Улучшенный иммунологический состав

Группа изобретений относится к медицине, а именно к терапии и иммунологии, и касается лечения или профилактики воспаления. Для этого вводят композицию, содержащую инулиновые частицы, антиген и патоген-ассоциированную молекулярную структуру (ПАМС) Toll-подобных рецепторов. Это обеспечивает эффективное лечение воспаления за счет синергетического усиления иммунного ответа компонентами композиции. 2 н. и 4 з.п ф-лы, 14 ил., 1 табл., 13 пр.

 

Область техники, к которой относится изобретение

Данное изобретение касается нового состава, подходящего для стимуляции, модуляции, или повышения иммунной реакции.

ВКЛЮЧЕНЫ В НАСТОЯЩУЮ ЗАЯВКУ ПОСРЕДСТВОМ ССЫЛКИ

Следующие международные патентные заявки, перечисленные здесь: PCT/AU86/00311 (WO 87/02679) под названием "Immunotherapeutic treatment", PCT/AU89/00349 (WO 90/01949) под названием "Gamma inulin compositions", и PCT/AU2005/001328 (WO 2006/024100) под названием "New polymorphic form of inulin and uses thereof.

PCT/AU2010/001221 (WO 2011/032229) под названием "A novel epsilon polymorphic form of inulin and compositions comprising same"

Целостное содержание всех этих приложений включено в данное описание посредством отсылки.

ПРЕДПОСЫЛКИ СОЗДАНИЯ ИЗОБРЕТЕНИЯ, ОБЗОР ИЗОБРЕТЕНИЯ И ОБЛАСТИ ТЕХНИКИ, К КОТОРОЙ ОНО ОТНОСИТСЯ

Перечисление или обсуждение с очевидностью ранее опубликованного документа в этой спецификации не обязательно следует считать подтверждением того, что документ является частью уровня техники или является частью общедоступного знания.

В данной области техники общеизвестно, что микробные производные соединений, которые вызывают активацию врожденной иммунной системы, также повышают адаптивный иммунный ответ на антиген совместно вводимой вакцины. Такие соединения, как известно, содержат или мимикрируют патоген-ассоциированные молекулярные структуры (ПАМС), где ПАМС является структурно консервативным мотивом, происходящим от патогена, который иммунологически отличается от молекул хозяина и распознается рецепторами врожденной иммунной систомы (Heine et al., 2005). Виды ПАМС присутствуют в определенных типах белков, липидов, липопротеинов, углеводов, гликолипидов, гликопротеинов, и нуклеиновых кислот, экспрессируемых определенными патогенами и включают триацил липопептиды, порины, гликаны, одно- и двухцепочечную РНК, флагеллин, липотехоевую кислоту, N-формиметионин, и бактериальную или вирусную ДНК. Такие ПАМС действуют как врожденные иммунные активаторы путем связывания с ПАМС-специфическими врожденными иммунными рецепторами, такими, как толл-подобные рецепторы (TLR), NOD-подобные рецепторы, рецепторами RIG лигазы и лектинами типа С. Это приводит к активации генов, отвечающих за воспалительные процессы в клетках иммунной системы.

Эти ПАМС соединения сходны в том, что все они активируют врожденную иммунную систему и вызывают активацию генов воспалительных путей, в частности путем активизации ядерного фактора-каппа В (NFκВ), - главного транскрипционного регулятора активации генов отвечающих за воспалительные процессы. Это воспаление в свою очередь может привести к повышению адаптивной иммунной реакции на совместно вводимый антиген в виде побочного эффекта, или как следствие активации врожденной иммунной системы. Усиление с помощью отдельного вещества адаптивной иммунной реакции на совместно вводимый антиген известно как «адъювантный» эффект.

Не желая ограничиваться теорией, специалистами в данной области науки принимается, что общим фактором, связывающим все соединения, обладающие адъювантной активностью, является их способность индуцировать иммунные "сигналы опасности" (Matzinger, 2002) которые приводят к активации врожденного иммунитета и тем самым к активации NFκB и других цепных реакций, инициирующих воспалительные процессы. Сигналы опасности, которые обеспечивают иммуноадъювантные эффекты, могут быть получены путем локального повреждения тканей, например, вызванного инъекцией воспалительных веществ, таких как масляные эмульсии, или более конкретно, посредством связывания ПАМС с рецепторами врожденной иммунной системы, чья роль заключается в обнаружении вторжения патогена и повреждения тканей. ПАМС-связанные сигналы опасности тем самым предупреждают врожденную иммунную систему о необходимости индуцировать оборонительную воспалительную реакцию против предполагаемой угрозы. После активации этих ПАМС рецепторов, которые обнаруживают угрозу, активируются воспалительные сигнальные пути, в том числе ключевой NFκB путь, что приводит к секреции иммунными клетками, такими как моноциты, ключевых воспалительных эффекторов, в том числе фактора некроза опухоли (TNF)-α, интерлейкинов (IL)-1, IL-6, IL-8 и IL-12, в числе других. Эти медиаторы воспалительного процесса, высвобождаемые в связи с ПАМС активацией, как известно в науке, имеют решающее значение для способности ПАМС повышать антиген-специфический адаптивный иммунный ответа, и на основе этой теории создают методы клеточного анализа для высокопроизводительного скрининга, направленного на выявление новых адъювантных соединений, исходя из их способности индуцировать воспалительные цитокины, такие как TNF-α, IFN-γ, IL-1, IL-8 или IL12 как показатели потенциальной адъювантной активности (Buckner et al., 2008).

Концептуально, два или более таких активатора врожденной иммунной системы, объединенные вместе, вызывают еще более сильные сигналы опасности, генерируя более высокие уровни активации воспалительных генов, и тем самым, предположительно, должны будут проявлять повышенную адъювантную активность (Querec et al., 2006; Kasturi et al., 2011). Однако, как известно специалистам в данной области науки, проблема использования ПАМС по отдельности или, более конкретно, в сочетании друг с другом в качестве иммуномодуляторов или адъювантов вакцин заключается том, что воспалительные эффекты обладают высокой токсичностью и, следовательно, способность к достижению усиленного адаптивного иммунного отклика таким образом затруднена сильно ограничивающей их дозу токсичностью, связанной с местным и системным воспалением, которая, соответственно, увеличивается вместе с увеличением дозы активатора врожденной иммунной системы. Например, даже сочетание частично детоксицированного ПАМС аналога - монофосфориллипида А (MPL), с гидроксидом алюминия ("alum") в адъюванте для поверхностного антигена вируса гепатита В (HBsAg) вакцина вызвала значительно больше местных реакций в месте инъекции, случаев лихорадки и других системных побочных эффектов, чем HBsAg только с адъювантом из гидроксида алюминия (Tong et al., 2005).

Увеличение реактогенности и токсичности, когда два или более активатора врожденной иммунной системы объединены в составе вакцины, является основным барьером для разрешения клинического применения таких адъювантных комбинаций даже там, где возможно их благоприятное влияние на иммуногенность вакцины (Petrovsky et al., 2008). Кроме того, не все комбинации активаторов врожденной иммунной системы являются благоприятными с точки зрения иммуногенности, так, некоторые комбинации активаторов врожденной иммунной системы создают адаптивную иммунную реакцию на совместно вводимый антиген, которая ничем не лучше, чем реакция на отдельно вводимые активаторы врожденной иммунной системы, а некоторые комбинации активаторов врожденной иммунной системы даже приводят к антиген-специфическим ответам более низким, чем при использовании каждого из активаторов врожденной иммунной системы по отдельности. Например, люди, иммунизированные С-концевем рекомбинантным циркумспорозоитным антигеном малярии только с гидроксидом алюминия демонстрируют более высокие концентрации антиген-специфических антител, чем лица получавшие комбинацию гидроксида алюминия с MPL (Gordon et al., 1995).

Наука вакционологии признает использование некоторых веществ, называемых адъювантами для потенцирования иммунного ответа при использовании в сочетании с антигеном. Используемый далее термин «адъювант» будет означать любое вещество или материал, который при введении одновременно или в соединении с антигеном, повышает иммунную реакцию на этот антиген. Проблема с очищенными рекомбинантными или синтетическими антигенами, используемыми в современных вакцинах, заключается в том, что они имеют плохую иммуногенность по сравнению с менее чистыми вакцинами старого стиля на основе живых или убитых целых клеток. Это создало большую потребность в разработке эффективных адъювантов. Адъюванты используются для индукции иммунного ответа, который развивается быстрее или сильнее, чем без использования адъюванта. Кроме того, адъюванты могут быть использованы для создания иммунного ответа с употреблением меньшего количества антигена, чем было бы необходимо без включения адъюванта; чтобы увеличить производство некоторых подклассов антител, которые предоставляют иммунологическую защиту, или усилить определенные клеточные иммунные ответы (например ответы CD4 или CD8 Т клеток памяти) (Petrovsky et al., 2004).

Известные адъюванты включают соли алюминия (и обычно называются "алюминиевыми" адъювантами). За редкими исключениями, алюминиевые адъюванты остается единственными адъювантами лицензированными для использования в людях во многих странах. Хотя алюминиевые адъюванты часто используют, чтобы вызвать хороший антительный (Th2) ответ на совместно вводимый антиген(ы), они в значительной степени неэффективны в стимулировании клеточного (Th1) иммунного ответа, который важен для защиты от многих патогенов. Кроме того, алюминий имеет свойство вызвать редкие тяжелые местные и системные побочные эффекты, включая стерильные абсцессы, эозинофилию и макрофагиальный миозит (Israeli et al., 2010). Существует также озабоченность по поводу возможной роли солей алюминия в нейродегенеративных заболеваний, таких как болезнь Альцгеймера (Bondy, 2010). Другие лицензированные адъюванты, включая MF59-адъювант на основе эмульсии скваленового масла, который имеет лицензию в Европе как часть вакцины против гриппа Durando et al., 2010), а также AS04, сочетание гидроксида алюминия и монофосфориллипида A (MPL), который имеет лицензию на Европа в вакцинах против гепатита В.

Тем не менее, крупнейшим препятствием для разработки более совершенных адъювантов для человека, используемых в одиночку или комбинированно, являются проблемы местной и системной токсичности и побочных реакций. Это является особой проблемой в развитии детских вакцин, где безопасность имеет первостепенное значение. Вакцино-опосредованные побочные реакции включают воспаление и образование гранулемы на участке инъекции, пирогенность, тошноты, адъювантный артрит, увеит, эозинофилию, аллергии, анафилаксии, токсичность, специфичную для отдельных органов или иммуннотоксичность, т.е. освобождение токсичных количеств воспалительных цитокинов (Petrovsky et al.). Такая крайняя токсичность затрудняет использование в целом сильнодействующих адъювантов, таких как полный адъювант Фрейнда (CFA), и в основном отражает чрезмерную активацию воспалительных путей адъювантом - активатором врожденной иммунной системы. Соединения или комбинированные препараты, которые могут успешно повышать адаптивный иммунный ответ, но в то же время хорошо переносятся, безопасны и нетоксичны для получателя остаются весьма редкими, и из сотен соединений, известных как активаторы врожденной иммунной системы и обладают адъювантным потенциалом, крайне малое их количество одобрено для использования в организме человека, и всего в два из них, алюминий и MPL, одобрены FDA для использования в вакцинах для человека на рынке США.

В идеале, адъюванты должны подходить для использования с широким кругом потенциальных вакцинных антигенов и быть безопасны для использования в популяциях с низким иммунным ответом, в том числе для детей, пожилых людей и лиц с ослабленным иммунитетом. Таким образом, одной из основных нерешенных проблем в области исследования вакцин остается увеличение потенциала вакцин без повышения локальной или системной токсичности. Трудность достижения этой цели иллюстрируется тем фактом, что алюминиевые адъюванты, спустя 90 лет после их открытия, продолжают доминировать в вакцинах для человека.

Так как по большей части механизмы адъювантной активности неизвестны, наука в целом не в состоянии предсказать на эмпирической основе, будет ли конкретное соединение или смесь соединений обладать адъювантной активностью. Аналогичным образом, нет никакого способа предусмотренного в данной области техники, чтобы предсказать на эмпирической основе, является ли конкретный адъювант или смесь адъювантов безопасна и хорошо переносима.

Кроме того, каждая адъювант-антиген комбинация может генерировать различные типы иммунного ответа, который может или не может обеспечить повышенную защиту от соответствующего патогена. Например, были описаны различные виды адаптивного иммунного ответа, например Т-хелперные (Th) Th1, Th2 и Th17 ответы. Для конкретного патогена один адаптивный иммунный ответ может быть более благоприятным для обеспечения защиты, чем другие. Например, для лейшмании ответ на вакцину по механизму Th1 является защитным, тогда как Th2 ответ может вызвать неблагоприятный результат. Для других патогенов обратное может быть правдой, так что Th2 ответ благоприятен, тогда как Th1 ответ является вредным, а в других ситуациях ответ на вакцину по механизму Th17 может быть желательным.

Это означает, что, для того чтобы найти успешные адъювант-антиген комбинации для вакцин, технология опирается на обширные испытания по методу проб и ошибок. Даже после тщательной проверки на животных моделях имеется масса примеров адъювант-антиген комбинаций, которые были эффективны в животных моделях испытаний и были неэффективными, или даже вредными при введении людям. Примером первого является неэффективность алюминиевых адъювантов в вакцинах против гриппа для человека, несмотря на показанную улучшенную защиту на животных моделях. Другим примером является респираторно-синцитиальный вирус (RSV), вакцина которого при формулировании с алюминиевым адъювантом показала повышение иммуногенности и защиты в животных моделях RSV-инфекции, но ухудшала заболевание и увеличивала смертность от RSV инфекции при введении ее детям. Как полагают, этот эффект был вызван вакциной из-за формирования неправильного типа иммунного ответа, а именно Th2, вместо Th1 ответа (Prince et al., 1986).

β-D-(2-l) полифруктофуранозил α-D-глюкоза (обычно известная как инулин) представляет собой полисахарид, который (как показано в WO 87/02679, WO 2006/024100, и WO 2011/032229, содержание каждого из которых включено здесь в качестве ссылки), обретает полезные свойства при кристаллизации в стабильные частицы. Инулин имеет относительно гидрофобную, полиоксиэтилен-подобную основу, это необычное строение, плюс его не ионизированная природа, позволяют проводить повторную кристаллизацию и легко получать его в очень чистом виде. Инулин в необработанном виде, как правило, растворяется в теплой воде, но, как показано в WO 87/02679, WO 2006/024100 и WO 2011/032229, может при специфической обработке кристаллизоваться в более стабильные полиморфные формы, в том числе в ранее описанные гамма (gIN), дельта (dIN) и эпсилон (eIN) формы.

Такие частицы инулина (далее собирательно называемые как "инулиновые частицы"), в основном нерастворимы при нормальной температуре тела млекопитающего, и, как было установлено, обладают прекрасными адъювантными свойствами. Не желая быть связанными теорией, мы констатируем, что стабильная конформация этих форм инулина важна для инулиновых частиц, чтобы они оставались интактными достаточно долго для того, чтобы связаться и взаимодействовать с иммунными клетками. Следовательно, когда суспензии инулиновых частиц нагревают до высокой температуры с тем, чтобы диссоциировать и растворить частицы инулина, полученный раствор инулина теряет иммунологическую и адъювантную активность. Инулиновые частицы разделяют свойства, связанные с их адъювантным действием, включая способность усиливать обработку антигена и презентацию его с помощью соответствующих иммунных клеток; такие свойства не присущи более растворимым формам инулина.

Не желая быть связанными теорией, мы наблюдали, что иммунные эффекты каждой полиморфной формы инулина увеличиваются последовательно, по мере того как увеличиваются температуры растворимости, так что частицы dIN являются более адъювантно активными и термостабильными, чем gIN, а частицы eIN, в свою очередь, более термостабильны и адъювантно активны, чем частицы dIN. Таким образом, gIN, dIN и eIN формы являются адъювантно активными по нарастающей. Как показано в WO 87/02679, WO 2006/024100, и WO 2011/032229, стабильные композиции инулина, включающие gIN, dIN и eIN частицы соответствующего размера и состава могут повысить гуморальный и/или клеточный адаптивный иммунный ответа к совместно вводимым в составе вакцины антигенам.

Как описано далее в настоящей заявке, при изучении биологических эффектов инулиновых частиц, мы сделали удивительное открытие, что также наблюдается их противовоспалительное действие. Более конкретно, было обнаружено, что при культивировании с человеческими мононуклеарными клетками периферической крови (РВМС) или спленоцитами мышей, инулиновые частицы активируют, а не подавляют экспрессию противо-воспалительных генов. С другой стороны, они снижают экспрессию многих про-воспалительных генов и, в частности, инулиновые частицы не активируют экспрессию NFkB.

Это было очень неожиданным открытием, по видимости, противоречившим широко принятой "модели опасности" согласно которой все адъюванты как полагают, работают через активацию про-воспалительных врожденных иммунных путей через активацию NFkB и/или инфламмасомы и тем самым, через активацию производства воспалительных цитокинов, таких как TNF-α, IL-1. "Модель опасности" была в значительной степени разработана на основе известной адъювантной активности ПАМС, например агонистов TLR, которые активируют врожденную иммунную систему, а так же прямо или косвенно увеличивают адаптивные иммунные реакции к совместно введенным антигенам. ПАМС-производные адъюванты все разделяют свойство индуцировать производство про-воспалительных цитокинов, включая фактор некроза опухоли (TNF)-α, интерлейкин (IL)-1 и IL-6. ПАМС индуцируют эти цитокины через активацию NFƙB, основного фактора транскрипции индуцирующего воспаление в иммунных клетках (Werling at al., 2003). Точно так же, алюминиевые адъюванты и масляные эмульсионные адъюванты активируют инфламмасому, - чувствительный к повреждению тканей механизм, который при активации также приводит к образованию воспалительных цитокинов, включая IL-1 (Eisenbarth et al., 2008). Напротив, инулиновые частицы при инкубации с РВМС человека не активируют NFkB, но вместо этого подавляют экспрессию про-воспалительных генов, включая интерлейкин (IL)-1, IL1RAP, IL18RAP, циклооксигеназы (ЦОГ-2), NALP3, NLRP3, NLRP12, CARD 12, IFIT1, IFIT2, IFIT3, IDO, CXCL5, CXCL6, CXCR7, CD14, TLR4, NOD2, формильные рецепторы 1, 2 и 3, и активируют гены, связанные с подавлением врожденных иммунных реакций и с торможением про-воспалительного IL1 цитокинового пути, в том числе антагониста IL-1-рецепторов (IL-1RA), IL1RN и IL1R2, а также IL-18BP, CD33, ATF3, TREM1, PPAR-гамма, FCRL2 и CD36. Эти данные показали, что инулиновые частицы имеют противовоспалительную активность, что приводит к первому аспекту настоящего изобретения, как описано ниже. Поэтому мы стремились проверить способность инулиновых частиц ингибировать воспаление, с целью возможного использования инулиновых частиц для лечения или профилактики воспалительного заболевания.

Чтобы проверить, могут ли инулиновые частицы уменьшить побочные эффекты про-воспалительных иммунных активаторов и адъювантов, инулиновые частицы были испытаны in vitro и in vivo, с рядом ПАМС и активаторов врожденной иммунной системы, в том числе с широким диапазоном агонистов TLR, ожидая, что частицы инулина будут ингибировать как воспаление, так и адъювантную активность индуцированную с помощью ПАМС и других активаторов врожденной иммунной системы. Результаты были неожиданными и удивительными, и привели ко второму аспекту настоящего изобретения. Как и предсказывалось, совместное введение инулиновых частиц вместе с классическим ПАМС, активирующим врожденную иммунную систему, таким как CpG-мотив, содержащий олигонуклеотиды (ODN), снизило активацию про-воспалительных генов, опосредованную CpG ODN. Неожиданно выяснилось, однако, что, несмотря на способность успешно ингибировать воспалительные сигналы, вызванные ПАМС, частицы инулина фактически усиливали адъювантную активность ПАМС на адаптивную иммунную реакцию, измеренную по их способности увеличивать защитный иммунный ответ памяти против совместно вводимого антигена. Это открытие было удивительным, учитывая, что частицы инулина, согласно прогнозам, должны были подавлять провоспалительные "сигналы опасности" и врожденную иммунную активацию, вызванную совместно вводимыми ПАМС. В сложившейся модели "сигнала опасности" инулиновые частицы путем ингибирования воспалительных реакций, должны были уменьшить адъювантную активность ПАМС.

Мы впоследствии повторили данный эксперимент со многими разнообразными другими адъювантами на основе ПАМС, и последовательно наблюдали такие же положительные эффекты инулиновых частиц, то есть уменьшение воспаления и повышение адъювантной активности. Ввиду предыдущего отсутствие предсказуемости в данной области техники адъювантов, при объединении нескольких веществ в единую композицию, последовательные сходные результаты, полученные при объединении инулиновых частиц со всеми тестируемыми ПАМС были еще одним неожиданным результатом. Не желая ограничиваться теорией, мы показали, что подавление инулиновыми частицами про-воспалительных путей врожденной иммунной системы, вызванных ПАМС, может парадоксальным образом повысить способность ПАМС стимулировать адаптивную реакцию иммунологической памяти, предполагая, что про-воспалительные цитокины врожденной иммунной системы, такие как IL1, индуцируемые ПАМС могут, особенно если их уровень слишком высок, подавлять, а не стимулировать адаптивную реакцию иммунной памяти. Таким образом, совместное введение частиц инулина и активаторов врожденной иммунной системы, таких как ПАМС, вместе с вакцинным антигеном, приводит к удивительному синергетическому усилению реакции иммунологической памяти против совместно вводимого вакцинного антигена. Совместное введение инулиновых частиц с активаторами врожденной иммунной системы или ПАМС также предоставило удивительную возможность снижения дозы активатора врожденной иммунной системы, так что тот же адъювантный эффект может быть получен с понижением дозы ПАМС активатора врожденной иммунной системы. Повторяем, что эффект инулиновых частиц невозможно было бы предсказать на модели адъювантного действия через "сигнал опасности". Это обеспечивает возможность использовать инулиновые частицы для достижения того же усиления адаптивного иммунного эффекта с низкой дозой активатора врожденной иммунной системы, тем самым предлагая возможность снизить дозо-зависимые побочные эффекты, такие как воспаление, вызванное активаторами врожденной иммунной системы, включая ПАМС. Совместное введение частиц инулина имеет дальнейший потенциал снижения нежелательных, связанных с воспалением, побочных эффектов, вызванных активаторами врожденной иммунной системы и ПАМС, блокируя или ослабляя экспрессию про-воспалительных генов.

Заявители нашли, таким образом, что сочетание инулиновых частиц вместе с ПАМС активаторами врожденной иммунной системы приводит к удивительно благоприятным и синергическим иммунным ответам.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к продуктам и методам индуцирования благоприятного противовоспалительного и/или иммунного ответа. Изобретение основано на неожиданном открытии, что инулиновые частицы могут быть использованы для обеспечения ранее неизвестного, противовоспалительного действия.

Еще один вариант разработки изобретения основан на неожиданном открытии, что совместное введение инулиновых частиц с активаторами врожденной иммунной системы приводит к выгодной синергической модуляции баланса между врожденными и адаптивными иммунными реакциями, так, что повышенный ответ иммунной памяти достигается к совместно вводимому антигену с, как минимум, сокращением ассоциированных с воспалением побочных эффектов.

Соответственно, в первом аспекте, настоящее изобретение обеспечивает композицию, содержащую или состоящую из инулиновых частиц, для использования в снижении или ингибировании воспаления, и/или для лечения или профилактики воспалительного заболевания у субъекта.

Иными словами, первый аспект настоящего изобретения обеспечивает способ уменьшения или ингибирования воспаления, и/или для лечения или предотвращения (в том числе профилактики против) воспалительного заболевания у субъекта, причем способ включает введение объекту терапевтически эффективного количества композиции, содержащей или состоящей из инулиновых частиц.

Соответственно, первый аспект настоящего изобретения относится к применению композиции, содержащей или состоящей из инулиновых частиц, в изготовлении лекарственного средства для уменьшения или ингибирования воспаления, и/или для лечения или профилактики воспалительного заболевания в объекте.

Развивая первый аспект настоящего изобретения, снижение или ингибирование воспаления, и/или лечение или профилактика воспалительных заболеваний, могут быть охарактеризованы через положительную регуляцию экспрессии одного или более противовоспалительных генов и/или белков, и/или понижающую регуляцию экспрессии одного или нескольких про-воспалительных генов и/или белков в субъекте, или более выборочно, в частности, в миелоидных или лимфоидных клетках, включая моноциты, дендритные клетки, гранулоциты, НК-клетки и/или лимфоциты. Примерами провоспалительных генов, для которых наблюдается понижающая регуляция в этой теме в этом контексте могут служить интерлейкин (IL)-1, IL1RAP, IL18RAP, IL-6, циклооксигеназы (ЦОГ-2), FPR2, MyD88, NALP3, Nlrp3, NLRP12, CARD12, IFIT1, IFIT2, IFIT3, IDO, CXCL5, CXCL6, CXCR7, CD14, TLR4, NOD2, формильные рецепторы 1, 2 или 3, и члены CXC1 семейства хемокинов и/или члены семьи TLR. Примерами противовоспалительных генов, подверженных позитивной регуляции для субъекта в этом контексте могут служить антагонисты IL-1-рецептора (IL-1ra), IL1RN и IL1R2, IL-18BP, CD5L, CD33, ATF3, TREM1, PPAR-гамма, FCRL2 и CD36.

Таким образом, инулиновые частицы могут быть использованы в соответствии с первым аспектом настоящего изобретения для снижения или подавления воспаления у субъекта. Воспаление у субъекта может быть вызвано, например, с помощью воздействия одного или более про-воспалительных веществ, в том числе патогенных инфекций (в том числе бактериальной, вирусной, грибковой или протозойной инфекции, в качестве примера инфекций могут служить инфекции пандемического или сезонного гриппа, легочная форма сибирской язвы, грамотрицательная септицемия, системная виремия, энцефалит, лихорадка Q, туляремия, оспа, хронический гепатит В или С, ОРВИ, коклюш, малярия, ВИЧ, туберкулез, полиомиелит, бешенство, респираторно-синцитиальный вирус (RSV), шигелла, мононуклеоз, цитомегаловирус и токсический шоковый синдром, аллергенные вещества, такие как яд насекомых, кошачья или собачья перхоть, рожь, антиген пылевого клеща, и пыльца и другие про-воспалительные вещества или композиции, в том числе, например, композиции, содержащие про-воспалительные вещества, такие как вакцинные композиции или аллерген-десенсибилизационные композиции или противоопухолевые препараты, частицы инулинаа могут быть введены субъекту до, одновременно с контактом субъекта с одним или более про-воспалительными веществами, или после него.

Вариантом, представляющим особый интерес в соответствии с первым аспектом настоящего изобретения является применение инулиновых частиц, для уменьшения или ингибирования воспаления у субъекта, обусловленного воздействием (например, введением) про-воспалительных веществ или композиций, содержащих вещество, содержащее или состоящее из активатора врожденной иммунной системы и, в частности, патоген-ассоциированных молекулярных структур (ПАМС), включая функциональные варианты, производные или аналоги. Про-воспалительная композиция может, например, представлять собой фармацевтически приемлемую композицию, содержащую про-воспалительный компонент, который намеренно вводят субъекту, или в другом примере может быть про-воспалительным веществом (например, биологическим или патогенным организмом или веществом), с которым субъект намеренно или случайно подвергается контакту. В этом контексте введение инулиновых частиц субъекту до, или одновременно с введением (в том числе в виде одной смеси), или воздействием про-воспалительной композиции может быть наиболее выгодно. Таким образом, в этом варианте осуществления композиция, содержащая частицы инулина, используется для уменьшения или ингибирования воспалительной реакции субъекта к про-воспалительным веществам или композициям.

Если про-воспалительная композиция представляет собой композицию адъюванта, который содержит или состоит из ПАМС то, например, частицы инулина могут быть использованы для уменьшения, ингибирования или предотвращения одной или более побочных реакций субъекта к ПАМС, включая головную боль, усталость, миалгию, диарею, лихорадку, воспаление и формирование гранулемы на месте инъекции, пирогенность, тошноту, адъювантный артрит, увеит, эозинофилию, аллергии, анафилаксии, орган-специфическую токсичность или иммунотоксичность, т.е. освобождение токсичных количеств воспалительных цитокинов.

Инулиновые частицы также могут быть использованы в соответствии с первым аспектом настоящего изобретения для лечения или профилактики воспалительного заболевания у субъекта. Виды воспалительных заболеваний, представляющих особый интерес для лечения или профилактики в данном контексте могут включать воспалительные заболевания, которые характеризуются, или связаны с активацией NFkB и/или повышенным уровнем IL-1 гена или белка, или сигнализации, или нарушением регуляции IL-1. Примерные воспалительных заболеваний включают мигрень, синдром хронической усталости, ревматоидный артрит, астма, хроническую обструктивную болезнь дыхательных путей, воспалительные заболевания кишечника, включая язвенный колит и болезнь Крона, синдром хронической усталости, криопирин связанные периодические синдромы, в том числе врожденную мультисистемную воспалительную болезнь и синдром Макла-Уэльса, инфламмасома-ассоциированные расстройств, псориаз, атеросклероз, сахарный диабет типа 1 или типа 2, наследственные синдромы лихорадки, периодический синдром, ассоциированный с рецептором фактора некроза опухоли, синдром Шнитцлера, системную красную волчанку, аутоиммунный гепатит, болезнь Бехчета и идиопатический рецидивирующий перикардит.

Соответственно, субъекты для лечения по способу согласно первому аспекту настоящего изобретения могут включать в себя тех, кто был, будет (в том смысле, что они должны быть подвергнуты, или имеют повышенный риск того, чтобы быть, предпочтительно в течение следующего месяца, недели, 6, 5, 4, 3, 2 или 1 дня, или меньше, чем 24, 12, 6, 5, 4, 3, 2 или 1 часа), подвергнутыми воздействию одного или более про-воспалительных веществ, в том числе патогенных инфекций (в том числе бактериальных, вирусных, грибковых или протозойных инфекций), аллергенных веществ или других про-воспалительных композиций, в том числе, например, композиции, содержащие про-воспалительный адъювант, такой как вакцинные композиции или аллерген-десенсибилизационные композиций и/или тех, кто уже страдает, или установлено, что будет иметь риск пострадать от воспалительных заболеваний, в том числе воспалительного заболевания, которое характеризуется, или связанной с повышением уровней IL-1 или сигнализации, или IL-1 регуляции, и могут быть выбраны из группы, состоящей из лиц у которых обнаружены мигрень, синдром хронической усталости, ревматоидный артрит, астма, хроническая обструктивная болезнь дыхательных путей, воспалительные заболевания кишечника, включая язвенный колит и болезнь Крона, синдром хронической усталости, криопирин-связанные периодические синдромы, в том числе врожденная мультисистемная воспалительная болезнь и синдром Макла-Уэльса, инфламмасомно-ассоциированные расстройства, псориаз, атеросклероз, сахарный диабет типа 1 или типа 2, наследственные синдромы лихорадки, периодический синдром, ассоциированной с рецептором фактора некроза опухоли, синдром Шнитцлера, системная красная волчанка, аутоиммунный гепатит, болезнь Бехчета и идиопатический рецидивирующий перикардит.

Второй аспект настоящего изобретения обеспечивает иммунологическую и/или его фармацевтически приемлемую композицию, содержащую:

(A) противовоспалительный компонент, такой как частицы инулина и/или одного или более других противовоспалительных ингибиторов IL-1 и/или одного или более других противовоспалительных ингибиторов активации NFkB;

(Б) вещество, содержащее или состоящее из одного или нескольких видов патоген ассоциированных молекулярных структур (ПАМС); и, необязательно, дополнительно включающий

(B) один или несколько дополнительных веществ, например, выбранных из группы, состоящей из антитела, антисенс-олигонуклеотида, белка, антигена, аллергена, полинуклеотидной молекулы, рекомбинантного вирусного вектора, целого микроорганизма, или целого вируса.

Патоген ассоциированные молекулярные структуры (ПАМС), как они использованы в контексте первого и второго аспектов настоящего изобретения относятся к молекулам, имеющим способность активировать врожденную иммунную систему. ПАМС прямо или косвенно распознаются одним или более рецепторами врожденной иммунной системы и/или активируют гены воспалительных процессов в клетках иммунной системы. ПАМС индуцируют экспрессию про-воспалительных генов и продукцию противовоспалительных белков иммунными клетками, включая, например, один или более из лимфоцитов, моноцитов, гранулоцитов, НК-клеток, дендритных клеток, про-воспалительную экспрессию генов, включая, например, однин или более цитокинов, включая TNF-α, G-CSF, GM-CSF, IL-1 до IL-33 и, в частности IL-1, IL-4, IL-5, IL-6, IL-12, IL-13, IL-18, IL-20, интерфероны, включая тип 1 интерферонов и гамма-интерферон, хемокинов в том числе семьи СХС хемокинов в том числе от CXCL1 до CXCL17, СС семьи хемокинов в том числе от CCL1 до CCL28, СХ3С хемокинов в том числе фракталкин, С семьи хемокинов включая от XCL1 до XCL2, причем индукция этих провоспалительных генов обычно включает активацию фактора транскрипции NFκВ.

В контексте настоящей заявки термин ПАМС включает не только те ПАМС, которые встречаются в природе, но также и функционально эквивалентные миметики, варианты, их производные и аналоги, в том числе синтетические ПАМС. Многочисленные природные и синтетические ПАМС известны в данной области техники, многие из которых описаны ниже более подробно.

Компонент (а) композиции по второму аспекту настоящего изобретения представляет собой противовоспалительный компонент, такой как противовоспалительный ингибитор IL-1 или противовоспалительный ингибитор NFkB. В варианте, представляющем особый интерес для настоящего изобретения, противовоспалительный компонент состоит из или содержит инулиновые частицы. Другими противовоспалительными ингибиторами IL-1, представляющими особый интерес являются функциональные эквиваленты инулиновых частиц, в смысле обладания, по существу, эквивалентными противовоспалительными свойствами, активностью и/или специфичностью и/или обладанием, по существу, эквивалентной адъювантной способностью. Они могут включать один или более из антагонистов рецептора IL1, IL1RA, Anakinra, Rilonacept, IL-1R/IL1RacP/Fc-fusion белок, Canakinumab, антитела, массово блокирующие IL-1β, блокаторы рецепторов IL1, IL-1RII, индометацин, нестероидные противовоспалительные средства (НПВС), включая индометацин, глюкокортикоиды, ингибиторы каспаз, включая каспазы 1, ингибиторы инфламмасомы, хлорохин, ингибиторы рецепторов, ингибиторы Р2Х7 рецептора ST2, куркумин, ресвератрол и ингибиторы биосинтеза эйкозаноидов.

Компонент (б) композиции по второму аспекту настоящего изобретения представляет собой вещество, содержащее или состоящее из одного или нескольких патоген ассоциированных молекулярных структур (ПАМС). В одном варианте вещество может содержать не больше, чем десять различных молекулярных видов ПАМС, такие как девять или меньше, восемь или менее, семь или менее, шесть или менее, пять или менее, четыре или менее, три или менее, два или менее различных, или только один специфический молекулярный вид ПАМС. В одном варианте, ограничение числа различных молекулярных видов ПАМС в компоненте (В) может быть применимо только в отношении комбинации с инулиновыми частицами, содержащими или состоящими из определенного типа инулина.

Так, например, в конкретном варианте осуществления, компонент (б) может содержать не больше, чем десять, девять, восемь, семь, шесть, пять, четыре три, два различных, или один определенный молекулярный вид ПАМС, где частицы инулина в компоненте (а) содержат или состоят из гамма инулина.

В другом конкретном варианте компонент (б) может содержать не больше, чем десять, девять, восемь, семь, шесть, пять, четыре три, два различных, или один определенный молекулярный вид ПАМС, где частицы инулина в компоненте (а) содержат или состоят из дельта инулина.

В другом конкретном варианте компонент (б) может содержать не больше, чем десять, девять, восемь, семь, шесть, пять, четыре три, два различных, или один определенный молекулярный вид ПАМС, где частицы инулина в компоненте (а) содержат или состоят из эпсилон инулина.

Различные молекулярные виды ПАМС, в контексте второго аспекта настоящего изобретения, могут, например, быть структурно различны. Такое структурное различие может, например, быть определено методами структурного анализа, которые известны и обычны в данной области, такими как масс-спектроскопия, ЯМР, ИК-Фурье, круговой дихроизм, или дифференциальная сканирующая калориметрия.

Дополнительно или альтернативно, различные молекулярные виды патоген ассоциированных молекулярных структур (ПАМС), в контексте второго аспекта настоящего изобретения, могут быть функционально различны. Функционально различные молекулярные виды ПАМС могут характеризоваться разными профилями связывания рецепторов врожденной иммунной системы. Это может быть оценено, например, путем измерения связывания видов ПАМС к панели врожденных иммунных рецепторов, которые могут, например, содержать рецепторы, выбранные из TLR, таких как человека или животного TLR-1, TLR-2, TLR-3, TLR-4, TLR-5, TLR-6, TLR-7, TLR-8, TLR-9, мыши TLR-11; NOD-1, NOD-2, другие NOD-подобные рецепторы (NLRS), такие как NLRP1, Nlrp3, NLRP12, NLRC4; Dectin-1;, DC-SIGN; AIM-2, С-тип лектин, MD2; CD14; LBP; CD36; RIG-I-подобные рецепторы в том числе RIG-I, MDA5, LGP2 и/или ASC. Связывание видов ПАМС к этим рецепторам может быть оценено с помощью обычных методов, таких как поверхностный плазмонный резонанс (Schasfoort, 2008). Специалист сможет определить соответствующие условия для оценки связывания, которые должны, как правило, быть выбраны, чтобы обеспечить оценку специфичности связывания в условиях от умеренных до очень строгих. Дополнительно или альтернативно, как известно специалисту в данной области, свойство ПАМС могут быть обнаружены, или оценены в иммунных клеточных линиях, таких как ТНР-1 или RAW клеточные линии, с помощью функционального анализа, например, с использованием теста с репортером активации NfkB, таким как люциферазная тест система от Thermo Scientific Pierce (Hughes, 2012) или путем измерения активации воспалительного гена или белка в ответ на инкубацию клеточной линии с веществом, исследуемого на ПАМС активность.

В одном из вариантов осуществления второго аспекта настоящего изобретения, совокупность ПАМС, которые присутствуют в компоненте (b) композиции (и, возможно, всех ПАМС в композиции, в том случае, если компонент (с) содержит другие ПАМС) не будет связываться с более чем 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 или 1 из рецепторов в панели рецепторов врожденной иммунной системы, как описано выше, с тем, что ПАМС, не связывает более чем 3, 2 или 1 из рецепторов, представляющих особый интерес.

Несмотря на способны косвенной активации врожденного иммунитета через лизис лизосом в фагоцитирующих клетках, активацию инфламмасомы, активацию каспазы, индукция смерти иммунных клеток, и высвобождение эндогенного ДНК, антигенсвязывающие несущие материалы с адъювантной активностью, такие как алюминий, (или соли или прецепитаты алюминия или других металлов, такие как фосфаты, сульфаты, гидроксиды или гидраты магния, кальция или алюминия) не показали способность связывать специфический рецептор ПАМС, и не имитируют молекулярные структуры, экспрессируемые патогенами, и таким образом следует, что они способны действовать иным образом, нежели молекулярно определенные ПАМС, которые связывают определенные рецепторы врожденной иммунной системы, они не являются частью определения ПАМС, которое используется в данной заявке.

Следует иметь в виду, что дополнительный компонент (с) композиции по второму аспекту настоящего изобретения, может, например, включать одно или несколько дополнительных веществ, выбранных из группы, состоящей из антитела, антисенс-олигонуклеотида, белка, антигена, аллергена, полинуклеотидной молекулы, рекомбинантного вирусного вектора, целого микроорганизма, или целого вируса, таким образом компонент (с) может внести один или несколько дополнительных ПАМС в композицию. Например, целые микроорганизмы, цельные вирусы, эндотоксин и т.п. будут содержать большое число (определенно больше, чем десять) молекулярно, структурно, физически и/или функционально различных молекулярных видов ПАМС. Таким образом, общее число различных молекулярных видов ПАМС в составе согласно второму аспекту настоящего изобретения, может быть больше, чем десять. Но это не умаляет требования, что в одном варианте осуществления второго аспекта настоящего изобретения компонент (б) композиции будет содержать не больше, чем десять, или меньше различных молекулярных видов ПАМС. Как правило, таким образом, вещество/(вещества) возможно присутствующие в компоненте (с) будут молекулярно, структурно и/или функционально отличны от молекул, присутствующих в компоненте (b).

Один или более ПАМС (предпочтительно все ПАМС), присутствующих в компоненте (б) композиции по второму аспекту настоящего изобретения обладают среднемассовой молекулярной массой до, но не более 200000 кДа, например, вплоть до, но не более чем 150000 кДа, 100000 кДа, 50000 кДа, 40000 кДа, 20000 кДа, 10000 кДа, 5000 кДа, 2000 кДа, 1000 кДа, 500 кДа, 450 кДа, 400 кДа, 350 кДа, 300 кДа, 250 кДа, 200 кДа, 150 кДа, 100 кДа, 50 кДа, 40 кДа, 30 кДа, 20 кДа, 10 кДа, 9 кДа, 8 кДа, 7 кДа, 6 кДа, 5 кДа, 4 кДа, 3 кДа, 2 кДа, или 1 кДа или менее.

Композиция в соответствии со вторым аспектом настоящего изобретения, может быть фармацевтически приемлемой композиции. В этом контексте фармацевтически приемлемая композиция может представлять собой композицию, которая является безопасной для введения субъекту, например, субъекту-человеку, путем инъекции, например внутривенной, подкожной или внутримышечной. В одном варианте дефиниции композиция может быть определена как безопасная, если она не является или по существу не содержит в себе, эндотоксина. Эндотоксин часто используется синонимично с термином липополисахарид, который является основным компонентом наружной клеточной стенки грамотрицательных бактерий. Он состоит из полисахаридной (углеводной) цепи и липидной группой, известной как липид А, который отвечает за токсические эффекты, наблюдаемые у эндотоксина. Полисахаридная цепь сильно варьирует у различных бактерий и определяет серотип эндотоксина, липидные компоненты также сильно варьируют таким образом, что один образец эндотоксина может содержать от 10 до 100 различных видов молекул. Эндотоксин весит примерно 10 кДа, но может образовывать крупные агрегаты до 1000 кДа. Эндотоксин, как правило, вреден и пирогенен в терапевтических композициях, и регулирующие органы ввели строгие ограничения на допустимые уровни эндотоксина в пределах фармацевтической композиции. Соответственно, уровень эндотоксина в композиции в соответствии со вторым аспектом настоящего изобретения, должен быть сведен к минимуму, и должен быть меньше, чем 100 единиц эндотоксина (ЕС) на дозу, например, менее 90, 80, 70, 60, 50 40, 30, 20, 10, 5, 4, 3, 2, 1 или менее ЕС на дозу. Концентрация эндотоксина в композиции в соответствии со вторым аспектом настоящего изобретения, может быть меньше, чем 200 EU/m3, например, менее 150, 100, 90, 80, 70, 60, 50 40, 30, 20, 10, 5, 4, 3, 2, 1 или меньше EU/m3. В некоторых вариантах осуществления эти ограничения могут быть применены к составу второго аспекта изобретения, где частицы инулина, присутствующие в компоненте (а) содержат или состоят из одного или двух: гамма инулина, дельта инулина или эпсилон инулина. Методы измерения уровней эндотоксина, такие как лимулус амебоцит лизатный (LAL) метод, хорошо известны в данной области.

Состав по второму аспекту настоящего изобретения дополнительно может быть упакован и/или представлен в удобной или единично дозированной форме.

Количество и/или концентрация ПАМС, присутствующего в компоненте (В) композиции по второму аспекту настоящего изобретения (и, дополнительно, количества и/или концентрации ПАМС, присутствующие во всей композиции) предпочтительно меньше, чем количество ПАМС, которое требуется в эквивалентной композиции, которая отличается только тем, что она не включает частицы инулина (или другого эквивалентного противовоспалительного компонента). Другими словами, присутствие частиц инулина (или другого эквивалентного противовоспалительного компонента) в компоненте (а) композиции по второму аспекту настоящего изобретения относится к композиции, которая способна индуцировать или модулировать иммунный ответ у субъекта используя меньше ПАМС в компоненте (б), чем требовалось бы для достижения такого же уровня или типа индукции или модуляции по сравнению с эквивалентным составом, который отличается только тем, что она не включает частиц инулина (или другого эквивалентного противовоспалительного компонента).

Соответственно, количество или концентрация одного или более ПАМС в компоненте (b) композиции по второму аспекту настоящего изобретения (и, необязательно, количества и/или концентрации одного или более ПАМС, присутствующих в композиции в целом) может быть меньше, например, меньше 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0,5%, 0,4%, 0,3%, 0,2%, 0,1%, 0,05%, 0,04%, 0,02%, 0,01% или менее (по весу), чем оптимальное количество тех же одного или более ПАМС, необходимых в эквивалентной композиции, которая отличается только тем, что она не включает частиц инулина (или другого эквивалентного противовоспалительного компонента). Оптимальное количество ПАМС в эквивалентной композиции является тем количеством, которое необходимо для достижения желаемого эффекта индукции или модуляции иммунного ответа, в том числе, например, адъювантное усиление иммунного ответа на совместно вводимый антиген, не будучи настолько высоким, чтобы вызывать неприемлемые уровни воспалительных и/или других побочных эффектов. Как известно в данной области, эти количества могут быть определены эмпирически для каждого ПАМС с использованием обычных методов, например, путем выполнения исследования токсичности на животных моделях с варьированием дозы, или с использованием суррогатных методов, таких как степень активации NFkB в клеточных функциональных тест системах. В действительности, такая эквивалентная композиция может быть полностью неспособна достигать того же уровня или типа индукции или модуляции, независимо от того, сколько ПАМС в нее входит, в отсутствие инулиновых частиц. В некоторых вариантах осуществления эти ограничения могут быть применены к составу второго аспекта изобретения, где частицы инулина, присутствующие в компоненте (а) содержат или состоят из одного или двух: гамма инулина, дельта инулина или эпсилон инулина.

Допустимое или оптимальное соотношение частиц инулина (или другого эквивалентного противовоспалительного компонента) в компоненте (а) к ПАМС в компоненте (b) композиции по второму аспекту настоящего изобретения, необходимое для того, чтобы достичь желаемого эффекта, можно быть определено эмпирически специалистом в данной области для каждой конкретной комбинации частиц инулина и ПАМС с использованием стандартных методов. Обычно, однако, отношение масса/масса частиц инулина (или другого эквивалентного противовоспалительного компонента) к молекулам ПАМС может быть в диапазоне от 10000:1 до 1:1, от 1000:1 до 1:1, от 100:1 до 1:1, или от 100:1 до 10:1.

Соответственно, иммунологические композиции в соответствии со вторым аспектом настоящего изобретения, могут включать эффективное количество, для индуцирования желаемого иммунного ответа, комбинированных компонентов, в котором комбинация включает в себя по меньшей мере одну инулиновую частицу (или другого эквивалентного противовоспалительного компонента) и по меньшей мере один ПАМС активатор врожденной иммунной системы. ПАМС-активатор врожденной иммунной системы в иммунологической композиции может быть любым типом ПАМС-активатором врожденной иммунной системы, известным в данной области. Например, ПАМС активатор врожденной иммунной системы может быть выбран из любой группы веществ, которые известны как агонисты рецепторов врожденного иммунитета. Соответственно, ПАМС-активаторы врожденной иммунной системы для использования в настоящем изобретении, могут связывать и быть агонистами любого из одного или более рецепторов врожденной иммунной системы: TLR, РНК геликазы, Nod1, NOD2, других NOD-подобных рецепторов (NLRS), таких как NLRP1, Nlrp3, NLRP12, NLRC4; Dectin-1; DC-SIGN; AIM-2; лектин типа С, MD2; CD 14; LBP; RIG-I-подобные рецепторы в том числе RIG-I, MDA5, LGP2 и/или ASC, рецепторы лектина типа С, рецепторы системы комплимента, FC рецепторы и скавенджер рецепторы.

Третий аспект настоящего изобретения представляет комплект частей, включающий: (а) первый контейнер, содержащий композицию, содержащую, или состоящую из противовоспалительного компонента, таких как частицы инулина и/или одного или более других противовоспалительных ингибиторов IL-1 или NFkB (как обсуждалось выше в отношении второго аспекта настоящего изобретения), и (б) второй контейнер, который содержит вещество, включающее или состоящее из ПАМС.

Раскрытые выше некоторые варианты осуществления, относящиеся к сущности, типу, количеству, концентрации и тому подобным различным компонентам в составе согласно второму аспекту настоящего изобретения, могут быть применены mutatis mutandis с соответствующими изменениями к определению композиций и веществ, представленных в первом и втором контейнерах из набора третьего аспекта настоящего изобретения.

Таким образом, в одном варианте осуществления третьего аспекта настоящего изобретения вещество, присутствующее во втором контейнере, может содержать не больше, чем десять различных молекулярных видов ПАМС, например, девять или менее, восемь или менее, семь или менее, шесть или менее, пять или менее, четыре или менее, три или менее, два или менее различных, или только один определенный молекулярный вид ПАМС. В одном варианте, ограничение числа различных молекулярных видов ПАМС в веществе, данном во втором контейнере, может быть применено только в отношении наборов, в которых первый контейнер содержит композицию, включающую или состоящую из частиц определенного типа инулина, например, только гамма-инулин, только дельта инулина или только эпсилон инулина.

В другом варианте осуществления третьего аспекта настоящего изобретения, совокупность ПАМС, которая присутствует во втором контейнере может не связываются с более чем 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 или 1 из рецепторов в панели врожденных иммунных рецепторов, как описано выше.

Любой или оба первые контейнеры и/или вторые контейнеры в комплекте третьего аспекта настоящего изобретения могут дополнительно включать один или несколько дополнительных веществ, например, выбранных из группы, состоящей из антитела, антисенс-олигонуклеотида, белка, антигена, аллергена, полинуклеотидной молекулы, рекомбинантного вирусного вектора, целого микроорганизма, или целого вируса.

Один или более ПАМС (предпочтительно все ПАМС), присутствующие во втором контейнере комплекта по третьему аспекту настоящего изобретения могут иметь средневесовую молекулярную массу вплоть до, но не более чем 200000 кДа, например вплоть до, но не более 150000 кДа, 100000 кДа, 50000 кДа, 40000 кДа, 20000 кДа, 10000 кДа, 5000 кДа, 2000 кДа, 1000 кДа, 500 кДа, 450 кДа, 400 кДа, 350 кДа, 300 кДа, 250 кДа, 200 кДа, 150 кДа, 100 кДа, 50 кДа, 40 кДа, 30 кДа, 20 кДа, 10 кДа, 9 кДа, 8 кДа, 7 кДа, 6 кДа, 5 кДа, 4 кДа, 3 кДа, 2 кДа, 1 кДа или менее.

Любой или оба первые контейнеры и/или вторые контейнеры в комплекте третьего аспекта настоящего изобретения могут содержать единичную дозу материала, содержащегося в них.

Любой или оба первые контейнеры и/или вторые контейнеры в комплекте третьего аспекта настоящего изобретения, как правило, будут фармацевтически приемлемыми композициями, как определено выше. Соответственно, уровень эндотоксина в одном или обоих первых контейнерах и/или вторых контейнерах в комплекте может быть меньше 100 EU на дозу, например, менее чем 90, 80, 70, 60, 50 40, 30, 20, 10, 5, 4, 3, 2, 1 или менее ЕС на дозу. Концентрация эндотоксина в одном или обоих первых контейнерах и/или вторых контейнерах в комплекте может быть меньше 200 EU/m3, например, менее 150, 100, 90, 80, 70, 60, 50 40, 30, 20, 10, 5, 4, 3, 2, 1 или меньше EU/m3. В некоторых вариантах осуществления эти ограничения могут быть применены к комплекту третьего аспекта изобретения, где инулиновые частицы, присутствующие в первом контейнере содержат или состоять из одного или двух: гамма инулина, дельта инулина или эпсилон инулина.

Количество и/или концентрация ПАМС присутствующее во втором контейнере комплекта третьего аспекта настоящего изобретения, предпочтительно меньше, чем оптимальное количество, например меньше чем 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0,5%, 0,4%, 0,3%, 0,2%, 0,1%, 0,05%, 0,04%, 0,02%, 0,01% или менее (по весу), количества ПАМС, которое требуется при использовании отдельно, для достижения желаемого уровня или типа индукции или модуляции иммунного ответа.

В одном варианте осуществления третьего аспекта настоящего изобретения соотношение масса/масса частиц инулина (или другого эквивалентного противовоспалительного компонента) в первом контейнере к ПАМС во втором контейнере может находиться в диапазоне от 10000:1 до 1:01, от 1000:1 до 1:1, от 100:1 до 1:1, или от 100:1 до 10:1.

В дополнительном варианте осуществления любой из первого, второго или третьего аспектов настоящего изобретения вещество, содержащее или состоящее из ПАМС может быть активатором врожденной иммунной системы и содержать или состоять из одного или более веществ, выбранных из группы, которая связывает и является агонистом одного или более из TLR, РНК геликазы, Nodi, NOD2, других NOD-подобных рецепторов (NLRS), таких как NLRP1, Nlrp3, NLRP12, NLRC4; Dectin-1; DC-SIGN; AIM-2; лектин типа С, MD2; CD 14; LBP; RIG-I-подобные рецепторы в том числе RIG-I, MDA5, LGP2 и/или ASC, рецепторы лектина типа С, рецепторы системы комплимента, FC рецепторы и скавенджер рецепторы.

В дополнительном варианте осуществления, любой из первого, второго или третьего аспектов настоящего изобретения, или каждый ПАМС может быть веществом, которое выбирают из группы, содержащей диацил липопептид, триацил липопептид, Pam3CSK4, липотейхоевую кислоту, пептидогликан, HSP70, зимозан, оцРНК, дцРНК, дцДНК, поли (I:С), поли (I:C-LC), Hiltonol™, PolyI:PolyC12-U, Ampligen™, MPLA, белок теплового шока, фибриноген, фрагменты гепаран сульфата, фрагменты гиалуроновой кислоты, синтетический агонист TLR4, имидазохинолин, gardiquimod, loxoribine, бропиримин, CL264, R848, CL075 полиУ, имиквимод, resiquimod, ssPolyU/LyoVec, ssRNA40/LyoVec, неметилированный CpG олигонуклеотид, класс В ODN, класса С ODN, CpG2006, CpG1826, CpG7909, 12-IE-DAP, IE-DAP, Tri-DAP, мурамилдипептид (MDP), L18-MDP, M-TriDAP, мурабутид, PGN-ECndi, PGN-ECndss, PGN-Санди, порин, липоарабуминоманнан, фосфолипоманнан, глюкуроноксилманнан, гликозилфосфатидилинозитол (GPI)-заякоренный протеин, гемозоин, вирусный дцДНК, синтетические дцДНК, вирусный дцРНК, синтетические дцРНК пептидогликан, содержащие мурамилдипептид NAG-NAM-гамма-D-глютамил-мезо диаминопимелиновую кислоту, пептидогликан, содержащий мурамилдипептид NAG-NAM-L-аланил-изоглутамин, N-формил метионин, мурамил трипептид, бета-1,3-глюкан, зимозан. хордовый фактор, трегалоза-6,6-дибегенат, поли (dA:dT), поли (dG:dC), 5'ррр-дцРНК, липопротеид низкой плотности (ЛПНП), окисленные ЛПНП, химически модифицированные ЛПНП, гемозоин, АТФ.

В дополнительном варианте осуществления любого из первого, второго или третьего аспектов настоящего изобретения, инулиновая частица может содержать, или состоит из инулина, который выбран из одного или более форм: гамма инулина, дельта инулина и эпсилон инулина, или комбинации любого из одного или более этих инулинов с фосфатом алюминия или гидроксидом алюминия, в том числе phosgammulin, phosdeltin, phosepsilin, algammulin и algammulin, aldeltin, alepsilin, которые могут быть получены методами, описанными в данном документе. Альфа и/или бета-инулин, или другие модифицированные частицы инулина также могут быть использованы в дополнение к, или вместо, гамма, дельта или эпсилон инулина, если они находятся в форме подходящих частиц.

В еще одном варианте осуществления композиции, используемой в первом аспекте, составе второго аспекта и/или первого и/или второго комплекта контейнеров по третьему аспекту, когда композиция, содержащая или состоящая из инулиновых частиц представляет собой композицию, которая включает в себя или состоит из частиц по меньшей мере двух инулиновых препаратов, препараты могут отличаться по полиморфной форме присутствующего инулина, и/или присутствием видов антигенсвязывающих материалов-носителей. Например -

частицы инулина могут содержать гамма инулин (и/или комбинацию гамма инулина с фосфатом алюминия или гидроксидом алюминия), смешанней с дельта инулином; альтернативно

частицы инулина могут содержать гамма инулин (и/или комбинацию гамма инулина с фосфатом алюминия или гидроксидом алюминия), смешанный с эпсилон инулином; альтернативно

частицы инулина могут содержать дельта инулин (и/или комбинацию дельта инулина с фосфатом алюминия или гидроксидом алюминия), смешанный с гамма инулином; альтернативно

частицы инулина могут содержать дельта инулин (и/или комбинацию дельта инулина с фосфатом алюминия или гидроксидом алюминия), смешанный с эпсилон инулином; альтернативно

частицы инулина могут содержать эпсилон инулин (и/или комбинацию эпсилон инулина с фосфатом алюминия или гидроксидом алюминия), смешанным с гамма-инулином; альтернативно

частицы инулина могут содержать эпсилон инулин (и/или комбинацию дельта инулина с фосфатом алюминия или гидроксидом алюминия), смешанным с дельта инулином.

В списке вышеприведенного, любое упоминание гамма-, дельта-и/или эпсилон инулина может быть заменено на альфа инулин и/или бета-инулина.

В дополнительном варианте осуществления любого из первого, второго или третьего аспектов настоящего изобретения, композиция используемая в первом аспекте, композиция второго аспекта, и/или первый и/или второй комплект контейнеров третьего аспекта, могут дополнительно содержать одно или несколько дополнительных веществ, например, выбранных из группы, состоящей из антитела, антисенс-олигонуклеотида, белка, антигена, аллергена, полинуклеотидной молекулы, рекомбинантного вирусного вектора, целого микроорганизма, или целого вируса.

Соответственно, в еще одном варианте осуществления любого из первого, второго или третьего аспектов настоящего изобретения, композиция используемая в первом аспекте, композиция второго аспекта, и/или первый и/или второй комплект контейнеров третьего аспекта, могут дополнительно содержать один или несколько антигенов. Некоторые или каждый антиген может быть любым типом антигенов, известных в данной области техники и может быть выбран из группы, состоящей из белков, гликопротеинов, пептидов, полипептидов, клеток, клеточных экстрактов, полисахаридов, полисахаридных конъюгатов, липидов, гликолипидов, нуклеиновых кислот и углеводов, или конъюгатов углеводов или липидов с белком, полипептидных/пептидных антигенов, мимотопов пептидных полисахаридов, или антигены могут быть закодированы в форме последовательностей нуклеиновых кислот. Антигены могут быть даны в необработанной, очищенной или рекомбинантной формах. Антигены могут быть получены из инфекционных патогенов, таких как вирусы, бактерии, грибы или паразиты, или антиген может быть получен из опухолевого антигена, аллергена или эндогенного белка.

Когда один или несколько антигенов, в частности один или несколько антигенов вакцины включен(ы) в еще одном варианте осуществления любого из первого, второго или третьего аспектов настоящего изобретения, тогда может также быть уместно дополнительно включать один или более антиген-связывающих агентов в той же смеси, что некоторые или все антигены.

Также предоставлены вторым и третьим аспектами настоящего изобретения способы получения композиции по второму аспекту или комплекту из третьего аспекта. Способ может включать в себя этап получения составных частей, а затем приведение их вместе с образованием композиции по второму аспекту или комплекту по третьему аспекту.

Настоящее изобретение также обеспечивает способ стимулирования или модулирования иммунной реакции, в том числе антиген-специфического иммунного ответа, у субъекта, путем введения субъекту терапевтически эффективного количества иммунологической композиции по второму аспекту или с использованием комплекта в соответствии с третьим аспектом. Способ включает в себя этапы, на которых введение субъекту иммунологической композиции по второму аспекту или компонентов комплекта по третьему аспекту, в котором композицию, или каждый компонент, вводят в эффективном количестве, в эффективном отрезке времени, и эффективным путем для вызова нужного иммунного ответа или действия.

Соответственно, четвертый аспект настоящего изобретения относится к способу индукции или модуляции иммунного ответа у субъекта, где указанный способ включает введение субъекту терапевтически эффективного количества композиции в соответствии со вторым аспектом настоящего изобретения, или одновременно, последовательно, или раздельно введение терапевтически эффективных количеств содержимого первого и второго контейнеров комплекта по третьему аспекту настоящего изобретения.

Другими словами, четвертый аспект настоящего изобретения относится к композиции, в соответствии со вторым аспектом настоящего изобретения, или комплекту в соответствии с третьим аспектом настоящего изобретения, используемой для индукции или модуляции иммунного ответа у субъекта.

Иными словами, четвертый аспект настоящего изобретения относится к применению композиции в соответствии со вторым аспектом настоящего изобретения, и/или комплекта в соответствии с третьим аспектом настоящего изобретения, в производстве лекарственного средства для индукции или модуляции иммунного ответа у субъекта.

В одном варианте четвертого аспекта настоящего изобретения модуляция иммунного ответа может включать в себя увеличение скорости развития иммунной реакции, по сравнению со скоростью развития иммунной реакции, полученной в субъекте с помощью эквивалентного состава, который отличается только в том, что он не включает частицы инулина. Рассматриваемый иммунный ответ может, например, быть адаптивным иммунным ответом на один или несколько антигенов. Адаптивный иммунный ответ может включать в себя ответ от одного или более типа Т-клеток (в том числе одного или нескольких типов CD4+ и/или CD8+ Т-клеток) и/или В-клеток, и может, например, быть определен по отношению к производству одного или более типов, или подтипов антител, таких как любые один или несколько из IgA, IgE, IgG1, IgG2a, IgG2b, IgG3, IgG4 или IgM или в отношении производства одного или нескольких видов цитокинов, таких как любой одном или более IFN-γ, TGF-β, GM-CSF, TNFα, IL-1, IL-2, IL-4, IL-5, IL-6, IL7, IL-8, IL-10, IL-12, IL13, IL-17, IL-20.

В другом варианте четвертого аспекта настоящего изобретения модуляция иммунного ответа может включать в себя увеличение специфичности иммунного ответа субъекта, по сравнению с специфичностью иммунного ответа, полученного в субъекте с помощью эквивалентного состава, который отличается только тем, что он не включает частиц инулина. Рассматриваемый иммунный ответ может, например, быть адаптивным иммунным ответом. Адаптивный иммунный ответ может включать в себя ответ от одного или более типов Т-клеток (в том числе одного или нескольких типов CD4+ и/или CD8+ Т-клеток) и/или В-клеток, и может, например, быть определен по отношению к производству одного или более типов или подтипов антител, таких как любые один или несколько из IgA, IgE, IgG1, IgG2, IgG3, IgG4 или IgM. Увеличение специфичности может, например, включать повышение уровня специфичности В- и/или Т-клеточного ответа к любому антигену, который представлен в введенной композиции(ях).

В другом варианте четвертого аспекта настоящего изобретения модуляция иммунного ответа может включать в себя увеличение интенсивности иммунной реакции субъекта, по сравнению с величиной иммунного ответа, полученного в субъекте с помощью эквивалентного состава, который отличается только тем, что он не включает частиц инулина. Рассматриваемый иммунный ответ может, например, быть адаптивным иммунным ответом. Адаптивный иммунный ответ может включать в себя ответ от одного или более типов Т-клеток (в том числе одного или нескольких типов CD4+ и/или CD8+ Т-клеток) и/или В-клеток, и может, например, быть определен по отношению к производству одного или более типов или подтипов антител, таких как любые один или несколько из IgA, IgE, IgG1, IgG2, IgG3, IgG4 или IgM.

В другом варианте четвертого аспекта настоящего изобретения модуляция иммунного ответа может включать в себя увеличение продолжительности иммунного ответа субъекта, по сравнению с продолжительностью иммунного ответа, полученного в субъекте с помощью эквивалентного состава, который отличается только тем, что он не включает частиц инулина. Рассматриваемый иммунный ответ может, например, быть адаптивным иммунным ответом. Адаптивный иммунный ответ может включать в себя ответ от одного или более типов Т-клеток (в том числе одного или нескольких типов CD4+ и/или CD8+ Т-клеток) и/или В-клеток, и может, например, быть определен по отношению к производству одного или более типов или подтипов антител, таких как любые один или несколько из IgA, IgE, IgG1, IgG2, IgG3, IgG4 или IgM.

В другом варианте четвертого аспекта настоящего изобретения модуляция иммунного ответа может включать в себя модификацию типа иммунного ответа субъекта, по сравнению с типом иммунного ответа, полученного в субъекте с эквивалентным составом, который отличается только тем, что он не включает частиц инулина. Рассматриваемый иммунный ответ может, например, быть адаптивным иммунным ответом. Тип адаптивного иммунного ответа может быть охарактеризован скоростью, величиной, специфичностью и/или продолжительностью одного или более аспектов адаптивного иммунного ответа по отношению к другим аспектам адаптивного ответа, включая, например, отклик от одного или более типа Т-клеток (в том числе одного или нескольких типов CD4+ и/или CD8+ Т-клеток; Th1, Th2, Th17 и Treg клеток) и/или В-клеток, и может, например, быть определен по отношению к продукции одного или нескольких типов или подтипов антител по сравнению с одним или несколькими другими подтипами, таких как любой один или несколько из IgA, IgE, IgG1, IgG2, IgG3, IgG4 или IgM в сравнении с любым одним или несколькими другими.

Более конкретные примеры модификации типа иммунного ответа субъекта, в соответствии с четвертым аспектом настоящего изобретения включают в себя изменение баланса между врожденной и адаптивной иммунной реакцией; повышение реакции иммунологической памяти; изменение типа иммунного ответа, например, путем повышения или ингибирования Th1, Th2, Th17 или Treg реакции по сравнению с другими ответами; подавлением реакции IgE; или усилением одного или более из IgA, IgM или IgG подтипов реакций. Иными словами, четвертый аспект настоящего изобретения обеспечивает способ для получения оптимального иммунного ответа по подклассу или подтипу, в том числе оптимальной Т- или В-клеточной ответ на антиген вакцины, где он не может быть достигнут в той же самой степени, с использованием эквивалентной композиции или набора, которые отличается только тем, что они не включают частиц инулина (или другого эквивалентного противовоспалительного компонента).

Пятый аспект настоящего изобретения относится к способу индукции или модуляции иммунного ответа на антиген, где указанный способ включает -

(А) введение субъекту терапевтически эффективного количества композиции, в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель; или

(Б) одновременное, последовательное или раздельное введение субъекту терапевтически эффективных количеств содержимого первого и второго контейнеров комплекта по третьему аспекту настоящего изобретения и содержание первого и/или второго контейнеров комплекте также включает антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель.

Иными словами, пятый аспект настоящего изобретения относится к композиции, в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель для использования в модуляции иммунного ответа на антиген, а также относится к комплекту по третьему аспекту настоящего изобретения, в котором содержание первого и/или второго контейнеров комплекта также включает антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель, для использования в индукции или модуляции иммунного ответа на антиген.

Иными словами, пятый аспект настоящего изобретения относится к применению композиции в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель, в производстве лекарственного средства для индукции или модуляции иммунного ответа на антиген, а также предусматривает использование комплекта по третьему аспекту настоящего изобретения, в котором содержание первого и/или второго контейнеров комплекта также включает антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель, для производства лекарственного средства для индукции или модуляции иммунного ответа на антиген.

Шестой аспект настоящего изобретения относится к способу вакцинации субъекта, где указанный способ включает -

(А) введение субъекту терапевтически эффективного количества композиции, в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель; или

(Б) одновременное, последовательное или раздельное введение субъекту терапевтически эффективных количеств содержимого первого и второго контейнеров комплекта по третьему аспекту настоящего изобретения, где содержание первого и/или второго контейнеров комплекта также включает антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель.

Иными словами, шестой аспект настоящего изобретения относится к композиции, в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель для использования в вакцинации субъекта, а также относится к комплекту, по третьему аспекту настоящего изобретения, в котором содержание первого и/или второго контейнеров комплекта также включает антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель, для использования в вакцинации субъекта.

Иными словами, шестой аспект настоящего изобретения относится к применению композиции в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель, в производстве лекарственного средства для вакцинации субъекта, а также предусматривает использование комплекта по третьему аспекту настоящего изобретения, в котором содержание первого и/или второго контейнеров комплекта также включает антиген и, необязательно, дополнительно включает антигенсвязывающий материал-носитель, для производства лекарственного средства для вакцинации субъекта.

Подходящие вакцинные антигены, используемые в пятом и/или шестом аспектах настоящего изобретения, могут включать описанные в данной заявке, включая те, которые описаны выше в отношении первого, второго и третьего аспектов настоящего изобретения.

Количество и/или концентрации антигена, используемые в пятом и шестом аспектах настоящего изобретения могут быть меньше, чем количество антигена, необходимое в эквивалентной композиции и/или наборе, который отличается только тем, что композиция или набор не содержат частиц инулина (или других равноценных противовоспалительных компонентов). Другими словами, присутствие частиц инулина (или другого эквивалентного противовоспалительного компонента) в композициях и/или наборах может иметь тактики и применения, которые позволят вызвать или модулировать иммунный ответ в соответствии с пятым аспектом, или вакцинировать субъект в соответствии с шестым аспектом, с меньшим количеством антигена.

Соответственно, количество или концентрацию одного или нескольких антигенов в композиции и/или наборах, используемых в пятом и/или шестом аспектах настоящего изобретения, может быть меньше, например, меньше 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0,5%, 0,4%, 0,3%, 0,2%, 0,1%, 0,05%, 0,04%, 0,02%, 0,01% или менее (по весу), чем оптимальные количества тех же одних или нескольких антигенов, который/которые необходимы для достижения соответствующего желаемого иммунного ответа, или эффективной вакцинации субъекта с помощью эквивалентной композиция или набора, которые отличается только тем, что они не включают частиц инулина (или другого эквивалентного противовоспалительного компонента).

Оптимальным количеством в эквивалентной композиции является количество, необходимое для достижения желаемого эффекта индукции или модуляции иммунного ответа, не будучи настолько высоким, чтобы вызывать неприемлемые уровни воспалительных и/или других побочных эффектов. Это может быть определено эмпирически специалистом в данной области для каждого антигена и ПАМС с использованием стандартных методов. В действительности, такая эквивалентная композиция может быть полностью неспособна на достижение того же уровня или типа индукции или модуляции, независимо от того, сколько ПАМС в нее входит, в отсутствие частиц инулина (или другого эквивалентного противовоспалительного компонента).

Настоящее изобретение также обеспечивает способ снижения существующего нежелательного иммунного ответа у субъекта, такого как аллергии на аллерген или хронического воспалительного состояния, например, путем понижающей регуляции аллерген-специфических IgE или индукции блокирующих аллерген-специфических IgG. Способ включает в себя этапы, на которых введение субъекту композиции по второму аспекту, или компонентов комплекта по третьему аспекту, и, необязательно, дополнительного компонента, такого как антиген или аллерген, где каждый компонент вводят в эффективном количестве, в эффективном отрезке времени, и эффективным путем для ингибирования или снижения нежелательных иммунных ответов и/или индуцирования благоприятных контррегулирующих иммунных реакций.

Соответственно, седьмой аспект настоящего изобретения предоставляет способ для аллергенной десенсибилизации субъекта, где указанный способ включает -

(А) введение субъекту терапевтически эффективного количества композиции, в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит аллерген и, необязательно, дополнительно содержит аллерген-связывающий материал-носитель; или

(Б) одновременное, последовательное или раздельное введение субъекту терапевтически эффективного количества содержимого первого и второго контейнеров комплекта по третьему аспекту настоящего изобретения, где содержание первого и/или второго контейнеров в комплекте также включает аллерген и, необязательно, дополнительно включает аллерген-связывающий материал-носитель.

Иными словами, седьмой аспект настоящего изобретения относится к композиции, в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит аллерген и, необязательно, дополнительно содержит аллерген-связывающий материал-носитель для использования в аллергенной десенсибилизации субъекта, и также относится к комплекту по третьему аспекту настоящего изобретения, в котором содержание первого и/или второго контейнеров комплекта также включает аллерген и, необязательно, дополнительно включает аллерген-связывающий материал-носитель, для использования в аллергенной десенсибилизации субъекта.

Иными словами, седьмой аспект настоящего изобретения относится к применению композиции в соответствии со вторым аспектом настоящего изобретения, где указанная композиция дополнительно содержит аллерген и, необязательно, дополнительно содержит аллерген-связывающий материал-носитель, при изготовлении лекарственного средства для аллергенной десенсибилизации субъекта, и также предусматривает использование комплекта по третьему аспекту настоящего изобретения, в котором содержание первого и/или второго контейнеров комплекта также включает аллерген и, необязательно, дополнительно содержит аллерген-связывающий материал-носитель, для производства лекарственного средства для аллергенной десенсибилизации субъекта.

Восьмой аспект настоящего изобретения относится к способу лечения рака, где указанный способ включает введение субъекту терапевтически эффективного количества композиции согласно второму аспекту изобретения, или одновременное, последовательное или раздельное введение субъекту терапевтически эффективных количеств содержимого первого и второго контейнеров набора по третьему аспекту настоящего изобретения.

Иными словами, Восьмой аспект настоящего изобретения относится к композиции, в соответствии со вторым аспектом настоящего изобретения или набора по третьему аспекту настоящего изобретения, для применения в лечении рака.

Иными словами, восьмой аспект настоящего изобретения относится к применению композиции в соответствии со вторым аспектом настоящего изобретения или комплекта по третьему аспекту настоящего изобретения в производстве лекарственного средства для лечение рака.

В одном варианте восьмого аспекта настоящего изобретения композиция в соответствии со вторым аспектом настоящего изобретения, дополнительно содержит антиген рака.

В другом варианте восьмому аспекту настоящего изобретения, содержание первого и/или второго контейнеров комплекта в соответствии с третьим аспектом настоящего изобретения, дополнительно содержит антиген рака.

Девятый аспект настоящего изобретения относится к способу изготовления вакцины, причем способ включает стадию объединения с антигеном, и, необязательно, также антигенсвязывающего материала-носителя, с компонентами (а) и (б) композиции в соответствии второму аспекту настоящего изобретения, таким образом, чтобы получить композицию вакцины.

Соответственно, девятый аспект настоящего изобретения также относится к применению композиции по второму аспекту настоящего изобретения, в качестве адъюванта к вакцине.

Следует отметить, что в следующих примерах показано, что композиции согласно настоящему изобретению способны обеспечить защиту одной дозой вакцины против в противном случае летальной инфекции. Мы также обнаружили, что композиции по настоящему изобретению, приготовленные в виде вакцины против гриппа, могут обеспечить эффективную защиту однократным ведением в мышиной модели. Защита однократной вакцинацией крайне желательна и, до сих пор, трудно достижима в области вакцинологии. Однако композиции по настоящей заявке показали способность обеспечивать защиту после одной дозы вакцины.

Соответственно, в другом варианте девятого аспекта настоящего изобретения приводится композиция вакцины однократного введения, содержащая или состоящая из инулиновых частиц (необязательно в форме композиции в соответствии со вторым аспектом настоящего изобретения или набора по третьему аспект), антиген и, необязательно, антигенсвязывающий носитель. Такая композиция вакцины однократного введения эффективна для обеспечения защиты вакциной у субъекта после только одной введенной дозы вакцины.

Также предложен способ вакцинации субъекта, при этом способ содержит или включает введение субъекту одной дозы вакцины. Хотя способ может включать один или несколько других шагов, он не включает никаких дополнительных стадии введения вакцины после первоначального введения.

Другими словами, настоящее изобретение также относится к созданию вакцины однократного введения, как определено выше, для применения в вакцинации субъекта способом, включающим или, состоящим из введения субъекту одной дозой вакцины.

Другими словами, настоящее изобретение также предусматривает использование вакцины однократного введения, как определено выше, для изготовления лекарственного средства для использования в вакцинации субъекта способом, включающим или состоящим из введения субъекту одной дозы вакцины.

Еще одно преимущество настоящего изобретения заключается в том, что его композиции, вещества, наборы и способы в соответствии с другими аспектами настоящего изобретения являются особенно эффективными в лечении групп субъектов, которые могут, как правило, быть не в состоянии реагировать, или адекватно реагировать, или реагировать с обычным адъювантом на вакцинные композиции. Такие группы могут включать молодежь, старшее поколение и беременных женщин. В одной из реализаций данной заявки, особый интерес может представлять вакцина против гриппа для введения таким субъектам.

Соответственно, субъектом, подлежащим лечению композициями, веществами, наборами и способами в соответствии с другими аспектами настоящего изобретения, может быть ребенок, например ребенок мужского или женского пола. Ребенок может, например, быть возраста 18 лет, 17 лет, 16 лет, 15 лет, 14 лет, 13 лет, 12 лет, 11 лет, 10 лет, 9 лет, 8 лет, 7 лет, 6 лет, 5 лет, 4 лет, 3 лет, 2 лет, 1 года, 11 месяцев, 10 месяцев, 9 месяцев, 8 месяцев, 7 месяцев, 6 месяцев, 5 месяцев, 4 месяцев, 3 месяцев, 2 месяцев, или 1 месяца, по сравнению с датой их рождения.

С другой стороны, субъект, подлежащий лечению композициями, веществами, наборами и способами в соответствии с другими аспектами настоящего изобретения, может быть старшим человеком, например мужского или женского пола. Человеку может быть по крайней мере 40 лет, по крайней мере, 45 лет, по крайней мере, 50 лет, по крайней мере, 55 лет, по крайней мере, 60 лет, по крайней мере, 65 лет, по крайней мере, 70 лет, по крайней мере, 75 лет, по крайней мере, 80 лет, по крайней мере 85 лет, или по крайней мере 90 лет.

С другой стороны, субъект, подлежащий лечению композициями, веществами, наборами и способами в соответствии с другими аспектами настоящего изобретения может быть беременной женщиной. Женщина может быть вплоть до или, по крайней мере на 5, 10, 15, 20, 25, 30, 35 или 40 неделях беременности.

Десятый аспект настоящего изобретения обеспечивает способ для идентификации оптимальных концентраций и соотношений компонентов (а) и (б) композиции согласно второму аспекту настоящего изобретения, способ содержит дополнительный этап объединения антигена и, возможно, также антигенсвязывающего материала-носителя, с компонентами (а) и (б) композиции в соответствии со вторым аспектом настоящего изобретения, введение комбинированного состава в диапазоне различных доз на серию субъектов и, затем, измерения результирующего иммунного ответа и, возможно, контакту субъекта с живым возбудителем, тем самым позволяя идентифицировать оптимальный состав.

В другом варианте десятого аспекта настоящего изобретения, содержание первого и/или второго контейнеров комплекта в соответствии с третьим аспектом настоящего изобретения образуют, необязательно с антигеном, образуют аналитический набор для идентификации оптимальной композиция для желаемого иммунологического применения.

В другом варианте десятого аспекта настоящего изобретения предложен способ изготовления аналитического набора/комплекта, причем способ включает стадию объединения антигена и, возможно, также антигенсвязывающего материала-носителя, с компонентами (а) и (б) композиции в соответствии со вторым аспектом настоящего изобретения, таким образом, чтобы производить набор анализа вакцины.

Эти и другие аспекты и варианты осуществления изобретения будут описаны здесь более подробно.

КРАТКОЕ ОПИСАНИЕ ПРИЛАГАЕМЫХ РИСУНКОВ

Рисунок 1 показывает четыре графика помеченные A-D, показывающие иммуногенность у мышей, иммунизированных трехвалентной вакциной против гриппа (TIV), сформулированной с TLR9 агонистом ПАМС CpG2006, подчеркивая синергетический эффект, когда инулиновые частицы добавляются в CpG-содержащие препараты вакцины TIV. Женские линии BALB / С мышей в возрасте 6-8 недель (N=5-8 на группу) иммунизировали внутримышечно дважды с промежутками 14 дней, 50 мкл коммерческой человеческой TIV на 100 нг НА на дозу, в сочетании с либо 2, 7, 20 или 60 μg CpG2006 отдельно или в смеси с 1 мг PDmix (1:5). Рис.А показывает общий уровень IgG против-гриппа в сыворотке, рис.В показывает уровни IgM против-гриппа в сыворотке, рис.С показывает уровни IgG1 против-гриппа в сыворотке и рис.D показывает уровни IgG2a против-гриппа в сыворотке через 42 дней после второй иммунизации, как показала ELISA. Представлены групповые средние значения OD+SD.

Рис.2 показывает шесть графиков, отмеченных A-F, демонстрируя синергетические эффекты комбинации TLR9 агониста ПАМС (CpG 1668) и инулиновых частиц (PDmixl:36) на иммунный ответ у новорожденных мышей к вакцине TIV. Неонатальных BALB / с мышей (п=5-7/group) иммунизировали внутримышечно TIV (100 нг общего белка ГА) на 14 день и 23 день от роду. Сыворотки отбирали через 14 дней после последней инъекции для измерения антител методом ELISA. Группы получали либо TIV отдельно или сформулированными с PDmixl: 36 (1 мг), CpG1668 (20 ug), или PDmix (1 мг)+CpG1668 (20 ug). Рис.А показывает, что группа, получавшая TIV+PDmix+CPG (последняя колонка в каждом рисунке) имела значительно больше общего антигриппозного IgG. Рис.В показывает больший уровень IgM, рис.С показывает меньший уровень IgG1, рис.D показывает больший уровень IgG2a, рис.Е показывает более высокий уровень анти-гриппозных CD4+ Т-клеток и рис.F показывает более высокие CD8+ ответы Т-клеточной памяти.

На рис.3 представлены четыре графика, помеченных A-D, показывающих уровни анти-гриппозных IgM, IgG2a, IgG1, и общего IgG в ELISA измерении в сыворотке 200-300 - дневных самок BALB/С мышей (п=10/group), иммунизированных внутримышечно дважды через 14 дней трехвалентной инактивированной гриппозной вакциной. Рис.А показывает общий уровень IgG против гриппа в сыворотке, рис.В показывает уровни IgM против-гриппа в сыворотке, рис.С показывает уровни IgG1 против гриппа в сыворотке, и рис.D показывает уровни IgG2a против-гриппа в сыворотке через 42 дней после второй иммунизации, в измерении с помощью ELISA. Представлены групповые средние значения OD+SD. Группа с совместным введением частиц инулина (PDmix) плюс TLR9 агониста ПАМС (CpG2006) достигла самых высоких титров анти-гриппозных антител.

На рис.4 представлены четыре графика, помеченных A-D, показывающих иммуногенность у мышей трехвалентной вакцины против гриппа (TIV), сформулированной с инулиновыми частицами PDmix только или в сочетании с рядом агонистов TLR9 ПАМС. Рис.А показывает общий уровень IgG против гриппа в сыворотке, рис.В показывает уровни IgM против-гриппа в сыворотке, рис.С показывает уровни IgG1 против гриппа в сыворотке и рис.D показывает уровни IgG2a против гриппа в сыворотке через 28 дней после второй иммунизации, в измерении с помощью ELISA. Представлены групповые средние значения OD+SD. Совместное введение TIV с PDmix и CpG1668 или CpG2006 или CpG2395 показал синергизм отдельных компонентов и увеличение общего уровня анти-гриппозных IgG, IgG2a и IgM. CpG2216 и CpG2237 не имели никакого влияния на антительные ответы.

На рис.5 представлены четыре графика, помеченных A-D, показывающих иммуногенность у мышей вакцины против бешенства (MIRV), сформулированного с одним из двух препаратов инулиновых частиц (dIN или PDmix) отдельно или в сочетании с TLR9 агонистом CpG 1668. Рис.А показывает сывороточный уровень общего IgG против бешенства, рис.В показывает сывороточный уровень IgM против бешенства, рис.С показывает сывороточный уровень IgG1 против бешенства и рис.D показывает сывороточный уровень IgG2a против бешенства через 14 дней после второй иммунизации, в измерении с помощью ELISA. Представлены групповые средние значения OD+SD. Сочетание обоих dIN или PDmix с CpG1668 плюс MIRV вызывает самые высокие уровни общих значений IgG, IgG1, IgG2a и IgM против бешенства.

На рис.6 представлены четыре графика, помеченные как А, В, С и D, показывающие иммуногенность у мышей трехвалентной вакцины против гриппа (TIV), сформулированной только с инулиновыми частицами PDmix или в сочетании с целым рядом агонистов TLR2 ПАМС (зимозан, LTA, липоманнан и PamCSK4) в сравнение с агонистом TLR9 ПАМС CpG2006. Рис.А показывает общий уровень IgG против гриппа в сыворотке, рис.В показывает уровни IgM против гриппа в сыворотке, рис.С показывает уровни IgG1 против гриппа в сыворотке и рис.D показывает уровни IgG2a против гриппа в сыворотке через 14 дней после второй иммунизации, как измеряется в ELISA. Представлены групповые средние значения OD+SD.

На рис.7 представлены три графика, помеченные как А, В, С, показывающие благоприятный усиливающий эффект комбинаций инулиновых частиц с различными ПАМС на иммуногенность у мышей от вакцины TIV. Рис.А показывает общий уровень IgG против гриппа в сыворотке, рис.В показывает уровни IgG1 против гриппа в сыворотке, и рис.С показывает уровни IgG2a против гриппа в сыворотке через 42 дней после второй иммунизации, как измеряется в ELISA. Представлены групповые средние значения OD+SD.

На рис.8 представлены шесть графиков, помеченных как А, В, С, D, Е, F, показывающих благоприятные иммунностимуляторные и дозосберегающие для антигенов эффекты комбинаций частиц инулина (dIN) с TLR9 агонистом ПАМС, CpG2006 на иммуногенность у мышей рекомбинантной вакцины против пандемического гриппа, rH5. BALB/С мышей в возрасте 6-8 недель (п=5-8/group) иммунизировали внутримышечно дважды с интервалом в 21 день, вводя 50 мкл вакцины, содержащей от 3 нг до 3 мкг рекомбинантного белка гемагглютинина гриппа серотипа Н5 (RH5) (Protein Sciences Corp, Meriden, USA), плюс или 1 мг dIN, или 1 мг dIN с 5 мкг CpG2006. Рис.А показывает уровень общего сывороточного анти-Н5 IgG, рис.В показывает уровень сывороточного анти-Н5 IgM, Рис.С показывает уровень сывороточного анти-Н5 IgG1, рис.D показывает уровень сывороточного анти-Н5 IgG2a, рис. показывает уровень сывороточного анти-Н5 IgG2b и Рис.F показывает уровень сывороточного анти-Н5 IgG3 через 14 дней после второй иммунизации как показало измерение методом ELISA. Представлены групповые средние значения OD+SD.

На рис.9 представлены 2 графы, помеченные А и В, показывающие благоприятный эффект с усилением иммунного ответа при комбинаций частиц инулина (dIN) с TLR9 агонистом ПАМС, CpG2006 вместе с H1N1 PR8 вакциной на выживаемость мышей после заражения смертельным вирусом PR8. Рис.А показывает мышей, получавших комбинации инулиновых частиц (dIN) с TLR9 агонистом ПАМС, CpG2006 вместе с вакциной H1N1 PR8 имеющих полную защиту без потери веса, или клинического заболевания, в то время как РК8+DIN без CpG был лишь частично защитным. Рис.В снова показывает в отдельном исследовании, что мыши, получавшие комбинации инулиновых частиц (DIN) с TLR9 агонистом ПАМС, CpG2006 вместе с вакциной H1N1 PR8 были защищены от смерти, в то время как РК8+CpG не дал никакой защиты.

На рис.10 представлены четыре графика А, В, С, D, показывающие титры ингибирования гемагглютинации (HI) и титры микронейтрализации (MN) в иммунизированных хорьках, измеренные в момент ревакцинации буст дозой (21 день до заражения), и через 14 дней после буст дозы (7 дней до заражения). Хорьки привитые двумя дозами H5N1 с Ad2 имели самые высокие титры нейтрализующих антител, в соответствии с повышенной иммунной реакцией, когда антиген H5N1 был в сочетании с частицами инулина и агонистом TLR9.

Рис.11 представляет график, показывающий улучшение (100%) выживания после смертельного заражения H5N1 у хорьков, которые получили Ad1 - или Ad2 - адъювантные вакцины H5N1, в том числе в группе, получавшей только одну иммунизацию с 22,5 мкг H5N1 вакцины+Ad2. Для каждой из 10 групп показан процент выживания: доза вакцины (или физиологического раствора)+адъювантная смесь (или физиологический раствор). Выживания в пяти группах адъювантной-вакцины были значительно выше, чем в двух группах безадъювантных вакцин (Log-Rank test, р=0.05) и в трех невакцинированных контрольных группах (Log-Rank test, p<0.00l).

На рис.12 представлены семь графиков, которые показывают среднее изменение веса иммунизированных хорьков в группах после заражения вирусом H5N1. Хорьки, привитые двумя дозами H5N1 с Ad2 не теряют вес вследствие усиленной защиты, когда антиген H5N1 был формулирован с частицами инулина и агонистом TLR9.

На рис.13 приведены семь графиков, которые показывают среднее изменение температуры иммунизированных хорьков после смертельного заражения вирусом H5N1. В то время как четыре хорька в Ad1 (только инулиновый адъювант) - адъювантной вакцинной группе продемонстрировали лихорадку, ни один хорек в Ad2 (инулиновые частицы+CpG) адъювантной группы не испытал лихорадки, в следствии усиленной защиты, когда антиген H5N1 был формулирован с частицами инулина и агонистом TLR9.

На рис.14 представлены три графика, которые показывают, что gIN, dIN или eIN все имели синергетический эффект с CpG, усиливающий индукции анти-HBsAg IgG1, IgG2a и IgM в соответствии с синергическим эффектом с ПАМС-активаторами врожденной иммунной системы, что является общей особенностью различных полиморфных форм инулиновых частиц. Взрослых мышей линии BALB / С, иммунизировали внутримышечно дважды через 21 день, HBsAg вместе с либо gIN, dIN или eIN частицами инулина отдельно или вместе с TLR9 ПАМС, CpG2006. Рис.А показывает сывороточные анти-HBsAg IgG1, рис.В показывает сывороточные анти-HBsAg IgG2a и рис.С показывает уровни сывороточных анти-HBsAg IgGM после второй иммунизации, измеренных методом ELISA. Показаны групповые средние значения OD+SD.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Практика настоящего изобретения будет использовать, если не указано обратное, традиционные методы вирусологии, иммунологии, микробиологии, молекулярной биологии и технологии на основе рекомбинантной ДНК в пределах известного научного знания, многие из которых описаны ниже с целью иллюстрации. Такие методики подробно описаны в литературе. См., например, Sambrook, et al. Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Maniatis et al. Molecular Cloning: A Laboratory Manual (1982); DNA Cloning: A Practical Approach, vol.I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., 1984); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., 1985); Transcription and Translation (B. Hames & S. Higgins, eds., 1984); Animal Cell Culture (R. Freshney, ed., 1986); Perbal, A Practical Guide to Molecular Cloning (1984), Current Protocols in Immunology ISBN 9780471522768 (Publisher: John Wiley and Sons Inc), Vaccine Adjuvants and Delivery Systems (Manmohan Singh ed. 2007), Methods in Molecular Biology, ISBN 9781607615842 (Publisher: Springer), History of Vaccine Development 2011, ISBN:1441913386 (Publisher: Springer)

Если не определено иначе, все технические и научные термины, используемые здесь, имеют то же значение, которые обычно понимаются специалистами с обычной квалификацией в данной области, к которой принадлежит данное изобретение. Хотя любые способы и материалы, подобные или эквивалентные описанным здесь, можно использовать в практике или при тестировании настоящего изобретения, предпочтительные способы и материалы будут описаны далее.

Как известно специалистам, имеющим опыт в данной области техники, активация врожденной иммунной системы может быть использован для повышения типа или величины адаптивной иммунологической реакции памяти. Повышение или модуляция адаптивного иммунного ответа является выгодной при вакцинации или во время аллергенной десенсибилизации, поскольку это может служить средством для увеличения или продления срока ответа иммунологической памяти против конкретного возбудителя, или изменить тип иммунного ответа на более выгодный. Например, для некоторых патогенных микроорганизмов, может быть предпочтительным вызывать сильный антительный (Th2) ответ на иммунизирующий антиген, в то время как для других патогенов может быть предпочтительным вызвать сильную реакцию Th1 или сильную реакцию Th17. С другой стороны, для антигенов, таких как аллергены может быть предпочтительным подавлять существующий IgE ответ и вместо него индуцировать ответ Th1 к аллергену. Было обнаружено, в соответствии с настоящим изобретением, что сочетание инулиновых частиц с активаторами врожденной иммунной системы дает множество уникальных форм иммунного ответа, которые могут, например, быть использованы для модуляции адаптивного ответа иммунологической памяти на извне введенный антиген по более благоприятному типу или направлению.

Настоящее изобретение обеспечивает, в первом аспекте, композицию, содержащую или состоящую из инулиновых частиц для использования в целях снижения или ингибирования воспаления, и/или для лечения или профилактики воспалительного заболевания у субъекта.

Второй аспект настоящего изобретения обеспечивает иммунологическую и/или фармацевтически приемлемую композицию, содержащую (а) противовоспалительный компонент, например частицы инулина и/или один или более других противовоспалительных ингибиторов IL-1; вместе с (б) вещество, содержащим или состоящим из одного или нескольких видов активаторов врожденной иммунной системы, таких как патоген-ассоциированные молекулярной структуры (ПАМС). Не желая быть связанными теорией, благоприятное иммунологическое взаимодействие происходит потому, что каждый из двух компонентов иммунологической композиции регулирует транскрипцию независимого набора иммунных генов, так, что структура иммунных генов, экспрессируемых в ответ на комбинированную иммунологическую композицию является уникальной комбинацией и отличается от форм генной экспрессии, вызванной отдельными компонентами.

Третий аспект настоящего изобретения относится к набору частей, включающему: (а) первый контейнер, содержащий композицию, содержащую или состоящую из противовоспалительного компонента, таких как частицы инулина и/или одного или более других противовоспалительных ингибиторов IL-1 (как обсуждалось выше в отношении второго аспекта настоящего изобретения), и (б) второй контейнер, который содержит вещество, включающее или состоящее из патоген-ассоциированных молекулярных структур (ПАМС).

Таким образом, компонент (а) композиции по второму аспекту настоящего изобретения, или комплекта по третьему аспекту изобретения, содержит или состоит из противовоспалительного компонента, например противовоспалительного ингибитора IL-1 или противовоспалительного ингибитора NFκВ.

Вариантом, представляющим особый интерес для настоящего изобретения является противовоспалительный компонент содержащий или состоящий из инулиновых частиц. Термин "инулиновые частицы", используемый здесь, относится не только к частицам, изготовленным из β-D-(2-1) полифруктофуранозил-α-D-глюкозы (также известными как инулин) а также их производным, такима как β-D-(2-1)полифруктоза которая может быть получена путем ферментативного удаления концевой глюкозы из инулина, например с помощью инвертазного или инулазного фермента способного удалять конечные глюкозы. Термин "инулиновые частицы" также относится к любой природной или синтетической частице, которая образована на, содержит или покрыта инулином, или его производным, или его миметиком. Подходящими производными инулина, включенными в объем данного термина являются производные инулина, в которых свободные гидроксильные группы были ацетилированы, метилированы или этерифицированы, например, путем химического замещения алкил, арил или ацильными группами, известными способами. Стабильная инулиновая частица может быть сплошной или полой и может полностью состоять из молекул инулина или альтернативно может иметь несахаровый основной скелет, или оболочку, содержащую, например, углеводные соединения, соединения металлов, белков или липидов, но которая на своей поверхности экспрессирует молекулы инулина либо ковалентно, либо нековалентно присоединены к компонентам, составляющим сердцевину. Предпочтительно, инулиновая частица будет выбрана из группы, dIN gIN и eIN, или их модификаций. Наиболее предпочтительной, инулиновой частицей будет dIN. Предпочтительно, инулиновые частицы будут иметь диаметр в диапазоне размеров от 20 нм до 20 μМ. Более предпочтительно, чтобы инулиновые частицы имели диаметр в диапазоне размеров от 0,1 до 5 μМ. Наиболее предпочтительно, чтобы инулиновые частицы имели диаметр в диапазоне размеров от 0,5 до 5 мМ.

В одном из вариантов, частицы инулина, используемые в настоящем изобретении, являются стабильными частицами инулина. Термин "стабильный", использованный здесь, относится к инулиновым частицам, которые полностью нерастворимы или в основном нерастворимы или частично нерастворимы при температуре тела субъекта, которому они должны быть введены. В этом контексте стабильность может необязательно включать смысл, что частицы инулина нерастворимы при инкубации при температуре до 25°С или до 30°С, 37°С, 40°С, 42°С, 45°С, 48°С, 50°С, 52°С, 55°С, 58°С, или 60°С, когда присутствуют в концентрации не более 0.5 мг/мл, или 1 мг/мл, или 2 мг/мл в дистиллированной воде или физиологическом растворе или фосфатно буфферном физиологическом растворе, по меньшей мере, 10, 20, 30, 40, 50 или 60 минут. Количество нерастворимого инулина может быть измерено по изменению оптической плотности суспензии инулина на 300 нм, 400 нм, 500 нм, 600 нм, длине волны 700 нм (OD700) с помощью спектрофотометра и, в этой связи, инулиновые частицы, можно сказать, являются стабильными если они остаются нерастворимы в заданных условиях, когда показание OD700 не падает ниже значения, которое составляет 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99,5%, 99,9% или по существу 100% от OD700 препарата частиц в том же растворителе и в той же концентрации до инкубации при определенной температуре (предпочтительно при измерении при температуре, которая на 10°С или ниже температуры инкубации).

Другие противовоспалительные компоненты, которые могут быть использованы в компоненте (а) состава согласно второму аспекту, или комплекту по этому аспекту изобретения, вместо или вместе с инулиновыми частицами, могут включать в себя -

(I) ингибиторы генов или белков IL-1 пути, особенно тех, которые функционально-эквивалентны целям инулиновых частиц, в том смысле, что обладают по существу эквивалентным противовоспалительным свойством, активностью и/или специфичностью и/или обладают по существу эквивалентным иммуномодулирующим или адъювантым свойством

(II) один или более из антагонистов рецептора IL1, IL1RA, Anakinra, Rilonacept, IL-1R/IL1RacP/Fc-fusion белок, Canakinumab, человеческие IL-1β антитела, блокаторы рецепторов IL1, IL-1RII, индометацин, нестероидные противовоспалительные средства (НПВС), глюкокортикоиды, ингибиторы каспаз, включая каспазы 1, ингибиторы инфламмасомы в том числе NALP3 антагонисты, куркумин, ресвератрол, хлорохин, ингибиторы Р2Х7-рецептора, ингибиторы рецепторов ST2, и/или антагонисты АТФ;

(III) агенты, которые активируют или повышают экспрессию противовоспалительного белка-рецептор, активируемый пролифераторами пероксисом (PPAR-γ) или активируют гены, или белки PPAR-γ пути, особенно в моноцитах и дендритных клетках (гены PPAR-γ пути также активируется с помощью инулиновых частиц). Ранее было показано, что повышение PPAR-γ ингибируют воспалительные реакции, в том числее подавляя LPS-индуцированные IL-1 и TNFα, и наоборот IL1 и TNFα PPAR-γ. Подходящие агенты могут включать в себя один или более из: розиглитазон, пиоглитазон, простагландин J2, куркумин, ресвератрол, тиазолидиндионы, берберин, перфлюорононановая кислота, RS5444, свободные жирные кислоты, витамин D, и/или эйкозаноиды.

(IV) противовоспалительные агенты, такие как аспирин, ибупрофен и напроксен, салициловая кислота, пептид-Т подчелюстной железы, фенилаланил-глутамил-глицин (FEG), имбирь, куркума, сесквитерпеновый лактон, омега-3 жирные кислоты, простагландин-Е, простагландин-Е3, куркумин, месалазин, селективные агонисты глюкокортикоидного рецептора, Lisofylline, Mofezolac, Oleocanthal, Ibuproxam, циклопентенон, простагландин, каннабидиол, BMS-345541, BMS-470, 539, амлексанокс, Amixetrine, Аллицин, Actarit, Butylpyrazolidines, например, фенилбутазон, Mofebutazone; оксифенбутазон; Clofezone; Kebuzone; Suxibuzone; производные уксусной кислоты и родственные вещества, такие как индометацин; сулиндак; толметин; зомепирак; диклофенак; альклофенак; Bumadizone; этодолак; Lonazolac; фентиазак; ацеметацин; Difenpiramide; Oxametacin; проглуметацин; кеторолак; ацеклофенак; буфексамак; индометацин, диклофенак, оксикамы, например, пироксикам; теноксикам; дроксикам; лорноксикам; мелоксикам; производные пропионовой кислоты, такие как ибупрофен, напроксен; кетопрофен; Fenoprofen; фенбуфен; беноксапрофен; супрофен; пирпрофен; флурбипрофен; индопрофен; тиапрофеновая кислота; Оксапрозин; Ibuproxam; дексибупрофен; Flunoxaprofen; алминопрофен; декскетопрофен; Naproxcinod; напроксен и эзомепразол; напроксен и мизопростол; Vedaprofen; Carprofen; Tepoxalin. Фенаматы, такие как мефенамовая кислота; толфенамовая кислота; флуфенамовая кислота, меклофенамовая кислота, флуниксин, коксибы, например, Celecoxib; Rofecoxib; валдекоксиб; парекоксиб; эторикоксиб; лумиракоксиб; Firocoxib; Robenacoxib; Mavacoxib; Cimicoxib, другие противовоспалительные и противоревматические агенты, такие как Nabumetone; нифлумовая кислота, азапропазон; глюкозамин; бензидамин; глюкозаминогликан полисульфата; Proquazone; Orgotein; нимесулид; Feprazone диацереин; Morniflumate; тенидап; Oxaceprol, хондроитин сульфат; авокадо и соевое масла, неомыляемые вещества, нифлумовая кислота, комбинации Feprazone,; пентозана полисульфат; аминопропионитрилом; Anti-inflammatory/antirheumatic агенты в комбинации с кортикостероидами, такие как фенилбутазон и кортикостероиды; Dipyrocetyl и кортикостероиды; ацетилсалициловая кислота и кортикостероиды, специфические противоревматические средства, включая хинолины, такие как Oxycinchophen, золото в препаратах, таких как натрий ауротиомалат; aurothiosulfate натрия; ауранофин; Aurothioglucose; Aurotioprol и/или пеницилламин и аналогичные агенты, такие как Bucillamine._

Как правило, инулиновые частицы (или другие эквивалентные противовоспалительные компоненты) могут быть использованы в количестве от 0,001 мг до 100 мг на килограмм веса тела субъекта, подлежащего иммунизации. Например, инулиновые частицы (или другие эквивалентные противовоспалительные компоненты) в композиции по настоящему изобретению могут присутствовать в концентрации в диапазоне от 0,1 мг до 100,0 мг на килограмм веса тела. В другом примере инулиновые частицы (или другие эквивалентные противовоспалительные компоненты) в композиции можно вводить взрослому субъекту-человеку в диапазоне от 1 до 100 мг на дозу, например, 20 мг на дозу.

Термин «адъювант» относится к веществу, или смеси, которые повышают иммунную реакцию на антиген. Часто первичная иммунизация только антигеном, в отсутствие адъюванта, не может вызывать иммунный ответ.

Термин "агонист" относится к белку, нуклеиновой кислоте, липиду, углеводу или химическому веществу, которое взаимодействует с клеточным рецептором с получением клеточного ответа. Агонисты, которые стимулируют врожденные иммунные рецепторы, могут представлять особый интерес в настоящем изобретении.

Термин "активатор врожденной иммунной системы» следует понимать как относящийся к любому веществу, которое прямо или косвенно активирует клетки, которые участвуют в функционировании иммунной системы. Без ограничения, активация врожденной иммунной системы может проявляться на клеточном уровне через одно или более изменений в экспрессии генов или продукции белка, индукции цитокинов или хемокинов, их продукции или секреции, изменении в морфологии клеток, дифференцировке, делении клеток, изменении в экспрессии белков на клеточной поверхности, хемотаксисе, фагоцитозе, экзоцитозе аутофагии, или апоптозе.

Термин "вакцина" определяется как иммуно-стимулирующий метод терапии, предназначенный вызывать положительный иммунный ответ против специфического антигена, при введении профилактически или для лечения уже существующего состоянии.

Термин "иммуногенный" относится к способности антигена вызывать иммунный ответ, включающий гуморальный и/или клеточный иммунитет.

Термин "иммунологически эффективное количество", используемый здесь в отношении антигена, или активатора врожденной иммунной системы и относится к количеству антигена или активатора врожденной иммунной системы, достаточном, чтобы вызвать иммунный ответ измеримый стандартными анализами, известными специалисту в данной области. Эффективность антигена в качестве иммуногена, может быть измерена либо с помощью пролиферации Т-клеток или секреции цитокинов, или в анализах на цитотоксичность, таких как тесты с высвобождением хрома в анализах для определения способности Т-клеток лизировать свою специфическую клетку-мишень, либо путем измерения уровней В-клеточной активности через измерения уровней циркулирующих антител, специфичных к антигену в сыворотке крови, или путем измерения количества антительных пятен формируемых В-клетками при экспрессии специфических антител, например, путем ELISPOT. Кроме того, уровень защитного иммунного ответа может измеряться через контакт иммунизированного организма с реплицирующим вирусом, патогеном или клеткой, содержащей антиген, против которого был иммунизирован организм. Например, если антиген, к которому желателен иммунный ответ представляет собой вирус или клетки опухоли, уровень защиты индуцированного "иммуногенно эффективным количеством" антигена измеряется через определение уровня выживания после введения в иммунизированное животное вируса или опухолевых клеток. Кроме того, защита также может быть измерена как уменьшение вирусной репликации или роста опухоли после заражения животных. Количество антигена, необходимое для обеспечения иммуногенного количества легко определяется специалистом с обычной квалификацией в данной области, например, путем подготовки серии вакцин по данному изобретению с различными концентрациями антигена, введение препаратов вакцины в соответствующих лабораторных животных (например, в мышей, крыс, морских свинок, кроликов) и анализируя результаты иммунного ответа путем измерения титров антител сыворотки или слизистой оболочки, антиген-индуцированного отека на коже (тест на гиперчувствительность замедленного типа), пролиферации Т-клеток, продукции цитокинов или цитотоксическую активность, защиты против патогена и тому подобного.

Термин "парентеральный" относится к инъекции вакцины в любые ткани организма и включает в себя внутримышечный, подкожный, внутрикожный, внутрибрюшинный и внутриглазной способы введения вакцины, с помощью способов и устройств доставки, хорошо известных в данной области техники.

В важных вариантах осуществления аспектов настоящего изобретения субъектом является человек. В других вариантах осуществления субъект выбран из группы, состоящей из животных, таких как: собака, кошка, лошадь, верблюд, корова, свинья, овца, коза, курица, сокол, кролик и рыба. Термин «животное» включает в себя всех домашних и диких млекопитающих, рыб, птиц, а также включает в себя, без ограничения, крупный рогатый скот, лошадей, свиней, овец, коз, верблюдов, собак, кошек, кроликов, оленей, норок, кур, уток, гусей, индеек, кур, дичи и тому подобное.

В одном варианте осуществления в качестве дополнительного компонента, состав по изобретению может также необязательно включать иммунологически эффективное количество химического вещества, которое активирует один или несколько типов клеток врожденной иммунной системы, таких как моноциты, дендритные клетки, NK клетки, лимфоциты или гранулоциты. Как известно в данной области, примеры химических веществ, которые вызывают активацию клеток врожденной иммунной системы включают лейкотриены, простагландины, цитокины, хемокины, интерфероны, кинины, витамин D, форболмиристатацетат, иономицин, митогены, опсонины, гистамин, брадикинин, серотонин, лейкотриены, цАМФ, антимикробные пептиды и пролекарства или индукторы вышеупомянутых веществ.

В важном варианте осуществления ПАМС-активатором врожденной иммунной системы настоящего изобретения является иммунологически эффективное количество вещества, которое связывается с рецептором врожденной иммунной системы. В настоящее время известные рецепторы врожденной иммунной системы включают TLR-1, TLR-2, TLR-3, TLR-4, TLR-5, TLR-6, TLR-7, TLR-8, TLR-9, TLR-11 грызунов; NOD-1, NOD-2, другие NOD-подобные рецепторы (NLRS), такие как NLRP1, NLRP3, NLRP12, NLRC4; Dectin-1; DC-SIGN; AIM-2; рецепторы маннозы в том числе пектинов С-типа, MD2; CD14; LBP; CARD (активации каспазы и рекрутирования домена), содержащей белки, такие как RIG-1 (ретиноевой кислотой индуцируемый ген-1) и MDA-5 (ген связанный с дифференциацией меланомы-5), LGP2 и ASC, скавенджер рецепторы, включая CD-36, CD-68 и SRB-1, С-реактивный белок, манноза связывающий лектин, факторы комплемента включая С3а и C4b и рецепторы комплемента, и N-формильные метиониновые рецепторы в том числе FPR и FPRL1. Особый интерес для настоящего изобретения представляют ПАМС, которые связывают и активируют TLR-1, -2, -3, -5, -6, -7, -9 и и NOD-подобные рецепторы. Более предпочтительными являются TLR3, TLR9 и агонисты рецептора NOD2. Наиболее предпочтительными являются агонисты TLR9.

В важном варианте по всем аспектам настоящего изобретения используется иммунологически эффективное количество одного или более ПАМС (патоген-ассоциированных молекулярных структур). ПАМС является структурно консервативной молекулой, которая происходит от патогена, который иммунологически отличается от молекул хозяина, опознается и специфически связывается с рецепторами врожденной иммунной системы. ПАМС присутствуют в ряде белков, липидов, липопротеинов, углеводов, гликолипидов, гликопротеинов, и нуклеиновых кислотах, экспрессируемых частью патогенов и включают агонисты TLR2, включая ди- и три-ацильные липопептиды, липотехоевую кислоту, зимозан, пептидогликан, порин, липоарабуминоманнан, фосфолипоманнан, глюкуроноксиломаннан, гликозилфосфатидилинозитол (DPI) - заякоренные белки в паразитов, агонисты TLR3 включая двухцепочечную РНК, включая синтетические дцРНК например полиинозиновая: полицитидиловая кислоты (поли I:С), агонисты TLR4 в том числе маннан, глюкуроноксиломаннан, белки теплового шока, фибриноген и синтетический MPL, агонисты TLR5 в том числе флагеллин, агонисты TLR6 в том числе липотехоевуюлипотехоевые кислоты, TLR7 и TLR8 агонисты в том числе вирусные или синтетические одноцепочечные (SS) РНК, например, Имиквимод и Resiquimod (R848), и агонисты TLR9 в том числе неметилированные цитозин-гуанин-динуклеотид олигонуклеотидные последовательности (CpG ODN) и гемозин, RIG-1 агонисты, такие как вирусные или синтетические двухцепочечные (DS) РНК, агонисты MDA5 такие как вирусны или синтетические двухцепочечные ДНК, агонисты Nodi включая пептидогликан, содержащий мурамилдипептид NAG-NAM-гамма-D-глутамил-мезодиаминопимелиновую кислоту, агонисты NOD2 включая пептидогликан, содержащий мурамилдипептид NAG-NAM-L-аланин-изоглутамин, RIG1 и агонисты MDA5 включая оцРНК и дцРНК, агонисты рецептора N-формил метионина, включая N-формил метионин. Таким образом, ПАМС-активаторы врожденной иммунной системы, которые используются в настоящем изобретении, могут быть выбраны из любого из вышеуказанных групп агонистов или синтетических аналогов или производных.

В важном варианте одного из аспектов настоящего изобретения, вещество, содержащее или состоящее из одного или нескольких патоген ассоциированных молекулярных структур (ПАМС) может присутствовать или вводиться в иммунологически эффективном количестве и/или концентрации в диапазоне от 0,01 до 500 микрограмм на килограмм массы тела.

В важном варианте одного из аспектов настоящего изобретения, каждое вещество, содержащее или состоящее из патоген-ассоциированных молекулярных структур (ПАМС) присутствует, или используется в форме чистого, отдельного и одномолекулярного химического соединения.

В одном варианте осуществления аспектов настоящего изобретения, вещество, содержащее или состоящее из патоген-ассоциированных молекулярных структур (ПАМС) может присутствовать или вводиться, в высшей степени очищенном состоянии, в результате чего каждый отдельный и одномолекулярный химический объект является ПАМС с чистотой по меньшей мере 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99,9%, 99,99%, 99,999%, по существу 100%.

В важном варианте осуществления, ПАМС из настоящего изобретения является агонистом TLR. В настоящее время считается, что у большинства видов млекопитающих есть приблизительно 10-15 различных типов TLR. Различные TLR связываются и активируются диапазоном природных и синтетических лигандов. Различные TLR сигнализируют через различные сигнальные молекулы, хотя эта их функция объединяет то, что все они активизируют воспалительный фактор транскрипции NFκБ.

В одном варианте из настоящего изобретения, ПАМС является агонистом TLR1, таким как агонист TLR1, приведенный из группы триацил липопептида и Pam3CSK4. Наиболее предпочтительным является Pam3CSK4.

В одном варианте настоящего изобретения, ПАМС является агонистом TLR2, таким как агонист TLR2, приведенный из группы гликолипида, липотейхоевой кислоты, пептидогликана, HSP70, зимозана и Pam3CSK4.

В одном варианте настоящего изобретения, ПАМС является агонистом TLR3, таким как агонист TLR3, приведенный из группы двухцепочечной РНК, поли (I:С), поли (I:C-LC) (Hiltonol™) и поли I: polyC12 U (Ampligen™). Наиболее предпочтительным является поли (I:С).

В другом варианте из настоящего изобретения, ПАМС является агонистом TLR4, таким как агонист TLR4, приведенный из группы монофосфориллипида A (MPLA), белков теплового шока, фибриногена, фрагменты гепаран сульфата, фрагменты гиалуроновой кислоты и синтетические агонисты TLR4 в том числе Е6020, GLA и LPS пептидные мимотопы. Наиболее предпочтительными является синтетический агонист TLR4, который преимущественно сигнализирует через TIR-домен содержащий адаптер вызывающий интерферон-β (TRIF), а не путем NFκB пути активации. Из-за токсичности и нормативных требований, липополисахаридные (LPS) агонисты TLR4 и вещества, содержащие LPS (например, эндотоксин) следует избегать в изобретении. Количество LPS и/или эндотоксина в веществах и композициях, используемых в аспектах настоящего изобретения, может быть меньше, чем 100 EU на дозу, например, менее чем 90, 80, 70, 60, 50 40, 30, 20, 10, 5, 4, 3, 2, 1 или менее ЕС на дозу. Концентрация LPS и/или эндотоксина в веществах и композициях, используемых в аспектах настоящего изобретения, может быть меньше, чем 200 EU/m3, например, менее 150, 100, 90, 80, 70, 60, 50 40, 30, 20, 10, 5, 4, 3, 2, 1 или меньше EU/m3.

В другом варианте настоящего изобретения, ПАМС является агонистом TLR5, таким как агонист TLR5, приведенный из группы бактериальных или синтетических флагеллинов. Наиболее предпочтительным является синтетический флагеллин.

В другом варианте настоящего изобретения, ПАМС является агонистом TLR6, таким как агонист TLR6, приведенный из группы диацил липопептидов. Наиболее предпочтительным является диацил липопептид.

В другом варианте настоящего изобретения, ПАМС является агонистом TLR7, таким как агонист TLR7, приведенный из группы вирусных одноцепочечных РНК, имидазохинолина, gardiquimod, loxoribine, бропиримина, CL264, R848 и CL075. Наиболее предпочтительным является R848.

В другом варианте настоящего изобретения, ПАМС является агонистом TLR8, таким как агонист TLR8, приведенный из группы одноцепочечной РНК, полиУ, Имиквимода, Resiquimod, ssPolyU/LyoVec и ssRNA40/LyoVec.

В важном предпочтительном варианте осуществления настоящего изобретения ПАМС является агонистом TLR9. Более предпочтительно, чтобы агонистом TLR9 являлся CpG-ODN. Термин "CpG" или "CpG-ODN молекула", как он использован здесь, следует понимать как относящийся к молекуле ODN, содержащей мотив, где цитозиновый нуклеозид с последующим гуаниновым нуклеозидом, связаны фосфатной молекулой в обычной манере полинуклеотидных последовательностей (т.е. "CpG мотив"), в которой цитозиновый нуклеозид неметилирован. CpG мотивы преобладают в бактериальных и вирусных геномах, но редки в геномах позвоночных. Кроме того, CpG мотивы, как правило, неметилированы в прокариотических организмах, тогда как в эукариотических организмах, метилтрансферазами ДНК обычно метилируются 70-80% присутствующих CpG мотивов. Это также относится к синтезированным молекулы олигонуклеотида, содержащим по крайней мере один неметилированный CpG-мотив. Часто присутствует более чем один CpG мотив. Разнообразные CpG олигонуклеотидные молекулы являются коммерчески доступными. Они, как правило, имеют 18-24 нуклеотидов в длину, но специалисту в данной области техники будет понятно, что олигонуклеотидные CpG молекулы другой длины так же эффективны. Олигонуклеотидные CpG молекулы могут содержать различные нуклеотидные последовательности, окружающие по меньшей мере один CpG-мотив, так как различные нуклеотидные последовательности, как было показано, могут стимулировать TLR9 в разной степени. ODN класса В являются сильными стимуляторами созревания человеческих В клеток и моноцитов. Они также стимулируют созревание дендритных клеток плазмацитоидньгх клеток (PDC), но в меньшей степени, чем ODN класса А и вызывают только очень малые количества IFNα. Класс С ODN имеют черты класса А и класса В. Предпочтительно CpG-ODN класса В или С используются в настоящем изобретении. Как известно специалистам в данной области, основа CpG может варьироваться от естественного фосфодиэфирного остова до синтетического фосфортиоатного или смеси двух типов остовов для повышения стабильности ODN. В предпочтительном варианте осуществления изобретения CpG ПАМС имеет естественную фосфоротиоатную основу и имеет от 18 до 28 нуклеотидов в длину. В другом предпочтительном варианте осуществления изобретения агонист TLR9 является CpG-ODN класса В или С с синтетическим фосфортиоатным остовом и от 18 до 28 нуклеотидов в длину. В предпочтительном варианте, ПАМС выбирается из группы CpG2006, CpG1826 и, наиболее предпочтительно, CpG7909.

В другом варианте ПАМС из настоящего изобретения является агонистом NOD-подобного рецептора. Предпочтительный агонистом рецептора Nod1 из группы ацилированного производного IE-DAP) (C12-IE-DAP), D-гамма-Glu-MDAP (IE-DAP), L-Ala-гамма-D-GIu-MDAP (Tri-DAP). Более предпочтительно, агонистом рецептора NOD2 из группы мурамилдипептида (MDP), мурамилтрипептида, L18-МДФ, M-TriDAP, мурабутида, PGN-ECndi, PGN-ECndss, N-гликолилованного мурамилдипептида и PGN-Sandi. Наиболее предпочтительным агонистом NOD2 является мурабутид.

В другом варианте ПАМС, согласно настоящему изобретению, является агонистом рецептора лектинов С-типа. Более предпочтительно, чтобы агонист рецептора лектинов С-типа связывался с одним из группы макрофаговых рецепторов маннозы, CLEC-2, DEC205/CD205, DC-SIGN, как, DC-ASGPR (MGL)/CD301, Dectin-1, Langerin/CD207, Mincle и CLR BDCA-2/CD303. Наиболее предпочтительно, чтобы агонист рецептора лектинов С-типа был из группы: бетта-1,3-глюкан, зимозан, убитые нагреванием С. Albicans, хордовый фактор, и трегалоза-6,6-дибегенат.

В другом варианте ПАМС, согласно настоящему изобретению, является агонистом семейства нуклеотид-связывающих домен подобных рецепторов олигомеризации (NLR) белков, включая продукт гена индуцируемого ретиноевой кислотой 1-геликазное семейство рецепторов, которые включают RIG-1 и MDA-5. Предпочтительно, чтобы агонист был взят из группы поли (I:С), поли (дА:ОТ), поли (DG:DC) и 5'ррр-дцРНК.

В другом варианте ПАМС, согласно настоящему изобретению, является агонистом ДНК-зондирующего белка, ДНК-зависимого активатора интерферон-регулирующих факторов (DAI) и отсутствует в меланоме 2 (AIM2). Предпочтительным является поли (дА:дТ).

В другом важном варианте осуществления ПАМС, согласно настоящему изобретению, является агонистом класса А, В или С скавенджер рецепторов, экспрессированных на клетках врожденной иммунной системы, которые могут, например, быть из группы SCARA1, SCARA2, SCARA3, SCARA4, SCARA5, SCARB1, SCARB2, SCARB3, MARCO, CD36, SR-B1, CD68, и LOX-1. Предпочтительными являются липопротеины низкой плотности (ЛПНП), окисленные ЛПНП, ацетилированные ЛПНП или химически модифицированные ЛПНП.

В другом варианте ПАМС, согласно настоящему изобретению, является агонистом NLRP1 или NALP3. Предпочтительными являются гемозоин или АТФ.

Выбранные ПАМС-активаторы врожденной иммунной системы согласно настоящему изобретению, могут быть добавлены к веществам и составам, используемым в аспектах настоящего изобретения в "иммунологически эффективных", иммуностимулирующих количествах, которые, как известно специалистам в данной области, могут варьировать в зависимости от вида, линии, возраста, веса и пола животного или человека, которому назначена иммунологическая композиция.

Термин "иммуностимулирующее количество" относится к количеству иммунного препарата, необходимого для увеличения иммунного ответа, которое измерено стандартными анализами, известными специалисту в данной области. Как можно понять, каждая иммунологическая композиция, содержащая частицы инулина (или другой эквивалентный противовоспалительный компонент) может иметь эффективный диапазон доз, которые могут отличаться в зависимости от того какой ПАМС активатор врожденной иммунной системы и какая форма инулина полиморфного вида (или другого эквивалентного противовоспалительного компонента) используется. Таким образом, не может быть определен один диапазон доз, который будет иметь точную подгонку для каждой возможной формы инулиновых частиц (или другого эквивалентного противовоспалительного компонента) и ПАМС - активаторов врожденной иммунной системы, в пределах объема настоящего изобретения. Однако иммуностимулирующее количество легко может быть определено специалистом с обычной квалификацией в данной области. Эффективность иммунной активации может быть измерена либо путем анализа пролиферации клеток, или измерения изменений в уровне экспрессии на поверхности клеток маркеров активации, например, с помощью проточной цитометрии или флуоресцентной микроскопии или цитолитических анализов, или путем измерения секреции цитокинов или хемокинов или других веществ, секретируемых активированными иммунными клетками или путем измерения активации и индуцирования изменения в экспрессии генов иммунной клетки, например, путем Real Time полимеразной цепной реакции или массивов экспрессии генов (Gene expression arrays). Количество каждого компонента иммунологического препарата необходимое, чтобы обеспечить иммунологически эффективное количество легко определяется специалистом с обычной квалификацией в данной области, например, путем подготовки серии иммунологических препаратов по изобретению с различными концентрациями ПАМС активаторов врожденной иммунной системы и частиц инулина (или другого эквивалентного противовоспалительного компонента) с последующим добавлением этих композиций в культуры клеток иммунной системы и анализируя активацию иммунных клеток с помощью известных специалистам в этой области техники, в том числе анализов, описанных в данном документе. Аналогичным образом, количества каждого компонента, необходимые, чтобы обеспечить усиление иммунного ответа на антиген вакцины могут быть легко определены специалистом с обычной квалификацией в данной области, например, путем подготовки серии иммунологических препаратов по изобретению с различными концентрациями ПАМС активаторов врожденной иммунной системы и частиц инулина (или другого эквивалентного противовоспалительного компонента), а также вакцинного антигена и введения вакцины вместе с частицами инулина (или другого эквивалентного противовоспалительного компонента), подходящим лабораторным животным (например, мышам или морским свинкам), и последующим анализом полученного антиген-специфического иммунного ответа по измерению титров антиген-специфических антител в сыворотке или на слизистой, или через антиген-индуцированный отек на коже (DTH) или антиген-стимулированную пролиферацию Т-клеток, или продукцию цитокинов.

ПАМС активаторы врожденной иммунной системы, используемые в изобретении, могут быть эффективными в любом животном, предпочтительно млекопитающем, а наиболее предпочтительно в человеке. Различные ПАМС активаторы врожденной иммунной системы могут вызвать оптимальную иммунную стимуляцию в зависимости от вида. Таким образом, ПАМС иммунный активатор, такой как специфический CpG ODN, который обеспечивает оптимальную стимуляцию в организме человека путем связывания с человеческим TLR9 не может вызвать оптимальное стимуляции у мышей, экспрессирующих TLR9 мыши, или наоборот. Специалист в данной области может определить оптимальные ПАМС активаторы врожденной иммунной системы, представляющие интерес для конкретного вида, используя обычные иммунные анализы, описанные здесь или известные в данной области.

Водная часть композиций и веществ из аспектов настоящего изобретения может быть заменена на буферный изоосмотический физиологический раствор. Поскольку составы и вещества могут быть предназначены для парентерального введения или через слизистую оболочку, может быть целесообразным разработать их так, чтобы они имели тоничность, по существу, такую же, как нормальные физиологические жидкости, чтобы предотвратить опухоль после введения или слишком быстрое всасывание композиции из-за дифференциальных концентрации ионов между композицией и физиологическими жидкостями. Также может быть целесообразным буферный солевой раствор, чтобы поддерживать рН, совместимое с нормальными физиологическими условиями. Например, буферный рН может находиться в диапазоне от 4 до 10, в диапазоне от 5 до 9, в диапазоне от 6 до 8,5, или в диапазоне от 7 до 8,5. Кроме того, в некоторых случаях может оказаться необходимым поддержание рН на определенном уровне, с тем чтобы обеспечить стабильность некоторых компонентов композиции, таких как частицы инулина, ПАМС или белковые антигены в композиции. Любой физиологически приемлемый буфер может быть использован в данном описании, но было обнаружено, что наиболее удобно использовать бикарбонат-солевой буфер (1%) при рН между 6 и 8,5. Подходящие консерванты включают хлорид бензалкония (0,003-0,03% вес/объем); хлорбутанол (0,3-0,9% вес/объем); парабены (0,01-0,25% вес/объем) и тимеросал (0,004-0,02% вес/объем).

Изобретение в других аспектах включает способ модуляции, включая подавление индукции не-антиген-специфического иммунного ответа. В одном аспекте данное изобретение обеспечивает способ усиления защиты от патогена, где указанный способ включает введение субъекту терапевтически эффективного количества композиции или вещества по изобретению. Это может обеспечить временную защиту против различных патогенов, включая вирусы, бактерии, паразиты, грибы и простейшие, для лечения рака, или для профилактики или лечения аутоиммунного заболевания, астмы или аллергии. Способ включает в себя этапы введение субъекту иммунологической композиции по настоящему изобретению в иммунологически эффективном количестве. Для более длительной защиты, иммунологическую композицию можно вводить более одного раза.

В различных вариантах осуществления иммунологическая композиция по настоящему изобретению предназначена для лечения или профилактики различных заболеваний. Таким образом, в различных вариантах осуществления иммунологические композиции в эффективном количестве, эффективны для лечения или профилактики инфекционного заболевания, рака, или аллергии. Соответственно, методы, представленные здесь, могут быть использованы для объекта, имеющего риск развития инфекционного заболевания или с самим заболеванием и, следовательно, метод является методом для лечения или профилактики инфекционных болезней. Эти способы также могут быть использованы на субъектах, которые болеют или подвержены риску развития астмы и способ представляет собой способ лечения или профилактики астмы у субъекта. Способ также может быть использован для субъекта с риском развития аллергии или с аллергией, и способ представляет собой способ лечения или профилактики аллергии. Метод также может быть использован для объекта, который подвергается риску развития рака или болен им, и метод является способом лечения или предотвращения рака.

Композиции и вещества, используемые в аспектах настоящего изобретения могут быть использованы в некоторых вариантах осуществления, чтобы изменить тип или величину иммунного ответа, в том числе в одном из вариантов совместно с антигеном. Соответственно, предлагается, что композиции и вещества могут быть широко использованы в качестве адъювантов вакцин, например, путем объединения его/их с одним или более из соответствующих антигенов с образованием профилактической или терапевтической вакцины. Таким образом, в важном варианте осуществления, композиции и вещества из аспектов настоящего изобретения дополнительно содержат вакцинный антиген. С другой стороны, субъекту, подлежащему лечению, дополнительно можно вводить антиген вакцины, в то же время, или после введения иммунологически эффективного количества иммунологической композиции. Антиген может быть выбран из группы, состоящей из микробного антигена, аутоантигена, ракового антигена, а также аллергена, но не ограничивается этим. В одном варианте осуществления, микробный антиген выбран из группы, состоящей из бактериального антигена, вирусного антигена, грибкового антигена и паразитного антигена. В другом варианте осуществления антиген может представлять собой пептидный антиген. В другом варианте осуществления антиген, кодируется экспрессируемым вектором в форме нуклеиновых кислот. В другом варианте осуществления композиция дополнительно содержит цитокин или субъекту дополнительно вводили цитокин.

Термин "антиген" относится к любому веществу, обычно белку или гликопротеину, липопротеину, сахариду, полисахариду или липополисахариду, который при введении стимулирует образование специфических антител или Т-клеток памяти. Антиген может стимулировать пролиферацию Т-лимфоцитов с рецепторами к антигену, и может вступать в реакцию с лимфоцитами, чтобы инициировать серию реакций, обеспечивающих клеточный иммунитет.

Подходящие антигены, используемые в данном изобретении, включают вещества, полученные из микробов (бактерии, грибы, простейшие, или вирусы) или эндогенные вещества, против которых может быть получен специфический иммунный ответ. Антигены могут быть получены из инактивированных организмов или могут быть сгенерированы с помощью технологии рекомбинантных белков или непосредственно синтезированы. Для целей этого описания, антиген определен как любой из белков, углеводов, липидов, нуклеиновых кислот или их смеси, или множество их, к которому есть желаемый иммунный ответ. Термин антиген, используемый здесь, включает также комбинации гаптенов с носителем. Гаптен представляет собой часть антигенной молекулы или антигенного комплекса, который определяет иммунологическую специфичность, но не достаточен, чтобы стимулировать иммунный ответ в отсутствие носителя. Как правило, гаптеном является относительно небольшой пептид или полисахарид и может быть фрагментом антигена. Гаптен будет специфически реагировать в естественных условиях и в пробирке с гомологичными антителами или Т-лимфоцитами. Гаптены, как правило, прикреплены к большим молекулам-носителям, таким как столбнячный анатоксин или гемоцианин лимфы улитки (KLH) путем ковалентного или не ковалентного связывания при образовании композиции в качестве вакцины.

Антигены могут быть использованы в вакцинах для лечения или профилактики заболевания. Они также могут быть использованы для создания специфических иммунных веществ, таких как антитела, которые могут быть использованы в диагностических тестах или наборах. Субъект антиген-содержащей вакцины, как правило, позвоночные, предпочтительно млекопитающие, более предпочтительно человек. Важно отметить, что не всегда необходимо, чтобы антиген был определен в молекулярных терминах. Например, иммунные ответы на опухоли могут быть получены, без знания заранее, или постфактум против которой молекулы направлен иммунный ответ. В этих случаях термин антиген относится к веществу или веществам, известным или не известным, к которым специфический иммунный ответ направлен. Специфичность иммунного ответа обеспечивает оперативное определение антигена, так что иммунитет против одного типа опухоли может быть специфическим для этого типа опухоли, но не другого типа опухоли.

В одном важном варианте аспектов настоящего изобретения, кодируемый антиген может быть получен из вируса гриппа,в том числе инактивированного вируса гриппа, такой как гемагглютинин гриппа, нейраминидаза или М2 белок или другие компоненты вируса гриппа.

в Показательные ДНК-содержащие вирусы, которые антигенны в позвоночных животных включают, но не ограничиваются ими: the family Poxviridae, including the genus Orthopoxvirus (Variola major, Variola minor, Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia), the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus (Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox, goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus (contagious postular dermatitis virus, pseudocowpox, bovine papular stomatitis virus); the family Iridoviridae (African swine fever virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the family Herpesviridae, including the alpha-Herpesviruses (Herpes Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus, Equine herpes virus 2 and 3, pseudorabies virus, infectious bovine keratoconjunctivitis virus, infectious bovine rhinotracheitis virus, feline rhinotracheitis virus, infectious laryngotracheitis virus) the Beta-herpesvirises (Human cytomegalovirus and cytomegaloviruses of swine, monkeys and rodents); the gamma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus, guinea pig herpes virus, Lucke tumor virus); the family Adenoviridae, including the genus Mastadenovirus (Human subgroups A, B, C, D, E and ungrouped; simian adenoviruses (at least 23 serotypes), infectious canine hepatitis, and adenoviruses of cattle, pigs, sheep, frogs and many other species, the genus Aviadenovirus (Avian adenoviruses); and non-cultivatable adenoviruses; the family Papoviridae, including the genus Papillomavirus (Human papilloma viruses, bovine papilloma viruses, Shope rabbit papilloma virus, and various pathogenic papilloma viruses of other species), the genus Polyomavirus (polyomavirus, Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K virus, BK virus, JC virus, and other primate polyoma viruses such as Lymphotrophic papilloma virus); the family Parvoviridae including the genus Adeno-associated viruses, the genus Parvovirus (Feline panleukopenia virus, bovine parvovirus, canine parvovirus, Aleutian mink disease virus, etc). DNA viruses also include Kuru and Creutzfeldt-Jacob disease viruses and chronic infectious neuropathic agents (CHINA virus).

члены семьи Reoviridae, в том числе рода Orthoreovirus (несколько серотипов обоих млекопитающих и птиц ретровирусов), род Orbivirus (Вирус синего, Вирус Eugenangee, вирус Кемерово, вирус африканской чумы лошадей, и Колорадо Тик вирус лихорадки), род Ротавирусная (ротавирус человека, Небраска теленка вирусной диареи, мышиные ротавирус, обезьян ротавирус, бычий или овец ротавирус, птичий ротавирус); семья Picornaviridae, в том числе род энтеровирусов (полиовируса, вирус Коксаки А и В, кишечно цитопатический человеком сирота (ECHO) вирусы, вирус гепатита A, Simian энтеровирусы, мышиный энцефаломиелит (МЭ) вирусы, Вирус полиомиелита Muris, бычий энтеровирусы, свиной энтеровирусы, род Cardiovirus (вирус энцефаломиокардита (ЭМС), Mengovirus), род Риновирус, род Apthovirus (ящур, семья Calciviridae, в том числе везикулярной экзантемой свиного вируса, морской лев вирус Сан-Мигель, Feline пикорнавирус и Норуолкский вирус, семья Togaviridae, в том числе рода Alphavirus (Восточный лошадиный энцефалит, Семлики вирус лес, вирус Синдбис, вирус чикунгунья, вирус O'Nyong-Nyong, вирус реки Росс, венесуэльского конского энцефалита, Западная конского энцефалита), род Flavirius (Москитная иметь вирус желтой лихорадки, денге Вирус, вирус японского энцефалита, энцефалит Сент-Луис вирус, вирус энцефалита Мюррей Долина, вирус Западного Нила, вирус Kunjin, Центральный клещевой вирус Европейский, Дальневосточный клещевой вирус, Кьясанурского вирус лес, вирус Louping III, вирус Повассан, омской геморрагической лихорадки вирус), род Rubivirus (Вирус краснухи), род Pestivirus (вирусное заболевание слизистой, вирус холеры свиней, вирус болезни пограничной); семья Bunyaviridae, в том числе рода Bunyvirus (Bunyamwera и родственных вирусов, Калифорния энцефалита группы вирусов), роду Phlebovirus (Sandfly лихорадка сицилийской вирус, Вирус Рифт-Валли), род Nairovirus (Вирус конго-крымской геморрагической лихорадки, Найроби овец вирусное заболевание), и род Uukuvirus (Uukuniemi и связанные вирусы); семья Orthomyxoviridae, в том числе вируса гриппа рода (гриппа типа вируса, много человеческих подтипов); Свиной вирус гриппа, и птичьего и лошадей Вирусы гриппа; гриппа типа В (много человеческих подтипов) и гриппа типа С (возможно отдельный род); семья Paramyxoviridae, в том числе рода парамиксовирус (Вирус парагриппа типа 1, вирус Сендай, вирус Hemadsorption, вирусы парагриппа типа 2 до 5, Болезнь Ньюкасла, вирус эпидемического паротита), род морбилливирус (Вирус кори, подострый склерозирующий панэнцефалит, вирус чумы, вирус чумы крупного рогатого скота), род Pneumovirus (дыхательный синцитиальный вирус (RSV), вирус бычьей респираторно-синцитиальный и Пневмония вирус мышей); вирус лес, вирус Синдбис, вирус чикунгунья, вирус OTStyong-Nyong, вирус реки Росс, венесуэльского конского энцефалита, Западная конского энцефалита), род Flavirius (Москитная иметь вирус желтой лихорадки, вирус денге, японский энцефалит, энцефалит Сент-Луис вирус, Мюррей Долина энцефалит вирус, вирус Западного Нила, вирус Kunjin, Центральный клещевой вирус Европейский, Дальневосточный клещевой вирус, Кьясанурского вирус лес, Louping Вирус III, вирус Повассан, Омск вирус геморрагической лихорадки), род Rubivirus (Вирус краснухи), род Pestivirus (вирусное заболевание слизистой, вирус чумы свиней, вирус болезни пограничной); семья Bunyaviridae, в том числе рода Bunyvirus (Bunyamwera и родственных вирусов, Калифорния энцефалита группы вирусы), род Phlebovirus (Sandfly лихорадка сицилийской вирус, Вирус Рифт-Валли), род Nairovirus (Вирус конго-крымской геморрагической лихорадки, Найроби овец вирусное заболевание), и род Uukuvirus (Uukuniemi и связанные вирусы); семья Orthomyxoviridae, в том числе вируса рода гриппа (вирус типа гриппа А, многих человеческих подтипов); свиного вируса гриппа, и птичьего и гриппа лошадей вирусов; гриппа типа В (множество человеческих подтипов) и гриппа типа С (возможно отдельный род); семья Paramyxoviridae, в том числе рода парамиксовирус (вирус парагриппа типа 1, вирус Сендай, вирус Hemadsorption, вирусы парагриппа типа от 2 до 5, Болезнь Ньюкасла Вирус, вирус паротита), род морбилливирус (Вирус кори, подострый склерозирующий панэнцефалит, вирус чумки, вирус чумы рогатого скота), род Pneumovirus (респираторно-синцитиальный вирус (RSV), бычий респираторно-синцитиальный вирус и вирус пневмонии мышей); семейство Rhabdoviridae, в том числе рода Vesiculovirus (VSV), вирус Chandipura, вируса Фландрия-Hart Park), род Lyssaviras (Бешенство вирус), рыба рабдовирусы, и два вероятным рабдовирусы (вирус Марбург и вирус Эбола); семья Arenaviridae, в том числе вируса лимфоцитарного хориоменингита (LCM), вирусной комплекса Tacaribe и вирус Ласса, семья Coronoaviridae, в том числе Вирус инфекционного бронхита (ИБК), мышь Вирус гепатита, энтеровирус корона человека, и кошачий инфекционный перитонит (Филин коронавируса).

Показательные ДНК-содержащие вирусы, которые антигенны в позвоночных животных включают, но не ограничиваются: семьи Poxviridae, в том числе рода ортопоксвирусным (натуральной оспы мажор, натуральной оспы минор, обезьянья оспа Vaccinia, коровья оспа, Buffalopox, Rabbitpox, эктромелии), род Leporipoxvirus (миксомы, фибромы), род Avipoxvirus (оспы кур, другие птичьего поксвирус), род Capripoxvirus (sheeppox, оспы коз), род Suipoxvirus (Swinepox), род Parapoxvirus (заразной postular вирус дерматит, паравакцина, бычий вирус стоматита папулезная); семья Iridoviridae (вирус африканской чумы свиней, лягушка вирусы 2 и 3, Lymphocystis вирус рыбы); семья Герпесвиридае, в том числе альфа-герпесвирусов (Herpes Simplex Типы 1 и 2, ветряной оспы, лошадей вируса абортов, лошадей вирусом герпеса 2 и 3, вирус псевдобешенства, инфекционный бычий вирус кератоконъюнктивит, инфекционный бычий вирус ринотрахеита, кошачьего ринотрахеита вирус, вирус инфекционного ларинготрахеит) бета-herpesvirises (цитомегаловируса человека и цитомегаловирусы из свиней, обезьян и грызунов); гамма-вирусы герпеса (вирус Эпштейна-Барр (EBV), вирус болезни Марека, герпес Saimiri, герпеса Ateles, герпеса Sylvilagus, морской вирус свиней герпес, Lucke вируса опухоли); семья Adenoviridae, в том числе рода Mastadenovirus (Human подгруппы А, В, С, D, Е и разгруппирована; обезьян аденовирусы (по крайней мере, 23 серотипов), инфекционный гепатит собак и аденовирусы крупного рогатого скота, свиней, овец, лягушек и многие другие виды, род Aviadenovirus (Птичий аденовирусы); и не cultivatable аденовирусы; семья Papoviridae, в том числе рода папилломы (человека вирусы папилломы, вирусы папилломы крупного рогатого скота, Shope кролик вирус папилломы, а также различные патогенные вирусы папилломы других видов), род полиомы (полиомы, Simian вакуолизирующий агент (SV-40), Кролик вакуолизирующий агент (РКВ), вирус K, вирус BK, Вирус JC, а также другие вирусы полиомы приматов, таких как вирус папилломы лимфотропного); семейные Parvoviridae в том числе рода адено-ассоциированные вирусы, вирусы рода Парвовирус (кошачий вирус панлейкопении, бычий парвовирус, собачий парвовирус, вирус Aleutian норка болезнь и т.д.) ДНК. Также Куру и Крейтцфельда-Якоба вирусы болезни и хронических инфекционных невропатические агентов (вирусов Китай).

Каждый из вышеуказанных списков является иллюстративным и не предназначен для ограничения.

Другие примеры антигенов, пригодных для настоящего изобретения, включают, но не ограничиваются антигенами инфекционных заболеваний, для которых защитный иммунный ответ может быть желательным в том числе антигены вируса человеческого иммунодефицита (ВИЧ) gag, env, pol, tat, rev, nef, обратная транскриптаза и другие антигенные компоненты ВИЧ или его части, Е6 и Е7 белки из вируса папилломы человека, EBNA1 антиген вируса простого герпеса, антигены вирусных гепатитов, такие как S, М, L белки вируса гепатита В, пре- S антиген из вируса гепатита В, и антигенные вирусные компоненты других гепатитов, например, гепатитов А, В, и С, такие как РНК гепатита С; вирусные антигены гриппа, такие как гемагглютинин, нейраминидаза, нуклеопротеида, М2 и другие антигенные компоненты вируса гриппа; вирусные антигены кори, такие как белки слияния вируса кори и другие антигенные компоненты вируса кори; вирусные антигены краснухи, таких как белки Е1 и Е2 и другие антигенные компоненты вируса краснухи; ротавирусные антигены, таких как VP7sc и другие ротавирусные антигенные компоненты; антигены цитомегаловируса, таких как гликопротеин оболочки В и другие цитомегаловирусные антигенные компоненты; антигены респираторно-синцитиального вируса, такие как RSV протеин слияния, белок М2 и другие антигенные компоненты респираторно-синцитиального вируса; простого герпеса вирусные антигены, такие как непосредственные ранние белки, гликопротеин D и другие антигенные вирусные компоненты простого герпеса; ветряной оспы вирусные антигены такие как GPI, GPII и другие антигенные вирусные компонентов ветряной оспы; японского энцефалита вирусные антигены, такие как белки Е, I, I-NS1, Н.С.1, Н.С.1-NS2A; бешенства вирусные антигены, такие как гликопротеин бешенства, бешенства нуклеопротеин и другие антигенные вирусные компоненты бешенства; Вирус Западного Нила PRM и Е белки, а также белок оболочки Эбола. Смотреть Fundamental Virology, Second Edition, eds. Knipe, D.M. and, Howley P.M. (Lippincott Williams & Wilkins, New York, 2001) для дополнительных примеров вирусных антигенов. Кроме того, также известны бактериальные антигены. Бактериальные антигены, которые могут быть использованы в композициях и способах по изобретению, включают, но не ограничиваются: бактериальные антигены коклюша, такие как коклюшный токсин, нитевидный гемагглютинин, пертактин, fim 2, fim 3, аденилатциклаза и другие бактериальные коклюшные антигене; дифтерийные бактериальные антигены, такие как дифтерийный токсин или анатоксин дифтерии и другие антигенные бактериальные компоненты, антигены столбняка, такие как столбнячный токсин или анатоксин столбняка и другие антигенные бактериальные компоненты; стрептококковые бактериальные антигены, такие как М белок и другие стрептококковые бактериальные антигены; стафилококковый бактериальный антиген, такие как ISDA, ISDB, SdrD, и SDRE; грамотрицательных бацилл бактериальные антигены, такие как липополисахариды, флагеллин и другие грамотрицательных антигены компоненты бактерий; микобактерий туберкулеза бактериальные антигены, такие как миколовые кислоты, белка теплового шока 65 (Hsp65), 30 кДа основной секретируемый белок, антиген 85А, ESAT-6 и другие микобактериальные антигены; антигенные бактериальные компоненты хеликобактер пилори; пневмококковых бактерий антигены, такие как пневмолизин, пневмококковые капсульные полисахариды и другие пневмококковые бактериальные антигены; гемофильного гриппа бактериальные антигены, такие как капсульные полисахариды гемофилуса и другие грипп бактериальные антигены; сибирской язвы бактериальные антигены, такие как сибирской язвы защитный антиген, антиген летального фактора сибирской язвы и другие сибирской язвы бактериальные антигенные компоненты, F1 и V белки из Yersinia Pestis; риккетсии бактериальные антигены, такие как romps и другие риккетсии бактериальные антигенные компоненты. Кроме того, включены с бактериальными антигенами, описанными здесь любые другие бактериальные, микобактериальные, микоплазменные, риккетсиозные или хламидийные антигены. Примеры протозойных и других паразитарных антигенов включают, но не ограничиваются ими:

Примерами антигенов прионовой болезни включают: PrP, beta-amyloid, and other prion-associated proteins, плазмодия тропического антигены, такие как мерозоитов поверхностных антигенов, спорозоитов поверхностных антигенов, циркумспорозоитного антигенов, гаметоцит/гамет поверхностных антигенов, кровь стадии антигена PF 1 55/RESA и других плазмодия антигена компоненты; Toxoplasma антигены, такие как SAG-1, Р30 и других компонентов Toxoplasma антиген; schistosomae антигены, такие как глутатион-8-трансферазы, paramyosin и другие компоненты schistosomal антиген; Leishmania основных и других leishmaniae антигенов, таких как gp 63, lipophosphoglycan и связанной с ней белка и другие leishmanial компоненты антигенов, а также Trypanosoma Cruzi антигены, такие как 75-77 кДа антигена, 56 кДа антигену и других трипаносомоза компонентов антиген. Примеры грибковых антигенов включают, но не ограничиваются ими, антигены из видов Candida, видов Aspergillus, Blastomyces видов, видов Histoplasma, видов Coccidiodomycosis, Malassezia перхоти и других видов, Exophiala werneckii и других видов, Piedraia hortai и других видов, Trichosporum beigelii и другие виды, виды Microsporum, Trichophyton видов, видов Epidermophyton, Sporothrix schenckii и другие виды, Fonsecaea pedrosoi и другие виды, Wangiella dermatitidis и другие виды, Pseudallescheria boydii и другие виды, Madurella grisea и другие виды, виды Rhizopus, виды Absidia и Mucor видов. Примеры антигенов заболеваний прионных включают PrP, бета-амилоида.

В дополнение к использованию композиций и веществ из аспектов настоящего изобретения в целях индуцирования антиген специфического иммунного ответа в организме человека, способы предпочтительных вариантов особенно хорошо подходят для лечения лошадей и других животных. Способы по изобретению можно использовать для защиты от инфекции в животноводстве, в том числе коров, верблюдов, лошадей, свиней, овец, и коз. Лошади подвержены флавивирусам, включая вирус японского энцефалита и вирус западного Нила. В предпочтительном варианте иммунологические композиции по настоящему изобретению можно вводить лошадям вместе с антигеном - инактивированным вирусом японского энцефалита, чтобы защитить их против японского энцефалита и смежных флавивирусов.

В дополнение к инфекционным и паразитарным агентам, упомянутым выше, еще одной областью желаемого повышения иммуногенности являются неинфекционные агенты в области рака, в которой клетки, экспрессирующие опухолевые антигены желательно выводить из организма, "опухолевый антиген", используемый здесь, представляет собой соединение, такое как пептид или белок, присутствующее в опухолевой ткани или клетке и которое способно вызывать иммунный ответ, когда экспрессируется на поверхности антигенпрезентирующей клетки в контексте МНС молекулы. Опухолевые антигены могут быть получены из раковых клеток либо путем получения неочищенных экстрактов раковых клеток, например, как описано в Cohen, et al., 1994, Cancer Research, 54:1055, или в форме частично очищенных антигенов, с помощью рекомбинантной технологии, либо синтеза известных антигенов, опухолевые антигены включают, но не ограничиваются: рекомбинантно экспрессированными, иммуногенными частями, или целой опухолью, или раковой опухолью. Такие антигены могут быть выделены или получены с помощью технологии рекомбинантной экспрессии ДНК или с помощью любых других средств, известных в данной области техники. В одном варианте осуществления рак выбран из группы, состоящей из рака желчных путей; рака кости; мозга и рак ЦНС; рака молочной железы; рака шейки матки; хориокарциномуы; рака толстой кишки; рака соединительной ткани; рака эндометрия; рака пищевода; рака глаз; желудка рак; лимфомы Ходжкина; интраэпителиальных новообразований; рака гортани; лимфомы; рака печени; рака легких (например, мелкоклеточный и немелкоклеточный); меланомы; нейробластомы; рака ротовой полости; рака яичников; рака поджелудочной железы; рака предстательной железы; рака прямой кишки; саркомы; рака кожи; рака яичек; рака щитовидной железы, и рака почки. Раковые антигены, которые можно использовать в композициях и способах по изобретению, включают, но не ограничиваются ими, это простатический специфический антиген (PSA), молочной железы, яичников, яичек, меланомы, теломеразы; белки множественной лекарственной резистентности, такие как Р-гликопротеин, MAGE- 1, альфа-фетопротеин, раково-эмбриональный антиген, мутант р53, антигены папилломы, ганглиозиды и другие углеводные компоненты, содержащиеся в меланоме или других раковых клетках. Предполагается, в соответствии с изобретением, что антигены из любого типа раковых клеток могут быть использованы в композициях и способах, описанных здесь. Антиген может представлять собой клетку рака, или их иммуногенные материалы, выделенные из раковой клетки, такие как мембранные белки. Включены сурвайвин и теломеразы универсальные антигены и mage антигены семейства рака яичка.

В другом предпочтительном варианте осуществления, композиции и способы по настоящему изобретению включают в себя антигены, связанные с аутоиммунными заболеваниями, которые можно использовать для индуцирования иммунной толерантности. Такие антигены включают, но не ограничиваются: основной белок миелина, миелин олигодендроцитов гликопротеин и протеолипидный белок рассеянного склероза, CII коллаген, белок ревматоидного артрита, декарбоксилазы глутаминовой кислоты, инсулина, и тирозинфосфатаза белков диабета типа 1, белок глиадина целиакии.

В другом предпочтительном варианте осуществления композиции, вещества и методы аспектов настоящего изобретения могут быть использованы с антигенами, известными как "аллергены", участвующие в аллергиях для индукции толерантности и подавления аллерген-специфических IgE. "Аллерген" представляет собой любое вещество, которое может вызвать аллергическую или астматическую реакцию у чувствительного субъекта. Аллергены включают пыльцу, яды насекомых, шерсть животных пыль, споры грибов и лекарственных средств (например, пенициллин). Примеры природных, животных и растений аллергенов включают, но не ограничиваются белки, специфичные для следующих родов: Canine (Canis familiaris); Dermatophagoides (e.g. Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana); Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale); Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum (e.g. PArrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum (e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea); Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum halepensis); and Bromus (e.g. Bromus inermis). Наиболее предпочтительными для изобретения является аллерген яда насекомоых.

В другом предпочтительном варианте осуществления композиции, вещества и методы аспектов настоящего изобретения могут быть использованы для иммунизации против антигенов, вовлеченных в астмы. Такие антигены включают, но не ограничиваются IgE и гистамин.

Термин «лечение» в данном описании охватывает любое лечение заболевания у птицы, рыбы или млекопитающего, в частности человека, и включает в себя:

(I) предотвращение заболевания у субъекта, который может быть предрасположен к заболеванию, но еще не установлено, что заболел;

(II) ингибирование заболевания, т.е. замедление или прекращение его развития; или

(III) облегчение болезни, т.е. обеспечение регрессии болезни. (Следует отметить, что вакцинация может повлиять на регрессию заболевания, где болезнь сохраняется из-за неэффективного распознавания антигена иммунной системой субъекта, хотя вакцина эффективно представляет антиген).

Термин "необязательно" означает, что могут или не могут происходить последовательно описываемые события или обстоятельства, и что описание включает случаи, когда указанное событие или обстоятельство происходит, и примеры, когда этого не происходит.

Термин "модуляция иммунного ответа" следует понимать как индукция любого наведенного изменения в иммунной клетке, которая может быть измерена способом, известным специалистам с обычной квалификацией в данной области. Предпочтительно, измеренный параметр для указания изменения в поведении или функции иммунных клеток будет выбран из группы изменением экспрессии генов, экспрессии белков, морфологии клеток, дифференцировки, деления клеток, экспрессии белков на клеточной поверхности, хемотаксиса, фагоцитоза, экзоцитоза, аутофагии, секреции хемокинов, секреции цитокинов и апоптоза.

В еще одном варианте осуществления настоящего изобретения, совместное введение инулиновых частиц (или другого эквивалентного противовоспалительного компонента) с ПАМС активаторами врожденной иммунной системы позволяет выбрать щадящие дозы ПАМС активатора врожденной иммунной системы. Таким образом, в присутствии инулиновых частиц (или другого эквивалентного противовоспалительного компонента), меньшая доза ПАМС активатора врожденной иммунной системы может быть использована для получения такого же уровня иммунной активации. Учитывая различные действия инулиновых частиц (или другого эквивалентного противовоспалительного компонента) и ПАМС активатора врожденной иммунной системы, дозо-снижающий эффект частиц инулина (или другого эквивалентного противовоспалительного компонента) позволяет более низким дозам ПАМС иммунного активатора быть использованным для достижения желаемого иммунного ответа или адъювантного эффекта и тем самым обеспечивает средства для снижения любых дозозависимых побочных эффектов или токсичностей ПАМС активатора врожденной иммунной системы, в то же время достигая желаемого иммунного результата. Дозозависимая токсичность от избыточного количества ПАМС-активаторов врожденной иммунной системы и воспаление являются основными ограничивающими дозу побочными эффектами ПАМС активаторов врожденной иммунной системы, изобретение обеспечивает новые средства, позволяющие уменьшить дозу и связанные побочные эффекты ПАМС-активаторов врожденной иммунной системы.

Состав и вещества из аспектов настоящего изобретения, могут быть введены в виде его/их отдельных компонентов одновременно или последовательно, но предпочтительно компонент инулиновых частиц (или другого эквивалентного противовоспалительного компонента) вводят вместе с или до антигена, но не после антигена. Когда компоненты композиции или вещества из аспектов настоящего изобретения вводят одновременно они могут быть введены в составе одних и тех же или отдельных композиций, и в последнем случае в тех же или разных местах инъекций, и в то же время, что и вакцинный антиген. ПАМС активатор врожденной иммунной системы можно вводить до, после или одновременно с частицами инулина (или другого эквивалентного противовоспалительного компонента) и антигенного компонента. Например, ПАМС-активатор врожденной иммунной системы можно вводить до или после введения компонента инулиновых частиц (или другого эквивалентного противовоспалительного компонента) вместе с прайм дозой антигена. Буст дозы антигена могут впоследствии быть введены с одной или обоими: ПАМС активатором врожденной иммунной системы и компонентом инулиновых частиц (или другого эквивалентного противовоспалительного компонента). "Прайм доза" является первой доза антигена которую вводят субъекту. "Буст доза" представляет собой вторую, третью, или последующие дозы антигена, которые вводят субъекту, который уже подвергся воздействию антигена.

Если компоненты вводят последовательно, разделение во времени между введением компонентов может быть вопросом минут или может быть больше. Разделение во времени, предпочтительно, менее 7 дней, 3 дня, или 2 дней и наиболее предпочтительно менее чем 1 день.

Композиции или вещества из аспектов настоящего изобретения могут быть использованы для повышения ответа вакцины, в сочетании с использованием ДНК-вакцины. В предпочтительном варианте осуществления, композиции или вещества из аспектов настоящего изобретения вводят с белком или другим физическим антигеном, в виде буст дозы, следующей после одной или нескольких прайм доз антигена, введенных в форме иммунологически эффективной дозы ДНК вакцины, кодирующей один или несколько антигенов. В дополнительном варианте осуществления композиции или вещества из аспектов настоящего изобретения / вводят с белком или другим физическим антигеном, в то же время как ДНК-вакцина, кодирующая один или несколько антигенов, вводя их либо в разных местах инъекции, либо смешанными вместе введенными в том же месте инъекции.

Композиции или вещества из аспектов настоящего изобретения с добавлением или без добавления физического антигена могут быть также введены вместе с вектором кодирующим антиген. В самом широком смысле, "вектор"-ом является любое транспортное средство способное облегчить вход в клетку и экспрессию в зараженной клетке кодируемого или содержащегося антигена. В общем, векторы, используемые в изобретении, включают, но не ограничиваются: плазмиды, фаги, вирусы и другие транспортные средства, полученные из вирусных или бактериальных источников, которые были изменены путем введения или внесения антигенных последовательностей нуклеиновых кислот. Вирусные векторы являются предпочтительным типом вектора и включают, но не ограничиваются последовательности нуклеиновых кислот из следующих вирусов: ретровирусов, таких как вирус мышиного лейкоза Молони, вирус мышиной саркомы Харви, мышиный вирус опухоли молочной железы и вируса саркомы Роуз; аденовирус, аденоассоциированный вирус, SV40-THn вирусов; вирусы полиомы; Эпштейна-Барра; вирусы папилломы; вирус герпеса; вирус коровьей оспы; вирус полиомиелита; ретровирус; лентивирус и Сендай вирус. В данной области техники хорошо известно, как легко использовать другие векторы аналогичным образом, чтобы доставить антигенные последовательности в клетки. см., например, Sanbrook et al., "Molecular Cloning: A Laboratory Manual". Second Edition, Cold Spring Harbor Laboratory Press, 1989.

Один или более препаратов, композиций, веществ из аспектов настоящего изобретения может включать в себя антигенсвязывающий материал-носитель или аллерген-связывающий материал-носитель. Антигенсвязывающий материал-носитель или аллерген-связывающий материал-носитель может содержать, например, одну или более соли металлов, такие как соли из группы, состоящей из гидроксида алюминия, фосфата алюминия, сульфата алюминия, фосфата кальция, сульфата кальция, и трехвалентного и двухвалентного фосфатов и сульфатов железа, фосфата хрома и сульфата хрома. Другие подходящие антигенсвязывающие носители и аллерген-связывающие материалы-носители включают белки, липиды и углеводы (например, гепарин, декстран и производные целлюлозы) и органические основания, такие как хитин (поли N-ацетилглюкозамин) и деацетилированные их производные, как известно специалисту в данной области техники.

В важном варианте осуществления ПАМС-активатор врожденной иммунной системы в иммунологической композиции физически связан с инулиновыми частицами (или другим эквивалентным противовоспалительным компонентом), или антигенсвязывающий материал-носитель объединен с инулиновыми частицами (или другим эквивалентным противовоспалительным компонентом). В предпочтительном варианте осуществления ПАМС-активатор врожденной иммунной системы связан с инулиновыми частицами (или другим эквивалентным противовоспалительным компонентом) связью, выбранной из группы, состоящей из ковалентной, гидростатической и электростатической связей. С другой стороны, ПАМС-активатор врожденной иммунной системы может быть в пространственной ловушке внутри инулиновых частицы (или других эквивалентных противовоспалительных компонентов). В дополнительном варианте осуществления, линкерная последовательность может быть использована, чтобы присоединить ПАМС активатор врожденной иммунной системы к инулиновым частицам (или другим эквивалентным противовоспалительным компонентам).

Кроме того, когда композиции или вещества в аспекте настоящего изобретения, включают антигенсвязывающий материал, предпочтительно, чтобы частицы инулина (или другого эквивалентного противовоспалительного компонента) были в сочетании с или связанными с антигенсвязывающим материалом-носителем.

Сокристаллы частиц инулина и антигенсвязывающего материала-носителя могут быть получены, например, способами включающими:

(А) приготовление суспензии частиц инулина;

(Б) нагревание суспензии, пока частицы инулина не растворятся;

(С) добавление к указанному раствору некоторого количества антигенсвязывающего материала-носителя;

(Г) повторное осаждение частиц инулина из указанной суспензии, и

(Е) выделение образованных частиц, содержащих частицы инулина и один или более антигенсвязывающий материал-носитель.

В развитие этой работы, частицы инулина могут быть сформулированы с антигенсвязывающим материалом-носителем, в частности, гидроксидом алюминия или фосфатом алюминия (в совокупности известными как алюминиевый гель). Алюминиевый гель широко используется в качестве адъюванта в вакцинах в котором он, как известно, индуцирует сильный антительный (Th2) иммунный ответ, но плохой клеточный (Th1) иммунный ответ. Таким образом, было установлено, что можно сформировать совместно кристаллизованные частицы gIN, dIN или eIN вместе с солями алюминия (например, гидроксид алюминия или фосфат алюминия), с образованием, соответственно, препарата gIN/алюминий (также известный как "Algammulin") (см. WO 90/01949, WO 2006/024100), препарата dIN/алюминий (также упоминается как "Aldeltin") или препарата eIN/гидроксидный алюминий (также упоминается как "Alepsilin"). В то время как в естественных условиях исследования показали, что вакцины, содержащие комплексы частиц инулина и алюминиевых солей хорошо переносятся, их способность увеличивать антительный ответ к совместно введенному антигену сверх адъювантных композиций на основе отдельно инулиновых частиц или алюминия, как правило, небольшая и суммирующаяся, а не синергическая, и, как и алюминиевые адъюванты по-отдельности, композиции инулина с алюминием смещают результирующий иммунный ответ на путь Th2,

иммунологический состав, выбирают из группы, состоящей из химиотерапевтического агента, вакцины против рака и иммунотерапевтического агента.

В рассматриваемом варианте, лекарственное средство от аллергии или астмы входящее в иммунологический состав выбирают из группы, состоящей из PDE-4 ингибитора бронходилятор/бетта-2 агониста, активатора K+ канала, VLA-4 антагониста, антагониста нейрокина, ингибитора синтеза ТХА2, ксантанина, антагониста арахидоновой кислоты, ингибитора 5 липоксигеназы, антагониста рецептора тромбоксана А2, антагониста тромбоксана А2, ингибитора белка активации 5-липоксигеназы, и ингибитора протеазы.

Композиции или вещества из аспектов настоящего изобретения могут быть приготовлены для парентерального введения, или могут быть приготовлены в системе продолжительного высвобождения. Система продолжительного высвобождения может быть микрочастицей, матрицей, или имплантируемым насосом, но не ограничивается этим.

В другом варианте осуществления композиции и веществ из аспектов настоящего изобретения сформулированы для доставки к поверхности слизистой оболочки. В рассматриваемых вариантах осуществления композиции и веществ из аспектов настоящего изобретения предоставляются в количестве, эффективном для стимулирования иммунного ответа слизистой оболочки. Поверхность слизистой оболочки может быть выбрана из группы, состоящей из пероральной, назальной, ректальной, вагинальной и глазной поверхности, но не ограничивается этим. В одном варианте осуществления композиции и вещества из аспектов настоящего изобретения формулированы для перорального введения. Композиции и вещества из аспектов настоящего изобретения также могут быть формулированы в качестве пищевой добавки. В рассматриваемом варианте, пищевая добавка формулируется как капсулы, таблетки, или сублингвальные таблетки. В другом варианте иммунологическую композицию получают для местного введения.

В вариантах осуществления, касающихся лечения субъекта, способ или применение изобретения может дополнительно содержать изолирование иммунных клеток субъекта, ex vivo контакте иммунных клеток с иммунологически эффективным количеством композиций и веществ из аспектов настоящего изобретения, чтобы таким образом получить ex vivo активированные иммунные клетки и необязательно заново ввести активированные иммунные клетки субъекту. В одном варианте осуществления, иммунные клетки представляют собой моноциты, и в другом варианте иммунные клетки представляют собой дендритные клетки. В другом варианте осуществления способ или применение может дополнительно содержать контактирование иммунных клеток с антигеном в присутствии, до, или после добавления иммунологически эффективного количества композиций или веществ из аспектов настоящего изобретения.

В еще одном аспекте изобретение обеспечивает способ идентификации оптимальной иммунологической композиции путем измерения контрольного уровня активации иммунно-клеточной популяции при контакте с композицией или веществом из аспектов настоящего изобретения, последующем сравнении с уровнем активации иммунно-клеточной популяции при контакте с исследуемой композицией, причем тестовый уровень, который равен или выше уровня контроля свидетельствует об эффективности иммунологической композиции.

Иммунный ответ может включать иммунную активацию как манифест изменений в экспрессии генов или продукции белка, таких как индукцию продукции или секреции цитокинов или хемокинов, изменение фенотипа, емкости пролифераци или выживания или модуляции иммунных эффекторных свойств. Иммунный ответ может дополнительно содержать индукцию, повышение или модуляцию адаптивной иммунной реакции с индукцией продукции антител или индукцией эффекторных Т-клеток или ответа иммунологической памяти против эндогенного или экзогенного антигена.

В дополнительном аспекте настоящее изобретение предоставляет способ модулирования иммунного ответа, где указанный способ включает введение субъекту терапевтически эффективного количества композиций или веществ из аспектов настоящего изобретения.

Используемый здесь, термин "эффективное количество" относится к нетоксичным, но достаточным количествам композиций и веществ из аспектов настоящего изобретения, для обеспечения желаемого эффекта. Точное требуемое количество будет изменяться от субъекта к субъекту в зависимости от таких факторов, как биологический вид субъекта, возраст и общее состояние субъекта, тяжесть состояния субъекта, от конкретного состава или веществ из аспектов настоящего изобретения, которые вводят и способа введения. Таким образом, невозможно определить точное "эффективное количество". Тем не менее, для любого заданного случая необходимое "эффективное количество" может быть определено рутинным способом обычным специалистом в данной области.

Кроме того, изобретение обеспечивает способ модуляции профиля цитокинов, продуцируемых в ответ на вакцины. Термин "модулировать" предусматривает подавление экспрессии конкретного цитокина, когда меньшие его уровни желаемы или увеличение экспрессии конкретного цитокина, когда большие его уровни желаемы. Модуляция конкретного цитокина может происходить местно или системно. ПАМС активаторы врожденной иммунной системы, используемые в качестве адъювантов вакцин могут непосредственно активировать макрофаги и дендритные клетки, вызывая секрецию цитокинов, такие как TNF-α и IL-1. Цитокинные профили, вызванные ПАМС активаторами врожденной иммунной системы определяют Т-клеточные регуляторные и эффекторные функции в иммунных реакциях, а также могут приводить к нежелательным реакциям на вакцину. В общем, ПАМС активаторы врожденной иммунной системы индуцируют цитокины, связанные с воспалением и лихорадкой в том числе TNF и IL-1, но могут также вызвать супрессорные цитокины, такие как IL-10, которые обеспечивают отрицательную обратную связь и могут таким образом ограничивать или снижать адаптивный иммунный ответ на совместно вводимый антиген. Композиции и вещества из аспектов настоящего изобретения способны модулировать цитокинные профили, обусловленные ПАМС активаторами врожденной иммунной системы, и тем самым приводить к более благоприятным иммунным ответам.

В других аспектах изобретение включает способ профилактики у субъекта избыточной поляризации иммунного ответа, вызванной в случае введение субъекту комбинации антигена и ПАМС активатора врожденной иммунной системы, такого как агонист TLR. Ранее было показано, что комбинация ПАМС активатора врожденной иммунной системы, такого как CpG-ODN, агониста TLR9, привело к смещению в сторону Th1 и подавлению Th2 пути ответа. Таким образом, было неожиданно обнаружено, что, когда инулиновые частицы сочетают с Th1-смещающим ПАМС активатором врожденной иммунной системы, таким как CpG-ODN, становится возможно поддерживать реакцию Th2 и в то же время индуцировать Th1 иммунный ответ на совместно вводимый антиген, что приводит к синергическому увеличению Th2 и Th1 ответов на антиген, в такой степени, к какой компоненты в отсутствие частиц инулина не способны.

Композиции и вещества из аспектов настоящего изобретения, могут быть приготовлены с фармацевтически приемлемым носителем, разбавителем или наполнителем в форме, пригодной для инъекции, или в форме, подходящей для перорального, ректального, вагинального, местного, назального, трансдермального или глазного введения. Композиции и вещества из аспектов настоящего изобретения могут также содержать дополнительный активный компонент, такой, как например, вакцинный антиген (в том числе рекомбинантный антиген), антигенную пептидную последовательность, или иммуноглобулин. Альтернативно, активный компонент может быть макрофаговым стимулятором, полинуклеотидной молекулой (например, кодирующей вакцинирующий агент) или рекомбинантным вирусным вектором.

Компоненты вакцины и адъювантной композиции по изобретению могут быть получены с помощью коммерческих источников или могут быть получены любым специалистом в данной области. Составы частиц инулина могут быть получены по способам, описанным в предварительной заявке на патент №61/243975 в Соединенных Штатах и в международных заявках на патент PCT/AU86/00311 (WO 87/02679), PCT/AU89/00349 (WO 90/01949) и РСТ/AU2005/001328 (WO 2006/024100) или могут быть получены в продаже от Vaxine Pty Ltd, Аделаида, Австралия. ПАМС активаторы врожденной иммунной системы для использования в настоящем изобретении, могут быть получены коммерческим путем или с использованием способов, хорошо известных в данной области. Например, синтетические триацилированные липопротеины, Pam3CSK4 (0,25 мкг/мышь), термически убитые листерии (2.5x10e7 клеток/мышь), липоарабуминоманнан из М. smegmatis (0,25 мкг/мышь), LPS-PG сверхчистый липополисахарид из Р. gINgivalis (2,5 мкг/мышь), стандартные липотейхоевые кислоты (LTA-SA) от золотистого стафилококка (2 мкг/мышь), пептидогликаны от золотистого стафилококка (PGN-SA) (2 мкг/мышь), синтетический диацилированный липопротеин (0,25 мкг/мышь), зимозан (1 мг/мышь) и CpG2006 (20 мкг/мышь), используемый в настоящем изобретении, были все приобретены у Invivogen, San Diego, USA. Синтетический CpG-ODN синтезированный с нативным или модифицированным фосфортиоатным остовом был приобретен у Geneworks, Австралия и может быть получен из других коммерческих источников. MPLA может быть приобретен у фирмы Sigma, USA или Invivogen, San Diego, USA. Плазмидные ДНК также могут быть получены с использованием способов, хорошо известных в данной области, например с использованием процедуры, Quiagen (Quiagen Inc, США), с последующей очисткой ДНК с использованием известных способов. Инактивированные или рекомбинантные антигены, используемые для иммунизации могут быть получены от коммерческих белковых и химических поставщиков, таких как Sigma, США или могут быть получены с использованием способов, хорошо известных в данной области.

Биологическая активность вакцины может быть исследована с помощью стандартных лабораторных методов, например, путем вакцинации стандартных лабораторных животных (например, мыши или морской свинки) со стандартным антигеном (например, столбняка), используя тестовый иммунологический препарат. Спустя время, необходимое для повторной вакцинации и формирования иммунного ответа, у животного берут кровь или селезенку, и измеряют ответ на вакцину. Ответ может быть количественно оценен по любым методам, принятым в данной области для измерения иммунной реакции, например с помощью определения в крови, слюне, влагалище, фекалиях, титра антител против стандартного антигена (для измерения гуморального иммунитета) и измерения пролиферации Т-клеток, измерения цитокинов в ELISPOT или цитокинов в ELISA анализах (для измерения Т-клеточного иммунитета).

Любому специалисту в данной области техники очевидно, что точные количества белкового антигена и иммунологической композиции, необходимые для производства данного эффекта будут зависеть от конкретных соединений и антигенов, а также размера, возраста, вида и состояния субъекта, подлежащего лечению. Таким образом, нельзя определить точные необходимые дозировки. Тем не менее, эти дозировки могут быть легко определены с использованием методов, известных специалистам в данной области. Обычно, одна или более вакцины с желаемым антигеном первоначально вводятся путем внутримышечной, подкожной или внутрикожной инъекции для прайминга иммунного ответа. Затем производится буст вакцинация после задержки (обычно с 1-12 месяцев, например, 6 месяцев) с помощью иммунологической композиции по данному изобретению предпочтительно путем введения один или несколько раз антигена в сочетании с иммунологической композиции путем парентеральной инъекции для систематического повышения иммунного ответа. Обычно доза антигена используемая для взрослого человека будет в диапазоне от 0,001-0,1 мг и наиболее обычно 0,001-0,1 мг, или 0,005-0,05 мг на дозу.

Как правило, диапазон от 0,1 до 5,0 мл вакцины вводится в практике настоящего изобретения, и предпочтительно диапазон от 0,1 до 1 мл для человеческого субъекта.

Композиции и вещества, в соответствии с аспектами настоящего изобретения предпочтительно вводят путем внутримышечной или внутрикожной инъекции, или другими парентеральными способами, или путем нанесения баллистического введения в эпидермис. Они также могут быть введены интраназально, ингаляционно, местно, внутривенно, перорально или в виде имплантатов, и даже возможно применение ректально или вагинально. Фармацевтически пригодными жидкими или твердыми формами препарата являются, например, водные или солевые растворы для инъекций или ингаляций, микрокапсулы, энкохлеированные формы, нанесенные на микроскопические частицы золота, находящиеся в липосомах, распылители, аэрозоли, гранулы для имплантации в кожу, или высушенные на остром предмете для вцарапывания в кожу. Фармацевтические композиции также включают гранулы, порошки, таблетки, драже, (микро) капсулы, суппозитории, сиропы, эмульсии, суспензии, кремы, капли или препараты с пролонгированным высвобождением активных соединений, в которых есть наполнители и добавки и/или вспомогательные вещества, такие как разрыхлители, связующие, покрывающие агенты, агенты, вызывающие набухание, смазывающие вещества, ароматизаторы, подсластители или растворители, обычно используемые, как описано выше. Фармацевтические композиции пригодны для использования в различных системах доставки лекарственных средств. Для краткого обзора существующих методов доставки лекарственных средств см. Langer, Science 249:1527-1533, 1990, которая включена сюда посредством ссылки.

Иммунологические композиции предпочтительно получают и вводят в дозированных единицах. Жидкие дозированные единицы это флаконы или ампулы для инъекций или другого парентерального введения. Твердые дозированные единицы это таблетки, капсулы и суппозитории. Введение определенной дозы может быть осуществлено как путем однократного введения в виде отдельной дозированной единицы или нескольких более мелких дозированных единицах. Введение нескольких доз через определенные интервалы недель или месяцев, общепринято для повышения антиген-специфических иммунных реакций.

Композиции и вещества из аспектов настоящего изобретения, или антигены, используемые в изобретении, могут быть доставлены в смеси более чем двух компонентов. Смесь может состоять из иммунологической композиции, включающей один или более типов инулиновых частиц (или другого эквивалентного противовоспалительного компонента) вместе с одним или несколькими ПАМС активаторами врожденной иммунной системы и с одним или несколькими антигенами.

Для того чтобы сущность настоящего изобретения могла быть более четко понята, его предпочтительные формы теперь будут описаны со ссылкой на следующие не ограничивающие примеры. Все содержание всех ссылок (включая литературные ссылки, выданные патентов, опубликованные патентные заявки, и одновременно рассматриваемые заявки на патенты) приведенные в данной заявке, тем самым явно включено посредством ссылки.

Примеры

Использование инулиновых частиц в вакцинах отдельно или в сочетании с другими иммунными активаторами была оценена. Рекомбинантный поверхностный антиген вируса гепатита В (HBsAg) и антиген вируса гриппа были использованы в качестве иллюстративных модельных систем в примерах, приведенных ниже.

МАТЕРИАЛЫ И МЕТОДЫ

Пример 1:

Подготовка адъювантных композиций

Составы инулиновых частиц, указанные в следующих примерах, были получены, как описано ниже.

Gammulin (Гамма инулин; gIN), Algammulin (AG) и Phosgammulin (PG): Гамма инулин (gIN) и Algammulin получали, как описано ранее в PCT/AU86/00311 (WO 87/02679) под названием "Immunotherapeutic treatment", и РСТ/AU89/00349 (WO 90/01949) под названием "Gamma inulin compositions", которые тем самым явно включены посредством ссылки. Для получения Phosgammulin (PG), 5%-ную суспензию в воде gIN сначала растворяли при нагревании при 80-85°C и затем смешивают с тонкой суспензей геля фосфата алюминия (Adju-Phos™ Aluminium Phosphate Gel Adjuvant 0.44%, BrenntagBiosector, Frederickssund, Дания) в пропорции инулин: Adju-Phos™ соотношение вес/вес от 2 до 200. Суспензию затем кристаллизовали при 5°C, затем превращали в гамма-форму (1 час при 45°) с получением Phosgammulin гибридных частиц и промывали и формулировали по мере необходимости.

Deltin (Delta инулин; dIN): Deltin (dIN) получали из gIN как описано ранее в WO 2006/024100, который включен в настоящее описание посредством ссылки. Вкратце, стандартная формулировка gIN в воде (200 мл при 50 мг/мл) инкубировали в течение 1 часа на водяной бане при 55°C, затем температуру повышали до 60°C в течение 30 мин. Частицы затем центрифугируют, ресуспендируют в воде при 55°C, вновь инкубируют при 55°С и снова промывают тем же самым способом, прежде чем окончательно ресуспендировать в 50 мл холодной воды. Эта обработка является достаточной, чтобы удалить большую часть инулина присутствующую в альфа- и гамма формах. Образец dlN-обогащенной взвеси растворяется полностью при 80-85°C. Показатель преломления указывает концентрацию 48 мг/мл. Deltin суспензия используемая в этих экспериментах имела концентрацию 5% масса/объем воды.

Phosdeltin (dIN/алюминий фосфат препарат (PD)): Для получения Phosdeltin (PD), 5% суспензию Deltin как описано выше, сначала растворяли в воде при нагревании при 80-85°C и затем смешивали с тонкой суспензей геля фосфата алюминия (Adju-Phos™ Aluminium Phosphate Gel Adjuvant 0.44%, BrenntagBiosector, Frederickssund, Дания) в пропорции dIN: Adju-Phos™ соотношение вес/вес от 2 до 200. Суспензию затем кристаллизовали при 5°C, затем превращали в gIN (1 час при 45°), затем dIN (1 час при 55°C) с получением Phosdeltin гибридных частиц и промывали и формулировали по мере необходимости.

Aldeltin (dIN/алюминий гидроксид препарат): Для получения Aldeltin (AD) используется та же самая процедура, что и выше для Phosdeltin за исключением того, что используют тонкую суспензию алюминиевой гидроокиси геля (Alhydrogel™ Aluminium Hydroxide Gel Adjuvant, Al (calc) 3.0%, BrenntagBiosector, Frederickssund, Дания) вместо алюминия фосфата геля. Вкратце, 5% суспензию Deltin в воде, как описано выше, сначала растворяли при нагревании при 80-85°C и затем смешивали с тонкой суспензией Alhydrogel™ в пропорции с получением dIN: Alhydrogel™ соотношении вес/вес от 2 и 200. Суспензию затем кристаллизовали при 5°C, затем превращали в gIN (1 час при 45°), а затем dIN (1 час при 55°C) с получением Aldeltin гибридных частиц, промывали и формулировали по мере необходимости.

Epsilin (eIN): Epsilin получали из dIN, как описано в PCT/AU2010/001221 под названием "A novel epsilon polymorphic form of inulin and compositions comprising same". Вкратце, eIN готовили путем нагревания концентрированной суспензии с концентрацией больше, чем 50 мг/мл dIN при 60°C в течение одного часа.

Phosepsilin (РЕ): Для получения Phosepsilin (РЕ), 5% суспензию eIN в воде, как описано выше, сначала растворяли при нагревании при 80-85°C и затем смешивали с тонкой суспензией геля фосфата алюминия (Adju-Phos™ Aluminium Phosphate Gel Adjuvant 0.44%, BrenntagBiosector, Frederickssund, Дания) в пропорции eIN: Adju-Phos™ вес/вес от 2 до 200. Суспензию затем кристаллизовали при 5°C, затем превращали в gIN (1 час при 45°), затем dIN (1 час при 55°C), а затем в eIN с получением Phosepsilin гибридных частиц и промывали и формулировали по необходимости. Alepsilin (АЕ) аналогичным образом производится путем использования Alhydrogel™ вместо Adju-Phos™ в вышеуказанном способе Phosepsilin.

PGmix, PDmix и PEmix: Phosdeltin (dIN/фосфат алюминия) и dIN составы, как описано выше, смешивали с образованием смешанной суспензии частиц, некоторые содержащие чистый инулин и другие содержащие инулин с фосфатом алюминия (PDmix). Для экспериментов, описанных здесь, комбинационное PDmix Phosdeltin: Deltin сочетание адъюванта было подготовлено в различных соотношениях в диапазоне от 1:1 до 1:36 вес/вес амальгамы инулиновых частиц с алюминием и инулиновых частиц, соответственно, именуемое в дальнейшем PDmix 1:1 до PDmix 1:36). Это позволило варьировать количество фосфата алюминия, содержащегося в частицах по отношению к количеству не содержащему соли алюминия dIN частицам. PGmix и PEmix были подготовлены таким же образом. Отношение Phosdeltin к Deltin частицам выражается в X:Y PD:D). Это означает, что количество x PD в рассчете через содержимый инулин смешивали с количеством y dIN в рассчете через содержимый инулин, чтобы сформировать PDmix х:y.

AGmix, ADmix и AEmix: Чтобы приготовить AD смеси, Aldeltin и Deltin составы, как описано выше, смешивают с образованием смешанной суспензии. Для экспериментов, описанных здесь, Aldeltin:Deltin комбинированный адъювант был подготовлен в различных соотношениях в диапазоне от 1:1 до 1:36 вес/вес инулина, тем самым позволяя варьировать количество Alhydrogel содержащих частиц по отношению к количеству не содержащих алюминий dIN частиц. AG и АЕ были подготовлены таким же образом.

ПАМС активаторы врожденной иммунной системы: ПАМС активаторы врожденной иммунной системы в том числе синтетический триацилированный липопротеин (Pam3CSK4) (0,25 мкг/мышь), убитых нагреванием листерий (2.5х10е7 клеток/мышь), липоарабуминоманнан от М. smegmatis (0,25 мкг/мышь), LPS-PG сверхчистый липополисахарида из P. gINgivalis (2,5 мкг / мышь), стандартные липотейхоевые кислоты из золотистого стафилококка (LTA-SA) (2 мкг/мышь), пептидогликаны от золотистого стафилококка (ПГН-SA) (2 мкг/мышь), синтетический диацилированный липопротеин (0,25 мкг/мышь), зимозан (1 мг/мышь), CpG2006 (20 мкг/мышь) и монофосфориллипид были все приобретены у Invivogen, San Diego, USA, и использовались в соответствии с инструкциями изготовителя. Кроме того, синтетические олигодезоксинуклеотиды (например ODN1826 из TCCATGACGTTCCTGACGTT последовательности, синтезированные с фосфортиоатным остовом) были приобретены у Geneworks, Australia. ПАМС-активаторы врожденной иммунной системы растворяли в соответствии с инструкциями изготовителя и разбавляли физиологическим раствором до использования.

Формулирование инулиновых частиц с ПАМС активаторами врожденной иммунной системы: Водные суспензии gIN, dIN, eIN, AG, AD, AE, PG, PD, PE, PG mix, PDmix, PEmix, AGmix, ADmix или AEmix (совместно именуемые "инулиновые частицы"), были приготовлены, как описано выше. Отдельные агонисты TLR и другие ПАМС активаторы врожденной иммунной системы, как описано выше смешивал с соответствующей суспензией частиц инулина с получением желаемой конечной концентрации. Таким же образом, растворы вакцинных антигенов, например, гемагглютинин гриппа или HBsAg, просто смешивали с соответствующей иммунологической композицией с получением желаемой окончательного концентрации вакцины. Смесь антигена, ПАМС активатора врожденной иммунной системы и инулиновых частицы тогда сразу до иммунизации набирали в шприц, готовый для инъекции.

Иммунизация мышей: BALB/С мышей разных возрастов группами в 5-10 мышей на группу иммунизировали внутримышечно в задние конечности 50 мкл вакцины в нормальном солевом растворе носителе. Инъекции проводили 0,3 мл инсулиновым шприцем, который имеет прикрепленную 29G иглу (Becton Dickenson, Franklin Lakes, NJ)

Оценка гуморального ответа на антигены: гепаринизированную кровь собирали ретробульбарной пункцией мягко анестезированных мышей, как описано в других местах (Michel et al., 1995.). Плазму отделяли центрифугированием (7 мин при 13000 оборотах в минуту). Антиген-специфические антитела в плазме были обнаружены и определены количественно с помощью анализа ELISA с использованием стандартного протокола. Разведения плазмы были сперва добавлены в микротитровальные 96-луночные плашки, покрытые антигеном и инкубированы в течение ночи при комнатной температуре. Связанные антитела детектировали инкубированием в течение 1 часа при 37°C с антителами к мышиными IgG, IgM, IgG1 или IgG2a, конъюгированными с пероксидазой хрена (HRP) (1:2000 в PBS-Tween, 10% FCS, 100 мкл/лунку), с последующей инкубацией с ТМВ-раствором (100 мкл/лунку, Sigma, St. Louis, МО) в течение 30 минут при комнатной температуре. Реакцию останавливали добавлением 1 М серной кислоты и считывали оптические плотности на считывающем устройстве для ELISA.

Чтобы определить, есть ли благоприятное соотношение дозы и иммунного ответа между агонистом TLR9 (CpG2006 ODN) и смесью инулиновых частиц (PDmix), женские линии BALB/С мышей в возрасте 6-8 недель (п=5-8 на группу) иммунизировали внутримышечно дважды через 14 дней, 50 мкл коммерческой трехвалентного инактивированной гриппозной вакцины человека (TIV) (Fluvax® 2007), 100 нг гемагглютинина на дозу, в сочетании с 2, 7, 20 или 60 мкг CpG2006 отдельно или в смеси с 1 мг PDmix (1:5). У мышей брали кровь через 42 дней после второй иммунизации и измеряли антител против вируса гриппа в ELISA (рис.1). Увеличение дозы CpG от 2 до 60 мкг подавляет ответ IgG1 против гриппа, в то же время, как повышает ответ IgG2a против гриппа. Тем не менее, из-за этого подавления IgG1 от CpG, общий анти гриппозный IgG ответ с CpG даже на самом высоком CpG 60 мкг дозы достоверно не отличался от результата, который достигается с TIV без адъюванта. Тем не менее, мыши, которые получили CpG2006 с частицами PDmix инулина, показали синергетическое повышение ответа IgG1 против гриппа, в частности, на CpG в дозах 2 и 7 мкг, что резко контрастировало с ингибированием реакции IgG1 против гриппа с такой же дозой CpG без инулиновых частиц. Повышение общего IgG комбинацией подтверждает, что инулиновые частицы обеспечивают дозосберегающий эффект для ПАМС активатора врожденной иммунной системы, так, что выгоды от ПАМС активатора врожденной иммунной системы на иммунный ответ получаются, когда его вводят в более низкой дозе вместе с инулиновыми частицами. В то же время, преимущество CpG в плане усиления ответа IgG2a было сохранено, или даже усиливалось в присутствии частиц инулина. Общая IgG реакция против гриппа была наибольшей в группе, получавшей TIV плюс частицы PDmix инулина с 60 мкг ПАМС, CpG. Кроме того, IgM ответ против гриппа был также увеличен в наибольшей степени при комбинации CpG и PDmix.

Пример 2:

Чтобы определить, является ли синергетический эффект PDmix и CpG связанным с возрастом, подобный эксперимент по примеру 1 был предпринят на самках мышей линии BALB/С (N=10/group), или в возрасте 14 дней (неонатальная модель) или в 200-300 - дневном возрасте (пожилая модель). Во-первых, 14 дневных самок BALB/с мышей (п=5-7 на группу) иммунизировали внутримышечно в задние конечности 50 мкл трехвалентной инактивированной гриппозной вакцины (TIV) (Fluvax® 2007, CSL Австралия), дозой 100 нг НА на мышь. TIV вводили отдельно или в смеси с dIN 1 мг, PDmix (1:36 PD: D/в) 1 мг, CpG1668 20ug или PDmix (1:36 PD: D/в) 1 мг + CpG1668 20ug. Мышей иммунизировали дважды, через 9 дней и образцы крови собирали через 14 дней после второй иммунизации для измерения ответов противогриппозных антител методом ELISA (рис.2). Добавление CpG1668 к TIV не увеличивало общей IgG против гриппа более, чем при иммунизации только антигеном вируса гриппа, хотя приводило к переключению с преимущественно IgG1 реакции на преимущественно IgG2a реакцию, в соответствии со способностью агонистов TLR9 вызывать Th2 на Th1 переключение в иммунном ответе. Максимальное повышение уровня общего анти-гриппозного IgG было видно, когда TIV было формулировано с CpG1668 плюс PDmix с синергическим эффектом отраженном в заметном увеличении анти-гриппозного общего IgG и IgM, до уровней, больших, чем с TIV с CpG1668 или PDmix в одиночку. Только у мышей, получавших PDmix вместе с CpG наблюдалось значительное увеличение титров ингибирования (HI) гемагглютинации, по сравнению с мышами, получавшими только TIV. Через пятьдесят два дня после второй иммунизации мышей умерщвляли и Т клеточные ответы против гриппа измеряли в CSFE основанном тесте пролиферации Т-клеток. У мышей, получивших PDmix плюс CpG1668 были самые высокие общие CD4 и CD8 Т-клеточные пролиферативные реакции на антигеном вируса гриппа. Поэтому сочетание Pdmix инулиновых частиц и CpG ПАМС активатора врожденной иммунной системы, который активирует TLR9, обеспечивает синергетическое усиление иммунного ответа на TIV, создавая самый высокий уровень антигриппозных антител общих IgG и IgM, будучи единственной группой способной индуцировать высокие уровни IgG2a и повышение титра защитного торможения гемагглютинации (HI) в новорожденных мышах. Аналогичным образом, CD4+ и CD8+ Т-клеточные пролиферативные ответы памяти на антиген вируса гриппа также были выше в группе комбинированной терапии. Это указывает на то, что сочетание частиц инулина и агониста TLR9 особенно полезно в индукции гуморальных и клеточных иммунных реакций у новорожденных.

Пожилые мыши, в возрасте 200-300 дней (п=6/группу) иммунизировали внутримышечно дважды через 14 TIV (100 нг гемагглютинина) с или без 1 мг PDmix (1:36), 20ug CpG1668 или смесью того и другого. Образцы крови собирали через 14 дней после второй иммунизации для измерения противогриппозных антител методом ELISA (рис.3). Синергизм на адаптивный иммунный ответ от совместного введения PDmix и CpG1668 также наблюдался у пожилых мышей в группе совместного введения TIV плюс инулиновые частицы PDmix плюс TLR9 агонист CpG2006, показавших самые высокие уровни анти гриппозных общего IgG, IgG2a и IgM ответы, у них также имелось смягчение подавления производства IgG1 частицами инулина, наблюдаемое с только CpG.

Пример 3:

Чтобы определить, зависит ли от последовательности CpG синергический эффект PDmix и CpG, эксперимент в примере 1, был повторен с использованием 6-8 недельных самок Balb/С мышей (n=5-7 на группу, которых иммунизировали внутримышечно дважды через 14 дней. Мышей иммунизировали внутримышечно TIV 100 нг НА плюс 1 мг PDmix (1:3) отдельно или вместе с CpG1668 (класс В ODN), CpG2216 (класс A ODN), CpG2006 (класс В ODN), CpG2395 (класс С ODN) или контрольной не-CpG последовательностью CpG2237, все в дозе 10 нмоль на мышь. Последовательности были следующими: CpG1668-tccatgacgttcctgatgct; CpG2216-ggGGGACGATCGTCgggggG; CpG2006-tcgtcgttttgtcgttttgtcgtt: CpG2395-tcgtcgttttcggcgcgcgccg; CpG2237-tgctgcttttgtgcttttgtgctt где строчные буквы представляют фосфодиэфирные связи и заглавные буквы представляют фосфоротиоатные связи. Уровни анти-гриппозных антител определялся посредством ELISA в крови, собранной через 28 дней после второй иммунизации (рис.4). Совместное введение PDmix с CpG1668, CpG2006 или CpG2395 показало синергию по сравнению с отдельными компонентами в виде увеличения титров анти-гриппозных общих IgG, IgG2a и IgM. При введении CpG2216 и CpG2237 не наблюдалось никакого влияния на уровни антител. Это подтверждает, что синергетический эффект частиц инулина и ODN является специфическим для ODN последовательностей, содержащих TLR9-связывающий CpG мотив, преимущественно относящихся к классу В или классу С ODN последовательностей.

Пример 4:

Чтобы определить, зависит ли от использованного антигена, синергетический эффект частиц инулина (dIN или PDmix) и CpG ODN, прививки были повторены с инактивированной вакциной против бешенства (Merieux инактивированная вакцина против бешенства (MIRV). Самок BALB/С мышей 6-8 недельного возраста (n=5-7 на группу) иммунизировали внутримышечно дважды через 14 дней только 10 мкл MIRV или в сочетании с 1 мг любого dIN или 1 мг PDmix (1:5) отдельно, либо в смеси вместе с CpG1668 (5 мкг). Уровни анти-MIRV антител определялись посредством ELISA крови, взятой через 14 дней после второй иммунизации (рис.5). Сочетание dIN или PDmix с CpG1668 плюс MIRV дает высокие антирабические общие IgG, IgG1, IgG2a и IgM, подтверждая, что синергический эффект распространяется на обе формы инулиновых частиц с или без содержания алюминия, и благоприятные свойства синергических комбинаций частиц инулина с агонистом TLR9-активатором врожденной иммунной системы распространены на иные, чем грипп антигены. Подобные исследования, проведенные тем же самым образом, как выше описанный эксперимент, подтверждают, что синергетический иммуностимулирующий эффект инулиновых частиц с CpG ODN распространяется на широкий спектр антигенов вакцин, в том числе MSP4 малярии или MSP белков, рекомбинантного или инактивированной ОРВИ CoV антигена, антигена пандемического гриппа H5N1, и антиген японского энцефалита, с последовательным повышением общих уровней IgG, IgG2a и IgM и снижением типичного подавления IgG1 под воздействием агонистов TLR9.

Пример 5:

Чтобы определить, распространяется ли благоприятный синергетический эффект инулиновых частиц на другие ПАМС врожденной иммунной системы активаторы, женские линии BALB/С мышей в возрасте 6-8 недель (N=5-10 на группу) иммунизировались внутримышечно дважды через 14 дней TIV 2007 (45нг НА/мышь) на день 0 и 14 день. Группы получили TIV плюс PDmix (1:5) только или совместно с 20ug CpG2006, или одним из целого ряда агонистов TLR2 в том числе 1 мг зимозаном, 2 мкг липотейхоевой кислоты (LTA), 0.25 мкг липоманнана или 0.25 мкг Pam3CSK4. Сыворотки собирали через 2 недели после второй инъекции для измерения антител против вируса гриппа путем ELISA. (Рис.6). Добавление каждого из отдельных ПАМС к композиции инулиновых частиц с TIV привело к увеличению анти-гриппозного общего IgG, с наибольшим эффектом от комбинации либо CpG агониста TLR9 или зимозана, агониста TLR2. В то время как комбинация с CpG подавляет ответ IgG1, сочетание зимозаном усиливает ответ IgG1, тогда как CpG и зимозан при добавлении к инулиновым частицам заметно усиливают ответ IgG2a и IgM. Липотехоевая кислота, PamCSK и липоманнан также повышали IgG2a и IgM ответы против гриппа, хотя и в меньшей степени. Это показало, что синергетический иммунологический эффект инулиновых частиц с агонистами TLR9 распространяется и на другие ПАМС, в том числе ряд агонистов TLR2.

Пример 6:

Чтобы определить, является ли благоприятный синергетический эффект инулиновых частиц общим для других ПАМС активаторов врожденной иммунной системы, женские линии BALB/C мышей в возрасте 6-8 недель (п=5-10 на группу) иммунизировали внутримышечно дважды через 14 дней 1 мкг рекомбинантного дрожжевого поверхностного антигена гепатита В (HBsAg), в сочетании либо с TLR2 агонистом PamCSK4 0,1 мкг/мышь, TLR3 агонистом Poly (I:С) 25 мкг/мышь, синтетическим агонистом TLR4 MPLA, агонистом TLR5 флагеллином, агонистом TLR6 MALP-2 0.04 мкг/мышь, TLR7 агонистом polyU 2.5 мкг/мышь или TLR9 агонистом CpG2006 20 мкг/мышь, с или без 1 мг PDmix (1:3). У мышей брали кровь через 42 дня после второй иммунизации и анти-HBsAg антитела измеряли с помощью ELISA. (Рис.7). Группы, получающие HBsAg плюс каждый из ПАМС в активаторов врожденной иммунной системы только имели низкий или неизмеримый анти-HBsAg общий IgG, IgG1, IgG2a и IgM. В противоположность этому, группы, получавшие каждый из иммунных активаторов ПАМС плюс PDmix показали заметное улучшение в уровне анти-HBsAg общего IgG реакции в соответствии с синергическим эффектом между частицами инулина и ПАМС активатором врожденной иммунной системы

Пример 7:

BALB/С мышей в возрасте 6-8 недель (п=5-8/group) иммунизировали внутримышечно дважды через 21 дней 50 мкл вакцины, содержащей между 3 нг и 3 мкг рекомбинантного гемагглютинина гриппа серотипа Н5 (RH5) (Protein Sciences Corp, Meriden, USA) плюс либо dIN 1 мг или dIN 1 мг CpG2006 5 мкг. У мышей брали кровь через 14 дней после второй иммунизации и антитела против рекомбинантного Н5 измеряли с помощью ELISA (рис.8). Результаты показали, что в сочетании с dIN 1 мг плюс 5 мкг CpG2006 только 10 нг RH5 индуцировала более высокий ответ IgG, чем только 3 мкг RH5, что эквивалентно более чем 300-кратному антиген сберегающему эффекту. Антиген сберегающий эффект был еще более сильным для ответов IgG2a, IgG2b и IgM, где RH5 3 нг в сочетании с dIN 1 мг плюс CpG2006 5 мкг вызывал высокий ответ IgG2a чем только 3 мкг RH5, что эквивалентно более чем 3000-кратного антиген сберегающему эффекту.

Пример 8:

Самки BALB/С мышей 22 месяцев от роду были иммунизированы внутримышечно дважды за 2 недели 0.1 мкг инактивированной РК8 гриппа H1N1 вакцины отдельно или в сочетании с dIN 1 мг или dIN 1 мг плюс CpG2006 10ug. Дополнительные контрольные группы получали только физиологический раствор или dIN, или dIN с CpG. Все мыши были затем заражены интраназально через 5 недель после второй иммунизации летальной дозой вируса PR8 (20xLD50). (Рис.9а). Все контрольные пожилые мыши, иммунизированные физиологическим раствором или только адъювантами, а также иммунизированные вакциной PR8 без адъюванта похудели и умерли. Мыши, иммунизированные вакциной PR8 плюс dIN, по-прежнему заболели и потеряли вес, но затем восстановились. В отличие от этого пожилые мыши, которые получили вакцину PR8 плюс сочетание dIN частиц с CpG2006 не заболели, не похудели и не умерли в результате того, что комбинация инулиновых частиц с агонистом TLR9 имела синергетический эффект, проявляемый в восстановлении способности престарелой иммунной системы реагировать на вакцины и тем самым получать полную защиту от клинической инфекции гриппа. Чтобы продемонстрировать, что усиление защиты от вируса РК8 не было связано с компонентом CpG самим по себе, самки BALB/с мышей в возрасте 6-8 недель иммунизировались внутримышечно инактивированным PR8 антигеном вируса гриппа вместе с физиологическим раствором, CpG2006, или комбинации dIN 1 мг и CpG 10 мкг на нулевой и третьей неделе, и мышей на седьмую неделю заразили летальной дозой вируса гриппа PR8 H1N1. (Рис.9В). Только мыши, иммунизированные PR8 плюс сочетание dIN и CpG выжили в то время как мыши, иммунизированные PR8 плюс CpG все умерли, в соответствии с чем защита их происходит только при комбинированном присутствии частиц инулина и агониста TLR9 в момент иммунизации.

Пример 9:

Кастрированные хорьки (Mustelaputoriousfuro, Triple F Farms, Sanger, PA) в возрасте 11-14 недель, весом от 0,7 до 1,9 кг содержались в течение четырнадцати дней для акклиматизации и карантина. Хорьки были серонегативными для циркулирующих в настоящее время гриппов А H1 и Н3, вируса гриппа В, и для Н5 антигена. H5N1 A/Vietnam/1203/2004 моновалентная субвирионная вакцина против гриппа: инвентарный номер репозитория Fisher- CLAG-1170 (лот № U007827) был получен из хранилища NIAID и хранился при 2 до 8°C. Вакцину при первой вакцинации вводили путем внутримышечной (IM) инъекции в одну нижнюю конечность, и в другую - при второй вакцинации, в объеме 0,5 мл. Контрольные животные получали либо только адъювант, либо равный объем буферного физиологического раствора. Были использованы две формы инулинового адъюванта, лот № VAX-SPL-0910-03 (dIN инулин 50 мг/мл в бикарбонатном буфере, далее именуемый adl) и Лот № VAX-SPL-0910-04 (dIN инулин 50 мг/мл в бикарбонатном буфере смешанном с CpG2006 до концентрации 0.3 mg/ml, далее именуемый Ad2). Доза 250 мкл на хорька каждой из этих композиций смешивалась с антигеном H5N1 до иммунизации каждого хорька. Таким образом, хорьки получали адъювантной дозу 10 мг dIN, если были случайно выбраны для получения Ad1 и адъювантную дозу 10 мг dIN+75 мкг CpG2006, если случайно были выбраны для получения Ad2. CpG2006 имел последовательность 5-TCGTCGTTTTGTCGTTTTGTCGTT с полным фосфортиоатным остовом и был приобретен у Geneworks Pty Ltd, Adelaide, Australia. Адъювант хранили при 2-8°C и сочетали с вакциной непосредственно перед использованием. Вирус гриппа A/Vietnam/1203/2004 (H5N1) (VN/1203) получали из Центров по контролю и профилактике заболеваний (CDC). Животные были распределены по группам с использованием стратифицированной (по массе тела) процедуры рандомизации с помощью компьютеризированной системы сбора данных (например, Path-Токе; Xybion, Cedar Knolls, NJ). В общей сложности 49 хорьков были распределены среди десяти групп; четыре группы по 7 хорьков каждая получили адъювантную вакцину дважды через 21 день между иммунизациями: 7,5 мкг вакцины + Ad1; 7,5 мкг вакцины + Ad2; 22,5 мкг + Ad1; 22,5 мкг вакцины + Ad2. Две группы по 3 хорька каждая получили вакцину дважды без адъюванта: 22,5 мкг без адъюванта, 7,5 мкг без адъюванта. Три контрольные группы из трех хорьков каждая получили дважды: физиологический раствор + Ad1; физиологический раствор + Ad2; физиологический раствор + физиологический раствор. Еще одна группа из 6 хорьков получила 22,5 мкг вакцины + Ad2 только один раз в момент прайминга других групп. Хорьки были заражены через три недели после буст-дозы вакцины или шесть недель после прайм дозы в группе, вакцинированной только один раз. Для процедуры заражения, после анестезии введением внутримышечно кетамина (20 мг/кг) и ксилазина (4 мг/кг), 106 EID50 (106 инфицирующих эмбрион доз/50%) VN/1203 закапывали по 500 мкл в каждую ноздрю, и разбавленный патоген культивировали, чтобы обеспечить надежность инфекции. Носовые промывные жидкости собирали введением в каждую ноздрю по 1,0 мл физиологического раствора, содержащего 1% бычьего сывороточного альбумина, 100 единиц пенициллина/мл, стрептомицин 100 мкг/мл, и амфотерицин В 0,25 мкг/мл. Цельная кровь для полного анализа крови была получена пункцией верхней полой вены на 4-й день после заражения. Два раза в день записывались наблюдения относительно глазных выделений, выделений из носа, чихания, кашля, характеристики стула и оценки активности. Гибнущие животные были определены любым из следующих критериев: температура менее 33,3°C, потеря веса >25%, безразличие к касанию, членовредительство, паралич, двигательные расстройства, или дыхательная недостаточность. Образцы из верхних дыхательных путей, полученные в течение жизни: носовые смывы получали через 2 и 4 дня после вирусного заражения, мазки из горла были получены через 1, 2, 3, 4 и 6, дней после заражения. В тканях, собранных при вскрытии, вирус гриппа культивировали от смывной жидкости хвостовой доли легкого и от четырех 250 мг фрагментов гомогенизатов (TissueLyser, QIAGEN, Valencia, СА) легких, мозга, селезенки, трахеобронхиальных лимфатических узлов, а также двух колец трахеи. Сыворотку собирали пункцией полой вены в день первой вакцинации и на 14, 21 и 28 день после первой вакцинации; день 14 после вакцинации соответствует дню - 28 до заражения, и день 28 после вакцинации соответствует дню - 14 до заражения. Образцы сыворотки были инактивированы рецептор-разрушающим ферментом (Denka-Seiken, Tokio, Japan) при 37°C в течение 16-20 часов с последующей тепловой инактивацией при 56°C в течение 30 минут. Ингибирование гемагглютинации (HI) проводили с использованием лошадиных эритроцитов. Титры нейтрализующих антител измеряли микронейтрализационным анализом (MN). Сто инфицирующих культуру ткани доз 50 (100 TCID 50) вируса VN/1203 смешивали с равными объемами серийных разведений сыворотки в четырех повторениях, инкубировали в течение 1 часа при 37°C и 100 мкл смеси добавляли к предварительно промытому монослою из MDCK клеток в 96-луночных планшетах. Планшеты инкубировали в течение 3 дней, и цитопатический эффект (СРЕ) визуально оценивали с помощью инвертированного микроскопа. Самый высокий титр сыворотки, обеспечивающий защиту более половины лунок, был принят в качестве защитного титра антител. Геометрические средние титров приведены, и отрицательный титр обозначен как 10. Легочная ткань и мозг с обонятельными луковицами были собраны при вскрытии умирающих хорьков в дни 6-8 после заражения, и у хорьков без симптомов на 14 день после заражения. После фиксации в формалине, стандартизированные срезы были сделаны для гистопатологии с левой краниальной, правой средней и правой хвостовой долей легких. Статистический анализ проводили с использованием GraphPad Prism (версия 5.03, GraphPad Software, Inc La Jolla, СА). Антительный ответ в сыворотке анализировали с помощью анализа вариации (ANOVA) с помощью пост-тестовой коррекции Бонферрони. Выживаемость была измерена через логарифмический ранговый критерий (Log-Rank test). Морбидность за счет увеличения оценки активности была проанализирована с помощью точного критерия Фишера. Вирусная нагрузка была определена как различающаяся с помощью ANOVA с повторным измерением.

Хорьки, иммунизированные сплит-вирионной вакциной H5N1 без адъюванта, независимо от дозы вакцины, не имели нейтрализующих антител H5N1 до заражения. Хорьки, получившие две дозы вакцины H5N1 с AD1, или Ad2, все продемонстрировали наличие нейтрализующих антител до заражения и через 21 день после прайминговой дозы, реципиенты Ad2-адъювантной вакцины имели значительно более высокие уровни нейтрализующих антител в сыворотке, чем группы Ad1 (р<0,03, Log Rank-sum test), как результат комбинации инулиновых частиц плюс ПАМС активатора врожденной иммунной системы (CPG), обеспечивающей повышенную иммунную реакцию (рис.10). Контрольные животные все умерли после заражения, из животных, вакцинированных двумя дозами только антигена погибли около 30%, и смертности не наблюдалось у животных, вакцинированных антигеном в сочетании с любой Ad1 или Ad2 (рис.11). Получатели двух доз вакцины без адъюванта потеряли более, чем 15% от массы тела на 5-й день после иммунизации (pi), и четверым выжившим удалось восстановить потерю веса. Группы, привитые двумя дозами антигена с Ad1 потеряли 5% от массы тела, затем восстановились, группы вакцинированные двумя дозами антигена с Ad2 не теряли веса в соответствии с улучшенной иммунной защитой, когда антиген H5N1 был формулирован с сочетанием инулиновых частицы и ПАМС-активатора врожденной иммунной системы (рис.12). Аналогичным образом, хотя 4 хорька в Ad1-адъювантных группах вакцин продемонстрировали лихорадку, не было хорьков в Ad2-адъювантной группе испытывавших лихорадку, в соответствии с синергетическим защитным эффектом от комбинации частиц инулина и ПАМС активатора врожденной иммунной системы (рис.13). У животных, вакцинированных Ad2, в мазке из горла, взятом в дни 2, 3, и 4 pi титры вируса гриппа были значительно ниже, чем у животных, получивших только антиген (Mann-Whitney, р=0,0018), тогда как титры у вакцинированных с помощью Ad1 существенно не отличались от титров тех, кто получил только вакцину. Получатели одной дозы вакцины с Ad2 не имели существенной разницы в вирусной нагрузке на день 2-4 pi по сравнению с группами, иммунизированными двумя дозами только антигена. Таким образом, комбинация препарата инулиновых частиц (dIN) с ПАМС активатором врожденной иммунной системы (CpG2006) синергически усиливает реакцию антитела на совместно вводимый антиген и обеспечивает усиленную защиту против летальной инфекции H5N1, даже после всего одной иммунизации. В ходе аналогичных исследований у мышей было показано, что одна доза вакцины с PR8 антигеном была достаточной для полной защиты мышей против смертельной PR8 инфекции, и такая защита может быть получена путем иммунизации мышей одной дозой в 5 мкг PR8 в сочетании с dIN и CpG2006 (10 мкг), в то время как иммунизация PR8 с одной составляющей композиции или в одиночку давала лишь частичную защиту, или никакую, соответственно.

Пример 10:

Чтобы проверить, является ли синергетический эффект инулиновых частиц в сочетании с ПАМС активатором врожденной иммунной системы исключительно особенностью dIN, или это свойство разделяют и другие полиморфные формы инулиновых частиц, взрослые линии BALB/С мышей, иммунизировали внутримышечно дважды, через 21 день, вводя HBsAg вместе с gIN, dIN или eIN инулиновыми частицами вместе с TLR9 ПАМС, CpG2006. У мышей брали кровь через 14 дней после второй иммунизации и измеряли антитела против гриппа методом ELISA (Рис.14). gIN, dIN или eIN имели синергетический усиливающий эффект с CpG в индукции анти-HBsAg IgG1, IgG2a и IgM, в соответствии с чем синергический эффект с ПАМС активаторами врожденной иммунной системы является общей особенностью различных полиморфных форм инулиновых частиц.

Пример 11:

Чтобы определить, распространяются ли синергетические эффекты частиц инулина и ПАМС не только на модели небольших животных, но и на модели крупных млекопитающих, группы из стандартно разведенных самок лошадей (п=3/группу), 4-8 летнего возраста и серо-отрицательных к JEV, иммунизировали вакциной японского энцефалита (JE) путем подкожной инъекции в область шеи. Выращенная в культуре клеток Веро (VERO), инактивированная вакцина JE (ccJE; Beijing-1 штамм) (Toriniwa& Komiya, 2008) полученная из института Kitasato, Japan. Вакцина вводилась в дозе 6 мкг, самостоятельно или вместе с dIN инулиновыми частицами (20 мг/доза) или dIN формулированные инулиновые частицы (40 mg/dose) плюс CpG7909 (200ug/dose) в общем объеме инъекции 1 мл. Лошади повторно иммунизировались второй дозой вакцины после 5-недель, и сыворотки собирались через 5 недель после первой и второй иммунизации. Теста нейтрализации по 50% снижению бляшек (PRNT50) проводился путем инкубации ~400 PFU JEV, штамм Nakayama, MVEV (MVE-1-51), или WNV (MRM61C штамм Kunjin) в ПО мкл HBSS-BSA с серийными 2-кратными разбавлениями антисыворотки в том же буфере в 96-луночном лотке при 37°C в течение 1 часа. Дубликатные 0,1 мл аликвоты анализировали на инфекционный вирус, по бляшкам на монослое клеток VERO выращенным в 6-луночных лотках для тканевых культур. Процент уменьшения бляшек был рассчитан по отношению к вирусным контролям, инкубированным с наивными сыворотками из того же штамма мыши. PRNT50 титры приведены в качестве обратных эквивалентов разведений сыворотки, в результате которых наблюдалось ≥50% снижение количества бляшек. Сравнение PRNT50 титров против JEV после 2 доз вакцины показали, что когда ccJE были формулированы только о с инулиновыми частицами, ответы нейтрализующих антител увеличивались в ~4-кратном размере по отношению к стандартной ccJE группе. Однако совместное введение с ccJE антигена и частиц инулина с CpG7909 привело к дополнительному 2-3 кратному увеличению титра JEV нейтрализующих антител (табл.1). Примечательно, что все лошади, получающие ccJE с частицами инулина плюс CpG достигли серопротективного титра антител (PRNT50>10) после всего одной дозы. Сочетание инулиновых частиц с агонистом TLR9 также привело к самому высокому уровню кросс-нейтрализующих антител против WNV и MVEV, указывая, что эта комбинация является особенно благоприятной для индукции кросс-нейтрализующих антител против других штаммов вируса или даже полностью других вирусов.

Пример 12:

Противовоспалительные эффекты инулиновых частиц могут быть удобно измерены в тесте с использованием цельной человеческой крови, либо очищенных человеческих мононуклеарных клеток периферической крови (РВМС) или в качестве альтернативы, если предпочтительнее мыши или другие мелкие виды, с использованием очищенных спленоцитов, или, если животное больше, например, кролика, по аналогии используя их цельную кровь или очищенные мононуклеарные клетки периферической крови. Таким образом, серии титрованных частиц инулина, уменьшающихся концентраций, от 1 mg/ml вплоть до 1 ng/ml добавляют к клеткам в многолуночную плашку, которую затем инкубировали при 37°C, или соответственно температуре тела видов, из которых были получены клетки. Измерение путем определения концентрации цитокина IL-1 является особенно предпочтительным. Измерение может быть сделано после от 4 до 24 часов, если экспрессия генов цитокинов измеряется через real-time ПЦР или приблизительно между 24 и 72 часами, если измеряется продукция белков цитокинов, например, посредством ELISA. В этом примере РВМС человека получали из крови 3 здоровых взрослых людей и инкубировали с 100 мкг/мл dIN частиц в течение 5 часов, после чего РНК экстрагировали с помощью TRIZOL, а затем ввели в систему полногеномного секвенирования (Illumina). Для сравнения контрольные РВМС из тех же субъектов инкубировали с про-воспалительным ПАМС в том числе Poly (I:С) и LPS. Как и ожидалось, средние величины экспрессии генов IL-1α и IL-1β РВМС от трех человеческих субъектов были увеличены в среднем на 4,1 и 4,4 раза после инкубации РВМС с Poly (I:С) или LPS, соответственно, по сравнению с РВМС, инкубированными в отсутствие агониста ПАМС. Напротив, экспрессия гена IL1β была снижена в 2,88 раза, и экспрессия гена IL1β в 2,17 раза в РВМС, культивируемых с dIN частицами 100 мкг/мл по сравнению с РВМС, инкубированными в одиночку. dIN частицы также подавляют экспрессию гена рецептора IL1, а именно IL1RAP который был в 1,46 раза подавлен в присутствии инулиновых частиц. Кроме того, дополнительно подчеркивая их противовоспалительное действие, dIN частицы привели к повышению активности генов, антагонистов про-воспалительного действия IL-1, включая IL1F5 (повышение активации в 1,49 раза), IL1R2 (повышение в 1,11 раз), и IL1RN (повышение в 2,9 раза). Далее был рассмотрен эффект комбинации dIN частиц и TLR9 агониста ПАМС, CpG. В присутствии dIN частиц плюс CpG, экспрессии генов IL1α и IL1β оставались подавленными по сравнению с экспрессией в нестимулированных РВМС, но что интересно, в присутствии комбинации dIN и CpG экспрессии генов антагонистов IL1 были еще более значительно повышены чем в присутствии только dIN. Поэтому с комбинированной стимуляцией влияние на гены, которые являются антагонистами про-воспалительного действия IL-1, включая IL1F5 (только dIN против dIN+CPG давало активации 1.9 против 1.49 раз соответственно), IL1R2 (1,35 раз против 1,11 раз), и IL1RN (3.47 раз против 2,94 раз). Таким образом, даже более удивительно, что сочетание инулиновых частиц с TLR9 агонистом ПАМС привело к еще большему повышению противовоспалительных свойств инулиновых частиц по сравнению с их активностью без ПАМС. В тех же образцах экспрессии генов связанных с противовоспалительными механизмами последовательно повышены. Таким образом, противовоспалительные ген, PPARG, последовательно подавляется в РВМС инкубированном с PAMCSK, Poly (I:C), LPS и всеми другими испытанными агонистами TLR, но был активирован в среднем в 1,24 раза, когда РВМС из трех человеческих субъектов инкубировали с dIN частицами. Соответствующие результаты были получены по уровням белков тех же генов и связанных с ними про-воспалительных маркеров, измеренных в РВМС человека после 24-48 часов инкубации с ПАМС или инулиновыми частицами, где уровни белков измерялись по цитокинному ELISA или вестерн-блоттингом. Результаты показали, что экспрессия воспалительных цитокинов, включая IL-1, ПАМС-стимулированными РВМС человека инкубированных с целыми живым или инактивированным вирусом (JEV) или очищенными ПАМС, снижается в присутствии инулиновых частиц в культурах РВМС. gIN и eIN частицы показали одинаковые эффекты с dIN в отношении их способности ингибировать IL-1 ген и экспрессию белка и повышать экспрессию противовоспалительных членов пути IL1 и PPAR γ, делая это общим свойством всех испытанных инулиновых частиц.

В рамках H1N1 2009 исследования вакцины против пандемического гриппа человека, dIN вводили субъекту человеку в дозе 20 мг на одну иммунизацию в сочетании с антигеном - рекомбинантным гемагглютинином H1N1 2009 (rHA). Частота головных болей была значительно ниже (р<0,05 точный критерий Фишера) в субъектах, получающих адъювант Advax™ (4/137:2,9%), по сравнению с получившими только rHA (15/137: 10,9%). После второй иммунизации снова была тенденция (р=0,06) меньших послеиммунизационных головных болей в группах, получавших адъювант Advax™ (2/135: 1,5%) по сравнению с получившими только rHA (8/137: 5,8%). Снижение частоты головных болей объясним о способностью инулиновых частиц вызывать снижение IL-1, так как IL-1 в сыворотке крови увеличен при кластерных болях(мигрень) и полиморфизмы гена IL-1 (3953 С / Т) связаны с мигренью (Martelletti др.., 1993;. Rainero et al., 2002). Это указывает на то, что в проверенной адъювантно-эффективной дозировке в организме человека инулиновые частицы также имеют противовоспалительное действие.

Пример 13:

Чтобы определить, проявляется ли благоприятный синергетический эффект инулиновых частиц с некоторыми другими ПАМС активаторами врожденной иммунной системы, самок мышей линии BALB/С в возрасте 6-8 недель (п=5-10 на группу) иммунизировали внутримышечно дважды через 14 дней 1 мкг рекомбинантного дрожжевого поверхностного антигена гепатита В (HBsAg), который находился в сочетании либо с TLR2 агонистом PamCSK4 0,1 мкг/мышь, с TLR3 агонистом Poly (I:С) 25 мкг/мышь, с синтетическим агонистом TLR4 MPLA, с агонистом TLR5 флагеллином, с агонистом TLR6 MALP-2 0.04 мкг/мышь, с TLR7 агонистом полиУ 2.5 мкг/мышь, или с TLR9 агонистом CpG2006 20 мкг/мышь, вместе, или без 1 мг PDmix (1:3). У мышей брали кровь через 42 дня после второй иммунизации, и анти-HBsAg антитела измеряли с помощью ELISA. Группы, получающие HBsAg плюс один из ПАМС активаторов врожденной иммунной системы имели низкие анти-HBsAg общие IgG, IgG1, IgG2a и IgM. В противоположность этому, группы, получавшие каждый из иммунных активаторов ПАМС плюс PDmix показали заметное улучшение в уровне анти-HBsAg общего IgG в соответствии с синергическим эффектом между частицами инулина и испытанными ПАМС-активаторами врожденной иммунной системы

В данном описании слово "содержат" или его вариации, такие как "содержит" или "содержащий", следует понимать как предполагаемое включение указанного элемента, целого или стадии, или группы элементов, целых чисел или стадий, но не исключение любого другого элемента, целого или стадии, или группы элементов, целых или стадий.

Все публикации, упомянутые в этом описании, включены в виде ссылки. Любое обсуждение документов, акты, материалы, приспособления, изделия и т.п., которые были включены в настоящее описание, предназначены исключительно для контекста настоящего изобретения. Это не следует рассматривать как допущение, что любой или все из этих вопросов являются частью предшествующего уровня техники или были общеизвестными знаниями в области, относящейся к настоящему изобретению, как она существовала в США или в другом месте до даты приоритета каждого пункта формулы изобретения.

Следует иметь в виду специалистам в данной области техники, что различные изменения и/или модификации могут быть сделаны с изобретением, как показано в конкретных вариантах без отхода от сущности, или объема изобретения в широком смысле. Настоящие варианты осуществления, таким образом, должны рассматриваться, во всех отношениях, как иллюстративные, а не ограничительные.

ССЫЛКИ

Bilkei-Gorzo, A, Food Chem Toxicol 31(5):357-361 (1993).

Cooper, PD and M Carter,. Mol Immunol 23(8):895-901 (1986).

Cooper, PD and EJ Steele, Immunol Cell Biol 66:345-352 (1988).

Cooper, PD and EJ Steele, Vaccine 9:351-357 (1991).

Crapper, DRetal.,. Science 180(85):511-513 (1973).

Garruto, RM et al., Acta Neuropathol 78(2):210-219 (1989).

Kawahara, M et al., Brain Res Bull 55(2):211-217 (2001).

Petrik, MS et al., Neuromolecular Medicine 9(1):83-100 (2007).

Phelps, CF, Biochem J, 95:41-47 (1965).

Verroust, PJ et al., Kidney Int 6:157-169 (1974).

Gordon et al., Safety, Journal of Infectious Disease, 171, pp.1576-1585, (1995)

Tong NK, Beran J, Kee SA et al. Kidney Int. 2005 Nov; 68(5):2298-303.

Matzinger P. Science. 2002 Apr 12; 296(5566):301-5.

Petrovsky N, Aguilar JC Immunol Cell Biol. 2004 Oct; 82(5):488-96.

Israeli E, et al. Clin Rev Allergy Immunol. 2010 Sep 30.

Bondy SC. Neurotoxicology. 2010 Sep; 31(5):575-81.

Durando P, Icardi G, Ansaldi F.Expert Opin Biol Ther. 2010 Apr; 10(4):639-51.

Prince GA, Jenson AB, Hemming VG, et al. J Virol. 1986 Mar; 57(3):721-8.

Heine H, Ulmer AJ. Chem Immunol Allergy. 2005; 86:99-119.

Werling D, Jungi TW. Vet Immunol Immunopathol. 2003 Jan 10; 91(1):1-12.

Eisenbarth SC, Colegio OR, O'Connor W, et al. Nature. 2008 Jun 19; 453(7198):1122-6.

Kandimalla ER, Struthers M, Bert AJ, et al. Cell Immunol. 2011 Apr 22.

Schasfoort, Richard В M (Editor) and Tudos Anna J (Editor) (2008). Handbook of Surface Plasmon Resonance. RSC publishing. ISBN 978-0-85404-267-8.

Douglas Hughes.; Jae Choi, Megan Dobbs, et al: at http://www.piercenet.com/previews/2012-articles/secreted-dual-luciferase-reporter-assays/

Buckner D, Wilson S, Kurk S, et al. J Biomol Screen. 2006 Sep; 11(6):664-71.

Kasturi SP, Skountzou I, Albrecht RA, et al. Nature. 2011 Feb 24; 470(7335):543-7.

Querec T, Bennouna S, Alkan S, et al. J Exp Med. 2006 Feb 20; 203(2):413-24.

Martelletti P, Granata M, Giacovazzo M., Cephalalgia 1993 Oct; 13(5):343-5

Rainero I, Pinessi L, Salani G, Valfre W, Rivoiro C, Savi L, et al., Headache 2002 May; 42(5):337-40.

1. Композиция для снижения или ингибирования воспаления, включая вызванного инфекцией, или для лечения или профилактики воспалительного или инфекционного заболевания, содержащая:

(A) инулиновые частицы;

(B) антиген; и

(C) искусственную или очищенную патоген-ассоциированную молекулярную структуру (ПАМС), представляющую собой агонист Toll-подобных рецепторов (TLR).

2. Композиция по п. 1, в которой ПАМС, представляющее собой агонист Toll-подобных рецепторов (TLR), содержит или состоит из вещества, выбранного из группы, состоящей из РНК, ДНК, CpG олигонуклеотида и неметилированной полинуклеотидной молекулы.

3. Композиция по любому из пп. 1 или 2, в которой инулиновая частица содержит или состоит из инулина, который выбран из одного или более из гамма-инулина, дельта-инулина и эпсилон-инулина.

4. Композиция по любому из пп. 1 или 2, в которой инулиновые частицы находятся в комплексе с фосфатом алюминия или гидроксидом алюминия.

5. Способ изготовления вакцины, включающий стадию объединения ингредиентов (А), (В) и (С) композиции по любому из пп. 1-4, тем самым получая вакцинную композицию.

6. Способ по п. 5, в котором инулиновые частицы находятся в комплексе с фосфатом алюминия или гидроксидом алюминия.



 

Похожие патенты:

В настоящем изобретении описывается соединение формулы I или его фармацевтически приемлемая соль или стереоизомер, где значения R1-R5 определены в формуле изобретения, которое является ингибитором JAK.

Изобретение относится к области органической химии, а именно к гетероциклическому соединению формулы I или к его фармацевтически приемлемой соли, где А представляет собой пиридил, замещенный одним или двумя А'; каждый А' независимо представляет собой С1-6 алкил, С1-6 алкокси, С1-6 галоалкил, пирролидинил, пиперидинил, возможно замещенный одним или двумя С1-6 алкилами; n представляет собой 0 или 1; В представляет собой фенил; каждый R независимо представляет собой -C(=O)R1, -C(=O)OR1 или -C(=O)NHR1; R1 представляет собой Н или R1'; R1' представляет собой С1-6 алкил, фенил, индолил, индазолил, пиридинил С1-6 алкил или морфолинил, возможно замещенный одним или двумя ; каждый представляет собой гидрокси, С1-6 алкил, С1-6 алкокси, карбокси или оксо.

Изобретение относится к новому соединению формулы I или его фармацевтически приемлемой соли или стереоизомеру, которые обладают свойствами ингибитора PI3K-альфа и относительной селективностью в отношении PI3K-дельта-опосредованного заболевания или болезненного состояния, выбранного из артрита, астмы и обструктивных заболеваний верхних дыхательных путей, аутоиммунных заболеваний или нарушений и онкологического заболевания.

Изобретение относится к соединениям формулы (I) и их фармацевтически приемлемым солям и стереоизомерам, которые являются ингибиторами IRAK. В формуле (I) R1 и R3 каждый независимо друг от друга означают Н, (CH2)pCON(R5)2, OA, Hal, СООН, СООА, (CH2)pNHCOA, (CH2)PHet1, (CH2)pNR2R5 или ОН; R2 означает Н или линейный или разветвленный алкил с 1, 2 или 3 атомами углерода; R4 означает Н или А; R5 означает Н или линейный или разветвленный алкил с 1, 2 или 3 атомами углерода; Z отсутствует или означает Ar-диил или Het-диил; L означает (СН2)n, где одна или две группы СН2 могут быть заменены посредством О и/или группы СН=СН и/или где один или два Н атома могут быть заменены посредством OR2 или NR2R5; Ar-диил означает 1,2-, 1,3- или 1,4-фенилен, необязательно замещенный посредством от 1 до 5 групп, независимо выбранных из Hal, ОН, О-A, Het2 и/или А; Het-диил означает ненасыщенный, насыщенный или ароматический 5- или 6-членный гетероцикл, имеющий от 1 до 2 атомов N, О и/или S, который может быть незамещенным или моно-, ди- или тризамещенным посредством О-А и/или А; А означает неразветвленный или разветвленный алкил, имеющий от 1 до 10 атомов углерода, в котором одна или две несмежных СН2 группы могут быть заменены посредством О; Het1 означает морфолинил; Het2 означает морфолинил; Hal означает F, Cl, Br, I; n означает 1, 2, 3, 4, 5 или 6; р означает 0, 1 или 2.

Изобретение относится к новым соединениям 2,4-пиримидиндиамина формулы (I) .Технический результат: получены новые соединения, которые могут применяться в лечении аутоиммунных заболеваний.

Группа изобретений относится к области медицины, а именно к фармакологии и иммунологии, и предназначена для лечения субъекта, имеющего аутоиммунное заболевание. Для лечения субъекта, имеющего аутоиммунное заболевание, указанному субъекту вводят терапевтически эффективное количество водного фармацевтического состава, включающего адалимумаб в концентрации, равной по меньшей мере 50 мг/мл, и воду.

Группа изобретений относится к медицине и касается терапевтической композиции для уменьшения воспаления ткани, содержащей полипептид гистидил-тРНК-синтетазы (HRS) длиной 500-506 аминокислот, который состоит из SEQ ID NO:70 (HRS(1-506)) или отличается от SEQ ID NO: 70 делецией и/или консервативной заменой 1-6 аминокислот и не содержит остатков 507-509 SEQ ID NO:1, где: a) полипептид HRS является по меньшей мере на 95% чистым, b) полипептид HRS является менее чем на 5% агрегированным и c) композиция имеет уровни эндотоксинов менее чем 10 ЕЭ/мг белка.

Изобретение относится к ветеринарии, в частности к ветеринарной фармакологии, может быть использовано для коррекции антиоксидантного статуса новорожденных телят, а также для профилактики заболеваний неинфекционной этиологии.

Изобретение относится к группе соединений формулы (I), содержащих хроменовое ядро, где R1 выбран из водорода и замещенного или незамещенного C1-С6 алкила; R2 и R3 независимо выбраны из водорода и замещенного или незамещенного C1-C6 алкила; или R2 и R3 вместе с атомом азота, с которым они связаны, образуют замещенный или незамещенный гетероцикл, где гетероцикл представляет собой стабильный моноциклический или бициклический радикал, содержащий от 3 до 15 членов, который является ненасыщенным, насыщенным или частично насыщенным и который состоит из атомов углерода и по меньшей мере одного гетероатома, выбранного из следующей группы: азот, кислород или сера; R4 представляет собой галоген; каждый C1-C6 алкил необязательно и независимо замещен одним или более заместителями, выбранными из галогена, гидроксила, карбоксила, карбонила, циано, нитро, меркапто, С3-С6 циклоалкила и NR'R'', где R' и R'' независимо выбраны из Н и незамещенного C1-C4 алкила; каждый С3-С6 циклоалкил и гетероцикл необязательно и независимо замещен одним или более заместителями, выбранными из галогена, гидроксила, карбоксила, карбонила, циано,амино, нитро, меркапто и незамещенного С1-С4 алкила; или их фармацевтически приемлемым солям, при условии, что соединение формулы (I) не представляет собой 1-((4-(4-фторфенил)-6-метокси-2Н-хромен-3-ил)метил)пирролидин, и способу их получения.

Настоящее изобретение относится к новому соединению формулы I, или его фармацевтически приемлемой соли, или стереоизомеру, которые обладают свойствами ингибитора PI3K-альфа и относительной селективностью в отношении PI3K-дельта.

Изобретение относится к медицине, а именно к ревматологии, и может быть использовано для лечения ревматоидного артрита (РА). Для этого пациенту вводят эффективное количество антитела и метотрексата, где указанное антитело включает вариабельный участок тяжелой цепи последовательности SEQ ID NO: 2 и вариабельный участок легкой цепи последовательности SEQ ID NO: 3 и указанное антитело вводят в дозе от 100 мг до 200 мг раз в две недели и где указанного пациента ранее лечили от ревматоидного артрита путем введения метотрексата и ранее неэффективно лечили от РА путем введения антагониста TNF-α, выбранного из группы, состоящей из этанерцепта, инфликсимаба, адалимумаба, голимумаба и/или сертолизумаба пегол.

Изобретение относится к фармацевтической промышленности, а именно к стабильной фармацевтической композиции на основе этанерцепта. Стабильная фармацевтическая композиция содержит этанерцепт, фосфатно-цитратный буфер и глицин в качестве средства, препятствующего агрегации, взятые в определенном соотношении.

Настоящее изобретение относится к иммунологии. Предложено антитело, способное связывать рецептор пролактина (PRLR).

Настоящее изобретение относится к иммунологии. Предложено антитело, способное связывать рецептор пролактина (PRLR).

Изобретение относится к области биохимии, в частности к применению антитела, специфичного к CD19 и флударабина для получения синергетической комбинации для лечения неходжкинской лимфомы, хронического лимфоцитарного лейкоза и/или острого лимфобластного лейкоза.

Изобретение относится к области биотехнологии, конкретно к вакцинам, которые содержат антигены и адъювант, что может быть использовано в медицине. Рекомбинантным путем получают и отбирают адъювант из группы рекомбинантных лектинов омелы белой, не имеющей гликозилирования, который используют в вакцине, которую в свою очередь используют в качестве лекарственного средства и композиции.

Изобретение относится к области биотехнологии, конкретно к иммуногенным композициям гастрина-17, и может быть использовано в медицине для лечения заболеваний, связанных с патологией секреции гастрина.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его функциональный фрагмент, способные к связыванию с PD-1.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его функциональный фрагмент, способные к связыванию с PD-1.

Настоящее изобретение относится к области иммунологии. Предложены антитело и фрагмент антитела, способные к связыванию с человеческим IL-17A.

Группа изобретений относится к медицине и касается фармацевтической композиции для лечения аутоиммунных заболеваний человека, содержащей адалимумаб и структурный стабилизатор, выбранный из сахарозы и трегалозы. При этом указанная фармацевтическая композиция не содержит хлорида натрия. Группа изобретений также касается применения указанной фармацевтической композиции для получения лекарственного средства для лечения аутоиммунных заболеваний у людей. Группа изобретений обеспечивает высокую стабильность композиции адалимумаба. 3 н. и 10 з.п. ф-лы, 1 ил., 10 табл., 6 пр.

Группа изобретений относится к медицине, а именно к терапии и иммунологии, и касается лечения или профилактики воспаления. Для этого вводят композицию, содержащую инулиновые частицы, антиген и патоген-ассоциированную молекулярную структуру Toll-подобных рецепторов. Это обеспечивает эффективное лечение воспаления за счет синергетического усиления иммунного ответа компонентами композиции. 2 н. и 4 з.п ф-лы, 14 ил., 1 табл., 13 пр.

Наверх