Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов



Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
Локусы fad3 для выполнения операций и соответствующие связывающиеся со специфическими сайтами-мишенями белки, способные к вызову направленных разрывов
C12N15/8241 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2665811:

САНГАМО ТЕРАПЬЮТИКС, ИНК. (US)
ДАУ АГРОСАЙЕНСИЗ ЭлЭлСи (US)

Изобретение относится к области биохимии, в частности к способу интегрирования представляющей интерес последовательности нуклеиновой кислоты в ген FAD3 в клетке. Кроме того, раскрыта сайт-специфическая нуклеаза на основе цинковых пальцев для применения в модификации гена FAD3. Изобретение позволяет осуществлять интегрирование представляющей интерес последовательности нуклеиновой кислоты в ген FAD3 с высокой эффективностью. 2 н. и 6 з.п. ф-лы, 20 табл., 24 ил., 9 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

Настоящая заявка притязает на приоритет предварительной заявки на патент США № 61/697854, поданной 7 сентября 2012, описание которой включено таким образом посредством ссылки в ее полном объеме, и предварительной заявки на патент США № 61/820260, поданной 7 мая 2013, описание которой включено таким образом посредством ссылки в ее полном объеме.

ОБЛАСТЬ ТЕХНИКИ

Настоящее описание относится в целом к композициям и способам для применения в технологии рекомбинантных растений (например, для создания трансгенных растений). Конкретнее, настоящее описание относится к клеткам растений и растениям, включающим локусы в своих геномах, которые могут использоваться для сайт-специфического введения любой представляющей интерес нуклеиновой кислоты.

ПРЕДПОСЫЛКИ СОЗДАНИЯ ИЗОБРЕТЕНИЯ

Многие растения подвергают генетической трансформации с использованием экзогенных нуклеиновых кислот (например, трансгенов) для внесения желаемых признаков, например, для увеличения сельскохозяйственной ценности. Примеры увеличений сельскохозяйственной ценности, которые могут быть достигнуты посредством генетической трансформации, включают: увеличенную пищевую ценность, повышение урожайности, устойчивость к вредителям и болезням, устойчивость к засухе и стрессоустойчивость, улучшение плодоовощного качества (например, улучшение пигментации и/или роста), устойчивость к гербицидам, получение промышленно полезных соединений и/или материалов из растения и/или получение лекарственных средств. Введение клонированных генов в клетки растений и регенерация стабильных фертильных трансгенных растений могут использоваться для стабилизации генетической модификации растения на протяжении множества поколений и, тем самым, делают возможной генную инженерию культурного растения.

В способах генетической трансформации и получения трансгенных растений экзогенная ДНК, как правило, случайным образом вводится в ядерную или пластидную ДНК эукариотической клетки растения, с последующим выделением клеток, содержащих интегрированную экзогенную ДНК, и последующей регенерацией стабильно трансформированного растения. Трансгенные растения, как правило, создавали с помощью технологии трансформации с использованием Agrobacterium. Успехи, достигнутые с помощью этих способов, стимулировали развитие других методов введения представляющей интерес молекулы нуклеиновой кислоты интереса в геном растения, таких как ПЭГ-опосредованное внедрение ДНК в протопласты, бомбардировка микрочастицами и трансформация с использованием нитевидных кристаллов кремния.

Однако во всех этих способах трансформации растений экзогенные нуклеиновые кислоты, включаемые в геном растения, интегрируются случайным образом в геном клетки растения и в непредсказуемом числе копий. Terada et al. (2002) Nat Biotechnol 20 (10): 1030; Terada et al. (2007) Plant Physiol 144 (2): 846; D'Halluin et al. (2008) Plant Biotechnology J. 6 (1): 93. Например, трансгены часто интегрируются в виде повторов последовательности, либо всего трансгена, либо его частей. Такой сложный характер интеграции обычно оказывает отрицательное влияние на уровень экспрессии интегрированной нуклеиновой кислоты (например, в результате разрушения транскрибированной РНК через посттранскрипционные механизмы генного сайленсинга, или путем индукции метилирования интегрированной ДНК). Также расположение сайта интеграции обычно влияет на уровень экспрессии интегрированной нуклеиновой кислоты. Кроме того, интеграция экзогенной ДНК может оказывать разрушительный эффект на область генома, в которой происходит интеграция, и, таким образом, влиять или нарушить нормальное функционирование этой области-мишени с вызовом нежелательных побочных эффектов. Сочетание факторов, включая вышеуказанные, приводит к широкой вариации уровня экспрессии трансгена или экзогенной ДНК (и общей агрономической ценности) между различными трансгенными клетками растений и линиями растений, даже теми, которые созданы с помощью одних и тех же способов. Поскольку интеграция является случайной, эти эффекты не могут быть под контролем специалиста-практика, когда он или она пытается создать новое растение с желаемыми характеристиками.

Приведенные выше соображения делают неизбежным то, что, всякий раз, когда исследуются эффекты введения конкретной экзогенной нуклеиновой кислоты в растение, должно быть создано и проанализировано большое количество трансгенных линий растений с целью получения значимых результатов. Так же при создании трансгенного растения, содержащего конкретную интегрированную нуклеиновую кислоту, для обеспечения трансгенного растения с желаемым фенотипом большая популяция независимо созданных линий трансгенных растений должна быть создана, чтобы сделать возможным отбор линии растений с оптимальной экспрессией нуклеиновой кислоты, и с минимальными побочными эффектами на фенотип в целом и характеристики трансгенного растения или без этих эффектов. Эти практические соображения приобретают дополнительную важность в случае трансгенных растений, созданных в результате вставки множества экзогенных нуклеиновых кислот (т.е. стэкинга генов). В таких растениях, такие явления, как посттранскрипционный генный сайленсинг, могут быть усилены.

Было разработано несколько методов с целью контролирования введения трансгенов в растения. Смотрите, например, Kumar and Fladung (2001) Trends Plant Sci. 6: 155-159. Эти методы основаны на интеграции трансгенов на основе гомологичной рекомбинации, которая была успешно применена как в случае прокариот, так и в случае низших эукариот. Paszkowski et al. (1988) EMBO J. 7: 4021-6. Однако до недавнего времени, в случае растений, преобладающий механизм для интеграции трансгенов был основан на незаконной рекомбинации, которая предполагает небольшую гомологию между подвергающимися рекомбинации цепями ДНК. Следовательно, основной проблемой в этой области является обнаружение и избирательное порождение редких событий гомологичной рекомбинации, которые скрывают гораздо более эффективные события интеграции через незаконную рекомбинацию. Кроме того, даже если избирательное порождение и обнаружение событий направленной гомологичной рекомбинации достигается, событие должно быть направлено в желаемое место в геноме хозяина для получения максимальной выгоды от этой стратегии.

Например, предполагаемая выгода от направленной генетической трансформации заключается в уменьшении вариабельности экспрессии трансгена от события к событию, по сравнению с событиями трансформации, которые имеют место в результате неспецифической интеграции. Дополнительной предполагаемой выгодой является значительное снижение числа событий, необходимых для скрининга введенной нуклеиновой кислоты, сортировки конструкций для трансформации и порождения событий, которые вносят вклад в желательные общие характеристики у результирующего трансгенного растения. Критическим фактором, необходимым для получения этих выгод, является определение конкретных мест в геноме, в которых эффективность трансгена является стойкой, и, если возможно, в которых вредные эффекты на растение-хозяина устранены или сведены к минимуму.

Недавно были описаны способы и композиции для направленного расщепления геномной ДНК. Такие события направленного расщепления могут использоваться, например, для индукции направленного мутагенеза, для индукции направленных делеций клеточных последовательностей ДНК и содействия направленной рекомбинации и интеграции в заданный локус хромосомы. Смотрите, например, Urnov et al. (2010) Nature 435(7042): 646-51; публикации заявок на патенты США № 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20090263900; 20090117617; 20100047805; 20110207221; 20110301073; 2011089775; 20110239315; 20110145940 и публикацию международной заявки WO 2007/014275, описания которых включены посредством ссылки в их полном объеме для всех целей. Расщепление может происходить благодаря использованию специфических нуклеаз, таких как сконструированные нуклеазы на основе цинковых пальцев (ZFN), эффекторные нуклеазы вроде активаторов транскрипции (TALEN), или используя систему CRISPR/Cas вместе со сконструированной CRISPR РНК (РНК в виде коротких палиндромных повторов, регулярно расположенных группами)/трансактивирующей CRISPR РНК («единой направляющей РНК») для проведения специфического расщепления. В публикации заявки на патент США № 20080182332 описывается использование нуклеаз на основе неканонических цинковых пальцев (ZFN) для направленной модификации геномов растений; в публикации заявки на патент США № 20090205083 описывается ZFN-опосредованная направленная модификация локуса EPSPS у растений; в публикации заявки на патент США № 20100199389 описывается направленная модификация локуса Zp15 у растений, а в публикации заявки на патент США № 20110167521 описывается направленная модификация генов растений, участвующих в биосинтезе жирных кислот. Кроме того, в Moehle et al. (2007) Proc. Natl. Acad, Sci. USA 104(9): 3055-3060 описывается использование сконструированных ZFN для направленного добавления генов в конкретный локус. В публикации заявки на патент США № 20110041195 описываются способы получения гомозиготных диплоидных организмов.

Однако остается потребность в композициях и способах для модификации и/или модулирования экспрессии генов FAD3 у растений, в том числе создания растений с направленными вставками желаемых трансгенов в локус FAD3.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Настоящее изобретение описывает композиции и способы для модуляции экспрессии генов FAD3 (например, у растений, водорослей и грибов) и использование этих локусов в качестве сайтов для направленной интеграции, представляющей интерес последовательности нуклеиновой кислоты (например, экзогенной последовательности нуклеиновой кислоты) в клетку-хозяина. В некоторых вариантах осуществления клетка-хозяин может содержать один или более геномов с одной или более последовательностей FAD3 (например, гомеологов и/или паралогов), некоторые или все из которых могут быть избирательно модифицированы и/или разрушены. В конкретных примерах настоящее изобретение описывает гены FAD3A, FAD3A'', FAD3C' и/или FAD3C, а также соответствующие и или паралоги, в Brassica napus (т.е., В. napus линии DH12075) и их применение в качестве локусов для направленной интеграции представляющей интерес последовательности нуклеиновой кислоты. Как в настоящем документе описано, хотя гены FAD3 вовлечены в биосинтез жирных кислот в организме хозяина, их модификация или разрушение (например, в результате интеграции экзогенной нуклеиновой кислоты в кодирующую последовательность FAD3) неожиданно может не оказывать или оказывать минимальные неблагоприятные эффекты на получающийся в результате организм хозяина.

Также в настоящем документе описывается использование одного или более конкретных локусов FAD3 вместе с полипептидом, способным к осуществлению расщепления и/или интеграции специфических последовательностей нуклеиновых кислот в локусах(ы) FAD3. Примеры использования локусов FAD3 вместе с полипептидом, способным к осуществлению расщепления локусов FAD3 и/или интеграции в них, включают полипептид, выбираемый из группы, состоящей из белков с цинковыми пальцами, мегануклеаз, доменов TAL, TALEN, РНК-направляемой CRISPR-Cas9, рекомбиназ, «лейциновых молний, CRISPr/Cas и других полипептидов, известных специалистам в данной области техники. Конкретные примеры включают химерный («составной») белок, включающий полипептид в виде сайт-специфического ДНК-связывающего домена и полипептида в виде расщепляющего домена (например, нуклеазы), такой как белок ZFN, включающей полипептид «цинковые пальцы» и полипептид с нуклеазной активностью FokI. Например, в настоящем описании представлена демонстрация in vitro и in vivo эффективности и специфичности конкретных ZFN, предназначенных для связывания и вызова двухцепочечных разрывов в FAD3A, FAD3А', FAD3A'', FAD3C, FAD3C', FAD3C'' и в их комбинациях без расщепления соответствующих гомеологов или паралогов. В некоторых вариантах осуществления конкретные локусы FAD3 могут использоваться с любым из вышеуказанных полипептидов для осуществления сайт-специфической интеграции представляющей интерес нуклеиновой кислоты, которая впоследствии экспрессируется в хозяине, оказывая минимальное отрицательное влияние на агрономические характеристики хозяина.

В некоторых аспектах в настоящем документе описываются полипептиды, включающие ДНК-связывающий домен, который специфически связывается с геном FAD3. В некоторых вариантах осуществления такой полипептид может также включать нуклеазный (расщепляющий) домен или половину домена (например, ZFN, рекомбиназу, транспозазу или хоминг-нуклеазу, в том числе хоминг-нуклеазу с модифицированным ДНК-связывающим доменом, домены TAL, TALEN, РНК-направляемую CRISPR-Cas9), и/или лигазный домен, так что полипептид может вызывать направленный двухцепочечных разрыв и/или способствовать рекомбинации представляющей интерес нуклеиновой кислоты в месте разрыва. В конкретных вариантах осуществления ДНК-связывающий домен, который нацелен на локус FAD3, может быть функциональным ДНК-расщепляющим доменом. Вышеуказанные полипептиды могут использоваться в некоторых вариантах осуществления для введения экзогенной нуклеиновой кислоты в геном организма хозяина, демонстрирующего гомологичную рекомбинацию, (например, вида растения или животного) в один или более локусов FAD3. В некоторых вариантах осуществления ДНК-связывающие домены включают белок «цинковые пальцы» с одним или более цинковых пальцев (например, 2, 3, 4, 5, 6, 7, 8, 9 или более цинковых пальцев) и может, что является сконструированным (не встречающимся в природе), связываться с любой последовательностью в гене FAD3. Любой из белков «цинковые пальцы», описанных в настоящем документе, может связываться с сайтом-мишенью в кодирующей последовательности гена-мишени или в соседних последовательностях (например, промоторе или других экспрессионных элементах). В некоторых вариантах осуществления белок «цинковые пальцы» связывается с сайтом-мишенью в гене FAD3, например, представленном в таблице 4. Спиральные участки распознавания приводимых в качестве примера FAD3-связывающих цинковых пальцев приведены в таблице 3. Один или более компонентных связывающих доменов «цинковые пальцы» белка с цинковыми пальцами может быть каноническим (C2H2) цинковым пальцем или неканоническим (например, C3H) цинковым пальцем (например, N-концевой и/или C-концевой цинковый палец может быть неканоническим пальцем).

Также в настоящем документе описываются способы разрушения или редактирования гена FAD3. Кроме того, в настоящем документе описываются генетически модифицированные организмы-хозяева (например, трансгенные растения), полученные с помощью способов в соответствии с вариантами осуществления настоящего изобретения. В конкретных примерах трансгенный организм, полученный с помощью способа в соответствии с вариантом осуществления настоящего изобретения, может представлять собой, без ограничения, водоросли, гриб, однодольное растение, двудольное растение, и т.д.

Вышеизложенные и другие признаки станут более очевидными из нижеследующего подробного описания нескольких вариантов осуществления, которое выполнено со ссылкой на сопроводительные фигуры.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг. 1, панелях А-Т, представлено совмещение последовательностей генов FAD3 (SEQ ID NO: 7-12), полученное с использованием AlignX®.

На фиг. 2 представлено филогенетическое древо последовательностей генов FAD3, построенное с использованием Jalview v 2.3 на основе расстояний между парами присоединяемых соседей. Отмеченные последовательности соответствуют следующему: FAD3A'/A'' описывается в данной заявке как FAD3A'; гаплотип 2 описывается в данной заявке как FAD3C'; гаплотип 1 описывается в данной заявке как FAD3C''; и гаплотип 3 описывается в данной заявке как FAD3A''.

На фиг. 3 представлена карта плазмиды pDAB107828.

На фиг. 4 представлена карта плазмиды pDAB107829.

На фиг. 5 представлена карта плазмиды pDAS000271.

На фиг. 6 представлена карта плазмиды pDAS000272.

На фиг. 7 представлена карта плазмиды pDAS000273.

На фиг. 8 представлена карта плазмиды pDAS000274.

На фиг. 9 представлена карта плазмиды pDAS000275.

На фиг. 10 представлена карта плазмиды pDAS000031.

На фиг. 11 представлена карта плазмиды pDAS000036.

На фиг. 12 представлена карта плазмиды pDAS000037.

На фиг. 13 представлена карта плазмиды pDAB107827.

На фиг. 14 представлена карта плазмиды pDAB107828.

На фиг. 15 представлена карта плазмиды pDAS000340.

На фиг. 16 представлена карта плазмиды pDAS000341.

На фиг. 17 представлена карта плазмиды pDAS000342.

На фиг. 18 представлена карта плазмиды pDAS000343.

Фиг. 19 является схемой, которая демонстрирует расположения праймеров и их положение относительно инициирующего кодона и стоп-кодона Fad3C. Панель А демонстрирует расположение мест праймеров в случае локуса Fad3C дикого типа. Панель В демонстрирует расположение мест праймеров для подтверждения интеграции донора, а также возможные ориентации, в которых донор мог бы интегрировать в локус Fad3C.

На фиг. 20, панелях А и В, представлены совмещения последовательностей после модификации с использованием указанных ZFN и плазмид-доноров. На фиг. 20А представлено совмещение последовательностей, амплифицированных из стыка tGFP-кассеты pDAS000341 с Fad3C в месте двухцепочечного разрыва, распознаваемом ZFN 8051-2A-28052. «» означает делеции, расположенные в сайтах расщепления. Представлено совмещение SEQ ID NO: 300 - SEQ ID NO: 313. На фиг. 20B представлено совмещение последовательности, амплифицированных из стыка tGFP-кассеты pDAS000343 с Fad3C в месте двухцепочечного разрыва, распознаваемом ZFN 28051-2A-28052 и ZFN 28053-2A-28054. «» означает делеции, расположенные в сайтах расщепления. Представлено совмещение SEQ ID NO: 314 - SEQ ID NO: 327.

На фиг. 21, панелях А и В, представлено совмещение последовательностей, амплифицированных из стыка hph-кассеты pDAS000340 с FAD3C в месте двухцепочечного разрыва, распознаваемом ZFN 28051-2А-28052. «Образец» представляет собой уникальный идентификатор для каждого растения, которое анализировали. «» означает делеции, расположенные в сайтах расщепления. Последовательности, представленные на фиг. 21А, предназначены для 5' стыка, а последовательности, представленные на фиг. 21В, предназначены для 3' стыка. В случае совмещения фиг. 21А представлены SEQ ID NO: 368 - SEQ ID NO: 375. В случае совмещения фиг. 21В представлены SEQ ID NO: 376 - SEQ ID NO: 377.

На фиг. 22 представлено совмещение последовательностей, амплифицированных из стыка hph-кассеты pDAS000342 с FAD3C в месте двухцепочечного разрыва, распознаваемом ZFN 28053-2A-28054. «Образец» представляет собой уникальный идентификатор для каждого растения, которое анализировали. «» означает делеции, расположенные в сайтах расщепления. Последовательности, представленные на фиг. 22, предназначены для 3' стыка. Представлено совмещение SEQ ID NO: 378 - SEQ ID NO: 379.

На фиг. 23, панелях А и В, представлено совмещение последовательностей, амплифицированных из стыка hph-кассеты pDAS000340 с FAD3C в месте двухцепочечного разрыва, распознаваемом ZFN 28051-2A-28052. «» означает делеции, расположенные в сайтах расщепления. Последовательности, представленные на фиг. 23А, предназначены для 5' стыка, а последовательности, представленные в блоке (В), предназначены для 3' стыка. В случае совмещения фиг. 23А представлены SEQ ID NO: 328 - SEQ ID NO: 334. В случае совмещения фиг. 23В представлены SEQ ID NO: 335 - SEQ ID NO: 342.

На фиг. 24, панелях А и В, представлено совмещение последовательностей, амплифицированных из стыка hph-кассеты pDAS000342 с FAD3C в месте двухцепочечного разрыва, распознаваемом ZFN 28053-2A-28054. «» означает делеции, расположенные в сайтах расщепления. Последовательности, представленные на фиг. 24А, предназначены для 5' стыка, а последовательности, представленные на фиг. 24В, предназначены для 3' стыка. В случае совмещения фиг. 24А представлены SEQ ID NO: 343 - SEQ ID NO: 346. В случае совмещения фиг. 24В представлены SEQ ID NO: 347 - SEQ ID NO: 351.

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

Последовательности нуклеиновых кислот представлены, используя стандартные однобуквенные сокращения для нуклеотидных оснований, как определено в § 1822 37 CFR. Представлена только одна цепь каждой последовательности нуклеиновой кислоты, но комплементарная цепь, как подразумевается, включена при любой ссылке на представленную цепь.

ПОДРОБНОЕ ОПИСАНИЕ НАСТОЯЩЕГО ИЗОБРЕТЕНИЯ

I. Обзор некоторых вариантов осуществления

Варианты осуществления настоящего изобретения создают подход к направленной интеграции экзогенных нуклеиновых кислот (например, трансгенов) в геном хозяина без оказания сильного неблагоприятного влияния на другие фенотипы хозяина за пределами тех, на которые оказывает влияние интегрированная нуклеиновая кислота. Некоторые варианты осуществления могут использоваться для «стэкинга» множества нуклеиновых кислот в одном геноме хозяина. При таком подходе используется развитие и развертывание четырех взаимосвязанных технологий: технологий таргетинга, позволяющих вводить двухцепочечные разрывы в определенные места в геномной ДНК (смотрите, например, Puchta et al. (1993) Nucleic Acids Res. 21: 5034-40; Sieber and Puchta (2002) Plant Cell 14: 1121-31; D'Halluin et al. (2008) Plant Biotechnol. J. 6 (1): 93-102; Cai et al. (2009) Plant Mol. Biol. 69 (6): 699-709; Shukla et al. (2009) Nature 459 (7245): 437-41); Shan et al. (2103) Nature Biotechnol. 31: 686-680; Le et al. (2013) Nature Biotechnol 31: 688-691; Nekrasov et al. (2013) Nature Biotechnol. 31: 691-693, Ainely et al. (2013) Plant Biotechnol. J. (On Line 19 Aug.); технологий доставки, позволяющих доставлять оптимизированную экзогенную (донорную) нуклеиновую кислоту (Bibikova et al. (2003) Science 300 (5620): 764); технологий интеграции, включающих модификацию генов хозяина (в месте или гомологичной рекомбинации, или путей NHEJ) для увеличения частот HDR или NHEJ для направленной интеграции донорной ДНК; аналитических средств для обогащения и характеристики событий направленной интеграции; и конкретных желаемых положений в геноме хозяина («локусов для выполнения операций»), которые являются генетически хорошо определенными и которые поддерживают стабильную экспрессию гена из поколения в поколение без значительного неблагоприятного влияния на трансформированный организм хозяина. Смотрите также публикации патентов США № 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20090263900; 20090117617; 20100047805; 20110207221; 20110301073; 2011089775; 20110239315; 20110145940; 20080182332; 20090205083; 20100199389; 0110167521. Например, в растениях, локусом для выполнения операций является локус, в котором отрицательное влияние на агрономические или связанные с качеством свойства трансгенного растения, в локус которого был вставлен трансген, является незначительным или вообще отсутствует.

В описанных в настоящем документе вариантах осуществления используется неожиданное открытие того, что гены FAD3 растений являются локусами для выполнения операций - направленной вставки экзогенных нуклеиновых кислот (например, гена(ов), некодирующих последовательностей ДНК, таких как сконструированные посадочные площадки (ELP) (заявка на патент США 12/011735) и сконструированная платформа для вставки трансгенов (ETIP) (находящаяся на рассмотрении заявка на патент США № 61/697882) и блок(ы) для трансформации растений). Повсеместный характер локусов FAD3 в растениях и факты, что изменение или нокаут FAD3 в каноле, кукурузе, подсолнечнике, пшенице, хлопчатнике и сое не влечет за собой агрономического или связанного с качеством ухудшения, определяет локусы FAD3 как широкий класс локусов для выполнения операций во всех коммерчески соответствующих видах растений.

В некоторых вариантах осуществления используется сайт-специфический двухцепочечный разрыв ДНК в локусе FAD3, например, в результате доставки и экспрессии специфического в отношении сайта-мишени ДНК-распознающего и расщепляющего белка. В конкретных примерах таким FAD3-специфическим ДНК-распознающим и расщепляющим белком может быть, например, и без ограничения, ZFN; TALEN; РНК-направляемая система CRISPR-Cas9, рекомбиназа (например, Cre, Hin, RecA, Tre и рекомбиназы FLP); мегануклеаза и сконструированный белок, происходящих из любого из указанных выше белков или их эквивалентов. Расщепление может также осуществляться с помощью системы CRISPR/CAS со сконструированной CRISPR РНК/трансактивирующей CRISPR РНК («единой направляющей РНК») для проведения специфического расщепления. В некоторых вариантах осуществления такой двухцепочечный разрыв может быть подвергнут репарации через интеграцию донорной нуклеиновой кислоты в сайт расщепления внутри локуса FAD3 для выполнения операций, например, с помощью репарации с использованием гомологичной ДНК (HDR) или негомологичного соединения концов (NHEJ).

Настоящее изобретение иллюстрирует применимость локусов FAD3 в качестве локусов для выполнения операций, например, с помощью описания локуса FAD3A или 3C в каноле (Brassica napus) и соответствующих FAD3-специфических ZFN, которые могут использоваться для интеграции экзогенной нуклеиновой кислоты в локус FAD3A или 3C.

Варианты осуществления настоящего изобретения решают многие нерешенные проблемы в данной области техники. Например, избирательность способа направленной интеграции, описанного в настоящем документе, может уменьшить или устранить необходимость повторных полевых испытаний, необходимых для устранения нежелательных трансгенных случаев, которые являются дорогостоящими из-за вовлеченных средств и обременительных нормативных требований в этой области. Кроме того, способы направленной вставки ДНК, описываемые в настоящем документе, могут быть особенно полезны в процессе стэкинга трансгенов.

Хотя природная нуклеотидная последовательность в эндогенном локусе FAD3 может быть использована, чтобы непосредственно направить представляющую интерес нуклеиновую кислоту, в некоторых вариантах осуществления нуклеиновая кислота может быть сначала направлена в по меньшей мере один локус FAD3 хозяина, чтобы облегчалась интеграция дальнейших молекул нуклеиновых кислот, представляющих интерес, в геном хозяина. В других примерах могут использоваться нуклеотидные последовательности, не гомологичные природным последовательностям организма хозяина (например, по существу случайным образом сконструированные последовательности нуклеиновых кислот), которые фланкируют сайт распознавания ДНК (например, сайты распознавания цинковых пальцев).

II. Термины

При использовании в этой заявке, включая формулу изобретения, термины в единственном числе и формы единственного числа, «a», «an» и «the», например, включают ссылки на множественное число, если из содержания явно не следует иное. Таким образом, например, ссылка на «plant», «the plant» или «a plant» также относится к множеству растений. Кроме того, в зависимости от контекста, использование термина «plant» может также относиться к генетически сходным или идентичным потомкам этого растения. Аналогичным образом, термин «nucleic acid» может относиться к множеству копий молекулы нуклеиновой кислоты. Аналогично, термин «probe» может относиться к множеству схожих или идентичных молекул зонда.

Числовые диапазоны включают числа, определяющие диапазон, и определенно включают каждое целое число и не являющуюся целым числом дробь в пределах заданного диапазона. Кроме особо оговоренных случаев, все технические и научные термины, используемые в настоящем описании, имеют значение, одинаковое со значением, в котором их обычно понимает специалист со средним уровнем компетентности в данной области техники.

Для облегчения обзора различных вариантов осуществления, описанных в этом описании, дается следующее объяснение специфических терминов:

Выделенный: «Выделенный» биологический компонент (например, нуклеиновая кислота или белок) был по существу отделен, получен отдельно от или очищен от других биологических компонентов в клетке организма, в котором компонент встречается в природе (т.е., другой хромосомной и экстрахромосомной ДНК и РНК, а также белков), при осуществлении химического или функционального изменения компонента (например, нуклеиновая кислота может быть выделена из хромосомы посредством разрыва химических связей, соединяющих нуклеиновую кислоту с оставшейся ДНК в хромосоме). Молекулы нуклеиновых кислот и белки, которые были «выделены», включают молекулы нуклеиновых кислот и белки, очищенные с помощью стандартных способов очистки. Этот термин также охватывает нуклеиновые кислоты и белки, полученные с помощью рекомбинантной экспрессии в клетке-хозяине, а также химически синтезированные молекулы нуклеиновых кислот, белки и пептиды.

Скрещивание: Используемый в настоящем описании в отношении растений термин «скрещивание» или «скрещенное» относится к слиянию половых клеток с помощью опыления для получения потомства (например, клеток, семян и растений). Этот термин охватывает как половые скрещивания (т.е. опыление одного растения другим), так и самоопыления (т.е. самоопыление, например, с помощью пыльцы и яйцеклетки из того же растения).

Возвратное скрещивание: Методы возрастного скрещивания могут использоваться для введения последовательности нуклеиновой кислоты в растение. Этот метод широко использовался в течение многих десятилетий, чтобы привнести новые признаки в растения. Jensen, N., Ed. Plant Breeding Methodology, John Wiley & Sons, Inc., 1988. В типичном протоколе возвратного скрещивания, исходный сорт, представляющий интерес, (рекуррентного родителя) скрещивают со вторым сортом (нерекуррентным родителем), который содержит представляющую интерес последовательность нуклеиновой кислоты, которая должна быть передана. Полученное в результате этого скрещивания потомство затем снова скрещивают с рекуррентным родителем, и процесс повторяют до тех пор, пока не будет получено растение, в котором, по существу, все желаемые морфологические и физиологические характеристики рекуррентного растения не будут восстановлены у преобразованного растения, в дополнение к переданной от нерекуррентного родителя последовательности нуклеиновой кислоты.

Интрогрессия: Используемый в настоящем описании термин «интрогрессия» относится к проникновению аллеля (или модифицированного аллеля, включающего экзогенную нуклеиновую кислоту) в генетический фон в определенный локус. В некоторых вариантах осуществления интрогрессия специфического аллеля в локус может происходить при передаче аллеля по меньшей мере одному потомку через половое скрещивание двух родителей одного и того же вида, причем по меньшей мере один из родителей имеет специфическую форму аллеля в своем геноме. Потомство, содержащее специфический аллель, можно повторно подвергнуть возвратному скрещиванию с линией, имеющей желаемый генетический фон. Полученное в результате возвратного скрещивания потомство можно подвергнуть скринингу в отношении специфической формы аллеля для получения нового сорта, в котором специфическая форма аллеля закреплена в генетическом фоне. В некоторых вариантах осуществления интрогрессия специфического аллеля может произойти в результате рекомбинации между двумя геномами-донорами (например, в слитом протопласте), причем по меньшей мере один из геномов-доноров содержит специфическую форму аллеля в своем геноме. Интрогрессия может включать проникновение специфической формы аллеля, которая может представлять собой, например, и без ограничения, разрушенный или модифицированный аллель; трансген; PTU и ELP.

Зародышевая плазма: Используемый в настоящем описании термин «зародышевая плазма» относится к генетическому материалу отдельного растения, группы растений (например, линии растений, сорта и семейства) и клона, происходящего от растения или группы растений. Зародышевая плазма может быть частью организма или клетки, или же она может быть отделена (например, выделена) из организма или клетки. В общем, зародышевая плазма обеспечивает генетический материал со специфическим молекулярным составом, который является основой для передаваемых по наследству качеств растения. Как в настоящем описании используется, «зародышевая плазма» относится к клеткам конкретного растения; семени; ткани конкретного растения (например, ткани, из которой могут быть выращены новые растения); и не являющимся семенами частям конкретного растения (например, листу, стеблю, пыльце и клеткам). Используемый в настоящем описании термин «зародышевая плазма» является синонимом термина «генетический материал», и он может использоваться для обозначения семени (или другого растительного материала), из которого может быть выращено растение. «Банк зародышевой плазмы» может относиться к организованной коллекции различных семян или другого генетического материала (в которой каждый генотип однозначно определен), из которого можно вырастить известный сорт, и на основе которого можно создать новый сорт.

Ген: Используемый в настоящем описании термин «ген» (или «генетический элемент») может относиться к передаваемой по наследству последовательности геномной ДНК, имеющей функциональную значимость. Геном может быть природная нуклеиновая кислота или нуклеиновая кислота, которая была интегрирована в геном. Термин «ген» может также использоваться для обозначения, например, и без ограничения, кДНК и/или мРНК, кодируемой передаваемой по наследству последовательностью геномной ДНК.

Молекула нуклеиновой кислоты: Используемый в настоящем описании термин «молекула нуклеиновой кислоты» может относиться к полимерной форме нуклеотидов (т.е. рибонуклеотидов, дезоксирибонуклеотидов и/или модифицированной форме любого из вышеуказанных). «Молекула нуклеиновой кислоты», как в настоящем описании используется, является синонимом термина «нуклеиновая кислота» и «полинуклеотид». Этот термин включает как смысловую, так и антисмысловую цепи РНК, кДНК, геномной ДНК и их синтетические формы и смешанные полимеры. Термин включает любую топологическую конформацию, в том числе одноцепочечную, двухцепочечную, отчасти дуплексную, триплексную, шпилечную, замкнутую в круг и запертую конформации. Молекула нуклеиновой кислоты может включать встречающиеся в природе или модифицированные нуклеотиды, или и те и другие. Такие нуклеотиды могут быть связаны друг с другом с помощью, встречающихся в природе и/или не встречающихся в природе нуклеотидных связей.

Молекулы нуклеиновых кислот могут быть химически или биохимически модифицированными или могут содержать дериватизированные нуклеотидные основания, как будет без труда понятно квалифицированным в данной области техники специалистам. Такие модификации включают, например, и без ограничения: метки; метилирование; замещение одного или более встречающихся в природе нуклеотидов аналогом и межнуклеотидные модификации (например, незаряженные связи, например, метилфосфонаты, фосфотриэфиры, фосфорамидаты и карбаматы; заряженные связи, например, фосфоротиоаты и фосфородитиоаты; боковые компоненты, например, пептиды; интеркаляторы, например, акридин и псорален; комплексоны; алкилаторы и модифицированные связи, например, альфа-аномерные нуклеиновые кислоты).

Экзогенная: «Экзогенной молекулой» является молекула, которая не присуща указанной системе (например, зародышевой плазме, сорту, элитному сорту и/или растению), что касается нуклеотидной последовательности и/или расположения в геноме (т.е. локуса) в случае полинуклеотида (и что касается аминокислотной последовательности и/или клеточной локализации в случае полипептида). В вариантах осуществления экзогенные или гетерологичные полинуклеотиды или полипептиды могут представлять собой молекулы, которые были искусственно поданы в биологическую систему (например, клетку растения, ген растения, конкретный вид или сорт растения и/или хромосому растения) и не присущи этой конкретной биологической системе. Таким образом, определение нуклеиновой кислоты «экзогенной» может означать, что нуклеиновая кислота произошла из источника, отличного от встречающегося в природе источника, или это может означать, что нуклеиновая кислота имеет неприродную конфигурацию, генетическую локализацию или расположение элементов.

В противоположность этому, например, «природная» или «эндогенная» нуклеиновая кислота представляет собой нуклеиновую кислоту (например, ген), которая не содержит элемент нуклеиновой кислоты, отличный от тех, которые обычно присутствуют в хромосоме или другом генетическом материале, в которой(ом) нуклеиновая кислота обычно встречается в природе. Транскрипт с эндогенного гена кодируется нуклеотидной последовательностью в ее природном хромосомном локусе, а не искусственно подается в клетку.

Функционально связанные: Первая последовательность нуклеиновой кислоты функционально связана со второй последовательностью нуклеиновой кислоты, если первая последовательность нуклеиновой кислоты находится в функциональной связи со второй последовательностью нуклеиновой кислоты. Например, промотор функционально связан с кодирующей последовательностью, если промотор оказывает влияние на транскрипцию или экспрессию кодирующей последовательности. В случае рекомбинантной продукции функционально связанные последовательности нуклеиновых кислот являются, как правило, непрерывными и, если необходимо соединить две кодирующих белки области, находятся в одной и той же рамке считывания. Однако элементы не должны быть смежными, чтобы быть функционально связанными.

Промотор: Промотор представляет собой область ДНК, которая, как правило, находится выше (по отношению к 5' области) нуклеиновой кислоты, которая усиливает транскрипцию нуклеиновой кислоты. Промоторы допускают надлежащую активацию или репрессию нуклеиновых кислот(ы), с которыми они функционально связаны. Промотор содержит специфические последовательности, которые распознаются факторами транскрипции. Эти факторы связываются с ДНК-последовательностями промоторов и приводят к привлечению РНК-полимеразы, фермента, который синтезирует РНК, исходя из кодирующей области нуклеиновой кислоты.

Трансформированная: Вектор «трансформирует» или «трансдуцирует» клетку, когда он переносит молекулы нуклеиновых кислот в клетку. Клетка является «трансформированной» молекулой нуклеиновой кислоты, когда молекула нуклеиновой кислоты становится устойчиво реплицируемой клеткой, либо в результате включения молекулы нуклеиновой кислоты в геном клетки, или в результате эписомальной репликации. Используемый в настоящем описании термин «трансформация» охватывает все методы, с помощью которых молекулу нуклеиновой кислоты можно ввести в клетку. Примеры включают, но без ограничения: трансфекцию с использованием вирусных векторов; трансформацию с использованием плазмидных векторов; электропорацию (Fromm et al. (1986) Nature 319: 791-3); липофекцию (Felgner et al. (1987) Proc Natl Acad Sci USA 84: 7413-7); микроинъекцию (Mueller et al. (1978) Cell 15: 579-85); перенос с использованием Agrobacterium (Fraley et al. (1983) Proc Natl Acad Sci USA 80: 4803-7); прямое поглощение ДНК и бомбардировку микрочастицами (Klein et al. (1987) Nature 327: 70).

Введенный: Используемый в настоящем описании термин «введенный», когда речь идет о транслокации экзогенной нуклеиновой кислоты в клетку, относится к включению нуклеиновой кислоты в клетку с помощью любой методики, имеющейся в данной области техники. Этот термин охватывает способы введения нуклеиновых кислот, включающие, например, и без ограничения, трансфекцию; трансформацию и трансдукцию.

Трансген: Используемый в настоящем описании термин «трансген» относится к экзогенной последовательности нуклеиновой кислоты, представляющей интерес. Например, трансген может кодировать промышленно или фармацевтически полезное соединение, или продукт экспрессии, который вносит вклад в желательный сельскохозяйственный признак (например, устойчивость к гербициду или устойчивость к вредителям). В дальнейшем примере трансген может представлять собой антисмысловую нуклеиновую кислоту, причем экспрессия антисмысловой нуклеиновой кислоты ингибирует экспрессию последовательности нуклеиновой кислоты-мишени. Трансген может включать регуляторные последовательности, функционально связанные с трансгеном, (например, промотор). В некоторых вариантах осуществления представляющая интерес молекула нуклеиновой кислоты, которую вводят с помощью сайт-специфического таргетинга в локус FAD3, является трансгеном. Однако представляющей интерес молекулой нуклеиновой кислоты может быть PTU, ELP, ETIP или эндогенная последовательность нуклеиновой кислоты в других вариантах осуществления (например, в которых желательны дополнительные, экзогенные геномные копии эндогенной последовательности нуклеиновой кислоты).

Элементы могут также включать ДНК, которая кодирует структурную РНК, например, шпилечную РНК. Такая РНК может модифицировать экзогенные или эндогенные гены, в том числе, но без ограничения, оказывая влияние на размещения информации или придавая устойчивость к гербицидам.

Рекомбинантный: Как в настоящем описании используется, термин «рекомбинантный» относится к материалу (например, нуклеиновой кислоте, гену, полинуклеотиду и/или полипептиду), который был изменен в результате вмешательства человека. Например, расположение частей или элементов рекомбинантной молекулы может не быть природным расположением, и/или первичная последовательность рекомбинантной молекулой может быть изменена по сравнению с ее природной последовательностью, например, для оптимизации ее экспрессии и/или активности. Материал может быть изменен с целью получения рекомбинантного материала, находящегося в своей природной среде или состоянии или удаленного из нее. В качестве одного примера открытая рамка считывания нуклеиновой кислоты является рекомбинантной, если нуклеотидная последовательность открытой рамки считывания была удалена из своего природного окружения и клонирована в искусственную молекулу нуклеиновой кислоты (например, вектор). Протоколы и реагенты для получения рекомбинатных молекул (например, рекомбинантных нуклеиновых кислот) являются обычными в данной области техники, и их использование является обычным делом. Термин «рекомбинантный» может также относится в настоящем описании к клетке или организму, которая включает рекомбинантный материал (например, растению и/или клетке растения, которая(ое) включает рекомбинантную нуклеиновую кислоту). В некоторых примерах рекомбинантный организм является трансгенным организмом.

Вектор: Используемый в настоящем описании термин «вектор» относится к полинуклеотиду или другой молекулы, который способен переносить по меньшей мере один сегмент(ы) нуклеиновой кислоты в клетку. Вектор может необязательно включать компоненты/элементы, которые опосредуют сохранение вектора и/или обеспечивают его предполагаемое использование (например, последовательности, необходимые для репликации, гены, придающие устойчивость к лекарственным средствам или антибиотикам, сайт множественного клонирования и/или функционально связанные элементы промотора/энхансера, которые делают возможной экспрессию клонированного гена). Векторы могут быть получены, например, из плазмид, бактериофагов или вирусов растений или животных. «Вектор для клонирования», «челночный вектор» или «вектор для субклонирования» обычно включает функционально связанные элементы для облегчения стадий клонирования или субклонирования (например, сайт множественного клонирования, содержащий несколько сайтов для рестрикционных эндонуклеаз).

Экспрессионный вектор: Термин «экспрессионный вектор», как в настоящем описании используется, относится к вектору, включающему функционально связанные полинуклеотидные последовательности, которые могут облегчить экспрессию кодирующей последовательности в конкретном организме-хозяине. Например, бактериальный экспрессионный вектор может облегчить экспрессию кодирующей последовательности в бактерии. Так же вектор для экспрессии в растениях может облегчить экспрессию кодирующей последовательности в клетке растения. Полинуклеотидные последовательности, облегчающие экспрессию у прокариот, могут включать, например и без ограничения, промотор; оператор и сайт связывания рибосом. Эукариотические экспрессионные векторы (например, вектор для экспрессии в растениях) может включать, например, промоторы; энхансеры; сигналы терминации и сигналы полиаденилирования (и другие последовательности), которые, правило, отличаются от тех, которые используются в прокариотических экспрессионных векторах.

Идентичность последовательностей: Термин «идентичность последовательностей» или «идентичность», как в настоящем описании используется в контексте двух последовательностей нуклеиновых кислот или полипептидов, относится к остаткам в двух последовательностях, которые являются одинаковыми при совмещении для максимального соответствия в определенном окне сравнения. Значение идентичности последовательностей можно определить путем сравнения двух оптимально совмещенных последовательностей (например, последовательностей нуклеиновых кислот и аминокислотных последовательностей) в окне сравнения, причем часть последовательности в окне сравнения может содержать добавления или делеции (т.е. пропуски) по сравнению с контрольной последовательностью (которая не содержит добавления или делеции) для оптимального совмещения двух последовательностей. Идентичность последовательностей рассчитывается в виде процента путем определения числа положений, в которых идентичный нуклеотид или аминокислотный остаток встречается в обеих последовательностях, с получением числа совпадающих положений, деления числа совпадающих положений на общее число положений в окне сравнении и умножения результата на 100 для получения процента идентичности последовательностей.

Методы совмещения последовательностей для сравнения хорошо известны в данной области техники. Различные программы и алгоритмы для совмещения описаны, например, Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48: 443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; Higgins and Sharp (1988) Gene 73: 237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. Nucleic Acids Res. (1988) 16: 10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8: 155-65; Pearson et al. (1994) Methods Mol. Biol. 24: 307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174: 247- 50. Детальное рассмотрение методов совмещения последовательностей и расчетов гомологии можно найти в Altschul et al. (1990) J. Mol. Biol. 215: 403-10.

Basic Local Alignment Search Tool (BLAST™; Altschul et al. (1990)) Национального центра биотехнологической информации (NCBI) может использоваться для совмещения последовательностей, и оно доступно из нескольких источников, включая Национальный центр биотехнологической информации (Bethesda, MD), и в интернете, для использования в связи с несколькими программами для анализа последовательностей. Описание того, как определить идентичность последовательностей с помощью этой программы, доступно в интернет в разделе «Помощь» для BLAST™. Для сравнений последовательностей нуклеиновых кислот, функция «Blast 2 sequences» программы BLAST™ (Blastn) может использоваться с использованием параметров по умолчанию. Последовательности нуклеиновых кислот с большей степенью схожести с контрольными последовательностями покажут увеличение процента идентичности при оценке этим методом.

Используемый в настоящем описании термин «по существу идентичные» может относиться к нуклеотидным последовательностям, которые идентичны на более чем 80%. Например, по существу идентичная нуклеотидная последовательность может быть идентична на по меньшей мере 85%, по меньшей мере 86%, по меньшей мере 87%, по меньшей мере 88%, по меньшей мере 89%, по меньшей мере 90%, по меньшей мере 91%, по меньшей мере 92%, по меньшей мере 93%, по меньшей мере 94%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99% или по меньшей мере 99,5% контрольной последовательности.

Локус: Используемый в настоящем описании термин «локус» относится к положению в геноме, которое соответствует поддающейся измерению характеристике (например, признаку). В некоторых вариантах осуществления представляющим особый интерес локусом является положение в геноме гена FAD3, причем разрушение гена уменьшает или устраняет экспрессию мРНК, транскрибируемой с гена дикого типа. Локус может быть определен с помощью зонда, который гибридизуется с уникальной нуклеотидной последовательностью, содержащейся в локусе, во время или гибридизации по Саузерну, или ПЦР.

Маркер: Как в настоящем описании используется, «маркер» относится к последовательности гена или нуклеотидной последовательности, которая может использоваться для идентификации растений, которые могут иметь конкретную аллель и/или обладать конкретным признаком или фенотипом. Маркер может быть описан как вариант в данном геномном локусе. Генетический маркер может быть короткой последовательностью ДНК, такой как последовательность, окружающая изменение одной пары оснований (однонуклеотидный полиморфизм или «SNP»), или длинной последовательностью, например, минисателлитом/повтором простой последовательности («SSR»). «Аллель-маркер» относится к варианту маркера, который присутствует в конкретном растении. Термин «маркер», используемый в настоящем описании, может относиться к клонированному сегменту хромосомной ДНК растений (например, сегменту, включающему локус FAD3, или модифицированный и/или разрушенный локус FAD3) и может также или альтернативно называться молекулой ДНК, комплементарной клонированному сегменту хромосомной ДНК растения. Как известно специалистам со средним уровнем компетентности в данной области техники, процесс получения дополнительной, прилегающей нуклеотидной последовательности для включения в маркер может быть повторен почти бесконечно (ограничен только длиной хромосомы), тем самым, идентифицируя дополнительные маркеры вдоль хромосомы. Любые и все из вышеописанных разновидностей маркеров могут использоваться в некоторых вариантах осуществления настоящего изобретения.

В некоторых вариантах осуществления присутствие трансгена или маркера (которые характеризуются последовательностью-«мишенью») в зародышевой плазме можно обнаружить посредством использования зонда в виде нуклеиновой кислоты; например, олигонуклеотида. Зондом может быть молекула ДНК или молекула РНК. Олигонуклеотидный зонд может быть получен синтетически или путем клонирования. Подходящие векторы для клонирования хорошо известны квалифицированным в данной области техники специалистам. РНК-зонды можно синтезировать способами, известными в данной области техники, например, с использованием молекулы ДНК в качестве матрицы.

Олигонуклеотидный зонд может быть меченным или немеченным. Существует широкий ряд методов для мечения молекул нуклеиновых кислот, в том числе, например, и без ограничения, мечение радиоактивным изотопом с использованием ник-трансляции; случайное праймирование и снабжение хвостом с помощью концевой дезокситрансферазы, причем используемые нуклеотиды являются меченными, например, радиоактивным 32P. Другие метки, которые могут использоваться, включают, например, и без ограничения, флуорофоры; ферменты; субстраты для ферментов; кофакторы ферментов и ингибиторы ферментов. Альтернативно, использование метки, которая обеспечивает детектируемый сигнал, сама по себе или в сочетании с другими активными агентами, может быть заменено лигандами, с которыми связываются рецепторы, причем рецепторы являются меченными (например, указанными выше метками) для обеспечения детектируемых сигналов, либо самих по себе, либо в сочетании с другими реагентами. Смотрите, например, Leary et al. (1983) Proc. Natl. Acad. Sci. USA 80: 4045-9.

Зонд может быть точной копией трансгена или маркера, который детектируют. Зондом может также быть молекула нуклеиновой кислоты, включающая или состоящая из нуклеотидную(ой) последовательность(и), которая, по существу, идентична клонированному сегменту хромосомной ДНК, включающая трансген или маркер, который детектируют. Зонд может, кроме того, включать дополнительные последовательности нуклеиновых кислот, например, промоторы, сигналы транскрипции и/или последовательности вектора.

Зонд может содержать всю или часть нуклеотидной последовательности-мишени и дополнительную, прилегающую нуклеотидную последовательность из генома. Его называют в настоящем описании «прилегающим зондом». Дополнительную, прилегающую нуклеотидную последовательность называют находящейся «вверху» или «внизу» от исходной мишени, в зависимости от того, находится ли прилегающая нуклеотидная последовательность из хромосомы с 5'- или 3'-стороны от исходного маркера, в обычном понимании. Зонд может также содержать нуклеотидную последовательность, которая не является прилегающей к последовательности исходной мишени; этот зонд называют в настоящем описании «неприлегающим зондом». Последовательность неприлегающего зонда может быть расположена достаточно близко к последовательности исходной мишени на хромосоме, так что несмежный зонд связывается с исходным маркером или трансгеном.

В некоторых вариантах осуществления зондом является молекула нуклеиновой кислоты, которая является «специфически гибридизуемой» с точной копией мишени, которую детектируют, или «определенно комплементарной» ей. «Специфически гибридизуемая» и «определенно комплементарная» являются терминами, которые указывают на достаточную степень комплементарности, так что происходит устойчивое и специфическое связывание между молекулой нуклеиновой кислоты, и мишенью. Молекула нуклеиновой кислоты может не быть на 100% комплементарна являющейся ее мишенью последовательности, чтобы быть специфически гибридизуемой. Молекула нуклеиновой кислоты является специфически гибридизуемой при наличии достаточной степени комплементарности во избежание неспецифического связывания нуклеиновой кислоты с не являющимися мишенями последовательностями в условиях, когда желательно специфическое связывание, например, в жестких условиях гибридизации.

Условия гибридизации, приводящие к конкретным степеням жесткости, будут варьировать в зависимости от природы предпочтительного метода гибридизации и состава и длины гибридизующихся последовательностей нуклеиновых кислот. Как правило, температура гибридизации и ионная сила (особенно концентрации Na+ и/или Mg++) буфера для гибридизации будут определять жесткость гибридизации, хотя продолжительности отмывок также влияют на жесткость. Расчеты, касающиеся условий гибридизации, необходимых для достижения конкретных степеней жесткости, известны специалистам со средним уровнем компетентности в данной области техники и обсуждаются, например, в Sambrook et al. (ed.) Molecular Cloning: A Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11; и Hames and Higgins (eds.) Nucleic Acid Hybridization, IRL Press, Oxford, 1985. Более подробную инструкцию и рекомендации в отношении гибридизации нуклеиновых кислот можно найти, например, в Tijssen, "Overview of principles of hybridization and the strategy of nucleic acid probe assays," in Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2, Elsevier, NY, 1993; и Ausubel et al., Eds., Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, NY, 1995.

Как в настоящем описании используются, «жесткие условия» охватывают условия, в которых гибридизация будет происходить только при наличии составляющего менее 25% несоответствия между молекулой для гибридизации и ДНК-мишенью. «Жесткие условия» включают дополнительные конкретные уровни жесткости. Таким образом, как в настоящем описании используется, условиями «средней жесткости» являются те, в которых молекулы с составляющим более чем 25% несоответствием последовательностей не будут гибридизоваться; условиями «средней жесткости» являются те, в которых молекулы с составляющим более чем 15% несоответствием не будут гибридизоваться; и условиями «высокой жесткости» являются те, в которых последовательности с составляющим более чем 10% несоответствием не будут гибридизоваться. Условиями «очень высокой жесткости» являются те, в которых последовательности с составляющим более чем 6% несоответствием не будут гибридизоваться.

В конкретных вариантах осуществления жесткими условиями являются гибридизация при 65°С в 6х натрий-цитратном буфере (SSC), 5х растворе Денхардта, 0,5% SDS и 100 мкг деградированной в результате гидродинамического сдвига ДНК из семенников лосося, с последующими промывками в течение 15-30 минут при 65°С в 2х буфере SSC и 0,5% SDS, а затем 1х SSC буфере и 0,5% SDS, и, наконец, 0,2x SSC буфере и 0,5% SDS.

(Не)равновесие по сцеплению: Используемый в настоящем описании термин «равновесие по сцеплению» относится к ситуации, когда маркер и вторая нуклеиновая кислота (например, трансген, PTU и второй маркер) расщепляются независимо друг от друга; т.е. маркер и вторая нуклеиновая кислота распределяются случайным образом среди потомства. Нуклеиновые кислоты, демонстрирующие равновесие по сцеплению, считаются несцепленными (независимо от того, находятся ли они на одной и той хромосоме). Используемый в настоящем описании термин «неравновесие по сцеплению» относится к ситуации, когда маркер и вторая нуклеиновая кислота расщепляются неслучайным образом; т.е. нуклеиновые кислоты характеризуются частотой рекомбинации, составляющей менее 50% (и, таким образом, по определению, разделяются менее чем на 50 сМ в одной и той же группе сцепления). В некоторых примерах нуклеиновые кислоты, демонстрирующие неравновесие по сцеплению, считаются сцепленными.

Сцепленные, тесно сцепленные и очень тесно сцепленные: Как в настоящем описании используется, сцепление между маркером и второй нуклеиновой кислотой (например, трансгеном, PTU и вторым маркером) может относиться к явлению, когда нуклеиновые кислоты на хромосоме демонстрируют поддающуюся измерению вероятность быть переданными вместе индивидуумам в следующем поколении. Таким образом, сцепление одного маркера со второй нуклеиновой кислотой можно определить и/или представить в виде частоты рекомбинации. Чем ближе две нуклеиновые кислоты друг к другу, чем ближе к «1» становится эта вероятность. Таким образом, термин «сцепленные» может относиться к одному или более генов или маркеров, которые передаются вместе со второй нуклеиновой кислотой с вероятностью, превышающей 0,5 (что можно ожидать от независимого расхождения, когда маркеры/гены расположены на разных хромосомах). Когда присутствие гена (например, трансгена) вносит вклад в фенотип у индивидуума, можно сказать, что маркеры, которые сцеплены с геном, сцеплены с фенотипом. Таким образом, термин «сцепленные» может относиться к взаимосвязи между маркером и геном, или между маркером и фенотипом.

Относительное генетическое расстояние (определяемое по частотам кроссинговера и измеряемое в сантиморганах (сМ)), как правило, пропорционально физическому расстоянию (измеряемому в парах оснований), которое отделяет два сцепленных маркера или гена друг от друга на хромосоме. Один сантиморган определяется как расстояние между двумя генетическими маркерами, которые демонстрируют составляющую 1% частоту рекомбинации (т.е. событие кроссинговера происходит между двумя маркерами каждые 100 клеточных делений). В общем, чем ближе один маркер к другому маркеру или гену (независимо от того, измеряется ли расстояние между ними в единицах генетического расстояния или физического расстояния), тем более тесно они сцеплены. Поскольку хромосомное расстояние приблизительно пропорционально частоте событий рекомбинации между признаками, существует приблизительное физическое расстояние, которое коррелирует с частотой рекомбинации. Эта корреляция является, как правило, известной или легко определяемой во всех основных культурных растениях (Helentjaris and Burr (eds) (1989) Development and Application of Molecular Markers to Problems in Plant Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; Gresshoff (ed.) (1994) Plant Genome Analysis. CRC Press, Boca Raton, FL; Lander et al. (1987) Genomics 1: 174-81; Tanksley et al. (1988) "Molecular mapping of plant chromosomes," In Chromosome Structure and Function. Gustafson and Apples (ed.) Plenum Press, NY, pp. 157-73) и многих других организмах. Например, 1 сМ соответствует приблизительно 2,5-3,0 т.п.о. у дрожжей, приблизительно 140 т.п.о. в Arabidopsis, приблизительно 400 т.п.о. в подсолнечнике и приблизительно 350 т.п.о. в Eucalyptus.

Термин «сцепленные» может относиться в настоящем описании к одной или более нуклеиновых кислот, которые демонстрируют частоту рекомбинации, составляющую менее 50% (т.е. менее 50 сМ). Например, «сцепленные» нуклеиновые кислоты могут рекомбинировать с частотой, составляющей приблизительно 45% или менее, приблизительно 40% или менее, приблизительно 35% или менее, приблизительно 30% или менее, приблизительно 25% или менее, приблизительно 20% или менее, приблизительно 15% или менее и приблизительно 10% или менее. Физические расстояния между такими нуклеиновыми кислотами на одной и той же хромосоме (нуклеиновые кислоты на разных хромосомах, как ожидается, будут находиться в равновесии по сцеплению), которые соответствуют вышеизложенным частотам рекомбинации, зависят от генома хозяина, и их можно легко рассчитать, как изложено, выше.

Используемый в настоящем описании термин «тесно сцепленные» может относиться к одной или более нуклеиновых кислот, которые демонстрируют частоту рекомбинации, составляющую приблизительно 20% или менее (т.е. приблизительно 20 сМ или менее). Например, «тесно сцепленные» нуклеиновые кислоты могут рекомбинировать с частотой, составляющей 22% или менее, приблизительно 18% или менее, приблизительно 16% или менее, приблизительно 14% или менее, приблизительно 12% или менее, приблизительно 10% или менее, приблизительно 8% или менее, приблизительно 6% или менее, приблизительно 4% или менее и приблизительно 2% или менее.

Используемый в настоящем описании термин «очень тесно сцепленные» может относиться к одной или более нуклеиновых кислот, которые демонстрируют частоту рекомбинации, составляющую приблизительно 10% или менее (т.е. приблизительно 10 сМ или менее). Например, «очень тесно сцепленные» нуклеиновые кислоты могут рекомбинировать с частотой, составляющей 11% или менее, приблизительно 9% или менее, приблизительно 8% или менее, приблизительно 7% или менее, приблизительно 6% или менее, приблизительно 5% или меньше, приблизительно 4% или менее, приблизительно 3% или менее, приблизительно 2% или менее и приблизительно 1% или менее.

Чем ближе конкретная нуклеиновая кислота к гену, который кодирует полипептид, который вносит вклад в конкретной фенотип (независимо от измерения в единицах генетического или физического расстояния), тем более тесно сцепленной является конкретная нуклеиновая кислота с фенотипом. В свете вышеизложенного, будет понятно, что нуклеиновые кислоты, сцепленные с конкретным геном или фенотипом, включают такие нуклеиновые кислоты, которые тесно сцеплены, и те нуклеиновые кислоты, которые очень тесно сцеплены, с геном или фенотипом. В некоторых вариантах осуществления, тем ближе конкретная нуклеиновая кислота к локусу FAD3 (например, модифицированному или разрушенному локусу FAD3), независимо от измерения в единицах генетического или физического расстояния, тем более тесно сцепленной является конкретная нуклеиновая кислота с любым признаком/фенотипом, который придает экзогенная нуклеиновая кислота, интегрированная в локус FAD3 (или с фенотипом FAD3 дикого типа в случае немодифицированного локуса). Таким образом, генетические маркеры, которые сцеплены, тесно сцеплены и/или очень тесно сцеплены с локусом FAD3, включающим интегрированную экзогенную нуклеиновую кислоту, могут использоваться в программе MAS для идентификации организмов (например, растений и сортов растений), включающих интегрированную нуклеиновую кислоту, чтобы идентифицировать организмы с фенотипом, который придает интегрированная нуклеиновая кислота, и воспроизвести такую интегрированную нуклеиновую кислоту и/или фенотип, который придает интегрированная нуклеиновая кислота, в других совместимых организмах.

Селекция с помощью маркеров: Используемый в данном описании термин «селекция с помощью маркеров» может относиться к способу селекции растений непосредственно в отношении одного или более признаков (например, полигенных признаков). В современной практике селекционеры пытаются определить легко обнаруживаемые признаки, такие как цвет цветка, вид покрытия семян, или варианты изоферментов, которые связаны с агрономически желаемым признаком. Затем селекционеры следят за агрономическим признаком в расщепляющейся, размножающейся популяции, следя за расщеплением легко обнаруживаемого признака. Однако существует очень мало этих связей между представляющими интерес признаками и легко обнаруживаемыми признаками, имеющими в распоряжении для использования при селекции растений. В некоторых вариантах осуществления настоящего изобретения селекция с помощью маркеров включает определение одного или более генетических маркеров (например, SNP, изофермента и/или маркеров SSR), которые сцеплены с локусом FAD3, в который была интегрирована экзогенная нуклеиновая кислота, вносящая вклад в представляющий интерес признак, и слежение за представляющим интерес признаком в расщепляющейся, размножающейся популяции, следя за расщеплением одного или более генетических маркеров. В некоторых вариантах осуществления расщепление одного или более генетических маркеров можно определить, используя зонд для одного или более генетических маркеров, путем анализа генетического образца от потомства растения на наличие одного или более генетических маркеров. Селекция с помощью маркеров обеспечивает экономически эффективный процесс с минимальными затратами времени для улучшения сортов растений.

Признак или фенотип: Термины «признак» и «фенотип» используются в настоящем описании взаимозаменяемо. Для целей настоящего изобретения, представляющие особый интерес признаки, включают агрономически важные признаки, которые могут быть выражены, например, в культурном растении, а также продукцию продуктов экспрессии трансгена в результате события направленной интеграции. Термин «молекулярный фенотип» может относиться к фенотипу, который поддается обнаружению на уровне популяции (одной или более) молекул. В некоторых примерах молекулярный фенотип можно только обнаружить на молекулярном уровне. Поддающимися обнаружению молекулами фенотипа могут быть нуклеиновые кислоты (например, геномная ДНК или РНК); белки и/или метаболиты. Например, молекулярным фенотипом может быть профиль экспрессии одного или нескольких продуктов генов (например, на определенном этапе развития растений или в ответ на условия окружающей среды или стресс).

Локус количественных признаков: Признаки, которые непрерывно меняются, вследствие генетических влияний (аддитивных, доминантных и эпистатических действий) и влияний окружающей среды, обычно называют «количественными признаками». Количественные признаки можно отличить от «качественных» или «дискретных» признаков на основе двух факторов: влияний окружающей среды на экспрессию генов, которые порождают непрерывное распределение фенотипов, и сложного характера расщепления, порождаемое полигенным наследованием. Идентификация одной или более областей генома, связанных с экспрессией количественного признака, характеризует такие области как локусы количественных признаков («QTL»).

Растение: Используемый в настоящем описании термин «растение» может относиться к целому растению, культуре клеток или тканей, полученных из растения, и/или любой части любого из вышеперечисленных. Таким образом, термин «растение» включает, например, и без ограничения, целые растения; компоненты и/или органы растений (например, листья, стебли и корни); ткани растений; семя и клетку растения. Клеткой растения может быть, например, и без ограничения, клетка в и/или из растении(я), клетка, выделенная из растения, и клетка, полученная с помощью культивирования клетки, выделенной из растения.

«Трансгенное растение» представляет собой растение, содержащее в по меньшей мере одной из своих клеток экзогенный полинуклеотид. Термин «трансгенный(ая,ое)» используется в настоящем описании для обозначения любой клетки, клеточной линии, каллуса, ткани, части растения или растения, генотип которой(ого) был изменен в присутствии экзогенной нуклеиновой кислоты. Таким образом, этот термин охватывает трансгенные организмы и клетки, которые были в начале изменены, чтобы содержать экзогенный полинуклеотид, и те организмы и клетки, которые были созданы с помощью скрещиваний или вегетативного размножения исходного трансгенного организма или клетки. Термин «трансгенный», как в настоящем описании используется, не охватывает геномные (хромосомные или экстрахромосомные) изменения, вводимые с помощью обычных методов селекции растений (например, скрещиваний только нетрансгенных организмов) или в результате встречающихся в природе событий (например, случайного перекрестного оплодотворения, нерекомбинантной вирусной инфекции, нерекомбинантной бактериальной трансформации, нерекомбинантной транспозиции и спонтанной мутации).

«Линия», «сорт» или «линия» растения представляет собой группу отдельных растений, имеющих одно и то же происхождение. Растения линии являются, как правило, инбредными до некоторой степени и, как правило, гомозиготными и однородными в большинстве генетических локусов (например, локусе FAD3). «Сублиния» может относиться к инбредному подмножеству потомков общего предка, которые генетически отличаются от других также инбредных подмножеств, произошедших от того же прародителя. В некоторых вариантах осуществления «подлинию» можно получить путем инбридинга семени от отдельного трансгенного растения, отобранного в поколении F3-F5, до тех пор, пока остаточные расщепляющиеся локусы не будут гомозиготными в большей части или во всех локусах.

«Связывающий белок» является белком, который способен к связыванию с другой молекулой. Связывающий белок может связываться, например, с молекулой ДНК (ДНК-связывающий белок), молекулой РНК (РНК-связывающий белок) и/или молекулой белка (белок-связывающий белок). В случае белок-связывающего белка он может связываться с самим собой (с образованием гомодимеров, гомотримеров и т.д.), и/или он может связываться с одной или более молекул отличного белка или белков. Связывающий белок может обладать более чем одним типом активности связывания. Например, белки с цинковыми пальцами обладают ДНК-связывающей, РНК-связывающей и белок-связывающей активностью.

«ДНК-связывающий белок с цинковыми пальцами» (или связывающий домен) является белком, или доменом в более большом белке, который связывается с ДНК специфическим в отношении последовательности образом, благодаря одному или более цинковых пальцев, которые представляют собой участки аминокислотной последовательности внутри связывающего домена, структура которых стабилизирована, благодаря координации иона цинка. Термин «ДНК-связывающий белок с цинковыми пальцами» часто сокращенно называют белком с цинковыми пальцами или ZFP.

«ДНК-связывающий домен TALE» или «TALE» представляет собой полипептид, включающий один или более повторных доменов/единиц TALE. Повторные домены участвуют в связывании TALE с узнаваемой им последовательностью ДНК-мишенью. Длина одной «повторяющейся единицы» (также называемой «повтором»), типично составляет 33-35 аминокислот, и она демонстрирует по меньшей мере некоторую степень гомологии последовательности с другими повторяющимися последовательностями TALE во встречающемся в природе белке TALE.

Можно «сконструировать» связывающие домены «цинковые пальцы» и TALE, которые связываются с заданной нуклеотидной последовательностью, например, через конструирование (изменение одного или более аминокислотных остатков) спирального участка распознавания, встречающегося в природе белка с цинковыми пальцами или TALE. Следовательно, сконструированные ДНК-связывающие белки («цинковые пальцы» или TALE) являются белками, которые не встречаются в природе. Неограничивающие примеры способов конструирования ДНК-связывающих белков являются разработка и отбор. Сконструированный ДНК-связывающий белок представляет собой, не встречающийся в природе белок, разработка/состав которого вытекают в основном из критериев рациональности. Критерии рациональности для разработки включают применение правил замещений и компьютерных алгоритмов для обработки информации в базе данных, хранящей информацию о существующих разработках ZFP и/или TALE и данные о связывании. Смотрите, например, патенты США № 6140081, 6453242 и 6534261; смотрите также WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 и WO 03/016496 и публикацию заявки на патент США № 20110301073.

«Отобранный» белок с цинковыми пальцами или TALE представляет собой, не обнаруживаемый в природе белок, получение которого является в основном результатом эмпирического процесса, такого как фаговый дисплей, ловушка взаимодействия или двугибридная система. Смотрите, например, патент США № 5789538, патент США № 5925523, патент США № 6007988, патент США № 6013453, патент США № 6200759, WO 95/19431; WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970; WO 01/88197; WO 02/099084 и публикацию заявки на патент США № 20110301073.

«Расщепление» относится к разрыву ковалентного остова молекулы ДНК. Расщепление можно инициировать с помощью множества способов, включающих, но без ограничения, ферментативный или химический гидролиз фосфодиэфирной связи. Возможен как одноцепочечный разрыв, так и двухцепочечный разрыв, и двухцепочечный разрыв может происходить в результате двух отдельных событий одноцепочечного разрыва. Расщепление ДНК может приводить к созданию или тупых концов, или липких концов. В некоторых вариантах осуществления составные полипептиды используются для направленного двухцепочечного разрыва ДНК.

«Полдомена для расщепления» представляет собой последовательность полипептида, которая, вместе со вторым полипептидом (или идентичным, или отличным), образует комплекс, обладающий активностью расщепления (предпочтительно активностью двухцепочечного разрыва). Термины «первая и вторая половины домена для расщепления», «+ и - половины домена для расщепления» и «правая и левая половины домена для расщепления» используются взаимозаменяемо для обозначения пар половин домена для расщепления, которые подвергаются димеризации.

«Сконструированный полдомена для расщепления» представляет собой половину домена для расщепления, который был модифицирован, чтобы образовывать облигатные гетеродимеры с другой половиной домена для расщепления (например, другим сконструированным полдоменом для расщепления). Смотрите также публикации заявок на патенты США № 2005/0064474, 20070218528, 2008/0131962 и 2011/0201055, включенные в настоящее описание посредством ссылки в их полном объеме.

Средство для создания двухцепочечного разрыва ДНК: Используемый в настоящем описании термин «средство для создания двухцепочечного разрыва ДНК» предназначен для ссылки на специальные положения-заявления, предусмотренные Конгрессом в §112 35 USC, шестом абзаце. В частности, «средство для создания двухцепочечного разрыва ДНК» относится к молекулярной структуре, которая способна к расщеплению обеих цепей двухцепочечной молекулы ДНК. Такие структуры включают полипептидные домены, включенные во многие известные белки нуклеазы, например, домен с нуклеазной активностью FokI, каталитический домен выбирают из группы, состоящей из белков Mmel, колицина-Е7 (CEA7_ECOLX), колицина-Е9, APFL, EndA, Endo I (END1_EC0LI), Endo G человека (NUCG_HUMAN), Endo G крупного рогатого скота (NUCG_BOVIN), R.HinPll, 1-Basl, 1-Bmol, 1-Hmul, 1-Tevl, 1-Tevll, 1-Tevlll, 1-Twol, R.Mspl, R.Mval, NucA, NucM, Vvn, Vvn_CLS, стафилококковой нуклеазы (NUC_STAAU), стафилококковой нуклеазы (NUC_STAHY), микрококковой нуклеазы (NUC_SHIFL), эндонуклеазы yncB, эндодезоксирибонуклеазы I (ENRN_BPT7), метназы, Nb.BsrDI, BsrDI А, Nt.BspD61 (большой субъединицы R.BspD61), ss.BspD61 (малой субъединицы R.BspD61), R.PIel, Mlyl, Alwl, Mval2691, Bsrl, Bsml, Nb.BtsCI, NtBtsCI, Rl.Btsl, R2.Btsl, субъединицы 1 BbvCI, субъединицы 2 BbvCI, альфа-субъединицы BpulOI, бета-субъединицы BpulOI, Bmrl, Bfil, 1-Crel, hExol (EX01JHUMAN), Exol дрожжей (EX01_YEAST), Exol E.coli, TREX2 человека, TREX1 мыши, TREX1 человека, TREX1 крупного рогатого скота, TREX1 крысы, DNA2 человека, DNA2 дрожжей (DNA2_YEAST).

Средство для репарации двухцепочечного разрыва ДНК: Используемый в настоящем описании термин «средство для репарации для репарации двухцепочечного разрыва ДНК» также предназначен для ссылки на специальные положения-заявления, предусмотренные Конгрессом в §112 35 USC, шестом абзаце. В частности, «средство для репарации двухцепочечного разрыва ДНК» относится к молекулярной структуре, которая способна способствовать/катализировать соединение концов двухцепочечных молекул ДНК, например, путем соединения концов, образованных в результате расщепления одной двухцепочечной молекулы ДНК, или путем соединения одного конца, образованного в результате расщепления одной двухцепочечной молекулы ДНК, с концом экзогенной двухцепочечной молекулы ДНК. Такие структуры включают полипептидные домены, включенные во многие известные белки лигазы, например, рекомбиназу Cre. В некоторых примерах одна и та же молекулярная структура может служить и в качестве средства для создания двухцепочечного разрыва ДНК, и в качестве средства для репарации двухцепочечного разрыва ДНК, причем одна и та же структура способствует как расщеплению, так и репарации двухцепочечных молекул ДНК (например, рекомбиназа Hin).

Индукция сайт-специфических двухцепочечных разрывов в геноме стимулирует путь ДНК-репарации в клетке растения-хозяине, который устраняет двухцепочечный разрыв посредством репарации с использованием гомологичной ДНК (HDR) или репарации с помощью негомологичного соединения концов (NHEJ). В растениях, как описывается в научной литературе, в точной интеграции гена или ДНК-донора в природные места в геноме или в заранее сконструированные места участвовали поступающие конструкции(я) ДНК-донора, которые включают различные количества последовательностей, гомологичных последовательностям, фланкирующим направленный двухцепочечный разрыв. Интеграция таких доноров в конкретный локус-мишень, предположительно, опиралась на путь HDR. Опора только на подход HDR для генного таргетинга в растениях может иметь ограничения в связи с сообщениями, что путь репарации HDR не является господствующим путем репарации ДНК по сравнению с NHEJ. В опубликованной научной литературе, касающейся растений, в которой используются специфические для мишени разрывы ДНК (вызванные ZFN, TALeN или сконструированными мегануклеазами и т.д.), путь NHEJ был описан в качестве способа введения специфических точечных мутаций (вставок или делеций) в геном. В настоящем описании авторы настоящего изобретения сообщают, что сайт-специфические двуцепочечные разрывы (вызванные ZFN, TALeN и т.д.) в присутствии различной донорной ДНК-конструкции, гомологичной районам от 0 до <10 п.о., могут быть специфически внесены в направленном разрыве через путь репарации NHEJ в растениях. Множество разнообразных донорных ДНК-конструкций с гомологией от нулевой до небольшой 1-10 п.н., простирающихся от линейных до замкнутых в круг, от одноцепочечных до двухцепочечных, может быть направлено в определенные места с помощью пути NHEJ. Таргетинг генома растений с использованием донорной ДНК на основе NHEJ может быть основан на «захвате липкого конца», причем направленный двухцепочечный разрыв в геноме создан Fokl (или другими эндонуклеазными доменами типа II), и соответствующие липкие концы находятся на донорных ДНК-конструкциях для NHEJ. Донорная ДНК с липкими концами может быть доставлена непосредственно в клетку в виде линейной донорной ДНК с заданными липкими концами. Альтернативный подход заключается в образовании липких концов донорной ДНК in vivo посредством совместной доставки ZFN хозяина-мишени и донорской молекулы в виде замкнутой в круг ДНК, которая содержит по меньшей мере один сайт распознавания ZFN, который идентичен сайту распознавания-мишени. Экспрессия по меньшей мере одной ZFN приводит к разрывам геномной ДНК хозяина (природной или заранее сконструированной) и замкнутой в круг донорной ДНК с образованием липких концов, которые устраняются с использованием пути репарации NHEJ.

В донорной молекуле может содержаться один или более сайтов расщепления ZFN (один сайт расщепления ZFN для линеаризации всей донорной молекулы, 2 одинаковых сайта для ZFN для высвобождения фрагмента донорной ДНК поменьше или 2 различных сайта для ZFN для высвобождения фрагмента из донора и соответствующего фрагмента от геномной ДНК хозяина (замены ДНК).

Таким образом, полинуклеотид-донор может представлять собой ДНК или РНК, одноцепочечную и/или двухцепочечную, и может быть введен в клетку в линейной или замкнутой в круг форме. Смотрите, например, публикации заявок на патенты США № 20100047805 и 20110207221. В некоторых вариантах осуществления настоящее изобретение может также включать линейную экзогенную (донорную) нуклеиновую кислоту(ы), композиции, включающие эти нуклеиновые кислоты, и способы получения и применения этих линейных донорных молекул. В некоторых вариантах осуществления линейная донорная молекула стабильно сохраняется в клетке, в которую она введена. В других вариантах осуществления линейная донорная молекула подвергнута модификации, чтобы противостоять экзонуклеолитическому расщеплению, например, путем размещения одной или более фосфоротиоатных, фосфодиэфирных связей между одной или более пар оснований на концах донорной молекулы. Линейная экзогенная нуклеиновая кислота может также включать одноцепочечную специфическую ДНК.

IV. Локусы FAD для выполнения операций

Локусы, названные FAD3 (десатураза 3 жирных кислоты) включены в QTL, участвующие в наследовании сложного полигенного признака, касающегося содержания жирных кислот в растениях. FAD3 кодирует фермент, ответственный за десатурацию линолевой кислоты (18:2) до линоленовой кислоты (C18:3). Tanhuanpaa et al. (1998) Mol. Breed. 4: 543-50; Schierholt et al. (2001) Crop Sci. 41: 1444-9.

В пути биосинтеза масла растений десатуразы жирных кислот (FAD) играют ключевую роль в биосинтезе липидов растений, и их активность оказывает существенное влияние на состав жирных кислот. FAD имеются в избытке в растениях, и анализ экспрессии говорит о том, что мРНК для FAD продуцируется в сверхизбыточном количестве. Кроме того, гены FAD экспрессируются в различных тканях и клеточных типах, а также субклеточных компартментах, в том числе пластиде и эндоплазматическом ретикулуме.

Состав жирных кислот растений, а также характеристики масел, полученных из них, во многих приложениях, определяется относительными концентрациями основных жирнокислотных компонентов: олеиновой, линолевой и линоленовой (C18:3) кислот. Концентрации этих жирных кислот преимущественно регулируется в зависимости от ферментов FAD2 и FAD3. Олеиновая кислота превращается в линолевую кислоту и линоленовую кислоту в растениях в соответствии со схемой:

Гены FAD3 были идентифицированы в основных видах растений и водорослей, включая, но без ограничения, кукурузу, сою, хлопчатник, Arabidopsis, пшеницу, кормовые травы, рис, подсолнечник и Brassica, и модификация экспрессии FAD приводит к изменению жирнокислотных профилей у таких организмов. Кроме того, растения, содержащие модифицированные гены FAD, были превращены в источник прибыли, и разрушение гена FAD, как было установлено, может улучшить питательные и функциональные свойства масла, продуцируемого растением-хозяином, без агрономического ухудшения растения-хозяина. Например, сорта канолы и подсолнечника, которые были коммерциализированы под маркой Nexera® (Dow AgroSciences, LLC), характеризуются более высоким содержанием олеиновой кислоты, более низким содержанием линолевой кислоты и более низким содержанием линоленовой кислоты (и более низким содержанием насыщенных жирных кислот), по сравнению с профилями для канолы и подсолнечника дикого типа. Преобладающим видом канолы, выращиваемым в Европе, Северной Америке и Австралии, является Brassica napus, полиплоидный вид Brassica, который, как полагали, возник в результате гибридизации В. oleracea (имеющего диплоидный C геном) и B. rapa (имеющего диплоидный A геном). Цитогенетическое исследование показало, что геномы AA и CC демонстрируют степень родства, являясь частично гомологичными друг другу. Оба А и С генома содержат высокий процент гомеологичных и/или паралогических генов. Соответственно, считается, что геномы АА и СС происходят из генома общего предка. Prakash and Hinata (1980) Opera Botanica 55: 1-57. Хотя геномы обоих видов предков формально относятся к диплоидам, эти геномы содержат высокий процент областей, которые дублируют друг друга. Song et al. (1991) Теор. Appl. Genet. 82: 296-304. Подробный анализ RFLP (полиморфизма длин рестрикционных фрагментов) органелл и ядер показал, что АА геном B. rapa внес десять хромосом в B. napus, в то время как В. oleracea внес девять хромосомы из своего генома СС в качестве донора по материнской линии. Song et al. (1992) Genome 35: 992-1001. Через ряд дупликаций в геномах обоих предков, а также благодаря высокому проценту сходства между A, B и C геномами, возникло несколько копий генов FAD2 и FAD3. С практической точки зрения, этот факт делает сложной селекцию канолы с модифицированными и/или разрушенными копиями этих генов, чтобы получить конкретный жирнокислотный профиль.

Все из известных функциональных копий гена FAD3 в каноле расположены в группе сцепления N4 в А геноме. Scheffler et al. (1997) TAG 94(5): 583-91; Schierholt et al. (2000) TAG 101(5-6): 897-901. Совсем недавно признак, относящийся к высокому содержанию олеиновой кислоты, у канолы был связан с модифицированным и разрушенным геном FAD3, который расположен в А геноме. Публикация заявки на патент США № 2006/0248611 A1; Hu et al. (2006) "Identification and Mapping of FAD2 and FAD3 Mutations and Development of Allele-specific Markers for High Oleic and Low Linolenic Acid Contents in Canola (Brassica napus L.), "Plant & Animal Genomes XIV Conference, January 14-18, 2006, San Diego, CA. Инактивация аллеля FAD3 вносит вклад в контроль содержания олеиновой кислоты путем уменьшения десатурации линолевой кислоты до линоленовой кислоты. Этот признак, относящийся к высокому содержанию олеиновой кислоты и FAD3, был определен в сорте B. napus (DMS100), который имеет характерное содержание олеиновой кислоты, составляющее приблизительно 77%. Смотрите публикацию заявки на патент США № 20060248611. Кроме того, были разработаны генетические маркеры, которые принимают участие в интрогрессии признака, относящегося к FAD3 и высокому содержанию олеиновой кислоты, в канолу.

Локусы FAD3 могут быть модифицированы и/или разрушены в растении без вредного воздействия на ценность растения, и для многих целей, с фактическим увеличением его ценности, в том числе изменением экспрессии FAD3, изменением масличности/соотношений и/или интеграцией и экспрессией желаемых трансгенов. Кроме того, в соответствии с повсеместным характером локусов FAD3 в растениях, FAD3 локусы могут быть модифицированы и/или разрушены без вреда для по меньшей мере некоторых целей для многих видов, в том числе, например, и без ограничения: канолы; сои; кукурузы; пшеницы; кормовых трав; Brassica sp; риса, помидор, ячменя; овса; сорго; хлопчатника и подсолнечника, а также грибов и водорослей. Варианты осуществления настоящего изобретения включают локусы FAD3 и их применение в качестве локусов для выполнения операций - интеграции экзогенных нуклеиновых кислот. В примерах локус FAD3 демонстрирует по меньшей мере один из нескольких признаков, которые, как было установлено, являются желательными в связи с его использованием в качестве локуса для выполнения операций, в том числе, например, и без ограничения: то, что существует приблизительно постоянный уровень экспрессии во время жизненного цикла организма-хозяина; и то, что, как ни удивительно, введение донорской ДНК в локус FAD3 не вызывает ухудшение качества или пригодности хозяина.

В некоторых вариантах осуществления настоящего изобретения по меньшей мере один локус FAD3 (например, локус FAD3A и/или FAD3C) используется в качестве сайта-мишени для сайт-специфической интеграции экзогенной нуклеиновой кислоты (например, нуклеиновой кислоты, включающей нуклеотидную последовательность, кодирующую представляющий интерес полипептид). В конкретных вариантах осуществления интеграция экзогенной нуклеиновой кислоты приводит к модификации локуса. Например, интеграция экзогенной нуклеиновой кислоты может модифицировать локус с образованием разрушенного (т.е. инактивированного) гена FAD3.

В некоторых вариантах осуществления локус FAD3 может включать нуклеотидную последовательность, которая может специфически гибридизоваться с комплементом нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: 20-23, SEQ ID NO: 25-38, SEQ ID NO: 40-45, SEQ ID NO: 47 и SEQ ID NO: 49. Например, локус FAD3 может включать нуклеотидную последовательность, выбираемую из группы, состоящей из SEQ ID NO: 20-23, SEQ ID NO: 25-38, SEQ ID NO: 40-45, SEQ ID NO: 47 и SEQ ID NO: 49. В некоторых вариантах осуществления локус FAD3 может включать нуклеотидную последовательность, которая, по существу, идентична нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: 20-23, SEQ ID NO: 25-38, SEQ ID NO: 40-45, SEQ ID NO: 47 и SEQ ID NO: 49. Например, в некоторых вариантах осуществления локусом FAD3 является гомолог FAD3 (например, ортолог или паралог), который включает нуклеотидную последовательность, которая идентична по меньшей мере приблизительно 85% нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: 20-23, SEQ ID NO: 25-38, SEQ ID NO: 40-45, SEQ ID NO: 47 и SEQ ID NO: 49. Гомолог FAD3 может включать нуклеотидную последовательность, которая, например, и без ограничения, идентична на по меньшей мере 80%, по меньшей мере 85%, по меньшей мере приблизительно 90%, по меньшей мере приблизительно 91%, по меньшей мере приблизительно 92%, по меньшей мере приблизительно 93%, по меньшей мере приблизительно 94%, по меньшей мере приблизительно 95%, по меньшей мере приблизительно 96%, по меньшей мере приблизительно 97%, по меньшей мере приблизительно 98%, по меньшей мере приблизительно 99%, по меньшей мере приблизительно 99,5%, 99,6%, 99,7%, 99,8% и/или по меньшей мере приблизительно 99,9% нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: 20-23, SEQ ID NO: 25-38, SEQ ID NO: 40-45, SEQ ID NO: 47 и SEQ ID NO: 49. Такой гомолог FAD3 можно легко идентифицировать и выделить из любого полного или частичного генома, легкодоступного для квалифицированных в данной области техники специалистов в случае ряда организмов.

IV. Направленная интеграция нуклеиновой кислоты в локус FAD3

Сайт-специфическая интеграция экзогенной нуклеиновой кислоты в локус FAD3 может быть осуществлена любым способом, известным квалифицированным в данной области техники специалистам. В некоторых вариантах осуществления интеграция экзогенной нуклеиновой кислоты в локус FAD3 включает приведение клетки (например, выделенной клетки или клетки в ткани или организма) в контакт с молекулой нуклеиновой кислоты, включающей экзогенную нуклеиновую кислоту. В примерах такая молекула нуклеиновой кислоты может включать нуклеотидные последовательности, фланкирующие экзогенную нуклеиновую кислоту, которые способствуют гомологичной рекомбинации между молекулой нуклеиновой кислоты и по меньшей мере одним локусом FAD3. В конкретных примерах нуклеотидные последовательности, фланкирующие экзогенную нуклеиновую кислоту, которые способствуют гомологичной рекомбинации, могут быть комплементарны эндогенным нуклеотидам локуса FAD3. В конкретных примерах нуклеотидные последовательности, фланкирующие экзогенную нуклеиновую кислоту, которые способствуют гомологичной рекомбинации, могут быть комплементарны ранее интегрированным экзогенным нуклеотидам. В некоторых вариантах осуществления множество экзогенных нуклеиновых кислот может быть интегрировано в один локус FAD3, например, при стэкинге генов.

Интеграцию нуклеиновой кислоты в локус FAD3 может облегчать (например, катализировать) в некоторых вариантах эндогенный клеточный аппарат клетки-хозяина, такой как, например, и без ограничения, эндогенная ДНК и эндогенные ферменты рекомбиназы. В некоторых вариантах осуществления интеграцию нуклеиновой кислоты в локус FAD3 может облегчать один или более факторов (например, полипептидов), которые предоставляются клетке-хозяину. Может быть предоставлена, например, нуклеаза(ы), рекомбинаназа(ы) и/или полипептиды лигазы (либо независимо, либо в составе химерного полипептида) путем контактирования полипептидов с клеткой-хозяином, или путем экспрессии полипептидов в клетке-хозяине. Соответственно, в некоторых примерах нуклеиновая кислота, включающая нуклеотидную последовательность, кодирующую по меньшей мере одну нуклеазу, рекомбиназу и/или полипептид лигазу, может быть введена в клетку-хозяина, или одновременно, или последовательно с нуклеиновой кислотой, которая должна быть интегрирована сайт-специфическим образом в локус FAD3, причем по меньшей мере одна нуклеаза, рекомбиназа и/или полипептид лигаза экспрессируется с нуклеотидной последовательности в клетке-хозяине.

А. ДНК-связывающие полипептиды

В некоторых вариантах осуществления сайт-специфическая интеграция может быть осуществлена путем использования факторов, которые способны распознавать и связывать определенные нуклеотидные последовательности, например, в геноме организма-хозяина. Например, многие белки содержат полипептидные домены, которые способны распознавать и связывать ДНК сайт-специфическим образом. ДНК-последовательность, которая распознается ДНК-связывающим полипептидом, может называться последовательностью-«мишенью». Полипептидные домены, которые способны распознавать и связывать ДНК сайт-специфическим образом, как правило, правильно сворачиваются и функционируют независимо со связыванием ДНК сайт-специфическим образом, даже в случае представленности в полипептиде, отличном от белка, из которого домен был первоначально выделен. Так же последовательности-мишени для распознавания и связывания ДНК-связывающими полипептидами, как правило, могут быть распознаны и связаны такими полипептидами, даже в случае присутствия в больших ДНК-структурах (например, хромосоме), в частности, когда сайт, в котором находится последовательность-мишень, является сайтом, который, как известно, является доступным для растворимых клеточных белков (например, геном).

Хотя ДНК-связывающие полипептиды, идентифицированные на основе белков, которые существуют в природе, типично связываются с дискретной нуклеотидной последовательностью или мотивом (например, консенсусной последовательностью распознавания), в данной области техники существуют и известны методы модификации многих таких ДНК-связывающих полипептидов для распознания отличной нуклеотидной последовательности или мотива. ДНК-связывающие полипептиды включают, например, и без ограничения: ДНК-связывающие домены «цинковые пальцы»; лейциновые молнии; ДНК-связывающие домены UPA; GAL4; TAL; LexA; репрессор Tet; LacR и рецептор стероидного гормона.

В некоторых примерах ДНК-связывающий полипептид представляет собой цинковый палец. Отдельные мотивы «цинковые пальцы» могут быть предназначены для выявления и специфического связывания любого из большого ряда ДНК-сайтов. Полипептиды канонические Cys2His2 (а также неканонические Cys3His) цинковые пальцы связываются с ДНК путем вставки α-спирали в большую бороздку двойной спирали ДНК-мишени. Распознание ДНК цинковым пальцем является модульным; каждый палец контактирует в основном с тремя последовательными парами оснований в мишени, и несколько ключевых остатков в полипептиде опосредуют распознание. Посредством включения множества ДНК-связывающих доменов «цинковые пальцы» в таргетирующую эндонуклеазу, специфичность ДНК-связывания таргетирующей эндонуклеазы можно дополнительно увеличить (и, следовательно, можно также увеличить специфичность любых регуляторных эффектов на гены, обеспечиваемых таким образом). Смотрите, например, Urnov et al. (2005) Nature 435: 646-51. Таким образом, один или более ДНК-связывающих полипептидов «цинковые пальцы» может быть сконструирован и использован из условия, чтобы таргетирующая эндонуклеаза, введенная в клетку-хозяина, взаимодействовала с ДНК-последовательностью, которая является уникальной в геноме клетки-хозяина.

Предпочтительно, когда белок «цинковые пальцы» не встречается в природе, поскольку он сконструирован так, чтобы связываться с предпочтительным сайтом-мишенью. Смотрите, например, Bererli et al. (2002) Nature Biotechnol. 20: 135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70: 313-340; Isalan et al. (2001) Nature Biotechnol. 19: 656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12: 632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10: 411-416; патенты США № 6453242; 6534261; 6599692; 6503717; 6689558; 7030215; 6794136; 7067317; 7262054; 7070934; 7361635; 7253273 и публикации заявок на патенты США № 2005/0064474; 2007/0218528; 2005/0267061, все из которых включены в настоящее описание посредством ссылки в их полном объеме.

Сконструированный связывающий домен «цинковые пальцы» может обладать новой специфичностью связывания, по сравнению со встречающимся в природе белком с цинковыми пальцами. Методы конструирования включают, но без ограничения, разработку на основе критериев рациональности и различные типы отбора. Разработка на основе критериев рациональности включает, например, использование баз данных, включающих последовательности нуклеотидов в триплетах (или квадруплетах) и аминокислотные последовательности отдельных цинковых пальцев, в которых каждая последовательность нуклеотидов в триплетах или квадруплетах связана с одной или более аминокислотных последовательностей цинковых пальцев, которые связываются с конкретной последовательностью в виде триплета или квадруплета. Смотрите, например, находящиеся в совместной собственности патенты США № 6453242 и 6534261, которые включены в настоящее описание посредством ссылки в их полном объеме.

Приводимые в качестве примера методы отбора, включающие фаговый дисплей и двугибридные системы, описаны в патентах США № 5789538, 5925523, 6007988, 6013453, 6410248, 6140466, 6200759 и 6242568, а также WO 98/37186, WO 98/53057, WO 00/27878, WO 01/88197 и GB 2338237. Кроме того, увеличение специфичности связывания для связывающих доменов «цинковые пальцы» было описано, например, в находящейся в совместной собственности заявке WO 02/077227.

Кроме того, как описано в этих и других ссылках, домены «цинковые пальцы» и белки с множеством цинковых пальцев могут быть связаны друг с другом с использованием любых подходящих линкерных последовательностей, в том числе, например, линкеров длиной 5 или более аминокислот. Смотрите также патенты США № 6479626; 6903185 и 7153949 ради приводимых в качестве примера линкерных последовательностей длиной 6 или более аминокислот. Белки, описываемые в настоящем документе, могут включать любую комбинацию подходящих линкеров между отдельными цинковыми пальцами белка.

Выбор сайтов-мишеней; ZFP и методы разработки и конструирования составных белков (и кодирующих их полинуклеотидов) известны квалифицированным в данной области техники специалистам и подробно описаны в патентах США № 61400815; 789538; 6453242; 6534261; 5925523; 6007988; 6013453; 6200759; WO 95/19431; WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970; WO 01/88197; WO 02/099084; WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 и WO 03/016496.

Кроме того, как описано в этих и других ссылках, домены «цинковые пальцы» и/или белки с множеством цинковых пальцев могут быть связаны друг с другом с использованием любых подходящих линкерных последовательностей, в том числе, например, линкеров длиной 5 или более аминокислот. Смотрите также, патенты США № 6479626; 6903185 и 7153949 ради приводимых в качестве примера линкерных последовательностей длиной 6 или более аминокислот. Белки, описываемые в настоящем документе, могут включать любую комбинацию подходящих линкеров между отдельными цинковыми пальцами белка.

В некоторых примерах ДНК-связывающий полипептид представляет собой ДНК-связывающий домен из GAL4. GAL4 является модульным трансактиватором в Saccharomyces cerevisiae, но он также функционирует в качестве трансактиватора во многих других организмах. Смотрите, например, Sadowski et al. (1988) Nature 335: 563-4. В этой регуляторной системе экспрессию генов, кодирующих ферменты пути метаболизма галактозы в S. cerevisiae, строго регулирует доступный источник углерода. Johnston (1987) Microbiol. Rev. 51: 458-76. Транскрипционный контроль этих метаболических ферментов опосредуется взаимодействием между положительным регуляторным белком, GAL4, и симметричной последовательностью ДНК размером 17 п.о., с которой специфически связывается GAL4 (UAS).

Встречающийся в природе GAL4 включает 881 аминокислотный остаток, с молекулярной массой, составляющей 99 кДа. GAL4 содержит функционально автономные домены, объединенные активности которых обуславливают активность GAL4 in vivo. Ма and Ptashne (1987) Cell 48: 847-53); Brent and Ptashne (1985) Cell 43 (3 Pt 2): 729-36. N-концевые 65 аминокислот GAL4 содержат ДНК-связывающий домен GAL4. Keegan et al. (1986) Science 231: 699-704; Johnson (1987) Nature 328: 353-5. Для специфического в отношении последовательности связывания требуется присутствие двухвалентного катиона, координируемого 6 остатками Cys, присутствующими в ДНК-связывающем домене. Содержащий скоординированный катион домен взаимодействует с и распознает консервативный триплеп(ом) CCG на каждом конце UAS размером 17 п.о. через прямые контакты с большой бороздкой спирали ДНК. Marmorstein et al. (1992) Nature 356: 408-14. ДНК-связывающая функция белка устанавливает С-концевые домены активации транскрипцию в непосредственной близости от промотора, так что домены активации могут направлять транскрипцию.

Дополнительные ДНК-связывающие полипептиды, которые могут использоваться в некоторых вариантах осуществления, включают, например, и без ограничения, связывающие последовательности из AVRBS3-индуцируемого гена; консенсусную связывающую последовательность из AVRBS3-индуцируемого гена или синтетическую связывающую последовательность, сконструированную на ее основе (например, ДНК-связывающий домен UPA); TAL; LexA (смотрите, например, Brent & Ptashne (1985), выше); LacR (смотрите, например, Labow et al. (1990) Mol. Cell Biol. 10: 3343-56; Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88 (12): 5072-6); рецептор стероидного гормона (Elliston et al. (1990) J. Biol Chem 265: 11517-121); репрессор Tet (гена устойчивости к тетрациклину) (патент США № 6271341), и мутантный репрессор Tet, который связывается с последовательностью оператора tet в присутствии, но не отсутствие, тетрациклина (Tc); ДНК-связывающий домен NF-κB; и компоненты регуляторной системы, описанной в Wang et al. (1994) Proc. Natl. Acad. Sci. USA 91(17): 8180-4, в которой используется слияние GAL4, рецептора гормона, и VP16.

В некоторых вариантах осуществления ДНК-связывающий домен одной или более нуклеаз, используемых в описываемых в настоящем документе способах и композициях, включает встречающийся в природе или сконструированный (не встречающийся в природе) ДНК-связывающий домен TAL-эффектора. Смотрите, например, публикацию заявки на патент США № 20110301073, которая включена в настоящее описание посредством ссылки в ее полном объеме. Патогенные бактерии растений рода Xanthomonas являются, как известно, причиной многих заболеваний важных культурных растений. Патогенность Xanthomonas зависит от консервативной секреторной системы типа III (T3S), которая вводит более 25 различных эффекторных белков в клетку растения. Среди этих вводимых белков находятся эффекторы вроде активаторов транскрипции (TAL), которые имитируют активаторы транскрипции растений и манипулируют транскриптомом растения (смотрите Kay et al. (2007) Science 318: 648-651). Эти белки содержат ДНК-связывающий домен и домен активации транскрипции. Одним из наиболее полно охарактеризованных TAL-эффекторов является AvrBs3 из Xanthomonas campestgris pv Vesicatoria (смотрите Bonas et al. (1989) Mol Gen Genet 218: 127-136 и WO2010079430). TAL-эффекторы содержат центрированный домен тандемных повторов, при этом каждый повтор содержит приблизительно 34 аминокислот, которые являются ключевыми для специфичности связывания с ДНК этих белков. Кроме того, они содержат последовательность ядерной локализации и кислотный домен активации транскрипции (для обзора смотрите Schornack S, et al. (2006) J. Plant Physiol (3): 256-272). Кроме того, у фитопатогенных бактерий Ralstonia solanacearum были обнаружены два гена, названные brg11 и hpx17, которые гомологичны семейству AvrBs3 Xanthomonas, у штамма GMI1000 биовара 1 Р. solanacearum и штамма RS1000 биовара 4 (смотрите Heuer et al. (2007) Appl and Envir Micro 73 (13): 4379-4384). Эти гены идентичны на 98,9% по нуклеотидной последовательности друг другу, но отличаются делецией 1575 п.о. в домене повторов hpxl7. Однако оба продукта генов идентичны на менее чем 40% по последовательности белкам семейства AvrBs3 Xanthomonas. Смотрите, например, патенты США № 8420782 и 8440431 и публикацию заявки на патент США № 20110301073.

В других вариантах осуществления нуклеаза включает систему CRISPR/Cas. Локус CRISPR (короткие палиндромные повторы, регулярно расположенные группами), который кодирует РНК-компоненты системы, и локус Cas (связываемый с CRISPR), который кодирует белки (Jansen et al. 2002. Mol. Microbiol 43: 1565-1575; Makarova et al. 2002 Nucleic Acids Res. 30: 482-496; Makarova et al. 2006 Biol Direct 1: 7; Haft et al. 2005 PLoS Comput Biol 1: e60) составляют последовательности генов нуклеазной системы CRISPR/Cas. Локусы CRISPR в микробных хозяевах содержат комбинацию связываемых с CRISPR (Cas) генов, а также некодирующие РНК-элементы, способные программировать специфичность CRISPR-опосредованного расщепления нуклеиновых кислот.

CRISPR типа II является одной из наиболее хорошо охарактеризованных систем и осуществляет направленный двухцепочечный разрыв ДНК в четыре последовательных шага. Во-первых, две некодирующие РНК, масса пре-(CRISPR РНК) и трансактивирующая CRISPR РНК, транскрибируются с локуса CRISPR. Во-вторых, трансактивирующая CRISPR РНК гибридизируется с районами повторов пре-(CRISPR РНК) и опосредует процессирование пре-(CRISPR РНК) в зрелые CRISPR РНК, содержащие индивидуальные спейсерные последовательности. В-третьих, комплекс зрелая CRISPR РНК:трансактивирующая CRISPR РНК направляет Cas9 к ДНК-мишени через спаривание оснований по Уотсону-Крику между спейсером в CRISPR РНК и протоспейсером в ДНК-мишени, рядом с прилегающем к фотоспейсеру мотивом (PAM), дополнительным требованием для распознания мишени. Наконец, Cas9 опосредует расщепление ДНК-мишени с созданием двухцепочечного разрыва в фотоспейсере. Активность системы CRISPR/Cas состоит из трех этапов: (I) введения чужеродных последовательностей ДНК в массу CRISPR для предотвращения будущих атак, в процессе, называемом «адаптация», (II) экспрессии соответствующих белков, а также экспрессии и процессировании массы CRISPR, а затем (III) РНК-опосредованной интерференции с помощью чужеродных нуклеиновых кислот. Таким образом, в бактериальной клетке некоторые из так называемых белков «Cas» связаны с естественной функцией системы CRISPR/Cas и выполняют роли в таких функциях, таких как вставка чужеродной ДНК и т.д.

В некоторых вариантах осуществления белок Cas может быть «функциональным производным» встречающегося в природе белка Cas. «Функциональным производным» полипептида со встречающейся в природе последовательностью является соединение, обладающее качественным биологическим свойством, общим с полипептидом со встречающейся в природе последовательностью». «Функциональные производные» включают, но не ограничения, фрагменты природной последовательности и производные полипептида со встречающейся в природе последовательностью и его фрагментов, при условии, что они обладают биологической активностью, общей с соответствующим полипептидом со встречающейся в природе последовательностью. Предусматриваемая в настоящем описании биологическая активность представляет собой способность функционального производного к гидролизу ДНК-субстрата на фрагменты. Термин «производное» охватывает как варианты аминокислотной последовательности полипептида, ковалентные модификации, так и их слияния. Подходящие производные полипептида Cas или его фрагмента включают, но не ограничения, мутанты, слияния, ковалентные модификации белка Cas или его фрагмента. Белок Cas, который включает белок Cas или его фрагмент, а также производные белка Cas или его фрагмента, могут быть получены из клетки или синтезированы химически или с помощью комбинации этих двух процедур. Клетка может представлять собой клетку, которая от природы продуцирует белок Cas, или клетку, которая от природы продуцирует белок Cas и генетически сконструирована для продуцирования эндогенного белка Cas на более высоком уровне экспрессии или для продукции белка Cas из экзогенно введенной нуклеиновой кислоты, кодирующей Cas, который является таким же, как эндогенный Cas, или отличается от него. В некоторых случаях клетка по природе не продуцирует белок Cas и генетически сконструирована для продуцирования белка Cas.

В конкретных вариантах ДНК-связывающий полипептид специфически распознает и связывает нуклеотидную последовательность-мишень, включенную в геномную нуклеиновую кислоту организма-хозяина. Любое количество дискретных случаев нуклеотидной последовательности-мишени может быть найдено в геноме хозяина в некоторых примерах. Нуклеотидная последовательность-мишень может быть редкой в геноме организма (например, менее чем приблизительно 10, приблизительно 9, приблизительно 8, приблизительно 7, приблизительно 6, приблизительно 5, приблизительно 4, приблизительно 3, приблизительно 2 или приблизительно 1 копии(й) последовательности-мишени может существовать в геноме). Например, нуклеотидная последовательность-мишень может быть расположена в уникальном сайте в геноме организма. Нуклеотидные последовательности-мишени могут быть, например, и без ограничения, случайным образом распределены по геному относительно друг друга; расположены в разных группах сцепления в геноме; расположены в одной и той же группе сцепления; расположены на разных хромосомах; расположены на одной и той же хромосоме, расположены в геноме в сайтах, которые экспрессируются в аналогичных условиях в организме (например, под контролем одних и тех же или, по существу, функционально идентичных регуляторных факторов); и расположен близко друг к другу в геноме (например, последовательности-мишени могут быть включены в нуклеиновые кислоты, интегрированные в виде конкатемеров в геномные локусы).

B. Таргетирующие эндонуклеазы

В конкретных вариантах осуществления ДНК-связывающий полипептид, который специфически распознает и связывает нуклеотидную последовательность-мишень, может быть включен в химерный полипептид для придания химерному полипептиду специфичности связывания с последовательностью-мишенью. В примерах, такой химерный полипептид может включать, например, и без ограничения, нуклеазу, рекомбиназу и/или полипептиды с лигазной активностью, учитывая, что эти полипептиды описаны выше. Химерные полипептиды, включающие ДНК-связывающий полипептид и нуклеазу, рекомбиназу и/или полипептид лигазы, могут также включать другие функциональные полипептидные мотивы и/или домены, такие как, например, и без ограничения: спейсерная последовательность, расположенная между функциональными полипептидами в химерном белке; лидерный пептид; пептид, который направляет составной белок в органеллу (например, ядро); полипептиды, которые расщепляются под действием клеточного фермента; пептидные метки (например, Myc, His и т.д.); и другие аминокислотные последовательности, которые не мешают функции химерного полипептида.

Функциональные полипептиды (например, ДНК-связывающие полипептиды и полипептиды с нуклеазной активностью) в химерном полипептиде могут быть функционально связаны. В некоторых вариантах осуществления функциональные полипептиды химерного полипептида могут быть функционально связаны путем их экспрессии с одного полинуклеотида, кодирующего по меньшей мере функциональные полипептиды, лигированные друг с другом в рамке для создания химерного гена, кодирующего химерный белок. В альтернативных вариантах осуществления функциональные полипептиды химерного полипептида могут быть функционально связаны с помощью других средств, например, путем поперечной связи независимо экспрессируемых полипептидов.

В некоторых вариантах осуществления ДНК-связывающий полипептид, который специфически распознает и связывает нуклеотидную последовательность-мишень, может быть включен в природный выделенный белок (или его мутант), причем природный выделенный белок или его мутант также содержит полипептид с нуклеазной активностью (а также может содержать полипептид с рекомбиназной и/или лигазной активностью). Примеры таких выделенных белков включают TALEN, рекомбиназы (например, Cre, Hin, Tre и рекомбиназу FLP), РНК-направляемую CRISPR-Cas9 и мегануклеазы.

Используемый в настоящем описании термин «таргетирующая эндонуклеаза» относится к природным или сконструированным выделенным белкам и их мутантам, включают ДНК-связывающий полипептид и полипептид с нуклеазной активностью, а также к химерным полипептидам, включающим ДНК-связывающий полипептид и нуклеазу. Любая таргетирующая эндонуклеаза, включающая ДНК-связывающий полипептид, который специфически распознает и связывает нуклеотидную последовательность-мишень, включенную в локус FAD3 (например, или поскольку последовательность-мишень включена в природную последовательность в этом локусе, или поскольку последовательность-мишень была введена в локус, например, посредством рекомбинации), может использоваться в некоторых вариантах осуществления.

Некоторые примеры химерных полипептидов, которые могут применяться в конкретных вариантах осуществления настоящего изобретения, включают, без ограничения, комбинации следующих полипептидов: ДНК-связывающие полипептиды «цинковые пальцы»; полипептид с нуклеазной активностью Fokl; домены TALE; лейциновые молнии; ДНК-связывающие мотивы факторов транскрипции; и ДНК-распознающие и/или расщепляющие домены, выделенные, например, и без ограничения, из TALEN, рекомбиназы (например, Cre, Hin, RecA, Tre и рекомбиназ FLP), РНК-направляемой CRISPR-Cas9, мегануклеазы и других, известных специалистам в данной области техники. Конкретные примеры включают химерный белок, включающий сайт-специфический ДНК-связывающий полипептид и полипептид с нуклеазной активностью. Химерные полипептиды могут быть сконструированы с использованием способов, известных квалифицированным в данной области техники специалистам, чтобы изменить последовательность распознавания ДНК-связывающего полипептида, включенного в химерный полипептид, для направления химерного полипептида к конкретной нуклеотидной последовательности, представляющей интерес.

В некоторых вариантах осуществления химерный полипептид включает ДНК-связывающий домен (например, цинковый палец, домен TAL-эффектора и т.д.) и домен с нуклеазной активностью (расщепления). Расщепляющий домен может быть гетерологичным по отношению к ДНК-связывающему домену, например, ДНК-связывающему домену «цинковые пальцы» и расщепляющему домену из нуклеазы, или ДНК-связывающему домену и расщепляющему домену TALEN, или ДНК-связывающему домену мегануклеазы и расщепляющему домену из другой нуклеазы. Гетерологичные расщепляющие домены могут быть получены из любой эндонуклеазы или экзонуклеазы. Примеры эндонуклеаз, из которых может быть получен расщепляющий домен, включают, но без ограничения, эндонуклеазы рестрикции и хоминг-эндонуклеазы. Смотрите, например, 2002-2003 Catalogue, New England Biolabs, Beverly, MA; и Belfort et al. (1997) Nucleic Acids Res. 25: 3379-3388. Известны дополнительные ферменты, которые расщепляют ДНК, (например, нуклеаза S1; нуклеаза фасоли золотистой; ДНКаза I поджелудочной железы; нуклеаза микрококков; дрожжевая HO эндонуклеаза; смотрите также Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). Один или более из этих ферментов (или их функциональных фрагментов) могут использоваться в качестве источника расщепляющих доменов и половин доменов для расщепления.

Так же из любой нуклеазы или ее части, изложенной выше, может быть получен полдомена для расщепления, для которого требуется димеризация для активности расщепления. В общем, два составных белка необходимы для расщепления, если составные белки содержат половины домена для расщепления. В качестве альтернативы может использоваться один белок, содержащий две половины домена для расщепления. Две половины домена для расщепления могут быть получены из одной и той же эндонуклеазы (или ее функциональных фрагментов), или каждый полдомена для расщепления может быть получен из отличных эндонуклеаз (или их функциональных фрагментов). Кроме того, сайты-мишени для двух составных белков предпочтительно расположены, по отношению друг к другу, таким образом, что связывание двух составных белков в соответствующих им сайтах-мишенях устанавливает половины домена для расщепления в пространственной ориентации друг к другу, которая позволяет половинам домена для расщепления образовывать функциональный домен расщепления, например, путем димеризации. Таким образом, в некоторых вариантах осуществления ближайшие края сайтов-мишеней разделены 5-8 нуклеотидами или 15-18 нуклеотидами. Однако любое целое число нуклеотидов или пар нуклеотидов может вставать между двумя сайтами-мишенями (например, от 2 до 50 пар нуклеотидов или более). В общем, сайт расщепления находится между сайтами-мишенями.

Эндонуклеазы рестрикции (рестрикционные ферменты) присутствуют у многих видов и способны к специфическому в отношении последовательности связыванию с ДНК (в рестрикционном сайте) и расщеплению ДНК в или вблизи сайта(е) связывания, например, так что одна или более экзогенных последовательностей (доноров/трансгенов) интегрируется в или вблизи сайта(е) связывания. Некоторые рестрикционные ферменты (например, типа IIS) расщепляют ДНК в сайтах, удаленных от сайта распознавания, и имеют разделимые связывающий и расщепляющий домены. Например, фермент типа IIS FokI катализирует двухцепочечный разрыв ДНК, на расстоянии 9 нуклеотидов от его сайта распознавания на одной цепи и на расстоянии 13 нуклеотидов от его сайта распознавания на другой цепи. Смотрите, например, патенты США № 5356802, 5436150 и 5487994; а также Li et al. (1992) Proc. Natl. Acad. Sci. USA 89: 4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90: 2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91: 883-887; Kim et al. (1994b) J Biol. Chem. 269: 31978-31982. Таким образом, в одном варианте осуществления составные белки включают расщепляющий домен (или полдомена для расщепления) из по меньшей мере одного рестрикционного фермента типа IIS и один или более связывающих доменов «цинковые пальцы», которые могут быть или могут не быть сконструированными.

Приводимым в качестве примера рестрикционным ферментом типа IIS, расщепляющий домен которого является отделимым от связывающего домена, является FokI. Этот конкретный фермент является активным в виде димера. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10570-10575. Соответственно, применительно к целям настоящего описания, часть фермента FokI, используемая в описываемых составных белках, считается половиной домена для расщепления. Таким образом, для направленного двухцепочечного разрыва и/или направленного замещения клеточных последовательностей, используя слияния цинковый палец-FokI, два составных белка, каждый из которых включает полдомена для расщепления FokI, могут использоваться для воссоздания каталитически активного расщепляющего домена. Альтернативно, может также использоваться одна молекула полипептида, содержащая ДНК-связывающий домен и две половины домена для расщепления FokI.

Расщепляющий домен или полдомена для расщепления может быть любой частью белка, в которой сохраняется активность расщепления, или в которой сохраняется способность к мультимеризации (например, димеризации) с образованием функционального расщепляющего домена.

Приводимые в качестве примера рестрикционные ферменты типа IIS описаны в публикации заявки на патент США № 20070134796, которая включена в настоящее описание в ее полном объеме. Дополнительные ферменты рестрикции также содержат отделимые связывающий и расщепляющий домены, и они предусматриваются в настоящем описании. Смотрите, например, Roberts et al. (2003) Nucleic Acids Res. 31: 418-420.

В некоторых вариантах осуществления расщепляющий домен включает одну или более сконструированных половин доменов для расщепления (также называемых мутантами домена, подвергаемого димеризации), которые минимизируют или предотвращают гомодимеризацию, которые описаны, например, в публикациях заявок на патенты США № 20050064474; 20060188987 и 20080131962, описание каждой из которых включено в настоящее описание посредством ссылки в ее полном объеме. Все из аминокислотных остатков в положениях 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537 и 538 FokI являются мишенями для оказания влияния на димеризацию половин доменов для расщепления FokI.

Приводимые в качестве примера сконструированные половины доменов для расщепления FokI, которые образуют облигатные гетеродимеры, включают пары, в которых первая половина домена для расщепления включает мутации в аминокислотных остатках в положениях 490 и 538 FokI, а вторая половина домена для расщепления включает мутации в аминокислотных остатках 486 и 499.

Таким образом, в одном варианте осуществления мутация в положении 490 приводит к замене Glu (E) на Lys (K); мутация в положении 538 приводит к замене Iso (I) на Lys (К); мутация в положении 486 приводит к замене GLn (Q) на Glu (E); и мутация в положении 499 приводит к замене Iso (I) на Lys (K). В частности, сконструированные половины доменов для расщепления, описываемые в настоящем документе, были приготовлены посредством вызова мутаций в положениях 490 (E→K) и 538 (I→K) в одной половине домена для расщепления с созданием сконструированного полдомена для расщепления, названного «E490K:I538K2», и посредством вызова мутаций в положениях 486 (Q→E) и 499 (I→L) в другой половине домена для расщепления с созданием сконструированного полдомена для расщепления, названного «Q486E:I499L». Сконструированные половины доменов для расщепления, описываемые в настоящем документе, являются мутантами облигатных гетеродимеров, в которые аберрантное расщепление минимизировано или исключено. Смотрите, например, публикацию заявки на патент США № 2008/0131962, описание которой включено посредством ссылки в ее полном объеме для всех целей.

В некоторых вариантах осуществления сконструированная половина домена для расщепления включает мутации в положениях 486, 499 и 496 (пронумерованных относительно FokI дикого типа), например, мутации, которые приводят к замене остатка дикого типа Gln (Q) в положении 486 на остаток Glu (E), остатка дикого типа Iso (I) в положении 499 на остаток Leu (L) и остатка дикого типа Asn (N) в положении 496 на остаток Asp (D) или Glu (E) (также называемая доменами «ELD» и «ELE», соответственно). В других вариантах осуществления сконструированная половина домена для расщепления включает мутации в положениях 490, 538 и 537 (пронумерованных относительно FokI дикого типа), например, мутации, которые приводят к замене остатка дикого типа Glu (E) в положении 490 на остаток Lys (K), остатка дикого типа Iso (I) в положении 538 на остаток Lys (K) и остатка дикого типа His (H) в положении 537 на остаток Lys (K) или остаток Arg (R) (также называемая доменами «KKK» и «KKR», соответственно). В других вариантах осуществления сконструированная половина домена для расщепления включает мутации в положениях 490 и 537 (пронумерованных относительно FokI дикого типа), например, мутации, которые приводят к замене остатка дикого типа Glu (E) в положении 490 на остаток Lys (K) и остатка дикого типа His (H) в положении 537 на остаток Lys (K) или остаток Arg (R) (также называемая доменами «KIK» и «KIR», соответственно). (Смотрите публикацию заявки на патент США № 20110201055). Сконструированные половины доменов для расщепления, описываемые в настоящем документе, можно приготовить, используя любой подходящий способ, например, сайт-направленный мутагенез половин доменов для расщепления дикого типа (FokI), как описано в публикациях заявок на патенты США № 20050064474; 20080131962 и 20110201055.

Альтернативно, нуклеазы могут подвергаться сборке in vivo на сайте-мишени нуклеиновой кислоты, используя так называемую технологию «разделенных ферментов» (смотрите, например, публикацию заявки на патент США № 20090068164). Компоненты таких разделенных ферментов могут экспрессироваться или с отдельных экспрессионных конструкций, или могут быть соединены в одну открытую рамку считывания, в которой отдельные компоненты разделены, например, саморасщепляющимся пептидом 2A или последовательностью IRES. Компонентами могут быть отдельные связывающие домены «цинковые пальцы» или домены в виде связывающего нуклеиновую кислоту домена мегануклеазы.

C. Нуклеазы на основе цинковых пальцев

В конкретных вариантах осуществления химерный полипептид представляет собой специально разработанную нуклеазу на основе цинковых пальцев (ZFN), которая может быть предназначена для осуществления направленного сайт-специфического двухцепочечного разрыва ДНК, в который может быть интегрирована экзогенная нуклеиновая кислота, или донорная ДНК (смотрите находящуюся в совместной собственности публикацию заявки на патент США № 20100257638, которая включена в настоящее описание посредством ссылки). ZFN представляют собой химерные полипептиды, содержащие домен для неспецифического расщепления из рестрикционной эндонуклеазы (например, FokI) и полипептид ДНК-связывающий домен «цинковые пальцы». Смотрите, например, Huang et al. (1996), J. Protein Chem 15: 481-9; Kim et al. (1997a) Proc. Natl. Acad. Sci. Sci. USA 94: 3616-20; Kim et al. (1996) Proc. Natl. Acad. Sci. USA 93: 1156-60; Kim et al. (1994) Proc Natl. Acad. Sci. USA 91: 883-7; Kim et al. (1997b) Proc. Natl. Acad. Sci. USA 94: 12875-9; Kim et al. (1997c) Gene 203: 43-9; Kim et al. (1998) Biol. Chem. 379: 489-95; Nahon and Raveh (1998) Nucleic Acids Res. 26: 1233-9; Smith et al. (1999) Nucleic Acids Res. 27: 674-81. В некоторых вариантах осуществления ZFN включают ДНК-связывающие домены «неканонические цинковые пальцы» (смотрите находящуюся в совместной собственности публикацию заявки на патент США № 20080182332, которая включена в настоящее описание посредством ссылки). Рестрикционная эндонуклеаза FokI должна подвергнуться димеризации через домен с нуклеазной активностью для того, чтобы расщеплять ДНК и вводить двухцепочечный разрыв. Следовательно, в случае ZFN, содержащих домен с нуклеазной активностью из такой эндонуклеазы, также требуется димеризация домена с нуклеазной активностью, чтобы расщеплять ДНК-мишень. Mani et al. (2005) Biochem. Biophys. Res. Commun. 334: 1191-7; Smith et al. (2000) Nucleic Acids Res. 28: 3361-9. Димеризации ZFN могут способствовать два смежных, противоположно ориентированных ДНК-связывающих сайта.

Гибкость и специфичность системы ZFN обеспечивает уровень контроля, ранее недостижимый с помощью известных стратегий редактирования генов с использованием рекомбиназы. В качестве одного примера, можно без труда сконструировать ZFN, которые, например, распознают специфические последовательности нуклеиновых кислот. Wu et al. (2007) Cell. Mol. Life Sci. 64: 2933-44 (Смотрите публикации заявок на патенты США № 20090205083, 20110189775, 20110167521 и 20100199389, включенные в настоящее описание посредством ссылки в их полном объеме). Рандомизация кодонов для остатков для распознавания цинковых пальцев позволяет отобрать новые пальцы, которые имеют высокое сродство к произвольно выбранным последовательностям ДНК. Кроме того, цинковые пальцы представляют собой встречающиеся в природе ДНК-связывающие молекулы, и сконструированные цинковые пальцы, как было показано, действуют на предназначенные для них мишени в живых клетках. Таким образом, нуклеазы на основе цинковых пальцев могут быть направлены на специфические, но произвольные сайты распознавания.

В конкретных примерах способ сайт-специфической интеграции экзогенной нуклеиновой кислоты в по меньшей мере один локус FAD3 хозяина для выполнения операций включает введение в клетку хозяина ZFN, причем ZFN распознает и связывает нуклеотидную последовательность-мишень, причем нуклеотидная последовательность-мишень включена в по меньшей мере один локус FAD3 хозяина. В некоторых примерах нуклеотидная последовательность-мишень не включена в геном хозяина в каком-либо другом положении, чем по меньшей мере один локус FAD3. Например, можно сконструировать ДНК-связывающий полипептид ZFN, который распознает и связывает нуклеотидную последовательность-мишень, определяемую в по меньшей мере одном локусе FAD3 (например, посредством секвенирования локуса FAD3). Способ сайт-специфической интеграции экзогенной нуклеиновой кислоты в по меньшей мере один локус FAD3 хозяина для выполнения операций, который включает введение в клетку хозяина ZFN, может также включать введение в клетку экзогенной нуклеиновой кислоты, причем рекомбинации экзогенной нуклеиновой кислоты с нуклеиновой кислотой хозяина, включающей по меньшей мере один локус FAD3, способствует сайт-специфическому распознаванию и связыванию ZFN с последовательностью-мишенью (и последующее расщепление нуклеиновой кислоты, включающей локус FAD3).

VI. Экзогенные нуклеиновые кислоты для интеграции в локус FAD3

Варианты осуществления настоящего изобретения могут включать одну или более нуклеиновых кислот, выбираемых из группы, состоящей из: экзогенной нуклеиновой кислоты для сайт-направленной интеграции в по меньшей мере один локус FAD3, например, и без ограничения, PTU, ELP, ETIP или ORF; нуклеиновой кислоты, включающей нуклеотидную последовательность, кодирующую таргетирующую эндонуклеазу; и вектора, содержащего по меньшей мере одну из двух или обе из вышеизложенных нуклеиновых кислот. Таким образом, конкретные нуклеиновые кислоты для использования в некоторых вариантах осуществления включают нуклеотидные последовательности, кодирующие полипептид, структурные нуклеотидные последовательности, и/или сайты распознания и связывания ДНК-связывающего полипептида.

А. Экзогенные молекулы нуклеиновых кислот для сайт-специфической интеграции

Как отмечено выше, вставка экзогенной последовательности (также называемой «донорной последовательностью» или «донором или «трансгеном») предусматривается, например, для экспрессии полипептида, коррекции мутантного гена или для увеличения экспрессии гена дикого типа. Должно быть очевидно, что донорная последовательность типично не идентична геномной последовательности, где она размещается. Донорная последовательность может содержать негомологичную последовательность, фланкированную двумя участками гомологии для обеспечения эффективной HDR в представляющем интерес месте. Кроме того, донорные последовательности могут включать векторную молекулу, содержащую последовательности, которые не гомологичны представляющей интерес области в хроматине клетки. Донорная молекула может содержать несколько прерывистых участков гомологии хроматину клетки. Например, для направленной вставки последовательностей, как правило, не присутствующих в представляющей интерес области, указанные последовательности могут присутствовать в донорной молекуле нуклеиновой кислоты и быть фланкированы участками гомологии последовательности в представляющей интерес области.

Полинуклеотид-донор может представлять собой ДНК или РНК, одноцепочечную или двухцепочечную, и может быть введен в клетку в линейной или замкнутой в круг форме. Смотрите, например, публикации заявок на патенты США № 20100047805, 20110281361, 20110207221 и заявку № 13/889162. В случае введения в линейной форме концы донорной последовательности могут быть защищены {например, от экзонуклеолитической деградации) с помощью способов, известных квалифицированным в данной области техники специалистам. Например, один или более дидезоксинуклеотидных остатков добавляют к 3'-концу линейной молекулы, и/или самокомплементарные олигонуклеотиды лигируют с одним или с обоих концов. Смотрите, например, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84: 4959-4963; Nehls et al. (1996) Science 272: 886-889. Дополнительные способы защиты экзогенных полинуклеотидов от деградации включают, но без ограничения, добавление концевых аминогрупп(ы) и использование модифицированных межнуклеотидных связей, таких как, например, фосфоротиоаты, фосфорамидаты, и O-метилрибозных или дезоксирибозных остатков.

Полинуклеотид может быть введен в клетку в виде части векторной молекулы, содержащей дополнительные последовательности, такие как, например, начала репликации, промоторы и гены, кодирующие устойчивость к антибиотикам. Кроме того, полинуклеотиды-доноры могут быть введены в виде «голой» нуклеиновой кислоты, в виде нуклеиновой кислоты в комплексе с таким агентом, как липосома или полоксамер, или могут быть доставлены с помощью вирусов {например, аденовируса, AAV, вируса герпеса, ретровируса, лентивируса и дефектного по интегразе лентивируса (IDLV)).

Донор обычно интегрируется так, что его экспрессия приводится в действие эндогенным промотором в сайте интеграции, а именно промотором, который управляет экспрессией эндогенного гена, в который интегрируется донор, (например, FAD3). Однако будет очевидно, что донор может включать промотор и/или энхансер, например, конститутивный промотор или индуцируемый или тканеспецифический промотор.

Кроме того, хотя это не требуется для экспрессии, экзогенные последовательности могут также включать регулирующие транскрипцию или трансляцию последовательности, например, промоторы, энхансеры, инсуляторы, внутренние сайты связывания рибосомы, последовательности, кодирующие пептиды 2А, и/или сигналы полиаденилирования.

Экзогенные нуклеиновые кислоты, которые могут быть интегрированы сайт-специфическим образом в по меньшей мере один локус FAD3 с тем, чтобы модифицировать локус FAD3, в вариантах осуществления, включают, например, и без ограничения, нуклеиновые кислоты, включающие нуклеотидную последовательность, кодирующую представляющий интерес полипептид; нуклеиновые кислоты, включающие агрономически важный ген; нуклеиновые кислоты, включающие нуклеотидную последовательность, кодирующую молекулу для РНК-интерференции; или нуклеиновые кислоты, которые разрушают ген FAD3.

В некоторых вариантах осуществления экзогенная нуклеиновая кислота интегрируется в локус FAD3 для модификации локуса FAD3, причем нуклеиновая кислота включает агрономически важный ген или нуклеотидную последовательность, кодирующую представляющий интерес полипептид, так что агрономически важный ген или нуклеотидная последовательность экспрессируется в хозяине с локуса FAD3. В некоторых примерах представляющий интерес полипептид (например, чужеродный белок) экспрессируется с нуклеотидной последовательности, кодирующей представляющий интерес полипептид, в промышленных количествах. В таких примерах представляющий интерес полипептид может быть извлечен из клетки-хозяина, ткани или биомассы. В некоторых вариантах осуществления хозяином является растение, а растительным материалом, предусмотренным для производства представляющего интерес полипептида в промышленных масштабах, может быть растение, часть растения, ткань растения или клетка растения. В некоторых примерах частью растения может быть семя растения. Экстракция белка из растительной биомассы может быть достигнута с помощью известных способов, которые рассматриваются, например, в Heney and Orr (1981) Anal. Biochem. 114: 92-6.

Так же агрономически важные гены могут быть экспрессированы в трансформированных клетках растений, растениях и/или их потомстве. Например, растение может быть генетически сконструировано с помощью методов конкретных вариантов осуществления для экспрессии различные фенотипов, представляющих агрономический интерес, с по меньшей мере одного локуса FAD3.

В некоторых вариантах осуществления нуклеиновые кислоты, включающие агрономически важный ген или нуклеотидную последовательность, кодирующую представляющий интерес полипептид, могут включать, например, и без ограничения: ген, который придает устойчивость к вредителям или болезни (смотрите например, Jones et al. (1994) Science 266: 789 (клонирование гена Cf-9 помидор для придания устойчивости к Cladosporium fulvum); Martin et al. (1993) Science 262: 1432; Mindrinos et al. (1994), Cell, 78: 1089 (ген RSP2 устойчивости к Pseudomonas syringae); публикация международной РСТ-заявки на патент № WO 96/30517 (устойчивость к цистообразующей нематоде сои); публикация международной РСТ-заявки на патент № WO 93/19181); ген, который кодирует белок Bacillus thuringiensis, его производное или синтетический полипептид по его образцу (смотрите, например, Geiser et al. (1986) Gene 48: 109 (клонирование и нуклеотидная последовательность гена Bt δ-эндотоксина; кроме того, молекулы ДНК, кодирующие гены δ-эндотоксина, могут быть приобретены из Американской коллекции типовых культур (Manassas, VA), например, под № доступа в АТСС: 40098, 67136, 31995 и 31998)); ген, который кодирует лектин (смотрите, например, Van Damme et al. (1994) Plant Molec. Biol 24: 25 (нуклеотидные последовательности нескольких генов маннозосвязывающих лектинов Clivia miniata); ген, который кодирует витамин-связывающий белок, например, авидин (смотрите публикацию международной РСТ-заявки на патент № US93/06487 (использование авидина и гомологов авидина в качестве ларвицидов против насекомых-вредителей)); ген, который кодирует ингибитор фермента, например, протеазы, ингибитор протеиназы или ингибитор амилазы (смотрите, например, Abe et al. (1987) J. Biol Chem 262: 16793 (нуклеотидная последовательность ингибитора цистеиновой протеиназы риса); Huub et al. (1993) Plant Molec Biol 21: 985 (нуклеотидная последовательность кДНК, кодирующая ингибитор I протеиназы табака); Sumitani et al. (1993) Biosci. Biotech. Biochem 57: 1243 (нуклеотидная последовательность ингибитора альфа-амилазы Streptomyces nitrosporeus) и патент США № 5494813); ген, кодирующий специфический для насекомых гормон или феромон, например, экдистероид или ювенильный гормон, его вариант, миметик на его основе, или его антагонист или агонист (смотрите, например, Hammock et al. (1990) Nature 344: 458 (экспрессия с использованием бакуловируса клонированной эстеразы ювенильного гормона, инактиватора ювенильного гормона)); ген, кодирующий специфический для насекомых пептид или нейропептида, который при экспрессии нарушает физиологию пораженного вредителя (смотрите, например, Regan (1994) J. Biol Chem 269: 9 (клонирование с целью экспрессии дает ДНК, кодирующую рецептор диуретического гормона насекомых); Pratt et al. (1989) Biochem Biophys Res Comm 163: 1243 (аллостатин в Diploptera puntata) и патент США № 5266317 (гены, кодирующие специфические для насекомых паралитические нейротоксины)); ген, кодирующий специфический для насекомых яд, который продуцирует в природе змея, оса или другой организм (смотрите, например, Pang et al. (1992) Gene 116: 165 (гетерологичная экспрессия в растениях гена, кодирующего токсичный по отношению к насекомым пептид скорпиона)); ген, кодирующий фермент, ответственный за гипераккумуляцию монотерпена, сесквитерпена, стероида, гидроксамовой кислоты, фенилпропаноидного производного или другой молекулы с инсектицидной активностью; ген, кодирующий фермент, участвующий в модификации, в том числе посттрансляционной модификации, биологически активной молекулы, например, гликолитического фермента, протеолитического фермента, липолитического фермента, нуклеазы, циклазы, трансаминазы, эстеразы, гидролазы, фосфатазы, киназы, фосфорилазы, полимеразы, эластазы, хитиназы или глюканазы, или встречающейся в природе, или синтетической (смотрите, например, публикацию международной РСТ-заявки на патент № WO 93/02197 (нуклеотидная последовательность гена каллазы), кроме того, молекулы ДНК, содержащие кодирующие хитазы последовательности, могут быть получены, например, из АТСС, под № доступа 39637 и 67152; Kramer et al. (1993) Insect Biochem. Molec. Biol 23: 691 (нуклеотидная последовательность кДНК, кодирующая хитиназу бражника Protoparce sexta) и Kawalleck et al. (1993) Plant Molec Biol. 21: 673 (нуклеотидная последовательность гена полиубиквитина ubi4-2 петрушки)); ген, кодирующий молекулу, которая стимулирует передачу сигнала (смотрите, например, Botella et al. (1994) Plant Molec Biol 24: 757 (нуклеотидные последовательности кДНК-клонов для калмодулина фасоли золотистой), и Griess et al. (1994) Plant Physiol. 104: 1467 (нуклеотидная последовательности кДНК-клона для калмодулина кукурузы)); ген, который кодирует пептид гидрофобного момента (смотрите, например, публикацию международной РСТ-заявки на патент № WO 95/16776 (производные пептидов Tachyplesin, которые ингибируют грибковые патогены растений) и публикацию международной РСТ-заявки на патент № WO 95/18855 (синтетические противомикробные пептиды, которые придают устойчивость к заболеванию)); ген, который кодирует мембранную пермеазу, каналообразующий белок, или блокатор каналов (смотрите, например, Jaynes et al. (1993) Plant Sci 89:43 (гетерологичная экспрессия аналога литического пептида цекропина-β для придания трансгенным растениям табака устойчивости к Pseudomonas solanacearum)); ген, который кодирует вирусный инвазивный белок или сложный токсин, происходящих из него (смотрите, например, Beachy et al. (1990) Ann. rev. Phytopathol. 28: 451); ген, который кодирует специфическое для насекомых антитело или иммунотоксин, происходящий из него (смотрите, например, Taylor et al., Abstract # 497, Seventh Int'l Symposium on Molecular Plant-Microbe Interactions (Edinburgh, Scotland) (1994) (ферментативная инактивация в трансгенном табаке с помощью продукции фрагментов одноцепочечных антител)); ген, кодирующий вирус-специфическое антитело (смотрите, например, Tavladoraki et al. (1993) Nature 366: 469 (трансгенные растения, экспрессирующие рекомбинантные гены антител, защищены от вирусной атаки)); ген, кодирующий ингибирующий развитие белок, вырабатываемый в природе патогеном или паразитом (смотрите, например, Lamb et al. (1992) Bio/Technology 10: 1436 (эндо-α-1,4-D-полигалактуроназы грибов способствуют грибковой колонизации и высвобождению питательных веществ из растений с помощью солюбилизирующей клеточную стенку растений гомо-1,4-D-галактуроназы); Toubart et al. (1992) Plant J. 2: 367 (клонирование и характеристика гена, который кодирует ингибирующий эндополигалактуроназу белок фасоли)); ген, кодирующий ингибирующий развития белок, продуцируемый в природе растением (смотрите, например, Logemann et al. (1992) Bio/Technology 10: 305 (трансгенные растения, экспрессирующие инактивирующий рибосомы ген ячменя, обладают повышенной устойчивостью к грибковому заболеванию)).

В некоторых вариантах осуществления нуклеиновые кислоты, включающие агрономически важный ген или нуклеотидную последовательность, кодирующую представляющий интерес полипептид, могут также и/или в качестве альтернативы включать, например, и без ограничения: гены, которые придают устойчивость к гербициду, такому как гербицид, который ингибирует точку роста или меристему, например, имидазолинон или сульфонилмочевина (приводимые в качестве примера гены в этой категории кодируют мутантные ферменты ALS и AHAS, описанные, например, Lee et al. (1988) EMBO J. 7: 1241, и Miki et al. (1990) Theor. Appl Genet. 80: 449, соответственно); устойчивость к глифосату, придаваемую с помощью, например, мутантных генов 5-энолпирувилшикимат-3-фосфат-синтазы (EPSP) (с помощью введения рекомбинантных нуклеиновых кислот и/или различных форм in vivo мутагенеза природных генов EPSP (в том числе, но без ограничения, CP4, DMMG и DGT-28); гены aroA и гены глифосат-ацетилтрансферазы (GAT), соответственно); другие фосфоносоединения, такие как придающие устойчивость к глюфосинату гены фосфинотрицин-ацетилтрансферазы (PAT) из видов Streptomyces, в том числе Streptomyces hygroscopicus и Sfreptomyces viridichromogenes, и пиридинокси- или феноксипропионовые кислоты и циклогексоны (гены, кодирующие ингибиторы ацетил-КоА-карбоксилазы). Смотрите, например, патенты США № 4940835 и 6248876 (нуклеотидные последовательности форм EPSP, которые могут придавать растению устойчивость к глифосату). Молекула ДНК, кодирующая мутантный ген aroA, может быть получена под номером доступа в АТСС - 39256. Смотрите также патент США № 4769061 (нуклеотидная последовательность мутантного гена aroA). В Европейской заявке на патент № 0333033 и в патенте США № 4975374 раскрыты нуклеотидные последовательности генов глютаминсинтетазы, которые могут придавать устойчивость к гербицидам, таким как L-фосфинотрицин. Нуклеотидные последовательности приводимых в качестве примера генов PAT представлены в Европейской заявке № 0242246, и DeGreef et al. (1989) Bio/Technology, 7: 61 (создание трансгенных растений, которые экспрессируют химерные гены bar, кодирующие PAT активности). Примеры генов, придающих устойчивость к феноксипропионовым кислотам и циклогексонам, таким как сетоксидим и галоксифоп, включают гены Acc1-S1, Acc1-S2 и Acc1-S3, описанные Marshall et al. (1992) Theor. Appl. Genet. 83: 435. Гены GAT, способные придавать устойчивость к глифосату, описаны, например, в WO 2005012515. Гены, придающие устойчивость к 2,4-D-феноксипропионовой кислоте и пиридилокси-ауксину в качестве гербицидов, описаны, например, в WO 2005107437 и WO 2007053482.

Нуклеиновые кислоты, включающие агрономически важный ген или нуклеотидную последовательность, кодирующую представляющий интерес полипептид, могут также включать, например, и без ограничения: ген, придающий устойчивость к гербициду, который ингибирует фотосинтез, такому как триазин (гены psbA и gs+) или бензонитрил (ген нитрилазы). Смотрите, например, Przibila et al. (1991) Plant Cell 3: 169 (трансформация Chlamydomonas плазмидами, кодирующими мутантные гены psbA). Нуклеотидные последовательности генов нитрилазы раскрыты в патенте США № 4810648, и молекулы ДНК, содержащие эти гены, доступны под № доступа в АТСС 53435, 67441 и 67442. Смотрите также Hayes et al. (1992) Biochem J. 285: 173 (клонирование и экспрессия ДНК, кодирующей глутатион-S-трансферазу).

В некоторых вариантах осуществления нуклеиновые кислоты, включающие агрономически важный ген или нуклеотидную последовательность, кодирующую представляющий интерес полипептид, могут также и/или в качестве альтернативы включать гены, которые придают или способствуют признак(у) с позитивными дополнениями, например, и без ограничения: модифицированный метаболизм жирных кислот, например, в результате трансформации растения антисмысловым геном стеарил-АСР-десатуразы для увеличения содержания стеариновой кислоты в растении (Смотрите, например, Knultzon et al. (1992) Proc Natl Acad Sci USA 89: 2624); уменьшенное содержание фитатов, например, введение кодирующего фитазу гена может увеличить распад фитата, добавляя больше свободного фосфата трансформированному растению (смотрите, например, Van Hartingsveldt et al. (1993) Gene 127: 87 (нуклеотидная последовательность гена фитазы Aspergillus niger); ген может быть введен для уменьшения содержания фитата в кукурузе, например, это может быть достигнуто путем клонирования и затем повторного введения ДНК, ассоциируемой с одной аллелью, которая может быть ответственна за мутанты кукурузы, характеризующиеся низкими уровнями фитиновой кислоты (Смотрите Raboy et al. (1990) Maydica 35: 383)); и модифицированный углеводный состав, например, в результате трансформации растений геном, кодирующим фермент, который изменяет характер ветвления крахмала (смотрите, например, Shiroza et al. (1988) J. Bacteol 170: 810 (нуклеотидная последовательность гена фруктозилтрансферазы мутанта Streptococcus); Steinmetz et al. (1985) Mol. Gen. Genet. 20: 220 (ген левансахаразы); Pen et al. (1992) Bio/Technology 10: 292 (α-амилаза); Elliot et al. (1993) Plant Molec Biol 21: 515 (нуклеотидные последовательности генов инвертазы помидора); Sogaard et al. (1993) J. Biol. Chem. 268: 22480 (ген α-амилазы ячменя); и Fisher et al. (1993) Plant Physiol. 102: 1045 (фермент II ветвления крахмала эндосперма кукурузы)).

В некоторых вариантах осуществления экзогенная нуклеиновая кислота интегрируется в локус FAD3 с модификацией локуса FAD3, причем нуклеиновая кислота включает PTU или ELP, так что облегчается, например, последующая сайт-специфическая интеграция второй экзогенной нуклеиновой кислоты в сайт PTU или ELP. Смотрите также заявку США № 13/889162.

Для интеграции с помощью таргетирующей эндонуклеазы представляющей интерес молекулы нуклеиновой кислоты в геном растения посредством направленной интеграции требуется доставка таргетирующих эндонуклеаз или молекул нуклеиновых кислот, кодирующих таргетирующие эндонуклеазы, с последующей экспрессией функционального белка таргетирующей эндонуклеазы в хозяине. Предпочтительно также, когда экзогенная нуклеиновая кислота присутствует в клетке-хозяине в то же время, что и время доставки или экспрессии таргетирующей эндонуклеазы в ней, так что функциональный белок таргетирующей эндонуклеазы индуцирует двухцепочечные разрывы в сайте(ах)-мишени(ях) в по меньшей мере одном локусе FAD3, которые затем подвергаются репарации, например, с помощью интеграции на основе гомологии экзогенной нуклеиновой кислоты в локус. Квалифицированный в данной области техники специалист может предвидеть, что экспрессия функционального белка таргетирующей эндонуклеазы может быть достигнута несколькими способами, включая, но без ограничения, трансгенез кодирующей таргетирующую эндонуклеазу конструкции и транзиторную экспрессию кодирующей таргетирующую эндонуклеазу конструкции. В обоих этих случаях экспрессия функционального белка таргетирующей эндонуклеазы и доставка экзогенной нуклеиновой кислоты в клетку-хозяина могут быть достигнуты одновременно в целях запуска направленной интеграции в локус FAD3.

Особым преимуществом, достигаемым в вариантах осуществления, в которых используются ZFN в качестве таргетирующих эндонуклеаз, является то, что требование димеризации расщепляющих доменов химерных нуклеаз на основе цинковых пальцев придает высокий уровень специфичности в отношении последовательности и, следовательно, расщепления. Поскольку каждая совокупность из трех пальцев связывает девять последовательных пар оснований, для двух химерных нуклеаз фактически требуется мишень длиной 18 п.о., если каждый домен «цинковый палец» имеет идеальную специфичность. Любая конкретная последовательность такой длины, по прогнозам, будет уникальной в пределах одного генома (при условии приблизительно 109 п.о.). Bibikova et al. (2001) Mol. Cell. Biol. 21 (1): 289-97; Wu et al. (2007), выше. Кроме того, дополнительные пальцы могут обеспечить увеличенную специфичность, Beerli et al. (1998) Proc. Natl. Acad. Sci. USA 95: 14628-33; Kim and Pabo (1998) Proc. Natl. Acad. Sci. USA 95: 2812-7; Liu et al. (1997) Proc. Natl. Acad. Sci. USA 94: 5525-30, таким образом, количество цинковых пальцев в каждом ДНК-связывающем домене можно увеличить для обеспечения еще большей специфичности. Например, специфичность можно дополнительно увеличить с помощью пары ZFN с 4-, 5-, 6- или более пальцев, которые распознают последовательность длиной 24 п.н. Urnov et al. (2005) Nature 435: 646-51. Таким образом, ZFN могут быть использованы из условия, чтобы последовательность распознавания, введенная в геном растения-хозяина, была уникальной в пределах генома.

В. Молекулы нуклеиновых кислот, включающие нуклеотидную последовательность, кодирующую таргетирующую эндонуклеазу

В некоторых вариантах осуществления нуклеотидная последовательность, кодирующая таргетирующую эндонуклеазу, может быть сконструирована путем манипуляции (например, лигирования) природными нуклеотидными последовательностями, кодирующими полипептиды, включаемые в таргетирующую эндонуклеазу. Например, нуклеотидная последовательность гена, кодирующего белок, включающий ДНК-связывающий полипептид, может быть проверена для идентификации нуклеотидной последовательности гена, которая соответствует ДНК-связывающему полипептиду, и эта нуклеотидная последовательность может использоваться в качестве элемента нуклеотидной последовательности, кодирующей таргетирующую эндонуклеазу, включающую ДНК-связывающий полипептид. Альтернативно, аминокислотная последовательность таргетирующей эндонуклеазы может использоваться для выведения нуклеотидной последовательности, кодирующей таргетирующую эндонуклеазу, например, в соответствии с вырожденностью генетического кода.

В приводимых в качестве примера молекулах нуклеиновых кислот, включающих нуклеотидную последовательность, кодирующую таргетирующую эндонуклеазу, последний кодон первой полинуклеотидной последовательности, кодирующей полипептид с нуклеазной активностью, и первый кодон второй полинуклеотидной последовательности, кодирующей ДНК-связывающий полипептид, может разделять любое количество триплетов нуклеотидов, например, без кодирования интрона или «стоп-кодона». Так же последний кодон нуклеотидной последовательности, кодирующей первую полинуклеотидную последовательность, кодирующую ДНК-связывающий полипептид, и первый кодон второй полинуклеотидной последовательности, кодирующей полипептид с нуклеазной активностью, может разделять любое число триплетов нуклеотидов. В этих и дополнительных вариантах осуществления последний кодон (т.е. на самом 3'-конце последовательности нуклеиновой кислоты) первой полинуклеотидной последовательности, кодирующей полипептид с нуклеазной активностью, и второй полинуклеотидной последовательности, кодирующей ДНК-связывающий полипептид, может быть слит в фазе совпадения с первым кодоном дополнительной полинуклеотидной кодирующей последовательности, который непосредственно прилегает к нему или отделен от него не более чем короткой пептидной последовательностью, такой как последовательность, кодируемая синтетическим нуклеотидным линкером (например, нуклеотидным линкером, который, возможно, использовался для достижения слияния). Примеры таких дополнительных полинуклеотидных последовательностей включают, например, и без ограничения, метки, направляющие пептиды и сайты ферментативного расщепления. Так же первый кодон на самом 5'-конце (последовательности нуклеиновой кислоты) первой и второй полинуклеотидных последовательностей может быть слит в фазе совпадения с последним кодоном дополнительной полинуклеотидной кодирующей последовательности, который непосредственно прилегает к нему или отделен от него не более чем короткой пептидной последовательностью.

Последовательность, разделяющая полинуклеотидные последовательности, кодирующие функциональные полипептиды в таргетирующей эндонуклеазе (например, ДНК-связывающий полипептид и полипептид с нуклеазной активностью), может, например, состоять из любой последовательности, из условия, чтобы кодируемая аминокислотная последовательность, наверное, не изменяла в значительной степени трансляцию таргетирующей эндонуклеазы. В связи с автономной природой известных полипептидов с нуклеазной активностью и известных ДНК-связывающих полипептидов, промежуточные последовательности не будут в примерах мешать соответствующим функциям этих структур.

C. Векторы и экспрессионные конструкции

В некоторых вариантах осуществления по меньшей мере одна молекула(ы) нуклеиновой кислоты, включающей по меньшей мере одну экзогенную полинуклеотидную последовательность, кодирующую представляющий интерес полипептид и/или таргетирующую эндонуклеазу, может быть введена в клетку, ткань или организм для экспрессии в ней. Например, молекула нуклеиновой кислоты, включающая полинуклеотидную последовательность, кодирующую таргетирующую эндонуклеазу, которая специфически распознает нуклеотидную последовательность, включенную в по меньшей мере один локус FAD3, может быть введена в клетку для экспрессии таргетирующей эндонуклеазы, и молекула нуклеиновой кислоты, включающая полинуклеотидную последовательность, кодирующую представляющий интерес полипептид, может быть введена в клетку из условия, чтобы полинуклеотидная последовательность, кодирующая представляющий интерес полипептид, интегрировалась в по меньшей мере один локус FAD3, например, путем гомологичной рекомбинации после введения экспрессированной таргетирующей эндонуклеазой двухцепочечного разрыва в локусе, и представляющий интерес полипептид экспрессировался с интегрированной полинуклеотидной последовательности.

В некоторых вариантах осуществления молекула нуклеиновой кислоты, такая как одна из указанных выше, может, например, представлять собой векторную систему, включающую, например, и без ограничения, линейную плазмиду или замкнутую кольцевую плазмиду. В конкретных примерах вектор может представлять собой экспрессионный вектор. Последовательности нуклеиновых кислот в соответствии с конкретными вариантами осуществления могут, например, быть интегрированы в вектор при условии, чтобы последовательность нуклеиновой кислоты была функционально связана с одной или более регуляторных последовательностей. Множество векторов имеется в распоряжении для этой цели, и выбор конкретного вектора может зависеть, например, от размера нуклеиновой кислоты, которая будут вставлена в вектор, конкретной клетки-хозяина, подвергаемого трансформации, и/или количества какого-либо кодируемого полипептида, который желательно экспрессировать. Вектор типично содержит различные компоненты, особенность которых зависит от функции вектора (например, амплификации ДНК или экспрессии ДНК), и конкретной клетки-хозяина(ев), с которой совместим вектор.

В некоторых вариантах осуществления регуляторной последовательностью, функционально связанной с одной или более кодирующих последовательностей, может быть последовательностью промотора, которая функционирует в клетке-хозяине, такой как бактериальная клетка, клетка водорослей, клетка гриба или клетка растения, в которой молекула нуклеиновой кислоты должна быть амплифицирована или экспрессирована. Некоторые варианты осуществления могут включать вектор для трансформации растений, который включает нуклеотидную последовательность, включающую по меньшей мере одну регуляторную последовательность, функционально связанную с одной или более нуклеотидных последовательностей, кодирующей представляющий интерес полипептид или таргетирующую эндонуклеазу, причем одна или более нуклеотидных последовательностей может экспрессироваться, под контролем регуляторной последовательности(ей), в клетке растения, его ткани или организме с продукцией, представляющего интерес полипептида или таргетирующей эндонуклеазы.

Промоторы, подходящие для использования в молекулах нуклеиновых кислот в соответствии с некоторыми вариантами осуществления, включают те, которые являются индуцируемыми, тканеспецифическими, вирусными, синтетическими или конститутивными, все из которых хорошо известны в данной области техники. Неограничивающие примеры промоторов, которые могут применяться в вариантах осуществления настоящего изобретения, предусматриваются в: патентах США №№ 6437217 (промотор RS81 кукурузы); 5641876 (промотор актина риса); 6426446 (промотор RS324 кукурузы); 6429362 (промотор PR-1 кукурузы); 6232526 (промотор А3 кукурузы); 6177611 (конститутивные промоторы кукурузы); 5322938, 5352605, 5359142 и 5530196 (промотор 35S); 6433252 (промотор олеозина L3 кукурузы); 6429357 (промотор актина 2 риса и интрон актина 2 риса); 6294714 (светоиндуцируемые промоторы); 6140078 (соль-индуцируемые промоторы); 6252138 (патоген-индуцируемые промоторы); 6175060 (индуцируемые при нехватке фосфора промоторы); 6388170 (двунаправленные промоторы); 6635806 (промотор гамма-коиксина); 5447858 (промотор белка теплового шока сои); и в заявке на патент США с серийным № 09/757089 (промотор хлоропластной альдолазы кукурузы).

Дополнительные, приводимые в качестве примера промоторы включают промотор нопалинсинтазы (NOS) (Ebert et al. (1987), Proc Natl Acad Sci USA 84 (16): 5745-9); промотор октопинсинтазы (OCS) (который находится на индуцирующих опухоль плазмидах из Agrobacterium tumefaciens); промоторы колимовируса, такие как промотор 19S вируса мозаики цветной капусты (CaMV) (Lawton et al. (1987) Plant Mol Biol 9: 315-24) промотор 35S CaMV (Odell et al. (1985) Nature 313: 810-2; 35S-промотор вируса мозаики норичника (Walker et al. (1987), Proc Natl Acad Sci USA 84 (19): 6624-8); промотор сахаросинтазы (Yang and Russel (1990) Proc Natl Acad Sci USA 87: 4144-8); сложный промотор гена R (Chandler et al. (1989), Plant Cell, 1: 1175-83); промотор гена α/β-связывающего белка хлорофилла; CaMV35S (патенты США №№ 5322938, 5352605, 5359142 и 5530196); FMV35S (патенты США №№ 6051753 и 5378619); промотор PC1SV (патент США № 5850019), промотор SCP1 (патент США № 6677503), а также промоторы AGRtu.nos (№ доступа в GenBank - V00087; Depicker et al. (1982) J. Mol Appl Genet. 1: 561-73; Bevan et al. (1983) Nature 304: 184-7).

В конкретных вариантах молекулы нуклеиновых кислот могут содержать тканеспецифический промотор. Тканеспецифический промотор представляет собой нуклеотидную последовательность, которая направляет более высокий уровень транскрипции функционально связанной нуклеотидной последовательностью в ткани, в отношении которой промотор является специфическим, по сравнению с другими тканями организма. Примеры тканеспецифичных промоторов включают, без ограничения: специфические для тапетума промоторы; специфические для пыльника промоторы; специфические для пыльцы промоторы (смотрите, например, патент США № 7141424 и публикацию международной РСТ-заявки № WO 99/042587); специфические для семяпочки промоторы; (Смотрите, например, заявку на патент США № 2001/047525 Al); специфические для плодов промоторы (смотрите, например, патенты США №№ 4943674 и 5753475); и специфические для семени промоторы (смотрите, например, патенты США № 5420034 и 5608152). В некоторых вариантах осуществления может использоваться специфический для стадии развития промотор (например, промотор, активный на более поздней стадии развития).

Дополнительные регуляторные последовательности, которые могут в некоторых вариантах осуществления быть функционально связаны с молекулой нуклеиновой кислоты, включают 5' UTR, расположенные между промоторной последовательностью и кодирующей последовательностью, которые функционируют в качестве лидерной последовательности трансляции. Лидерная последовательность трансляции присутствует в полностью процессированной мРНК, и она может влиять на процессирование первичного транскрипта и/или стабильность РНК. Примеры лидерных последовательностей трансляции включают лидерные последовательности белка теплового шока кукурузы и петуньи (патент США № 5362865), лидерные последовательности белков оболочки вирусов, лидерные последовательности рибулозо-1,5-бифосфаткарбоксилазы/оксигеназы растений и другие. Смотрите, например, Turner and Foster (1995) Molecular Biotech. 3(3): 225-36. Предусматриваются неограничивающие примеры 5' UTR: GmHsp (патент США № 5659122); PhDnaK (патент США № 5362865); AtAnt1; TEV (Carrington and Freed (1990) J. Virol 64: 1590-7); и AGRtunos (№ доступа в GenBank - V00087; и Bevan et al. (1983), выше).

Дополнительные регуляторные последовательности, которые могут в некоторых вариантах осуществления быть функционально связаны с молекулой нуклеиновой кислоты, также включают 3' нетранслируемые последовательности, 3' участки терминации транскрипции или участки полиаденилирования. Они представляют собой генетические элементы, расположенные 3' от нуклеотидной последовательности, и включают полинуклеотиды, которые обеспечивают сигнал полиаденилирования и/или другие регулирующие сигналы, способные оказывать влияние на транскрипцию или процессирование мРНК. Сигнал полиаденилирования функционирует в растениях с вызовом присоединения нуклеотидов в виде полиаденилата к 3'-концу мРНК-предшественника. Последовательность полиаденилирования может быть получена из множества генов растений, или из генов Т-ДНК. Неограничивающим примером 3' участка терминации транскрипции является 3' участок нопалинсинтазы (nos 3'; Fraley et al. (1983) Proc Natl Acad Sci USA 80: 4803-7). Пример использования различных 3' нетранслируемых районов приведен в Ingelbrecht et al. (1989) Plant Cell, 1: 671-80 Неограничивающие примеры сигналов полиаденилирования включают таковой из гена RbcS2 Pisum sativum (Ps.RbcS2-E9; Coruzzi et al. (1984) EMBO J. 3: 1671-9) и AGRtu.nos (№ доступа в GenBank - E01312).

Дополнительная информация о регуляторных последовательностях, которые могут приняться в конкретных вариантах осуществления, представлена, например, в Goeddel (1990) "Gene Expression Technology", Methods Enzymol. 185, Academic Press, San Diego, CA.

Рекомбинантная молекула нуклеиновой кислоты или вектор может включать селектируемый маркер, который придает селектируемый фенотип трансформированной клетке, такой как клетка растения. Селектируемые маркеры могут также использоваться для отбора клеток или организмов, которые включают молекулу нуклеиновой кислоты, включающую селектируемый маркер. Маркер может кодировать устойчивость к биоциду, устойчивость к антибиотику (например, канамицину, генетицину (G418), блеомицину и гигромицину) или устойчивость к гербициду (например, глифосату). Примеры селектируемых маркеров включают, но без ограничения: ген neo, который придает устойчивость к канамицину и может быть выбран в случае использования, например, канамицина и G418; ген bar, который придает устойчивость к биалафосу; мутантный ген EPSP-синтазы, который придает устойчивость к глифосату; ген нитрилазы, который придает устойчивость к бромоксинилу; мутантный ген ацетолактатсинтазы (ALS), который придает устойчивость к имидазолинону или сульфонилмочевине; и ген устойчивости к метотрексату DHFR. В наличие имеется множество селектируемых маркеров, которые придают устойчивость к воздействию химических веществ, включая, например, и без ограничения, ампициллин; блеомицин; хлорамфеникол; гентамицин; гигромицин; канамицин; линкомицин; метотрексат; фосфинотрицин; пуромицин; спектиномицин; рифампицин; стрептомицин и тетрациклин. Примеры таких селектируемых маркеров проиллюстрированы, например, в патентах США № 5550318; 5633435; 5780708 и 6118047.

Молекула нуклеиновой кислоты или вектор может также или альтернативно включать скринируемый маркер. Скринируемые маркеры могут использоваться для мониторинга экспрессии. Приводимые в качестве примера скринируемые маркеры включают ген β-глюкуронидазы или uidA (GUS), который кодирует фермент, для которого известны различные хромогенные субстраты (Jefferson et al. (1987) Plant Mol Biol Rep. 5: 387-405); ген R-локуса, который кодирует продукт, который регулирует продукцию пигментов антоцианинов (красного цвета) в тканях растений (Dellaporta et al. (1988) "Molecular cloning of the maize R-nj allele by transposon tagging with Ac." In 18th Stadler Genetics Symposium, P. Gustafson and R. Appels, eds, Plenum, NY (pp. 263-82), ген β-лактамазы (Sutcliffe et al. (1978) Proc Natl Acad Sci USA 75: 3737-41); ген, который кодирует фермент, для которого известны различные хромогенные субстраты (например, PADAC, хромогенный цефалоспорин); ген люциферазы (Ow et al. (1986) Science 234: 856-9); ген xylE, который кодирует катехол-диоксигеназу, которая преобразует хромогенные катехины (Zukowski et al. (1983) Gene 46 (2-3): 247-55); ген амилазы (Ikatu et al. (1990) Bio/Technol 8: 241-2), ген тирозиназы, который кодирует фермент, способный окислять тирозин до DOPA и допахинона, который, в свою очередь подвергается конденсации с образованием меланина (Katz et al. (1983) J. Gen. Microbiol. 2703-14), и ген α-галактозидазы.

Все из нуклеотидных последовательностей, которые кодируют, например, конкретный представляющий интерес полипептид или конкретную таргетирующую эндонуклеазу, будут сразу же различимы квалифицированными в данной области техники специалистами. Вырожденность генетического кода дает имеющее предел число кодирующих последовательностей для конкретной аминокислотной последовательности. Выбор конкретной последовательности, кодирующей полипептид в соответствии с вариантами осуществления настоящего изобретения, осуществляется по усмотрению специалиста-практика. Различные кодирующие последовательности могут быть желательны в различных приложениях.

В некоторых вариантах осуществления может быть желательно модифицировать нуклеотиды нуклеиновой кислоты, например, для увеличения экспрессии полинуклеотидной последовательности, включаемой в нуклеиновую кислоту у конкретного хозяина. Генетический код является избыточным с 64 возможными кодонами, но большинство организмов преимущественно используют подмножество этих кодонов. Кодоны, которые используются наиболее часто у вида, называются оптимальными кодонами, а те, которые не используются очень часто, относят к редким кодонам или кодонам с низким уровнем использования. Zhang et al. (1991) Gene 105: 61-72. Кодоны могут быть заменены для отражения использования предпочтительных кодонов у конкретного хозяина в ходе процесса, иногда называемого «оптимизацией кодонов». Оптимизированные кодирующие последовательности, содержащие кодоны, предпочитаемые конкретным прокариотическим или эукариотическим хозяином, могут быть получены, например, для увеличения скорости трансляции или для получения рекомбинантных РНК-транскриптов, обладающих желательными свойствами (например, более длинным полупериодом существования по сравнению с транскриптами, продуцированными с неоптимизированной последовательности).

Нуклеиновые кислоты могут быть введены в клетку-хозяина в вариантах осуществления настоящего изобретения любым способом, известным квалифицированным в данной области техники специалистам, в том числе, например, и без ограничения: путем трансформации протопластов (смотрите, например, патент США № 5508184); поглощения ДНК с использованием высушивания/ингибирования (смотрите, например, Potrykus et al. (1985) Mol. Gen. Genet. 199: 183-8); путем электропорации (смотрите, например, патент США № 5384253); при перемешивании с волокнами карбида кремния (смотрите, например, патенты США № 5302523 и 5464765); путем трансформации с использованием Agrobacterium (смотрите, например, патенты США № 5563055, 5591616, 5693512, 5824877, 5981840 и 6384301); и путем ускорения частиц, покрытых ДНК (смотрите, например, патенты США № 5015580, 5550318, 5538880, 6160208, 6399861 и 6403865). Посредством применения таких методов, как эти, клетки практически любого вида можно стабильно трансформировать. В некоторых вариантах осуществления трансформирующая ДНК интегрируется в геном клетки-хозяина. В случае многоклеточного вида трансгенные клетки могут быть регенерированы в трансгенный организм. Любой из этих способов может использоваться для получения трансгенного растения, например, содержащего одну или более последовательностей нуклеиновых кислот настоящего изобретения в геноме трансгенного растения.

Самый широко используемый способ введения экспрессионного вектора в растения основан на природной системе трансформации Agrobacterium. А. umefaciens и А. rhizogenes являются растительными патогенными почвенными бактериями растения, которые генетически трансформируют клетки растений. Ti и Ri плазмиды A. tumefaciens и A. rhizogenes, соответственно, содержат гены, ответственные за генетическую трансформацию растения. Ti (индуцирующие опухоль)-плазмиды содержат большой сегмент, известный как Т-ДНК, которая переносится в трансформируемые растения. Еще один сегмент Ti плазмиды, область vir, отвечает за перенос Т-ДНК. Область Т-ДНК ограничена с левой и правой стороны границами, каждая из которых состоит из концевых повторяющихся нуклеотидных последовательностей. В некоторых модифицированных бинарных векторах гены индукции опухолей были делетированы, и функции области vir используются для переноса чужеродной ДНК, ограниченной пограничными последовательностями Т-ДНК. Т-область также может содержать, например, селектируемый маркер для эффективной регенерации трансгенных растений и клеток, и сайт множественного клонирования для вставки последовательностей для переноса, например, нуклеиновую кислоту, кодирующую составной белок настоящего изобретения.

Таким образом, в некоторых вариантах осуществления вектор для трансформации растений происходит из Ti плазмиды А. tumefaciens (смотрите, например, патенты США № 4536475, 4693977, 4886937 и 5501967 и Европейский патент EP 0122791) или Ri плазмиды A. rhizogenes. Дополнительные векторы для трансформации растений включают, например, и без ограничения, те, которые описаны в Herrera-Estrella et al. (1983) Nature 303: 209-13; Bevan et al. (1983), выше; Klee et al. (1985) Bio/Technol. 3: 637-42; и в Европейском патенте ЕР 0120516, и те, которые происходят из любого из вышеперечисленных. Другие бактерии, такие как Sinorhizobium, Rhizobium и Mesorhizobium, которые в природе взаимодействуют с растениями, могут быть подвергнуты модификации, чтобы опосредовать перенос генов в ряд разнообразных растений. Эти связанные с растениями симбиотические бактерии могут быть сделаны компетентным для переноса генов в результате приобретения как нейтрализованной Ti плазмиды, так и подходящего бинарного вектора.

После предоставления экзогенной ДНК в клетки-реципиенты трансформированные клетки, как правило, идентифицируют для дальнейшего культивирования и регенерации растений. Для увеличения возможности идентификации трансформированных клеток желательным может быть использование селектируемого или скринируемого гена-маркера, изложенного ранее, с вектором, используемым для получения трансформанта. В случае использования селектируемого маркера трансформированные клетки идентифицируют в популяции потенциально трансформированных клеток посредством подвергания клеток воздействию селективного агента или агентов. В случае использования скринируемого маркера клетки могут быть подвергнуты скринингу на связанный с геном-маркером желаемый признак.

Клетки, которые выдерживают воздействие селективного агента, или клетки, которые были оценены как позитивные при скрининге, можно культивировать в средах, которые поддерживают регенерацию растений. В некоторых вариантах осуществления любые подходящие среды для культивирования тканей растений (например, среды MS и N6), могут быть модифицированы путем включения дополнительных веществ, таких как регуляторы роста. Ткань можно поддерживать в основной среде с регуляторами роста до тех пор, пока не будет иметься достаточно ткани, чтобы начать попытки регенерировать растение, или после неоднократных циклов отбора вручную до тех пор, пока морфология ткани не будет подходящей для регенерации (например, в течение по меньшей мере 2 недель), а затем перенести в среды способствующие образованию ростков. Культуры периодически переносят до тех пор, пока не произошло образование в достаточной степени ростков. После образования ростков их переносят в среды, способствующие образованию корней. После образования достаточного количества корней растения могут быть перенесены в почву для дальнейшего выращивания и созревания.

Для подтверждения присутствия представляющей интерес молекулы нуклеиновой кислоты (например, нуклеотидной последовательности, кодирующей полипептид, включающий по меньшей мере один составной белок настоящего изобретения) в регенерирующемся растении может быть выполнен ряд анализов. Такие анализы включают, например: молекулярно-биологические анализы, например, блоттинг по Саузерну и Нозерн-блоттинг, ПЦР и секвенирование нуклеиновых кислоты; биохимические анализы, такие как обнаружение присутствия белкового продукта, например, с помощью иммунологических средств (ELISA и/или Вестерн-блоттинга) или по ферментативной функции; анализы частей растений, такие как анализы листьев или корней; и анализ фенотипа целого регенерированного растения.

События интеграции могут быть проанализированы, например, путем амплификации с использованием ПЦР, используя, например, олигонуклеотидные праймеры, специфические для нуклеотидной последовательности, представляющей интерес. Следует понимать, что генотипирование с использованием ПЦР включает, но не ограничения, амплификацию с помощью полимеразной цепной реакции (ПЦР) геномной ДНК, полученной из выделенной ткани растения-хозяина, которая по прогнозам содержит представляющую интерес молекулу нуклеиновой кислоты, интегрированную в геном, с последующим стандартным клонированием и анализом последовательностей продуктов ПЦР-амплификации. Методы генотипирования с использованием ПЦР были в достаточной степени описаны (смотрите, например, Rios, G. et al. (2002) Plant J. 32: 243-53), и могут быть применены к геномной ДНК, полученной из любого вида растений или типа ткани, в том числе клеточных культур.

Трансгенное растение, созданное, используя метод трансформации с использованием Agrobacterium, как правило, содержит от одной до множества копий рекомбинантной ДНК. Одну рекомбинантную ДНК-последовательность называют «трансгенным случаем» или «событием интеграции». Такие трансгенные растения являются гетерозиготными по встроенной последовательности ДНК. В некоторых вариантах осуществления трансгенное растение, гомозиготное по трансгену, может быть получено половым скрещиванием (самоопылением) являющегося независимым сегрегантом трансгенного растения, которое содержит одну экзогенную последовательность гена, с самим собой, например, растения F0, чтобы получить семя F1. Четвертая часть полученных F1-семян будет гомозиготной по трансгену. Проращивание F1-семян дает растения, которые могут быть проверены на гетерозиготность, как правило, с использованием анализа SNP или анализа с использованием термического цикла амплификации, который позволяет провести различия между гетерозиготами гомозиготами (т.е. анализ зиготности).

В дополнение к прямой трансформации растения или клетки растения молекулой нуклеиновой кислоты в некоторых вариантах осуществления, трансгенные растения могут быть получены в конкретных вариантах осуществления путем скрещивания первого растения, имеющего по меньшей мере один трансгенный случай, со вторым растением, не имеющим такого случая. Например, нуклеиновая кислота, включающая по меньшей мере один модифицированный локус FAD3, в который экзогенная нуклеиновая кислота была интегрирована сайт-специфическим образом, может быть введена в первую линию растений, которая поддается трансформации, для получения трансгенного растения, которое может быть скрещено со второй линией растений для интрогрессии по меньшей мере одного модифицированного локуса FAD3 (и, следовательно, экзогенной нуклеиновой кислоты) во второй линии растений.

Для подтверждения присутствия молекулы нуклеиновой кислоты, представляющей интерес, в регенерирующемся растении может быть выполнен ряд анализов. Такие анализы включают, например: молекулярно-биологические анализы, например, блоттинг по Саузерну и Нозерн-блоттинг, и ПЦР; биохимические анализы, такие как обнаружение присутствия белкового продукта, например, с помощью иммунологических средств (ELISA и/или Вестерн-блоттинга) или по ферментативной функции; анализы частей растений, такие как анализы листьев или корней; и анализ фенотипа целого регенерированного растения.

События направленной интеграции могут быть подвергнуты скринингу, например, с помощью ПЦР-амплификации, используя, например, олигонуклеотидные праймеры, специфические для молекул нуклеиновых кислот, представляющих интерес. Следует понимать, что генотипирование с использованием ПЦР включает, но не ограничения, амплификацию с помощью полимеразной цепной реакции (ПЦР) геномной ДНК, полученной из выделенной каллусной ткани растения, которая по прогнозам содержит представляющую интерес молекулу нуклеиновой кислоты, интегрированную в геном, с последующим стандартным клонированием и анализом последовательностей продуктов ПЦР-амплификации. Методы генотипирования с использованием ПЦР были в достаточной степени описаны (смотрите, например, Rios, G. et al. (2002) Plant J. 32: 243-53) и могут быть применены к геномной ДНК, полученной из любого вида растений или типа ткани, в том числе клеточных культур. Комбинации олигонуклеотидных праймеров, которые связываются и с последовательностью-мишенью, и с введенной последовательностью, могут быть использованы последовательно или мультиплексированы в реакциях ПЦР-амплификации. Возможны олигонуклеотидные праймеры, предназначенные для отжига с сайтом-мишенью, введенными последовательностями нуклеиновых кислот и/или их комбинации. Таким образом, стратегии генотипирования с использованием ПЦР могут включать (но без ограничения) амплификацию специфических последовательностей в геноме растения, амплификацию нескольких специфических последовательностей в геноме растения, амплификацию неспецифических последовательностей в геноме растения или их комбинациями. Квалифицированный в данной области техники специалист может разработать дополнительные комбинации праймеров и реакций амплификации для детального исследования генома. Например, набор из прямого и обратного олигонуклеотидных праймеров может быть предназначен для отжига с последовательностью(ями) нуклеиновой кислоты, специфической для мишени за пределами границ введенной последовательности нуклеиновой кислоты.

Могут быть сконструированы прямые и обратные олигонуклеотидные праймеры, которые специфически отжигаются с введенной молекулы нуклеиновой кислоты, представляющей интерес, например, в последовательности, соответствующей кодирующей области в молекуле нуклеиновой кислоты, представляющей интерес, или других частях молекулы нуклеиновой кислоты, представляющей интерес. Эти праймеры могут использоваться в сочетании с праймерами, описанными выше. Олигонуклеотидные праймеры могут быть синтезированы в соответствии с желаемой последовательностью и коммерчески доступны (например, от Integrated DNA Technologies, Inc., Coralville, IA). За амплификацией может следовать клонирование и секвенирование или прямой анализ последовательностей продуктов амплификации. Квалифицированный в данной области техники специалист может представить себе альтернативные методы анализа продуктов амплификации, полученных во время генотипирования с использованием ПЦР. В одном варианте осуществления олигонуклеотидные праймеры, специфические для гена-мишени, используют в ПЦР-амплификациях.

VI. Трансгенные растения и растительные материалы, содержащие нуклеиновую кислоту, интегрированную в локус FAD3 для выполнения операций

В некоторых вариантах осуществления предусматривается трансгенное растение, причем растение включает клетку растения, включающую по меньшей мере один модифицированный (например, локус FAD3, разрушенный и/или с направленной интеграцией экзогенной последовательности) локус FAD3. В конкретных вариантах осуществления такое растение может быть получено посредством трансформации ткани растения или клетки растения и регенерации в целое растение. В дальнейших вариантах осуществления такое растение может быть получено с помощью введения экзогенной нуклеиновой кислоты в по меньшей мере один локус FAD3 сайт-специфическим образом, или посредством интрогрессии модифицированного локуса FAD3 в зародышевой плазме. Также предусматриваются растительные материалы, включающие такую клетку растения. Такой растительный материал может быть получен из растения, включающего клетку растения.

Трансгенное растение или растительный материал, включающий клетку растения, включающую по меньшей мере один модифицированный локус FAD3, может в некоторых вариантах осуществления обладать одной или более из следующих характеристик: экспрессией таргетирующей эндонуклеазы в клетке растения; экспрессией представляющего интерес полипептида в клетке растения (или в его пластиде); экспрессией таргетирующей эндонуклеазы в ядре клетки растения; локализацией таргетирующей эндонуклеазы в клетке растения; интеграцией в локус FAD3 в геноме клетки растения; интеграцией нуклеотидной последовательности, кодирующей представляющий интерес полипептид или агрономически важный ген, в локус FAD3 в геноме клетки растения; и/или присутствием РНК-транскрипта, соответствующего кодирующей последовательности, интегрированной в локус FAD3 в геноме клетки растения. Такое растение может дополнительно иметь один или более желательных признаков, в том числе, например, и без ограничения, признаки, являющиеся результатом экспрессии эндогенной или трансгенной нуклеотидной последовательности, экспрессия которой регулируется представляющим интерес полипептидом, или агрономически важного гена, интегрированного в локус FAD3 в геноме клетки растения; устойчивость к насекомым, других вредителям и болезнетворным агентам; устойчивость к гербицидам; повышенную стабильность, урожайность или срок годности; устойчивости к условиям окружающей среды; фармацевтическое производство; промышленное производство и повышения пищевой ценности.

Трансгенное растение в соответствии с настоящим изобретением может быть любым растением, которое может быть трансформировано нуклеиновой кислотой, которая впоследствии интегрируется в по меньшей мере один локус FAD3 в соответствии со способами, описываемыми в настоящем документе. Соответственно, растение может быть двудольным или однодольным. Неограничивающие примеры двудольных растений, которые можно использовать в способах настоящего изобретения, включают Arabidopsis, люцерну, бобы, брокколи, капусту, канолу, морковь, цветную капусту, сельдерей, китайскую капусту, хлопчатник, огурцы, баклажаны, салат, дыню, горох, перец, арахис, картофель, тыкву, редьку, семена рапса, шпинат, сою, сквош, сахарную свеклу, подсолнечник, табак, помидоры и арбуз. Неограничивающие примеры однодольных растений, которые можно использовать в способах настоящего изобретения, включают кукурузу, ячмень, лук, рис, сорго, пшеницу, рожь, просо, сахарный тростник, овес, тритикале, просо и газонную траву. Трансгенные растения в соответствии с настоящим изобретением могут использоваться и выращиваться любым образом.

Некоторые варианты осуществления также обеспечивают товары, полученные из трансгенных растений настоящего изобретения. Товары включают, например, и без ограничения: пищевые продукты, крупы, масла или дробленые или цельные зерна или семена растения, включающего одну или более нуклеотидных последовательностей, интегрированных в по меньшей мере один локус FAD3. Обнаружение одной или более таких нуклеотидных последовательностей в одном или более товаров или товарных продуктов является фактическим доказательством того, что товар или товарный продукт был по меньшей мере частично получен на основе трансгенного растения, созданного в соответствии с вариантом осуществления настоящего изобретения. В некоторых вариантах осуществления трансгенное растение или семя, включающее клетку растения, включающую по меньшей мере один модифицированный локус FAD3, может включать по меньшей мере один другой трансгенный случай в своем геноме, включая, без ограничения: трансгенный случай, с которого транскрибируется молекула для РНК-интерференции; ген, кодирующий инсектицидный белок {например, инсектицидный белок Bacillus thuringiensis); ген устойчивости к гербициду (например, ген, обеспечивающий устойчивость к глифосату); и ген, вносящий вклад в желаемый фенотип у трансгенного растения (например, повышенную урожайность, измененный метаболизм жирных кислот или восстановление цитоплазматической мужской стерильности).

Трансгенное растение, включающее клетку растения, включающую по меньшей мере один модифицированный локус FAD3, может иметь один или более желательных признаков. Такие признаки могут включать, например: устойчивость к насекомым, другим вредителям и болезнетворным агентам; устойчивость к гербицидам; повышенную стабильность, урожайность или срок годности; устойчивость к условиям окружающей среды; фармацевтическое производство; промышленное производство и повышения пищевой ценности. Желательные признаки могут быть приданы с помощью одной или более молекул нуклеиновых кислот, интегрированных в результате направленной рекомбинации в локус FAD3, которые экспрессируются в растении, демонстрирующем желательные признаки. Таким образом, в некоторых вариантах осуществления желательный признак может быть обусловлен присутствием трансгена(ов) в растении, который введен в геном растения в месте по меньшей мере одного модифицированного локуса FAD3. В дополнительном варианте осуществления желательный признак может быть достигнут с помощью традиционной селекции, при этом этот признак может быть придан с помощью одной или более молекул нуклеиновых кислот, интегрированных в результате направленной рекомбинации в по меньшей мере один модифицированный локус FAD3.

Трансгенные растения в соответствии с изобретением могут использоваться или выращиваться любым способом, причем присутствие по меньшей мере одного модифицированного локуса FAD3 является желательным. Соответственно, можно сконструировать растение, которое, в частности, имеет один или более желаемых признаков, посредством трансформации молекулами нуклеиновых кислот, которые затем интегрируются сайт-специфическим образом в по меньшей мере один локус FAD3 в соответствии с настоящим изобретением, и возделывания и выращивания любым способом, известным квалифицированным в данной области техники специалистам.

VII. Селекция с помощью маркеров трансгенных растений, включающих нуклеиновую кислоту, интегрированную в локус FAD3 для выполнения операций

Обеспечены молекулярные маркеры, которые сцеплены (например, тесно сцеплены) с Fad2 и Fad3 в Brasicca spp. Например, идентифицированы сегменты ДНК, содержащие последовательности, приведшие к признаку HO (FAD3). Эти сегменты расположены вблизи маркеров и между маркерами, которые сцеплены (например, тесно связаны) с мутантными аллелями в группе сцепления в геноме. Таким образом, молекулы нуклеиновых кислот, включающие мутантный ген FAD3, имеющий инактивирующую мутацию, также обеспечиваются. Идентифицированные сегменты, и их маркеры, включены в объект настоящего изобретения, в частности, согласно их положению в группах сцепления в геноме B. napus.

Все ссылки, включая публикации, патенты и заявки на патенты, приведенные в настоящем описании, включены таким образом посредством ссылки в той мере, в которой они не вступают в противоречие с подробно разработанными деталями этого раскрытия, а значит, включены в той же степени, как если бы было отдельно и конкретно указано, что каждая ссылка включена посредством ссылки, и как если бы каждая ссылка была изложена во всей своей полноте. Ссылки, обсуждаемые в настоящем описании, предоставлены только в случае их раскрытия до даты подачи настоящей заявки. Ничто в настоящем описании не должно быть истолковано как признание того, что авторы настоящего изобретения не имеют права датировать задним числом такое раскрытие ввиду предшествующего изобретения. Следующие примеры приведены для иллюстрации некоторых конкретных признаков и/или вариантов осуществления. Примеры не следует рассматривать как ограничение раскрытия конкретными признаками или вариантами осуществления, приведенными в качестве примера.

ПРИМЕРЫ

Пример 1: Идентификация последовательностей-мишеней FAD3 из библиотеки бактериальных искусственных хромосом

Конструирование библиотеки BAC

Библиотека бактериальных искусственных хромосом (BAC) была получена от коммерческого поставщика (Amplicon Express, Pullman, WA). Библиотека BAC включала 110592 клонов ВАС, содержащих высокомолекулярные фрагменты геномной ДНК (гДНК), выделенные из Brassica napus var. DH10275. гДНК расщепляли с использованием рестрикционного фермента или BamHI, или HindIII. Выделенные фрагменты гДНК длиной приблизительно 135 т.п.н. лигировали в вектор pCC1BAC (Epicentre, Madison, WI) и трансформировали в Escherichia coli str. DH10B (Invitrogen). Библиотека ВАС состояла из четного числа ВАС-клонов, которые были сконструированы с использованием двух различных рестрикционных ферментов. Как таковая ВАС-библиотека, сконструированная с использованием HindIII, находилась в 144 отдельных 384-луночных планшетах. Так же ВАС-библиотека, сконструированная с использованием BamHI, находилась в 144 отдельных 384-луночных планшетах. Всего 110592 ВАС-клонов было выделено и расположено в 288 отдельных 384-луночных планшетах. Каждый из 288 отдельных 384-луночных планшетов предоставлялся поставщиком в виде одной экстракции ДНК для быстрого скрининга на основе ПЦР. Результирующая BAC-библиотека охватывает приблизительно 15 г.п.о. гДНК, что соответствует 12-кратному охвату генома Brassica napus var. DH10275 (оценка генома Brassica napus L. составляет приблизительно 1132 г.п.о., как описано в Johnston et al. (2005) Annals of Botany 95: 229-235).

Анализ кодирующих последовательностей FAD3, выделенных из библиотеки ВАС

Сконструированную библиотеку ВАС использовали для выделения кодирующих последовательностей гена FAD3. Эксперименты по секвенированию проводились с целью идентификации конкретных последовательностей шести гомеологов и паралогов гена FAD3 Brassica napus L. var. DH10275.

Последовательность гена FAD3 была первоначально идентифицирована у модельного вида Arabidopsis thaliana. Последовательность гена приведена в Genbank как локусный маркер: At2g29980. Относительные геномные связи между модельным видом растения Arabidopsis thaliana и диплоидным видом Brassica rapa, одним из прародителей тетраплоидного вида Brassica napus, были описаны ранее (Schranz et al. (2006) Trends in Plant Science 11 (11): 535-542). С использованием конкретной связи с геном FAD сравнительный анализ предсказал, что 3-4 копии гена могут встречаться в диплоидном геноме Brassica. Дополнительные исследования с использованием генетического картирования были завершены Scheffler и др. (1997) в Theoretical and Applied Genetics 94: 583-591. Результаты этих исследований с использованием генетического картирования показали, что шесть копий гена FAD3 присутствовали в Brassica napus.

Предыдущие попытки секвенирования, сосредоточенные на генах FAD3 из Brassica napus, идентифицировали и генетически картировали специфические копии в и А, и С геноме (Hu et al. (2006) Theoretical and Applied Genetics, 113 (3): 497-507). Коллекция маркерных экспрессируемых последовательностей (EST) из специфических для семян библиотек кДНК была ранее создана и секвенирована из линии растений DH12075 Andrew Sharpe из Agriculture and Agri-food Canada, 107 Science Place, Saskatoon, Saskatchewan. В качестве коллекции EST из дублированного гаплоидного растения канолы DH12075 полноразмерные последовательности генов не были доступны, кроме того, также не было показателей качества последовательностей и уверенности в правильности названия нуклеотидов. Следовательно, вариации последовательностей между различными прочтениями последовательностей генов FAD не могли быть однозначно связаны с различными копиями генов различных гомеологов и паралогов семейства генов FAD3, а также не было геномной последовательности. Однако когда был выполнен комбинированный анализ последовательностей с использованием EST, а также двух полноразмерных последовательностей генов FAD3A и FAD3C, описанных в Hu и др. (2006), были идентифицированы EST, которые соответствовали обоим генам, вместе с 4 дополнительными гаплотипами. В результате, всего шесть уникальных гаплотипов FAD3 было идентифицировано. После сборки всех имеющихся данных для различных гаплотипов FAD3, была определена высокая степень дивергенции последовательности в экзоне 1. Дивергенция последовательности FAD3 в экзоне 1 была определена как возможность, которая может быть использована для разработки специфических для гена/аллели ПЦР-праймеров. Кроме того, были идентифицированы или экзоны, которые были в минимальной степени различающимися между гаплотипами (например, экзоны 5, 6, 7 и 8 содержали 1-3 п.н., которые варьировали между FAD3A и FAD3C), или экзоны, которые были лишены вариации последовательности (например, экзоны 2 и 3).

Анализ с использованием секвенирования библиотеки ВАС, которая была сконструирована из B. napus L. var. DH12075, привел к выделению шести последовательностей ВАС (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 и SEQ ID NO: 6), на основе которых были определены кодирующие последовательности для FAD3A (SEQ ID NO: 7), FAD3A' (SEQ ID NO: 8), FAD3A'' (SEQ ID NO: 9), FAD3C (SEQ ID NO: 10), FAD3C'' (SEQ ID NO: 11) и FAD3C' (SEQ ID NO: 12). Последовательности генов FAD3A, FAD3A', FAD3A'', FAD3C, FAD3C'' и FAD3C' были идентифицированы и генетически картированы.

Анализ последовательностей шести генов FAD3 проводили с использованием программы для совмещения последовательностей и построения филогенетического древа методом объединения соседей, используя процент идентичности. Совмещение последовательностей было сделано с помощью программы AlignX® из компьютерной программы Vector NTI Advance 11.0 (Life Technologies, Carlsbad, CA) и представлено на фиг. 1. В AlignX® используется модифицированный алгоритм Clustal W для достижения совмещений множества последовательностей или белков, или нуклеиновых кислот для сравнения сходства и аннотаций. Построение филогенетического древа методом объединения соседей было осуществлено с помощью программного обеспечения Jalview v2.3® и показано на фиг. 2 (Waterhouse et al. (2009) Bioinformatics 25 (9) 1189-1191). Контиги, определенные как содержащие гены FAD3, были использованы в качестве BTASTn-запросов к базе данных генов Arabidopsis thaliana. Область каждого из 6 контигов, содержащих ген FAD3, идентифицировали путем сравнения с геном FAD3 Arabidopsis thaliana. (№ доступа в Genbank: At2g29980). Затем FAD3-контиги были ориентированы таким образом, чтобы все гены FAD3 находились в ориентации от 5' к 3'. FAD3-контиги усекали, чтобы они содержали до 2 выше 5' и 1 ниже 3' генов Arabidopsis thaliana, где это возможно. После ориентации полные кодирующие области генов FAD3 были выделены из каждого контига и использованы для построения филогенетического древа методом объединения соседей, чтобы отобразить связь между различными членами семейства генов FAD3. Шесть членов семейства FAD3 были совмещены в 3 пары генов FAD3 (фиг. 2).

Скрининг на основе ПЦР

Группа ПЦР-праймеров была разработана для скрининга вышеупомянутой библиотеки ВАС. Праймеры были сконструированы, или в виде универсальных праймеров, которые будут амплифицировать все члены семейства генов, или в виде геноспецифических праймеров для направленной амплификации аллелей. Были разработаны ПЦР-праймеры, которые имеют длину 20 п.о. (+/- 1 п.о.) и имеют G/C содержание = 50% (+/- 8%). В таблице 1 приведены праймеры, которые были разработаны и синтезированы. Клоны библиотеки ВАС объединяли и подвергали скринингу с помощью полимеразной цепной реакции (ПЦР).

Таблица 1
Последовательности праймеров, используемых для ПЦР-амплификации последовательностей FAD3
Название праймера: SEQ ID NO: Последовательность:
D_uni_F3_F1 SEQ ID NO:13 GAATAAGCCATCGGACACAC
D_spec_F3_F2 SEQ ID NO:14 ATGCGAACGGAGACGAAAGG
D_spec_F3_F3 SEQ ID NO:15 TGTTAACGGAGATTCCGGTG
D_spec_F3_F4 SEQ ID NO:16 GTAGCAATGTGAACGGAGAT
D_uni_F3_R1 SEQ ID NO:17 CAGTGTATCTGAGCATCCG
D_spec_F3_R2 SEQ ID NO:18 GTGGCCGAGTACGAAGATAG
D_spec_F3_R3 SEQ ID NO:19 CAGTAGAGTGGCCAGAGGA

Два различных набора условий были использованы для полимеразной цепной реакции (ПЦР). Первый ряд ПЦР-реакций содержал: 1X буфер для ПЦР (содержащий dNTP); 1,5 мМ MgCl2, 200 мкМ 0,25 Е ДНК-полимеразы Immolase® (Bioline, London, Великобритания); 250 нМ каждого праймера и приблизительно 5-10 нг матричной ДНК. Второй ряд ПЦР-реакций был разработан для амплификации геномной ДНК и содержал: 5-10 нг геномной ДНК, 1Х буфер для ПЦР, 2 мМ dNTP, 0,4 мкМ прямого и обратного праймера, и 0,25 Е ДНК-полимеразы Immolase® (Bioline, London, Великобритания). Реагенты объединяли в конечном объеме = 13 мкл и амплифицировали, используя термоциклер MJ PTC200® (BioRad, Hercules, CA) или ABI 9700 Gene Amp System® (Life Technologies, Carlsbad, CA). Cкрининг на основе ПЦР конкретных планшетов проводили с использованием способа скрининга по 4 направлениям, основанного на системе скрининга, описанной Bryan и др. (Scottish Crops Research Institute annual report: 2001-2002) с использованием описанных выше условий ПЦР. После скрининга на основе ПЦР объединенных библиотек ВАС, амплифицированный продукт ПЦР секвенировали, используя прямой метод секвенирования по Сэнгеру. Амплифицированные продукты очищали с использованием этанола, ацетата натрия и EDTA, следуя протоколу BigDye® v3.1 (Applied Biosystems), и электрофорез проводили по принципам автоматизированного капиллярного электрофореза ABI3730xl®.

После скрининга на основе ПЦР и используемого для подтверждения секвенирования по Сэнгеру, была идентифицирована коллекция планшетов, которые содержали различные члены семейства генов FAD3. Всего шесть уникальных последовательностей гомеологичных и паралогических генов FAD3 было идентифицировано (Таблица 2). Всего два планшета для каждой последовательности гена было отобрано для подвергания планшета скринингу, чтобы определить конкретную лунку и клон в планшете, который содержал ген FAD3 (таблица 2). Конкретные лунки были определены для обоих планшетов, и индивидуальный клон был выбран для каждого из членов семейства генов FAD3 (таблица 2).

Таблица 2
Определение планшетов с ВАС-клонами, которые давали положительную реакцию с хорошо разработанными комбинациями ПЦР-праймеров, наряду с двумя идентификаторами планшетов, которые были отобраны для идентификации клонов в планшете
Название гена Наборы праймеров Списки позитивных планшетов Выбранные планшеты
FAD3A
(FAD3A-1)
F2+R2 16, 231 Планшет 16 Планшет 231
FAD3C F4+R2 18, 27, 136, 178, 211, 232 Планшет 18 Планшет 27
FAD3C'' (Гаплотип1) F4+R2, F4+R3, F3+R3 23, 44, 53, 56, 77, 116, 158, 199, 209, 278, 280, 282, 283, 284, 286 Планшет 44 Планшет 199
FAD3A' (FAD3A'/FAD3A'') F4+R2 52, 121, 139 Планшет 121 Планшет 139
FAD3C' (Гаплотип 2) F4+R2 144, 188, 235 Планшет 144 Планшет 188
FAD3A'' (Гаплотип 3) F4+R3 и F3+R3 69, 105, 106, 229, 242, 247, 248 Планшет 69 Планшет 106

Один ВАС-клон, для каждого идентифицированного члена семейства генов FAD, дополнительно анализировали с помощью секвенирования. ДНК клона ВАС была выделена и приготовлена для секвенирования, используя набор Large Construct Kit® (Qiagen, Valencia, CA), в соответствии с инструкциями производителя. Экстрагированная ВАС-ДНК была приготовлена для секвенирования с использованием GS-FLX Titanium Technology® (Roche, Indianapolis, IN) в соответствии с инструкциями производителя. Реакции секвенирования проводили с использованием физически разделенного на секторы планшета GS-FLX TI Pico-titer Plate® с BAC, объединенными в пары для оптимального вывода данных. ВАС были объединены в пары, причем ген FAD2 был в паре с геном FAD3. Все созданные данные, касающиеся последовательностей, были собраны с помощью Newbler v2.0.01.14® (454 Life Sciences, Branford, CT). Собранные контиги оценивали вручную на предмет присутствия соответствующего гена FAD, используя Sequencher v3.7® (GeneCodes, Ann Arbor, MI).

После того, как полноразмерная геномная последовательность всех генов FAD3 была определена и полностью охарактеризована, были разработаны нуклеазы на основе цинковых пальцев, которые связываются с последовательностями для каждого конкретного члена семейства генов.

Пример 2: Конструирование связывающих доменов «цинковые пальцы», специфических в отношении генов FAD3

Белки с цинковыми пальцами, направленные против последовательностей ДНК, кодирующих различные функциональные последовательности содержащего FAD3 локуса, были разработаны, как описывалось ранее. Смотрите, например, Urnov et al. (2005) Nature 435: 646-651. Приводимые в качестве примера последовательность-мишень и распознающие спиральные участки продемонстрированы в таблице 3 (конструкции распознающих спиральных участков) и таблице 4 (сайты-мишени). В таблице 4, нуклеотиды в сайте-мишени, с которыми контактируют распознающие спиральные участки ZFP, указаны с использованием заглавных букв; неконтактирующие нуклеотиды указаны с использованием строчных букв. Были сконструированы целевые центры нуклеаз на основе цинковых пальцев (ZFN), которые связываются с семью сайтами-мишенями FAD3. Конструкции цинковых пальцев, специфических в отношении FAD3, были включены в векторы для экспрессии цинковых пальцев, кодирующие белок, имеющий по меньшей мере один палец со структурой CCHC. Смотрите публикацию заявки на патент США № 2008/0182332. В частности, последний палец в каждом белке имел остов CCHC для распознающего спирального участка. Кодирующие неканонические цинковые пальцы последовательности были слиты с доменом с нуклеазной активностью рестрикционного фермента типа IIS - FokI (аминокислотами 384-579 последовательности Wah et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10564-10569) посредством ZC линкера из четырех аминокислот и сигналом ядерной локализации opaque-2, происходящим из Zea mays, с образованием нуклеаз на основе цинковых пальцев, специфическими в отношении FAD3 (ZFN). Экспрессией составных белков управлял относительно сильный конститутивный промотор, такой промотор, происходящий из промотора вируса мозаики прожилок листьев маниоки (CsVMV), и сбоку от них находился 3' нетранслируемый район ORF23 Agrobacterium tumefaciens (AtuORF23 3'UTR vl). Самогидролизующаяся 2А кодирующая нуклеотидная последовательность из вируса Thosea asigna (Szymczak et al. 2004) была добавлена между двумя ZFN, которые были клонированы в конструкцию. Примеры векторов описаны ниже.

Расщепляющую активность оптимальных цинковых пальцев подтверждали, используя систему на основе почкующихся дрожжей, которая, как было ранее установлено, позволяет идентифицировать активные нуклеазы. Смотрите, например, публикацию заявки на патент США № 20090111119; Doyon et al. (2008) Nat Biotechnol. 26: 702-708; Geurts et al. (2009) Science 325:433. Цинковые пальцы для различных функциональных доменов были выбраны для in-vivo использования. Из многочисленных ZFN, которые были сконструированы, продуцированы и, как проверено, связываются с предполагаемыми полинуклеотидными сайтами-мишенями в геномном локусе FAD, были идентифицированы пятнадцать ZFN, обладающих in vivo активностью на высоком уровне, и они были выбраны для дальнейших экспериментальных работ. Эти ZFN были охарактеризованы как способные эффективно связывать и расщеплять уникальные полинуклеотидные сайты-мишени в локусе FAD3 в полевых условиях.

Таблица 3
Конструкции специфических в отношении FAD3 цинковых пальцев
ZFP sF1 F2 F3 F4 F5 F6
27961 QKKDRSY
(SEQ ID NO:117)
QRGNRNT (SEQ ID NO:119) RSDHLSR (SEQ ID NO:120) RNQDRTN (SEQ ID NO:121)
27962 (SEQ ID NO:122) RQDSRSQ (SEQ ID NO:123) QSSDLSR (SEQ ID NO:124) DRSALAR (SEQ ID NO:125) TSGSLTR (SEQ ID NO:126) N/A
27973 QSSDLSR (SEQ ID NO:124) AASNRSK (SEQ ID NO:128) TSGSLSR (SEQ ID NO:129) RSDALAR (SEQ ID NO:130) RSDVLST (SEQ ID NO:131) WGRLRKL (SEQ ID NO:132)
27974 ERGTLAR (SEQ ID NO:133) RSDDLTR (SEQ ID NO:134) RSDHLSA (SEQ ID NO:135) QHGALQT (SEQ ID NO:136) TSGNLTR (SEQ ID NO:137) QSGHLSR (SEQ ID NO:138)
27987 TSGSLTR (SEQ ID NO:126) RSDHLSQ (SEQ ID NO:140) CTRNRWR (SEQ ID NO:141) RSDNLSE (SEQ ID NO:142) ASKTRKN (SEQ ID NO:143) N/A
27990 TSGSLSR (SEQ ID NO:129) TSSNRAV (SEQ ID NO:145) TSGNLTR (SEQ ID NO:137) DRSALAR (SEQ ID NO:125) RSDVLSE (SEQ ID NO:148) RNFSLTM (SEQ ID NO:149)
27991 QSGDLTR (SEQ ID NO:150) TSGSLSR (SEQ ID NO:129) QSGNLAR (SEQ ID NO:152) TSGSLSR (SEQ ID NO:129) QSGSLTR (SEQ ID NO:154) N/A
27992 DRSHLAR (SEQ ID NO:155) TSGSLSR (SEQ ID NO:129) TSSNRAV (SEQ ID NO:145) TSGNLTR (SEQ ID NO:137) DRSALAR (SEQ ID NO:125) N/A
28004 QSGNLAR (SEQ ID NO:152) HLGNLKT (SEQ ID NO:161) RSDHLSQ (SEQ ID NO:140) TARLLKL (SEQ ID NO:163) QSGNLAR (SEQ ID NO:152) QTSHLPQ (SEQ ID NO:165)
28005 RSDNLSV (SEQ ID NO:166) TSGHLSR (SEQ ID NO:167) TSGSLTR (SEQ ID NO:126) RSDALST (SEQ ID NO:169) DRSTRTK (SEQ ID NO:170) N/A

28021 QNAHRKT (SEQ ID NO:171) TSGNLTR (SEQ ID NO:137) LKQMLAV (SEQ ID NO:173) RSDNLSR (SEQ ID NO:174) DNSNRKT (SEQ ID NO:175) N/A
28022 RSDNLSV (SEQ ID NO:166) QNANRIT (SEQ ID NO:177) TSGSLSR (SEQ ID NO:129) QSSVRNS (SEQ ID NO:179) DRSALAR (SEQ ID NO:125) N/A
28023 RSDNLSR (SEQ ID NO:174) DNSNRKT (SEQ ID NO:175) DRSNLTR (SEQ ID NO:183) RSDVLSE (SEQ ID NO:148) TRNGLKY (SEQ ID NO:185) N/A
28024 RSDALAR (SEQ ID NO:130) RSDVLSE (SEQ ID NO:148) RSSDRTK (SEQ ID NO:188) RSDNLSV (SEQ ID NO:166) QNANRIT (SEQ ID NO:177) N/A
28025 QSSDLSR (SEQ ID NO:124) QSTHRNA (SEQ ID NO:192) RSDNLAR (SEQ ID NO:116) QRGNRNT (SEQ ID NO:119) RSDHLSR (SEQ ID NO:120) RNQDRTN (SEQ ID NO:121)
28026 DRSNLSR (SEQ ID NO:122) RQDSRSQ (SEQ ID NO:123) QSSDLSR (SEQ ID NO:124) DRSALAR (SEQ ID NO:125) TSGSLTR (SEQ ID NO:126) N/A
28035 QSSDLSR (SEQ ID NO:124) AASNRSK (SEQ ID NO:128) TSGSLSR (SEQ ID NO:129) RSDALAR (SEQ ID NO:130) RSDTLSQ (SEQ ID NO:206) QRDHRIK (SEQ ID NO:207)
28036 RSDDLTR (SEQ ID NO:134) QSSDLRR (SEQ ID NO:209) RSDHLSA (SEQ ID NO:135) QHGALQT (SEQ ID NO:136) TSGNLTR (SEQ ID NO:137) QSGHLSR (SEQ ID NO:138)
28039 TSGSLSR (SEQ ID NO:129) RSDALAR (SEQ ID NO:130) RSDTLSQ (SEQ ID NO:206) QRDHRIK (SEQ ID NO:207) TSGNLTR (SEQ ID NO:137) DRGDLRK (SEQ ID NO:219)
28040 DSSDRKK (SEQ ID NO:220) TSGNLTR (SEQ ID NO:137) DNYNRAK (SEQ ID NO:222) DRSHLTR (SEQ ID NO:223) RSDNLTT (SEQ ID NO:224) N/A
28051 RSDNLSN (SEQ ID NO:225) TSSSRIN (SEQ ID NO:226) RSDNLSE (SEQ ID NO:142) ASKTRKN (SEQ ID NO:143) RSDALTQ (SEQ ID NO:229) N/A

28052 RSDTLST (SEQ ID NO:230) DRSSRIK (SEQ ID NO:231) RSDDLSK (SEQ ID NO:232) DNSNRIK (SEQ ID NO:233) N/A N/A
28053 QSSDLSR (SEQ ID NO:124) QAGNLSK (SEQ ID NO:235) QSGDLTR (SEQ ID NO:150) TSGSLSR (SEQ ID NO:129) QSGNLAR (SEQ ID NO:152) N/A
28054 TSGSLSR (SEQ ID NO:129) LRQTLRD (SEQ ID NO:240) TSGNLTR (SEQ ID NO:137) DRSALAR (SEQ ID NO:125) RSDVLSE (SEQ ID NO:148) RNFSLTM (SEQ ID NO:149)
28055 QSGDLTR (SEQ ID NO:150) TSGSLSR (SEQ ID NO:129) QSGNLAR (SEQ ID NO:152) TSGSLSR (SEQ ID NO:129) QSGSLTR (SEQ ID NO:154) N/A
28056 DRSHLAR (SEQ ID NO:155) TSGSLSR (SEQ ID NO:129) LRQTLRD (SEQ ID NO:240) TSGNLTR (SEQ ID NO:137) DRSALAR (SEQ ID NO:125) N/A

Таблица 4
Сайты-мишени для специфических в отношении FAD3 цинковых пальцев
ZFP Сайт-мишень (5'→3') SEQ ID NO:
27961 cgCCGGAGAAAGAGAGAGAGctttgagg SEQ ID NO:20
27962 tgGTTGTCGCTATGGACcagcgtagcaa SEQ ID NO:21
27969 tcTCCGTTcGCATTGcTACGCTggtcca SEQ ID NO:22
27970 gaAAGGTTtGATCCGAGCGCAcaaccac SEQ ID NO:23
27973 tcTCCGTTcGCATTGcTACGCTggtcca SEQ ID NO:22
27974 tcGGAGATATAAGGGCGGCCattcctaa SEQ ID NO:25
27987 taGCCCAGAACAGGGTTccttgggcggc SEQ ID NO:26
27988 ctTCGTACTCGGCCACGactggtaattt SEQ ID NO:27
27989 ttGAAGTTGCAaTAAGCTttctctcgct SEQ ID NO:28
27990 acTTGCTGGTCGATCATGTTggccactc SEQ ID NO:29
27991 aaGTAGTTGAAGTTGCAataagctttct SEQ ID NO:30
27992 tgGTCGATCATGTTGGCcactcttgttt SEQ ID NO:31
28004 aaCGAGAATGAAGGAATGAAgaatatga SEQ ID NO:32
28005 atACCATGGTTGGTAAGtcatttatttt SEQ ID NO:33
28021 ccAACGAGgAATGATAGAtaaacaagag SEQ ID NO:34

28022 caGTCACAGTTcTAAAAGtctatggtgt SEQ ID NO:35
28023 tgTGACTGGACcAACGAGgaatgataga SEQ ID NO:36
28024 tcTAAAAGTCTATGGTGttccttacatt SEQ ID NO:37
28025 cgCCGGAGAAAGAGAGAGCTttgaggga SEQ ID NO:38
28026 tgGTTGTCGCTATGGACcagcgtagcaa SEQ ID NO:21
28035 ctTAAACGGTGGTTgTGCGCTcggatca SEQ ID NO:40
28036 tcGGAGATATAAGGGCTGCGattcctaa SEQ ID NO:41
28039 tcTCCGATctTAAACGGTGGTTgtgcgc SEQ ID NO:42
28040 atAAGGGCTGCGATTCCtaagcattgtt SEQ ID NO:43
28051 agATGGCCCAGAAAAGGgttccttgggc SEQ ID NO:44
28052 cgTACTCGGCCACGactggtaatttaat SEQ ID NO:45
28053 ttGAAGTTGCAaTAAGCTttctctcgct SEQ ID NO:28
28054 acTTGCTGGTCGATCGTGTTggccactc SEQ ID NO:47
28055 aaGTAGTTGAAGTTGCAataagctttct SEQ ID NO:30
28056 tgGTCGATCGTGTTGGCcactcttgttt SEQ ID NO:49

Пример 3: Оценка расщепления генов FAD3 нуклеазой на основе цинковых пальцев

Сборка конструкций

Плазмидные векторы, содержащие конструкции для экспрессии приводимых в качестве примера нуклеаз на основе цинковых пальцев - ZFN, которые были идентифицированы, используя анализ на основе дрожжей, описанный в примере 2, были разработаны и укомплектованы, используя навыки и методы, общеизвестные в данной области техники. Каждая кодирующая цинковые пальцы последовательность была слита с последовательностью, кодирующей сигнал ядерной локализации opaque-2 (Maddaloni et al. (1989) Nuc. Acids Res. 17(18): 7532), который был расположен на N-конце нуклеазы на основе цинковых пальцев.

Затем, слитая последовательность сигнал ядерной локализации opaque-2:: нуклеаза на основе цинковых пальцев была объединена в пару с комплементарной слитой последовательностью сигнал ядерной локализации opaque-2:: нуклеаза на основе цинковых пальцев. Как таковая, каждая конструкция включала одну открытую рамку считывания, состоящую из двух слитых последовательностей сигнал ядерной локализации opaque-2:: нуклеаза на основе цинковых пальцев, разделенных последовательностью 2A из вируса Thosea asigna (Mattion et al. (1996) J. Virol. 70: 8124-8127). Экспрессией составных белков управлял относительно сильный конститутивный промотор, такой промотор, происходящий из промотора вируса мозаики прожилок листьев маниоки (CsVMV), и сбоку от них находился 3' нетранслируемый район ORF23 Agrobacterium tumefaciens (AtuORF23 3'UTR).

Сборку векторов осуществляли, используя IN-FUSION™ Advantage Technology (Clontech, Mountain View, CA). Эндонуклеазы рестрикции были получены от New England Biolabs (NEB; Ipswich, MA), и ДНК-лигазу Т4 (Invitrogen) использовали для лигирования ДНК. Приготовление плазмид осуществляли, используя набор NucleoSpin® Plasmid Kit (Macherey-Nagel Inc., Bethlehem, PA) или Plasmid Midi Kit (Qiagen) в соответствии с инструкциями поставщиков. Фрагменты ДНК выделяли, используя набор QIAquick Gel Extraction Kit™ (Qiagen) после гель-электрофореза с использованием Трис-ацетатного буфера. Колонии всех собранных плазмид первоначально скринировали путем рестрикционного расщепления ДНК минипрепарата. Плазмидную ДНК отобранных клонов секвенировал поставщик коммерческих услуг по секвенированию (Eurofins MWG Operon, Huntsville, AL). Данные, касающиеся последовательности, были собраны и проанализированы с помощью программного обеспечения SEQUENCHER™ (Gene Codes Corp., Ann Arbor, MI). Перед доставкой в протопласты B. napus, плазмидную ДНК получали из культур E. coli, используя Pure Yield Plasmid Maxiprep System® (Promega Corporation, Madison, WT) или Plasmid Maxi Kit® (Qiagen, Valencia, CA) в соответствии с инструкциями поставщиков.

Результирующие одиннадцать плазмидных конструкций: pDAB107824 (ZFN 28025-2A-28026), pDAB107815 (ZFN 27961-2A-27962), pDAB107816 (ZFN 27969-2A-27970), pDAB107817 (ZFN 27973-2A-27974), pDAB107825 (ZFN 28035-2A-28036), pDAB107826 (ZFN 28039-2A-28040), pDAB107818 (ZFN 27987-2A-27988), pDAB107827 (ZFN 28051-2A-28052), pDAB107821 (ZFN 28004-2A-28005), pDAB107819 (ZFN 27989-2A-27990), pDAB107828 (ZFN 28053-2A-28054) (фиг. 3), pDAB107829 (ZFN 28055-2A-28056) (фиг. 4), pDAB107820 (ZFN 27991-2A-27992), pDAB107822 (ZFN 28021-2A-28022) и pDAB 107823 (ZFN 28023-2A-28024) были подтверждены с помощью расщепления рестрикционными ферментами и посредством секвенирования ДНК.

Получение ДНК для трансфекции

Плазмидную ДНК описанных выше векторов стерилизовали путем осаждения, промывали в 100% (об./об.) этанола и сушили в вытяжном шкафу с ламинарным потоком. Осадок ДНК суспендировали в 30 мкл стерильной бидистиллированной воды в конечной концентрации, составляющей 0,7 мкг/мкл, для трансфекции в протопласты клеток, как описано ниже. Приготовление плазмидной ДНК было проведено, чтобы получить в результате суперскрученную плазмидную ДНК для транзиторной трансфекции и линеаризованной плазмидной ДНК для стабильной трансфекции. Добавление ДНК-носителя (например, ДНК спермы рыб) к плазмиде для трансформации не требовалось в случае транзиторной трансфекции протопластов клеток. Для транзиторных исследований приблизительно 30 мкг плазмидной ДНК на 106 протопластов использовали для каждой трансформации.

Трансфекция

Трансфекцию Brassica napus L. var. DH10275 выполняли, как описано в Spangenberg et al. (1986) Plant Physiology 66: 1-8, составы сред описаны в Spangenberg G. and Protrykus I. (1995) Polyethylene Glycol-Mediated Direct Gene Transfer in Tobaco Protoplast. In Gene Transfer to Plants (Protrykus I. and Spangenberg G. Eds) Springer-Verlag, Berlin. Семена Brassica napus были подвергнуты поверхностной стерилизации в 70% этаноле. Семена погружали в 12 мл 70% раствора этанола и перемешивали с помощью осторожного встряхивания смеси в течение 10 минут. 70% раствор этанола удаляли путем слива раствора и заменяли раствором для стерилизации семян, состоящим из 1% масс./об. гипохлорита кальция и 0,1% об./об. Твина-20. Семена погружали в раствор для стерилизации семян и перемешивали с помощью осторожного встряхивания смеси в течение 25 минут. Раствор для стерилизации семян сливали, и подвергнутые стерилизации семена промывали три раза в 50 мл стерильной воды. И, наконец, семена переносили на стерильные 80-мм диски из фильтровальной бумаги Whatman (Fisher-Scientific, St. Louis, МО), которые клали в чашку Петри, и семена слегка пропитывали стерильной водой. Чашку Петри закрывали герметично Parafilm® (Fisher-Scientific, St. Louis, МО), и чашки инкубировали при 25°С в полной темноте в течение одного-двух дней. После того, как отмечались признаки прорастания семян, проростки переносили в чашку Петри, содержащую затвердевшую среду GEM, для способствования дальнейшему прорастанию семян. Проростки инкубировали в среде GEM при 25°С в течение четырех-пяти дней.

Объем жидкой среды PS (приблизительно 10 мл) сливали в стерильную чашку Петри. Используя стерильный пинцет и скальпель, надземную часть четырех-пяти-дневного проростка на стадии роста и развития 4-го листа удаляли и отбрасывали Сегменты гипокотиля длиной 20-40 мм, как было установлено, дают наибольшую популяцию небольших протопластов с богатым содержанием цитоплазмы. Сегменты гипокотиля асептически вырезали и переносили в жидкую среду PS. Вырезанные сегменты гипокотиля объединяли и разрезали в поперечном направлении на 5-10-мм сегменты. Затем сегменты гипокотиля переносили в свежую среду PS и инкубировали при комнатной температуре в течение 1 часа. Подвергнутые плазмолизису гипокотили переносили в чашку Петри, содержащую раствор фермента. Следили за тем, чтобы все сегменты гипокотиля были погружены в раствор. Чашки Петри закрывали герметично Parafilm® и инкубировали в течение ночи в течение шестнадцати-восемнадцати часов при 20-22°С при осторожном встряхивании.

Протопласты клеток освобождали из сегментов гипокотиля. Продукты расщепления в течение ночи гипокотиля осторожно перемешивали для освобождения протопластов в растворе фермента. Чашку Петри слегка наклоняли, чтобы способствовать переносу суспензии расщепления, включающей раствор фермента и растительные остатки. Используя 10-мл пипетку, суспензию расщепления переносили в стерилизованную установку для фильтрации (фильтр с отверстием = 100 микрон) протопластов для дальнейшего отделения протопластов от растительных остатков. По установке для фильтрации осторожно постукивали для освобождения лишней жидкости, которая была захвачена в сито. Суспензию протопластов, приблизительно от 8 до 9 мл, осторожно перемешивали и распределяли по 14-мл стерильным пластиковым центрифужным пробиркам с круглым дном. На каждую суспензию наслаивали 1,5 мл раствора W5. Раствор W5 осторожно подавали на суспензию протопластов под углом и подавали по каплям с минимальным перемешиванием. Добавление раствора W5 к суспензии протопластов приводило к получению богатой протопластами поверхности раздела. Эту поверхность раздела собирали с помощью пипетки. Далее, собранные протопласты переносили в новую 14-мл центрифужную пробирку и осторожно перемешивали. Выход или полученные протопласты определяли, используя гемоцитометр, для определения количества протопластов на мл. Способ повторяли, причем ткань листа расщепляли с получением протопластов мезофильного происхождения.

Затем добавляли раствор W5 до объема = 10 мл, и протопласты осаждали при 70×g, перед удалением раствора W5. Остающуюся суспензию протопластов ресуспендировали при осторожном встряхивании. Каждую пробирку, содержащую суспензию протопластов, заполняли 5 мл раствора W5 и инкубировали при комнатной температуре от одного до четырех часов. Суспензии протопластов осаждали при 70×g, и весь раствор W5 удаляли. Затем добавляли 300 мкл буфера для трансформации в каждую из суспензий из осажденных протопластов, которые содержали выделенные протопласты. В каждую из пробирок, 10 мкг плазмидной ДНК добавляли к суспензиям протопластов. Плазмидная ДНК включала конструкции нуклеаз на основе цинковых пальцев, описанных выше. Затем добавляли 300 мкл предварительно подогретого раствора ПЭГ 4000 к суспензии протопластов, и по пробиркам осторожно постукивали. Допускали инкубацию суспензий протопластов, и смеси для трансформации при комнатной температуре в течение пятнадцати минут без какого-либо перемешивания. Еще 10 мл раствора W5 добавляли в каждую пробирку в виде последовательных аликвот = 1 мл, 1 мл, 1 мл, 2 мл, 2 мл, и 3 мл при осторожном перевертывании пробирок между каждым добавлением раствора W5. Протопласты осаждали посредством центрифугирования в центрифуге при 70×g. Весь раствор W5 удаляли, оставляя чистую суспензию протопластов.

Затем добавляли 0,5 мл среды K3 к осажденным протопластам клеток, и клетки ресуспендировали. Ресуспендированные протопласты клеток помещали в центр чашки Петри с 5 мл К3 и 0,6 мл агарозы Sea Plaque™ (Cambrex, East Rutherford, NJ) в соотношении 1:1. Чашки Петри встряхивали одним плавным вихревым движением и оставляли инкубировать в течение 20-30 минут при комнатной температуре. Чашки Петри закрывали герметично Parafilm®, и протопласты культивировали в течение двадцати четырех часов в полной темноте. После инкубации в темноте чашки Петри культивировали в течение шести дней при тусклом свете (5 мкМоль м-2 сек-1 из трубок белого свечения Osram L36 W/21 Lumilux). После стадии культивирования использовали стерильный шпатель для разделения агарозы, содержащий протопласты, на четверти круга. Разделенные четверти круга помещали в 250-мл пластиковый сосуд для культивирования, содержащий 20 мл среды А, и инкубировали на роторной качалке при 80 об./мин и амплитуде качания - 1,25 см при 24°С в постоянно тусклом свете в течение 14 дней, а затем анализировали для определения уровня активности каждой конструкции ZFN.

Выделение геномной ДНК из протопластов канолы

Трансфецированные протопласты поставляли в отдельных 1,5- или 2,0-мл микроцентрифужных пробирках. Клетки были осаждены на дне пробирке в буферном растворе. Экстракцию ДНК осуществляли с помощью быстрого замораживания клеток в жидком азоте с последующей лиофилизацией клеток, в течение приблизительно 48 часов в Labconco Freezone 4.5® (Labconco, Kansas City, MO) при -40°С и давлении приблизительно 133×10-3 мбар. Лиофилизированные клетки подвергали экстракции ДНК с использованием набора для растений DNeasy® (Qiagen, Carlsbar, CA), следуя инструкциям производителя, за исключением того, что разрушение ткани не требовалось, и протопласты клеток добавляли непосредственно в буфер для лизиса.

Проверка специфических для FAD3A и FAD3C ZFN в отношении расщепления геномных последовательностей ДНК в протопластах канолы

Разработка сайтов-мишеней ZFN в локусе, содержащем FAD3A и FAD3C, была кластерной, так что было разработано множество пар ZFN для перекрывания сайтов-мишеней. Кластеризация сайтов-мишеней ZFN позволила разработать ПЦР-праймеры, которые будут амплифициовать фланкирующую геномную последовательность из всех членов семейства генов FAD3A и FAD3C в 100-п.н. окне, чтобы охватить все перекрывающиеся сайты-мишени ZFN. Как таковая, технология секвенирования с коротким прочтением Illumina могла использоваться для оценки целостности сайта-мишени ZFN в трансфецированных протопластах. Кроме того, требовалось, чтобы разработанные ПЦР-праймеры включали специфические нуклеотидные основания, которые приписывали бы прочтения последовательностей к конкретному члену-гену семейства генов FAD3А и FAD3C. Поэтому требовалось, чтобы все ПЦР-праймеров связывали 5-10 нуклеотидов от любого сайта-мишени ZFN, поскольку известно, что активность в виде негомологичного соединения концов (NHEJ) вызывает небольшие делеции, которые могут удалить место праймирования с ингибированием амплификации и, следовательно, искажением оценки активности NHEJ.

Были разработаны праймеры, которые связываются со всеми из локусов-мишеней ZFN для семейств генов FAD3A и FAD3C (таблица 5), и они были проверены эмпирически в отношении амплификации всех членов семейства генов посредством секвенирования по Сэнгеру продуктов ПЦР-амплификации. В ряде случаев не смогли разработать праймеры, которые различали бы все члены семейства генов (таблица 6), однако во всех случаях являющиеся мишенями последовательности генов FAD3A или FAD3C можно было отличить. После разработки ПЦР-праймеров последовательности ДНК в качестве специальных штрих-кодов были включены в праймеры для ПЦР, которые использовали, чтобы отличить различные локусы-мишени ZFN локусы и отнести конкретные прочтения последовательностей к трансфекции и ZFN (таблицы 5 и 6).

Таблица 5
Эффективность амплификации разработанных праймеров для ПЦР, определенная на семействах генов FAD3. «X» указывает на специфичность детекции копий гена, подчеркивание и «+» указывает на то, что в конкретном локусе, о котором идет речь, прочтения последовательностей, которые предусматривают два праймера, не удалось различить, и «N/A» означает, что локус не удалось амплифицировать, исходя из этих конкретных копий генов
Локус для ZFN Копия гена FAD
FAD3A FAD3C FAD3A' FAD3C' FAD3A'' FAD3C''
Локус 1 X X X X X X
Локус 2 X X X X N/A X
Локус 3 X X + + X X
Локус 4 X X X X + +
Локус 5 X X N/A N/A N/A N/A
Локус 6 X X X X X X
Локус 7 X X X X X X

Таблица 6
Последовательности праймеров, разработанных для оценки активности специфических в отношении FAD3 ZFN. Праймеры включают специальные штрих-коды, наряду с обоими необходимыми для Illumina адаптерными последовательностями для конструирования библиотеки Illumina для секвенирования с помощью синтеза. Приобретенные праймеры представляли собой сумму всех трех представленных колонок
ID локуса SEQ ID NO: Последовательность адаптерного праймера Illumina Штрих-код Специфический для локуса праймер
FAD3_ZFN_Locus1A_F3 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCT ACGTA CCTTTCTTCACCACATTYCA
FAD3_ZFN_Locus1B_F3 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCT CGTAC CCTTTCTTCACCACATTYCA

FAD3_ZFN_Locus2C_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGACGATGGTTGTCGCTATGGACC
FAD3_ZFN_Locus3D_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACTCGAAAGGTTTGATCCRAGCG
FAD3_ZFN_Locus3E_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGCGAAAGGTTTGATCCRAGCG
FAD3_ZFN_Locus3F_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTACTGACGAAAGGTTTGATCCRAGCG
FAD3_ZFN_Locus4G_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCTAGCCGTGTATTTTGATAGCTGGTTC
FAD3_ZFN_Locus4H_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTAGCCCGTGTATTTTGATAGCTGGTTC
FAD3_ZFN_Locus5J_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTAGCTGGAGCTTCTCAGACATTCCTCT
FAD3_ZFN_Locus6K_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCAGTGTTTATTTGCCCCAAGCGAGAG
FAD3_ZFN_Locus6L_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGTCGTTTATTTGCCCCAAGCGAGAG
FAD3_ZFN_Locus6M_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTCAGTTTATTTGCCCCAAGCGAGAG
FAD3_ZFN_Locus6N_F1 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCAGGTTTATTTGCCCCAAGCGAGAG
FAD3_ZFN_Locus7P_F3 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTACGACTTCAACTACTTGCTGGTCSAT
FAD3_ZFN_Locus7Q_F3 50 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACGTACTTCAACTACTTGCTGGTCSAT
FAD3_ZFN_Locus1A_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTACGTACGTTCACATTGSTRCGYTGG
FAD3_ZFN_Locus1B_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTCGTACCGTTCACATTGSTRCGYTGG
FAD3_ZFN_Locus2C_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTCTGACCCGATCTTAAACGGYGGTTGT
FAD3_ZFN_Locus3D_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTGACTTAGCTCATGGATCTCAAAGGACT

FAD3_ZFN_Locus3E_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGACTGTAGCTCATGGATCTCAAAGGACT
FAD3_ZFN_Locus3F_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTACTGATAGCTCATGGATCTCAAAGGACT
FAD3_ZFN_Locus4G_R_uni 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGCTAGTTAAATTACCAGTCGTGGCC
FAD3_ZFN_Locus4H_R_uni 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTCTAGCTTAAATTACCAGTCGTGGCC
FAD3_ZFN_Locus5J_R2 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTAGCTCTTTTTTCTTCGATKCTAAAGATT
FAD3_ZFN_Locus6K_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTCAGTCTGTGACTGGACCAACGAGG
FAD3_ZFN_Locus6L_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTCAGTCCTGTGACTGGACCAACGAGG
FAD3_ZFN_Locus6M_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTAGTCACTGTGACTGGACCAACGAGG
FAD3_ZFN_Locus6N_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGTCAGCTGTGACTGGACCAACGAGG
FAD3_ZFN_Locus7P_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGTACGACTTACAATGTAAGGAACRCCRTA
FAD3_ZFN_Locus7Q_R1 65 CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTACGT
ACTTACAATGTAAGGAACRCCRTA

После экстракции ДНК из протопластов канолы, трансфецированных ZFN, была осуществлена ПЦР-амплификация локусов-мишеней ZFN с целью получения необходимых специфических для локусов молекул ДНК в правильном для секвенирования на основе Illumina с помощью технологии синтеза формате. Каждый анализ был оптимизирован для работы на 25 нг исходной ДНК (приблизительно 12500 эквивалентов генома из клеток Brassica napus). Проводили несколько реакций на образец, чтобы обеспечить охват, необходимый для оценки эффективности NHEJ и специфичности на соответствующем уровне, приблизительно шестнадцать ПЦР-реакций, которые эквивалентны 200000 копям генома Brassica napus из индивидуальных протопластов. Maxter-Mix для ПЦР-амплификации были приготовлены для всех образцов, подлежащих исследованию с помощью одного и того же анализа, и одну реакцию, выполненную в трех повторах, анализировали, используя количественный метод ПЦР, который был использован для определения оптимального количества циклов, выполняемых на ткани-мишени, чтобы гарантировать то, что ПЦР-амплификация не стала бы блокированной из-за нехватки реагентов и все еще находилась бы в экспоненциальной стадии амплификации. Эксперименты с необходимыми отрицательными контрольными реакциями проводили в 96-луночном формате, используя термоциклер MX3000P thermocycler® (Stratagene, LaJolla, CA).

Из результата, полученного на основе основных принципов количественной ПЦР, относительное увеличение флуоресценции наносили на график от цикла к циклу, и определяли количество циклов в анализе, которое обеспечило бы достаточную амплификацию, без позволения реакции стать блокированной из-за нехватки реагентов, в попытке снизить излишнее циклирование и амплификацию общих транскриптов или молекул. Неиспользованную Maxter-Mix, остающуюся на льду до завершения анализа с помощью количественной ПЦР и определения числа циклов, затем делили на аликвоты в нужное количество реакционных пробирок (приблизительно 16 для каждого анализа ZFN), и проводили ПЦР-реакцию.

После амплификации образцы для одного локуса-мишени ZFN объединяли вместе, и 200 мкл объединенного продукта для каждой ZFN очищали, используя набор MinElute PCR purification kit® (Qiagen), в соответствии с инструкциями производителя. Чтобы смочь секвенировать образец с использованием технологии короткого прочтения Illumina, требовалось присоединить дополнительные спаренные концевые праймеры путем амплификации на образованных фрагментах. Это было достигнуто путем ПЦР-амплификации с использованием праймеров, которые были бы частично комплементарны последовательности, добавленной в первом цикле, но также содержат необходимую спаренную концевую последовательность. Оптимальное количество циклов ПЦР для выполнения, которое добавило бы спаренные концевые последовательности без излишней амплификации общих фрагментов к матрице, снова определяли, используя прогонки образца через анализ циклов с использованием количественной ПЦР, как описано ранее.

После ПЦР-амплификации, полученный продукт очищали с помощью MinElute column® (Qiagen), следуя инструкциям производителя, и разделяли в 2,5% агарозном геле. Фрагменты ДНК, визуализированные с использованием Syber® Safe (Life Technologies, Carlsbad, CA) в виде полос правильного размера, выделяли из геля, чтобы удалить любые остаточные, образованные в ходе ПЦР димеры праймеров или другие побочные фрагменты, ДНК экстрагировали из куска геля, используя MinElute gel extraction kit® (Qiagen), в соответствии с инструкциями производителя. После завершения экстракции из геля проводили дополнительную очистку ДНК, используя магнитные шарики AMPure® (Beckman-Coulter, Brea, CA), в соотношении ДНК:шарик = 1:1,7. Затем ДНК оценивали в отношении концентрации, используя набор для количественного анализа библиотеки на основе количественной ПЦР для секвенирования Illumina (KAPA) с использованием разведения 1/40000 и 1/80000 и с выполнением реакции в трех повторах. На основании результатов количественной ПЦР ДНК разводили до стандартной концентрации = 2 нМ, и все библиотеки объединяли для секвенирования ДНК. Образцы готовили для секвенирования с использованием набора cBot cluster generation kit® (Illumina, San Diego, CA) и секвенировали на Illumina GA2x® с прочтениями = 100 п.о. при секвенировании спаренных концов, следуя инструкциям производителя.

Метод анализа данных для определения негомологичного соединения концов в сайтах-мишенях цинковых пальцев.

После завершения реакции секвенирования и получения первичных данных, выполненного с использованием канала биоинформации Illumina для распознания азотистых оснований, был выполнен полный анализ для определения делетированных оснований в сайте-мишени ZFN в каждом конкретном случае. Был разработан специальный сценарий PERL для извлечения и сортировки штрих-кодов из последовательностей ДНК путем вычислений, следуя списку входных последовательностей. Штрих-код должен был соответствовать эталонной последовательности с оценкой в Phred, превышающей 30, чтобы быть приемлемым, для уменьшения ошибочного отнесения прочтений последовательностей. После того, как прочтения последовательностей были сгруппированы в разные группы штрих-кодов, которые были использованы, фильтр качества пропускали через все последовательности. Фильтр качества был вторым специально разработанным сценарием PERL. Прочтения последовательностей исключали, если было больше трех оснований, называемых «N», или если средняя оценка в Phred была меньше 20, или если было 3 последовательных основания с оценкой в Phred меньше 20, или если длина прочтения последовательности была меньше 40 п.о. Остальные последовательности объединяли, если оба спаренных прочтения последовательности были доступны, используя пакет NextGENe® (SoftGenetics, State College, PA). Остальные объединенные прочтения последовательностей затем сокращали до коллекции уникальных прочтений последовательности, используя третий специальный сценарий PERL, со счетом количества избыточных последовательностей, которые были определены регистрируемыми на конце оставшейся части идентификатора последовательности. Уникальные прочтения последовательностей затем совмещали с эталонной последовательностью FAD3, используя программное обеспечение NextGENe®, которое создало содержащий пропуски, выровненный файл FASTA.

Используя содержащий пропуски файл FASTA, осуществляли изменение номера положения пропущенного основания относительной входной эталонной последовательности с использованием четвертого специального сценария PERL. Это позволило идентифицировать основания, которые позволяют дифференцировать различные члены семейства генов, (либо гомеологичную или паралогичную вариацию последовательности между различными членами семейства генов) в собранных данных. После выполнения изменения нумерации оснований было возможным создание сводок гаплотипов для всяких уникальных прочтений последовательностей и отнесение прочтений к конкретным членам семейства генов. После группировки прочтений в соответствии с геном было идентифицировано и оценено окно размером 10 п.н., которое окружало сайт-мишень ZFN. Регистрировали число последовательностей с делециями в гене, наряду с числом отсутствующих оснований.

Эти данные затем графически представляли в виде множества линейных графиков, с использованием числа последовательностей с 1-10 делетированными основаниями в сайте-мишени ZFN на 10000 прочтений последовательностей. Этот анализ был проведен для всех трансфекций ZFN, наряду с контрольными трансфекциями. В нескольких случаях повторы в природной последовательности ДНК приводят к увеличению ошибки секвенирования в сайте-мишени ZFN, такая ошибка может обычно рассматривается как увеличение преобладания делеций отдельных оснований, которые были зарегистрированы во всех образцах, как трансфецированных ZFN, так и контролях.

Исходя из этих результатов, отмечается наибольший уровень активности ZFN в сайте-мишени FAD3A и FAD3C, как определено по более высокой активности NHEJ. ZFN, которые кодировали плазмиды pDAB107828 (т.е. ZFN28053 и 28054) и pDAB-107829 (т.е. ZFN28055 и 28056), были отобраны для таргетинга в полевых условиях сконструированной платформы для вставки трансгенов (ETIP), с учетом их характеристик: значительной активности расщепления геномной ДНК и минимальной нецеленаправленной активности.

Пример 4: ДНК-конструкций для линий растений канолы со сконструированной платформой для интеграции трансгенов (ETIP)

Плазмидные векторные конструкции, описываемые ниже, были построены с использованием способов и методов, общеизвестных квалифицированному в данной области техники специалисту. Применение конкретных реагентов и методов, описанных в этом параграфе, хорошо известно квалифицированным в данной области техники специалистам и могло бы быть легко заменено другими реактивами и способами для достижения желаемой цели построения плазмидных векторных конструкций. Эндонуклеазы рестрикции были получены от New England Biolabs (NEB; Ipswich, MA). Лигирование выполняли с помощью Т4 ДНК-лигазы (Invitrogen, Carlsbad, CA). Gateway реакции проводили с использованием смеси ферментов GATEWAY® LR Clonase® (Invitrogen) для сборки одного исходного вектора в один вектор назначения. I-FUSION™ реакции проводили с использованием IN-Fusion™ Advantage Technology (Clontech, Mountain View, CA) для сборки одного исходного вектора в один вектор назначения. Приготовления плазмид выполняли, используя набор NUCLEOSPTN® Plasmid Kit (Macherey-Nagel Inc., Bethlehem PA) или Plasmid Midi Kit® (Qiagen), следуя инструкциям поставщиков. Фрагменты ДНК выделяли, используя набор QIAquick Gel Extraction Kit™ (Qiagen) после гель-электрофореза с использованием Трис-ацетатного буфера. Колонии всех собранных плазмид первоначально скринировали путем рестрикционного расщепления ДНК минипрепарата. Плазмидную ДНК отобранных клонов секвенировал поставщик коммерческих услуг по секвенированию (Eurofins MWG Operon, Huntsville, AL). Данные, касающиеся последовательности, были собраны и проанализированы с помощью программного обеспечения SEQUENCHER™ (Gene Codes Corp., Ann Arbor, MI).

Контрольные векторы

Контрольный вектор использовали для разработки метода сортировки на основе сортировки клеток с возбуждением флуоресценции (FACS). Стандартные методы клонирования были использованы при конструировании контрольного вектора, pDAS000031 (Фиг. 10: вставка Т-цепи в виде SEQ ID NO: 85), включающего две кассеты для экспрессии генов. Первая кассета для экспрессии гена содержала промотор 19S вируса мозаики цветной капусты (промотор 19S CaMV; Shillito et al. (1985) Bio/Technology, 3: 1099-1103):: ген устойчивости к гигромицину (hph(HygR); патент США № 4727028):: и 3' нетранслируемый район открытой рамки считывания 1 Agrobacterium tumefaciens (терминатор AtORF1; Huang et al.(1990) J Bacteriol 1990 772: 1814-1822). Вторая кассета для экспрессии гена содержала промотор убиквитина 10 Arabidopsis thaliana (промотор AtUbi10; Callis et al. (1990) J Biol Chem, 265: 12486-12493):: DsRed (DsRed(D); патент США № 6852849) и интрон из Arabidopsis (интрон # 1; GenBank: AB025639.1):: 3' нетранслируемый район открытой рамки считывания 23 Agrobacterium tumefaciens (терминатор AtORF23; патент США № 5428147) в виде слияния в рамке считывания с транс-ориентацией (например, ориентацией голова к голове. Плазмидный вектор был IN-Fusion™ собран с использованием Advantage Technology (Clontech, Mountain, CA).

Пример 5: Созданий линий растений канолы с ETIP

Трансформация Brassica napus

ETIP-конструкции для специфической для сайта FAD3A и FAD3C конструкции (PDAS000271 - pDAS000275) и сопровождающая ZFN (pDAB107828 и 107829), и контрольная конструкция DS-RED (pDAS000031) ранее описаны в примере 4. Эти бинарные векторы трансформировали в Agrobacterium tumefaciens штамм GV3101: PM90. Трансформацию протопластов клеток Brassica napus выполняют, используя протокол трансфекции, описанный в примере 3 с некоторыми изменениями.

Изменения протокола включают использование альгината натрия вместо агарозы Sea Plaque™. Эксперименты по трансфекции, в которых и ZFN конструкция, и ETIP-конструкция совместно доставляются в протопласты клеток Brassica napus, выполняли в концентрации ДНК, включающей равное 5:1 молярное соотношение плазмидных ДНК. Другие ETIP и контрольные плазмидные конструкции трансформировали в концентрации = 30 мкг плазмидной ДНК.

Дополнительные изменения протокола включают развитие целых растений из трансформированных протопластов клеток в среде, содержащей 1,5 мг/мл гигромицина. Для развития целых растений требуется замена среды А каждые две недели и контролирование роста колоний, происходящих из протопластов. После вырастания колоний, происходящих из протопластов, до приблизительно 2-3 мм в диаметре, колонии переносят в отдельные лунки 12-луночного планшета Costar® (Fisher Scientific, St. Lois, MO), содержащего затвердевшую среду MS Morpho. Планшеты инкубируют в течение одной-двух недель при 24°С при постоянно тусклом свете до пролиферации каллюса до размера 8-10 мм в диаметре. После достижения протопластами клеток диаметра = 1-2 см, протопласты клеток переносят в отдельные 250-мл сосуды для культивирования, содержащие MS Morpho. Сосуды инкубируют при 24°С в условиях 16 ч света (20 мкМоль м-2 сек-1 из трубок белого свечения Osram L36 W/21 Lumilux) и 8 ч темноты. В пределах одной-двух недель видно множество проростков. Проростки переносят в 250-мл сосуды для культивирования, содержащие среду MS, после того, как они достигают в длину 3-4 см. 250-мл сосуды для культивирования инкубируют при 24°С в условиях 16 ч света (20 мкМоль м-2 сек-1 из трубок белого свечения Osram L36 W/21 Lumilux) и 8 ч темноты. Проростки сохраняют в сосудах для культивирования, пока они не развиваются в растеньица, в это время их переносят в теплицу для выращивания до созревания.

Пример 6: Молекулярное подтверждение интеграции T-ДНК, содержащих ETIPS, в каноле

Геномную ДНК экстрагируют из ткани листьев всех предполагаемых трансгенных растений, используя набор DNeasy 96 Plant DNA extraction kit™ или DNeasy Plant Mini Kit™ (Qiagen). Геномную ДНК из каждого растения анализируют с помощью ПЦР, используя праймеры, сконструированные для амплификации virC: pTiC58 прямой (SEQ TD NO: 88 CGAGAACTTGGCAATTCC) и pTiC58 обратный (SEQ ID NO: 89 TGGCGATTCTGAGATTCC) для проверки в отношении персистенции А. tumfaciens, праймеры, предназначенные для амплификации актина из B. Napus; Actin прямой (SEQ ID NO: 90 GACTCATCGTACTCTCCCTTCG) и Actin обратный (SEQ ID NO: 91 GACTCATCGTACTCTCCCTTCG), для проверки качества геномной ДНК. Разрабатывают праймеры для амплификации гена hph: HPH прямой (SEQ ID NO: 92 TGTTGGTGGAAGAGGATACG) и HPH обратный (SEQ ID NO: 93 ATCAGCAGCAGCGATAGC), кодируемого ETIP. Растения, которые не дают продукт при использовании праймеров для амплификации virC и которые образуют ампликоны правильного размера при амплификации с использованием праймеров для актина и hph, подтверждаются как трансгенные.

Выполняют второй скрининг, когда гДНК из каждого трансгенного растения анализируют с помощью ПЦР, используя пять наборов праймеров, сконструированных для амплификации бинарного вектора за пределами области Т-ДНК [(1F SEQ ID NO: 94 ATGTCCACTGGGTTCGTGCC; 1R SEQ ID NO: 95 GAAGGGAACTTATCCGGTCC) (2F SEQ ID NO: 96 TGCGCTGCCATTCTCCAAAT; 2R SE ID NO: 97 ACCGAGCTCGAATTCAATTC) (3F SEQ ID NO: 98 CCTGCATTCGGTTAAACACC; 3R SEQ ID NO: 99 CCATCTGGCTTCTGCCTTGC) (4F SEQ ID NO: 100 ATTCCGATCCCCAGGGCAGT; 4R SEQ ID NO: 101 GCCAACGTTGCAGCCTTGCT) (5F SEQ ID NO: 102 GCCCTGGGATGTTGTTAAGT; 5R SEQ ID NO: 103 GTAACTTAGGACTTGTGCGA)]. Растения, на основе которых амплифицируются ПЦР-продукты правильного и ожидаемого размера при использовании наборов праймеров 3 и 4, считаются имеющими базовую интеграцию.

ДНК из растений с базовой интеграцией очищают из 20 г ткани листьев с использованием модифицированного метода СТАВ (Maguire et al. (1994) Plant Molecular Biology Reporter, 12 (2): 106-109). Выделенную гДНК расщепляют несколькими рестрикционными ферментами, и 10 мкг гДНК разделяют с помощью электрофореза в агарозном геле и переносят на мембрану, используя стандартный протокол блоттинга по Саузерну. Мембраны зондируют, используя DIG Easy Hyb System™ (Roche, South San Francisco, CA), в соответствии с инструкциями производителя. Зонды для каждой экспрессионной кассеты для ELP и эндогенного контрольного гена, актина, амплифицируют с ETIP-конструкции, используя следующие праймеры: (IPT-F SEQ ID NO: 104 TCTCTACCTTGATGATCGG; IPT-R SEQ ID NO: 105 AACATCTGCTTAACTCTGGC; dsRED-F SEQ ID NO: 106 ATGGCTTCATCTGAGAACG; dsRED-R SEQ ID NO: 107 TTCCGTATTGGAATTGAGG; РАТ-F SEQ ID NO: 108 TTGCTTAAGTCTATGGAGGCG; РАТ-R SEQ ID NO: 109 TGGGTAACTGGCCTAACTGG; ELP-F SEQ ID NO: 110 ATGATATGTAGACATAGTGGG; ELP-R SEQ ID NO: 111 AGGGTGTAAGGTACTAGCC; Hph-F SEQ ID NO: 112 TGTTGGTGGAAGAGGATACG; Hph-R SEQ ID NO: 113, ATCAGCAGCAGCGATAGC; actin-F SEQ ID NO: 114 GTGGAGAAGAACTACGAGCTACCC; actin-R SEQ ID NO: 115 GACTCATCGTACTCTCCCTTCG).

Амплифицируют и секвенируют ETIP-последовательность из всех растений, содержащих только одну копию ETIP. Последовательность каждой вставки Т-ДНК анализируют с помощью прямого секвенирования продуктов ПЦР, используя ABI3730x1™ (Applied Biosystems, Life Teachnologies). Вставку Т-ДНК амплифицируют с геномной ДНК, используя Phusion Hot Start II Polymerase™ (Finnzymes, Thermo Fisher Scientific). Реакции амплификации Т-ДНК выполняют с использованием нескольких пар праймеров для амплификации перекрывающихся последовательностей длиной приблизительно 2 т.п.н. Каждый ПЦР-продукт секвенируют с использованием нескольких праймеров, чтобы обеспечить полный охват. ПЦР-реакции обрабатывают щелочной фосфатазой креветки и экзонуклеазой I (Applied Biosystems, Life Technologies), чтобы инактивировать избыток праймера до реакции секвенирования продукта ПЦР-реакции. Последовательности, фланкирующие вставку Т-ДНК, каждой линии с одной копией ETIP определяют посредством расщепления очищенной геномной ДНК восемью эндонуклеазами рестрикции отдельно с последующим лигированием двухцепочечных адаптеров, специфических для липких концов, созданных эндонуклеазами рестрикции. После этого шага лигирования выполняют ПЦР с использованием биотинилированного праймера или для 3', или для 5'-конца ETIP и праймера к каждому адаптеру. Продукты ПЦР захватывают и очищают на шарики(ах) Ampure Solid Phase Reversible Immobilization (SPRI) beads™ (Agencourt Bioscience Corporation, Beckman Coulter Company). Выполняют «вложенную ПЦР», и все продукты секвенируют, используя секвенирование по Сэнгеру ABI и протокол секвенирования Big Dye Terminaror v3.1 cycle™ (Applied Biosystems, Life Technologies). Данные о последовательности собирают и анализируют, используя программное обеспечение SEQUENCHER™ (Gene Codes Corp., Ann Arbor, MI).

Результаты для трансгенной по ETIP канолы, трансформированной конструкций для нуклеазы на основе цинковых пальцев и ETIP-конструкциями PDAS000271-PDAS000275

Трансгенные случаи Brassica napus, которые порождены посредством трансформации ETIP- и ZFN-конструкциями, имеют следствием интеграцию полноразмерной вставки T-цепи полинуклеотидной последовательности ETIP в одной копии из DAS000273 или pDAS275 в локус FAD3A и из pDAS000271, pDAS000272 или pDAS000274 в локус FAD3C. Три-четыре случая полностью характеризуют и подтверждают, что они содержат интегрированную ETIP. Подтверждение осуществляют, используя способ внутренней-внешней ПЦР-амплификации, и в дальнейшем подтверждение осуществляют с помощью блоттинга по Саузерну. Выбранные случаи Т0 выращивают до стадии развития T1. Растения Т1 подвергают повторному скринингу для определения зиготности интегрированной Т-цепи. Подвергнутые скринингу случаи относят к категориям «гомозиготные», «гемизиготные» или «нулевые».

Гомозиготные случаи используют для получения протопластов с помощью описанного ранее способа. Впоследствии протопласты трансформируют совместно ZFN, которая предназначена для таргетинга сайта связывания цинкового пальца, который включен в последовательность ETIP и донорную плазмиду, которая гомологична специфическим районам ETIP. ZFN расщепляет локус ETIP, и донорная плазмида интегрируется в геном клеток Brassica napus с репарацией с использованием гомологичной ДНК. В результате интеграции донорной плазмиды частичный трансген DS-red восстанавливается до полноразмерного трансгена DS-red. Экспрессия теперь полностью функционального трансгена DS-red используется для сортировки протопластов клеток методом на основе FACS. Предполагаемые трансгенные растения сортируют, используя метод на основе FACS, описанный в примере 7, и выделенные протопласты регенерируют в зрелые растения. Интеграцию донорной плазмиды подтверждают в подвергнутых ETIP-таргетингу растениях, используя молекулярные способы подтверждения. Как таковой, локус ETIP служит в качестве сайт-специфического локуса для направленной интеграции гена - донорной полинуклеотидной последовательности.

Пример 7: Сортировка на основе FACS протопластов клеток

Протопласты Brassica napus, которые были трансфецированы контрольной конструкцией DS-red, pDAS000031, были отсортированы с помощью FACS-опосредованной сортировки клеток, используя сортер BD Biosciences Influx-Cell sorter™ (San Jose, CA). Протопласты клеток выделяли и трансфецировали, как описано в примере 3. После того как клетки были трансфецированы pDAS000031, клетки сортировали, используя сортер FACS с условиями, описанными в таблице 7.

Таблица 7
Условия, используемые для сортировки протопластов клеток, трансфецированных рDAS000031
Параметры
Падение частота 6,1 кГц
Диаметр насадки 200 мкм
Давление проточной жидкости 4 фунта на квадратный дюйм
Среды для восстановления Среда W5
Условия культивирования Культура в шариках с использованием легкоплавкой агарозы и альгината натрия
Критерии сортировки Сортировка на основе аутофлуоресценции хлорофилла, экспрессия гена-репортера (DS-red)
Отбор (%) 50-75
Жизнеспособность после сортировки (%) >95

Протопласты, которые экспрессировали трансген DS-red, были отсортированы и выделены. Выделенные с помощью FACS протопласты подсчитывали с помощью сортера. Приблизительно 1×105-1,8×105 клеток помещали в лунку 24-луночного титрационного микропланшета в первый день после выделения с использованием FACS. Клетки переносили в культуру в шариках на 5-20 дней. Схожие условия были проверены, когда приблизительно 1×104 клеток помещали в лунку 2- или 4-луночного титрационного микропланшета на второй день после выделения с использованием FACS. Различные условия, которые были проверены, привели к выделению клеток с жизнеспособностью, составляющую 95-98% от всех выделенных протопластов клеток. FACS-отсортированные протопласты клеток переносили в культуру в шариках на 3-20 дней. FACS-отсортированные протопласты клеток регенерировали в растения, в среде, которая содержала 1,5 мг/мл гигромицина, используя описанный выше протокол. Предполагаемые трансгенные растения, как было подтверждено с помощью молекулярных протоколов подтверждения, содержат интактную вставку T-цепи из pDAS000031.

Способ сортировки на основе FACS непосредственно применим к скринингу любой последовательности флуоресцентного трансгена и используется для выделения части протопластов клеток Brassica napus, которая подвергнута таргетингу с использованием флуоресцентного трансгена через репарацию с использованием гомологичной ДНК в пределах специфического сайта в области ETIP в геномном локусе.

Пример 8: Направленная интеграция в десатуразу омега-3 жирных кислот Brassica napus (FAD3) через NHEJ и ее разрушение

Выбор связывающих доменов «цинковые пальцы», специфических в отношении FAD3C и FAD3A

Транскрибируемые области гомологичных генов FAD3 были идентифицированы и охарактеризованы, были разработаны нуклеазы на основе цинковых пальцев, которые связывают и расщепляют эти сайты в случае NHEJ-опосредованного таргетинга с использованием донорной последовательности. Белки с цинковыми пальцами (ZFP), направленные против последовательностей ДНК из гомологов последовательностей FAD3, были разработаны и проверены, как описано выше. Из ZFN, демонстрирующих целенаправленную активность были отобраны два белка с цинковыми пальцами, которые разрезают FAD3-мишень с высокой эффективностью: ZFP 28051-2A-28052 распознает SEQ ID NO: 255 5'-gcccaaggaacCCTTTTCTGGGCCATcttcgTACTCGGCCACGactggtaatttaat-3' и, как было установлено, специфически связывает и расщепляет геномный локус Fad3C. Так же белок с цинковыми пальцами 28053- 280542А распознает последовательность SEQ ID NO.: 256 5'-agcgagagaaAGCTTAtTGCAACTTCaactacTTGCTGGTCGATCGTGTTggccactc-3' и, как установлено, специфически связывает и расщепляет геномный локус Fad3A и Fad3C. Приводимые в качестве примера сайты-мишени приведены в Таблице 8; нуклеотиды в сайте-мишени, с которыми контактируют распознающие спиральные участки ZFP, указаны с использованием заглавных букв; неконтактирующие нуклеотиды указаны с использованием строчных букв. Нуклеотиды в копиях FAD3, которые отличаются от Fad3C, указаны подчеркиванием. Нуклеотиды в сайтах-мишенях, с которыми контактируют распознающие спиральные участки ZFP, представлены в таблице 8.

Таблица 8
Сайты связывания белков с цинковыми пальцами, специфических в отношении Fad3C (28051-2A-28052) или Fad3A и Fad3C (28053-2-28054)
28051-2A-28052 SEQ ID NO: SEQ ID NO:257 gcccaaggaacCCTTTTCTGGGCCATct
SEQ ID NO:45 cgTACTCGGCCACGactggtaatttaat
Fad3C 259 GCCCAAGGAACCCTTTTCTGGGCCATCTTCGTACTCGGCCACGACTGGTAATTTAAT
Fad3A 260 GCCCAAGGAACCCTGTTCTGGGCTATCTTCGTACTCGGCCACGACTGGTAATTTAAT
Fad3C' 261 GCCCAAGGAACCCTTTTCTGGGCCATCTTCGTCCTCGGCCACGACTGGTAAAGTTTC
Fad3A' 261 GCCCAAGGAACCCTTTTCTGGGCCATCTTCGTCCTCGGCCACGACTGGTAAAGTTTC
Fad3A'' 263 GCCCAAGGAACCCTTTTCTGGGCCATCTTCGTTCTTGGCCACGACTGGTAAATTAAA
Fad3C'' 263 GCCCAAGGAACCCTTTTCTGGGCCATCTTCGTTCTTGGCCACGACTGGTAAATTAAA

28053-2A-28054 SEQ ID NO: SEQ ID NO:265 agcgagagaaAGCTTAtTGCAACTTCaa
SEQ ID NO:47 acTTGCTGGTCGATCGTGTTggccactc
Fad3C 256 AGCGAGAGAAAGCTTATTGCAACTTCAACTACTTGCTGGTCGATCGTGTTGGCCACTC

Fad3A 268 AGCGAGAGAAAGCTTATTGCAACTTCAACTACTTGCTGGTCGATCATGTTGGCCACTC
Fad3C' 269 AGCGAGAGAAAGCTTATTGCAACTTCAACTACTTGCTGGTCCATAATGTTGGCCATTC
Fad3A' 270 AGCGAGAGAAAGCTTATTGCAACTTCGACTACTTGCTGGTCCATAATGTTGGCAATTC
Fad3A'' 271 AGCGAGAGGAAGCTTATTGCAACTTCAACAACTTGCTGGTCCATAATGTTGGCCACTC
Fad3C'' 272 AGCGAGAGGAAGCTTATTGCAACTTCAACTACTTGCTGGTCCATAATGTTGGCCACTC

Разработка и конструирование экспрессионных векторов, кодирующих нуклеазы на основе цинковых пальцев, специфических в отношении FAD3C и FAD3A

Конструкции специфических для FAD3 цинковых пальцев были включены в векторы для экспрессии цинковых пальцев, кодирующие белок, имеющий по меньшей мере один палец со структурой CCHC (публикация заявки на патент США № 2008/0182332). В частности, последний палец в каждом белке имел остов CCHC для распознающего спирального участка. Кодирующие неканонические цинковые пальцы последовательности были слиты с доменом с нуклеазной активностью рестрикционного фермента типа IIS - FokI (аминокислотами 384-579 последовательности Wah et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10564-10569) посредством ZC линкера из четырех аминокислот и сигналом ядерной локализации sop2. Самогидролизующаяся 2А кодирующая нуклеотидная последовательность из вируса Thosea asigna (Szymczak et al. 2004) была добавлена между двумя составными белками ZFN. Экспрессией ZFN управлял сильный конститутивный промотор и 5' нетранслируемый район (UTR), происходящие из вируса мозаики прожилок листьев маниоки (Verdaguer et al., Plant Molecular Biology 1996, 31 (6): 1129-1139), и сбоку находился 3' UTR (включающий терминатор транскрипции и сайт полиаденилирования) из открытой рамки считывания 23 (ORF23) из Agrobacterium tumefaciens pTil5955 (Barker et al., Plant Molecular Biology 1983, 2 (6): 335-50).

Сборку векторов осуществляли, используя IN-FUSION™ Advantage Technology (Clontech, Mountain View, CA). Эндонуклеазы рестрикции были получены от New England Biolabs (NEB; Ipswich, MA), и ДНК-лигазу Т4 (Invitrogen) использовали для лигирования ДНК. Приготовление плазмид осуществляли, используя набор NucleoSpin® Plasmid Kit (Macherey-Nagel Inc., Bethlehem, PA) или Plasmid Midi Kit (Qiagen) в соответствии с инструкциями поставщиков. Фрагменты ДНК выделяли, используя набор QIAquick Gel Extraction Kit™ (Qiagen) после гель-электрофореза с использованием Трис-ацетатного буфера. Колонии собранных плазмид первоначально скринировали путем рестрикционного расщепления ДНК минипрепарата. Плазмидную ДНК отобранных клонов секвенировал поставщик коммерческих услуг по секвенированию (Eurofins MWG Operon, Huntsville, AL). Данные, касающиеся последовательности, были собраны и проанализированы с помощью программного обеспечения SEQUENCHER™ (Gene Codes, Ann Arbor, MI). Результирующие плазмидные конструкции: pDAB107827 (ZFN 28051-2A-28052, фиг. 13, SEQ ID NO: 273) и pDAJB107828 (ZFN 28053-2A-28054, фиг. 14, SEQ ID NO: 274) подтверждали с помощью расщепления рестрикционными ферментами и с помощью секвенирования ДНК.

Разработка и конструирование векторов-«доноров» для NHEJ-направленной репарации ДНК

Были выполнены две стратегии интеграции ДНК в FAD3: сплайсинг гена, при котором экспрессионная кассета интегрируется в один ZFN-индуцированный двухцепочечный разрыв, и редактирование гена, при котором часть гена удаляется при использовании двух ZFN-индуцированных двухцепочечных разрывов, и экспрессионная кассета встраивается для репарации разрыва.

Для каждого метода интеграции, сплайсинга гена или редактирования гена, были сконструированы два вектора. Первый кодировал кассету для экспрессии гена turboGFP (tGFP), а второй кодировал кассету для экспрессии гена, который придает устойчивость к антибиотику гигромицину. Кассета для экспрессии tGFP включала промотор, 5' нетранслируемую область и интрон из гена полиубиквитина 10 (UBQ10) Arabidopsis thaliana (Norris et al., Plant Molecular Biology 1993, 21 (5), 895-906), а затем кодирующую последовательность tGFP (Evrogen, Moscow, Russia). Кодирующая последовательность tGFP была оптимизирована в отношении кодонов для экспрессии в двудольных растениях, и 3' нетранслируемая область (UTR) включала терминатор транскрипции и сайт полиаденилирования из открытой рамки считывания 23 (ORF23) из pTi15955 A. tumefaciens (Barker et al., Plant Molecular Biology 1983, 2 (6), 335-50). Кассета для экспрессии гена устойчивости к гигромицину включала промотор 19S, включающий 5' UTR из вируса мозаики цветной капусты (CaMV) (Cook and Penon Plant Molecular Biology 1990 14 (3), 391-405) с последующим геном гигромицин-фосфотрансферазы (hph) (Kaster et al., Nucleic Acids Research 1983 11 (19), 6895-6911). Ген hph был оптимизирован в отношении кодонов для экспрессии в двудольных растений и фланкирован 3' UTR, включающим терминатор транскрипции и сайт полиаденилирования открытой рамки считывания 1 (ORF1) из pTil5955 A. tumefaciens (Barker et al., Plant Molecular Biology 1983, 2 (6), 335-50). Обе кассеты были синтезированы коммерческим поставщиком услуг по синтезу гена (GeneArt, Life Technologies, Regensberg, Германия).

Векторы для экспериментов по сплайсингу гена были сконструированы посредством клонирования двух последовательно расположенных копий последовательности распознавания ZFN, подвергаемой таргетингу с помощью ZFN, закодированной в векторе pDAB10782. Векторы для экспериментов по редактированию гена были сконструированы посредством клонирования одной копии каждой из последовательностей распознавания ZFN, подвергаемой таргетингу с помощью ZFN, кодируемых в векторах pDAB107827 и pDAB107828. В обоих случаях эти две последовательности распознавания ZFN были разделены последовательностями распознавания рестрикционными эндонуклеазами BamHI и NotI. tGFP- и HPH-кассеты были клонированы в сайты BamHI и NotI каждого вектора, что привело к четырем векторам-«донорам»: pDAS000340 (донору для сплайсинга гена устойчивости к гигромицину: SEQ ID NO: 275, фиг. 15), pDAS000341 (донору для сплайсинга гена-репортера tGFP: SEQ ID NO: 276, фиг. 16), pDAS00342 (донору для редактирования гена устойчивости к гигромицину: SEQ ID NO: 277, фиг. 17) и pDAS000343 (донору для редактирования гена-репортера tGFP: SEQ ID NO: 278, фиг. 18).

Колонии собранных плазмид первоначально скринировали с помощью расщепления рестрикционными эндонуклеазами ДНК, очищенной из ночных культур E.coli. Рестрикционные эндонуклеазы были получены от New England Biolabs™ (NEB, Ipswich, MA) и Promega™ (Promega Corporation, WI). Приготовления плазмид осуществляли, используя набор QIAprep Spin Miniprep Kit™ (Qiagen, Hilden, Германия) или Pure Yield Plasmid Maxiprep System™ (Promega Corporation, WI) в соответствии с инструкциями поставщиков. После подтверждения рестрикционных фрагментов с помощью электрофореза в агарозном геле полученных фрагментов, плазмидные ДНК отобранных клонов секвенировали, используя секвенирование по Сэнгеру ABI и протокол секвенирования Big Dye Terminator v3.1™ (Applied Biosystems, Life Technologies). Данные о последовательности собирали и анализировали, используя программное обеспечение SEQUENCHER™ (Gene Codes, Ann Arbor, MI).

Сохранение растительного материала для выделения протопластов

Протопласты мезофильного происхождения выделяли из трехнедельных стерильных ростковых культур Brassica napus (DH10275). Соответствующие семена проращивали в соответствии с методами, описанными в настоящем документе. Семена были подвергнуты поверхностной стерилизации, используя 70% этанол, в течение 1 минуты и осторожно встряхивали с последующими 3-4 промывками в стерильной бидистиллированной воде. Впоследствии семена стерилизовали, используя 20% отбеливателя и 10 мкл Твина 20. Семена дополнительно обрабатывали отбеливателем на шейкере настольного типа при приблизительно 100 об./мин в течение 15 минут с последующими 3-4 промывками в стерильной бидистиллированной воде, семена осторожно переносили на стерильную фильтровальную бумагу, чтобы удалить избыточную влагу, и высевали в среду для прорастания семян (½ концентрации MS/B5 витамины + 1% сахарозы + 0,8% агара; рН 5,8.

Приблизительно 50-60 мл среды наливали в каждую чашку Петри™ (15×100 мм), и эти чашки размещали под небольшим углом, используя подставку. Приблизительно 50 семян помещали в каждую чашку. Чашки инкубировали в вертикальном положении при 22°С в условиях 16 ч/сут света (20 мкМоль м-2 сек-1) в течение 6 дней. Сегменты гипокотиля размером 0,5 см иссекали из шестидневных проростков и культивировали в среде для стимуляции проростков (MS/B5 витамины + 3% сахарозы + 500 мг/л MES + BAP (13 мкм) + зеатин (5 мкм) + нитрат серебра (5 мг/л) + 0,8% агара (рН 5,8). Среду наливали в 100×20 мм стерильные чашки Петри™, приблизительно 20 эксплантатов помещали на среду в каждой чашке. Меристемы проростков, которые появились через 3-4 недели, переносили в среду для роста в длину проростков (MS/B5 витамины + 2% сахарозы + 500 мг/л MES + BAP (2 мкм) + GA-3 (0,1 мкм) + 0,8% агара (рН 5,8) и с наливом в 250-мл сосуды для культивирования), и культуры поддерживали в этой среде в течение 4 недель с использованием одного цикла субкультивирования между ними. Проростки высотой 2-3 см затем переносили в среду для стимуляции развития корневой системы (1/2 концентрации MS/B5 витамины + 1% сахарозы + 500 мг/л MES + IBA (2,5 мкм) + 0,6% агара (рН 5,8) и с наливом в 700-мл сосуды для культивирования) для развития корневой системы. Укоренившиеся проростки субкультивировали в свежей среде для стимуляции развития корневой системы с 3-4-недельными интервалами в виде стеблевых черенков в течение двух-трех циклов до использования. Культуры поддерживали на всем протяжении при 22°С в условиях 16 ч/сут света (30 мкМоль м-2 сек-1).

Выделение и очистка протопластов мезофильного происхождения

In vitro выращенные растения Brassica napus DH12075 использовали в качестве источника эксплантов для выделения протопластов мезофильного происхождения. Для выделения протопластов, 3-ий - 4-ый верхние полностью раскрывшиеся листья от (3-4)-недельных растеньиц разрезали острым скальпелем на мелкие полоски (от 0,5 до 1 мм) для выделения протопластов. Ферментативное расщепление выполняли путем обработки 250-500 мг листового материала 25 мл буфера для расщепления (1,2% (масс./об.) целлюлазы «Onozuka™» R10 и 0,2% (масс./об.) Macerozyme® R10, которые растворены в среде K4 (Spangenberg et al., 1998)). Чашку Петри™, содержащую листовой материал и буфер для расщепления, закрывали герметично Parafilm™ и инкубировали при комнатной температуре в течение от 12 до 15 ч в темноте. После инкубации в течение ночи продукты расщепления фильтровали через фильтр для клеток BD® (с размером отверстий = 70 мкм). На суспензию протопластов (5-6 мл), собранную в 14-мл пробирку с круглым дном, наслаивали 1 мл буфера для промывки W5 (154 мМ NaCl, 125 мМ CaCl2, 5 мМ КС1 и 5 мМ глюкозы; рН 5,8 Menzel et al. (1981)).

Суспензии протопластов далее центрифугировали при 400 об./мин в течение 10 мин. После центрифугирования протопласты, которые плавали в интерфазе, извлекали и промывали посредством центрифугирования с использованием 10 мл буфера W5 при 400 об./мин в течение 10 мин. После последней промывки выделенные протопласты ресуспендировали до плотности 1×106 протопластов на мл буфера W5 и инкубировали в течение 1 часа до трансфекций.

Оценка выхода и жизнеспособности протопластов

Выход протопластов оценивали, используя гемоцитометр, по методу Sambrook и Russell (2006). Жизнеспособность клеток проверяли, используя 400 мг/л красителя Эванса голубого, растворенного в 0,5 М манните, как описано Huang и соавт. (1996), с незначительными изменениями протокола.

Доставка ДНК с использованием ПЭГ 4000

До доставки в протопласты В. napus плазмидную ДНК каждой донорной и ZFN-конструкции получали из культур E.coli, используя Pure Yield Plasmid Maxiprep System® (Promega Corporation Madison, WI), следуя инструкциям поставщиков. Аликвоты донорной и ZFN плазмидной ДНК готовили в трех молярных соотношениях: 1:1 (30 мкг каждой плазмиды), 5:1 (донорная плазмида:ZFN плазмида в общей сложности до 30 мкг плазмидной ДНК) и 10:1 (донорная плазмида:ZFN плазмида в общей сложности до 30 мкг плазмидной ДНК). Кроме того, аликвоты только донора и только ZFN (30 мкг) были приготовлены в качестве контролей. Количества ДНК, доставляемые в протопласты B. napus через ПЭГ 4000-опосредованную трансформацию, представлены в таблице 9.

Таблица 9
Количества ZFN и донорной ДНК, доставляемые в протопласты
Молярное соотношение плазмидной ДНК Общее количество ДНК (мкг), доставляемое в 1 миллион протопластов
Сплайсинг Только донорная плазмида 30
Только ZFN-плазмида (pDAB107827) 30
1:1 Донор:ZFN 60
5:1 Донор:ZFN 30
10: Донор:ZFN 30
Редактирование Только донорная плазмида 30
1:1: ZFN-плазмиды (pDAB107827 и pDAB107828) 30
1:1:1 Донор:ZFN:ZFN 90
5:1:1 Донор:ZFN:ZFN 30
10:1:1 Донор:ZFN:ZFN 30

Каждую аликвоту плазмидной ДНК применяли к одному миллиону протопластов (жизнеспособность ≥95), суспендированных в 100 мкл буфера для трансформации (15 мм MgCl2, 0,1% (масс./об.) морфолиноэтансульфокислоты (MES) и 0,5 М маннита; рН 5,8), с последующим добавлением 150 мкл раствора ПЭГ (40% (масс./об.) ПЭГ 4000 в 0,4 М манните и 0,1 М Ca(NО3)2 (рН 6-7), Spangenberg and Potrykus (1995). После инкубации в течение 10-15 мин при комнатной температуре добавляли по каплям 5 мл буфера W5, и протопласты осторожно перемешивали. Еще 5 мл буфера W5 добавляли в виде медленной струи к суспензии протопластов. Протопласты осторожно перемешивали и центрифугировали при 400 об./мин в течение 10 мин, и супернатант W5 удаляли, оставляя протопласты в виде осадка. Трансфецированные протопласты затем инкубировали в 1 мл буфера W5 при комнатной температуре, пока они не были внедрены в культуры в шариках. Трансфецированные протопласты внедряли в соответствии со способом с использованием альгината натрия, описанным ниже.

Культивирование протопластов мезофильного происхождения для получения жизнеспособных микрокаллусов

До внедрения в среду, трансфецированные протопласты центрифугировали при 400 об./мин в течение 10 минут, и буфер W5 осторожно удаляли. Затем протопласты ресуспендировали в 1,0 мл 0,5 М маннита и инкубировали на льду. К суспензии протопластов добавляли равный объем 1,0% альгината натрия, и осуществляли осторожное перемешивание. Суспензию протопластов инкубировали на льду до ее внедрения. Раствор для образования шариков (0,4 М маннит + 50 мМ CaCl2 (рН 5,8)) переносили в стерильный шести-луночный планшет (3-4 мл на лунку) с помощью серологической пипетки. Точно 1,0 мл суспензии протопластов добавляли по каплям, используя 1-мл пипетку, в раствор для образования шариков, и каждый трансфецированный образец (приблизительно 5×105 протопластов) внедряли в каждую лунку. Суспензию протопластов инкубировали в течение 1-2 часов при комнатной температуре с образованием шариков альгината натрия. После инкубационного периода раствор для образования шариков осторожно удаляли и заменяли на 4-5 мл 1:2 смеси сред K3+H:А (Spangenberg et al. 1998), дополненной 1,5 мг/л гигромицина. Протопласты культивировали в течение 3-4 недель в темноте при 22°С на шейкере (50 об./мин). Через 3-4 недели высвобождали устойчивые микрокаллусы (0,5-1,0 мм) посредством обработки буфером для деполимеризации (0,3 М маннит + 20 мМ цитрат натрия (рН 5,8)). После удаления жидких сред, 3-4 мл буфера для деполимеризации добавляли в каждую лунку, содержащую культуры в шариках, и осуществляли инкубацию при комнатной температуре в течение 2 часов. Используя стерильный пинцет, шарики осторожно перемешивали для увеличения эффективности высвобождения микрокаллусов. Затем использовали стерильную 1,0-мл пипетку для осторожного перешивания желатинирующего агента, который выделялся в буфер для деполимеризации, а затем удалялся. Микрокаллусы промывали дважды, используя 5 мл жидкой среды А, и микрокаллусы ресуспендировали в достаточном количестве жидкости А (50 мл жидкости А использовали для одного мл объема осажденных клеток (SCV: его измеряли после переноса всех освобожденных микрокаллусов в стерильную 50- или 15-мл пробирку фирмы Falcon и допуска осаждения в течение 5 мин)). После равномерного перемешивания микрокаллусов 0,5 мл микрокаллусов, суспендированных в жидкой среде А, переносили на среду B1 (MS/MS витамины + 3,5% сахарозы + 500 мг/л MES + BAP (5 мкм) + NAA (5 мкм) + 2,4-D (5 мкм) + 1,5 мг/л гигромицина + 0,7% агарозы типа I (рН 6,0) и с наливом в 100×20 мм стерильные чашки Петри™), и, используя 1-2 мл дополнительной жидкой среды А, микрокаллусы распределяли равномерно по среде В1, и избыточное количество жидкой среды А осторожно удаляют из каждой чашки. Чашки закрывали, используя ленту из микропористого материала, которая увеличивала созревание зародыша. Культуры сохраняли при 22°С в условиях 16 ч/сут света (30 мкМоль м-2 сек-1).

Пролиферация и регенерация проростков из протопластов мезофильного происхождения

Устойчивые к гигромицину колонии отбирали из среды B1 (микрокаллусы, получаемые методами SA и SP) через 2-3 недель инкубации и переносили на среду B2 (MS/MS витамины + 3,0% сахарозы + 500 мг/л MES + 500 мг/л PVP + 5 мг/л нитрата серебра + 5 мг/л 2i P + NAA (0,5 мкм) + GA-3 (0,3 мкм) + 1,5 мг/л гигромицина + 0,7% агарозы типа I (рН 5,8) и с наливом в 100×20 мм стерильную чашку Петри™). Приблизительно 25-30 каллусов помещали в каждую чашку, и чашки закрывали герметично Parafilm®, и инкубировали при 22°С в условиях 16 ч/сут света (30 мкМоль м-2 сек-1). Устойчивые к гигромицину колонии впоследствии извлекали после 5-6 циклов субкультивирования на среде В2 с двухнедельным интервалом. Количество каллусов на чашку уменьшалось до 12-15 после третьего цикла субкультивирования. Ростковые бугорки, которые появляются через 10-12 недель, осторожно извлекали вместе с остатками каллусов и переносили в среду для роста в длину проростков (MS/B5 витамины + 2% сахарозы + 500 мг/л MES + BAP (2 мкм) + GA-3 (0,1 мкм) + 300 мг/л тиментина + 1,5 мг/л гигромицина + 0,8% агара (рН 5,8) и с наливом в 250-мл сосуды для культивирования). Проростки, которые выживают после 2-3 циклов отбора с использованием гигромицина, переносили на среду для укоренения (1/2 концентрации MS/B5 витамины + 1% сахарозы + 500 мг/л MES + IBA (2,5 мкм) + 1,5 мг/л гигромицина + 0,6% агара (рН 5,8) и с наливом в 700-мл сосуды для культивирования).

Выделение геномной ДНК из протопластов мезофильного происхождения

Трансфецированные протопласты переносили с 3-см чашки Петри™ в 2-мл микроцентрифужную пробирку. Клетки осаждали центрифугированием при 70×g, и супернатант удаляли. Чтобы максимизировать выделение трансфецированных протопластов, чашку Петри™ промывали три раза 1 мл буфера для промывки. Каждую промывку выполняли посредством вращения буфера для промывки в чашке Петри™ в течение 1 минуты, а затем переноса жидкости в ту же 2-мл микроцентрифужную пробирку. В конце каждой промывки клетки осаждали центрифугированием при 70×g, и супернатант удаляли. Осажденные протопласты быстро замораживали в жидком азоте до лиофилизации в течение 24 ч в Labconco Freezone 4.5® (Labconco, Kansas City, МО) при -40°С и давлении = 133×10-3 мбар. Лиофилизированные клетки подвергали экстракции ДНК с использованием набора DNA-DNeasy® Plant DNA Extraction Mini Kit (Qiagen) в соответствии с инструкциями производителя, за исключением того, что разрушение ткани не требовалось, и протопласты клеток добавляли непосредственно в буфере для лизиса.

Выделение геномной ДНК из каллусной ткани

Отдельные каллусы быстро замораживали в жидком азоте перед лиофилизацией в течение 24 ч в Labconco Freezone 4.5® (Labconco, Kansas City, МО) при -40°С и давлении = 133×10-3 мбар. Лиофилизированные каллусы подвергали экстракции ДНК с использованием набора DNeasy® Plant DNA Extraction Mini Kit (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя.

Выделение геномной ДНК из ткани листьев

Тридцать (30) мг ткани молодых листьев из регенерированных растений быстро замораживали в жидком азоте перед лиофилизацией в течение 24 ч в Labconco Freezone 4.5® (Labconco, Kansas City, МО) при -40°С и давлении = 133×10-3 мбар. Лиофилизированные каллусы подвергали экстракции ДНК с использованием набора DNeasy® Plant DNA Extraction Mini Kit (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя.

Анализ с помощью ПЦР геномной ДНК в отношении NHEJ-опосредованного сплайсинга и редактирования FAD3C

Определение интеграции донорной ДНК в ген Fad3C B. napus осуществляли с помощью ряда ПЦР, в котором по меньшей мере один праймер был специфическим для локуса Fad3C (таблица 10), и второй праймер - специфическим для промотора, или терминатора кассеты gfp (таблица 10 и фиг. 19A). Специфичность была достигнута посредством разработки олигонуклеотидов, в которых последняя пара оснований совмещалась с SNP, который позволял дифференцировать геномную последовательность Fad3C от других копий генов FAD3, и включала фосфоротиоатную межнуклеотидную связь перед этой парой оснований, как показано звездочкой [*]. Эта разработка, используемая в комбинации с полимеразой, обладающей корректирующей активностью, направляла специфическую амплификацию каждого аллеля Fad3C или Fad3A и исключала другие копии FAD3, как отмечалось. Каждый набор праймеров был проверен опытным путем в отношении амплификации правильных копий гена с помощью секвенирования по Сэнгеру продуктов ПЦР-амплификации, полученных из B. napus дикого типа.

Таблица 10
Олигонуклеотидные последовательности, используемые для обнаружения интеграции ДНК в ZFN-индуцированные двухцепочечные разрывы
Название праймера Последовательность праймера SEQ ID NO: Специфичность
1 FAD3CNHEJ-L4-F2 gattcctaagcattgttgggt*c 279 Fad3C только
2 FAD3CNHEJ-L4-R2 gaaaatctcatatcgaacgtgcg*t 280 Fad3C только
3 FAD3CNHEJ-L6-F1 cgcttaccctctctatctggta*a 281 Не амплифицирует Fad3C' или Fad3C''
4 FAD3CNHEJ-L6-R2 ccttgcctctgtaccaaggca*g 282 Fad3C только
5 19SPNHEJ-R2 gtgtgtgggaatcttatcttcgg 283 n/a
6 AtORF1NHEJ-F1 caagtcaggtattatagtccaagca 284 n/a
7 AtUbiNHEJ-R1 caagaatatcctgatccgttgac 285 n/a
8 AtORF23tNHEJ-F1 tggcagttgaaatactcaaacc 286 n/a
9 FAD3aCNHEJ-L4-F1 gtcctttgagatccatgagcta*t 287 Fad3A только
10 FAD3aCNHEJ-L4-F2 gattcctaagcattgttgggt*a 288 Fad3A только
11 FAD3aNHEJ-L4-R1 tgcgttcaagaaatcaaagac*a 289 Fad3A только
12 FAD3aNHEJ-L4-R2 gaaaatctcatatcgaacgtgcg*g 290 Fad3A только
13 FAD3aNHEJ-L6-F1 tctggtaaatcctaattcct*c 291 Fad3A только

14 FAD3aNHEJ-L6-R2 ccttgcctctgtaccaaggca*a 292 Fad3A только
15 FAD3aNHEJ-L6-R1 cttgcctctgtaccaaggcaactt*c 293 Исключает Fad3C
* Указывает фосфоротиоатные межнуклеотидные связи для направления специфической амплификации (с помощью корректирующей полимеразы) Fad3C или Fad3A с исключением других копий FAD3, как отмечалось. Каждый набор праймеров был проверен опытным путем в отношении амплификации правильных копий гена с помощью секвенирования по Сэнгеру продуктов ПЦР-амплификации, полученных из B. napus дикого типа.

Обнаружение добавления гена к FAD3C посредством негомологичного соединения концов в протопластах

Геномную ДНК экстрагировали из пулов протопластов (одного миллиона протопластов в каждом пуле), в которые за двадцать четыре часа до этого была доставлена донорная ДНК, кодирующая кассету для функционального репортера tGFP (pDAS000341 или pDAS000343), ZFN ДНК (pDAB 107827 или pDAB 107828) или смесь донорной и ZFN ДНК. Количества ДНК, доставляемые для трансформации, описаны выше. ПЦР-продукты были клонированы в плазмидные векторы. Редактирование генома происходит независимо в каждой клетке, приводя к множеству различных событий вставки, посредством клонирования в плазмидный вектор каждое редактирование генома можно точно секвенировать. Несколько клонов секвенировали на основе автоматизированного капиллярного электрофореза ABI3730XL®. Анализ последовательностей генов был осуществлен, используя программное обеспечение Sequencher v5.0™ (GeneCodes, Ann Arbor, MI).

Доказательство добавления гена в локус Fad3C в результате редактирования или сплайсинга было обеспечено посредством амплификации обоих 5' и 3' стыков Fad3C-кассеты из геномной ДНК, экстрагированной из протопластов, используя праймеры, описанные в таблице 10. ПЦР-амплификация с использованием праймеров «FAD3CNHEJ-L4-F2» и «AtUbiNHEJ-R1» была выполнена для амплификации 5' стыка tGFP кассеты с Fad3C. ПЦР-амплификация с использованием праймеров «FAD3CNHEJ-L4-R2» и «AtORF23tNHEJ-F1» была выполнена для амплификации 3' стыка tGFP кассеты с Fad3C. ПЦР-амплификация с использованием праймеров «FAD3CNHEJ-L4-F2» и «FAD3CNHEJ-L4-R2» была выполнена для амплификации сквозь двухцепочечные разрывы, вызванные ZFN 28051-2A-28052. Амплификация не отмечалась, исходя из протопластов, в которые была доставлена только ZFN плазмида или донорная плазмида. Все последовательности стыков свидетельствовали о вставке tGFP кассеты в локус Fad3C путем NHEJ-опосредованной репарации. Отмечались делеции различных длин из одного из двух или обоих из генома и кассеты, а также добавления последовательностей, происходящих из векторных остовов (или из донора, или из ZFN), вставляемых между геномом и кассетой (фиг. 20 и фиг. 20В).

Обнаружение добавления гена к FAD3C посредством негомологичного соединения концов в каллусной ткани, регенерированной из протопластов

Еще одно доказательство сплайсинга и редактирования локуса Fad3C было получено из каллусной ткани, регенерированной из протопластов в процессе селекции (1,5 мг/л гигромицина, как описано выше), в которые была доставлена донорная ДНК, кодирующая hph кассету (pDAS000340 или pDAS000342), только ZFN ДНК (pDAB107827 или pDAB107828) или донорная и ZFN ДНК (количества доставляемой ДНК приведены в таблице 9). ДНК экстрагировали из приблизительно 80 каллусов для каждого соотношения, за исключением редактирования 1:1:1, в случае которого каллусы не выжили, через четыре недели после трансфекции протопластов.

Интеграцию hph кассеты в геном B. napus (fwat Fad3C или случайным образом) подтверждали с помощью количественной ПЦР Taqman™, используя праймеры (SEQ ID NO: 294; F-5' CTTACATGCTTAGGATCGGACTTG 3', SEQ ID NO: 295; R-5' AGTTCCAGCACCAGATCTAACG 3') и зонд (SEQ ID NO: 296; 5' CCCTGAGCCCAAGCAGCATCATCG 3'), специфический в отношении гена hph. Эти пары праймеры-зонд использовали в сдвоенной реакции с праймерами (SEQ ID NO: 297; F-5' CGGAGAGGGCGTGGAAGG 3', SEQ ID NO: 298; R-5' TTCGATTTGCTACAGCGTCAAC 3') и зондом (SEQ ID NO: 299; 5' AGGCACCATCGCAGGCTTCGCT 3'), специфическим в отношении белка I/I группы белков с высокой подвижностью B. napus (HMG I/Y), который присутствует в одной копии в А геноме (Weng et al., 2004, Plant Molecular Biology Reporter). Амплификацию выполняли в термоциклере C1000 с использованием системы для обнаружения продуктов ПЦР в режиме реального времени CFX96 или CF384 (BioRad, Hercules, CA). Результаты анализировали с использованием пакета программного обеспечения CFX Manager™ (BioRad). Относительное количество рассчитывали в соответствии с методом 2-ΔΔCt (Livak and Schmittgen, 2001), что давало оценку числа копий hph кассеты, вставленной в геном.

Доказательство NFTEJ-опосредованного сплайсинга и редактирования Fad3C было получено при проведении анализов с помощью ПЦР с использованием одного праймера, специфического в отношении Fad3C, и второго праймера, специфического в отношении или промотора, или терминатора hph кассеты (таблица 9 и фиг. 19В). Из-за ограниченных количеств ДНК, полученных из каллусной ткани, только интеграция в смысловой ориентации была проанализирована. ПЦР-продукты подвергали очистке из геля с использованием набора QiaQuick MiniElute PCR Purification Kit™ (Qiagen) и секвенировали с использованием прямого метода секвенирования по Сэнгеру. Продукты для секвенирования очищали с использованием этанола, ацетата натрия и EDTA, следуя протоколу BigDye® v3.1 (Applied Biosystems), и секвенировали и анализировали, как описано выше.

Количества каллусов, содержащих донорную кассету, в каждом эксперименте приведены в таблице 11. Доказательство добавления донорного гена в локус Fad3C в результате редактирования и/или сплайсинга было предоставлено путем ПЦР-амплификации (с использованием праймеров, представленных в таблице 10) сквозь сайты расщепления ZFN и оба 5' и 3' стыка Fad3C с hph кассетой. ПЦР-амплификация геномной ДНК, выделенной из каллусной ткани, регенерированной из контрольных протопластов, которые были трасформированы только hph-плазмидой (pDAS000340 и pDAS000342) или только ZFN-плазмидой (pDAB107827 и pDAB107828), не приводила к получению продуктов ПЦР-амплификации.

ПЦР-ампликоны, полученные в результате амплификации 5' и 3' стыков Fad3C с hph кассетой, очищали из агарозного геля и секвенировали для подтверждения специфичности интеграции в геномный локус Fad3C. Результаты секвенирования продуктов ПЦР показали, что каждый выделенный каллюс, регенерированный из отдельно трансформированного протопласта, приводил только к одному продукту ПЦР-амплификации и не содержал клетки смешанных генотипов.

В экспериментах по NHEJ-опосредованной интеграции донорных последовательностей в геномный локус Fad3C частота добавления к локусу-мишени (определяемого по любой части вектора с донорной ДНК, амплифицируемой с локуса-мишени) составляла 42%, 46% и 32% для соотношений ДНК 1:1, 5:1, 10:1 (донорная ДНК:ZFN ДНК), соответственно. Смотрите таблицу 12. Частоту целенаправленного сплайсинга определяли путем анализа того, являются ли амплифицируемыми стыки с кассетой, и на основе секвенирования ПЦР-продуктов. Эти результаты подтвердили, что кассета была вставлена в локус-мишень в правильной ориентации. Частота интеграции была рассчитана как 4%, 3% и 3% для составляющих 1:1, 5:1 и 10:1 соотношений донорная плазмидная ДНК:ZFN плазмидная ДНК, соответственно. В экспериментах по редактированию гена частота добавления к локусу-мишени, определяемого по любой части вектора с донорной ДНК, амплифицируемой с локуса-мишени, составила 66% и 65% для составляющих 5:1:1 и 10:1:1 соотношений донорная плазмидная ДНК:ZFN плазмидная ДНК, соответственно. Смотрите таблицу 13. Частоту целенаправленного редактирования определяли по амплифицируемости стыков с кассетой и получению последовательности ПЦР-продуктов. Эти результаты подтвердили, что кассета вставлялась в локус-мишень в правильной ориентации с частотами = 3% и 6% для составляющих 5:1:1 и 10:1:1 соотношений донорная плазмидная ДНК:ZFN плазмидная ДНК, соответственно. Как отмечено в анализах протопластов, пары оснований были или делетированы, или дополнительные основания были вставлены между геномом и кассетой в результате расщепления геномного локуса с помощью ZFN (фиг. 21-22).

В некоторых случаях анализы ПЦР-продуктов имели результатом добавления нуклеотидных последовательностей в локусе-мишени, отсутствие ПЦР-продукта или ПЦР-продукт большего размера, чем наблюдаемый в образцах дикого типа. Эти результаты, полученные в результате ПЦР-амплификации с использованием праймеров, фланкирующих сайт расщепления, показали, что локус был разрушен в обеих парах хромосом (фиг. 21-22). В некоторых случаях более одной полосы амплифицировались в стыках сплайсинга (фиг. 21-22), с указанием, что различные вставки имели место независимо в каждой копии генома.

Таблица 11
Количество каллусов, позитивных по присутствию hph, через четыре недели во время селекции
Доставленные векторы Молярное соотношение донорная ДНК:ZFN ДНК Отобранное количество каллусов Количество каллусов, позитивных по присутствию hph, через четыре недели во время селекции
pDAS000340 DAB107827 1:1 88 76
5:1 88 35
10:1 87 37
pDAS000342 DAB107827 DAB107828 1:1:1 - -
5:1:1 80 38
10:1:1 79 52

Таблица 12
Количество каллусов со вставками hph в результате сплайсинга в локус FadC в DSB, вызванный ZFN28051-2A-28052
Доставленные векторы Молярное соотношение донорная ДНК:ZFN ДНК Количество каллусов, позитивных по hph, через четыре недели во время селекции Количество каллусов, исходя из которых амлифицировалась по меньшей мере одна граница сплайсинга Количество каллусов, исходя из которых амлифицировалась по меньшей мере одна истинная* граница Количество каллусов, исходя из которых амлифицировались обе границы сплайсинга
pDAS000340 + DAB107827 1:1 76 32 0 3
5:1 35 16 0 1
10:1 37 12 0 1
* Количество делетированных пар оснований или дополнительных пар оснований, вставленных в сайт расщепления.

Таблица 13
Количество каллусов со вставками hph в результате редактирования в локусе FadC в сайты расщепления, вызванного ZFN28051-2A-28052 и ZFN28053-2A-28054
Доставленные векторы Молярное соотношение донорная
ДНК:ZFN ДНК
Количество каллусов, позитивных по hph, через четыре недели во время селекции Количество каллусов, исходя из которых амлифицировалась по меньшей мере одна граница сплайсинга Количество каллусов, исходя из которых амлифицировалась по меньшей мере одна истинная* граница Количество каллусов, исходя из которых амлифицировались обе границы редактирования
pDAS000342 + DAB107827 +
DAB107828
5:1:1 38 25 2 1
10:1:1 52 34 2 3
* Количество делетированных пар оснований или дополнительных пар оснований, вставленных в сайт расщепления.

Обнаружение добавления гена к FAD3C посредством негомологичного соединения концов у растений

ДНК экстрагировали из растений, которые были регенерированы из протопластов и перенесены в среду для посадки растений в горшки (как описано выше). Большинство регенерированных растений по оценкам содержали только 1-2 копии hph кассеты, закодированной в донорной ДНК. Растения анализировали с помощью того же набора анализов, описанного для каллусной ткани, а также с помощью анализов для определения того, вставлена ли кассета в антисмысловой ориентации, или интеграции донора в локус Fad3A.

Таблица 14
Расчетное количество копий растений, регенерированных из протопластов. В случае каждого соотношения были выполнены три трансфекции одного миллиона протопластов
Доставленные векторы Молярное соотношение донорная ДНК:ZFN ДНК # растений c 1-2 копиями hph # растений c 3-4 копиями hph # растений c 5 или более копий hph
pDAS000340 DAB107827 1:1 37 16 34
5:1 18 14 30
10:1 16 13 18
pDAS000342 DAB107827
DAB107828
1:1:1 0 1 1
5:1:1 22 14 18
10:1:1 23 11 27
Всего --- 116 69 128

Частота целенаправленного сплайсинга для линейных донорных расчетных конструкций в случае, когда hph кассета вставлялась в Fad3C в любом направлении, составляла 51%, 32% и 56% для соотношений донорная ДНК:ZFN ДНК в концентрациях, составляющих 1:1, 5:1 и 10:1, соответственно (таблица 15). Исходя из этих результатов, 35% 32% и 50% (1:1, 5:1 и 10:1) были вставлены в прямой ориентации (таблица 15).

Частота целенаправленного редактирования в случае, когда hph кассета вставлялась в Fad3C в любом направлении, заменяя область от локуса 4 до локуса 6, составляла 2% и 0% для соотношений донорная ДНК:ZFN ДНК:ZFN ДНК в концентрациях, составляющих 5:1:1 и 10:1:1, соответственно (таблица 16), Кроме того, когда обе ZFN доставлялись в соотношении = 5:1:1, 2% подвергались сплайсингу в локусе 4, и 10% подверглись сплайсингу в локусе 6, и, когда обе ZFN доставлялись в соотношении = 10:1:1, 10% подверглись сплайсингу в локусе 4, и 15% подвергались сплайсингу в локусе 6. ПЦР-ампликоны были получены и секвенированы с целью определения последовательностей стыков со вставкой. Полученные последовательности для специально обозначенных растений описаны в таблице 17.

Таблица 15
Количество растений со вставками hph в результате сплайсинга в локус FadC в DSB, вызванный ZFN28051-2A-28052
Соотношение Прямая ориентация Обратная ориентация Обе ориентации (прямая и обратная) Всего Проверенные случаи, позитивные по hph
Одна 5' внутренняя-внешняя Одна 3' внутренняя-внешняя И 5', и 3' Одна 5' внутренняя-внешняя Одна 3' внутренняя-внешняя И 5', и 3' Одна 5' или 3' И 5', и 3' Целенаправленный Нецеленаправленный
1:1 3 2 2 5 3 4 17 4 40 47 87
5:1 8 2 1 - - - 3 - 14 48 62
10:1 8 2 1 2 - 2 9 2 26 21 47

Таблица 16
Количество растений со вставками hph в результате редактирования в локус FadC в сайты расщепления, вызванного ZFN28051-2A-28052 и ZFN28053-2A-28054
Соотношение Прямая ориентация Обратная ориентация Обе ориентации (прямая и обратная) Всего Проверенные случаи, позитивные по hph
Одна граница 5' внутренняя-внешняя Одна граница 3' внутренняя-внешняя Обе границы 5' и 3' Одна граница 5' внутренняя-внешняя Одна граница 3' внутренняя-внешняя Обе границы 5' и 3' Одна граница 5' или 3' Обе границы 5' и 3' Целенаправленное Нецеленаправленное
1:1 3 2 2 5 3 4 17 4 40 47 87
5:1 8 2 1 - - - 3 - 14 48 62
10:1 8 2 1 2 - 2 9 2 26 21 47

Таблица 17
Относящиеся к растениям детали об одной копии hph, объекта, вставленного в локус Fad3C в сайты расщепления, вызванного ZFN28051-2A-28052 и ZFN28053-2A-28054
Штрихкод растения ПЦР/информация о последовательности SEQ ID NO:
349711 Локус 4 5' 353
349685 Локус 4 5' 354
346258 Локус 4 5' 355
348918 Локус 4 5' 356
359900 Локус 4 5' 357
346125 Локус 4 5' 358
348919 Локус 4 5' 359
349215c Локус 4 5' 360
349216c Локус 4 5' 361
346102 Локус 4 3' 362
346175 Локус 4 3' 363
345888 Локус 6 3' 364
356731 Локус 6 3' 365
346128 Локус 4 3' антисмысловая ориентация 366
347359 Локус 6 5' антисмысловая ориентация 367

Частота целенаправленного сплайсинга в случае, когда hph кассета вставлялась в Fad3C в любом направлении в случае замкнутого в круг донора, составляла 51%, 32% и 56% для 1:1, 5:1 и 10:1, соответственно (таблица 18, фиг. 23). Исходя из них, 35% 32% и 50% (1:1, 5:1 и 10:1) были вставлены в прямой ориентации (Таблица 18).

Частота целенаправленного редактирования в случае, когда hph кассета вставлялась в Fad3C в любом направлении, заменяя область от локуса 4 до 6 локуса, составляла 2% и 0% для 5:1:1 и 10:1:1, соответственно (таблица 19, фиг. 24). Кроме того, когда обе ZFN доставлялись в соотношении 5:1:1, 2% подверглись сплайсингу в локусе 4, и 10% подверглись сплайсингу в локусе 6, и, когда обе ZFN доставлялись в соотношении 10:1:1 10% подверглись сплайсингу в локусе 4, и 15% подвергались сплайсингу в локусе 6.

Таблица 18
Количество растений с hph, вставленной в результате сплайсинга в локус FadC в DSB, вызванный ZFN28051-2A-28052
Доставленные векторы Молярное соотношение донорная ДНК:ZFN ДНК Количество проанализированных растений (позитивных по hph) Количество растений, исходя из которых амплифицировалась по меньшей мере одна граница сплайсинга (прямой праймер/
обратный праймер/тот или другой)
Количество растений, исходя из которых амплифицировались обе границы сплайсинга (прямой праймер/
обратный праймер/тот или другой)
pDAS000340 + DAB107827 1:1 60 21/23/31 4/7/8
5:1 37 12/4/12 3/1/3
10:1 46 23/12/26 4/4/7
* Нет делетированных пар оснований или дополнительных пар оснований, вставленных в сайт расщепления

Таблица 19
Количество растений с hph, вставленных в результате редактирования в локус FadC в сайты расщепления, вызванного ZFN28051-2A-28052 и ZFN28053-2A-28054
Доставленные векторы Молярное соотношение донорная ДНК:ZFN ДНК Количество проанализированных растений (позитивных по hph) Количество растений, исходя из которых амплифицировалась по меньшей мере одна граница сплайсинга (прямой праймер/
обратный праймер/тот или другой)
Количество растений, исходя из которых амплифицировались обе границы редактирования (прямой праймер/
обратный праймер/тот или другой)
pDAS000342
+
DAB107827
+
DAB107828
5:1:1 39 17/11/24 0/1/1
10:1:1 63 27/27/34 0/0/0
* Нет делетированных пар оснований или дополнительных пар оснований, вставленных в сайт расщепления

Направленная интеграция десатуразы омега-3 жирных кислот Brassica napus с помощью HDR

Векторы-доноры, содержащие tGFP и HPH кассеты, модифицируют для включения 1 т.п.о. 5' и 3' донорных последовательностей FAD3. 5' и 3' донорные последовательности FAD3 идентичны на 100% природной последовательности FAD3 и получены из сайта связывания цинкового пальца FAD3; GCCCAAGGAACCCTTTTCTGGGCCATCTTCGTACTCGGCCACGACTGGTAATTTAAT (SEQ ED NO: 255) или AGCGAGAGAAAGCTTATTGCAACTTCAACTACTTGCTGGTCGATCGTGTTGGCCACТС (SEQ ID NO: 256). Результирующие четыре вектора-«донора» похожи на pDAS000340 (донор для сплайсинга гена устойчивости к гигромицину), pDAS000341 (донор для сплайсинга гена-репортера tGFP), pDAS00342 (донор для редактирования гена устойчивости к гигромицину) и pDAS000343 (донор для редактирования гена-репортера tGFP), причем единственной модификацией является включение 1 т.п.о. геномных 5' и 3' последовательностей FAD3. Кодирующие нуклеазы на основе цинковых пальцев плазмиды (pDAB107827 и pDAB107828), ранее описанные для NHEJ-опосредованной интеграции, используются для HDR-опосредованной интеграции.

Трансформация Brassica napus

Протопласты мезофильного происхождения выделяют и получают из растений Brassica napus (DH10275), как описано выше. Протопласты трансформируют с использованием очищенной плазмидной ДНК. Аликвоты донорной и ZFN плазмидной ДНК готовят в трех молярных соотношениях: 1:1 (30 мкг каждой плазмиды), 5:1 (донорная плазмида:ZFN плазмида до всего 30 мкг плазмидной ДНК) и 10:1 (донорная плазмида:ZFN плазмида до всего 30 мкг плазмидной ДНК). Кроме того, аликвоты только донора и только ZFN (30 мкг) были приготовлены в качестве контролей. Количества ДНК, доставляемые в протопласты B. napus через ПЭГ 4000-опосредованную трансформацию, суммированы в таблице 20. Трансформированные протопласты клеток культивируют, как описано выше, причем средой для отбора является содержащая глюфосинат селективная среда, и предполагаемые трансформанты анализируют с помощью анализа с помощью количественной ПЦР на вставки трансгенов.

Таблица 20
Количества ZFN и донорной ДНК, доставляемых в протопласты
Обратная ориентация; соотношение плазмидных ДНК Общее количество ДНК (мкг), доставляемое в 1 миллион протопластов
Сплайсинг Только донорная плазмида 30
Только ZFN-плазмида 30
1:1 Донор:ZFN 60
5:1 Донор:ZFN 30
10: Донор:ZFN 30

Редактирование Только донорная плазмида 30
1:1: ZFN плазмиды 30
1:1:1 Донор:ZFN:ZFN 90
5:1:1 Донор:ZFN:ZFN 30
10:1:1 Донор:ZFN:ZFN 30

Обнаружение добавления гена к FAD3 с помощью HDR в протопластах

Геномную ДНК экстрагируют из пулов протопластов (одного миллион протопластов в каждом пуле), в которые за двадцать четыре часа до этого доставляют донорную ДНК, кодирующую кассету для функционального репортера или кассету селектируемого маркера, ZFN ДНК или смесь донорной и ZFN ДНК. Количества ДНК, доставляемые для трансформации, описаны выше. ПЦР-продукты клонируют в плазмидные векторы. Редактирование генома происходит независимо в каждой клетке, приводя к множеству различных событий вставки, посредством клонирования в плазмидный вектор каждое редактирование генома можно точно секвенировать. Несколько клонов секвенируют на основе автоматизированного капиллярного электрофореза ABI3730XL®. Анализ последовательностей генов осуществляют, используя программное обеспечение Sequencher v5.0™ (GeneCodes, Ann Arbor, MI).

Доказательство добавления гена в локус Fad3C в результате редактирования или сплайсинга обеспечивают посредством амплификации обоих 5' и 3' стыков Fad3C с кассетой из геномной ДНК, экстрагированной из протопластов. Амплификация не отмечается, исходя из протопластов, в которые была доставлена только ZFN плазмида или донорная плазмида. Все последовательности стыков свидетельствуют о вставке кассеты в локус Fad3C путем HDR-опосредованной репарации. Отмечаются делеции различных длин из одного из двух или обоих из генома и кассеты, а также добавления последовательностей, происходящих из векторных остовов (или из донора, или из ZFN), вставляемых между геномом и кассетой.

Обнаружение добавления гена к FAD3 посредством HDR в каллусной ткани, регенерированной из протопластов

Еще одно доказательство сплайсинга и редактирования локуса Fad3 было получено из каллусной ткани, регенерированной из протопластов в процессе селекции, в которые была доставлена донорная ДНК, кодирующая кассету, только ZFN ДНК или донорная и ZFN ДНК. ДНК экстрагируют из приблизительно 80 каллусов для каждого соотношения.

Интеграцию кассеты в геном B. napus подтверждают с помощью количественной ПЦР Taqman™, используя праймеры и зонды, специфические в отношении вставки донора и геномных фланкирующих последовательностей. Относительное количество рассчитывают в соответствии с методом 2-ΔΔCt (Livak and Schmittgen, 2001), что давало оценку числа копий кассеты, вставленной в геном. Доказательство NFTEJ-опосредованного сплайсинга и редактирования FAD3 получают при проведении анализов с помощью ПЦР с использованием одного праймера, специфического в отношении FAD3, и второго праймера, специфического в отношении или промотора, или терминатора кассеты. ПЦР-продукты подвергают очистке из геля с использованием набора QiaQuick MiniElute PCR Purification Kit™ (Qiagen) и секвенируют с использованием прямого метода секвенирования по Сэнгеру. Продукты для секвенирования очищают с использованием этанола, ацетата натрия и EDTA, следуя протоколу BigDye® v3.1 (Applied Biosystems), и секвенируют и анализируют, как описано выше.

Определяют количества каллусов, содержащих донорную кассету, в каждом эксперименте. Доказательство добавления донорного гена в локус Fad3 в результате редактирования и/или сплайсинга предоставляют путем ПЦР-амплификации сквозь сайты расщепления ZFN и оба 5' и 3' стыка FAD3 с кассетой. ПЦР-амплификация геномной ДНК, выделенной из каллусной ткани, регенерированной из контрольных протопластов, которые трасформированы только плазмидой или только ZFN плазмидой, не приводит к получению продуктов ПЦР-амплификации.

ПЦР-ампликоны, полученные в результате амплификации 5' и 3' стыков FAD3 с кассетой, очищают из агарозного геля и секвенируют для подтверждения специфичности интеграции в геномный локус FAD3. Результаты секвенирования продуктов ПЦР указывают на то, что каждый выделенный каллюс, регенерированный из отдельно трансформированного протопласта, приводит только к одному продукту ПЦР-амплификации и не содержит клетки смешанных генотипов.

Обнаружение добавления гена к FAD3 посредством HDR у растений

ДНК экстрагируют из растений, которые регенерированы из протопластов и перенесены в среду для посадки растений в горшки. Большинство регенерированных растений по оценкам содержат только 1-2 копии кассеты, закодированной в донорной ДНК. Растения анализируют с помощью того же набора анализов, описанного для каллусной ткани, а также с помощью анализов для определения того, вставлена ли кассета в локус FAD3.

Частоту целенаправленного сплайсинга в случае, когда кассета вставляется в локус FAD3, определяют, используя анализы с помощью ПЦР, описанные выше. Полученные полосы, соответствующие ампликонам, секвенируют для определения фланкирующих последовательностей. Кроме того, растения проверяются в отношении нецеленаправленных вставок, чтобы определить частоту интеграции кассеты в сайты, отличные от FAD3.

Пример 9: Направленная интеграция десатуразы омега-3 жирных кислот (FAD3) Brassica napus с агрономически важным геном

Конструкции, содержащие трансген DGT-28 (международная заявка на патент № WO/2013/116700, которая включена в настоящее описание посредством ссылки), который придает устойчивость к гербициду глифосату, разрабатывают и строят для интеграции в локус FAD3 генома Brassica napus. Эти конструкции и связанные конструкции нуклеаз на основе цинковых пальцев (например, pDAB107827 и pDAB107828) трансформируют в клетки Brassica napus, как описано ранее выше. Трансформанты идентифицируют и подтверждают с помощью молекулярных анализов подтверждения, как описано выше. Выделяют хромосомные интегранты FAD3, включающие интегрированный трансген dgt-28. Примером интеграции трансгена dgt-28 в локус FAD3 является NHEJ-опосредованная интеграция и HDR-опосредованная интеграция. Интеграция в локус FAD3 может быть направлена в эндогенную последовательность FAD3 или в ранее описанную ETIP (pDAS000271 - pDAS000275), которая стабильно интегрирована в локус FAD3. Интеграцию в локус FAD3 через NHEJ-опосредованный механизм можно осуществить, используя линеаризованные или замкнутые в круг донорные ДНК-конструкции. Трансформированные dgt-28 случаи Brassica napus получают и проверяют в отношении надежной экспрессии DGT-28 и последующей устойчивости к гербициду глифосату.

Хотя в настоящем документе были описаны некоторые, приводимые в качестве примера варианты осуществления, специалистам со средним уровнем компетентности в данной области техники будет понятно и очевидно, что множество добавлений, исключений и модификаций, приводимых в качестве примера вариантов осуществления может быть выполнено без отхода от объема следующей формулы изобретения. Кроме того, признаки одного варианта осуществления могут быть объединены с признаками другого варианта осуществления.

1. Способ интегрирования представляющей интерес последовательности нуклеиновой кислоты в ген FAD3 в клетке, включающий:

расщепление, сайт-специфическим образом, сайта-мишени в гене FAD3 в клетке с помощью нуклеазы на основе цинковых пальцев, включающей от трех до шести доменов «цинковые пальцы», причем каждый домен «цинковые пальцы» включает распознающий спиральный участок, где

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:116, 117, 116, 119, 120 и 121, и расщепляет сайт-мишень SEQ ID NO:20 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:122, 123, 124, 125 и 126, и расщепляет сайт-мишень SEQ ID NO:21 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:124, 128, 129, 130, 131, 132, и расщепляет участок-мишень SEQ ID NO:22 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:133, 134, 135, 136, 137 и 138, и расщепляет сайт-мишень SEQ ID NO:25 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:126, 140, 141, 142 и 143, и расщепляет сайт-мишень SEQ ID NO:26 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:124, 235, 150, 129 и 152, и расщепляет сайт-мишень SEQ ID NO:28 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:129, 145, 137, 125, 148 и 149, и расщепляет сайт-мишень SEQ ID NO:29 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:150, 129, 152, 129 и 154, и расщепляет сайт-мишень SEQ ID NO:30 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:155, 129, 145, 137 и 125, и расщепляет сайт-мишень SEQ ID NO:31 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:152, 161, 140, 163, 152 и 165, и расщепляет сайт-мишень SEQ ID NO:32 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:166, 167, 126, 169 и 170, и расщепляет сайт-мишень SEQ ID NO:33 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:171, 137, 173, 174 и 175, и расщепляет сайт-мишень SEQ ID NO:34 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:166, 177, 129, 179 и 125, и расщепляет сайт-мишень SEQ ID NO:35 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:174, 175, 183, 148 и 185, и расщепляет сайт-мишень SEQ ID NO:36 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:130, 148, 188, 166 и 177, и расщепляет сайт-мишень SEQ ID NO:37 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:124, 192, 116, 119, 120 и 121, и расщепляет сайт-мишень SEQ ID NO:38 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:124, 128, 129, 130, 206 и 207, и расщепляет сайт-мишень SEQ ID NO:40 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:134, 209, 135, 136, 137 и 138, и расщепляет сайт-мишень SEQ ID NO:41 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:129, 130, 206, 207, 137 и 219, и расщепляет сайт-мишень SEQ ID NO:42 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:220, 137, 222, 223 и 224, и расщепляет сайт-мишень SEQ ID NO:43 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:225, 226, 142, 143 и 229, и расщепляет сайт-мишень SEQ ID NO:44 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:230, 231, 232 и 233, и расщепляет сайт-мишень SEQ ID NO:45 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:129, 240, 137, 125, 148 и 149, и расщепляет сайт-мишень SEQ ID NO:47 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:155, 129, 240, 137 и 125, и расщепляет сайт-мишень SEQ ID NO:49 или вблизи него;

с созданием, таким образом, разрыва в гене FAD3; и

интегрирование в указанный разрыв представляющей интерес последовательности нуклеиновой кислоты, которая присутствует в указанной клетке.

2. Способ по п.1, причем геном FAD3 является ген FAD3A, FAD3А’, FAD3A”, FAD3C, FAD3C” и/или FAD3C’.

3. Способ по п.2, причем расщепление сайт-специфическим образом является специфическим в отношении некоторых, но не всех копий FAD3A, FAD3А’, FAD3A”, FAD3C, FAD3C” и/или FAD3C’.

4. Способ по п.1 или 2, причем клеткой является клетка растения.

5. Способ по п.4, причем клеткой растения является клетка однодольного растения или клетка двудольного растения.

6. Способ по п.5, причем растение выбирают из группы, состоящей из Brassica sp., Brassica napus, Brassica rapa, Brassica juencea, Brassica oleracea, Brassica nigra, Zea sp., Zea mays, Glycine sp., Glycine max, Triticum sp., Triticum aestivum, Oryza sp., Oryza sativa, Triticae sp., Triticae triticum, Heliantheas sp., Heliantheas helianthus, Gossypium sp., Gossypium hirsutum и Hordeum vulgar.

7. Способ по п.1 или 2, причем представляющую интерес последовательность нуклеиновой кислоты выбирают из группы, состоящей из последовательности, включающей сайт-мишень для связывания ДНК-связывающего домена, одного или более генов устойчивости к инсектицидам, одного или более генов устойчивости к гербицидам, одного или более генов эффективности потребления азота, одного или более генов эффективности потребления воды, одного или более генов пищевой ценности, одного или более генов ДНК-связывающих белков, одного или более генов селектируемых маркеров и их комбинации.

8. Сайт-специфическая нуклеаза на основе цинковых пальцев для применения в модификации гена FAD3, где указанная нуклеаза на основе цинковых пальцев включает от трех до шести доменов «цинковые пальцы», причем каждый домен «цинковые пальцы» включает распознающий спиральный участок, где

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:116, 117, 116, 119, 120 и 121, и расщепляет сайт-мишень SEQ ID NO:20 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:122, 123, 124, 125 и 126, и расщепляет сайт-мишень SEQ ID NO:21 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:124, 128, 129, 130, 131, 132, и расщепляет участок-мишень SEQ ID NO:22 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:133, 134, 135, 136, 137 и 138, и расщепляет сайт-мишень SEQ ID NO:25 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:126, 140, 141, 142 и 143, и расщепляет сайт-мишень SEQ ID NO:26 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:124, 235, 150, 129 и 152, и расщепляет сайт-мишень SEQ ID NO:28 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:129, 145, 137, 125, 148 и 149, и расщепляет сайт-мишень SEQ ID NO:29 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:150, 129, 152, 129 и 154, и расщепляет сайт-мишень SEQ ID NO:30 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:155, 129, 145, 137 и 125, и расщепляет сайт-мишень SEQ ID NO:31 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:152, 161, 140, 163, 152 и 165, и расщепляет сайт-мишень SEQ ID NO:32 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:166, 167, 126, 169 и 170, и расщепляет сайт-мишень SEQ ID NO:33 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:171, 137, 173, 174 и 175, и расщепляет сайт-мишень SEQ ID NO:34 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:166, 177, 129, 179 и 125, и расщепляет сайт-мишень SEQ ID NO:35 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:174, 175, 183, 148 и 185, и расщепляет сайт-мишень SEQ ID NO:36 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:130, 148, 188, 166 и 177, и расщепляет сайт-мишень SEQ ID NO:37 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:124, 192, 116, 119, 120 и 121, и расщепляет сайт-мишень SEQ ID NO:38 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:124, 128, 129, 130, 206 и 207, и расщепляет сайт-мишень SEQ ID NO:40 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:134, 209, 135, 136, 137 и 138, и расщепляет сайт-мишень SEQ ID NO:41 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:129, 130, 206, 207, 137 и 219, и расщепляет сайт-мишень SEQ ID NO:42 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:220, 137, 222, 223 и 224, и расщепляет сайт-мишень SEQ ID NO:43 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:225, 226, 142, 143 и 229, и расщепляет сайт-мишень SEQ ID NO:44 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:230, 231, 232 и 233, и расщепляет сайт-мишень SEQ ID NO:45 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:129, 240, 137, 125, 148 и 149, и расщепляет сайт-мишень SEQ ID NO:47 или вблизи него;

указанная нуклеаза на основе цинковых пальцев содержит распознающие спиральные участки в следующем порядке, представленные в SEQ ID NO:155, 129, 240, 137 и 125, и расщепляет сайт-мишень SEQ ID NO:49 или вблизи него.



 

Похожие патенты:

Изобретение относится к прикладной микробиологии, биотехнологии и микробиологической промышленности. Способ биосинтеза нуклеазы бактерий Serratia marcescens предусматривает добавление митомицина С в количестве 0,01-1,0 мг/л культуральной жидкости в период экспоненциального роста бактерий Serratia marcescens на среде LB.

Изобретение относится к биотехнологии. Описан способ модифицирования заданного сайта-мишени в последовательности нуклеиновой кислоты-мишени в клетке-хозяине с помощью программируемого нуклеопротеинового молекулярного комплекса.

Группа изобретений относится к биотехнологии и касается получения рекомбинантной барназы. Предложена рекомбинантная плазмида pET-STII-Ba, обеспечивающая синтез в клетках Escherichia coli барназы, имеющей аминокислотную последовательность SEQ ID №3.

Представленная группа изобретений касается полинуклеотида, кодирующего вариант хоминг-эндонуклеазы (ХЭ) I-OnuI, экспрессионного вектора, содержащего такой полинуклеотид, полипептида эндонуклеазы, композиции для лечения гемоглобинопатии и клетки, содержащей указанные полинуклеотид, вектор или полипетид эндонуклеазы.

Изобретение относится к биотехнологии. Штамм бактерий Serratia species К-57, обладающий РНКазной и ДНКазной активностью, депонирован в Коллекции бактерий, бактериофагов и грибов Федерального бюджетного учреждения науки «Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора» под регистрационным номером В-1289.

Настоящее изобретение относится к биохимии, в частности к мутантному полипептиду полимеразы ВГВ, содержащему мутантный домен полимеразы ВГВ с внутренней делецией, которая подавляет функциональную активность полимеразы, и мутантный домен РНКазы Н с внутренней делецией и мутациями, которые подавляют функциональную активность РНКазы Н.

Изобретение относится к микробиологической промышленности и может быть использовано в биотехнологии, генетической инженерии, медицине и ветеринарии. Предложено применение РНКаза Bacillus sp.

Изобретение относится к биотехнологии. Описана лиофилизированная лекарственная форма гликопротеина дезоксирибонуклеазы I человека для приготовления ингаляционного раствора для снижения вязкости мокроты, отличающаяся тем, что указанный гликопротеин представляет собой рекомбинантную дезоксирибонуклеазу I человека с аминокислотной последовательностью, представленной в описании, получаемую в микроорганизме Е.
Изобретение относится к биотехнологии и может быть использовано в растениеводстве. Предложено применение фермента РНКазы Bp в качестве ингибитора развития РНК-геномных фитовирусов.

Изобретение относится к биотехнологии. Штамм бактерий Serratia species является продуцентом внеклеточных рибонуклеазы и дезоксирибонуклеазы, обладающих противовирусной активностью в отношении вирусов птичьего гриппа A/chickenKurgan/05/2005 (H5N1) и вируса гриппа человека A/Aichi/2/68 (H3N2).

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, способные к специфичному связыванию с PD-L1.

Группа изобретений относится к области медицины. Предложена нуклеиновая кислота, способствующая выживаемости фоторецепторов, содержащая последовательность нуклеотидов, которая кодирует белок RdCVF человека, и вторую последовательность нуклеотидов, которая кодирует сигнальную последовательность Igk, функционально связанную с последовательностью нуклеотидов, кодирующей белок RdCVF человека, где последовательность, кодирующая RdCVF человека, содержит перекодированную последовательность нуклеотидов.

Настоящее изобретение относится к иммунологии. Предложено антитело, способное связывать рецептор пролактина (PRLR).

Предложены рекомбинантная плазмидная ДНК pBiPr-ABIgA1FI6-Intht, включающая кодирующие последовательности легкой и тяжелой цепи человеческого антитела F16 к гемагглютинину вируса гриппа А человека изотипа IgA1, и способ получения указанного человеческого антитела, а также линия эукариотических клеток, содержащая указанную рекомбинантную плазмидную ДНК, и способ получения указанной линии клеток.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его функциональный фрагмент, способные к связыванию с PD-1.

Изобретение относится к области биотехнологии, конкретно к получению полипептидных комплексов, обладающих цитотоксичностью в отношении раковых клеток, что может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к шаттлам для гематоэнцефалического барьера, что может быть использовано в медицине. Получают шаттл для гематоэнцефалического барьера, который связывается с рецептором трансферрина, содержит специфичный к нему scFab, линкер и эффекторный элемент для головного мозга, что используют в фармацевтических композициях для транспорта эффекторного элемента для головного мозга через гематоэнцефалический барьер.

Настоящее изобретение относится к иммунологии. Предложено антитело, специфически связывающееся с CD26 человека, а также кодирующие такое антитело нуклеиновые кислоты, экспрессирующий вектор, клетка-хозяин и способ производства антитела.

Настоящее изобретение относится к области биотехнологии, конкретно к композиции даклизумаба, и может быть использовано в медицине. Полученная композиция препарата даклизумаба подходит для подкожного введения и может быть применена при лечении индивидов, страдающих от рассеянного склероза.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий участок, способные к связыванию с фосфорилированным эпитопом на тау-белке человека с высокой специфичностью и/или аффинностью.

Изобретение относится к области биохимии, в частности к средству для лечения состояний человеческого организма, связанных с уменьшением уровня экспрессии гена ANG и/или уменьшением количества и/или активности белка ангиогенина на основе генно-терапевтической субстанции с геном ANG, представляющей собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена ANG, с кодирующей последовательностью белка ангиогенина, с делециями 5' и 3'-нетранслируемых областей, и регуляторными элементами, обеспечивающими повышение экспрессии гена ANG в эукариотических клетках и в клетках органов и тканей человека, выбранных из фибробластов, эпителиальных клеток роговицы глаза, кожи, слизистой оболочки полости рта или мышечной ткани, в сочетании с транспортной молекулой или без нее при введении этого средства в органы и ткани человека.

Изобретение относится к области биохимии, в частности к способу интегрирования представляющей интерес последовательности нуклеиновой кислоты в ген FAD3 в клетке. Кроме того, раскрыта сайт-специфическая нуклеаза на основе цинковых пальцев для применения в модификации гена FAD3. Изобретение позволяет осуществлять интегрирование представляющей интерес последовательности нуклеиновой кислоты в ген FAD3 с высокой эффективностью. 2 н. и 6 з.п. ф-лы, 20 табл., 24 ил., 9 пр.

Наверх