать гены нейротрофического фактора головного мозга (BDNF). Эти системы включают, но без ограничения, человека, трансгенных животных, клетки, культуры клеток, ткани, ксенотрансплантаты и их комбинации.

В одном неограничивающем примере паттерны экспрессии в клетках или в тканях, обработанных одним или более антисмысловых соединений, сравниваются с паттернами экспрессии в контрольных клетках или тканях, не обработанных антисмысловыми соединениями, и полученные паттерны экспрессии анализируют, определяя, имеют ли отношение различные (дифференциальные) уровни экспрессии генов, например, к заболеванию, сигнальному пути, клеточной локализации, экспрессии генов, размеру, структуре или функции изучаемых генов. Этот анализ можно проводить на стимулированных или нестимулированных клетках и в присутствии или в отсутствие других соединений, которые влияют на паттерны экспрессии.

Примеры методов анализа экспрессии генов, известных из уровня техники, включают методы: с применением ДНК-чипов или микрочипов, SAGE (серийный анализ экспрессии генов), READS (амплификация фрагментов кДНК, полученных гидролизом с помощью рестриктаз), TOGA (общий анализ экспрессии генов), с применением белковых чипов и протеомики, секвенирование метки экспрессированной последовательности (EST), субтрактивный РНК-фингерпринтинг (SuRF), субтрактивное клонирование, сравнительный анализ (DD), сравнительную геномную гибридизацию, FISH (флуоресцентную in situ гибридизацию) и масс-спектрометрию.

Соединения по изобретению применимы для исследований и диагностики, так как эти соединения гибридизуются с нуклеиновыми кислотами, кодирующими нейротрофический фактор головного мозга (BDNF). Например, олигонуклеотиды, которые гибридизуются с такой же эффективностью и в тех же условиях, что и эффективные BDNF модуляторы по настоящему изобретению, являются эффективными праймерами или зондами в условиях, способствующих амплификации или детекции генов, соответственно. Эти праймеры и зонды применимы в методах, в которых требуется специфическая детекция нуклеотидных молекул, кодирующих BDNF, и при амплификации указанных нуклеотидных молекул для детекции или для применения в других исследованиях BDNF. Гибридизацию антисмысловых олигонуклеотидов, в частности праймеров и зондов, по изобретению с нуклеиновой кислотой, кодирующей BDNF, можно детектировать способами, известными из уровня техники. Такие способы могут включать конъюгацию фермента с олигонуклеотидом, мечение олигонуклеотида радиоактивной меткой или любой другой подходящий способ детекции. Можно также приготовить наборы, использующие такие способы детекции для определения уровня BDNF в образце.

Специалисты в данной области техники также используют специфичность и чувствительность антисмысловых соединений для применения в терапии. Антисмысловые соединения применялись в качестве терапевтических средств при лечении болезненных состояний у животных, включая людей. Лекарства на основе антисмысловых олигонуклеотидов безопасно и эффективно вводили людям и применяли в ряде клинических испытаний, которые проводятся в настоящее время. Таким образом, установлено, что антисмысловые соединения могут являться полезными терапевтическими средствами, выполненными с возможностью применения их в схемах лечения для обработки клеток, тканей и лечения животных, в особенности людей.

С целью терапии животному, предпочтительно, человеку с подозрением на заболевание или расстройство, которое можно лечить модуляцией экспрессии BDNF полинуклеотидов, вводят антисмысловые соединения по настоящему изобретению. Например, согласно одному неограничивающему варианту способы включают стадию введения нуждающемуся в лечении животному терапевтически эффективного количества модулятора BDNF. Модуляторы BDNF по настоящему изобретению эффективно модулируют активность BDNF или модулируют экспрессию BDNF белка. Согласно одному варианту активность или экспрессия BDNF в организме животного ингибируется примерно на 10% по сравнению с контролем. Предпочтительно, активность или экспрессия BDNF в организме животного ингибируется примерно на 30%. Более предпочтительно, активность или экспрессия BDNF в организме животного ингибируется примерно на 50% или более. Так, олигомерные соединения модулируют экспрессию мРНК нейротрофического фактора головного мозга (BDNF) по меньшей мере на 10%, по меньшей мере на 50%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 98%, по меньшей мере на 99% или на 100% по сравнению с контролем.

Согласно одному варианту активность или экспрессия нейротрофического фактора головного мозга (BDNF) у животного повышается примерно на 10% по сравнению с контролем. Предпочтительно, активность или экспрессия BDNF у животного повышается примерно на 30%. Более предпочтительно, активность или экспрессия BDNF у животного повышается на 50% или более. Так, олигомерные соединения модулируют экспрессию мРНК BDNF по меньшей мере на 10%, по меньшей мере на 50%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 98%, по меньшей мере на 99% или на 100% по сравнению с контролем.

Например, повышение или снижение экспрессии нейротрофического фактора головного мозга (BDNF) можно количественно определять в сыворотке, в крови, в жировой ткани, печени или в любой другой физиологической жидкости, ткани или в любом другом органе животного. Предпочтительно, клетки, имеющиеся в указанных анализируемых жидкостях, тканях или органах, содержат молекулу нуклеиновой кислоты, кодирующей BDNF пептиды и/или сам BDNF белок.

Соединения по изобретению можно применять в фармацевтических композициях, добавляя эффективное количество соединения в фармацевтически приемлемый разбавитель или носитель. Соединения и способы по изобретению можно также применять профилактически.

Конъюгаты

Другая модификация олигонуклеотидов по изобретению включает химическое связывание с олигонуклеотидом одним или более агентов или конъюгатов, которые повышают активность, клеточное распределение или клеточное поглощение олигонуклеотида. Эти агенты или конъюгаты могут включать группы конъюгатов, ковалентно связанные с функциональными группами, такими как первичные или вторичные гидроксильные группы. Группы конъюгатов по изобретению включают интеркаляторы, репортерные молекулы, полиамины, полиамиды, полиэтиленгликоли, простые полиэфиры, группы, которые повышают фармакодинамические свойства олигомеров. Типичные группы конъюгатов включают холестерины, липиды, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины и красители. Группы, которые улучшают фармакодинамические свойства, в контексте настоящего изобретения включают группы, которые повышают поглощение, резистентность к расщеплению и/или стабилизируют специфическую к последовательности гибридизацию с целевой нуклеиновой кислотой. Группы, которые улучшают фармакокинетические свойства, в контексте настоящего изобретения включают группы, которые улучшают поглощение, распределение, метаболизм или выведение соединений по настоящему изобретению. Типичные группы конъюгатов раскрываются в Международной заявке № PCT/US92/09196, поданной 23 октября 1992 года, и в патенте США №6,287,860, которые включены в настоящее изобретение посредством отсылки. Фрагменты (группы) конъюгатов включают, но без ограничения, липидные частицы, такие как холестерин, холевую кислоту, тиоэфир, например, гексил-S-тритилтиол, тиохолестерин, алифатическую цепь, например, остатки додекандиола или ундецильные остатки, фосфолипид, например, дигексадецил-rac-глицерин или триэтиламмония 1,2-ди-О-гексадецил-rac-глицеро-3-Н-фосфонат, полиаминовую или полиэтиленгликолевую цепь, или адамантануксусную кислоту, пальмитильный остаток или остаток октадециламина или гексиламинокарбонил-t оксихолестерина. Олигонуклеотиды по изобретению могут также конъюгироваться с активными лекарственными веществами, например, аспирином, варфарином, фенилбутазоном, ибупрофеном, супрофеном, фенбутеном, кетопрофеном, (S)-(+)-пранопрофеном, карпрофеном, данзилсаркозином, 2,3,5-трииодбензойной кислотой, флуфенаминовой кислотой, фолиниевой кислотой, бензотиадиазидом, хлортиазидом, диазепином, индометицином, барбитуратом, цефалоспорином, сульфамидным препаратом, антидиабетическим, антибактериальным средством или антибиотиком.

Типичные патенты США, в которых описывается получение таких олигонуклеотидных конъюгатов, включают, но без ограничения, патенты США №№4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 и 5,688,941.

Препараты

Соединения по изобретению могут также смешиваться, инкапсулироваться, конъюгироваться или иным образом ассоциироваться с другими молекулами, молекулярными структурами или смесями соединений, например, такими как липосомы, молекулы, нацеленные на рецептор, пероральные, ректальные, местные или другие препараты, с целью способствовать поглощению (проникновению), распределению и/или всасыванию. Типичные патенты США, в которых описывается получение таких препаратов, способствующих поглощению, распределению и/или всасыванию, включают, но без ограничения, патенты США №№5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,165; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; и 5,595,756, каждый из которых включен в данное изобретение посредством отсылки.

Хотя для модуляции целевой экспрессии и/или функции необязательно антисмысловые олигонуклеотиды вводить в составе вектора, некоторые варианты изобретения относятся к конструкциям векторов экспрессии для экспрессии антисмысловых олигонуклеотидов, содержащим промоторы, последовательности генов гибридных промоторов и обладающим сильной конститутивной промоторной активностью или промоторной активностью, которая может индуцироваться в нужный момент.

Согласно одному варианту практическое применение изобретения включает введение по меньшей мере одного из вышеуказанных антисмысловых олигонуклеотидов посредством подходящей системы доставки нуклеотидов. Согласно одному варианту такая система включает невирусный вектор, функционально связанный с полинуклеотидом. Примеры таких невирусных векторов включают только олигонуклеотид (например, любой один или более олигонуклеотид с последовательностью SEQ ID NO: 12-49) или олигонуклеотид в комбинации с соответствующим белком, полисахаридом или липидом.

Кроме того, подходящие системы доставки нуклеиновых кислот включают вирусный вектор, как правило, последовательность по меньшей мере одного из группы: аденовирус, адено-ассоциированный вирус (AAV), хелпер-зависимый аденовирус, ретровирус или комплекс гемагглютинин вируса (гриппа) Япония-липосома (HVJ). Предпочтительно, вирусный вектор содержит сильный эукариотический промотор, функционально связанный с полинуклеотидом, например, промотор цитомегаловируса (CMV).

Другие предпочтительные векторы включают вирусные векторы, слитые (химерные) белки и химические конъюгаты. Ретровирусные векторы включают мышиные вирусы лейкемии Молони и векторы на основе вирусов ВИЧ (HTV). Один предпочтительный вектор на основе вируса ВИЧ содержит по меньшей мере два вектора, в которых гены gag и pol взяты из генома ВИЧ, а ген env взят из другого вируса. Предпочтительными векторами являются ДНК-содержащие вирусные векторы. Эти векторы включают векторы на основе поксвирусов, такие как векторы на основе ортопоксвирусов или авипоксвирусов, герпесвирусов, таких как вектор на основе вируса простого герпеса I (HSV), аденовирусные векторы и адено-ассоциированные вирусные векторы.

Антисмысловые соединения по изобретению охватывают любые фармацевтически приемлемые соли, сложные эфиры или соли таких сложных эфиров, или любое другое соединение, которое, после введения его животному, включая человека, способно давать (непосредственно или опосредованно) биологически активный метаболит или его остаток.

Термин "фармацевтически приемлемые соли" относится к физиологически и фармацевтически приемлемым солям соединения по изобретению: т.е. к солям, которые сохраняют нужную биологическую активность исходного соединения и не вызывают (не придают этому соединению) нежелательного токсикологического эффекта. Предпочтительные примеры фармацевтически приемлемых солей для олигонуклеотидов и их применение подробнее описано в патенте США №6,287,860, который включен в настоящее изобретение посредством отсылки.

Настоящее изобретение включает также фармацевтические композиции и препараты, содержащие антисмысловые соединения по изобретению. Фармацевтические композиции по настоящему изобретению можно вводить различными способами в зависимости от того, какое лечение требуется, местное или системное, или от области, подлежащей лечению. Применение может быть местным (топическим, включая введение в глаз или в слизистые, в том числе вагинальную и ректальную доставку), легочным, например, посредством ингаляции или инсуффляции (вдувания) порошков или аэрозолей с помощью ингалятора; интратрахеальным, интраназальным, эпидермальным и трансдермальным, пероральным или парентеральным. Парентеральное введение включает внутривенную, интраартериальную, подкожную, интраперитонеальную (внутрибрюшинную) или внутримышечную инъекцию или инфузию; или интракраниальное, например, интратекальное или интравентрикулярное введение. Для лечения (обработки) тканей в центральной нервной системе можно осуществлять введение, например, с помощью инъекции или инфузии в спинномозговую жидкость (ликвор). Введение антисмысловой РНК в спинномозговую жидкость описано, например, в опубликованной патентной заявке на патент США №2007/0117772, "Methods for slowing familial ALS disease progression," ("Методы замедления прогрессирования семейной болезни ALS" ("амиотрофического бокового склероза"), которая включена в настоящее изобретение посредством отсылки.

Если предполагается вводить антисмысловой олигонуклеотид по настоящему изобретению в центральную нервную систему, его можно вводить с одним или более агентами, способствующими проникновению антисмыслового олигонуклеотида через гематоэнцефалический барьер. Можно делать инъекцию, например, в энторинальную область коры головного мозга или в гиппокамп. Доставка нейротрофических факторов путем введения аденовирусного вектора в мотонейроны в мышечной ткани описано, например, в патенте США №6,632,427, "Adenoviral-vector-mediated gene transfer into medullary motor neurons" ("Опосредуемый аденовирусным вектором перенос генов в медуллярные мотонейроны"), который включен в настоящее изобретение посредством отсылки. Доставка векторов непосредственно в головной мозг, например, в полосатое тело, таламус, гиппокамп или в черную субстанцию, известна из уровня техники и описана, например, в патенте США №6,756,523, "Adenovirus vectors for the transfer of foreign genes into cells of the central nervous system particularly in brain" ("Аденовирусные векторы для переноса чужеродных генов в клетки центральной нервной системы, в частности, в головной мозг"), который включен в настоящее изобретение посредством отсылки. Введение можно осуществлять быстро, например, с помощью инъекции, или медленно в течение некоторого периода времени, например, с помощью медленной инфузии или в виде препаратов с замедленным высвобождением.

Антисмысловые олигонуклеотиды по настоящему изобретению могут также связываться или конъюгироваться с агентами, которые придают желательные фармацевтические или фармакодинамические свойства. Например, антисмысловой олигонуклеотид может связываться с любым веществом, которое, как известно из уровня техники, вызывает проникновение или перенос через гематоэнцефалический барьер, такое как антитело к рецептору трансферрина, и вводится с помощью внутривенной инъекции. Антисмысловое соединение может связываться с вирусным вектором, например, таким, который делает антисмысловое соединение более эффективным и/или повышает перенос антисмыслового соединения через гематоэнцефалический барьер. Осмотический лизис клеток гематоэнцефалического барьера можно осуществлять также, например, инфузией сахаров, включая, но без ограничения, мезо-эритрит, ксилит, D(+) галактозу, D(+) лактозу, D(+) ксилозу, дульцит, мио-инозит(ол), L(-) фруктозу, D(-) маннит, D(+) глюкозу, D(+) арабинозу, D(-) арабинозу, целлобиозу, D(+) мальтозу, D(+) раффинозу, L(+) рамнозу, D(+) мелибиозу, D(-) рибозу, адонитол (адонит), D(+) арабитол (арабит), L(-) арабитол, D(+) фукозу, L(-) фукозу, D(-) ликсозу, L(+) ликсозу и L(-) ликсозу, или аминокислоты, включая, но без ограничения, глутамин, лизин, аргинин, аспарагин, аспарагиновую кислоту, цистеин, глутаминовую кислоту, глицин, гистидин, лейцин, метионин, фенил ал анин, пролин, серии, треонин, тирозин валин и таурин. Методы и материалы для увеличения проницаемости гематоэнцефалического барьера описаны, например, в патентах США №4,866,042, "Method for the delivery of genetic material across the blood brain barrier" ("Методы доставки генетического материала через гематоэнцефалический барьер"), №6,294,520, "Material for passage through the blood-brain barrier" ("Материал для переноса через гематоэнцефалический барьер") и №6,936,589, "Parenteral delivery systems" ("Парентеральные системы доставки"), все они включены в настоящее изобретение посредством отсылки во всей полноте.

Антисмысловые соединения по изобретению могут смешиваться, инкапсулироваться, конъюгироваться или иным образом ассоциироваться с другими молекулами, молекулярными структурами или смесями соединений, например, такими как липосомы, молекулы, нацеленные на рецептор, пероральные, ректальные, местные или другие препараты, с целью способствовать поглощению, распределению и/или всасыванию. Например, в препарат можно включать катионные липиды, чтобы способствовать поглощению олигонуклеотидов. Одной такой композицией, которая, как показано, способствует поглощению, является ЛИПОФЕКТИН (LIPOFECTIN от компании GIBCO-BRL, Bethesda, MD).

Полагают, что олигонуклеотиды, содержащие по меньшей мере одну 2'-O-метоксиэтильную модификацию, особенно хорошо подходят для перорального применения. Фармацевтические композиции и препараты для местного (топического) применения могут включать трансдермальные пластыри, мази, лосьоны, кремы, гели, капли, суппозитории, спреи, жидкие препараты и порошки. Обычные фармацевтические носители, водная, порошкообразная или масляная основы могут быть необходимы или желательны. Также могут применяться презервативы, перчатки и т.п. с покрытием.

Фармацевтические препараты по настоящему изобретению, которые удобно представлять в виде стандартной лекарственной формы, можно готовить обычными методами, хорошо известными в фармацевтической промышленности. Такие методы включают стадию смешения активных ингредиентов с фармацевтическим(и) носителем (носителями) или эксципиентом (эксципиентами). Как правило, препараты готовят при равномерном и тщательном перемешивании активных ингредиентов с жидкими носителями или тонкоизмельченными твердыми носителями, или с теми и с другими, а затем, при необходимости, осуществляют формование продукта.

Композиции по настоящему изобретению можно приготовить в виде любой из множества возможных лекарственных форм, например, таких, но без ограничения, как таблетки, капсулы, гелевые капсулы, жидкие сиропы, мягкие гели, суппозитории и клизмы. Композиции по настоящему изобретению можно также готовить в виде суспензий в водных, неводных или смешанных средах. Водные суспензии могут также содержать вещества, которые повышают вязкость суспензии, включая, например, натрий карбоксиметилцеллюлозу, сорбит и/или декстран. Суспензия может содержать также стабилизаторы.

Фармацевтические композиции по настоящему изобретению включают, но без ограничения, растворы, эмульсии, пены и липосомосодержащие препараты. Фармацевтические композиции и препараты по настоящему изобретению могут содержать один или более агентов, включающих вещества, способствующие проникновению (поглощению), носители, эксципиенты или другие активные или неактивные ингредиенты.

Обычно эмульсии представляют собой гетерогенные (неоднородные) системы, в которых одна жидкость диспергирована в другой в виде капелек, диаметр которых обычно превышает 0.1 мкм. Помимо диспергированных фаз, эмульсии могут содержать дополнительные компоненты, а активное лекарство может присутствовать в виде раствора в водной фазе, масляной фазе или самостоятельно в виде отдельной фазы. Согласно одному варианту изобретение включает микроэмульсии. Эмульсии и их применение хорошо известны из уровня техники и более подробно описаны в патенте США №6,287,860.

Препараты по настоящему изобретению включают липосомальные препараты. Термин "липосома" в данном контексте означает везикулу, состоящую из амфифильных липидов, расположенных в виде сферического бислоя или сферических бислоев. Липосомы представляют собой однослойные (моноламеллярные) или многослойные везикулы, имеющие мембрану из липофильного материала и гидрофильную внутреннюю часть, содержащую композицию для доставки. Катионные липосомы представляют собой положительно заряженные липосомы, которые, как полагают, взаимодействуют с отрицательно заряженными молекулами ДНК с образованием устойчивого комплекса. Полагают, что липосомы, которые являются чувствительными к рН или заряжены отрицательно, скорее захватывают ДНК, нежели образуют с ней комплекс. Как катионные, так и некатионные липосомы применялись для доставки ДНК в клетки.

Липосомы включают также "пространственно стабилизированные" липосомы, этот термин в данном контексте относится к липосомам, которые содержат один или более липидов со специальными функциями. При включении их в липосомы эти липиды со специальными функциями дают липосомы с увеличенным временем циркуляции в кровотоке по сравнению с липосомами, не содержащими такие специальные липиды. Примерами пространственно стабилизированных липосом являются липосомы, в которых часть образующего везикулы липидного участка липосомы содержит один или более гликолипидов или дериватизирована с помощью одного или более гидрофильных полимеров, таких как остаток полиэтиленгликоля (ПЭГ, PEG). Подробнее липосомы и их применение описаны в патенте США №6,287,860.

Фармацевтические препараты и композиции по настоящему изобретению могут включать также поверхностно-активные вещества (ПАВ). Применение поверхностно-активных веществ (ПАВ) в лекарственных продуктах, препаратах и эмульсиях хорошо известно из уровня техники. Подробнее поверхностно-активные вещества (ПАВ) и их применение описано в патенте США №6,287,860, который включен в настоящее изобретение посредством отсылки.

Согласно одному варианту в настоящем изобретении применяются различные усилители поглощения (всасывания) для эффективной доставки нуклеиновых кислот, в особенности олигонуклеотидов. Помимо содействия диффузии нелипофильных лекарственных средств через клеточные мембраны, усилители всасывания также повышают проникновение (всасывание) липофильных лекарств. Усилители всасывания можно классифицировать как относящиеся к одной из пяти больших групп, а именно, к поверхностно-активным веществам, жирным кислотам, солям желчных кислот, хелатирующим агентам и не являющимся поверхностно-активными нехелатирующим веществам. Более подробно усилители всасывания и их применение описаны в патенте США №6,287,860, который включен в настоящее описание посредством отсылки.

Специалист в данной области техники понимает, что препараты обычно готовят в соответствии с предполагаемым применением, а именно, в соответствии со способом введения.

Предпочтительные поверхностно-активные вещества (ПАВ) для местного применения включают такие ПАВ, в которых олигонуклеотиды по изобретению находятся в виде смеси с агентом для местной (топической) доставки, таким как липиды, липосомы, жирные кислоты, эфиры жирных кислот, хелатирующие агенты и ПАВ. Предпочтительные липиды и липосомы включают нейтральные (например, диолеилфосфатидилэтаноламин (DOPE), димиристоилфосфатидилхолин (DMPC), дистеароилфосфатидилхолин), отрицательные (отрицательно заряженные) (например, димиристоилфосфатидилглицерин (DMPG)) и катионные (например, диолеоилтетраметиламинопропил (DOTAP) и диолеилфосфатидилэтаноламин (DOTMA)).

Для местного или другого применения олигонуклеотиды по изобретению могут быть инкапсулированы в липосомы или они могут образовывать комплексы с липосомами, в частности, с катионными липосомами. Или же олигонуклеотиды могут образовывать комплексы с липидами, в частности, с катионными липидами. Предпочтительные жирные кислоты и сложные эфиры, их фармацевтически приемлемые соли и их применение более подробно описаны в патенте США №6,287,860.

Композиции и препараты для перорального применения включают порошки или гранулы, микрочастицы, наночастицы, суспензии или растворы в воде или в неводных средах, капсулы, гелевые капсулы, порошки для приготовления раствора (саше), таблетки или минитаблетки. Может быть целесообразным добавлять загустители (вещества, повышающие вязкость), корригенты вкуса и запаха, разбавители, эмульгаторы, диспергирующие агенты или связующие. Предпочтительными пероральными препаратами являются такие препараты, в которых олигонуклеотиды по изобретению вводятся совместно с одним или более агентов из группы: усилители всасывания, ПАВ и хелатирующие вещества. Предпочтительные ПАВ включают жирные кислоты и/или их сложные эфиры или соли, желчные кислоты и/или их соли. Более подробно предпочтительные желчные кислоты/соли и жирные кислоты и их применение описаны в патенте США №6,287,860, который включен в настоящее изобретение посредством отсылки. Также предпочтительными являются комбинации усилителей всасывания, например, жирные кислоты/соли в комбинации с желчными кислотами/солями. Особенно предпочтительной комбинацией является комбинация натриевой соли лауриновой кислоты, каприновой кислоты и UDCA. Другие усилители всасывания включают полиоксиэтилен-9-лауриловый эфир, полиоксиэтилен-20-цетиловый эфир. Олигонуклеотиды по изобретению могут доставляться перорально в виде гранул, включающих частицы, высушенные распылительной сушкой, или в виде комплексов с микро- или наночастицами. Агенты, образующие комплексы с олигонуклеотидами, и их применение более подробно описаны в патенте США №6,287,860, который включен в настоящее изобретение посредством отсылки.

Композиции и препараты для парентерального, интратекального или интравентрикулярного введения могут включать стерильные водные растворы, которые могут содержать буферы, разбавители и другие подходящие добавки, такие, но без ограничения, как усилители всасывания, носители и другие фармацевтически приемлемые носители или эксципиенты.

Согласно некоторым вариантам в изобретении предусматриваются фармацевтические композиции, содержащие одно или более олигомерных соединений и один или более других химиотерапевтических агентов, которые действуют не по антисмысловому механизму. Примеры таких химиотерапевтических агентов включают, но без ограничения, противораковые химиотерапевтические лекарства, такие как даунорубицин, дауномицин, дактиномицин, доксорубицин, эпирубицин, идарубицин, эзорубицин, блеомицин, мафосфамид, ифосфамид, цитозин-арабинозид, бисхлорэтил нитрозомочевина, бусульфан, митомицин С, актиномицин D, митрамицин, преднизон, гидроксипрогестерон, тестостерон, тамоксифен, дакарбазин, прокарбазин, гексаметиленимин, пентаметиленимин, митоксантрон, амсакрин, хлорамбуцил, метилциклогексилнитрозомочевина, хлорметин, мелфалан, циклофосфамид, 6-меркаптопурин, 6-тиогуанин, цитарабин, 5-азацитидин, гидроксимочевина, дезоксикоформицин, 4-гидроксипероксициклофосфорамид, 5-фторурацил (5-FU), 5-фтордезоксиуридин (5-FUdR), метотрексат (МТХ), колхицин, таксол, винкристин, винбластин, этопозид (VP-16), триметрексат, иринотекан, топотекан, гемцитабин, тенипозид, цисплатин и диэтилстилбестрол (DES). В случае их применения с соединениями по изобретению такие химиотерапевтические агенты могут вводиться самостоятельно (индивидуально) (например, 5-FU и олигонуклеотид), последовательно (например, 5-FU и олигонуклеотид в течение некоторого периода времени, а затем МТХ и олигонуклеотид) или в комбинации с одним или более других таких химиотерапевтических агентов (например, 5-FU, МТХ и олигонуклеотид, или 5-FU, лучевая терапия и олигонуклеотид). Противовоспалительные лекарственные средства, в том числе, но без ограничения, нестероидные противовоспалительные лекарственные средства и кортикостероиды, включая, но без ограничения, рибивирин, видарабин, ацикловир и ганцикловир, также могут входить в состав композиций по изобретению. Комбинации антисмысловых соединений и других, несмысловых, лекарственных средств также входят в объем данного изобретения. Два или более соединений могут применяться совместно или последовательно.

Согласно другому, родственному, варианту композиции по изобретению могут содержать одно или более антисмысловых соединений, в особенности олигонуклеотидов, нацеленных на первую нуклеиновую кислоту, и одно или более дополнительных антисмысловых соединений, нацеленных на вторую нуклеиновую кислоту-мишень. Например, первая мишень может представлять собой конкретную антисмысловую последовательность нейротрофического фактора головного мозга (BDNF), а вторая мишень может представлять собой область другой нуклеотидной последовательности. Или же композиции по изобретению могут содержать два или более антисмысловых соединений, нацеленных на разные области одной и той же целевой нуклеиновой кислоты нейротрофического фактора головного мозга (BDNF). В настоящем изобретении даны некоторые примеры антисмысловых соединений, а другие примеры можно выбрать из соответствующих соединений, известных из уровня техники. Два или более соединений можно вводить совместно или последовательно.

Дозировка:

Полагают, что приготовление терапевтических композиций и их последующее введение (дозировка) относятся к компетенции специалистов в данной области техники. Дозировка зависит от тяжести и восприимчивости к терапии подлежащего лечению болезненного состояния, причем курс лечения длится от нескольких дней до нескольких месяцев, или до тех пор, пока не наступит выздоровление или пока не пройдет болезненное состояние. Оптимальные схемы введения доз можно рассчитать, количественно определяя кумуляцию препарата в организме пациента. Специалисты в данной области техники могут легко определить оптимальные дозы, методологию дозирования и частоту введения доз. Оптимальные дозы могут меняться в зависимости от относительной активности отдельных олигонуклеотидов и, как правило, могут оцениваться на основании значений ЕС50, оказавшихся эффективными in vitro и in vivo на животных моделях. Как правило, доза составляет от 0.01 мкг до 10 мг массы тела и может вводиться один или более раз в день, в неделю или в год или даже один раз каждые 2-20 лет. Специалист в данной области техники легко может определить частоту введения доз на основании найденных значений времени удерживания и концентрации лекарства в физиологических жидкостях или тканях организма. После успешного лечения для предупреждения рецидива болезненного состояния желательна поддерживающая терапия пациента, когда олигонуклеотид вводят в поддерживающих дозах в диапазоне от 0.01 мкг/кг до 10 мг/кг массы тела с частотой от одного или более раз в день до одного раза каждые 2-20 лет.

Согласно некоторым вариантам лечение пациента проводят, давая дозу лекарства, которая составляет по меньшей мере примерно 1, по меньшей мере примерно 2, по меньшей мере примерно 3, по меньшей мере примерно 4, по меньшей мере примерно 5, по меньшей мере примерно 6, по меньшей мере примерно 7, по меньшей мере примерно 8, по меньшей мере примерно 9, по меньшей мере примерно 10, по меньшей мере примерно 15, по меньшей мере примерно 20, по меньшей мере примерно 25, по меньшей мере примерно 30, по меньшей мере примерно 35, по меньшей мере примерно 40, по меньшей мере примерно 45, по меньшей мере примерно 50, по меньшей мере примерно 60, по меньшей мере примерно 70, по меньшей мере примерно 80, по меньшей мере примерно 90 или по меньшей мере примерно 10 мг/кг массы тела. Некоторые дозы вводимых в виде инъекций антисмысловых олигонуклеотидов описаны, например, в патенте США №7,563,884, "Antisense modulation of PTP1B expression" ("Антисмысловая модуляция экспрессии РТР1В"), который во всей полноте включен в настоящее изобретение посредством отсылки.

Хотя различные варианты настоящего изобретения описаны выше, следует отдавать отчет, что они представлены только в качестве примера и не являются ограничивающими. Можно делать различные изменения в раскрываемых вариантах в соответствии с описанием в настоящем изобретении, не отступая от сущности и объема изобретения. Следовательно, объем настоящего изобретения не следует ограничивать каким-либо из вышеописанных вариантов.

Все документы, указанные в настоящей заявке, включены в данное изобретение посредством отсылки. Все публикации и патентные документы, цитированные в настоящей заявке, включены посредством отсылки для всех целей в той же степени, как если бы каждая отдельная публикация или каждый отдельный патентный документ были указаны индивидуально. Цитируя в данном документе различные противопоставленные материалы, Заявители не признают, что какой-либо конкретный ссылочный материал является "прототипом" их изобретения. Варианты композиций и способов по изобретению показаны в нижеприведенных примерах.

ПРИМЕРЫ

Нижеприведенные неограничивающие примеры служат для иллюстрации выбранных вариантов изобретения. Варианты показанных соотношений и альтернативных компонентов очевидны для специалистов и входят в объем вариантов настоящего изобретения.

Пример 1: Дизайн антисмысловых олигонуклеотидов (олиго), специфических для нуклеотидных молекул, антисмысловых по отношению к нейротрофическому фактору головного мозга (BDNF) и/или смысловой нити BDNF полинуклеотида

Как указано выше, термин "олигонуклеотид, специфический к" или "олигонуклеотид нацелен на" относится к олигонуклеотиду, имеющему последовательность, (i) способную образовывать устойчивый комплекс с участком целевого гена, или (ii) способную образовывать устойчивую двойную спираль с участком мРНК транскрипта целевого гена.

Отбор подходящих олигонуклеотидов упрощает применение компьютерных программ (например, IDT AntiSense Design, IDT OligoAnalyzer), которые позволяют в каждой данной последовательности автоматически идентифицировать подпоследовательности из 19-25 нуклеотидов, которые образуют гибриды с целевой полинуклеотидной последовательностью с заданной температурой плавления (обычно 50-60°С) и не образуют димеры сами с собой (из двух одинаковых подпоследовательностей) или другие комплексные вторичные структуры.

Отбор подходящих олигонуклеотидов упрощают также компьютерные программы, которые позволяют автоматически выравнивать нуклеотидные последовательности и показывают области идентичности или гомологии. Такие программы применяются для сравнения нуклеотидных последовательностей, полученных, например, при поиске в базах данных, таких как GenBank, или секвенированием ПЦР-продуктов. Сравнение нуклеотидных последовательностей в пределах генов и межгенных областей данного генома способствует отбору последовательностей, которые проявляют нужную степень специфичности в отношении целевого гена. Эти методы позволяют отбирать олигонуклеотиды, которые проявляют высокую степень комплементарности по отношению к целевым нуклеотидным последовательностям и более низкую степень комплементарности по отношению к другим нуклеотидным последовательностям в данном геноме. Специалист понимает, что выбор подходящих областей генов для применения в настоящем изобретению предоставляет значительную степень свободы.

Антисмысловое соединение "может специфически гибридизоваться", "специфически гибридизуется", если связывание соединения с целевой нуклеиновой кислотой препятствует нормальной функции целевой нуклеиновой кислоты, а именно, вызывать модуляцию функции и/или активности, и имеется достаточная степень комплементарности для того, чтобы избежать неспецифического связывания антисмыслового соединения с нецелевыми нуклеотидными последовательностями в условиях, когда желательно специфическое связывание, а именно, в физиологических условиях при проведении анализов in vivo или при терапевтическом воздействии и в условиях проведения анализов in vitro.

Гибридизационные свойства олигонуклеотидов по настоящему изобретению можно определять с помощью одного или более in vitro анализов, известных из уровня техники. Например, свойства олигонуклеотидов по настоящему изобретению можно узнать, определив прочность связывания молекулы целевого природного антисмыслового соединения и молекулы предполагаемого лекарства по кривой плавления.

Прочность связывания молекулы целевого природного антисмыслового соединения и молекулы (Молекулы) предполагаемого лекарства можно определять любым из стандартных методов измерения силы межмолекулярного взаимодействия, например, по кривой плавления.

В анализе с построением кривой плавления определяют температуру, при которой происходит быстрый переход комплекса природное антисмысловое соединение/Молекула из двунитевой конформации в однонитевую. Эта температура широко применяется как надежная мера силы взаимодействия между двумя молекулами.

Кривую плавления можно строить, используя кДНК копию истинной природной антисмысловой РНК или синтетический ДНК- или РНК-нуклеотид, соответствующий сайту связывания Молекулы. Имеется множество наборов, содержащих все реагенты, необходимые для проведения этого анализа (например, набор Applied Biosystems Inc. MeltDoctor kit). Эти наборы включают соответствующий буферный раствор, содержащий один из красителей, связывающих двунитевую ДНК (днДНК, дцДНК, dsDNA), (таких как красители ABI HRM, SYBR Green, SYTO и т.д.). В свободном виде днДНК-красители не излучают флуоресценцию, но при связывании их с днДНК интенсивность флуоресценции становится высокой.

Для проведения анализа кДНК или соответствующий олигонуклеотид смешивали с Молекулой в концентрации, определяемой конкретными протоколами производителя. Смесь нагревали до 95°С, чтобы диссоциировали все ранее образованные комплексы, затем медленно охлаждали до комнатной температуры или другой более низкой температуры, определяемой производителем набора, чтобы молекулы ДНК могли гибридизоваться. Затем новообразованные комплексы медленно нагревали до 95°С, одновременно постоянно определяли интенсивность флуоресценции, излучаемой в ходе реакции. Интенсивность флуоресценции обратно пропорциональна количеству днДНК, присутствующей в реакционной смеси. Данные собирали, используя прибор для ПЦР в реальном времени, совместимый с набором (например, систему для проведения ПЦР в реальном времени ABI's StepOne Plus или прибор lightTyper, Roche DiagNOtics, Lewes, UK).

Пики плавления определяли, строя график: отношение отрицательной производной флуоресценции к производной температуры (-d(Флуоресценция)/dT) по оси y) в зависимости от температуры (по оси x) с использованием соответствующей программы (например, lightTyper (Roche) или SDS Dissociation Curve, ABI). Результаты анализировали, чтобы определить температуру быстрого перехода от комплекса днДНК к однонитевым молекулам. Эту температуру называют Tm (Тпл.), и она прямо пропорциональна силе взаимодействия между двумя молекулами. Как правило, Тпл превышает 40°С.

Дизайн модифицированных молекул AntagoNAT:

Был получен и протестирован целый ряд антисмысловых олигонуклеотидов на основе ДНК, названных AntagoNAT, специфических к некодирующим Bdnf-AS и другим антисмысловым транскриптам. Были получены различные AntagoNAT длиной от 12 до 20 нуклеотидов с полной фосфоротиоатной модификацией или без полной фосфоротиоатной модификации плюс/минус 2-O'-метил-РНК или LNA (замкнутой нуклеиновой кислоты)- модифицированные нуклеотиды. Наивысшую эффективность наблюдали при определении уровня Bdnf мРНК с 16-нуклеотидным фосфоротиоатным "гэпмером" (химерным олигонуклеотидом, субсегментом) с тремя LNA-модифицированными нуклеотидами на каждом конце (XXXnnnnnnnnnnXXX). Для блокирования взаимодействий между смысловым и антисмысловым транскриптами человеческого BDNF использовали 14-нуклеотидные смешанные олигонуклеотиды (сегменты, "миксмеры"), содержащие как молекулы LNA, так и молекулы 2-O'-метил РНК. Хотя предполагается, что эти 2-O'-метил РНА-модифицированные олигонуклеотиды только блокируют РНК, в этом эксперименте наблюдалась минимальная отрицательная модуляция целевых РНК (Фигура 11). Последовательности различных AntagoNAT, так же как всех других киРНК, праймеры и зонды для этих исследований, перечислены в Таблице 1.

Пример 2: Модуляция BDNF полинуклеотидов

Все антисмысловые олигонуклеотиды, применяемые в Примере 2, были получены, как описано в Примере 1. Компании-изготовителю (IDT Inc. of Coralville, IA) было дано указание получить задуманные олигонуклеотиды с фосфоротиоатной связью и предоставить созданные фосфоротиоатные аналоги, показанные в Таблице 1. Звездочка между нуклеотидами показывает присутствие фосфоротиоатной связи. Олигонуклеотиды, необходимые для эксперимента в Примере 2, можно синтезировать любым методом, известным из уровня техники, например, методом, применявшимся в компании IDT: на твердой подложке, такой как стеклянные бусы с порами контролируемого размера 5 микрон (CPG), с применением фосфорамидитных мономеров (обычных нуклеотидов, у которых все активные группы были защищены защитными группами, например, тритильной группой в сахарах (углеводах), бензоильной группой на А и С и N-2-изобутирильной группой на G). Защитные группы предотвращают нежелательные реакции в ходе олигонуклеотидного синтеза. Защитные группы снимали (удаляли) в конце процесса. Начальный нуклеотид связывался с твердой подложкой (носителем) через 3' углеродный атом, и синтез продолжали в направлении от 3' к 5'. Добавление нового основания к растущей олигонуклеотидной цепи происходило в четыре стадии: 1) снимали защитную группу с 5' кислородного атома иммобилизованного нуклеотида с помощью трихлоруксусной кислоты; 2) иммобилизованные и следующий по порядку в последовательности нуклеотиды связывали с применением тетразола; реакция идет через тетразолил фосфорамидитный интермедиат; 3) непрореагировавшие свободные нуклеотиды и побочные продукты реакции отмывали, а непрореагировавшие иммобилизованные олигонуклеотиды кэпировали, чтобы предотвратить их участие в следующем раунде синтеза; кэширование проводили ацетилированием свободной 5' гидроксильной группы с применением уксусного ангидрида и N-метилимидазола; 4) для того, чтобы стабилизировать связь между нуклеотидами, атом фосфора окисляли иодом в воде, если надо получить фосфодиэфирную связь, или используя реагент Бокажа (Beaucage) (3Н-1,2-бензодитиол-3-он-1,1-диоксид), если требуется фосфоротиоатная связь. Чередуя два окисляющих агента, можно построить химерный скелет. Описанные выше четыре стадии повторяли для каждого нуклеотида в последовательности. Когда была синтезирована полная последовательность, олигонуклеотид отщепляли от твердой подложки и снимали защитные группы с помощью гидроксида аммония при высокой температуре. Защитные группы отмывали, удаляя соли, а оставшиеся олигонуклеотиды лиофилизировали.

Обработка клеток Hek293 различными киРНК для определения количества BDNF мРНК

1. Клетки Hek293 из АТСС (cat# CRL-1573) выращивали в среде MEM/EBSS (Hyclone cat #SH30024) + 10% FBS + пенициллин + стрептомицин при 37°С в атмосфере, содержащей 5% СО2. За день до эксперимента клетки пересевали при плотности 5×105/лунка в 6-луночные планшеты и инкубировали при 37°С и 5% СО2.

2. В день эксперимента среду в 6-луночных планшетах заменяли на свежую среду MEM/EBSS + 10%FBS.

3. Все BDNF-AntagoNAT (антисмысловой олигонуклеотид BDNF-AS) разводили до концентрации 20 мкМ, a BDNF-AS киРНК (киРНК, комплементарную BDNF-AS) до концентрации 10 мкМ; оба олигонуклеотидных соединения получали в компании IDT. 2 мкл этого раствора инкубировали с 400 мкл среды Opti-MEM (Gibco cat#31985-070) и 4 мкл липофектамина (Lipofectamine) 2000 (Invitrogen cat# 11668019) при комнатной температуре в течение 20 мин и по каплям прибавляли в одну лунку 6-луночных планшетов с клетками HepG2. Аналогичную смесь, содержащую 2 мкл воды вместо раствора олигонуклеотидов, применяли в контрольных опытах, имитирующих трансфекцию (с ложной трансфекцией).

4. После инкубации в течение 3-18 час при 37°С и 5% СО2 среду заменяли на свежую среду MEM/EBSS + 10% FBS + пенициллин + стрептомицин.

5. Через 48 час. добавляли антисмысловые олигонуклеотиды. Затем среду удаляли и из клеток экстрагировали РНК, используя систему выделения тотальной РНК SV Total RNA Isolation System от корпорации Promega (cat# Z3105) или набор для выделения тотальной РНК RNeasy Total RNA Isolation от фирмы Qiagen (cat#74181) в соответствии с инструкциями производителя.

6. Для осуществления реакции обратной транскрипции с применением случайных гексамеров добавляли 200-400 нг экстрагированной РНК, 2.5 мМ смесь dNTP, MgCl2 и соответствующего буфера. кДНК (20-40 нг) из этой реакции обратной транскрипции брали для контроля генной экспрессии с помощью ПЦР в реальном времени, применяя смесь для экспрессии генов ABI Taqman Gene Expression Mix (cat#4369510) и 300 нМ прямого и обратного праймеров и 200 нМ зонда в конечном объеме реакционной смеси 15 мкл. Дизайн праймеров/зондов определяли, используя программу FileBuilder (Applied Biosystem). Праймеры были нитеспецифическими по отношению к парам смысловой-антисмысловой олигонуклеотид, а зонды перекрывали границы экзонов, чтобы исключить возможность амплификации геномной ДНК. ABI анализ для человеческого BDNF представлял собой анализ экспрессии генов Applied Biosystems Taqman Gene Expression Assay: Hs00542425_sl (BDNF) от Applied Biosystems Inc., Foster City CA). Использовали следующий цикл ПЦР: 50°С в течение 2 мин, 95°С в течение 10 мин, 40 циклов (95°С в течение 15 секунд, 60°С в течение 1 мин) на приборе GeneAmp 7900 Machine (Applied Biosystems). Кратность изменения экспрессии генов после обработки антисмысловыми олигонуклеотидами рассчитывали на основании разницы 188-нормализованных величин dCt между обработанными образцами и образцами, подвергшимися ложной (имитации) трансфекции.

7. Олигонуклеотиды для детекции BDNF-AS:

ABI анализ ID Hs00417345_m1

Последовательность по изобретению GCACACCTGGAGATACTCTATTATA (SEQ ID No.: 65)

8. Олигонуклеотиды для детекции BDNF:

ABI анализ ID Hs00542425_s1

CCTGCAGAATGGCCTGGAATTACAA (SEQ ID No.: 66)

Олигонуклеотиды для детекции BDNF-AS: ABI анализ ID Hs00417345_m1

Последовательность по изобретению GCACACCTGGAGATACTCTATTATA (SEQ ID No.: 65)

Олигонуклеотиды для детекции BDNF:

ABI анализ ID Hs00542425_s1

CCTGCAGAATGGCCTGGAATTACAA (SEQ ID No.: 66)

9. Результаты получены с учетом предельных значений цикла (Ct). Разница между значениями Ct для экспериментальных и эталонных генов (18S RNA) рассчитывается в виде ddCt и изображается на графике в процентах каждой РНК по сравнению с калибровочным стандартом.

Результаты: Трансфекция нескольких клеточных линий человеческого и мышиного происхождения, включая клетки HEK293T, при использовании различных киРНК, которые нацелены на неперекрывающиеся области BDNF-AS транскрипта, показала 2-6-кратную положительную (повышающую) регуляцию (повышение экспрессии) BDNF транскрипта (Фигура 1а и Фигура 6) через 48 час. Положительная регуляция BDNF не была связана с выбором эндогенного контроля (Фигура 5а-b). Положительная регуляция не влияла на регуляцию других соседних генов BDNF (Фигура 9).

На Фигуре 5 показано, что нокдаун BDNF-AS приводит к положительной регуляции (повышению экспрессии) BDNF мРНК. Нокдаун BDNF-AS, с применением киРНК-1 (10 нМ), нацеливающей на неперекрывающуюся область BDNF-AS транскрипта, вызвал 6-кратное повышение экспрессии BDNF (смысловой) мРНК (****=Р<0.0001). Результаты, приведенные в настоящем изобретении, получены в экспериментах на клетках НЕК293Т с применением бета актина (левый рисунок) или 18S рРНК (правый рисунок) в качестве эндогенных контрольных веществ и образца ложной (имитации) трансфекции в качестве эталонного образца. Предполагается, что этот эксперимент показывает, что выбор калибровочного стандарта (эталонного образца) не меняет наблюдаемое повышение экспрессии BDNF мРНК.

На Фигуре 6 показана посттрансляционная регуляция экспрессии Bdnf. Клетки N2a трансфецировали при использовании комбинации mBdnf-AntagoNAT9, нацеленного на мышиный Bdnf-AS транскрипт, и Drosha киРНК, нацеленной на белок Drosha, который участвует в процессировании микроРНК (миРНК). Положительную регуляцию Bdnf мРНК наблюдали после обработки клеток с помощью mBdnf-ANtagoNAT9 (*** = значение р<0.0001). Добавление Drosha киРНК минимально повышало количество транскрипта Bdnf по сравнению с обработкой mBdnf-AntagoNAT9 (* = значение р<0.05). Этот опыт позволяет предположить участие других посттрансляционных механизмов в регуляции Bdnf транскрипта, например, миРНК.

На Фигуре 9 показано, что нокдаун BDNF-AS не изменяет уровень ни TrkB, ни соседних генов BDNF (Let7C и KTF18A) в обоих направлениях: LIN7C и KIF18A представляют собой гены, расположенные в 3' направлении и в 5' направлении от BDNF, соответственно. Тирозинкиназный рецептор типа 2 (TrkB) кодирует мембраносвязанный рецептор для BDNF и локализован на другой хромосоме (Chr-9) по сравнению с BDNF. Изучался вопрос: изменяются ли эти гены в результате элиминации BDNF-AS транскрипта. Клетки HEK293T трансфецировали с помощью контрольной киРНК или BDNF-AS киРНК и количественно определяли уровни транскриптов. Наблюдали отрицательную регуляцию BDNF-AS транскрипта и положительную регуляцию BDNF мРНК, как показано в другом месте данной заявки. Было найдено, что нокдаун BDNF AS не оказывает влияния на экспрессию TrkB или соседних генов Let7C и KIF18A. Эти результаты наводят на мысль, что при элиминации BDNF-AS происходит локус-специфическое изменение экспрессии BDNF.

Обработка клеток Hek293 одной киРНК в течение 0-96 час с целью определения количества BDNF и BDNF-AS в зависимости от времени

Методика обработки была такая же, как при обработке клеток Hek293 с помощью киРНК, но в этом эксперименте клетки собирали за время от 0 до 96 час после добавления олигонуклеотидов.

Результаты: Изучение зависимости экспрессии BDNF и BDNF-AS от времени показало, что оптимальная положительная регуляция BDNF, вызванная киРНК, наблюдается через 48 час. одновременно с оптимальной отрицательной регуляцией BDNF-AS (Фигура 1b).

Обработка клеток Hek293 различными hBDNF-AntagoNATs с целью определения количества BDNF и BDNF-AS

Методика обработки была такая же, как при обработке клеток Hek293 с помощью киРНК, но в этом эксперименте клетки обрабатывали с помощью AntagoNATs.

Результаты: Транскрипт BDNF-AS содержал область, перекрывающую 225 нуклеотидов, которая полностью комплементарна BDNF мРНК. Взаимодействие РНК-РНК может быть ответственно за несогласованную (дискордантную) регуляцию BDNF при использовании его антисмыслового транскрипта. Для того чтобы определить роль BDNF-AS в регуляции BDNF мРНК, для блокирования взаимодействия между смысловыми и антисмысловыми транскриптами применяли гэпмеры (AntagoNATs), содержащие как LNA-, так и 2'ОМе-модификации РНК. Перекрывающаяся область охватывалась заполнением hBDNF-AntagoNATs. Было найдено, что применение hBDNF-AntagoNATs повышает экспрессию (положительно регулирует) BDNF мРНК. Наблюдалась минимальная отрицательная регуляция BDNF-AS транскрипта, которая не предполагалась для содержащих 2'ОМе-РНК блокирующих олигонуклеотидов. Были изучены 16 hBDNF-AntagoNATs, и было найдено, что блокирующая первую половину BDNF-AS перекрывающаяся область оказывала большое воздействие на положительную регуляцию BDNF мРНК. Конкретно, hBDNF-AntagoNATl и hBDNFAntagoNAT4 вызывали заметную экспрессию (положительная регуляция) BDNF мРНК. В отличие от синтетических киРНК антисмысловые олигонуклеотиды являются однонитевыми и могут быть короче, поэтому уменьшается неспецифическое (нецелевое) связывание. Олигонуклеотиды, модифицированные с помощью однонитевых закрытых нуклеиновых кислот (LNA), как правило, являются более эффективными in vivo по сравнению с немодифицированными киРНК (Фигура 7).

Обработка клеток N2a мыши различными mBDNF-AntagoNATs с целью определения количества BDNF и BDNF-AS

Использовали такую же методику, как и при обработке клеток Hek293 различными hBDNF-AntagoNATs для определения количества BDNF и BDNF-AS, но в этом эксперименте клетки представляли собой клетки N2a. Также использовали следующий цикл ПЦР: 50°С в течение 2 мин, 95°С в течение 10 мин, 50 циклов (95°С в течение 15 секунд, 60°С в течение 1 мин) на приборе GeneAmp 7900 (Applied Biosystems).

Результаты, приведенные на Фигуре 8, показывают, что при использовании AntagoNATs происходит ингибирование мышиного Bdnf-AS транскрипта в клетках N2a: что блокирование области перекрытия между смысловым и антисмысловым транскриптами человеческого BDNF повышает уровни экспрессии (положительную регуляцию) BDNF мРНК. Затем изучали, действительно ли в мышиной линии клеток действует аналогичный регуляторный механизм, и тестировали 11 mBdnf-AntagoNATs, которые нацелены на мышиный Bdnf-AS транскрипт. mBdnf-AntagoNATs включают фосфоротиоатный скелет и три LNA-модифицированных нуклеотида как на 3', так и на 5' конце. Контрольные олигонуклеотиды имеют аналогичные скелет и модификации, но не нацелены ни на какую-либо последовательность в геномах млекопитающих. Два mBdnf-AntagoNATs (mBdnf-AntagoNAT3 и mBdnf-AntagoNAT-9) обладали способностью повышать уровни Bdnf мРНК в клетках N2a. Итак, блокирование мышиного Bdnf-AS транскрипта с помощью однонитевых AntagoNATs (16-мерных) вызывало повышение уровней (положительную регуляцию) Bdnf мРНК в клетках N2a мыши. Эти результаты говорят о том, что антисмысловой транскрипт Bdnf оказывает подавляющее (ингибирующее) действие на Bdnf мРНК.

Обработка клеток Hek293 различными киРНК с целью количественного определения BDNF белка

Методика обработки была такая же, как при обработке клеток Hek293 с помощью различных киРНК с целью определения количества BDNF мРНК за исключением стадии 5, которую проводили через 48 час после добавления киРНК. Затем удаляли среду и клетки разрушали и количественно определяли в них уровень BDNF белка методом ELISA (Фигура 1с) и Вестерн-блоттингом (Фигура 1d).

Вестерн-блоттинг: клетки НЕК293Т трансфецировали с применением 10 нМ BDNF-AS или контрольной киРНК. Клетки разрушали через 48 час после трансфекции в 200 мкл буфера Лэммли для образцов (Biorad), содержащего 350 мМ DTT. 20 мкл лизата разделяли электрофорезом в полиакриламидном геле с 10% додецилсульфата натрия (SDS PAGE) и переносили на нитроцеллюлозную мембрану в течение ночи. Затем мембрану инкубировали с первичным антителом для МесР2 (Abcam), BDNF (Promega, номер в каталоге G164B) и вторичным антителом, конъюгированным с HRP. После добавления HRP субстрата с помощью рентгеновской пленки детектировали сигнал хемилюминесценции (пероксидазную метку). Ту же самую мембрану разрезали на полоски и повторно использовали для обнаружения β-актина в качестве контроля нагрузки.

ELISA: Клетки трансфецировали с помощью 20 нМ BDNF-AS киРНК или контрольной киРНК. Клеточный супернатант собирали для ELISA экспериментов. Или же тотальный белок экстрагировали из тканей головного мозга мышей, погруженных в буфер для экстракции белка плюс ингибиторы протеаз (набор ВСА, Fisher), и гомогенизировали на приборе для дезинтеграции Bioruptor в присутствии металлических бус. Тотальный белок определяли количественно, используя набор ВСА для анализа белка (Pierce номер по каталогу 23227), и нагрузку (количество образца) нормализовали по концентрациям тотального белка. Наборы ELISA: для человеческого BDNF получали от Promega (номер по каталогу G7611), а для мышиного Bdnf-от Millipore (номер по каталогу CYT306), и проводили анализ ELISA в соответствии с протоколом фирмы-поставщика. Среднее значение оптической плотности определяли в трех повторностях при 450 нм, вычитали фоновое значение и нормализовали по контрольному образцу.

Обработка клеток Hek293 (not sure) с помощью mBDNF-AntagoNAT9 в различных концентрациях с целью количественно определить BDNF мРНК

Методика обработки была такая же, как при обработке клеток Hek293 с помощью различных киРНК с целью определения количества BDNF мРНК за исключением стадии 3, в которой весь mBDNF-AntagoNAT9 разводили до разной концентрации с тем, чтобы конечную из 11 различных концентраций добавить к клеткам (серийные разведения 1:3 в интервале от 300 нМ до 5 пМ), используя пропорциональное количество (в той же пропорции) Липофектамина 2000 (Invitrogen cat#11668019), как при обработке клеток Hek293 различными киРНК для определения количества BDNF мРНК, используя такой же объем среды Opti-MEM (Gibco cat#31985-070). Операцию проводили при комнатной температуре в течение 20 мин и полученные смеси по каплям прибавляли в одну из лунок 6-луночных планшетов с клетками HepG2. Аналогичную смесь, содержащую воду вместо раствора олигонуклеотида, использовали в качестве контроля с имитацией трансфекции (имитирующего контроля).

Результаты: Как показано на Фигуре 1е, наблюдается зависимая от дозы повышающая регуляция BDNF, когда на BDNF-AS нацелен mBDNF-AntagoNAT9.

На Фигуре 1 показана опосредуемая антисмысловым соединением регуляция смысловой мРНК и белка. (А) Нокдаун природного антисмыслового транскрипта мозгового нейротрофического фактора (BDNF), BDNF-AS, в клетках HEK293T (n=12 на обработку) при использовании каждой из трех уникальных киРНК (10 нМ), нацеленных на неперекрывающуюся область BDNF-AS транскрипта, вызывал 2-6-кратную положительную регуляцию BDNF (смыслового) мРНК (n=6 для каждой экспериментальной точки/обработка ***=Р<0.001, **=Р<0.01). Аналогичные результаты получали в экспериментах на клетках человеческих кортикальных нейронов (HCN), клетках глиобластомы (MK059), мышиных клетках N2a и нейросферах (результаты не показаны). В качестве контрольных использовали последовательности скремблированной, ложно трансфецированной и контрольной киРНК. Контрольной киРНК для этого и других экспериментов является инертная киРНК (CCUCUCCACGCGCAGUACATT), которая не нацелена ни на одну известную последовательность в геноме млекопитающих. Все результаты измерений были нормализованы по 18S рРНК и изображались на графике в процентах каждой РНК по сравнению с калибровочным стандартом.

(Б) Изменения в уровне BDNF и BDNF-AS транскриптов определяли в зависимости от времени, после нокдауна BDNF-AS (n=6 для каждой экспериментальной точки/обработки). киРНК-опосредованный нокдаун человеческого BDNF-AS вызывал эффективную и устойчивую отрицательную регуляцию BDNF-AS через 6 час и кончая моментом через 72 часа после нокдауна. Уровни BDNF мРНК повышались через 18 час, оставаясь высокими в течение более 72 час, и возвращались к уровням перед обработкой через 96 час. Следует отметить, что пик через 48 часов является устойчивым и воспроизводимым. Хотя нокдаун BDNF-AS начинается через 6 часов, положительная регуляция BDNF начиналась через 18 час после обработки. В течение этой задержки во времени (временного лага) между элиминацией BDNF-AS и повышением уровня BDNF мРНК наблюдается последовательный порядок событий, указывающий на то, что клеткам требуется время для адаптации к удалению антисмыслового транскрипта перед положительной регуляции BDNF.

(В) Опосредуемый киРНК нокдаун BDNF-AS транскрипта вызвал повышение уровней белка BDNF, количественно определяемых методом ELISA. Клетки трансфецировали с помощью 10 нМ двух активных киРНК для BDNF-AS, скремблированных киРНК или контрольной киРНК в течение 48 часов. Супернатанты этих клеток концентрировали и анализировали на BDNF белок методом ELISA, используя имеющийся в продаже набор. Уровень BDNF белка значительно повышался (n=6 на обработку, ***=р<0.0001, **=Р<0.001) при нацеливании киРНК на BDNF-AS транскрипт.

(Г) Вестерн-блоттинг подтвердил, что нокдаун "небелкового кодирования" BDNF-AS, при использовании BDNF-AS киРНК1, но не контрольного ненацеливающего (ненаправленного) киРНК транскрипта, повышал уровни BDNF белка, не изменяя уровни бета-актина. В целом эти результаты наводят на мысль, что существует дискордантная взаимосвязь между смысловыми и антисмысловыми BDNF транскриптами, в силу которой BDNF-AS подавляет экспрессию BDNF мРНК и белка. Устранение этого эффекта отрицательной (понижающей) регуляции, при использовании BDNF-AS нокдауна, вызывает положительную (повышающую) регуляцию уровней BDNF мРНК и белка.

(Д) Дозозависимое повышение уровня Bdnf после элиминации Bdnf-AS: эксперименты по определению зависимости "доза-эффект" проводили, готовя образцы, содержащие 11 различных концентраций (серийные разведения 1:3 в интервале от 300 нМ до 5 пМ) mBdnf-AntagoNAT9 (n=6 на экспериментальную точку /обработку), и наблюдали зависимое от дозы повышение уровней Bdnf мРНК при концентрации 1-300 нМ с ЕС50 6.6 нМ.

Обработка нейросфер из клеток гиппокампа с помощью киРНК

Извлечение (иссечение) нервных стволовых клеток нейросфер гиппокампа у мышей: Нервные стволовые клетки выделяли из гиппокампа детенышей мышей Р0-Р1. Гиппокампы механически диссоциировали на отдельные клетки, собирали посредством кратковременного центрифугирования и выращивали в смеси сред DMEM и F12, содержащей глутамин, антибиотики, раствор В27, и как EGF, так и FGF с концентрацией 0.001 мМ. Через 3-4 дня появлялись плавающие нейросферы. 100,000 клеток засевали в 24-луночные планшеты с иммобилизованным поли-L-лизином (PLL). После посева клеток нейросфер на PLL начинался процесс дифференцировки. На третий день после посева из среды удаляли факторы роста и оставляли клетки расти еще в течение 4 дней (7 дней после посева). К этому времени клеточная культура содержала смесь клеточных линий, состоящую из астроцитов, нейронов, олигодендроцитов и их предшественников, делающих ее более похожей на зрелую ткань головного мозга. Экспрессию Bdnf и Bdnf-AS количественно определяли в плавающих нейросферах как на 3, так и на 7 день после засевания культур. Эксперименты, связанные с нокдауном, проводили на 3 или 7 день после посева с использованием либо 50 нМ киРНК, либо 20 нМ антисмысловых олигонуклеотидов, нацеленных на Bdnf-AS транскрипт. Нервные стволовые клетки также засевали в камере для иммуноцитохимических исследований (18,000 клеток на лунку) с общим объемом 80 мкл. Затем нейросферы трансфецировали в соответствии с тем же самым протоколом, для оценки действия нокдауна Bdnf-AS на функции примированных мышиных клеток. Через 48-72 час клетки фиксировали параформальдегидом (4%) в течение 20 мин и несколько раз отмывали с помощью IX PBS. После блокирования посредством FBS нейросферы инкубировали в течение ночи с первичным антителом (моноклональным кроличьим антителом к β тубулину III, TUJ1) в концентрации 1:2000. Фиксированные клетки инкубировали со вторичным антителом, меченным с помощью Alexafluor 568 (антителом козы против кроличьего IgG, 2 мг/мл, с концентрацией 1:5000). Ядра окрашивали красителем Хёхст. Изображения получали детекцией антигена методом иммунофлуоресцентной микроскопии.

Нацеливание AntagoNATs на BDNF-AS:

В данном контексте термин AntagoNAT применяется для описания однонитевых олигонуклеотидных молекул, которые ингибируют взаимодействие смысловых-антисмысловых последовательностей (с различными модификациями, см. дополнительные методы). Были созданы однонитевые гэпмеры, олигонуклеотиды длиной 14 нуклеотидов, содержащие модификации в виде 2'O-Метил РНК и/или закрытых нуклеиновых кислот (LNA). Применяя такую стратегию, мы покрыли (охватили) всю перекрывающуюся область транскриптами человеческого BDNF-AS и BDNF и идентифицировали несколько эффективных AntagoNATs, способных положительно регулировать BDNF мРНК. hBDNF-AntagoNATl и hBDNF-AntagoNAT4, нацеленные на первый участок перекрывающейся области, вызывал наиболее сильный отклик. Результаты показывают, что блокады антисмысловой РНК BDNF с помощью однонитевых AntagoNATs достаточно для того, чтобы вызвать повышение уровней BDNF мРНК.

Затем был создан однонитевой гэпмер, LNA-модифицированный, 15 ДНК олигонуклеотидов (AntagoNATs), длиной 16 нуклеотидов с фосфоротиоатным скелетом, комплементарный мышиному Bdnf-AS транскрипту. Два AntagoNATs (mBdnf-AntagoNAT3 и mBdnf-AntagoNAT9) систематически показывали статистически значимое повышение уровней Bdnf мРНК в мышиных клетках N2a (Фигура 7).

На Фигуре 7 показано ингибирование человеческого BDNF-AS транскрипта с помощью hBDNFAntagoNAT: BDNF-AS транскрипт содержит область, перекрывающую 225 нуклеотидов, которая полностью комплементарна BDNF мРНК. Взаимодействия РНК-РНК могут быть ответственны за дискордантную регуляцию BDNF с помощью антисмыслового транскрипта. Для того, чтобы определить значение BDNF-AS в регуляции BDNF мРНК, гэпмеры (AntagoNATs), содержащие как LNA-, так и 2'ОМе РНК- модификацию, применяли для блокирования взаимодействия между смысловым и антисмысловым транскриптами. Перекрывающуюся область охватывали (покрывали), "разбивая" hBDNF-AntagoNATs. Было найдено, что применение hBDNF-AntagoNATs положительно регулирует (повышает экспрессию) BDNF мРНК. Наблюдалась минимальная понижающая регуляция BDNF-AS транскрипта, которую не предполагали для 2'ОМе-РНК-содержащих блокирующих олигонуклеотидов. Тестировали 16 hBDNF-AntagoNATs (14-меры, каждый из которых имеет последовательность, приведенную ниже), и было найдено, что блокирование первой половины перекрывающейся области BDNF-AS оказывало более сильное воздействие на положительную регуляцию BDNF мРНК. Конкретно, hBDNF-AntagoNAT 1 и hBDNFAntagoNAT4 вызывали заметную положительную регуляцию BDNF мРНК. В отличие от синтетических киРНК антисмысловые олигонуклеотиды являются однонитевыми и могут быть короче; следовательно, уменьшаются уровни неспецифического (нецелевого) связывания. Однонитевые олигонуклеотиды, модифицированные с помощью закрытых нуклеиновых кислот (LNA), как правило, более эффективны in vivo по сравнению с немодифицированными киРНК. Положительная регуляция Bdnf повышает рост нейронов.

Положительная регуляция Bdnf повышает рост нейронов:

В соответствии со многими более ранними сообщениями, в которых указывается на стимулирующее воздействие Bdnf на рост нейронов и нейрогенез у взрослых 16-17 лет, было найдено, что повышение уровня Bdnf, обусловленное нокдауном Bdnf-AS транскрипта, приводило к увеличению числа нервных клеток (нейронов) и к росту и созреванию аксонов (нейритов) на 3 и на 7 день после засевания в виде нейросфер (Фигуры 5a-d). Эти результаты наводят на мысль, что положительная регуляция эндогенного Bdnf, вследствие ингибирования антисмысловой РНК, индуцирует нейрональную дифференцировку предшественников нервных клеток и может обусловить дефинитивный фенотип нейронов в момент образования.

Результаты: На Фигуре 2 показано, что положительная регуляция Bdnf повышает нейрональный рост (А-В) Полученные при иммуноцитохимическом анализе изображения нейросфер гиппокампа, обработанных либо контрольной киРНК (А), либо Bdnf-AS киРНК (В) 3 день после засевания. (C-D) Полученные при иммуноцитохимическом анализе изображения созревания нейронов и роста нейритов в нейросферах гиппокампа, обработанных либо контрольной киРНК (С), либо Bdnf-AS киРНК (D) 7 день после засевания. Обработка клеток с помощью киРНК, нацеленной на Bdnf-AS транскрипт, привела к повышению числа нервных клеток, а также к интенсификации роста и созревания нейритов как на 3, так и на 7 день после засевания нейросфер. Р-Тубулин III окрашивал ядра клеток красным, GFAP окрашивал зеленым и DAPI окрашивал синим.

Интрацеребровентрикулярная (ICV) доставка mBDNF- AntagoNAT9 с помощью миниосмотических насосов вызывает нокдаун BDNF-AS и положительную регуляцию BDNF.

Исследование на мышах: Для экспериментов in vivo брали 10 самцов мышей C57BL/6 в возрасте восемь недель. Мышей готовили, имплантируя подкожно в задний рог третьего желудочка головного мозга постоянную канюлю, связанную с миниосмотическим насосом, который обеспечивал непрерывную инфузию (0.11 микролитров/час) синтетического антисмыслового олигонуклеотида, направленного на Bdnf-AS (mBdnf-AntagoNAT9), или контрольного олигонуклеотида (инертной последовательности, которая отсутствует у человека или у мыши) в дозе 1.5 мг/кг/день в течение 4 недель. Система для внутривенных инфузии была связана с выходным отверстием миниосмотического насоса и шла подкожно к постоянной канюле, таким образом, что лекарственные средства доставлялись непосредственно в мозг. На 5 день после имплантации, и в течение пяти последующих дней, всем животным стали ежедневно вводить BrdU (80 мг/кг) в виде интраперитонеальной (IP, внутрибрюшинной) инъекции. На 28 день после хирургического вмешательства животных умерщвляли и из головного мозга каждой мыши извлекали ткани трех органов (гиппокампа, лобной доли и мозжечка) для количественных измерений РНК.

Нокдаун Bdnf-AS повышает уровень Bdnf in vivo:

Для интрацеребровентрикулярной (ICV) доставки mBdnf-AntagoNAT9 6 мышам C57BL применяли миниосмотические насосы. Затем выбирали mBdnf-AntagoNAT9, который бы был нацелен на неперекрывающуюся область Bdnf-AS мыши, путем сравнения его с другими AntagoNATs на основании его высокой эффективности по повышению уровней Bdnf мРНК in vitro. Через 28 дней непрерывной инфузии AntagoNAT уровни Bdnf мРНК были повышенными в областях переднего мозга, прилегающих к третьему желудочку, у мышей, получавших mBdnf-AntagoNAT9, по сравнению с неизменившимися уровнями у мышей, получавших инертный контрольный олигонуклеотид (Фигуры 3a, b). Bdnf и Bdnf-AS транскрипты не изменились в гипоталамусе, структуре, которая не непосредственно связана с третьим желудочком (Фигура 3с). Помимо этого, было найдено, что блокада Bdnf-AS, опосредуемая AntagoNAT, приводит к повышенным уровням Bdnf белка (Фигуры 3d, e). Полученные результаты согласуются с результатами in vitro, описанными выше, и показывают, что блокада Bdnf-AS приводит к повышению уровней экспрессии Bdnf мРНК и белка in vivo.

Экстракция РНК и RT-ПЦР в образцах головного мозга мышей: Мышей подвергали эвтаназии через 28 дней и головной мозг извлекали. Одну половину головного мозга каждой мыши фиксировали в 4% растворе формальдегида в течение ночи для гистологических исследований. Другую половину мозга извлекали для количественных измерений РНК в гиппокампе, лобной доле и мозжечке. РНК экстрагировали после гомогенизации в тризоле (реагент Trizol, Invitrogen, 15596-026) в соответствии с протоколом производителя. Водную фазу отделяли и добавляли равный объем 70% этанола, а затем пропускали через колонки Qiagen RNeasy (QIAGEN, 74106), и эти образцы РНК подвергали обработке на колонке с ДНКазой для удаления примесей ДНК. 400 нг каждого образца применяли для синтеза первой нити кДНК, и проводили RT-ПЦР измерения. Изменения в процентах уровней РНК для отдельных тканей построили в виде диаграмм по сравнению с контрольными мышами в каждой диаграмме.

Результаты: На Фигуре 3 показано, что Bdnf-AS регулирует уровни Bdnf мРНК и белка in vivo; (А-С) С применением миниосмотических насосов непрерывно, в течение 28 дней, осуществляли вливание (инфузию) mBdnf-AntagoNAT9 (CAACATATCAGGAGCC) или контрольного олигонуклеотида (CCACGCGCAGTACATG) в третий желудочек головного мозга мышей (n=5 на подопытную группу животных *=Р<0.05, **=Р<0.01, ***=Р<0. 0 0 1) Повышение уровней Bdnf в гиппокампе (А) и в лобной доле (В) вызывал только mBdnf-AntagoNAT9, направленный против Bdnf-AS, но не контрольный олигонуклеотид. В гипоталамусе (С) оба транскрипта были неизменными, как и ожидалось от ткани органа, который не связан непосредственно с третьим желудочком головного мозга. (D-E) Уровни BDNF белка определяли методом ELISA, было найдено, что инфузия mBdnf-AntagoNAT9 приводит к повышению уровней BDNF белка как в гиппокампе (D), так и в лобной доле (Е), по сравнению с мышами, получавшими контрольный олигонуклеотид.

Интрацеребровентрикулярная (ICV) доставка mBDNF-AntagoNAT9 с помощью миниосмотических насосов вызывает нокдаун BDNF-AS и положительную регуляцию BDNF.

Мышам, которым в первую неделю исследования в течение пяти дней вводили mBdnf-AntagoNAT9, инъецировали BrdU. После 28 дней непрерывной инфузии AntagoNAT проводили гистологическое исследование тканей головного мозга и количественно определяли пролиферацию и выживаемость нервных клеток с применением Ki67 и BrdU маркеров, соответственно. У мышей, получавших mBdnf- AntagoNAT9, наблюдалось увеличение Ki67 позитивных (пролиферирующих) клеток по сравнению с мышами, получавшими контрольные олигонуклеотиды (Фигуры 4а, b). В результате определения количества Ki67 позитивных клеток было найдено значительное повышение уровня клеточной пролиферации у мышей, которым вливали mBdnf-AntagoNAT9, по сравнению с мышами, которые получали контрольные олигонуклеотиды (Фигура. 4с). У мышей, которым вливали mBdnf-AntagoNAT9, было обнаружено значительное увеличение BrdU включения (выжившие клетки) по сравнению с мышами, получавшими контрольные олигонуклеотиды (Фигура 4d). Между объемом гиппокампа мышей, получавших контрольные олигонуклеотиды, и мышей, получавших mBdnf-AntagoNAT9, различий не наблюдалось (Фигура 4е). Эти результаты показывают, что Bdnf-AS регулирует уровни Bdnf in vivo.

Результаты: На Фигуре 4 показано, что блокирование Bdnf-AS, in vivo, вызывает повышение выживаемости и пролиферации нейронов; (А-В) мышам вводили mBdnf-AntagoNAT9 или контрольные олигонуклеотиды. После 28 дней непрерывного вливания (инфузии) mBdnf-AntagoNAT9 проводили гистологическое исследование тканей головного мозга с использованием Ki67. Ki67 представляет собой маркер пролиферации клеток в гиппокампе; было обнаружено увеличение числа пролиферирующих клеток у мышей, получавших Bdnf-AntagoNAT, по сравнению с мышами, получавшими контрольные олигонуклеотиды. У мышей, получавших mBdnf-AntagoNAT9 (В), наблюдалось увеличение числа Ki67 позитивных клеток (пролиферирующих клеток) по сравнению с мышами, которым вводили контрольные олигонуклеотиды (А). (С) У мышей, которым вводили mBdnf-AntagoNAT9, наблюдалось значительное увеличение Ki67 позитивных клеток по сравнению с мышами, которым вводили контрольные олигонуклеотиды. (D) У мышей, которым вводили mBdnf-AntagoNAT9, наблюдалось значительное увеличение числа выживших клеток (BrdU позитивных) по сравнению с мышами, которым вводили контрольные олигонуклеотиды. (Е) Между объемом гиппокампа мышей, получавших контрольные олигонуклеотиды, и мышей, получавших mBdnf-AntagoNAT9, различий не наблюдалось. Взятые вместе эти результаты (n=5 на подопытную группу животных *=Р<0.05, ***=Р<0.001) демонстрируют, что Bdnf-AS регулирует уровни Bdnf in vivo и что блокирование взаимодействия Bdnf смысловых-антисмысловых транскриптов вызывает повышение пролиферации и выживаемости клеточных линий нервных клеток (нейрональных клеточных линий).

Хотя изобретение проиллюстрировано и описано по отношению к одному или более способов осуществления изобретения, эквивалентные изменения и модификации придут в голову другим специалистам в данной области техники после чтения и осмысления данного описания и прилагающихся рисунков. Кроме того, хотя конкретный признак изобретения мог быть раскрыт в отношении лишь одного из способов осуществления изобретения, такой признак может быть связан с одним или более других признаков других способов осуществления изобретения, которые желательны и целесообразны для любого данного или специфического применения.

Реферат настоящей заявки позволит читателю быстро уяснить сущность технического описания. Следует указать, что это описание не следует принимать как ограничивающее объем или сущность нижеприведенной формулы изобретения.

1. Способ повышающей регуляции экспрессии полинуклеотида нейротрофического фактора головного мозга (BDNF) в биологической системе, включающий осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, длиной от 10 до 30 нуклеотидов, где указанный по меньшей мере один антисмысловой олигонуклеотид имеет по меньшей мере 90% комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов природного антисмыслового полинуклеотида для полинуклеотида BDNF, причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, что приводит к повышающей регуляции экспрессии полинуклеотида нейротрофического фактора головного мозга (BDNF), при условии, что по меньшей мере один антисмысловой олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55.

2. Способ по п. 1, в котором экспрессия полинуклеотида BDNF увеличиваются in vivo или in vitro по сравнению с контролем.

3. Способ по п. 1, в котором по меньшей мере один антисмысловой олигонуклеотид имеет по меньшей мере 90% комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов нуклеотидной последовательности, содержащей кодирующие и/или некодирующие нуклеотидные последовательности полинуклеотида BDNF.

4. Способ по п. 1, в котором по меньшей мере один антисмысловой олигонуклеотид имеет по меньшей мере 90% комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов перекрывающихся или неперекрывающихся последовательностей полинуклеотида нейротрофического фактора головного мозга (BDNF).

5. Способ по п. 1, в котором по меньшей мере один антисмысловой олигонуклеотид содержит одну или более модификаций, выбранных из по меньшей мере одного модифицированного остатка сахара, по меньшей мере одного модифицированного межнуклеозидного мостика, по меньшей мере одного модифицированного нуклеотида и их комбинации.

6. Способ по п. 5, в котором одна или более модификация выбрана из: (а) 2'-O-метоксиэтил-модифицированного остатка сахара, 2'-метокси-модифицированного остатка сахара, 2'-O-алкил-модифицированного остатка сахара, бициклического остатка сахара и их комбинации; (b) основной цепи из фосфоротиоатных мостиков; (с) модифицированной межнуклеозидной связи, выбранной из фосфоротиоата, 2'-О-метоксиэтила (МОЕ), 2'-фторсодержащего, алкилфосфоната, фосфородитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, триэфирфосфата, ацетамидата, карбоксиметилового эфира, и их комбинации; (d) модифицированного нуклеотида, выбранного из петидилнуклеиновой кислоты (PNA), закрытой нуклеиновой кислоты (LNA), арабинонуклеиновой кислоты (FANA), их аналога, производного и их комбинации, и любой комбинации (а), и/или (b), и/или (с), и/или (d).

7. Способ повышающей регуляции функции полинуклеотида BDNF в биологической системе, включающий: осуществление контакта указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом длиной от 10 до 30 нуклеотидов, при этом указанный по меньшей мере один антисмысловой олигонуклеотид имеет по меньшей мере 90% комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов природной антисмысловой последовательности для полинуклеотида BDNF, причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, что приводит к повышающей регуляции функции полинуклеотида BDNF, при условии, что по меньшей мере один антисмысловой олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55.

8. Способ повышающей регуляции экспрессии полинуклеотида BDNF в клетках или тканях пациента in vivo или in vitro, который включает осуществление контакта указанных клеток пациента или тканей с по меньшей мере одним антисмысловым олигонуклеотидом длиной от 10 до 30 нуклеотидов, при этом указанный по меньшей мере один антисмысловой олигонуклеотид длиной от 10 до 30 нуклеотидов, где указанный по меньшей мере один антисмысловой олигонуклеотид имеет по меньшей мере 90% комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов природного антисмыслового полинуклеотида для полинуклеотида BDNF, причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, что приводит к повышающей регуляции экспрессии полинуклеотида BDNF в клетках или тканях пациента in vivo или in vitro, при условии, что по меньшей мере один антисмысловой олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55.

9. Способ по п. 8, в котором по меньшей мере один антисмысловой олигонуклеотид содержит последовательность, как представлено в любой из SEQ ID NO: 16, 17, 19, 23, 24, 27, 29 и 30.

10. Способ повышающей регуляции экспрессии полинуклеотида BDNF в клетках или тканях млекопитающего in vivo или in vitro, который включает осуществление контакта указанных клеток или тканей с по меньшей мере одним олигонуклеотидом короткой интерферирующей РНК (киРНК) длиной от 19 до 30 нуклеотидов, причем указанный по меньшей мере один олигонуклеотид киРНК является специфичным к природному антисмысловому полинуклеотиду BDNF, при этом указанный по меньшей мере один олигонуклеотид киРНК имеет по меньшей мере 90% комплементарность последовательности с участком в 19-30 нуклеотидов указанного природного антисмыслового полинуклеотида для полинуклеотида BDNF; и повышающей регуляции экспрессии полинуклеотида BDNF в клетках или тканях млекопитающего in vivo или in vitro, где указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из SEQ ID NO: 3, 4, 5, 6, 7, 8, 10 и 11.

11. Способ по п. 10, в котором указанный олигонуклеотид имеет 100% комплементарность указанному природному антисмысловому полинуклеотиду.

12. Олигонуклеотид длиной от 10 до 30 нуклеотидов, имеющий по меньшей мере одну модификацию и/или замещение, причем указанный олигонуклеотид имеет по меньшей мере 90% комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов природного антисмыслового полинуклеотида для полинуклеотида BDNF, причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, при условии, что олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55, где по меньшей мере одну модификацию, выбранную из по меньшей мере одного модифицированного остатка сахара, по меньшей мере одного модифицированного межнуклеозидного мостика, по меньшей мере одного модифицированного нуклеотида и любой их комбинации; и при этом указанный олигонуклеотид представляет собой антисмысловое соединение, которое гибридизуется с и повышает регуляцию экспрессии гена BDNF in vivo или in vitro по сравнению с стандартным контролем.

13. Олигонуклеотид по п. 12, в котором по меньшей мере одна модификация выбрана из (а) межнуклеозидного мостика, выбранного из группы, состоящей из фосфоротиоата, алкилфосфоната, фосфородитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, триэфирфосфата, ацетамидата, карбоксиметилового эфира и их комбинации; (b) основной цепи из фосфоротиоатных мостиков; (с) модифицированной межнуклеозидной связи, выбранной из фосфоротиоата, 2'-O-метоксиэтила (МОЕ), 2'-фторсодержащего, алкилфосфоната, фосфородитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, триэфирфосфата, ацетамидата, карбоксиметилового эфира и их комбинации; (d) 2'-O-метоксиэтил-модифицированного остатка сахара, 2'-метокси-модифицированного остатка сахара, 2'-O-алкил-модифицированного остатка сахара, бициклического остатка сахара и их комбинации.

14. Олигонуклеотид по п. 12, который специфично гибридизуется с и повышает регуляцию экспрессии по меньшей мере одного полинуклеотида BDNF in vivo или in vitro по сравнению со стандартным контролем.

15. Олигонуклеотид по п. 12, который содержит по меньше мере одну из последовательностей, представленных в любой из последовательностей SEQ IDNO: 16, 17, 19, 23, 24, 27, 29 и 30.

16. Фармацевтическая композиция для лечения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом BDNF, содержащая по меньшей мере один олигонуклеотид по п. 12, специфичный к одному или более полинуклеотидам BDNF, и фармацевтически приемлемый эксципиент.

17. Композиция по п. 16, в которой по меньшей мере один олигонуклеотид представляет собой олигонуклеотид, имеющий по меньшей мере примерно 90% комплементарность последовательности любой из нуклеотидных последовательностей, представленных в SEQ ID NO: 16, 17, 19, 23, 24, 27, 29 и 30.

18. Композиция по п. 17, в которой по меньшей мере один олигонуклеотид представляет собой олигонуклеотид, содержащий нуклеотидную последовательность, выбранную из последовательностей, представленных в SEQ ID NO: 16, 17, 19, 23, 24, 27, 29 и 30.

19. Композиция по п. 17, в которой по меньшей мере один олигонуклеотид содержит нуклеотидную последовательность, выбранную из SEQ ID NO: 16 и 19.

20. Композиция по п. 17, в которой по меньшей мере одна модификация и/или замена выбрана из фосфоротиоата, метилфосфоната, молекул петидилнуклеиновой кислоты, закрытой нуклеиновой кислоты (LNA) и их комбинации.

21. Композиция по п. 17, в которой по меньшей мере одна модификация и/или замещение выбрано из: (а) 2'-O-метоксиэтил-модифицированного остатка сахара, 2'-метокси-модифицированного остатка сахара, 2'-О-алкил-модифицированного остатка сахара, бициклического остатка сахара и их комбинации; (b) основной цепи из фосфоротиоатных мостиков; (с) модифицированной межнуклеозидной связи, выбранной из фосфоротиоата, 2'-O-метоксиэтила (МОЕ), 2'-фторсодержащего, алкилфосфоната, фосфородитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, триэфирфосфата, ацетамидата, карбоксиметилового эфира и их комбинации; (d) модифицированного нуклеотида, выбранного из петидилнуклеиновой кислоты (PNA), закрытой нуклеиновой кислоты (LNA), арабинонуклеиновой кислоты (FANA), их аналога, производного и их комбинации, и любой комбинации (а), и/или (b), и/или (с), и/или (d).

22. Способ профилактики или лечения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом BDNF и/или по меньшей мере одним продуктом, который он кодирует, включающий введение пациенту терапевтически эффективной дозы по меньшей мере одного антисмыслового олигонуклеотида длиной от 10 до 30 нуклеотидов, причем указанный по меньшей мере один олигонуклеотид имеет по меньшей мере 90% комплементарность природному антисмысловому полинуклеотиду, причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, при условии, что по меньшей мере один антисмысловой олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55, и повышает регуляцию экспрессии указанного по меньшей мере одного полинуклеотида BDNF, что приводит к профилактике или лечению заболевания, ассоциированного с по меньшей мере одним полинуклеотидом BDNF и/или по меньшей мере одним продуктом, который он кодирует.

23. Способ по п. 22, в котором заболевание, ассоциированное с по меньшей мере одним полинуклеотидом BDNF выбрано из заболевания или расстройства, ассоциированного с аномальной функцией и/или экспрессией BDNF, неврологического заболевания или расстройства, заболевания или расстройства, ассоциированного с нарушенным нейрогенезом; нейродегенеративного заболевания или расстройства (такого как болезнь Альцгеймера, болезнь Паркинсона, болезнь Хантингтона, бокового амиотрофического склероза и т.п.), психоневрологического расстройства (депрессии, шизофрении, шизофреноформного расстройства, шизоаффективного расстройства и бредового расстройства, беспокойства, такого как паническое расстройство, фобий (включая агорафобию), обсессивно-компульсивного расстройства, посттравматического стрессового расстройства, биполярного расстройства, нервной анорексии, нервной булимии), аутоиммунного расстройства (такого как рассеянного склероза) центральной нервной системы, потери памяти, потеря кратковременной или долговременной памяти, умеренной забывчивости, нарушение способности к обучению у детей, закрытой травмы головы, синдрома дефицита внимания, реакции нейронов на вирусную инфекцию, повреждения головного мозга, нарколептической болезни, расстройства сна (такого как расстройства суточного ритма, бессонницы и нарколепсии), разрыва нервов или повреждения нервов, разрыва спинномозгового ствола нерва (CNS) и повреждения нервных и мозговых клеток, неврологическое расстройство, связанное с наличием СПИД, множественного моторного тикового расстройства, характеризующегося моторными и вокальными тиками (такого как синдрома Туретта, хронического моторного или вокального тикового расстройства, временного тикового расстройства и нарушения стереотипного движения), расстройства, связанного с злоупотреблением психотропными веществами (такого как наркологического расстройства, злоупотребления психотропными веществами и осложнений после злоупотребления психотропными веществами/ зависимости от них, такими как психологическое расстройство, вызванное психотропными веществами, синдром отмены и деменция, вызванная употреблением психотропных веществ, или амнестический синдром), травм головного мозга, тиннитуса, невралгии (такой как тригеминальной невралгии), боли (такой как хронической боли, боли при хроническом воспалении, боли, связанной с артритом, фибромиалгии, боли в спине, боли, связанной с раковым заболеванием, боли, связанной с расстройством пищеварения, боли, связанной с болезнью Крона, боли, связанной с аутоиммунным заболеванием, боли, связанной с эндокринным заболеванием, боли, связанной с диабетической нейропатией, фантомной боли в конечностях, самопроизвольной боли, хронической постоперационной боли, хронической боли челюстно-лицевой области, каузальгии, постгерпетической невралгии, боли, связанной с наличием СПИД, комплексного регионального болевого синдрома I и II типа, тригеминальной невралгии, хронической боли в спине, боли, связанной с повреждением спинномозгового нерва, боли, связанной с употреблением лекарств и рецидивирующей острой боли, нейропатической боли), неадекватной активности нейронов, приводящей к нейродистезии при наличии такой болезни как диабет, рассеянный склероз и болезнь двигательного нейрона, атаксии, ригидности мышц (спастичности), синдрома дисфункции височно-нижнечелюстного сустава, синдрома дефицита удовлетворенности (RDS), нейротоксичности, вызванной употреблением алкоголя или психотропных веществ (таких как экстази, метамфетамина и т.п.), умственной отсталости и ухудшения когнитивных способностей (такой как умственной отсталости, вызванной внесиндромной ломкой X-хромосомой, синдром ломкой Х-хромосомы, синдром Дауна, аутизм), афазии, паралича Белла, болезни Якоба-Крейцфельда, энцефалита, возрастной дегенерации макулы, синдрома Ундины, синдрома WAGR, потери слуха, синдрома Ретта, эпилепсии, повреждения спинного мозга, инсульта, гипоксии, ишемии, повреждения головного мозга, диабетической нейропатии, периферической нейропатии, осложнения после трансплантации нервов, болезни двигательного нейрона, повреждения периферических нервов, ожирения, метаболического синдрома, рака, астмы, атопического заболевания, воспаления, аллергии, экземы, нейроонкологического заболевания или расстройства, нейроиммунологического заболевания или расстройства, нейроотологического заболевания или расстройства и заболевания или расстройства, связанного с пожилым возрастом и старением.

24. Применение олигонуклеотида, имеющего нуклеотидную последовательность, выбранную из группы, состоящей из последовательностей SEQ ID NO: 50-55, для нацеливания на природный антисмысловой транскрипт полинуклеотида BDNF, для модуляции экспрессии полинуклеотида BDNF, при этом указанные природные антисмысловые транскрипты выбраны из группы, состоящей из последовательностей, соответствующих SEQ ID NO: 3-11.

25. Применение олигонуклеотида, имеющего нуклеотидную последовательность, выбранную из группы, состоящей из последовательностей SEQ ID NO 50-55, для нацеливания на природный антисмысловой транскрипт полинуклеотида BDNF, для повышения регуляции экспрессии полинуклеотида BDNF, причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из SEQ ID NO: 3, 4, 5, 7, 8, 10 и 11.

26. Способ по п. 1, где повышающая регуляция представляет собой выживаемость нейронов, пролиферацию нейронов или и то и другое.

27. Способ по п. 1, где повышается регуляция экспрессии BDNF полинуклеотида в гиппокампе, лобной доле или и в том и в другом.



 

Похожие патенты:

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к способу получения конъюгата рекомбинантного аналога интерферона бета 1b с полимером олигосахаридной природы.

Предложен способ проведения теста нейтрализации для оценки способности вакцины-кандидата противодействовать инфицированию HCMV (цитомегаловирус человека). Способ включает следующие стадии: (i) смешивание инактивированной нагреванием сыворотки от субъекта, иммунизированного вакциной-кандидатом HCMV, с HCMV, содержащим флуоресцентную метку, для получения смеси; (ii) добавление 2,5% комплемента кролика к смеси со стадии (i); (iii) контакт клетки-хозяина, восприимчивой к инфекции HCMV, где указанная клетка-хозяин представляет собой пигментированную эпителиальную клетку сетчатки клеточной линии ARPE-19, при условиях, подходящих для инфицирования смесью инактивированной нагреванием сыворотки в присутствии комплемента кролика со стадии (ii); (iv) оценку уровня флуоресценции клетки-хозяина, находившейся в контакте с указанной смесью, методом проточной цитометрии; и (v) определение уровня инфицирования клетки-хозяина на основе измеренного уровня флуоресценции.

Предложенное изобретение относится к области биотехнологии. Предложен способ индукции иммунного ответа у индивидуума на чужеродный белковый антиген.

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Изобретение дополнительно относится к применению такой молекулы искусственной нуклеиновой кислоты, кодирующей терапевтические пептиды или белки в медицине при генной терапии и/или генетической вакцинации.

Изобретение относится к области ветеринарной вирусологии и касается штамма вируса инфекционной анемии цыплят. Представленный штамм «ИК-4» выделен из паренхиматозных органов больных анемией цыплят-бройлеров.

Изобретения касаются нуклеиновокислотного средства, конструкта нуклеиновой кислоты, проглатываемой пчелой композиции и способа профилактики или лечения. Выделенное нуклеиновокислотное средство содержит последовательность нуклеиновой кислоты, комплементарную последовательности нуклеиновой кислоты, выбранной из группы, состоящей из SEQ ID NO: 95, 97, 98, 101, 103 и 106.

Изобретение относится к генной инженерии и биотехнологии и может быть использовано для получения химерного белка ангиогенина человека. Предложена рекомбинантная плазмида pPICZaA:ZZ_ANG, содержащая синтетический ген химерного белка ангиогенина человека (SEQ ID NO: 1), состоящего из аминокислотной последовательности двух IgG-связывающих доменов белка A (SEQ ID NO: 2) и ангиогенина человека (SEQ ID NO: 3), соединенных между собой пептидным линкером (SEQ ID NO: 4).

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Изобретение дополнительно относится к применению такой молекулы искусственной нуклеиновой кислоты, кодирующей терапевтические пептиды или белки в медицине при генной терапии и/или генетической вакцинации.
Изобретения касаются модифицированной клетки СНО и способа размножения ортопоксвируса при ее использовании. Представленная клетка модифицирована таким образом, чтобы включать последовательность, кодирующую CP77 под контролем конститутивного промотора, и последовательность, кодирующую D13L и/или K1L также под контролем конститутивного промотора.

Предложенная группа изобретений относится к области биотехнологии. Предложены рекомбинантный вирус птичьего герпеса индейки (rHVT), мультивалентная вакцина его содержащая, набор, содержащий вакцину, предназначенные для вакцинации птиц, а также применение рекомбинантного вируса птичьего герпеса индейки для изготовления вакцинной композиции для иммунизации птиц.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к способу получения конъюгата рекомбинантного аналога интерферона бета 1b с полимером олигосахаридной природы.

Изобретение относится к области биотехнологии, а именно к изолированным цис-регуляторным элементам для придания промотору индуцируемости патогеном, химерному промотору, обладающему индуцируемостью патогеном, рекомбинантному гену для экспрессии в растительной клетке после контакта с патогеном, экспрессирующим вектору для повышения устойчивости растения к патогенам, где патоген представляет собой грибок или оомицет.

Изобретения касаются нуклеиновокислотного средства, конструкта нуклеиновой кислоты, проглатываемой пчелой композиции и способа профилактики или лечения. Выделенное нуклеиновокислотное средство содержит последовательность нуклеиновой кислоты, комплементарную последовательности нуклеиновой кислоты, выбранной из группы, состоящей из SEQ ID NO: 95, 97, 98, 101, 103 и 106.

Изобретение относится к области биохимии, в частности к мутантному растению сорго, содержащему в своем геноме по меньшей мере один полинуклеотид, где указанный полинуклеотид кодирует полипептид, имеющий замену аланина на треонин в положении 93 большой субъединицы белка AHAS сорго, причем указанное растение имеет повышенную устойчивость к одному или более имидазолиноновым гербицидам, к его семени, а также к способу его получения и способу его идентификации.

Изобретение относится к биохимии. Описано антитело для увеличения количества связываний антигена антителом, для улучшения удержания антитела в плазме или для стимулирования захвата антителом антигена в клетке, содержащее антигенсвязывающий домен и FcRn-связывающий домен человека, активность связывания антигена которого отличается в двух различных условиях концентрации кальция и является более низкой в условиях низкой концентрации кальция, чем в условиях высокой концентрации кальция, где низкая концентрация кальция представляет собой концентрацию ионизированного кальция от 0,1 до 30 мкМ, а высокая концентрация кальция представляет собой концентрацию ионизированного кальция от 100 мкМ до 10 мМ, где указанное антитело содержит по крайней мере четыре аминокислоты, выбранные из группы, включающей аминокислоты в положениях 30, 31, 32, 50 и 92 в соответствии с нумерацией по Kabat в легкой цепи, которые обладают хелатирующей активностью в отношении металла.

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Изобретение дополнительно относится к применению такой молекулы искусственной нуклеиновой кислоты, кодирующей терапевтические пептиды или белки в медицине при генной терапии и/или генетической вакцинации.

Изобретение относится к области биохимии, в частности к растению помидора для применения в увеличении производства помидоров, включающему одну или более клеток растения, в которых последовательность эндогенного гена митохондриальной малатдегидрогеназы (mMDH) модифицирована путем вставки и/или делеции таким образом, что активность любого белка mMDH, экспрессируемого из модифицированного гена, снижается, а также к его части.

Изобретение относится к молекулярной биологии, биотехнологии, генной инженерии и медицине и представляет собой средство для лечения состояний человеческого организма, связанных с уменьшением экспрессии гена Р4НА1 и/или уменьшением количества белка пролил 4-гидроксилазы альфа 1, на основе генно-терапевтических субстанций с геном Р4НА1, представляющее собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена Р4НА1, с кодирующей последовательностью белка пролил 4-гидроксилазы альфа 1, с делециями 5'- и 3'-нетранслируемых областей, а именно полученной на основе участка немодифицированной кДНК гена Р4НА1 SEQ ID No: 1, или модифицированной кДНК гена Р4НА1, при этом в качестве модифицированной кДНК гена Р4НА1 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие высокий уровень экспрессии гена Р4НА1 в эукариотических клетках.

Изобретение относится к области биохимии, в частности к способу интегрирования интересующей последовательности нуклеиновой кислоты в ген FAD2 клетки, включающему сайт-специфическое расщепление гена FAD2 клетки растения с использованием нуклеазы с цинковыми пальцами.

Изобретение относится к области биохимии, в частности к способу интегрирования интересующей последовательности нуклеиновой кислоты в ген FAD2 в клетку сои, включающему расщепление сайт-специфическим образом гена FAD2 клетки сои с использованием нуклеазы с «цинковыми пальцами».

Изобретение относится к области биохимии, в частности к генетически модифицированному грызуну, экспрессирующему гуманизированный Т-клеточный рецептор (TCR) и содержащему в геноме своей зародышевой линии: нереаранжированную последовательность вариабельной области TCRα, и/или нереаранжированную последовательность вариабельной области TCRβ, к способу его получения, а также к его выделенной эмбриональной клетке и ткани. Также раскрыт способ получения Т-клеточного рецептора человека к представляющему интерес антигену, а также способ получения Т-клетки со специфичностью против представляющего интерес антигена с использование вышеуказанного грызуна. Изобретение также относится к нуклеиновой кислоте, кодирующей гуманизированный TCRα полипептид, а также к нуклеиновой кислоте, кодирующей гуманизированный TCRβ полипептид. Изобретение позволяет эффективно получать гуманизированный Т-клеточный рецептор. 8 н. и 28 з.п. ф-лы, 19 ил., 4 табл., 10 пр.

Настоящее изобретение относится к биохимии. Описан способ повышающей регуляции экспрессии полинуклеотида нейротрофического фактора головного мозга в биологической системе. Осуществляют контакт указанной биологической системы с по меньшей мере одним антисмысловым олигонуклеотидом, длиной от 10 до 30 нуклеотидов, где указанный по меньшей мере один антисмысловой олигонуклеотид имеет по меньшей мере 90 комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов природного антисмыслового полинуклеотида для полинуклеотида BDNF. Причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы, состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, что приводит к повышающей регуляции экспрессии полинуклеотида нейротрофического фактора головного мозга, при условии, что по меньшей мере один антисмысловой олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55. Также описан аналогичный способ повышающей регуляции функции полинуклеотида BDNF в биологической системе. Также описаны соответствующие способ повышающей регуляции функции полинуклеотида BDNF в биологической системе и способ повышающей регуляции экспрессии полинуклеотида BDNF в клетках или тканях пациента in vivo или in vitro, в том числе млекопитающего. Представлен олигонуклеотид длиной от 10 до 30 нуклеотидов, имеющий по меньшей мере одну модификацию иили замещение, причем указанный олигонуклеотид имеет по меньшей мере 90 комплементарность и специфически гибридизуется с участком в 10-30 нуклеотидов природного антисмыслового полинуклеотида для полинуклеотида BDNF. Причем указанный природный антисмысловой полинуклеотид состоит по существу из последовательности, выбранной из группы состоящей из нуклеотидов: 1-1279 в SEQ ID NO: 3, или 1-1478 в SEQ ID NO: 4, или 1-1437 в SEQ ID NO: 5, или 1-2322 в SEQ ID NO: 6, или 1-2036 в SEQ ID NO: 7, или 1-2364 в SEQ ID NO: 8, или 1-3136 в SEQ ID NO: 9, или 1-906 в SEQ ID NO: 10, или 1-992 в SEQ ID NO: 11, при условии, что олигонуклеотид не имеет последовательность любую из SEQ ID NO: 50-55, где по меньшей мере одну модификацию, выбранную из: по меньшей мере одного модифицированного остатка сахара, по меньшей мере одного модифицированного межнуклеозидного мостика, по меньшей мере одного модифицированного нуклеотида и любой их комбинации. Кроме того, указанный олигонуклеотид представляет собой антисмысловое соединение, которое гибридизуется с и повышает регуляцию экспрессии гена BDNF in vivo или in vitro по сравнению с стандартным контролем. Описана фармацевтическая композиция для лечения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом BDNF, содержащая по меньшей мере один представленный олигонуклеотид, специфичный к одному или более полинуклеотидам BDNF, и фармацевтически приемлемый эксципиент. Также описан способ профилактики или лечения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом BDNF иили по меньшей мере одним продуктом, который он кодирует, включающий введение пациенту терапевтически эффективной дозы по меньшей мере одного представленного олигонуклеотида. 9 н. и 18 з.п. ф-лы, 9 ил., 1 табл., 2 пр.

Наверх