Тест-система для прогнозирования развития рецидивов у больных раком тела матки на основании уровня экспрессии гена esr1


G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2661599:

федеральное государственное бюджетное учреждение "Ростовский научно-исследовательский онкологический институт" Министерства здравоохранения Российской Федерации (RU)

Изобретение относится к молекулярной биологии, онкологии и биотехнологии. Тест-система для прогнозирования рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1 содержит контрольные смеси и смесь для ПЦР-РВ реакции, включающую 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратным красителем EvaGreen Dye, ДНК-полимеразу Thermus aquaticus в количестве 5 ед/мкл и высокоспецифичные олигонуклеотидные праймеры для генов ESR1 и АСТВ. Изобретение обеспечивает простоту и точность прогнозирования рецидивов у пациенток с диагнозом рак тела матки без использования дорогостоящего оборудования, а также высокую чувствительность и специфичность. 1 табл., 2 пр.

 

Изобретение относится к молекулярной биологии, онкологии и биотехнологии и может быть использовано для прогнозирования развития рецидивов по уровню относительной экспрессии гена ESR1 у больных раком тела матки.

Рак тела матки является самой распространенной злокачественной опухолью органов малого таза у женщин (см. World Cancer Report 2014. World Health Organization. Chapter 5.12.) и относится к гормонально-зависимым опухолям. Эндометрий, являясь «тканью-мишенью» для половых гормонов, чрезвычайно чувствителен к действию эстрогенов (см. Causes, Risk Factors, and Prevention TOPICS - Do we know what causes endometrial cancer? - cancer.org - American Cancer Society - Retrieved 5 January 2015).

Биологический эффект эстрогенов реализуется через их взаимодействие с эстрогенными рецепторами, которые, в свою очередь, активируют гены-мишени во многих тканях. Показано, что повышенная экспрессия гена ERα (ESR1) сопровождает процессы онкотрансформации во многих тканях (см. Bardin A., Boulle N., Lazennec G., Vignon F. Loss of ERb expression as a common step in estrogen-dependent tumor progression // Endocrine-Related Cancer. 2004. Vol.11. P. 537-551). Поэтому в качестве маркеров для прогнозирования рецидивов у больных раком тела матки адекватно использовать уровень относительной экспрессии гена эстрогенного рецептора α (ESR1).

Рецидивы являются одной из ведущих причин неудач в лечении рака тела матки и определяют неблагоприятный прогноз заболевания. Частота возникновения рецидивов варьирует от 28 до 40% при железисто-плоскоклеточном раке и до 5-10% при высокодифференцированной аденокарциноме эндометрия (см. Урманчеева А.Ф., Ульрих Е.А., Нейштадт Э.Л. и др. Серозно-папиллярный рак эндометрия (клинико-морфологические особенности. Вопр. онкологии 2002; 48 (6): 679-83.). Более 80% рецидивов возникают в первые 2 года после радикального лечения (см. Кузнецов В.В, Нечушкина В.М. Хирургическое лечения рака тела матки. Практ. онкология 2004; (17): 25-32.). С увеличением промежутка времени после операции прогрессивно снижается вероятность появления местного рецидива. По срокам клинического проявления рецидивы разделяют на ранние, установленные в первые 2 года после операции, и поздние, выявленные в срок более 2 лет (например, через 12 лет). Причинами возникновения ранних рецидивов являются крайне агрессивное течение заболевания, имплантационный путь метастазирования, неадекватный объем хирургического вмешательства. Причины и сроки возникновения поздних рецидивов не определены и достаточно не изучены, но, скорее всего, зависят от биологических особенностей опухоли.

Анализ патентных источников показал наличие следующих (близких по тематике) изобретений.

1) «Способ прогнозирования выживаемости больных эндометриоидным раком тела матки» (см. патент RU №2299690 C1, опубл. 27.05.2007, Бюл. №15): на основе оценки исходного соматического состояния больной и ряда иммуногистохимических параметров опухоли прогнозируется выживаемость больной эндометриоидным раком тела матки. В качестве иммуногистохимических параметров используются Ki-67 и HER2.

2) «Способ определения эффективности лечения рака тела матки» (см. патент RU №2424806 С1, опубл. 27.07.2011, Бюл. №21): на основе определения коэффициента соотношения тетрагидро-11-дезоксикортизола к кортизолу через 1,5-2 недели после окончания лечения в суточной моче прогнозируют длительность безрецидивного периода.

3) «Способ прогнозирования развития рецидива при раке тела матки» (см. патент RU №2250077 С2, опубл. 20.04.2005, Бюл. №11): включает биохимическое исследование в ткани злокачественной опухоли и эндометрия, при этом до и после проведения комплексного лечения определяют активности катепсина Д и кислотостабильных ингибиторов, рассчитывают коэффициент соотношения катепсина Д и кислотостабильных ингибиторов, и при уровне коэффициента, превышающем показатели, характерные для ткани интактного эндометрия, более чем в 2,4-2,8 раза, прогнозируют развитие рецидива рака эндометрия в срок до 6 месяцев.

4) «Молекулярные маркеры для прогноза развития рака» (Заявка: 2011101382, опубл. 27.07.2012, Бюл. №21), включающий определение в биологическом образце уровня экспрессии множества генов: ACTG1, СА12, CALM2, CCND1, СНРТ1, CLEC2B, CTSB, CXCL13, DCN, DHRS2, EIF4B, ERBB2, ESR1, FBX028, GABRP, GAPDH, H2AFZ, IGFBP3, IGHG1, IGKC, KCTD3, KIAA0101, KRT17, MLPH, ММР1, NAT1, NEK2, NR2F2, OAZ1, PCNA, PDLIM5, PGR, PPIA, PRC1, RACGAP1, RPL37A, SOX4, ТОР2А, UBE2C и VEGF.

5) «Способ диагностики гиперпролиферативных состояний и оценки риска развития рака шейки матки при цервикальной интраэпителиальной неоплазии и папилломавирусном носительстве на основе определения уровней мРНК функционального комплекса генов человека» (Заявка: 2012113964, опубл. 20.10.2013, Бюл. №29). Для диагностики гиперпролиферативных состояний предлагается использовать следующие генетические маркеры: MKI67, CDKN2A, MYBL2, CCNB1, BIRC5, AURKA, ESR1, PGR, BCL2, ВАХ, BAG1, PTEN, CD68 и PTGS2.

Описанные изобретения используют либо более трудоемкие и сложные в анализе способы, либо обладают меньшей чувствительностью и специфичностью, чем предлагаемая нами тест-система.

Анализ патентных источников (www.fips.ru) также показал отсутствие действующих патентов и заявок на патент тест-системы для прогнозирования развития рецидивов у больных раком тела матки на основании уровня относительной экспрессии гена ESR1.

Изобретение «Тест-система для прогнозирования развития рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1» является новым, так как относительная экспрессия только данного гена ранее не использовалась для заявленной в способе цели, также как последовательность праймеров гена ESR1 и АСТВ в составе предлагаемой тест системы.

Техническим результатом заявляемого изобретения является создание и внедрение новой, простой в исполнении, не дорогостоящей и точной тест-системы с уникальными высокоспецифичными последовательностями синтетических олигонуклеотидов (праймеров) для прогнозирования рецидивов у пациенток с диагнозом рак тела матки.

Технический результат достигают тем, что используют смесь для ПЦР-РВ реакции: 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратным красителем EvaGreen Dye, ДНК-полимеразу Thermus aquaticus 5 ед/мкл и высокоспецифичные праймеры для генов ESR1 и АСТВ, проводят две амплификации: контрольную и основную, анализируют первичные данные с помощью программного продукта амплификатора и рассчитывают относительную экспрессию генетического локуса ESR1 по формуле RE=2-ΔCt с последующим вычислением соотношения относительной экспрессии этого гена в опухолевой ткани относительно нормальной ткани матки по формуле K=REcancer/REnormal, где K - коэффициент относительной экспрессии, REcancer - относительная экспрессия в опухолевой ткани, REnormal - относительная экспрессия в условно нормальной ткани, сравнивают полученные значения K с интервалом прогностического коэффициента экспрессии, и при значении KESR1≤1 прогнозируют течение заболевания без рецидивов, при значении KESR1≥6 развитие рецидивов, а при значениях коэффициента K между указанными интервалами считают полученный результат неопределенным, при этом специфичные олигонуклеотидные праймеры для определения экспрессии гена ESR1: прямой TGGAGTCTGGCTCTGTGAGG, обратный CAATGGTGCACTGGTTGGTG относительно гена АСТВ: прямой AACCGCGAGAAGATGACCC, обратный AGCACAGCCTGGATAGCAAC для предложенной выше тест-системы, последовательности которых подобраны с учетом сплайсинга мРНК.

Заявленный анализ основан на определении относительной экспрессии гена ESR1, предварительно нормализованного относительно референтного локуса АСТВ, и последующем вычислении соотношения экспрессии гена в опухолевой ткани по отношению к нормальной ткани: K=Ecancer/Enormal.

Заявленная тест-система включает следующие приемы: определение относительной экспрессии генетических локусов методом ПЦР-РВ в присутствии флуоресцентного красителя EvaGreen Dye и специфичных праймеров на матрице синтезированной кДНК; анализ первичных данных с помощью программного продукта амплификатора; расчет экспрессии гена на основании соотношения сигналов, продуцируемых ампликонами изучаемой и референсной последовательностей, и обработка данных на соответствие значениям коэффициентов экспрессии, характерным для групп пациенток с течением заболевания с рецидивами и без.

Заявленная тест-система, рассчитанная на 50 реакций, включает:

1. Смесь для ПЦР-РВ реакции (Mix_PCR) - 1200 мкл, содержащую 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратной концентрацией красителя EvaGreen Dye.

2. ДНК-полимеразу Thermus aquaticus 5 ед/мкл (Taq) - 50 мкл.

3. Смесь прямого и обратного праймеров с концентрацией 5 мкМ каждого для гена ESR1 (ESR1_Mix) - 100 мкл.

4. Смесь прямого и обратного праймеров с концентрацией 5 мкМ каждого для гена АСТВ (Ref_Mix)) - 300 мкл.

5. Контроль реакционной смеси (стандартная кДНК с концентрацией 2 нг/мкл) - 1000 мкл.

6. NTC (контроль без матрицы, Milli-Q вода обработанная DEPC) - 1000 мкл.

7. Milli-Q-DEPC-H2O (Milli-Q вода обработанная DEPC) - 2000 мкл.

Из расчета на одну ПЦР-РВ реакцию смесь должна содержать перечисленные выше компоненты в следующем соотношении:

4 мкл Mix_PCR + 0,2 мкл Taq + 2 мкл ESR1_Mix (или Ref_Mix) + 6 мкл матрицы* + 7,8 мкл Milli-Q-DEPC-H2O

* - кДНК или РНК нормализованная до концентрации 2 нг/мкл, NTC или контроль реакционной смеси.

Для тест-системы были разработаны специфичные олигонуклеотидные прямые и обратные праймеры для генов ESR1 и АСТВ. Дизайн специфичных олигонуклеотидных праймеров (таблица 1) осуществлялся с использованием референсных последовательностей NCBI GenBank на основе следующих принципов: область отжига олигонуклеотидных праймеров должна быть в диапазоне 58-63°С; GC-состав в диапазоне 40-60%; в последовательности праймера должны отсутствовать стабильные вторичные структуры - шпильки и димеры, e-value последовательности праймера должно стремится к нулю и быть не больше 0,05, a query coverage (покрытие целевой последовательности) 100% (для версии BLASTN 2.3.1+), температуры отжига праймеров (forward и reverse) не должны различаться друг от друга более чем на 0,5°. Также при подборе праймеров учитывался сплайсинг мРНК. Так для гена АСТВ прямой праймер покрывает последовательность в конце 3 экзона, а обратный праймер - последовательность в начале 4 экзона.

Работу с тест-системой, содержащей разработанные специфичные олигонуклеотидные праймеры, осуществляют следующим образом.

На первом этапе отбирают образцы тканей пациенток - опухолевые и условно здоровые, из операционного или биопсийного материала. Образцы для транспортировки в лабораторию и хранения замораживают в жидком азоте.

Фрагменты ткани измельчают (скальпелем, ножницами или др. способом), гомогенизируют (напр., растирают в фарфоровых ступках) в присутствии лизирующего раствора ингибирующего активность РНКаз (напр., содержащего 4М гуанидин тиоцианат, саркозил и 2-меркаптоэтанол). Дальнейшее выделение РНК из тканей проводят любым доступным методом (рекомендуется метод гуанидин-тиоцианат-фенол-хлороформной экстракции по P. Chomczynski & N. Sacchi (2006)).

Выделенная РНК обрабатывается ДНКазой. Перед проведением реакции обратной транскрипции для проверки качества выделенной РНК проводят электрофорез в 2% геле агарозы по методу Masek Т. et al. (см. Masek Т., Vopalensky V., Suchomelova P., Pospisek M. Denaturing RNA electrophoresis in TAE agarose gels.//Anal Biochem. - 2005 - 336(1) - P.46-50.). Также перед проведением реакции обратной транскрипции измеряют концентрацию полученных препаратов РНК (любым доступным методом) и нормализуют ее до 2 нг/мкл.

Синтез кДНК можно проводить с использованием коммерческих наборов, основанных на применении обратной транскриптазы M-MuLV Reverse Transcriptase и случайных праймеров (random hexamer). Реакцию обратной транскрипции проводят при 37°C в течение 30 минут.

Полученную кДНК нормализуют до 2 нг/мкл. Реагенты для выделения РНК, синтеза кДНК, определения концентрации РНК и кДНК, проведения электрофорез не входят в состав тест-системы.

Для выполнения анализа необходимо провести две амплификации (реакции ПЦР-РВ). В первой проверяется качество кДНК и чистота препарата тотальной РНК. Реакция проводится с использование смеси праймеров для АСТВ.

Дальнейшее использование кДНК в тест-системе возможно, если соблюдаются следующие условия:

1) CtACTB для образца кДНК не превышает 28 цикла.

2) разница CtACTB между образцом кДНК и РНК должна быть не меньше 5 циклов.

3) CtACTB контроля реакционной смеси должно быть не выше 24 цикла.

4) CtACTB для NTC должен отсутствовать.

Во второй амплификации определяется уровень сигналов, продуцируемых амплификатами локусов ESR1 и референсного АСТВ в нормальной и опухолевой ткани.

Анализируемые последовательности генетических локусов амплифицировали в 20 мкл ПЦР-смеси, содержащей 12 нг кДНК, 0,20 мМ dNTPs, 2,5 мМ MgCl2, 1× ПЦР-буфер, 1× краситель EvaGreen и 0,05 е.а./мкл реакционной смеси ДНК-полимеразы Thermus aquaticus, и по 500 нМ прямого и обратного праймеров для референтного гена (актина, АСТВ) или гена-мишени.

Количественную ПЦР-РВ амплификацию проводили на термоциклере по следующей программе: первичная денатурация: t=95°C в течение 3 мин. 40 циклов: t=95°C в течение 10 с, t=60°C в течение 30 с, t=72°C в течение 30 с. В одной постановке в качестве матрицы использовали одновременно кДНК опытной (опухоль) и контрольной (условно здоровая ткань) пробы для определения сигналов, продуцируемых амплификатами локусов ESR1 и референсного АСТВ, каждого в трех повторностях.

Относительная экспрессия генетических локусов вычислялась следующим образом:

- рассчитывали медиану Ct по трем повторам для целевого локуса и референсного АСТВ,

- далее рассчитывали величину ΔCt=Ct(ESR1)-Ct(ACTB),

- относительную экспрессию генетического локуса (RE) рассчитывали по формуле 2-ΔCt.

Вывод об изменении экспрессии гена делали, сравнивая показатели относительной экспрессии генетических локусов в опухолевой и условно здоровой ткани. Для этого вычисляли медиану REоп опухолевых образцов и медиану REк контрольных (условно здоровая ткань) для каждого генетического локуса и рассчитывали соотношение относительной экспрессии генов в опухолевой ткани по отношению к нормальной ткани матки: K=REcancer/REnormal.

Далее сравнивают полученные значения K с интервалом прогностического коэффициента экспрессии, и при значении K в пределах KESR1≤1 прогнозируют течение заболевания без рецидива, а при значении KESR1≥6 прогнозируют течение заболевания с последующим рецидивом. При значениях коэффициента K между указанными интервалами считают полученный результат неопределенным.

Для доказательства прогностической ценности предлагаемой тест-системы приводится 2 выписки из историй болезни.

Пример №1. Больная С. 61 года, госпитализирована в марте 2013 г. в онкогинекологическое отделение РНИОИ с верифицированным диагнозом рак тела матки после биопсии эндометрия по месту жительства. Морфологическое заключение о наличии эндометриоидной аденокарциномы было подтверждено при пересмотре в РНИОИ.

KESR1 в биоптатах у данной пациентки составил 9,30.

На этапе догоспитального обследования при комбинированном сонографическом исследовании гениталий и органов брюшной полости, малого таза было обнаружено минимальное распространение процесса в пределах полости матки, без перехода на цервикальный канал. В зоне срединного М-эха обнаружились участки повышенной эхогенности с толщиной эндометрия до 5-6 мм. В тазовых и парааортальных лимфатических узлах при СРКТ признаков метастатического поражения не выявлено, что позволило предположить до операции стадию T1N×M0. Сопутствующее гинекологическое заболевание - мелкоузловая миома матки. Рак эндометрия у больной развился на фоне метаболического синдрома в менопаузе более 7 лет.

16.03.2013 г. больной было выполнено хирургическое вмешательство согласно стандарту лечения: нервосберегающая пангистерэктомия, тазовая и селективная парааортальная лимфаденэктомия. При макроскопической оценке в удаленной матке была обнаружена полиповидная экзофитная опухоль, распространяющаяся на всю полость матки, исключая цервикальный канал.

Послеоперационное течение - без особенностей. Морфологический анализ после операции - в полости матки эндометриоидная аденокарцинома G2 с инвазией в миометрий на глубину 2 мм при толщине стенки матки 2,5 см; в удаленных лимфоузлах и по линии резекции влагалища признаков опухолевого роста не обнаружено. Таким образом, степень распространения процесса, согласно классификации TNM соответствовала T1aN0M0.

Учитывая общую площадь поражения полости матки карциномой эндометрия и умеренную степень дифференцировки опухоли, в апреле-мае 2010 г. больная получила курс адъювантной сочетанно-лучевой терапии: ТА=40 Гр, ТВ=40 Гр и эндовагинальную γ-терапию в дозе 40 Гр. В октябре 2013 г. при очередном диспансерном осмотре в культе влагалища у больной был обнаружен рецидив, подтвержденный цитологически (ц.а. №34721-23 аденокарцинома). В этой связи больной было проведено 6 курсов полиохимиотерапии по схеме САР (циклофосфан-адриамицин-цисплатин).

На фоне проведения последнего курса в марте 2014 г. в правой паховой области у пациентки появился метастаз. Опухоль верифицирована: метастаз аденокарциномы. Больная консультирована в РОНЦ им. Н.Н. Блохина в апреле 2014 года, где во время обследования были обнаружены метастатические лимфоузлы в правой аксиллярной области, верифицированные при пункционной биопсии, как аденокарцинома. В апреле 2014 года начата II линия полихимиотерапии по схеме AUC-7, которую больная не закончила из-за продолжающейся неконтролируемой генерализации с метастазами в легкие.

Смерть больной наступила в мае 2014 года, через 15 месяцев после стандартного радикального лечения.

* * *

Пример №2. Больная Б., 63 лет, госпитализирована в онкогинекологическое отделение РНИОИ 27 ноября 2013 г. с верифицированным и подтвержденным при пересмотре в РНИОИ диагнозом: рак тела матки в глубокой менопаузе, аденокарцинома.

На догоспитальном этапе при сонографическом комбинированном исследовании была обнаружена матка без признаков миомы, нормальных размеров, с неравномерно утолщенным эндометрием до 6-8 мм, местами повышенной эхогенности в зоне срединного М-эха. При СРКТ признаков отдаленного метастазирования и поражения тазовых и парааортальных лимфоузлов не обнаружено.

Сопутствующая соматическая патология - гипертоническая болезнь, сахарный диабет II типа, избыточный вес - признаки метаболического синдрома. 30 ноября 2013 г. больной выполнена стандартная операция: нервосберегающая пангистерэктомия, тазовая и селективная парааортальная лимфаденэктомия.

Макроскопически преимущественно в области дна и верхней половины полости матки обнаружена экзофитная опухоль с инфильтрацией в миометрий и очагами деструкции. Послеоперационный период - без осложнений. Морфологический анализ - эндометриоидная аденокарцинома с инвазией 1/2 стенки матки.

KESR1 в биоптате у данной пациентки составил 0,72.

В лимфатических узлах и по линии резекции влагалища признаков опухолевого роста не обнаружено, что позволило определить степень распространения процесса, как T1bN0M0. Согласно стандарту комбинированного лечения больная получила курс адъювантной сочетано-лучевой терапии общей СОД: ТА=50 Гр, ТВ=40, FP и эндовагинально 40 Гр.

Больная наблюдается без признаков рецидива и метастазов.

С помощью предлагаемой тест-системы было осуществлено прогнозирование течения заболевания у 30 пациенток с диагностированным раком тела матки.

Технико-экономическая эффективность изобретения «Тест-система для прогнозирования развития рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1» заключается в возможности с высокой точностью прогнозировать исход такого заболевания как рак тела матки. Заявляемая тест-система, включает разработанные нами праймеры и является экономически оправданной для уточнения особенностей течения заболевания и дает возможность скорректировать тактику лечения, осуществляется в условиях стандартной лаборатории молекулярной биологии (ПЦР), без использования специального дорогостоящего оборудования; обладает высокой чувствительностью и специфичностью, осуществление анализа возможно с операционными биоптатами немедленно замороженными в жидком азоте и занимает не более 10 часов (с учетом подготовительных этапов), и не более 3,5 часов (при непосредственном использовании тест-системы).

Тест-система для прогнозирования рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1, включающая реагенты для амплификации библиотеки кДНК, полученной на матрице тотальной РНК с помощью реакции обратной транскрипции в режиме реального времени - ПЦР-РВ и контрольные смеси, отличающаяся тем, что используют смесь для ПЦР-РВ реакции: 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратным красителем EvaGreen Dye, ДНК-полимеразу Thermus aquaticus 5 ед/мкл и высокоспецифичные праймеры для генов ESR1 и АСТВ, проводят две амплификации: контрольную и основную, анализируют первичные данные с помощью программного продукта амплификатора и рассчитывают относительную экспрессию генетического локуса ESR1 по формуле RE=2-ΔCt с последующим вычислением соотношения относительной экспрессии этого гена в опухолевой ткани относительно нормальной ткани матки по формуле K=REcancer/REnormal, где K - коэффициент относительной экспрессии, REcancer - относительная экспрессия в опухолевой ткани, REnormal - относительная экспрессия в условно нормальной ткани, сравнивают полученные значения K с интервалом прогностического коэффициента экспрессии и при значении KESR1≤1 прогнозируют течение заболевания без рецидивов, при значении KESR1≥6 развитие рецидивов, а при значениях коэффициента K между указанными интервалами считают полученный результат неопределенным, при этом используют специфичные олигонуклеотидные праймеры для определения экспрессии гена ESR1: прямой TGGAGTCTGGCTCTGTGAGG, обратный CAATGGTGCACTGGTTGGTG относительно гена АСТВ: прямой AACCGCGAGAAGATGACCC, обратный AGCACAGCCTGGATAGCAAC для предложенной выше тест-системы, последовательности которых подобраны с учетом сплайсинга мРНК.



 

Похожие патенты:

Предложен способ проведения теста нейтрализации для оценки способности вакцины-кандидата противодействовать инфицированию HCMV (цитомегаловирус человека). Способ включает следующие стадии: (i) смешивание инактивированной нагреванием сыворотки от субъекта, иммунизированного вакциной-кандидатом HCMV, с HCMV, содержащим флуоресцентную метку, для получения смеси; (ii) добавление 2,5% комплемента кролика к смеси со стадии (i); (iii) контакт клетки-хозяина, восприимчивой к инфекции HCMV, где указанная клетка-хозяин представляет собой пигментированную эпителиальную клетку сетчатки клеточной линии ARPE-19, при условиях, подходящих для инфицирования смесью инактивированной нагреванием сыворотки в присутствии комплемента кролика со стадии (ii); (iv) оценку уровня флуоресценции клетки-хозяина, находившейся в контакте с указанной смесью, методом проточной цитометрии; и (v) определение уровня инфицирования клетки-хозяина на основе измеренного уровня флуоресценции.
Изобретение относится к медицине, а именно к трансфузиологии, и касается прогнозирования потребности в аллогенных эритроцитсодержащих компонентах крови в интраоперационном и раннем послеоперационном периодах при коронарном шунтировании.

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ оценки риска прогрессирования цервикальной интраэпителиальной неоплазии.

Изобретение относится к области медицины, в частности к гинекологии, и предназначено для профилактики нарушений менструальной функции у пациенток. Определяют уровень витамина D в сыворотке крови.

Предложенная группа изобретений относится к области медицины. Предложены способ определения, с какой вероятностью пациент с раком реагирует на лечение антагонистом VEGF, и способ выбора терапии для конкретного пациента с раком в популяции пациентов с раком, для которых предполагают проведение терапии.
Изобретение относится к области медицины, в частности к пульмонологии, и предназначено для прогнозирования течения бронхиальной астмы (БА) во время беременности. Определяют форму и контроль БА, наличие сердечно-сосудистых заболеваний, социальный статус беременной.
Изобретение относится к области молекулярной генетики и репродуктивной медицины и предназначено для профилактики привычного невынашивания беременности. У спонтанного абортуса с предварительно установленным нормальным кариотипом, исключающим наличие хромосомных аномалий, определяют статус метилирования импринтированных генов PEG1, DLK1, PEG10, PLAGL1, KCNQ1OT1, РЕG3 и GRB10.
Изобретение относится к области медицины и предназначено для диагностики миелодиспластического синдрома. В мононуклеарных фракциях клеток пациентов определяют экспрессию VEGF-A, VEGFR1 и VEGFR2.
Изобретение относится к области медицины и предназначено для диагностики миелодиспластического синдрома. В мононуклеарных фракциях клеток пациентов определяют экспрессию VEGF-A, VEGFR1 и VEGFR2.

Изобретение относится к области медицины, в частности к хирургии, и может быть использовано для прогнозирования развития острой почечно-печеночной недостаточности у больных острой хирургической патологией.

Группа изобретений относится к биотехнологии, в частности к способу прогнозирования резистентности к инфекционному некрозу поджелудочной железы у лосося и способу отбора лосося для использования в качестве производителя.

Изобретение относится к биотехнологии. Предложен способ репликации человеческого митохондриального генома в клетках дрожжей Yarrowia lipolytica.

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ оценки риска прогрессирования цервикальной интраэпителиальной неоплазии.

Изобретение относится к области медицины, в частности к гинекологии, и предназначено для профилактики нарушений менструальной функции у пациенток. Определяют уровень витамина D в сыворотке крови.

Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования пятилетней безметастатической выживаемости у больных раком молочной железы.

Предложенная группа изобретений относится к области медицины. Предложены способ определения, с какой вероятностью пациент с раком реагирует на лечение антагонистом VEGF, и способ выбора терапии для конкретного пациента с раком в популяции пациентов с раком, для которых предполагают проведение терапии.
Изобретение относится к области молекулярной генетики и репродуктивной медицины и предназначено для профилактики привычного невынашивания беременности. У спонтанного абортуса с предварительно установленным нормальным кариотипом, исключающим наличие хромосомных аномалий, определяют статус метилирования импринтированных генов PEG1, DLK1, PEG10, PLAGL1, KCNQ1OT1, РЕG3 и GRB10.

Изобретение относится к области медицины и предназначено для прогнозирования наличия хромосомных аномалий в эмбрионах удовлетворительного и плохого качества в программе экстракорпорального оплодотворения (ЭКО).

Предложенная группа изобретений относится к области медицины. Предложен способ диагностики и/или определения у субъекта предрасположенности к развитию острого повреждения почек, включающий определение уровня экспрессии по меньшей мере miR-26b и сравнение указанного уровня экспрессии с контрольным значением, где снижение экспрессии является показателем острого повреждения почек или предрасположенности к развитию острого повреждения почек.

Изобретение относится к биотехнологии. Описан способ оценки риска сердечно-сосудистых событий у субъекта, включающий стадии определения в образце, выделенном от указанного субъекта, страдающего хроническим заболеванием почек, присутствия полиморфизмов в положении 27 в последовательностях нуклеиновой кислоты из SEQ ID NO:1-8, или в последовательности, находящейся в сильном неравновесном сцеплении с последовательностью из любой из SEQ ID NO:1-8, где присутствие в положении 27 С в SEQ ID NO:1, С в SEQ ID NO:2, T в SEQ ID NO:3, С в SEQ ID NO:4, С в SEQ ID NO:5, A в SEQ ID N0:6, T в SEQ ID NO:7 и G в SEQ ID NO:8, что соответствует номеру доступа в db SNP rs17465637, rs6725887, rs9818870, rs12526453, rs1333049, rs501120, rs9982601, rs10455872, соответственно, или присутствие полиморфизма в последовательности любого другого rs, который находится в сильном неравновесном сцеплении с любым из этих упомянутых rs, является показателем риска наличия сердечно-сосудистого события.

Изобретение относится к области биотехнологии, а именно к способу определения наличия/отсутствия мутации fl2 с применением растительной ткани кукурузы, а также к генетически сконструированному растению кукурузы.

Изобретение относится к молекулярной биологии, онкологии и биотехнологии. Тест-система для прогнозирования рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1 содержит контрольные смеси и смесь для ПЦР-РВ реакции, включающую 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратным красителем EvaGreen Dye, ДНК-полимеразу Thermus aquaticus в количестве 5 едмкл и высокоспецифичные олигонуклеотидные праймеры для генов ESR1 и АСТВ. Изобретение обеспечивает простоту и точность прогнозирования рецидивов у пациенток с диагнозом рак тела матки без использования дорогостоящего оборудования, а также высокую чувствительность и специфичность. 1 табл., 2 пр.

Наверх