Набор синтетических олигонуклеотидов для количественного определения днк ureaplasma parvum, ureaplasma urealyticum и mycoplasma hominis в слизистой оболочке влагалища



Владельцы патента RU 2663453:

ООО "НекстБио" (RU)

Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для количественного определения ДНК Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой. Изобретение обеспечивает расширение арсенала средств количественного определения ДНК условно-патогенных урогенитальных микоплазм в биологическом материале. 3 пр.

 

Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии, и касается синтетических олигонуклеотидов для выявления ДНК Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis. Изобретение предназначено для исследования биологического материала человека, полученного от лиц с подозрением на наличие инфекций урогенитального с целью выявления ДНК Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis. Олигонуклеотиды могут быть использованы для создания набора реагентов для выявления ДНК условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) методом полимеразной цепной реакции. Изобретение позволяет проводить обнаружение указанных микроорганизмов в биологическом материале с высокой точностью.

Из уровня техники известны дифференцирующие и специфические олигонуклеотиды для идентификации последовательностей ДНК инфекционных агентов в биологических материалах, способ видовой идентификации инфекционных агентов, биочип и набор для осуществления этого способа [Патент России №2348695, Бюл. №7, (ЗАО Молекулярно-медицинские технологии, RU), опубл. 10.03.2009 г.]. В способе видовой идентификации инфекционных агентов проводят мультиплексную полимеразную цепную реакцию в присутствии специфических олигонуклеотидов в качестве праймеров с последующей гибридизацией ПЦР-продуктов с дифференцирующими олигонуклеотидами на микрочипе и определяют урогенитальную инфекцию по наличию гибридизационных комплексов. Отдельные специфические олигонуклеотиды и дифференцирующие олигонуклеотиды формируют композиции для идентификации Human herpesvirus 5, Human herpesvirus 4, herpesvirus 1 и/или Human herpesvirus 2, Human Streptococcus agalactiae и/или Streptococcus pyogenes, Streptococcus agalactiae, Gardnerella vaginalis, Mycoplasma hominis, Mycoplasma genitalium, Candida albicans, Ureaplasma urealyticum и/или Ureaplasma parvum, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis. Указанные специфические олигонуклеотиды и микрочип с дифференцирующими олигонуклеотидами входят в набор для видовой идентификации урогенитальной инфекции.

Также известен способ проведения количественной ПЦР в режиме реального времени. [Заявка WO 02/070751А1, (University Of Pittsburg Of The Commonwealth System Of Higher Education, US), опубл. 12.09.2002 г.]. В способе используются наборы специфических праймеров для ПЦР. При описании способа заявитель приводит наиболее оптимальные параметры для ПЦР.

Также известны способы и аппараты для высокочувствительного выявления наличия или отсутствия в биологическом образце микроорганизмов [Заявка на патент США на изобретение US 2016/0108467, (Rochester Investment Partners, GB) опубл. 21.04.2016]. Способы включают использование диагностической мультиплексной панели для единовременного определения множества микрорганизмов. Перечень микроорганизмов включает, но не ограничивается, следующие микрорганизмы: Mycoplasma spp., Chlamydia spp., Ureaplasma spp, Neisseria spp., Gardnerella spp., Trichomonas spp., Treponema spp., Candida albicans: или вирусные патогены, такие как цитомегаловирус (CMV), вирус гепатита (HAV. HBV и HCV и т.д.), вирус гепатита Е (HEV), вирусы гепатита G и GB (GBV-C), вирус иммунодефицита человека (HIV, HIV-1, HIV-2), вирус папилломы человека (HPV), вирус простого герпеса (HSV, HSV-1, HSV-2), и вирус Варицелла-Зостер (VZV). Диагностическая панель может содержать один или более праймеров. Другими заболеваниями, которые можно диагностировать с помощью данной панели являются пищевые отравления, туберкулез, вирус-индуцированные опухоли, энцефалит, малярия, гепатиты, менингиты, лейшманиоз, Африканский трипаносомоз; пневмония; ОРВИ; бешенство; лихорадка долины Рифт, инфекции, вызванные патогенами туляремии; шигелл; ботулизма; желтой лихорадкой; лихорадкой ку; эболой; лихорадкой денге, лихорадкой Западного Нила: дизентерией, кори и тифа. Наиболее предпочтительно диагностическая панель предназначена для совместного выявления Candida albicans, Chlamydia trachomatis, Gardnerella vaginalis, Mycoplasma genitalium, Mycoplasma homittis, Neisseria gonorrhoeae, Trichomonas vaginalis, Treponema pallidum, Ureaplasma urealyticum.

Также известны способ и набор для диагностики Haemophilus ducreyi (ассоциированного с Chancroid), Chlamydia trachomatis (ассоциированного с Chlamydia), Neisseria gonorrhoeae (ассоциированного с Gonorrhea), Mycoplasma genitalium (ассоциированного с Mycoplasma), Cardnerella vaginalis (ассоциированного с Vaginitis), Treponema pallidum (ассоциированного с Syphilis), и любые другие прокариотические организмы, определяемые с помощью 16S РНК) [Заявка на патент США на изобретение US 2017/0002432, (uBiome, Inc., US) опубл. 05.01.2017]. В набор для диагностики входят последовательности праймеров для выявления указанных микроорганизмов при помощи твердофазной ПЦР.

Также известен способ молекулярной диагностики, включающий специфический захват однонитевой целевой нуклеотидной последовательности который может быть изготовлен из встречающихся в природе нуклеотидов или которые могут быть изготовлены из нуклеотидов, которые не встречаются в природе или любую их смесь, например, ДНК и/или РНК, с помощью дополнительного зонда, содержащего один или более молекулы интеркалятора [US 20130230856, правообладатель Quantibact A/S, DK, от 05.09.2013]. Способ подходит для выявления таких микроорганизмов, как Gardnerella vaginalis, Ureaplasma urealyticum, Mycoplasma hominis, Atopobium vaginae и Candida albicans.

Известны способы, композиции и наборы для мультиплексного анализа нуклеиновой кислоты одиночных клеток. Способы, составы и системы могут использоваться для последовательного параллельного односегментного секвенирования [WO2 015031691 A1, (Cellular Research INC., US), от 05.03.2015]. Способы, композиции и системы могут использоваться для одновременного анализа тысяч клеток. Тысячи клеток могут содержать смешанную популяцию клеток (например, клетки разных типов или подтипов разных размеров).

Также известен способ идентификации патогенов в биологическом образце, полученном от человека или животного, с помощью набора праймеров (табл. 8, 9, 10, 11, 12 патентного документа) [US 20040219517, (Ibis Biosciences, Inc., US), от 04.11.2004]. Способ предназначен для выявления Mycoplasma, Ureaplasma и др. патогенных микроорганизмов.

Также известны способы идентификации патогенов в биологических образцах человека и животных, обнаружения множества этиологических агентов, присутствующих в образцах, полученных от людей и животных, определения подробной генетической информации о таких патогенах или этиологических агентах, а также быстрого обнаружения и идентификации биоагентов в экологических, клинических или других образцах [US 2009148829 A1, (Ibis Biosciences, Inc., US), от 11.06.2009]

Техническим результатом, на достижение которого направлено предлагаемое изобретение, является расширение арсенала средств количественного определения ДНК условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) в биологическом материале (отделяемое слизистой оболочки влагалища).

Указанный результат достигается путем использования при постановке ПЦР набора синтетических олигонуклеотидов для количественного определения ДНК условно-патогенных урогенитальных микоплазм Ureaplasma parvum, Ureaplasma urealyticum (в области амплификации urease complex component gene) и Mycoplasma hominis (в области амплификации 16S rRNA), включающие в себя праймеры следующих последовательностей Seq. N 1-Seq. N 8, также используются зонды с флуоресцентной меткой, интенсивность флуоресценции которых свидетельствует о количестве образующегося продукта, Seq. N 9-Seq. N 12:

GCAAATTGCTGCTGGAGCTT Seq. N 1

TCGCCCTTTCATAGCTGCAA Seq. N 2

AGCGTGGATTGTACGTCCTT Seq. N 3

GTAGCAGGTGCTTGTGGTCT Seq. N 4

TTAAAGCCTGGGGCTCAACC Seq. N 5

CTACGCATTTCACCGCTTCAC Seq. N 6

GTCAGGGCAGAGCCATCTATTGCT Seq. N 7

CCACATGCCCAGTTTCTATTGGTCT Seq. N 8

TGAGGGGCAACAGGAAATGCGA Seq. N 9

AGCGTTTCCTGTTGCCCCTCA Seq. N 10

CCAGCCCGCTTTAGATACTGGCA Seq. N 11

TGCCCAGGGCCTCACCACCA Seq. N 12

Существенным отличием работы с данными праймерами является:

1) Высокая специфичность и чувствительность праймеров в областях амплификации (16S rRNA, urease complex component gene) позволяет выявить ДНК условно-патогенных урогенитальных микоплазм в биологическом материале при низкой концентрации возбудителя.

2) Для снижения вероятности образования неспецифических продуктов реакции использовали праймеры с высокой температурой отжига.

3) Использование данных праймеров для ПЦР совместимо с образцами ДНК, выделенных с применением коммерческих наборов, таких как «АмплиПрайм® ДНК-сорб-АМ», «МагноПрайм ЮНИ» и «МагноПрайм ФАСТ» (ООО «НекстБио» Россия).

Указанный набор синтетических олигонуклеотидов может являться составной частью многосоставных реакционных смесей, реакционных смесей раскапаных под прослойку парафина и лиофильновысушенных реакционных смесей.

Указанный набор синтетических олигонуклеотидов является составной частью набора следующих веществ:

1. ПЦР-смесь, включающая в состав указанные праймеры и зонды, специфические к участку ДНК Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis, смесь дезоксинуклеозидтрифосфатов (дНТФ).

2. ПЦР-буфер

3. Набор контрольных образцов (положительный контрольный образец и отрицательный контрольный образец):

3.1. Положительный контрольный образец (ПК) - смесь бактериофагов λ и плазмид со вставками специфических последовательностей. Положительный контрольный образец вносится в отдельную пробирку с реакционной смесью. Результат амплификации ПК демонстрирует эталонное положительное прохождение реакции, с которым сравниваются результаты амплификации исследуемых образцов.

3.2. Отрицательный контрольный образец - образец, который вводится в эксперимент для контроля возможного загрязнения реактивов продуктами ранее проведенных реакций. Отрицательный контрольный образец вносится в отдельную пробирку с реакционной смесью. Положительный результат в этом образце свидетельствует о необходимости заменить реагенты и переставить эксперимент.

Пример 1. Определение наличия ДНК условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) в биологическом образце с помощью набора синтетических олигонуклеотидов в составе многосоставной реакционной смеси.

Биологический материал (отделяемое слизистой оболочки влагалища) перед проведением ПЦР с помощью предлагаемого набора реагентов проводится через процедуру пробоподготовки с использованием набора реагентов для пробоподготовки, который не является предметом данного патента. В ходе этой процедуры из биологического материала выделяется ДНК, которые, в свою очередь, используют для проведения ПЦР. Вместе с образцами биологического материала процедуру экстракции проходят контрольные образцы - отрицательный контроль и положительный контроль.

Предварительно готовиться реакционная смесь путем смешивания ПЦР-смеси, содержащей специфические синтетические олигонуклеотидные праймеры и зонды, и ПЦР-буфера в объемах, необходимых для исследования образцов биологического материала и контрольных образцов (отрицательный и положительный контроли).

В предварительно подготовленные маркированные пробирки вносится приготовленная реакционная смесь.

В пробирки с реакционной смесью, промаркированные для образцов биологического материала, вносятся пробы ДНК, полученные на этапе экстракции.

В специально промаркированную пробирку вносятся пробы ДНК, полученные на этапе экстракции из отрицательного контроля.

В специально промаркированную пробирку вносятся пробы ДНК, полученные на этапе экстракции из положительного контроля.

Установить пробирки в ячейки реакционного модуля прибора, провести амплификацию и выполнить анализ результатов.

Предложенный набор синтетических олигонуклеотидов позволяет определять ДНК условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) с высокой точностью.

Пример 2. Определение наличия ДНК условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) в биологическом образце с помощью набора синтетических олигонуклеотидов в составе реакционной смеси раскапаной под прослойку парафина.

Биологический материал (отделяемое слизистой оболочки влагалища) перед проведением ПЦР проводится через процедуру пробоподготовки с использованием набора реагентов для пробоподготовки. В ходе этой процедуры из биологического материала выделяется ДНК, которую, в свою очередь, используют для проведения ПЦР. Вместе с образцами биологического материала процедуру экстракции проходят контрольные образцы - отрицательный контроль и положительный контроль.

Отобрать необходимое количество пробирок с ПЦР-смесью для амплификации ДНК исследуемых и контрольных образцов. Убедиться, что парафин полностью покрывает раствор на дне пробирок.

На поверхность парафина внести буферный раствор с полимеразой, при этом он не должен проваливаться под парафин и смешиваться с ПЦР-смесью.

Внести в подготовленные маркированные пробирки пробы ДНК, полученные в результате экстракции из исследуемых образцов. В специально промаркированную пробирку вносится проба ДНК, полученная на этапе экстракции из отрицательного контроля.

В специально промаркированную пробирку вносятся пробы ДНК, полученные на этапе экстракции из положительного контроля.

Установить пробирки в ячейки реакционного модуля прибора, провести амплификацию и выполнить анализ результатов.

Предложенный набор синтетических олигонуклеотидов позволяет определять ДНК условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) с высокой точностью.

Пример 3. Определение наличия ДНК условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) в биологическом образце с помощью набора синтетических олигонуклеотидов в составе лиофильновысушенной реакционной смеси

Биологический материал (отделяемое слизистой оболочки влагалища) перед проведением ПЦР проводится через процедуру пробоподготовки с использованием набора реагентов для пробоподготовки. В ходе этой процедуры из биологического материала выделяется ДНК, которую, в свою очередь, используют для проведения ПЦР. Вместе с образцами биологического материала процедуру экстракции проходят контрольные образцы - отрицательный контроль и положительный контроль.

Отобрать необходимое количество пробирок или достать 96-луночный планшет для амплификации с готовой лиофилизированной реакционной смесью для амплификации ДНК исследуемых и контрольных образцов.

В подготовленные пробирки или лунки планшета внести по пробу ДНК, полученную в результате экстракции из исследуемых образцов.

Поставить контрольные реакции:

а) в пробирку или лунку планшета с реакционной смесью внести контрольный образец.

б) в пробирку или лунку планшета с реакционной смесью внести контрольный образец.

в) отрицательный контроль экстракции (ОК) - в пробирку или лунку планшета с реакционной смесью внести пробы, экстрагированные из ОКО.

Установить пробирки или планшет в ячейки реакционного модуля прибора, провести амплификацию и выполнить анализ результатов.

Предложенный набор синтетических олигонуклеотидов позволяет определять ДНК условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) с высокой точностью.

Набор синтетических олигонуклеотидов для количественного определения условно-патогенных урогенитальных микоплазм (Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis) в слизистой оболочке влагалища методом полимеразной цепной реакции, отличающийся тем, что включает в себя праймеры следующих последовательностей Seq. N1 - Seq. N8, также используются зонды с флуоресцентной меткой, интенсивность флуоресценции которых свидетельствует о количестве образующегося продукта, Seq. N9 - Seq. N12:



 

Похожие патенты:

Изобретение относится к биотехнологии и предусматривает способы тестирования образца на наличие одной или нескольких мишеней. Способы включают приведение образца в контакт с одним или несколькими специфичными для мишени партнерами по связыванию, где каждый специфичный для мишени партнер по связыванию соединен с докинг-цепью и где специфичные для мишени партнеры по связыванию с разной специфичностью соединены с разными докинг-цепями, приведение образца в контакт с мечеными визуализирующими цепями с нуклеотидной последовательностью, которая комплементарна докинг-цепям, с получением меченых визуализирующих цепей, стабильно связанных с докинг-цепями, визуализацию образца и тушение сигнала от связанной меченой визуализирующей цепи или удаление связанных меченых визуализирующих цепей от докинг-цепей путем ферментативного расщепления, модификации или разрушения меченых визуализирующих цепей.

Изобретение относится к области медицины и предназначено для прогнозирования риска развития эссенциальной гипертензии. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, осуществляют выделение ДНК из периферической венозной крови и анализ генетических маркеров матриксных металлопротеиназ.

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ оценки риска прогрессирования цервикальной интраэпителиальной неоплазии.

Изобретение относится к области медицины и предназначено для прогнозирования наличия хромосомных аномалий в эмбрионах удовлетворительного и плохого качества в программе экстракорпорального оплодотворения (ЭКО).

Изобретение относится к области медицины, в частности к медицинской генетике, и предназначено для ранней генетической диагностики риска развития сахарного диабета (СД) 2 типа.

Изобретение относится к области медицины, в частности к медицинской генетике, и предназначено для ранней генетической диагностики риска развития сахарного диабета (СД) 2 типа.

Изобретение относится к области медицины, биологии и биотехнологии и предназначено для определения генотипа человека по полиморфизму в гене цитохрома Р450 CYP2D6*6 (1707delT) rs5030655.

Изобретение относится к области медицины, биологии и биотехнологии и предназначено для определения генотипа человека по полиморфизму в гене цитохрома Р450 CYP2D6*6 (1707delT) rs5030655.

Изобретение относится к области медицины, биологии и биотехнологии и предназначено для определения генотипа человека по полиморфизму в гене цитохрома Р450 CYP2D6*4 (1846G>A) rs3892097.

Изобретение относится к области медицины, биологии и биотехнологии и предназначено для определения генотипа человека по полиморфизму в гене цитохрома Р450 CYP2D6*4 (1846G>A) rs3892097.

Настоящее изобретение относится к области биотехнологии, конкретно к пептидомиметикам эпитопа аполипопротеина А-I, и может быть использовано в медицине. Пептидомиметик эпитопа аполипопротеина А-I, способный специфично связываться с антителами против аполипопротеина А-I, используется в диагностическом иммунологическом методе анализа и позволяет выявить ряд сердечно-сосудистых заболеваний по образцу биологической жидкости.

Изобретение относится к области биотехнологии, в частности к набору диаминобензидин (ДАБ)-содержащего субстрата для окрашивания с использованием антитела, меченного пероксидазой.

Изобретение относится к области биохимии, в частности к антителу к адреномедуллину или его антигенсвязывающему фрагменту. Указанное антитело или его антигенсвязывающий фрагмент специфически связывается с N-концевой областью (ак-1-21) зрелого человеческого ADM, имеющей последовательность YRQSMNNFQGLRSFGCRFGTC, представленную в виде SEQ ID NO:23, и обладает аффинностью связывания с ADM, составляющей по меньшей мере 10-7 М.

Изобретение относится к области медицины, а именно к лабораторной диагностике туберкулеза. Материал для обнаружения возбудителей туберкулеза человека методом полимеразной цепной реакции (ПЦР) представляет собой суспензию, полученную растворением в 0,5 мл физиологического раствора мазков мокроты, неокрашенных и окрашенных по Циль-Нильсену, содержащих возбудителей туберкулеза человека.

Изобретение относится к медицине, а именно к инструментальным способам оценки функционального состояния системы гемостаза. Способ выявления гепарина в пробах крови заключается в том, что выполняют тромбоэластографию с цельной цитратной кровью с добавлением раствора 0,2М кальция хлорида и тромбоэластографии с цельной цитратной кровью с добавлением раствора 0,2М кальция хлорида и инактиватора гепарина, а наличие в пробе крови гепарина выявляют по показателям времени от начала свертывания до образования первых волокон фибрина, мин (R), времени изменения амплитуды свертывания, его нарастания или замедления, мин (K), по показателям максимальной амплитуды (МА) и угла альфа (угол α) в пробе с инактиватором по сравнению с пробой без него, при этом в качестве инактиватора гепарина используют полибрен в конечной концентрации 15-30 мкг/мл, а наличие в пробе крови гепарина выявляют по укорочению показателей R и K и увеличению МА и угла α в пробе с цельной цитратной кровью с добавлением раствора 0,2М кальция хлорида и полибрена по сравнению с пробой с цельной цитратной кровью с добавлением раствора 0,2М кальция хлорида.

Изобретение относится к аналитической химии, а именно к фармацевтическому анализу, и может быть использовано для количественного определения фенобарбитала в таблетках “Корвалол” методом УФ-спектрофотометрии.

Изобретение относится к химико-фармацевтической промышленности и касается способа идентификации лекарственных растительных субстанций - плодов шиповника и витаминного сбора №1 путем анализа спектральных характеристик спиртового извлечения.

Изобретение относится к лабораторному оборудованию, в частности приборам, используемым для определения физико-химических свойств мелкодисперсных огнегасящих составов.

Изобретение относится к иммунологии. Предложено антитело и его антигенсвязывающий фрагмент против эпитопа, расположенного в С-концевой части клаудина 18.2 (CLDN18.2).

Изобретение относится к медицине, а именно к педиатрии и пульмонологии, и может быть использовано при проведении диагностики бронхиальной астмы у детей от 2 до 17 лет с затяжным и хроническим кашлем.

Изобретение касается рекомбинантных белков, содержащих антигенные эпитопы белков Core, Small Envelope, NS2A и preM вируса Зика, и комплексного антигена, содержащего указанные белки.

Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для количественного определения ДНК Ureaplasma parvum, Ureaplasma urealyticum и Mycoplasma hominis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой. Изобретение обеспечивает расширение арсенала средств количественного определения ДНК условно-патогенных урогенитальных микоплазм в биологическом материале. 3 пр.

Наверх