Система мониторинга патогенного потенциала энтеробактерий методом полимеразной цепной реакции

Изобретение относится к биотехнологии. Изобретение предназначено для выявления и идентификации в пробах ДНК, выделенных из чистых культур, клинических образцов, проб пищевых продуктов и элюатов, полученных в результате концентрирования из воды, генетических детерминант пяти факторов патогенности бактерий группы кишечной палочки методом ПЦР с помощью набора маркерных детерминант 25 затравочных пар. Преимуществом заявляемого изобретения является выявление маркеров патогенности, что позволяет усовершенствовать технику ПЦР-анализа для диагностики микроорганизмов с выраженным патогенным потенциалом, который определяет возникновение инфекционного заболевания и его тяжесть, а также факторами персистенции, обуславливающими вероятность хронизации процесса и формирование бактерионосительства. Изобретение может иметь применение в эпидемиологических службах для мониторинга эпидемиологической обстановки. 2 н.п. ф-лы, 1 ил., 1 пр.

 

По существующим правилам и нормам исследование санитарно-эпидемической безопасности воды, а также пищевых продуктов включает в себя выявление санитарно-показательных микроорганизмов, являющихся индикатором микробного загрязнения. Существующие экспресс-системы биомониторинга ориентированы на выявление видов-индикаторов загрязнения, в то время как болезнетворный потенциал как условно-патогенных, так и патогенных микроорганизмов может существенно различаться у разных штаммов.

Одним из ключевых фенотипических маркеров персистентного профиля бактерий является антилизоцимная активность, которая отражает, главным образом, способность клетки к продукции экскретируемых соединений, обеспечивающих инактивацию лизоцима в питательной среде (Андрющенко С.В., Перунова Н.Б., Бухарин О.В. Гомологи гена периплазматического ингибитора лизоцима PliC и их роль в антилизоцимной активности энтеробактерий // Микробиология. 2013, №3, С. 302-311).

Одним из базовых маркеров патогенности бактерий ввиду широкой распространенности является гемолизин - порообразующий токсин. Гемолизин (фактор цитотоксичности) продуцируют различные микроорганизмы, в том числе рода Escherichia-Shigella (Bielaszewska М., Aldick Т., Bauwens A., Karch Н. Hemolysin of enterohemorrhagic Escherichia coli: structure, transport, biological activity and putative role in virulence // Int. J. Med. Microbiol. 2014; V. 304 N. 5-6, P.: 521-529).

Некоторые штаммы Escherichia coli и Klebsiella pneumoniae продуцируют аэробактин - сидерофор, связывающий железо для дальнейшего переноса внутрь бактериальной клетки с целью его накопления в биотопах, бедных железом (таких как мочевыводящий тракт), что также является фактором патогенности (Searle L.J., Porcelli I., Sheppard S.K., Lucchini S. Variation in siderophore biosynthetic gene distribution and production across environmental and faecal populations of Escherichia coli // PLoS One, 2015, V. 10, N. 3, e0117906).

Генотоксин-колибактин - токсин поликетидной природы, способный проникать в ядро клетки хозяина и связываться там с ДНК, нарушая нормальный процесс репликации, становясь фактором риска развития злокачественных опухолей (прежде всего - прямой кишки (Johnson J.R., Johnston В., Kuskowski М.А., Nougayrede J.P., Oswald E. Molecular epidemiology and phylogenetic distribution of the Escherichia coli pks genomic island // J. Clin. Microbiol., 2008, V. 46, N. 12, P: 3906-3911).

Энтеротоксин типа С - самотранспортирующийся токсин острой диареи, обладающий способностью инактивировать лизоцим - важный фермент защиты хозяина (Mellies J.L., Navarro-Garcia F., Okeke I., Frederickson J., Nataro J.P., Kaper J.B. espC pathogenicity island of enteropathogenic Escherichia coli encodes an enterotoxin // Infect. Immun., 2001, V. 69, N. 1, P: 315-324).

Определение факторов вирулентности и персистенции микроорганизмов доступно с помощью существующих микробиологических методов, но все данные способы обладают существенными недостатками: большие затраты труда и времени (1-3 суток) необходимого для проведения анализа выделяемых микроорганизмов, что не позволяет использовать их для задач массового микробиологического мониторинга.

Метод полимеразной цепной реакции (ПЦР) обладает высокой специфичностью - выявляется уникальный фрагмент ДНК, специфичный для данного возбудителя и отсутствуют ошибки в связи с перекрестно-реагирующими антигенами, выявляемыми методами иммунологической диагностики. Экстремальная чувствительность реакции, обеспечиваемая выявлением даже единичных клеток возбудителей, позволяет использовать ПЦР в тех случаях, когда другие методы диагностики не дают положительного результата. Кроме того, длительность стандартного ПЦР-анализа от этапа выделения ДНК с электрофоретической детекцией обычно не превышает 1,5 часов. Проведение ПЦР в формате «реального времени» (ПЦР-РВ) позволяет ускорить получение результата до 30-60 минут, что имеет большое значение в проведении массового микробиологического мониторинга (ПЦР «в реальном времени» // Ребриков Д.В., Саматов Г.А., Трофимов Д.Ю. и др.; под ред. д.б.н. Д.В. Ребрикова; предисл. Л.А. Остермана и акад. РАН и РАСХН Е.Д. Свердлова; 2-е изд., испр. и доп. - М.: БИНОМ. Лаборатория знаний, 2009. - 233 с.)

Известен способ определения опасности микробиологической загрязненности воды, описанный в заявке RU 2576030 (С1), опубл. 27.02.2016, определяющий наличие микроорганизмов по их флуоресценции при возбуждении ультрафиолетовым излучением в пробе воды. Однако данный способ не обладает специфичностью по определению таксономической принадлежности и болезнетворных факторов микроорганизмов.

Известен способ выявления кишечных вирусов в клинических образцах и воде методом мультиплексной ПЦР, описанный в заявке RU 2506317 (С2), опубл. 10.02.2014, имеющий сходную цель и метод проведения диагностики, но направленный на выявление вирусных патогенов, тогда как предлагаемый способ включает определение только патогенов бактериальной природы.

Известен способ определения наличия бактерий Escherichia coli O157:Н7 в биологических и пищевых образцах на основе иммунодетекции, сопряженной с полимеразной цепной реакцией, описанный в заявке RU 2569196 (С1), опубл. 20.11.2015, сходный по выявляемому объекту, но использующий иную методику его идентификации - с привлечением иммунологических методов, а также не выявляющий в предлагаемом способе генетические детерминанты патогенности энтеробактерий.

Наиболее близким аналогом является набор для выявления ДНК различных групп диарогенных эшерихий в объектах окружающей среды и клиническом материале методом ПЦР "АмплиСенс® Эшерихиозы-FL" (ЦНИИ Эпидемиологии, г. Москва). Данный набор реагентов позволяет выявлять гены патогенности диареегенных кишечных палочек: кодирующие способность к адгезии (еае), инвазии(ipaH), шигаподобные токсины (stx1 и stx2) и энтеротоксины (lt), тогда как предлагаемый способ направлен на выявление генов секретируемых ингибиторов лизоцима типа С (pliCc и pliCp), гемолизина (hlyA и hlyС), аэробактина (iucB, iucC и iucA), колибактина (clbB и clbN) и энтеротоксина (espCp и espCc).

Техническим результатом заявляемого изобретения является выявление пяти известных генетических детерминант факторов патогенности энтеробактерий в пробе ДНК, выделенной из исследуемого материала.

Технический результат достигается способом, при котором для положительного заключения о наличии в пробе генов патогенности энтеробактерий в клиническом материале либо в материале из объектов окружающей среды для постановки ПЦР-анализа используются следующие пары праймеров:

3'-5'

Для хромосомного гомолога гена ингибитора лизоцима pliСс:

Для плазмидного гомолога гена ингибитора лизоцима рliСр:

Для гена биосинтеза аэробактина iucA:

Для гена биосинтеза аэробактина iucB:

Для гена биосинтеза аэробактина iucC:

Для гена продукции гемолизина hlyA:

Для гена активации гемолизина hlyC:

Для хромосомного гомолога гена энтеротоксина espCc:

Для плазмидного гомолога гена энтеротоксина espCp:

Для гена биосинтеза колибактина clbB:

Для гена биосинтеза колибактина clbN:

Изобретение поясняется чертежами: на фиг. 1 показан пример фореграммы.

Пример выполнения анализа:

1 этап - постановка реакции амплификации:

Реакционная смесь для ПЦР в объеме 15 мкл приготовляется из набора праймеров и реагентов в составе: 2 мкл 25 мМ раствора магния хлорида, 2 мкл 10-кратного ПЦР-буфера Б, 1,6 мкл 2,5 мМ раствора дезоксирибонуклеотидтрифосфатов, 0,5 мкл 10 мкМ смеси праймеров, 0,2 мкл 5 ед/мкл раствора Taq-полимеразы и 8,7 мкл деионизованной воды. ДНК-проба, выделенная из исследуемого источника вносится в подготовленную реакционную смесь для ПЦР в объеме 5 мкл. С целью предотвращения испарения воды из реакционной смеси, на ее поверхность наслаивается 20-30 мкл стерильного парафинового масла. Реакция проводится в ДНК-амплификаторе в течение 30 циклов при температуре отжига 62°С для праймерных пар ко всем вышеуказанным маркерным последовательностям. Время проведения ПЦР составляет 1 час.

2 этап - визуализация результатов амплификации:

Получаемые ампликоны подвергаются агарозному гель-электрофорезу. С этой целью раствор, содержащий амплифицированную ДНК, смешивается с 4 мкл. 10-кратного буфера для внесения с бромфеноловым синим и по 20 мкл полученной смеси вносится в лунки 3% агарозного геля. Электрофорез проводится в ТВЕ-буфере однократной концентрации с 50 мкг/мл этидия бромида в качестве люминесцентного красителя при напряженности поля 10 В/см в течение 18 мин (Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генетической инженерии. Молекулярное клонирование // М.: Мир, 1984. - 479 с.).

Визуализация результатов разделения нуклеиновых кислот проводится в проходящем ультрафиолетовом свете с длиной волны 312 нм на установке гель-документирования «Vilber Lourmat» с последующей фотофиксацией изображения.

В качестве маркера молекулярной массы нуклеиновых кислот используется линейный маркер «pUC/MspI» (ООО «Лаборатория Медиген», Россия) в количестве 0,8 мкг. регистрация результатов производится на основе наличия либо отсутствия полос люминесценции бромида этидия в агарозном геле, расположенных в диапазоне молекулярных масс, соответствующих локализации маркерных фрагментов до 208 нуклеотидных пар.

3 этап - интерпретация результатов:

Положительная реакция определяется при наличии полосы люминесценции в геле в положении, соответствующем молекулярной массе положительной контрольной пробы, как показано на фореграмме, где рliСс, рliСр, iucA - пары проб для выявления соответствующих генов, внесенные в вышерасположенные на фореграмме лунки ТВЕ-геля, О - опытные пробы, K - положительные контрольные пробы, с нижележащими на фореграмме полосами люминесценции.

Для верификации работоспособности реакции в качестве положительных контролей и замены маркера молекулярной массы нуклеиновых кислот применяются препараты ДНК, выделенные из чистых культур:

штамм Salmonella enterica АТСС 14028 - для хромосомного гомолога рliСс;

штамм Klebsiella pneumoniae ICIS-278_PBV - для плазмидного гомолога гена рliСр, для генов биосинтеза аэробактина iucB, iucC и iucA;

штамм Е. coli М-17 - для гена биосинтеза колибактина clbN, clbB;

штамм Е. coli ICIS-228 - для гена продукции гемолизина hlyA, hlyC;

штамм Е. coli ICIS-238 - для хромосомного гомолога гена энтеротоксина типа С espCc;

штамм Е. coli ICIS-248 для плазмидного гомолога гена энтеротоксина типа С espCp.

1. Способ определения патогенного потенциала, т.е. вероятности энтеробактерий родов Escherichia, Shigella, Klebsiella, Salmonella вызывать инфекционные и гнойно-воспалительные заболевания, методом полимеразной цепной реакции, включающий выявление следующих генетических детерминант с использованием праймеров указанных последовательностей:

хромосомного гомолога гена ингибитора лизоцима pliCc - SEQ ID NO 1,2;

плазмидного гомолога гена ингибитора лизоцима pliCp - SEQ ID NO 3, 4;

гена биосинтеза аэробактина iucA - SEQ ID NO 5, 6, либо SEQ ID NO 7, 8;

гена биосинтеза аэробактина iucB - SEQ ID NO 9, 10, 11;

гена биосинтеза аэробактина iucC - SEQ ID NO 12, 13;

гена продукции гемолизина hlyA - SEQ ID NO 14, 15;

гена активации гемолизина hlyC - SEQ ID NO 16, 17;

хромосомного гомолога гена энтеротоксина espCc - SEQ ID NO 18, 19;

плазмидного гомолога гена энтеротоксина espCp - SEQ ID NO 20, 21;

гена биосинтеза колибактина clbB - SEQ ID NO 22, 23;

гена биосинтеза колибактина clbN - SEQ ID NO 24, 25;

при этом штаммы вышеуказанных видов, препараты выделенной ДНК которых демонстрируют положительный результат двухкратного ПЦР-анализа с указанными праймерами хотя бы по двум генам не более одной из таких детерминант, как аэробактин iuc, гемолизин hly или колибактин clb, считаются имеющими средний патогенный потенциал;

штаммы вышеуказанных видов, препараты выделенной ДНК которых демонстрируют положительный результат двухкратного ПЦР-анализа с указанными праймерами хотя бы по двум генам хотя бы одной из таких детерминант, как ингибиторы лизоцима рНС или энтеротоксин espC, либо хотя бы двух таких детерминант, как аэробактин iuc, гемолизин hly или колибактин clb, считаются имеющими высокий патогенный потенциал; все остальные исследуемые системой штаммы считаются имеющими низкий патогенный потенциал.

2. Набор праймеров для осуществления способов по п. 1 включает олигонуклеотиды следующих последовательностей:

SEQ ID NO 1 GATCCCATTTACCCTCTTTCTCG

SEQ ID NO 2 CATCGGGATCATCTCGTTTACC

SEQ ID NO 3 CGATGAAGCGGGCTGTTAGTGGTT

SEQ ID NO 4 TACGGCTTGCAGTTGCTCAGGATG

SEQ ID NO 5 GAGCAGCCGCAAAGCCAGACCAA

SEQ ID NO 6 GCACCAGGCCGTAATCCGCTTCA

SEQ ID NO 7 GGAGCAGCCGCAAAGCCAGACC

SEQ ID NO 8 GCCGAAACCAGCAGCGAATCACC

SEQ ID NO 9 GTGGCCTGCATCTGCTGGTTGGTG

SEQ ID NO 10 GTGCGCTGCGTACGTGGCTCATTC

SEQ ID NO 11 GTGCGCTGCGTACGGGGCTCAT

SEQ ID NO 12 CGCTGGCTGAAACCGGATGAAAGT

SEQ ID NO 13 ACCACCCGGAACAGTTGCGTAAGC

SEQ ID NO 14 GGAACAAAAGCTGCAGCGGGTATC

SEQ ID NO 15 GCAGCAGCCAGGAAAGAAAGAGGA

SEQ ID NO 16 ATGGCCATTATCTGTTTTTGCTAT

SEQ ID NO 17 ACTTTCTTTCTCCCGACATCCA

SEQ ID NO 18 GAGCTGGACGGTGTGGATTTGTTC

SEQ ID NO 19 CTCGCCGTGTACTGATTGTCGTGA

SEQ ID NO 20 ACTGGCGGTCGGATTACTGAG

SEQ ID NO 21 GCTTTATTCGCTGCACTTCCTG

SEQ ID NO 22 ACGGGAAATGCACAGAGGTCACT

SEQ ID NO 23 TAGCGAACGCCGGGTAAACAC

SEQ ID NO 24 GCCCCTGCACATCATCAATC

SEQ ID NO 25 GCTACGCCATCGCTCCTAATAC



 

Похожие патенты:

Изобретение относится к области биотехнологии, в частности к способу оценки высокой мясной продуктивности овец сальской породы. Указанный способ включает выделение ДНК, амплификацию фрагмента гена GH с использованием праймеров 5'-GGAGGCAGGAAGGGATGAA-3' и 5'-CCAAGGGAGGGAGAGACAGA-3', рестрикцию амплифицированного фрагмента гена GH эндонуклеазой HaeIII, определение генотипов и отбор животных с генотипом АВ/GH.

Изобретение относится к области биотехнологии, молекулярной генетики и молекулярной биологии. Используется для синтеза, детектирования и последующего секвенирования ДНК с метилированными CpG-динуклеотидами.

Изобретения касаются способа тестирования собаки для определения предрасположенности собаки к накоплению меди в печени с использованием установления наличия определенного полиморфизма, применения такого полиморфизма для определения предрасположенности собаки к накоплению меди в печени, способа тестирования собаки и способа отбора.

Изобретение относится к области медицины и предназначено для прогнозирования риска развития эссенциальной гипертензии. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, осуществляют выделение ДНК из периферической венозной крови и анализ генетических маркеров матриксных металлопротеиназ.

Изобретение относится к молекулярной биологии, онкологии и биотехнологии. Тест-система для прогнозирования рецидивов у больных раком тела матки на основании уровня экспрессии гена ESR1 содержит контрольные смеси и смесь для ПЦР-РВ реакции, включающую 1 мМ dNTPs, 12,5 мМ MgCl2, 5-кратный ПЦР-буфер с 5-кратным красителем EvaGreen Dye, ДНК-полимеразу Thermus aquaticus в количестве 5 ед/мкл и высокоспецифичные олигонуклеотидные праймеры для генов ESR1 и АСТВ.

Изобретение относится к области биотехнологии, а именно к способу определения наличия/отсутствия мутации fl2 с применением растительной ткани кукурузы, а также к генетически сконструированному растению кукурузы.

Группа изобретений относится к биотехнологии, в частности к способу прогнозирования резистентности к инфекционному некрозу поджелудочной железы у лосося и способу отбора лосося для использования в качестве производителя.

Изобретение относится к биотехнологии. Предложен способ репликации человеческого митохондриального генома в клетках дрожжей Yarrowia lipolytica.

Изобретение относится к медицине и биотехнологии и раскрывает способ получения питательной среды. Способ включает следующие стадии.

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ оценки риска прогрессирования цервикальной интраэпителиальной неоплазии.

Изобретение относится к биотехнологии. Описан способ отбора клинического материала из шейки матки при выявлении дисплазии эпителия шейки матки и проведение его иммуногистохимических исследований с выявлением диагностических признаков хламидиоза. Клинический материал дополнительно отбирают из полости матки, при этом клинические материалы оперативно фиксируют для иммуноцитохимического исследования. После чего препарат, полученный из шейки матки, вводят в контакт с первичными антителами к белку Ki-67, оценивают активность этого антигена в препаратах, по величине которой устанавливают хроническую или острую форму хламидиоза при показателях активности соответственно 2,4+0,09 или 5,9+0,25. При показателях его активности, соответствующих промежуточным значениям между названными, делают вывод об отсутствии хламидиоза в шейке матки и после этого оценивают активность пролиферирующего клеточного ядерного антигена Ki-67 в препаратах, полученных из материала, отобранного из полости матки, по величине которой устанавливают хроническую или острую форму хламидиоза при показателях активности соответственно 1,3+0,09 или 3,9+0,25. Технический результат - расширение диагностического спектра, включающее выявление сроков заражения инфекцией, обеспечение возможности проведения дифференциальной диагностики процессов в эпителии и на фоне отсутствия клинической симптоматики решение вопроса, с чем патологическое состояние слизистой оболочки связано, с инфекцией или малигнизацией, с уточнением стратегии хирургических вмешательств, касающихся удалять или оставить и сколько удалять. Это позволяет использовать заявленный способ в гинекологии, акушерстве, дерматовенерологии и судебно-медицинской экспертизе не только в возрастной группе женщин в постменопаузе, но и в случае неблагоприятного исхода беременности и вынашивания плода, прогнозирования патологии новорожденного. 1 з.п. ф-лы, 10 ил., 1 табл., 1 пр.

Изобретение относится к биотехнологии и предусматривает способы тестирования образца на наличие одной или нескольких мишеней. Способы включают приведение образца в контакт с одним или несколькими специфичными для мишени партнерами по связыванию, где каждый специфичный для мишени партнер по связыванию соединен с докинг-цепью и где специфичные для мишени партнеры по связыванию с разной специфичностью соединены с разными докинг-цепями, приведение образца в контакт с мечеными визуализирующими цепями с нуклеотидной последовательностью, которая комплементарна докинг-цепям, с получением меченых визуализирующих цепей, стабильно связанных с докинг-цепями, визуализацию образца и тушение сигнала от связанной меченой визуализирующей цепи или удаление связанных меченых визуализирующих цепей от докинг-цепей путем ферментативного расщепления, модификации или разрушения меченых визуализирующих цепей. Изобретения расширяют арсенал способов для визуализации представляющих интерес мишеней при высокой пространственной разрешающей способности. 3 н. и 47 з.п. ф-лы, 10 ил., 1 пр.

Изобретение относится к области биотехнологии и молекулярно-генетической диагностики. Раскрыт способ проведения ПЦР с аллель-специфичными зондами для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1. Изобретение позволяет расширить арсенал способов генотипирования крупного рогатого скота по аллелям А и К DGAT1 на основе ПЦР в реальном времени и повысить их надежность. 2 ил.

Изобретение относится к биохимии. Описан способ обнаружения колоректальных аденом поздней стадии у человека, включающий этапы: измерения общего профиля или уровня экспрессии одной или нескольких микроРНК, полученных из одного или нескольких биологических образцов субъекта, где по меньшей мере одна из этих микроРНК является miR18a; и сравнение общего профиля экспрессии одной или нескольких микроРНК из биологического образца от субъекта с предполагаемыми колоректальными аденомами поздней стадии с общим профилем экспрессии одной или нескольких микроРНК из биологического образца из нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от колоректальных аденом поздней стадии, и где сверхэкспрессия miR18a свидетельствует о наличии колоректальных аденом поздней стадии. Изобретение расширяет арсенал средств для обнаружения колоректальных аденом поздней стадии у человека. 2 н. и 9 з.п. ф-лы, 4 ил., 6 табл.

Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для количественного определения ДНК Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой. Изобретение обеспечивает расширение арсенала средств количественного определения ДНК условно-патогенных урогенитальных микоплазм в биологическом материале. 3 пр.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для количественного определения ДНК Candida albicans, Candida glabrata, Candida krusei, Candida tropicalis и Candida parapsilosis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой. Изобретение обеспечивает расширение арсенала средств выявления ДНК грибов рода Candida в биологическом материале. 3 пр.

Предложенная группа изобретений относится к области фармакогеномики. Предложены способы и набор для прогнозирования чувствительности пациента со злокачественным новообразованием к лечению ингибитором Wnt посредством измерения дифференциальной экспрессии биомаркера Notch1 в образце злокачественного новообразования. Предложено применение ингибитора Wnt 2-[5-метил-6-(2-метилпиридин-4-ил)пиридин-3-ил]-N-[5-(пиразин-2-ил)пиридин-2-ил]ацетамида или его фармацевтически приемлемой соли для лечения пациента со злокачественным новообразованием. Предложены фармацевтические композиции, содержащие указанный ингибитор. Предложенная группа изобретений обеспечивает эффективное определение чувствительности клеток к ингибиторам Wnt посредством использования специфичных биомаркеров. 9 н. и 14 з.п. ф-лы, 16 ил., 1 табл., 8 пр.

Изобретение относится к биотехнологии, конкретно к определению прогноза развития септического синдрома у пациента, и может быть использовано в медицине. Получают биологический образец, выбранный из образца крови, сыворотки, слюны, ткани или циркулирующих клеток пациента, и экстрагируют биологический материал: нуклеиновую кислоту или белок из биологического образца. С использованием специфического реагента в отношении продукта экспрессии гена-мишени S100A9, выбранного из праймера амплификации, зонда гибридизации и/или антитела, определяют экспрессию гена-мишени S100A9. Изобретение позволяет по сверхэкспрессии гена-мишени S100A9 по отношению к определенной пороговой величине определить прогноз развития септического синдрома у пациента. 2 н. и 7 з.п. ф-лы, 2 ил., 3 табл., 5 пр.

Группа изобретений относится к молекулярно-биологическому диагностированию. Микрофлюидный картридж (100) для детекции биомолекул содержит камеру (140) детекции, микрочип (142) на основе комплементарной структуры металл-оксид-полупроводник (CMOS), имеющий сенсорную область (144), расположенную в камере (140) детекции, и контактную область (146), герметично отделенную от камеры (140) детекции. Камера (140) детекции выполнена с возможностью подачи раствора пробы через впускной канал (124) и вывода анализируемого раствора пробы через выпускной канал (126). Сенсорная область (144) микрочипа (142) содержит систему функционализованных тестовых участков (130) для электрохимической детекции биомолекул в растворе пробы. Каждый тестовый участок (130) сенсорной области (140) снабжен собственным сигма-дельта модулятором (132) для аналого-цифрового преобразования электрических сигналов, генерируемых на тестовых участках (130) при электрохимической детекции. Обеспечивается упрощение и сокращение времени процесса детекции биомолекул. 2 н. и 8 з.п. ф-лы, 14 ил.

Изобретение относится к биотехнологии. Изобретение предназначено для выявления и идентификации в пробах ДНК, выделенных из чистых культур, клинических образцов, проб пищевых продуктов и элюатов, полученных в результате концентрирования из воды, генетических детерминант пяти факторов патогенности бактерий группы кишечной палочки методом ПЦР с помощью набора маркерных детерминант 25 затравочных пар. Преимуществом заявляемого изобретения является выявление маркеров патогенности, что позволяет усовершенствовать технику ПЦР-анализа для диагностики микроорганизмов с выраженным патогенным потенциалом, который определяет возникновение инфекционного заболевания и его тяжесть, а также факторами персистенции, обуславливающими вероятность хронизации процесса и формирование бактерионосительства. Изобретение может иметь применение в эпидемиологических службах для мониторинга эпидемиологической обстановки. 2 н.п. ф-лы, 1 ил., 1 пр.

Наверх