Модулирование экспрессии вируса гепатита b (hbv)

Изобретение может применяться в медицине и относится к одноцепочечному модифицированному олигонуклеотиду, состоящему из 16-30 связанных нуклеозидов и имеющему последовательность нуклеооснований, состоящую из последовательностей SEQ ID NO: 226, 17, 50, 224, 722, 807, 1327, 1340 и 1379, причем указанный олигонуклеотид содержит: сегмент гэп, состоящий из связанных дезоксинуклеозидов; сегмент крыла 5', состоящий из связанных нуклеозидов; и сегмент крыла 3', состоящий из связанных нуклеозидов; сегмент гэп расположен между сегментом крыла 5' и сегментом крыла 3'; каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар или затрудненный этиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь или фосфодиэфирную связь; каждый цитозин представляет собой 5-метилцитозин. Предложены новые модифицированные олигонуклеотиды и композиции на их основе, эффективные для лечения HBV-связанного заболевания, расстройства или состояния. 6 н. и 10 з.п. ф-лы, 22 пр., 77 табл., перечень последовательностей.


Перечень последовательностей

Настоящая заявка подана вместе с перечнем последовательностей в электронном формате. Перечень последовательностей представлен в виде файла, озаглавленного BIOL0175WOSEQ.txt, который был создан 18 апреля 2012 года и имеет размер около 256 кБ. Информация о перечне последовательностей в электронном формате включена в настоящий документ путем ссылки в полном объеме.

Область изобретения

В некоторых аспектах реализации данного изобретения представлены способы, соединения и композиции для ингибирования экспрессии мРНК и белка вируса гепатита В (HBV) у животного. Такие способы, соединения и композиции применимы для лечения, предупреждения или улучшения связанных с HBV заболеваний и расстройств.

Уровень техники

Гепатит В представляет собой вирусное заболевание, которое передается парентерально через зараженный материал, такой как кровь и продукты крови, зараженные иглы, половым путем, а также вертикально от инфицированных матерей к их потомству. По оценкам Всемирной организации здравоохранения, во всем мире инфицировано более 2 миллиардов людей, каждый год возникает около 4 миллионов острых случаев, происходит 1 миллион смертей в год и появляется 350-400 миллионов хронических носителей (Всемирная организация здравоохранения: Geographic Prevalence of Hepatitis B Prevalence, 2004. http://www.who.int/vaccines-surveillance/graphics/htmls/hepbprev.htm).

Вирус HBV представляет собой двухцепочечный гепатотропный вирус, который инфицирует только людей и приматов, не являющихся человеком. Репликация вируса происходит преимущественно в печени и, в меньшей степени, в почках, поджелудочной железе, костном мозге и селезенке (Hepatitis В virus biology. Microbiol Mol Biol Rev. 64: 2000; 51-68.). Вирусные и иммунные маркеры могут быть обнаружены в крови, и они характеризуют развивающиеся со временем структуры антигенов-антител. Первый обнаруживаемый вирусный маркер представляет собой HBsAg, за ним следует е-антиген гепатита В (HBeAg) и ДНК HBV. В инкубационный период титры могут быть высокими, однако уровни ДНК и HBeAg HBV падают при возникновении заболевания и могут быть не обнаруживаемыми во время пика клинической болезни (Hepatitis В virus infection-natural history and clinical consequences. N Engl J Med.. 350: 2004; 1118-1129). HBeAg представляет собой вирусный маркер, обнаруживаемый в крови, который коррелирует с активной вирусной репликацией и, следовательно, высокой вирусной нагрузкой и инфективностью (Hepatitis В е antigen-the dangerous end game of hepatitis B. N Engl J Med. 347: 2002; 208-210). Присутствие анти-HBsAb и анти-HBcAb (IgG) указывает на выздоровление и иммунитет у ранее инфицированного субъекта.

В настоящее время терапии для хронической инфекции HBV, которые рекомендованы Американской ассоциацией по изучению болезней печени (AASLD) и Европейской ассоциацией по изучению печени (EASL), включают интерферон альфа (INFα), пегилированный интерферон альфа-2а (Peg-IFN2a), энтекавир и тенофовир. Нуклеозидные и нуклеотидные терапии, энтекавир и тенофовир, являются успешными для снижения вирусной нагрузки, однако скорости снижения сероконверсии HBeAg и HBeAg даже ниже, чем эти показатели, полученные при терапии с IFNα. Также используют другие аналогичные терапии, включая ламивудин (ЗТС), телбивудин (LdT) и адефовир, однако для нуклеозидной/нуклеотидной терапии в целом, возникновение резистентности ограничивает терапевтическую эффективность.

Следовательно, в данной области техники существует необходимость открытия и разработки новых противовирусных терапий. Кроме того, существует необходимость в новых анти-HBV терапиях, способных увеличивать скорости сероконверсии HBeAg и HBsAg. В недавнем клиническом исследовании была обнаружена корреляция между, сероконверсией и снижением HBeAg (Fried et аl. (2008) Hepatology 47:428) и снижением HBsAg (Moucari et al. (2009) Hepatology 49:1151). Снижение уровней антигенов может обеспечивать возможность иммунологического контроля инфекции HBV, поскольку высокие уровни антигенов, предположительно, вызывают иммунологическую толерантность. Существующие нуклеозидные терапии для HBV способны существенно снижать уровни HBV, однако они слабо влияют на уровни HBeAg и HBsAg.

Антисмысловая технология развивается как эффективное средство снижения экспрессии специфических генных продуктов, и, следовательно, может быть подтверждена ее уникальная полезность в ряде терапевтических, диагностических и исследовательских применений для модулирования экспрессии HBV (смотри публикации патентов США №№2008/0039418 и 2007/0299027). Антисмысловая терапия отличается от нуклеозидной терапии тем, что она может напрямую влиять на транскрипты для антигенов HBV и, посредством этого, снижать уровни HBeAg и HBsAg в сыворотке. Из-за большого количества перекрывающихся транскриптов, вырабатываемых при инфекции HBV, существует также возможность снижения ДНК HBV, помимо HBeAg и HBsAg, одним антисмысловым олигомером. Следовательно, антисмысловая технология развивается как эффективное средство снижения экспрессии определенных генных продуктов, и, следовательно, может быть подтверждена ее уникальная полезность в ряде терапевтических, диагностических и исследовательских применений для модулирования HBV.

Краткое описание изобретения

В настоящем документе представлены способы, соединения и композиции для модулирования экспрессии мРНК и белка HBV. В некоторых аспектах реализации данного изобретения, соединения, применимые для модулирования экспрессии мРНК и белка HBV, представляют собой антисмысловые соединения. В некоторых вариантах реализации, антисмысловые соединения представляют собой антисмысловые олигонуклеотиды.

В некоторых вариантах реализации, модулирование может происходить в клетке или ткани. В некоторых вариантах реализации клетка или ткань находится в организме животного. В некоторых вариантах реализации животное представляет собой человека. В некоторых вариантах реализации снижаются уровни мРНК HBV. В некоторых вариантах реализации снижаются уровни ДНК HBV. В некоторых вариантах реализации снижаются уровни белка HBV. В некоторых вариантах реализации снижаются уровни антигена HBV. В некоторых вариантах реализации снижаются уровни s-антигена HBV (HBsAg). В некоторых вариантах реализации снижаются уровни е-антигена HBV (HBeAg). Такое снижение может происходить в зависимости от времени или в зависимости от дозы.

Также представлены способы, соединения и композиции, применимые для предупреждения, лечения и улучшения заболеваний, расстройств и состояний. В некоторых вариантах реализации, такие связанные с HBV заболевания, расстройства и состояния представляют собой болезни печени. В некоторых вариантах реализации, такие заболевания, расстройства и состояния печени включают желтуху, рак печени, воспаление печени, фиброз печени, воспаление, цирроз печени, печеночную недостаточность, диффузное гепатоцеллюлярное воспалительное заболевание, гемофагоцитарный синдром, серозный гепатит, виремию HBV и заболевание печени, связанное с трансплантацией. В некоторых вариантах реализации, такие связанные с HBV заболевания, расстройства и состояния представляют собой гиперпролиферативные заболевания, расстройства и состояния. В некоторых вариантах реализации такие гиперпролиферативные заболевания, расстройства и состояния включают рак, а также связанные злокачественные образования и метастазы. В некоторых вариантах реализации, такие виды рака включают рак печени и гепатоцеллюлярный рак (НСС).

Такие заболевания, расстройства и состояния могут в совокупности иметь один или несколько факторов риска, причин или последствий. Некоторые факторы риска и причины развития заболевания печени или гиперпролиферативного заболевания включают возраст; табакокурение; воздействие солнечного света и ионизирующей радиации; контакт с некоторыми химическими веществами; инфекцию некоторыми вирусами и бактериями; некоторые гормональные терапии; семейный анамнез рака; употребление алкоголя; и некоторые особенности образа жизни, включая плохое питание, недостаток физической активности и/или избыток веса. Некоторые симптомы и последствия, связанные с развитием заболевания печени или гиперпролиферативного заболевания, включают, но не ограничиваясь этим: болезнь, похожую на грипп, слабость, боли, головную боль, жар, потерю аппетита, диарею, желтуху, тошноту и рвоту, боль в области печени, стул земляного или серого цвета, зуд по всему телу и мочу темного цвета.

В некоторых вариантах реализации, способы лечения включают введение антисмыслового соединения HBV пациенту, нуждающемуся в этом. В некоторых вариантах реализации, способы лечения включают введение антисмыслового олигонуклеотида HBV пациенту, нуждающемуся в этом.

Подробное описание

Следует понимать, что изложенное выше общее описание и следующее подробное описание являются лишь примерными и пояснительными, и не являются ограничивающими заявленное изобретение. В настоящем документе применение единственного числа включает множественное число, если специально не оговорено иное. При использовании в настоящем документе, применение «или» означает «и/или», если не указано иное. Кроме того, использование термина «включая», а также других форм, таких как «включает» и «включен», не является ограничивающим. Также, такие термины как «элемент» или «компонент» охватывают элементы и компоненты, составляющие одно целое, а также элементы и компоненты, которые составляют более одной субъединицы, если специально не указано иное.

Заголовки разделов, используемые в настоящем документе, предназначены только для организационных целей, и их не следует толковать как ограничения описываемого предмета обсуждения. Все документы или части документов, которые упомянуты в настоящей заявке, включая, но не ограничиваясь этим, патенты, патентные заявки, статьи, книги и трактаты, в явной форме включены в настоящий документ путем ссылки в отношении фрагментов указанных документов, рассматриваемых в настоящем документе, а также в полном объеме.


Если не даны конкретные определения, то номенклатура, используемая в связи с методиками и приемами, а также сами методики и приемы аналитической химии, синтетической органической химии и медицинской и фармацевтической химии, описанные в настоящем документе, представляют собой те, которые хорошо известны и общеприняты в данной области техники. Для химического синтеза и химического анализа могут быть использованы стандартные методики. Где это допустимо, все патенты, заявки, опубликованные заявки и другие публикации, номера доступа GENBANK и связанная информация о последовательностях, которую можно получить из таких баз данных как Национальный центр биотехнологической информации (NCBI), а также другие данные, упомянутые в тексте настоящего описания, включены в настоящий документ путем ссылки в отношении фрагментов указанных документов, рассматриваемых в настоящем документе, а также в полном объеме.

Если не указано иное, то следующие термины имеют следующие значения:

«2'-O-метоксиэтил» (также 2'-МОЕ и 2'-O(СН2)2-ОСН3) относится к O-метокси-этиловой модификации в 2'-положении фуранозного кольца. Сахар с 2'-O-метоксиэтиловой модификацией представляет собой модифицированный сахар.

«2'-МОЕ нуклеозид» (также 2'-O-метоксиэтиловый нуклеозид) обозначает нуклеозид, содержащий 2'-МОЕ модифицированный сахарный фрагмент.

«2'-замещенный нуклеозид» обозначает нуклеозид, содержащий заместитель в 2'-положении фуранозильного кольца, отличный от Н или ОН. В некоторых вариантах реализации, 2'-замещенные нуклеозиды содержат нуклеозиды с бициклическими сахарными модификациями.

«3'-сайт-мишень» относится к нуклеотиду целевой нуклеиновой кислоты, который комплементарен к 3'-основному нуклеотиду конкретного антисмыслового соединения.

«5'-сайт-мишень» относится к нуклеотиду целевой нуклеиновой кислоты, который комплементарен к 5'-основному нуклеотиду конкретного антисмыслового соединения.

«5-метилцитозин» обозначает цитозин, модифицированный метильной группой, присоединенной в 5-положении. 5-метилцитозин представляет собой модифицированное нуклеооснование.

«Около» обозначает в пределах ±7% от значения. Например, если указано «соединения, по меньшей мере примерно на 70% ингибирующие HBV», подразумевается, что уровни HBV ингибированы в диапазоне от 63% до 77%.

«Приемлемый профиль безопасности» обозначает характеристику побочных эффектов, которая находится в пределах клинически допустимых пределов.

«Активное фармацевтическое средство» обозначает вещество или вещества в фармацевтической композиции, которые обеспечивают терапевтическое преимущество при введении пациенту. Например, в некоторых вариантах реализации, антисмысловый олигонуклеотид, направленный на HBV, представляет собой активное фармацевтическое средство.

«Активная область мишени» обозначает область мишени, на которую направлено одно или несколько активных антисмысловых соединений. «Активные антисмысловые соединения» обозначают антисмысловые соединения, которые снижают уровни целевой нуклеиновой кислоты или уровни белка.

«Острая инфекция гепатита В» возникает, если у пациента, на которого воздействовал вирус гепатита В, начали развиваться признаки и симптомы вирусного гепатита. Этот период времени, называемый инкубационным периодом, составляет около 90 дней, но может быть коротким, лишь 45 дней, или более продолжительным, до 6 месяцев. Для большинства людей эта инфекция вызывает слабый или умеренный дискомфорт, и проходит самостоятельно благодаря иммунной реакции организма, борющейся с вирусом. Однако у некоторых людей, особенно у людей с ослабленной иммунной системой, таких как пациенты, страдающие СПИДом, проходящие химиотерапию, принимающие иммуноподавляющие лекарства или принимающие стероиды, из-за острой инфекции HBV существуют серьезные проблемы, которые перерастают в более тяжелые состояния, такие как скоротечная печеночная недостаточность.

«Введенные одновременно» относится к совместному введению двух средств любым способом, при котором фармакологическое действие обоих средств проявляется у пациента одновременно. При одновременном введении не требуется, чтобы оба агенты были введены в одной фармацевтической композиции, в одной лекарственной форме или одним способом введения. Действие обоих средств не обязательно должно проявляться одновременно. Их действие должно лишь перекрываться в течение определенного периода времени, и оно не обязательно должно иметь одинаковую протяженность по времени.

«Введение» обозначает предоставление фармацевтического средства пациенту, и включает, но не ограничиваясь этим, введение медицинским специалистом или самостоятельное введение.

«Средство» обозначает активное вещество, которое может обеспечивать терапевтическое преимущество при введении животному. «Первое средство» обозначает терапевтическое соединение, описанное в настоящем документе. Например, первое средство может быть антисмысловым олигонуклеотид ом, направленным на HBV. «Второе средство» обозначает второе терапевтическое соединение, описанное в настоящем документе (например, второй антисмысловый олигонуклеотид, направленный на HBV) и/или не-HBV терапевтическое соединение.

«Улучшение» относится к уменьшению по меньшей мере одного показателя тяжести состояния или заболевания. Тяжесть показателей может быть определена субъективными или объективными оценками, известными специалистам в данной области.

«Животное» относится к человеку или животному, не являющемуся человеком, включая, но не ограничиваясь этим, мышей, крыс, кроликов, собак, котов, свиней и приматов, не являющихся человеком, включая, но не ограничиваясь этим, обезьян и шимпанзе.

«Антитело» относится к молекуле, которая характеризуется каким-либо специфическим взаимодействием с антителом, причем каждое антитело и антиген определены в отношении друг друга. Антитело может относиться к полной молекуле антигена или его фрагменту или области, такой как тяжелая цепь, легкая цепь, область Fab и область Fc.

«Антисмысловая активность» обозначает любую обнаруживаемую или измеримую активность, которая относится к гибридизации антисмыслового соединения с его целевой нуклеиновой кислотой. В некоторых вариантах реализации, антисмысловая активность представляет собой снижение количества или экспрессии целевой нуклеиновой кислоты или белка, кодируемого такой целевой нуклеиновой кислотой.

«Антисмысловое соединение» обозначает олигомерное соединение, способное подвергаться гибридизации с целевой нуклеиновой кислотой при помощи водородной связи. Примеры антисмысловых соединений включают одноцепочечные и двухцепочечные соединения, такие как антисмысловые олигонуклеотиды, миРНК, шкРНК, мноРНК, микроРНК и сателлитные повторы.

«Антисмысловое ингибирование» обозначает снижение уровней целевой нуклеиновой кислоты в присутствии антисмыслового соединения, комплементарного к целевой нуклеиновой кислоте по сравнению с уровнями целевой нуклеиновой кислоты в отсутствие антисмыслового соединения.

«Антисмысловые механизмы» представляют собой все механизмы, включающие гибридизацию соединения с целевой нуклеиновой кислотой, причем результат или эффект гибридизации заключается в целевом разрушении или целевой оккупации с сопутствующей остановкой клеточного механизма, включающего, например, транскрипцию или сплайсинг.

«Антисмысловый олигонуклеотид» обозначает одноцепочечный олигонуклеотид, имеющий последовательность нуклеооснований, которая допускает гибридизацию с соответствующей областью или сегментом целевой нуклеиновой кислоты.

«Основная комплементарность» относится к способности точного спаривания нуклеооснований антисмыслового олигонуклеотида с соответствующими нуклеооснованиями в целевой нуклеиновой кислоте (то есть гибридизации), и она опосредована водородным связыванием Уотсона-Крика, Хугстина или обратным водородным связыванием Хугстина между соответствующими нуклеооснованиями.

«Бициклический сахар» обозначает фуранозное кольцо, модифицированное мостиковым присоединением двух не геминальных атомов углерода. Бициклический сахар представляет собой модифицированный сахар.

«Вес тела» относится к полному весу тела животного, включая все ткани, в том числе жировую ткань.

«Кэп-структура» или «концевой кэп-фрагмент» обозначает химические модификации, которые были внедрены в любой конец антисмыслового соединения.

«cEt» или «затрудненный этил» обозначает бициклический сахарный фрагмент, включающий мостик, соединяющий 4'-углерод и 2'-углерод, причем указанный мостик имеет формулу: 4'-СН(СН3)-O-2'.

«Затрудненный этилнуклеозид» (также cEt нуклеозид) обозначает нуклеозид, включающий бициклический сахарный фрагмент, содержащий мостик 4'-СН(СН3)-O-2'.

«Химически отличная область» относится к области антисмыслового соединения, которая каким-либо образом химически отличается от другой области того же антисмыслового соединения. Например, область, имеющая 2'-O-метоксиэтил нуклеотиды является химически отличной от области, имеющей нуклеотиды с 2'-O-метоксиэтиловыми модификациями.

«Химерные антисмысловые соединения» обозначает антисмысловые соединения, которые имеют по меньшей мере 2 химически отличных области, каждое положение имеет множество субъединиц.

«Хроническая инфекция гепатита В» возникает, если субъект, который изначально страдал острой инфекцией, впоследствии не поборол эту инфекцию. Станет ли заболевание хроническим или будет полностью излечено, - зависит, в основном, от возраста инфицированного субъекта. Хроническое заболевание развивается примерно у 90% детей, инфицированных при рождении. Однако, по мере взросления субъекта, риск хронической инфекции снижается, и острая инфекция перерастает в хроническую у 20%-50% детей и менее 10% подростков и взрослых. Хронические инфекции HBV представляют собой основную лечебную цель для вариантов реализации настоящего изобретения, хотя композиции антисмысловых нуклеотидов (ASO) настоящего изобретения также могут лечить связанные с HBV состояния, такие как воспаление, фиброз, цирроз, рак печени, серозный гепатит и другие.

«Совместное введение» обозначает введение пациенту двух или более фармацевтических средств. Два или более фармацевтических средств могут быть в одной фармацевтической композиции или могут быть в отдельных фармацевтических композициях. Каждый из двух или более фармацевтических средств может вводиться таким же или другим способом введения. Совместное введение включает параллельное или последовательное введение.

«Комплементарность» обозначает способность спаривания между нуклеооснованиями первой нуклеиновой кислоты и второй нуклеиновой кислоты.

«Выполнение» обозначает соблюдение пациентом рекомендованного лечения.

«Включают», «включает» и «включающий» следует понимать как предполагающие включение указанной стадии или элемента, или группы стадий или элементов, но не как исключение какой-либо другой стадии или элемента, или группы стадий или элементов.

«Смежные нуклеооснования» обозначает нуклеооснования, расположенные непосредственно рядом друг с другом.

«Курс лечения» обозначает способ или курс, который восстанавливает здоровье или представляет собой предписанное лечение определенной болезни.

«Дезоксирибонуклеотид» обозначает нуклеотид, имеющий водород в 2' положении сахарной части нуклеотида. Дезоксирибонуклеотиды могут быть модифицированы любым из множества заместителей.

«Разработан» или «разработан для» относится к процессу разработки олигомерного соединения, которое специфически гибридизуется с определенной молекулой нуклеиновой кислоты.

«Разбавитель» обозначает ингредиент в композиции, которые не обладает фармакологической активностью, но является фармацевтически необходимым или желательным. Например, в лекарствах для инъекций разбавитель может быть жидкостью, например, солевым раствором.

«Лекарственная форма» обозначает форму, в которой представлено фармацевтическое средство, например, пилюля, таблетка или другая лекарственная форма, известная в данной облатти техники.

«Доза» обозначает определенное количество фармацевтического средства, которое обеспечивается при разовом введении или в течение определенного периода времени. В некоторых вариантах реализации, доза может быть введена двумя или более болюсами, таблетками или инъекциями. Например, в некоторых вариантах реализации, если необходимо подкожное введение, то для заданной дозы необходим объем, который не может быть обеспечен одной инъекцией. В таких вариантах реализации для достижения заданной дозы может быть использовано две или более инъекций. В некоторых вариантах реализации доза может быть введена двумя или более инъекциями для минимизации реакции пациента в точке инъекции. В других вариантах реализации, фармацевтическое средство вводят инфузией в течение продолжительного периода времени или непрерывно. Дозы могут быть определены как количество фармацевтического средства в час, день, неделю или месяц.

«Режим дозирования» представляет собой комбинацию доз, предназначенную для достижения одного или нескольких заданных эффектов.

«Продолжительность» обозначает период времени, в течение которого продолжается определенная активность или событие. В некоторых вариантах реализации продолжительность лечения представляет собой период времени, в течение которого вводят дозы фармацевтического средства.

«Эффективное количество» в контексте модулирования активности или лечения, или предупреждения состояния, обозначает введение такого количества активного ингредиента пациенту, нуждающемуся в таком модулировании, лечении или профилактике, как в однократной дозе, так и в составе серии доз, которое является эффективным для модулирования указанного эффекта, или для лечения, или для профилактики, или для улучшения указанного состояния. Эффективное количество может варьироваться в зависимости от состояния здоровья и физического состояния пациента, подлежащего лечению, таксономической группы пациентов, подлежащих лечению, состава композиции, оценки медико-санитарной обстановки и других релевантных факторов.

«Эффективность» обозначает способность вызывать заданный эффект.

«Экспрессия» включает все функции, при помощи которых кодированная геном информация превращается в структуры, существующие и функционирующие в клетке. Такие структуры включают, но не ограничиваясь этим, продукты транскрипции и трансляции.

«Полная комплементарность» или «100% комплементаность» обозначает, что каждое нуклеооснование первой нуклеиновой кислоты имеет комплементарное нуклеооснование во второй нуклеиновой кислоте. В некоторых вариантах реализации, первая нуклеиновая кислота представляет собой антисмысловое соединение, а целевая нуклеиновая кислота представляет собой вторую нуклеиновую кислоту.

«Полностью модифицированный мотив» относится к антисмысловому соединению, включающему смежную последовательность нуклеозидов, причем практически каждый нуклеозид представляет собой нуклеозид с модифицированным сахаром, имеющий однообразную модификацию.

«Химерный олигонуклеотид» обозначает химерное антисмысловое соединение, в котором внутренняя область, имеющая множество нуклеозидов, которые поддерживают Н расщепление РНазы, расположена между внешними областями, имеющими один или несколько нуклеозидов, причем нуклеозиды, включающие внутреннюю область, являются химически отличными от нуклеозида или нуклеозидов, составляющих внешние области. Внутренняя область может быть упомянута как «гэп», а внешние области могут быть упомянуты как «крылья».

«С увеличенным гэп» обозначает антисмысловое соединение, имеющее сегмент гэп из 12 или более смежных 2'-дезоксирибонуклеотидов, расположенных между 5' и 3' сегментами крыльев, имеющими от одного до шести нуклеотидов с фрагментами модифицированного сахара.

«HBV» обозначает вирус гепатита В млекопитающих, включая вирус гепатита В человека. Этот термин охватывает географические генотипы вируса гепатита В, в частности, вирус гепатита В человека, а также различные штаммы географических генотипов вируса гепатита В.

«Антиген HBV» обозначает любой антиген или белок вируса гепатита В, включая ядерный белок, такой как «ядерный антиген гепатита В» или «HBcAG» и «антиген Е гепатита В», или «HBeAG» и белки оболочки, такие как «поверхностный антиген HBV» или «HBsAg», или «HBsAG».

«Антиген Е гепатита В» или «HBeAg», или «HBeAG» представляет собой секретируемую, нечастичную форму ядерного белка HBV. Антигены HBV HBeAg и HBeAg имеют общие первичные аминокислотные последовательности, поэтому демонстрируют перекрестную активность на Т-клеточном уровне. HBeAg не является необходимым для вирусной сборки или репликации, хотя исследования позволяют предположить, что они могут быть необходимы для создания хронической инфекции. Неонатальное инфицирование HBeAg-негативным мутантом зачастую приводит к моментальному возникновению острой, а не хронической инфекции HBV (Terezawa et al. (1991) Pediatr. Res. 29:5), тогда как инфицирование молодых североамериканских лесных сурков WHeAg-негативным мутантом приводит к гораздо более низкому уровню хронической инфекции WHV (Cote et al. (2000) Hepatology 31:190). HBeAg может потенциально действовать как толераген путем инактивации сердцевинных специфических Т-клеток за счет удаления или клональной анэргии (Milich et al. (1998) J. Immunol. 160:8102). Существует положительная корреляция между снижением вирусной нагрузки и антигенов HBV и снижением экспрессии Т-клетками ингибирующего рецептора, программирующего гибель, 1 (PD-1, известного также как PDCD1), отрицательного регулятора активированных Т-клеток, при противовирусной терапии и сероконверсии HbeAg(Evans et al. (2008) Hepatology 48:759).

«мРНК HBV» обозначает любую матричную РНК, экспрессируемую вирусом гепатита В.

«Нуклеиновая кислота HBV» или «ДНК HBV» обозначает любую нуклеиновую кислоту, кодирующую HBV. Например, в некоторых вариантах реализации, нуклеиновая кислота HBV включает, без ограничения, любую последовательность ДНК вируса, кодирующую геном HBV или его часть, любую последовательность РНК, транскрибируемую из вирусной ДНК, включая любую последовательность мРНК, кодирующую белок HBV.

«Белок HBV» обозначает любой белок, секретируемый вирусом гепатита В. Этот термин охватыват различные антигены HBV, включая ядерные белки, такие как «антиген Е гепатита», «HBeAg», или «HBeAG» и оболочечные белки, такие как «поверхностный антиген HBV» или «HBsAg».

«Поверхностный антиген HBV» или «HBsAg», или «HBsAG» представляет собой оболочечный белок инфекционных вирусных частиц HBV, но он также секретируется как неинфекционная частица с содержанием в сыворотке в 1000 раз выше, чем вирусные частицы HBV. Уровни HBsAg в сыворотке инфицированного человека или животного могут достигать 1000 мкг/мл (Kann and Gehrlich (1998) Topley & Wilson’s Microbiology and Microbial Infections, 9th ed. 745). При острых инфекциях HBV, период полувыведения HBsAg из сыворотки, или t½, составляет 8,3 дня (Chulanov et al. (2003) J. Med. Virol. 69: 313). Интернализация HBsAg миелоидными дендритными клетками ингибирует повышующую регуляцию со-стимулирующих молекул (то есть В7) и ингибирует стимулирующую способность Т-клеток (den Brouw et al. (2008) Immunology 126:280), и дендритные клетки хронически инфицированных пациентов также демонстрируют недостаток экспрессии со-стимулирующих молекул, секреции IL-12 и стимуляции Т-клеток в присутствии HBsAg (Zheng et al. (2004) J. Viral Hepatitis 11:217). HBsAg-специфичные клетки CD8 пациентов с СНВ демонстрируют измененное тетрамерное связывание. Эти клетки CD8 не являются анэргическими, но они могут обладать топологией TCR, которая обусловливает частичную переносимость или невосприимчивость (Reignat et al. (2002) J. Exp. Med. 195:1089). Более того, снижение HBsAg в сыворотке >1 log на 24 неделе имеет высокое предиктивное значение (92%) для устойчивой вирологической реакции (SVR - определяется как не обнаруживаемая ДНК HBV по ПЦР через 1 год после лечения) в ходе Peg-IFNα2a терапии (Moucari et al. (2009) Hepatology 49:1151).

«Состояние, связанное с гепатитом В» или «HBV-связанное состояние» обозначает любое заболевание, биологическое состояние, медицинское состояние или событие, которое обострено, обусловлено, связано, имеет отношение или приписано к инфекции, воздействию или болезни гепатита В. Термин «состояние, связанное с гепатитом В» включает хроническую инфекцию HBV, воспаление, фиброз, цирроз, рак печени, серозный гепатит, желтуху, рак печени, воспаление печени, фиброз печени, цирроз печени, печеночную недостаточность, диффузное гепатоцеллюляное воспалительное заболевание, гемофагоцитарный синдром, серозный гепатит, виремию HBV, заболевание печени, связанное с трансплантацией, и состояния, имеющие симптомы, которые могут включать любой или все из следующих: болезнь, похожую на грипп, слабость, боли, головную боль, жар, потерю аппетита, диарею, тошноту и рвоту, боль в области печени, стул земляного или серого цвета, зуд по всему телу и мочу темного цвета, в сочетании с положительным тестом на присутствие вируса гепатита В, вирусного антигена гепатита В или положительным тестом на присутствие антитела, специфичного к вирусному антигену гепатита В.

«Гибридизация» обозначает гибридизацию молекул комплементарных нуклеиновых кислот. В некоторых вариантах реализации, молекулы комплементарных нуклеиновых кислот включают, но не ограничиваясь этим, антисмысловое соединение и целевую нуклеиновую кислоту. В некоторых вариантах реализации, молекулы комплементарных нуклеиновых кислот включают, но не ограничиваясь этим, антисмысловый олигонуклеотид и целевую нуклеиновую кислоту.

«Идентификация животного, имеющего инфекцию HBV» обозначает определение животного, у которого диагностирован HBV; или определение животного, имеющего любой симптом инфекции HBV, включая, но не ограничиваясь этим, хроническую инфекцию HBV, воспаление, фиброз, цирроз, рак печени, серозный гепатит, желтуху, рак печени, воспаление печени, фиброз печени, цирроз печени, печеночную недостаточность, диффузное гепатоцеллюлярное воспалительное заболевание, гемофагоцитарный синдром, серозный гепатит, виремию HBV, заболевание печени, связанное с трансплантацией, и состояния, имеющие симптомы, которые могут включать любой или все из следующих: болезнь, похожую на грипп, слабость, боли, головную боль, жар, потерю аппетита, диарею, тошноту и рвоту, боль в области печени, стул земляного или серого цвета, зуд по всему телу и мочу темного цвета, в сочетании с положительным тестом на присутствие вируса гепатита В, вирусного антигена гепатита В или положительным тестом на присутствие антитела, специфичного к вирусному антигену гепатита В, в сочетании с положительным тестом на присутствие вируса гепатита В, вирусного антигена гепатита В или положительным тестом на присутствие антитела, специфичного к вирусному антигену гепатита В.

«Непосредственно смежные» обозначает отсутствие промежуточных элементов между непосредственно смежными элементами.

«Пациент» обозначает человека или животного, не являющегося человеком, выбранного для лечения или терапии.

«Выполнение пациентом» обозначает соблюдение пациентом рекомендованного или предписанного лечения.

«Вызывает», «ингибирует», «потенцирует», «повышает», «увеличивает», «снижает» и тому подобные, обычно обозначают количественные различия между двумя состояниями. Такие термины могут относиться к статистически значимому различию между двумя состояниями. Например, «количество, эффективное для ингибирования активности или экспрессии HBV», обозначает, что уровень активности или экспрессии HBV в обработанном образце количественно отличается, и может быть статистически значимым, от уровня активности или экспрессии HBV в необработанных клетках. Такие термины применяют, например, к уровням экспрессии и уровням активности.

«Ингибирование HBV» обозначает снижение уровня экспрессии мРНК, ДНК и/или белка HBV. В некоторых вариантах реализации, HBV ингибируют в присутствии антисмыслового соединения, направленного на HBV, включая антисмысловый олигонуклеотид, направленный на HBV, по сравнению с уровнями экспрессии мРНК, ДНК и/или белка HBV в отсутствие HBV антисмыслового соединения, такого как антисмысловый олигонуклеотид.

«Ингибирование экспрессии или активности» относится к снижению, блокированию экспрессии или активности и не обязательно обозначает полное исключение экспрессии или активности.

«Реакция в точке инъекции» обозначает воспаление или аномальное покраснение кожи пациента в месте инъекции.

«Межнуклеозидная связь» относится к химической связи между нуклеозидами.

«Внутрибрюшинное введение» обозначает введение в брюшину инфузией или инъекцией.

«Внутривенное введение» обозначает введение в вену.

«Удлиненные» антисмысловые олигонуклеотиды представляют собой те, которые имеют один или несколько дополнительных нуклеозидов по сравнению с антисмысловым олигонуклеотидом, описанным в настоящем документе.

«Связанный дезоксинуклеозид» обозначает основание нуклеиновой кислоты (A, G, С, Т, U), замещенное дезоксирибозой, связанной фосфатным эфиром с образованием нуклеотида.

«Связанные нуклеозиды» обозначает соседние нуклеозиды, связанные вместе межнуклеозидной связью.

«Блокированная нуклеиновая кислота» или «БНК», или «БЫК нуклеозиды» обозначает мономеры нуклеиновых кислот, имеющие мостиковое соединение двух атомов углеродов между положением 4' и 2' нуклеозидного сахарного звена, с образованием посредством этого бициклического сахара. Примеры такого бициклического сахара включают, но не ограничиваясь этим, А) α-L-метиленокси (4'-СН2-O-2') БНК, (В) β-D-метиленокси (4'-СН2-O-2') БНК, (С) этиленокси (4'-(СН2)2-O-2') БНК, (D) аминоокси (4'-CH2-O-N(R)-2') БНК и (Е) оксиамино (4'-CH2-N(R)-O-2') БНК, как показано ниже.

При использовании в настоящем документе, БНК соединения включают, но не ограничиваясь этим, соединения, имеющие по меньшей мере один мостик между положением 4' и 2' сахара, причем каждый из мостиков независимо включает 1 или от 2 до 4 связанных групп, независимо выбранных из -[C(R1)(R2)]n-, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O)x- и -N(R1)-; причем: х равен 0, 1 или 2; n равен 1, 2, 3 или 4; каждый R1 и R2 независимо представляет собой Н, защитную группу, гидроксил, C1-C12 алкил, замещенный C112 алкил, C2-C12 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C5-C20 арил, замещенный C5-C20 арил, гетероциклический радикал, замещенный гетероциклический радикал, гетероарил, замещенный гетероарил, Cs-C-j алициклический радикал, замещенный C5-C7 алициклический радикал, галоген, OJ1, NJ1J2, SJ1, N3, COOJ1, ацил (С(=O)-Н), замещенный ацил, CN, сульфонил (S(=O)2-J1), или сульфоксил (S(=O)-J1); и каждый Ji и J2 независимо представляет собой Н, C1-C12 алкил, замещенный C1-C12 алкил, C2-C12 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, С520 арил, замещенный C5-C20 арил, ацил (С(=O)-Н), замещенный ацил, гетероциклический радикал, замещенный гетероциклический радикал, C1-C12 аминоалкил, замещенный C112 аминоалкил или защитную группу.

Примеры 4'-2' мостиковых групп, входящих в определение БНК, включают, но не ограничиваясь этим, группы формул: -[C(R1)(R2)]n-, -[C(R1)(R2)]n-O-, -C(R1R2)-N(R1)-O- или -C(R1R2)-O-N(R1)-. Более того, другие группы, входящие в определение БНК, представляют собой 4'-СН2-2', 4'-(СН2)2-2', 4'-(СН2)3-2', 4'-СН2-O-2', 4'-(СН2)2-O-2', 4'-CH2-O-N(R1)-2' и 4'-CH2-N(R1)-O-2'- мостики, причем каждый R1 и R2 независимо представляет собой Н, защитную группу или С112 алкил.

Также в определение БНК по настоящему изобретению включены БНК, в которых 2'-гидроксильная группа рибозильного сахарного кольца связана с 4' углеродным атомом сахарного кольца с образованием посредством этого метиленокси (4'-СН2-O-2') мостика для получения бициклического сахарного фрагмента. Мостик также может быть метиленовой (-СН2-) группой, соединяющей 2' кислородный атом и 4' углеродный атом, для которой используют термин метиленокси (4'-СН2-O-2') БНК. Более того, в случае бициклического сахарного фрагмента, имеющего этиленовую мостиковую группу в этом положении, используют термин этиленокси (4'-СН2СН2-O-2') БНК. a-L-метиленокси (4'-СН2-O-2'), изомер метиленокси (4'-СН2-O-2') БНК, также входит в определение БНК, используемое в настоящем документе.

«Не совпадающий» или «не комплементарный нуклеозид» относится к случаю, когда нуклеооснование первой нуклеиновой кислоты не может спариваться с соответствующим нуклеооснованием второй или целевой нуклеиновой кислоты.

«Модифицированная межнуклеозидная связь» относится к замещению или любому изменению природной межнуклеозидной связи (то есть фосфодиэфирной межнуклеозидной связи).

«Модифицированное нуклеооснование» обозначает нуклеооснование, отличное от аденина, цитозина, гуанина, тимидина или урацила. «Не модифицированное нуклеооснование» обозначает пуриновые основания аденин (А) и гуанин (G), а также пиримидиновые основания тимин (Т), цитозин (С) и урацил (U).

«Модифицированный нуклеозид» обозначает нуклеозид, имеющий, независимо, модифицированный сахарный фрагмент и/или модифицированное нуклеооснование.

«Модифицированный нуклеотид» обозначает нуклеотид, имеющий, независимо, модифицированный сахарный фрагмент, модифицированную межнуклеозидную связь или модифицированное нуклеооснование.

«Модифицированный олигонуклеотид» обозначает олигонуклеотид, включающий по меньшей мере одну модифицированную межнуклеозидную связь, модифицированный сахар и/или модифицированное нуклеооснование.

«Модифицированный сахар» обозначает замещение и/или любое изменение природного сахарного фрагмента.

«Мономер» относится к одному звену олигомера. Мономеры включают, но не ограничиваясь этим, нуклеозиды и нуклеотиды, будь то природные или модифицированные.

«Мотив» обозначает схему не модифицированных и модифицированных нуклеозидов в антисмысловом соединении.

«Природный сахарный фрагмент» обозначает сахарный фрагмент, который находится в ДНК (2'-Н) или РНК (2'-ОН).

«Природная межнуклеозидная связь» обозначает 3'-5' фосфодиэфирную связь.

«Некомплементарное нуклеооснование» относится к паре нуклеооснований, которые не образуют водородные связи друг с другом или иным образом не поддерживают гибридизацию.

«Нуклеиновая кислота» относится к молекулам, состоящим из мономерных нуклеотидов. Нуклеиновая кислота включает, но не ограничиваясь этим, рибонуклеиновые кислоты (РНК), дезоксирибонуклеиновые кислоты (ДНК), одноцепочечные нуклеиновые кислоты, двухцепочечные нуклеиновые кислоты, малые интерферирующие рибонуклеиновые кислоты (миРНК) и микроРНК (микроРНК).

«Нуклеооснование» обозначает гетероциклический фрагмент, способный спариваться с основанием другой нуклеиновой кислоты.

«Комплементарность нуклеооснования» относится к нуклеооснованию, которое способно к спариванию с другим нуклеооснованием. Например, аденин (А) в ДНК комплементарен тимину (Т). Например, аденин (А) в РНК комплементарен урацилу (U). В некоторых вариантах реализации комплементарное нуклеооснование относится к нуклеооснованию антисмыслового соединения, которое способно к спариванию с нуклеооснованием его целевой нуклеиновой кислоты. Например, если нуклеооснование в определенном положении антисмыслового соединения способно к водородному связыванию с нуклеооснованием в определенном положении целевой нуклеиновой кислоты, то это положение водородного связывания между указанным олигонуклеотидом и целевой нуклеиновой кислоты считают комплементарным по этой паре нуклеооснований.

«Последовательность нуклеооснований» обозначает порядок смежных нуклеооснований, независимый от какого-либо сахара, связи и/или модификации нуклеооснования.

«Нуклеозид» обозначает нуклеооснование, связанное с сахаром.

«Нуклеозид-миметик» включает такие структуры, используемые для замены сахара или сахара и основания, и необязательно связи в одном или нескольких положениях олигомерного соединения, как, например, нуклеозид-миметики, имеющие морфолино, циклогексенил, циклогексил, тетрагидропиранил, бицикло или трицикло-сахарные заменители, например, не фуранозные сахарные звенья. Нуклеотид-миметик включает такие структуры, используемые для замены нуклеозида и связи в одном или нескольких положениях олигомерного соединения, как, например, пептидные нуклеиновые кислоты или морфолиновые соединения (морфолиновые соединения, связанные при помощи -N(H)-C(=O)-O- или другой не фосфодиэфирной связи). Заменитель сахара пересекается с несколько более широким термином нуклеозид-миметика, но он предназначен для указания замены только сахарного звена (фуранозного кольца). Тетрагидропираниловые кольца, представленные в настоящем документе, являются иллюстративными для примера заменителя сахара, в котором группа фуранозного сахара заменена тетрагидропираниловой кольцевой системой. «Миметик» относится к группам, которые являются заменой для сахара, нуклеооснования и/или межнуклеозидной связи. Как правило, миметик используют вместо сахара или комбинации сахара и межнуклеозидной связи, а нуклеооснование сохраняется для гибридизации с выбранной мишенью.

«Нуклеотид» обозначает нуклеозид, имеющий фосфатную группу, ковалентно связанную с сахарной частью нуклеозида.

«Нецелевое действие» относится к нежелательному или пагубному биологическому действию, связанному с модулированием экспрессии РНК или белка гена, отличного от целевой нуклеиновой кислоты.

«Олигомерное соединение» обозначает полимер связанных мономерных субъединиц, который способен гибридизоваться по меньшей мере с какой-либо областью молекулы нуклеиновой кислоты.

«Олигонуклеозид» обозначает олигонуклеотид, в котором межнуклеозидные связи не содержат атом фосфора.

«Олигонуклеотид» обозначает полимер связанных нуклеозидов, каждый из которых может быть модифицированным или не модифицированным, не зависимо друг от друга.

«Парентеральное введение» обозначает введение инъекцией (например, болюсной инъекцией) или инфузией. Парентеральное введение включает подкожное введение, внутривенное введение, внутримышечное введение, внутриартериальное введение, внутрибрюшинное введение или внутричерепное введение, например, интратекальное или интрацеребровентрикулярное введение.

«Пептид» обозначает молекулу, образованную связыванием по меньшей мере двух аминокислот амидными связями. Без ограничения, при использовании в настоящем документе, «пептид» относится к полипептидам и белкам.

«Фармацевтически приемлемый носитель» обозначает среду или разбавитель, который не взаимодействует со структурой олигонуклеотида. Некоторые такие носители обеспечивают возможность составления фармацевтических композиций, таких как, например, таблетки, пилюли, драже, капсулы, жидкости, гели, сиропы, взвеси, суспензии и пастилки для перорального приема пациентом.

«Фармацевтически приемлемое производное» охватывает фармацевтически приемлемые соли, конъюгаты, пролекарства или изомеры соединений, описанных в настоящем документе.

«Фармацевтически приемлемые соли» обозначает физиологически и фармацевтически приемлемые соли антисмысловых соединений, то есть соли, которые сохраняют заданную биологическую активность исходного олигонуклеотида и не наделяют его нежелательным токсикологическим действием.

«Фармацевтическое средство» обозначает вещество, которое обеспечивает терапевтическое преимущество при введении пациенту. Например, в некоторых вариантах реализации, антисмысловый олигонуклеотид, направленный на HBV, представляет собой фармацевтическое средство.

«Фармацевтическая композиция» обозначает смесь веществ, пригодную для введения субъекту. Например, фармацевтическая композиция может включать антисмысловый олигонуклеотид и стерильный водный раствор. В некоторых вариантах реализации фармацевтическая композиция демонстрирует активность в анализе свободного поглощения в некоторых клеточных линиях.

«Фосфотиоатная связь» обозначает связь между нуклеозидами, где фосфодиэфирная связь модифицирована заменой одного из не мостиковых атомов кислорода атомом серы. Фосфотиоатная связь представляет собой модифицированную межнуклеозидную связь.

«Часть» обозначает определенное количество смежных (то есть связанных) нуклеооснований нуклеиновой кислоты. В некоторых вариантах реализации, часть является определенным количеством смежных нуклеооснований целевой нуклеиновой кислоты. В некоторых вариантах реализации, часть является определенным количеством смежных нуклеооснований антисмыслового соединения.

«Предупреждение» или «профилактика» относится к отсрочке или предотвращению возникновения или развития состояния или заболевания в течение периода времени от часов до дней, предпочтительно от недель до месяцев.

«Пролекарство» обозначает терапевтическое средство, которое готовят в неактивной форме, которая превращается в активную форму (то есть лекарство) внутри организма или его клеток под действием эндогенных ферментов или других химических веществ и/или условий.

«Профилактически эффективное количество» относится к количеству фармацевтического средства, которое обеспечивает профилактическое или превентивное преимущество для животного.

«Рекомендованная терапия» обозначает лечебную схему, рекомендованную медицинским специалистом для лечения, улучшения или предупреждения заболевания.

«Область» определяют как часть целевой нуклеиновой кислоты, имеющую по меньшей мере одну идентифицируемую структуру, функцию или характеристику.

«Рибонуклеотид» обозначает нуклеотид, имеющий гидрокси-группу в 2' положении сахарной части нуклеотида. Рибонуклеотиды могут быть модифицированы любым из множества заместителей.

«Соли» обозначают физиологически и фармацевтически приемлемые соли антисмысловых соединений, то есть соли, которые сохраняют заданную биологическую активность исходного олигонуклеотида и не наделяют его нежелательным токсикологическим действием.

«Сегменты» определяют как более мелкие или субфрагменты областей целевой нуклеиновой кислоты.

«Сероконверсию» определяют как отсутствие HBeAg в сыворотке плюс присутствие HBeAb в сыворотке, в случае мониторинга HBeAg как определителя сероконверсии, или определяют как отсутствие HBsAg в сыворотке, в случае мониторинга HBsAg как определителя сероконверсии, по результатам определения доступных в настоящее время пределов обнаружения коммерческих систем иммуноферментного твердофазного анализа (ELISA).

«Укороченные» или «усеченные» версии антисмысловых олигонуклеотидов, представленных в настоящем документе, имеют один, два или более удаленных нуклеозидов.

«Побочные эффекты» обозначает физиологические реакции, приписываемые лечению, которые отличны от заданного действия. В некоторых вариантах реализации, побочные эффекты включают, без ограничения, реакции в точке инъекции, аномалии при испытании функции печени, аномалии функции почек, печеночную токсичность, почечную токсичность, аномалии центральной нервной системы и миопатии. Например, повышенные уровни аминотрансферазы в сыворотке могут указывать на печеночную токсичность или аномалию функции печени. Например, повышенный билирубин может указывать на печеночную токсичность или аномалию функции печени.

«Существенный», при использовании в настоящем документе, обозначает измеримый или наблюдаемый, например, существенный результат, такой как существенное улучшение или существенное снижение, как правило, относится к измеримому или наблюдаемому результату, такому как измеримое или наблюдаемое улучшение или снижение.

«Сайты», при использовании в настоящем документе, определяют как уникальные положения нуклеооснований в целевой нуклеиновой кислоте.

«Замедляет прогрессирование» обозначает уменьшение развития указанного заболевания.

«Может специфически гибридизоваться» относится к антисмысловому соединению, имеющему достаточную степень комплементарности между антисмысловым олигонуклеотидом и целевой нуклеиновой кислотой для инициации заданного эффекта, одновременно демонстрирующему минимальное влияние или отсутствие влияния на нецелевые нуклеиновые кислоты в условиях, в которых необходимо специфическое связывание, то есть при физиологических условиях в случае анализов in vivo и при терапевтическом лечении. «Строгие условия гибридизации» или «строгие условия» относятся к условиям, в которых олигомерное соединение гибридизуется с его целевой последовательностью, но с минимальным количеством других последовательностей.

«Статистически значимый», при использовании в настоящем документе, обозначает измеримый или наблюдаемый параметр, который маловероятно является случайным результатом.

«Подкожное введение» обозначает введение непосредственно под кожу.

«Субъект» обозначает человека или животного, не являющегося человеком, выбранного для лечения или терапии.

«Мишень» относится к белку, модулирование которого задано. «Целевой ген» относится к гену, кодирующему мишень.

«Таргетинг» обозначает процесс разработки и выбора антисмыслового соединения, которое будет специфически гибридизоваться с целевой нуклеиновой кислотой и вызывать заданный эффект.

«Целевая нуклеиновая кислота», «целевая РНК», «целевой РНК транскрипт» и «мишень нуклеиновой кислоты», все эти термины обозначают нуклеиновую кислоту, на которую могут быть нацелены антисмысловые соединения.

«Целевая область» обозначает часть целевой нуклеиновой кислоты, на которую направлено одно или несколько антисмысловых соединений.

«Целевой сегмент» обозначает последовательность нуклеотидов целевой нуклеиновой кислоты, на которую направлено антисмысловое соединение. «Сайт-мишень 5'» относится к 5'-основному нуклеотиду целевого сегмента. «Сайт-мишень 3'» относится к 3'-основному нуклеотиду целевого сегмента.

«Терапевтически эффективное количество» обозначает количество фармацевтического средства, которое обеспечивает пациенту терапевтическое преимущество.

«Лечение» относится к введению композиции для изменения или улучшения заболевания или состояния.

«Не модифицированные» нуклеооснования обозначают пуриновые основания аденин (А) и гуанин (G), а также пиримидиновые основания тимин (Т), цитозин (С) и урацил (U).

«Не модифицированный нуклеотид» обозначает нуклеотид, состоящий из природных нуклеооснований, сахарных фрагментов и межнуклеозидных связей. В некоторых вариантах реализации не модифицированный нуклеотид представляет собой нуклеотид РНК (то есть β-D-рибонуклеозиды) или нуклеотид ДНК (то есть β-D-дезоксирибонуклеозид).

«Валидированный целевой сегмент» определяют как часть целевой области, состоящую по меньшей мере из 8 нуклеооснований (то есть 8 смежных нуклеооснований), на которую направлено активное олигомерное соединение.

«Сегмент крыла» обозначает множество нуклеозидов, модифицированных для влияния на свойства олигонуклеотида, такие как усиленная ингибирующая активность, повышенная связывающая аффиность к целевой нуклеиновой кислоте или устойчивость к разложению нуклеазами in vivo.

Некоторые варианты реализации

В некоторых вариантах реализации представлены способы, соединения и композиции для ингибирования экспрессии мРНК HBV.

В некоторых вариантах реализации представлены антисмысловые соединения, нацеленные на нуклеиновую кислоту HBV. В некоторых вариантах реализации нуклеиновая кислота HBV является последовательностями, представленными далее под номером доступа GENBANK U95551.1 (включена в настоящий документ как SEQ ID NO:1).

В некоторых вариантах реализации, соединения, представленные в настоящем документе, представляют собой или включают модифицированный олигонуклеотид. В некоторых вариантах реализации эти соединения включают модифицированный олигонуклеотид и конъюгат, описанный в настоящем документе. В некоторых вариантах реализации, модифицированный олигонуклеотид представляет собой фармацевтически приемлемое производное.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид длиной от 10 до 30 связанных нуклеооснований, нацеленный на HBV. Мишень HBV может иметь последовательность, указанную в SEQ ID NO:1, или ее часть, или ее вариант.

В некоторых вариантах реализации, соединения или модифицированные олигонуклеотиды, представленные в настоящем документе, имеют длину от 10 до 30 связанных нуклеооснований, и нацелены на HBV. В некоторых вариантах реализации, мишень HBV имеет последовательность, указанную в SEQ ID NO:1. В некоторых вариантах реализации, такие соединения или олигонуклеотиды нацелены на одну из следующих нуклеотидных областей HBV: CCTGCTGGTGGCTCCAGTTC (SEQ ID NO:1273); AGAGTCTAGACTCGTGGTGGACTTCTCTCA (SEQ ID NO:1354); CATCCTGCTGCTATGCCTCATCTTCTT (SEQ ID NO:1276); CAAGGTATGTTGCCCGT (SEQ ID NO:1277); CCTATGGGAGTGGGCCTCAG (SEQ ID NO:1279; TGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCG (SEQ ID NO:1287); TATATGGATGATGTGGT (SEQ ID NO:1359); TGCCAAGTGTTTGCTGA (SEQ ID NO:1360); TGCCGATCCATACTGCGGAACTCCT (SEQ ID NO:1361); CCGTGTGCACTTCGCTTCACCTCTGCACGT (SEQ ID NO:1352); GGAGGCTGTAGGCATAAATTGGT (SEQ ID NO:1353); CTTTTTCACCTCTGCCTA (SEQ ID NO:1362); TTCAAGCCTCCAAGCTGTGCCTTGG (SEQ ID NO:1363); AGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGG (SEQ ID NO:1274); TGGATGTGTCTGCGGCGTTTTATCAT (SEQ ID NO:1275); TGTATTCCCATCCCATC (SEQ ID NO:1278); TGGCTCAGTTTACTAGTGC (SEQ ID NO:1280); GGGCTTTCCCCCACTGT (SEQ ID NO:1281); TCCTCTGCCGATCCATACTGCGGAACTCCT (SEQ ID NO:1282); CGCACCTCTCTTTACGCGG (SEQ ID NO:1283); GGAGTGTGGATTCGCAC (SEQ ID NO:1284); или GAAGAAGAACTCCCTCGCCT (SEQ ID NO:1285). В некоторых вариантах реализации, такие соединения или олигонуклеотиды имеют сегмент гэп из 9, 10 или более связанных дезоксинуклеозидов. В некоторых вариантах реализации, такие соединения или олигонуклеотиды имеют сегмент гэп из 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 или 16 связанных нуклеозидов. В некоторых вариантах реализации, такой сегмент гэп находится между двумя сегментами крыльев, которые независимо имеют 1, 2, 3, 4, 5, 6, 7 или 8 связанных модифицированных нуклеозидов. В некоторых вариантах реализации, один или несколько модифицированных нуклеозидов в сегменте крыла содержит модифицированный сахар. В некоторых вариантах реализации, модифицированный сахар представляет собой бициклический сахар. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой нуклеозид БНК. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-замещенный нуклеозид. В некоторых вариантах реализации, 2'-замещенные нуклеозиды включают нуклеозид ы с бициклическими сахарными модификациями. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-МОЕ нуклеозид. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой затрудненный этилнуклеозид (cEt).

В некоторых вариантах реализации, соединения или композиции содержат модифицированные олигонуклеотиды, состоящие из 10-30 связанных нуклеозидов, и имеющие последовательность нуклеооснований, содержащую часть, содержащую по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1. В некоторых вариантах реализации, такие олигонуклеотиды имеют сегмент гэп из 9, 10 или более связанных дезоксинуклеозидов. В некоторых вариантах реализации, такой сегмент гэп находится между двумя сегментами крыльев, которые независимо имеют 1, 2, 3, 4, 5, 6, 7 или 8 связанных модифицированных нуклеозидов. В некоторых вариантах реализации, один или несколько модифицированных нуклеозидов в сегменте крыла содержит модифицированный сахар. В некоторых вариантах реализации, модифицированный сахар представляет собой бициклический сахар. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой нуклеозид БНК. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-замещенный нуклеозид. В некоторых вариантах реализации, 2'-замещенные нуклеозиды содержат нуклеозиды с бициклическими сахарными модификациями. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-МОЕ нуклеозид. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой затрудненный этилнуклеозид (cEt). В некоторых вариантах реализации, каждый модифицированный нуклеозид в каждом сегменте крыла независимо представляет собой 2'-МОЕ нуклеозид или нуклеозид с бициклической сахарной модификацией, такой как затрудненный этилнуклеозид (cEt) или нуклеозид БЫК.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 10-30 связанных нуклеозидов, и имеющий последовательность нуклеооснований, содержащую по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеооснований любой из последовательностей SEQ ID NO:5-310, 321-802, 804-1272, 1288-1350, 1364-1372, 1375, 1376 или 1379. В некоторых вариантах реализации, такие олигонуклеотиды имеют сегмент гэп из 9, 10 или более связанных дезоксинуклеозидов. В некоторых вариантах реализации, такой сегмент гэп находится между двумя сегментами крыльев, которые независимо имеют 1-5, 1-4, 1-3, 2-5, 2-4 или 2-3 связанных модифицированных нуклеозида. В некоторых вариантах реализации, такой сегмент гэп находится между двумя сегментами крыльев, которые независимо имеют 1, 2, 3, 4, 5, 6, 7 или 8 связанных модифицированных нуклеозидов. В некоторых вариантах реализации, один или несколько модифицированных нуклеозидов в сегменте крыла содержит модифицированный сахар. В некоторых вариантах реализации, модифицированный сахар представляет собой бициклический сахар. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой нуклеозид БЫК. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-замещенный нуклеозид. В некоторых вариантах реализации, 2'-замещенные нуклеозиды включают нуклеозиды с бициклическими сахарными модификациями. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-МОЕ нуклеозид. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой затрудненный этилнуклеозид (cEt).

В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3 или 4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, каждый нуклеозид с модифицированным сахаром независимо представляет собой 2'-МОЕ нуклеозид или нуклеозид с бициклическим сахарным фрагментом, такой как затрудненный этилнуклеозид (cEt) или нуклеозид БНК. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 9 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4 или 5 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, каждый нуклеозид с модифицированным сахаром независимо представляет собой 2'-МОЕ нуклеозид или бициклический нуклеозид, такой как затрудненный этилнуклеозид (cEt) или нуклеозид БНК.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 10-30 связанных нуклеозидов, и имеющий последовательность нуклеооснований, содержащую по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеооснований любой из последовательностей SEQ ID NO:5-310, 321-802, 804-1272, 1288-1350, 1364-1372, 1375, 1376 или 1379. В некоторых вариантах реализации, такие олигонуклеотиды имеют сегмент гэп из 10 или более связанных дезоксинуклеозидов. В некоторых вариантах реализации, такой сегмент гэп находится между двумя сегментами крыльев, которые независимо имеют 1-5, 1-4, 1-3, 2-5, 2-4 или 2-3 связанных модифицированных нуклеозида. В некоторых вариантах реализации, такой сегмент гэп находится между двумя сегментами крыльев, которые независимо имеют 2, 3, 4, 5, 6, 7 или 8 связанных модифицированных нуклеозидов. В некоторых вариантах реализации, один или несколько модифицированных нуклеозидов в сегменте крыла содержит модифицированный сахар. В некоторых вариантах реализации, модифицированный сахар представляет собой бициклический сахар. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой нуклеозид БНК. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-замещенный нуклеозид. В некоторых вариантах реализации, 2'-замещенные нуклеозиды включают нуклеозиды с бициклическими сахарными модификациями. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-МОЕ нуклеозид.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 10-30 связанных нуклеозидов, и имеющий последовательность нуклеооснований, содержащую по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеооснований любой из последовательностей SEQ ID NO:5, 15, 16, 33, 39-95, 123-135, 163-175, 180-310, 321-406, 413-455, 461-802 или 804-1272. В некоторых вариантах реализации, такие олигонуклеотиды имеют сегмент гэп из 10 или более связанных дезоксинуклеозидов. В некоторых вариантах реализации, такой сегмент гэп находится между двумя сегментами крыльев, которые независимо имеют 1-5, 1-4, 1-3, 2-5, 2-4 или 2-3 связанных модифицированных нуклеозида. В некоторых вариантах реализации, один или несколько модифицированных нуклеозидов в сегменте крыла содержит модифицированный сахар. В некоторых вариантах реализации, модифицированный сахар представляет собой бициклический сахар. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой нуклеозид БЫК. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-замещенный нуклеозид. В некоторых вариантах реализации, 2'-замещенные нуклеозиды включают нуклеозиды с бициклическими сахарными модификациями. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-МОЕ нуклеозид.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 10-30 связанных нуклеозидов, и имеющий последовательность нуклеооснований, содержащую по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеооснований любой из последовательностей SEQ ID NO:6-14, 17-32, 34-38, 96-122, 136-162, 176-179, 407-412, 456-462, 523-538. В некоторых вариантах реализации, такие олигонуклеотиды имеют сегмент гэп из 10 или более связанных дезоксинуклеозидов. В некоторых вариантах реализации, такой сегмент гэп находится между двумя сегментами крыльев, которые независимо имеют 1-5, 1-4, 1-3, 2-5, 2-4 или 2-3 связанных модифицированных нуклеозида. В некоторых вариантах реализации, один или несколько модифицированных нуклеозидов в сегменте крыла содержит модифицированный сахар. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-замещенный нуклеозид. В некоторых вариантах реализации, модифицированный нуклеозид представляет собой 2'-МОЕ нуклеозид. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 14 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-3 или 2 нуклеозида с модифицированным сахаром.

В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 9 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4 или 5 нуклеозидов с модифицированным сахаром, как нуклеозиды 2'-МОЕ.

В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 17 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3-4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4, 5 или 6 нуклеозидов с модифицированным сахаром, как нуклеозиды 2'-МОЕ.

В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 18 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 3-5 или 4 нуклеозида с модифицированным сахаром.

В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 20 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5 или 5 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 22, 3, 4, 5, 6, 7 или 8 нуклеозидов с модифицированным сахаром, как нуклеозиды 2'-МОЕ.

В некоторых вариантах реализации, соединения или композиции содержат соль модифицированного олигонуклеотида.

В некоторых вариантах реализации, соединения или композиции дополнительно содержат фармацевтически приемлемый носитель или разбавитель.

В некоторых вариантах реализации, последовательность нуклеооснований модифицированного олигонуклеотида по меньшей мере на 70%, 75%, 80%, 85%, 90%, 95% или 100% комплементарна последовательности SEQ ID NO:1, по результатам измерения целостности модифицированного олигонуклеотида.

В некоторых вариантах реализации, последовательность нуклеооснований модифицированного олигонуклеотида по меньшей мере на 70%, 75%, 80%, 85%, 90%, 95% или 100% комплементарна любой из последовательностей SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, по результатам измерения целостности модифицированного олигонуклеотида.

В некоторых вариантах реализации, соединение или модифицированный олигонуклеотид является одноцепочечным.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 18 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 14 связанных нуклеозидов.

В некоторых вариантах реализации, по меньшей мере одна межнуклеозидная связь модифицированного олигонуклеотида представляет собой модифицированную межнуклеозидную связь. В некоторых вариантах реализации, каждая межнуклеозидная связь представляет собой фосфотиоатную межнуклеозидную связь.

В некоторых вариантах реализации, по меньшей мере один нуклеозид модифицированного олигонуклеотида включает модифицированный сахар. В некоторых вариантах реализации, по меньшей мере один модифицированный сахар содержит 2'-O-метоксиэтиловую группу (2'-O(СН2)2-ОСН3). В некоторых вариантах реализации, модифицированный сахар содержит группу 2'-O-СН3.

В некоторых вариантах реализации, по меньшей мере один модифицированный сахар представляет собой бициклический сахар. В некоторых вариантах реализации, по меньшей мере один модифицированный сахар, бициклический сахар содержит мостик 4'-(СН2)nO-2', причем n равен 1 или 2. В некоторых вариантах реализации, бициклический сахар содержит мостик 4'-CH2-O-2'. В некоторых вариантах реализации, бициклический сахар содержит мостик 4'-СН(СН3)-O-2'.

В некоторых вариантах реализации, по меньшей мере один нуклеозид указанного модифицированного олигонуклеотида содержит модифицированное нуклеооснование. В некоторых вариантах реализации, модифицированнле нуклеооснование представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из одноцепочечного модифицированного олигонуклеотида.

В некоторых вариантах реализации, модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из связанных нуклеозидов; и с) сегмент крыла 3', состоящий из связанных нуклеозидов. Сегмент гэп расположен между сегментом крыла 5' и сегментом крыла 3', и каждый нуклеозид каждого сегмента крыла содержит модифицированный сахар.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из 10 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из трех связанных нуклеозидов, сегмент крыла 3' состоит из трех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар и/или затрудненный этиловый (cEt) сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин. В некоторых аспектах, каждый из трех связанных нуклеозидов сегмента крыла 5' представляет собой 2'-O-метоксиэтиловый сахар, и каждый из трех связанных нуклеозидов сегмента крыла 3' представляет собой затрудненный этиловый (cEt) сахар. В других аспектах, три связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3', а три связанных нуклеозида сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, затрудненный этиловый (cEt) сахар и 2'-O-метоксиэтиловый сахар в направлении от 5' к 3'. В других аспектах, три связанных нуклеозида сегмента крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, и затрудненный этиловый (cEt) сахар в направлении от 5' к 3', а три связанных нуклеозида сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из 10 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из двух связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин. В некоторых аспектах, два связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3', а четыре связанных нуклеозида сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и 2'-O-метоксиэтиловый сахар в направлении от 5' к 3'.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из 9 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из двух связанных нуклеозидов; пять связанных нуклеозидов сегмента крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид, затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид и затрудненный (cEt) сахар в направлении от 5' к 3'; два связанных нуклеозида сегмента крыла 3' представляют собой 2'-O-метоксиэтиловый сахар и 2'-O-метоксиэтиловый сахар в направлении от 5' к 3'; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из 8 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из трех связанных нуклеозидов, сегмент крыла 3' состоит из пяти связанных нуклеозидов; три связанных нуклеозида сегмента крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из пяти связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из 8 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из трех связанных нуклеозидов, сегмент крыла 3' состоит из пяти связанных нуклеозидов, каждый из трех связанных нуклеозидов сегмента крыла 5' представляет собой затрудненный этиловый (cEt) сахар; каждый из пяти связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из 9 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из четырех связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин. В некоторых аспектах, четыре связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3', а четыре связанных нуклеозида сегмента крыла 3' представляют собой 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар и 2'-O-метоксиэтиловый сахар в направлении от 5' к 3'.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из 9 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из четырех связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов; четыре связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; четыре связанных нуклеозида сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар и 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из 9 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из четырех связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов; четыре связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из 8 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов; пять связанных нуклеозидов сегмента крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид, затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из 8 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов; пять связанных нуклеозидов сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из 7 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из пяти связанных нуклеозидов; пять связанных нуклеозидов сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; пять связанных нуклеозидов сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар и 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из 7 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из шести связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов; шесть связанных нуклеозидов сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из 7 связанных дезоксинуклеозидов, и сегмент крыла 5' состоит из шести связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов; шесть связанных нуклеозидов сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из 10 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из пяти связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит затрудненный этиловый (cEt) сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из 10 связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из пяти связанных нуклеозидов, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин, причем пять связанных нуклеозидов крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид, затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид и затрудненный этиловый (cEt) сахар в направлении от 5' к 3', и каждый из пяти связанных нуклеозидов крыла 3' представляет собой 2'-O-метоксиэтиловый сахар.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из трех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из трех связанных нуклеозидов. В некоторых аспектах, сегмент гэп расположен между сегментом крыла 5' и сегментом крыла 3'; каждый из трех связанных нуклеозидов сегмента крыла 5' представляет собой 2'-O-метоксиэтиловый сахар, и каждый из трех связанных нуклеозидов сегмента крыла 3' представляет собой затрудненный этиловый (cEt) сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозиновый остаток представляет собой 5-метилцитозин. В других аспектах, сегмент гэп расположен между сегментом крыла 5' и сегментом крыла 3'; три связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; три связанных нуклеозида сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, затрудненный этиловый (cEt) сахар и 2'-O-метоксиэтиловый сахар в направлении от 5' к 3'; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозиновый остаток представляет собой 5-метилцитозин. В других аспектах, три связанных нуклеозида сегмента крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, и затрудненный этиловый (cEt) сахар в направлении от 5' к 3', а три связанных нуклеозида сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из двух связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов. В некоторых аспектах, сегмент гэп расположен между сегментом крыла 5' и сегментом крыла 3'; два связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; четыре связанных нуклеозида сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и 2'-O-метоксиэтиловый сахар в направлении от 5' к 3'; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 9 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоязий из двух связанных нуклеозидов, причем пять связанных нуклеозидов сегмента крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид, затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид и затрудненный (cEt) сахар в направлении от 5' к 3'; два связанных нуклеозида сегмента крыла 3' представляют собой 2'-O-метоксиэтиловый сахар и 2'-O-метоксиэтиловый сахар в направлении от 5' к 3'; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 8 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из трех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из пяти связанных нуклеозидов, причем три связанных нуклеозида сегмента крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из пяти связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 8 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из трех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из пяти связанных нуклеозидов, причем каждый из трех связанных нуклеозидов сегмента крыла 5' представляет собой затрудненный этиловый (cEt) сахар; каждый из пяти связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 9 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из четырех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин. В некоторых аспектах, четыре связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3', а четыре связанных нуклеозида сегмента крыла 3' представляют собой 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар и 2'-O-метоксиэтиловый сахар в направлении от 5' к 3'.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 9 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из четырех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов, причем четыре связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; четыре связанных нуклеозида сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар и 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 9 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из четырех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов, причем четыре связанных нуклеозида сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ Ю NO: 1, и причем модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 8 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов, причем пять связанных нуклеозидов сегмента крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид, затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 8 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов, причем пять связанных нуклеозидов сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 7 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоящий из пяти связанных нуклеозидов, причем пять связанных нуклеозидов сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; пять связанных нуклеозидов сегмента крыла 3' представляют собой затрудненный этиловый (cEt) сахар, затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар и 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь преставляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 7 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из шести связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов, причем шесть связанных нуклеозидов сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 7 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из шести связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов, причем шесть связанных нуклеозидов сегмента крыла 5' представляют собой 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар, 2'-O-метоксиэтиловый сахар, затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид и затрудненный этиловый (cEt) сахар в направлении от 5' к 3'; каждый из четырех связанных нуклеозидов сегмента крыла 3' представляет собой 2'-O-метоксиэтиловый сахар; каждая межнуклеозидная связь представляет собой фосфотиоатную связь; и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 10 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоящий из пяти связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла включает затрудненный этиловый (cEt) сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из 10 связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоящий из пяти связанных нуклеозидов, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин, причем пять связанных нуклеозидов крыла 5' представляют собой затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид, затрудненный этиловый (cEt) сахар, 2'-дезоксинуклеозид и затрудненный этиловый (cEt) сахар в направлении от 5' к 3', и каждый из пяти связанных нуклеозидов крыла 3' представляет собой 2'-O-метоксиэтиловый сахар.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из пяти связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из двух связанных нуклеозидов, сегмент крыла 3' состоит из восьми связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из восьми связанных нуклеозидов, сегмент крыла 3' состоит из двух связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из трех связанных нуклеозидов, сегмент крыла 3' состоит из семи связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из семи связанных нуклеозидов, сегмент крыла 3' состоит из трех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из четырех связанных нуклеозидов, сегмент крыла 3' состоит из шести связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из шести связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 18 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из четырех связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нулеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из трех связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из двух связанных нуклеозидов, сегмент крыла 3' состоит из шести связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из шести связанных нуклеозидов, сегмент крыла 3' состоит из двух связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из четырех связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из трех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 17 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из трех связанных нуклеозидов, сегмент крыла 3' состоит из пяти связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из трех связанных нуклеозидов, сегмент крыла 3' состоит из трех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из пяти связанных нуклеозидов, сегмент крыла 3' состоит из двух связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из двух связанных нуклеозидов, сегмент крыла 3' состоит из пяти связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из четырех связанных нуклеозидов, сегмент крыла 3' состоит из трех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 16 связанных нуклеозидов, сегмент гэп состоит из девяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из трех связанных нуклеозидов, сегмент крыла 3' состоит из четырех связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, модифицированный олигонуклеотид состоит из 14 связанных нуклеозидов, сегмент гэп состоит из десяти связанных дезоксинуклеозидов, сегмент крыла 5' состоит из двух связанных нуклеозидов, сегмент крыла 3' состоит из двух связанных нуклеозидов, каждый нуклеозид каждого сегмента крыла содержит 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозин представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоящий из пяти связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из двух связанных нуклеозидов; и с) сегмент крыла 3', состоящий из восьми связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из восьми связанных нуклеозидов; и с) сегмент крыла 3', состоящий из двух связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из трех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из семи связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из семи связанных нуклеозидов; и с) сегмент крыла 3', состоящий из трех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из четырех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из шести связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 20 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из шести связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 18 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из четырех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из трех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из двух связанных нуклеозидов; и с) сегмент крыла 3', состоящий из шести связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из шести связанных нуклеозидов; и с) сегмент крыла 3', состоящий из двух связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из четырех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоящий из трех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 17 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из трех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из пяти связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из трех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из трех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO: 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из пяти связанных нуклеозидов; и с) сегмент крыла 3', состоящий из двух связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из двух связанных нуклеозидов; и с) сегмент крыла 3', состоящий из пяти связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из четырех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из трех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 16 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из девяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из трех связанных нуклеозидов; и с) сегмент крыла 3', состоящий из четырех связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, соединения или композиции содержат модифицированный олигонуклеотид, состоящий из 14 связанных нуклеозидов, имеющих последовательность нуклеооснований, содержащую часть, состоящую по меньшей мере из 8 смежных нуклеооснований, комплементарную равной по длине части любого из нуклеооснований, представленных далее в последовательностях SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, причем указанная последовательность нуклеооснований комплементарна к SEQ ID NO:1, и при этом модифицированный олигонуклеотид содержит: а) сегмент гэп, состоящий из десяти связанных дезоксинуклеозидов; b) сегмент крыла 5', состоящий из двух связанных нуклеозидов; и с) сегмент крыла 3', состоящий из двух связанных нуклеозидов. Сегмент гэп располагается между сегментом крыла 5' и сегментом крыла 3', каждый нуклеозид каждого сегмента крыла включает 2'-O-метоксиэтиловый сахар, каждая межнуклеозидная связь представляет собой фосфотиоатную связь, и каждый цитозиновый остаток представляет собой 5-метилцитозин.

В некоторых вариантах реализации, представленные способы, соединения и композиции ингибируют уровни экспрессии мРНК и/или ДНК HBV и/или уровни белка, и/или уровни антигена.

В другом варианте реализации представлен способ лечения HBV-связанных заболеваний, расстройств и состояний у млекопитающих, включающий введение терапевтически эффективного количества любой фармацевтической композиции, описанной выше, млекопитающему, нуждающемуся в этом, для лечения HBV-связанных заболеваний, расстройств и состояний. В родственных вариантах реализации млекопитающим является человек, а HBV-состояние заболевание, расстройство и состояние представляет собой инфекцию вируса гепатита В от вируса гепатита В человека. Более конкретно, вирус гепатита В человека может быть любым из человеческих географических генотипов: А (Северо-Западная Европа, Северная Америка, Центральная Америка); В (Индонезия, Китай, Вьетнам); С (Восточная Азия, Корея, Китай, Япония, Полинезия, Вьетнам); D (Средиземноморский регион, Ближний восток, Индия); Е (Африка); F (коренные американцы, Полинезия); G (Соединенные Штаты, Франция); или Н (Центральная Америка).

В некоторых вариантах реализации антисмысловое соединение или олигонуклеотид, направленный на нуклеиновую кислоту HBV, комплементарен в пределах следующих нуклеотидных областей последовательности SEQ ID NO:1: 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61-76, 61-77, 61-80, 62-77, 63-84, 68-114, 101-123, 98-123, 113-138, 116-138, 131-150, 137-162, 152-186, 158-177, 167-186, 191-215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-274; 245-260, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-266, 251-268, 251-269, 245-269, 245-266, 245-261, 250-265, 250-266, 250-267, 250-268, 250-269, 251-270, 252-267, 253-268, 253-269, 253-272, 253-274, 254-269, 254-270, 254-274, 255-270, 255-271, 255-274, 255-401, 255-400, 255-274, 255-273, 255-272, 255-271, 256-271, 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-276, 258-273, 259-274, 260-279, 262-281, 262-321, 262-315, 262-312, 265-312, 266-288, 266-291, 266-285, 281-321, 281-303, 290-321, 290-312, 292-311, 290-312, 293-312, 293-315, 293-321, 296-321, 302-321, 324-343, 339-361, 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385, 362-381, 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 380-399, 382-401, 384-433, 384-400, 384-401, 385-401, 405-424, 409-428, 405-428, 411-426, 411-427, 411-430, 411-431, 411-437, 412-431, 411-426, 411-427, 412-428, 412-431, 412-427, 413-433, 413-432, 413-428, 413-429, 413-432, 413-433, 414-427, 415-427, 414-429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431, 415-434, 416-431, 416-432, 416-429, 416-435, 417-432, 417-433, 417-436, 418-433, 418-435, 418-434, 418-437, 419-435, 419-434, 420-435, 419-432, 419-434, 421-436, 422-437, 422-441, 423-436, 425-465, 454-473, 454-472, 457-476, 457-472, 457-473, 454-476, 455-472, 457-485, 458-485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463-482, 457-491, 458-491, 459-491, 460-491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594, 584-606, 611-645, 617-363, 623-642, 617-645, 639-754, 639-658, 639-654, 641-656, 642-657, 643-658, 642-754, 653-672, 662-685, 665-685,665-689, 668-687, 670-754, 670-706, 670-685, 670-686, 670-689, 671-690, 671-691, 671-686, 671-687, 672-693, 672-697, 672-707, 672-687, 672-688, 673-688, 674-693, 678-693, 679-694, 679-707, 679-698, 679-701, 679-702, 679-707, 680-695, 680-699, 679-699, 681-706, 681-696, 682-697, 682-706, 682-707, 682-702, 682-701, 683-698, 684-699, 685-700, 686-701, 687-754, 688-704, 689-709, 689-710, 690-705, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-706, 684-703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689-705, 689-708, 690-705, 690-706, 690-709, 691-706, 692-711, 693-716, 693-712, 695-715, 697-716, 697-716, 690-716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-754, 738-753, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811-833, 811-844, 814-833, 811-906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951-1044, 951-1024, 951-1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082-1101, 1088-1107, 1088-1134, 1094-1119, 1097-1119, 1112-1134, 1118-1143, 1118-1146, 1088-1146, 1121-1140, 1127-1146, 1127-1193, 1150-1193, 1156-1187, 1165-1187, 1170-1192, 1171-1191, 1172-1191, 1176-1192, 1176-1285, 1177-1192, 1176-1191, 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1245-1265, 1251-1280, 1262-1285, 1251-1285, 1259-1296, 1259-1290, 1259-1287, 1261-1296, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1296, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271-1290, 1271-1296, 1277-1296, 1261-1290, 1262-1290, 1268-1290, 1263-1305, 1259-1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281-1324, 1281-1336, 1282-1301, 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 1311-1336, 1311-1333, 1326-1345, 1353-1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602, 1518-1537, 1521-1563, 1521-1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571-1595, 1577-1605, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1578-1598, 1571-1598, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1580-1605, 1580-1602, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1582-1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651-1720, 1651-1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781-1797, 1781-1796, 1781-1796, 1781-1800, 1781-1797, 1782-1799, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799, 1778-1889, 1778-1794, 1779-1795, 1780-1799, 1785-1800, 1794-1813, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831, 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821-1840, 1821-1844, 1821-1837, 1822-1843, 1822-1839, 1822-1837, 1823-1843, 1823-1838, 1824-1839, 1827-1846, 1861-1884, 1861-1880, 1865-1885, 1866-1881, 1867-1882, 1867-1886, 1868-1883, 1869-1885, 1869-1884, 1870-1885, 1871-1886, 1872-1887, 1874-1889, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891-1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921-1934, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381-2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892 и 3161-3182.

В некоторых вариантах реализации антисмысловое соединение или олигонуклеотид, направленный на нуклеиновую кислоту HBV, направлен на следующие нуклеотидные области последовательности SEQ ID NO:1: 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61-76, 61-77, 61-80, 62-77, 63-84, 68-114, 101-123, 98-123, 113-138, 116-138, 131-150, 137-162, 152-186, 158-177, 167-186, 191-215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-274; 245-260, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-266, 251-268, 251-269, 245-269, 245-266, 245-261, 250-265, 250-266, 250-267, 250-268, 250-269, 251-270, 252-267, 253-268, 253-269, 253-272, 253-274, 254-269, 254-270, 254-274, 255-270, 255-271, 255-274, 255-401, 255-400, 255-274, 255-273, 255-272, 255-271, 256-271, 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-276, 258-273, 259-274, 260-279, 262-281, 262-321, 262-315, 262-312, 265-312, 266-288, 266-291, 266-285, 281-321, 281-303, 290-321, 290-312, 292-311, 290-312, 293-312, 293-315, 293-321, 296-321, 302-321, 324-343, 339-361, 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385, 362-381, 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 380-399, 382-401, 384-433, 384-400, 384-401, 385-401, 405-424, 409-428, 405-428, 411-426, 411-427, 411-430, 411-431, 411-437, 412-431, 411-426, 411-427, 412-428, 412-431, 412-427, 413-433, 413-432, 413-428, 413-429, 413-432, 413-433, 414-427, 415-427, 414-429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431, 415-434, 416-431, 416-432, 416-429, 416-435, 417-432, 417-433, 417-436, 418-433, 418-435, 418-434, 418-437, 419-435, 419-434, 420-435, 419-432, 419-434, 421-436, 422-437, 422-441, 423-436, 425-465, 454-473, 454-472, 457-476, 457-472, 457-473, 454-476, 455-472, 457-485, 458-485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463-482, 457-491, 458-491, 459-491, 460-491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594, 584-606, 611-645, 617-363, 623-642, 617-645, 639-754, 639-658, 639-654, 641-656, 642-657, 643-658, 642-754, 653-672, 662-685, 665-685,665-689, 668-687, 670-754, 670-706, 670-685, 670-686, 670-689, 671-690, 671-691, 671-686, 671-687, 672-693, 672-697, 672-707, 672-687, 672-688, 673-688, 674-693, 678-693, 679-694, 679-707, 679-698, 679-701, 679-702, 679-707, 680-695, 680-699, 679-699, 681-706, 681-696, 682-697, 682-706, 682-707, 682-702, 682-701, 683-698, 684-699, 685-700, 686-701, 687-754, 688-704, 689-709, 689-710, 690-705, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-706, 684-703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689-705, 689-708, 690-705, 690-706, 690-709, 691-706, 692-711, 693-716, 693-712, 695-715, 697-716, 697-716, 690-716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-754, 738-753, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811-833, 811-844, 814-833, 811-906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951-1044, 951-1024, 951-1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082-1101, 1088-1107, 1088-1134, 1094-1119, 1097-1119, 1112-1134,1118-1143, 1118-1146, 1088-1146, 1121-1140, 1127-1146, 1127-1193, 1150-1193, 1156-1187, 1165-1187, 1170-1192, 1171-1191, 1172-1191, 1176-1192, 1176-1285, 1177-1192, 1176-1191, 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1245-1265, 1251-1280, 1262-1285, 1251-1285, 1259-1296, 1259-1290, 1259-1287, 1261-1296, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1296, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271-1290, 1271-1296, 1277-1296, 1261-1290, 1262-1290, 1268-1290, 1263-1305, 1259-1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281-1324, 1281-1336, 1282-1301, 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 1311-1336, 1311-1333, 1326-1345, 1353-1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602,1518-1537, 1521-1563, 1521-1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571-1595, 1577-1605, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1578-1598, 1571-1598, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1580-1605, 1580-1602, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1582-1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651-1720, 1651-1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781-1797, 1781-1796, 1781-1796, 1781-1800, 1781-1797, 1782-1799, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799, 1778-1889, 1778-1794, 1779-1795, 1780-1799, 1785-1800, 1794-1813, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831, 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821-1840, 1821-1844, 1821-1837, 1822-1843, 1822-1839, 1822-1837, 1823-1843, 1823-1838, 1824-1839, 1827-1846, 1861-1884, 1861-1880, 1865-1885, 1866-1881, 1867-1882, 1867-1886, 1868-1883, 1869-1885, 1869-1884, 1870-1885, 1871-1886, 1872-1887, 1874-1889, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891-1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921-1934, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381-2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892 и 3161-3182.

В некоторых вариантах реализации, антисмысловое соединение или олигонуклеотид, направленный на нуклеиновую кислоту HBV, комплементарен в пределах генной области второй части pre-Sl HBV, соответствующей нуклеотидной области 1-1932 последовательности SEQ ID NO:1. В некоторых вариантах реализации, антисмысловое соединение или олигонуклеотид, направленный на нуклеиновую кислоту HBV, комплементарен в пределах генной области первой части pre-Sl HBV, соответствующей нуклеотидной области 2831-3182 последовательности SEQ ID NO:1.

В некоторых вариантах реализации, антисмысловое соединение или олигонуклеотид, направленный на нуклеиновую кислоту HBV, нацелен на генную область второй части pre-S I HBV, соответствующую нуклеотидной области 1-1932 последовательности SEQ ID NO:1. В некоторых вариантах реализации, антисмысловое соединение или олигонуклеотид, направленный на нуклеиновую кислоту HBV, нацелен на генную область первой части pre-Sl HBV, соответствующую нуклеотидной области 2831-3182 последовательности SEQ ID NO:1.

В некоторых вариантах реализации, антисмысловые соединения или олигонуклеотиды направлены на область нуклеиновой кислоты HBV. В некоторых вариантах реализации, такие соединения или олигонуклеотиды направлены на область нуклеиновой кислоты HBV, имеющую часть смежных нуклеооснований, которая комплементарна равной по длине части нуклеооснований указанной области. Например, эта часть может быть частью, содержащей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеооснований, комплементарной равной по длине части области, упомянутой в настоящем документе. В некоторых вариантах реализации такие соединения или олигонуклеотиды направлены на следующие нуклеотидные области последовательности SEQ ID NO:1: 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61-76, 61-77, 61-80, 62-77, 63-84, 68-114, 101-123, 98-123, 113-138, 116-138, 131-150, 137-162, 152-186, 158-177, 167-186, 191-215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-274; 245-260, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-266, 251-268, 251-269, 245-269, 245-266, 245-261, 250-265, 250-266, 250-267, 250-268, 250-269, 251-270, 252-267, 253-268, 253-269, 253-272, 253-274, 254-269, 254-270, 254-274, 255-270, 255-271, 255-274, 255-401, 255-400, 255-274, 255-273, 255-272, 255-271, 256-271, 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-276, 258-273, 259-274, 260-279, 262-281, 262-321, 262-315, 262-312, 265-312, 266-288, 266-291, 266-285, 281-321, 281-303, 290-321, 290-312, 292-311, 290-312, 293-312, 293-315, 293-321, 296-321, 302-321, 324-343, 339-361, 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385, 362-381, 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 380-399, 382-401, 384-433, 384-400, 384-401, 385-401, 405-424, 409-428, 405-428, 411-426, 411-427, 411-430, 411-431, 411-437, 412-431, 411-426, 411-427, 412-428, 412-431, 412-427, 413-433, 413-432, 413-428, 413-429, 413-432, 413-433, 414-427, 415-427, 414-429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431, 415-434, 416-431, 416-432, 416-429, 416-435, 417-432, 417-433, 417-436, 418-433, 418-435, 418-434, 418-437, 419-435, 419-434, 420-435, 419-432, 419-434, 421-436, 422-437, 422-441, 423-436, 425-465, 454-473, 454-472, 457-476, 457-472, 457-473, 454-476, 455-472, 457-485, 458-485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463-482, 457-491, 458-491, 459-491, 460-491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594, 584-606, 611-645, 617-363, 623-642, 617-645, 639-754, 639-658, 639-654, 641-656, 642-657, 643-658, 642-754, 653-672, 662-685, 665-685,665-689, 668-687, 670-754, 670-706, 670-685, 670-686, 670-689, 671-690, 671-691, 671-686, 671-687, 672-693, 672-697, 672-707, 672-687, 672-688, 673-688, 674-693, 678-693, 679-694, 679-707, 679-698, 679-701, 679-702, 679-707, 680-695, 680-699, 679-699, 681-706, 681-696, 682-697, 682-706, 682-707, 682-702, 682-701, 683-698, 684-699, 685-700, 686-701, 687-754, 688-704, 689-709, 689-710, 690-705, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-706, 684-703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689-705, 689-708, 690-705, 690-706, 690-709, 691-706, 692-711, 693-716, 693-712, 695-715, 697-716, 697-716, 690-716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-754, 738-753, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811-833, 811-844, 814-833, 811-906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951-1044, 951-1024, 951-1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082-1101, 1088-1107, 1088-1134, 1094-1119, 1097-1119, 1112-1134, 1118-1143, 1118-1146, 1088-1146, 1121-1140, 1127-1146, 1127-1193, 1150-1193, 1156-1187, 1165-1187, 1170-1192, 1171-1191, 1172-1191, 1176-1192, 1176-1285, 1177-1192, 1176-1191, 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1245-1265, 1251-1280, 1262-1285, 1251-1285, 1259-1296, 1259-1290, 1259-1287, 1261-1296, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1296, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271-1290, 1271-1296, 1277-1296, 1261-1290, 1262-1290, 1268-1290, 1263-1305, 1259-1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281-1324, 1281-1336, 1282-1301, 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 1311-1336, 1311-1333, 1326-1345, 1353-1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602, 1518-1537, 1521-1563, 1521-1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571-1595, 1577-1605, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1578-1598, 1571-1598, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1580-1605, 1580-1602, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1582-1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651-1720, 1651-1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781-1797, 1781-1796, 1781-1796, 1781-1800, 1781-1797, 1782-1799, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799, 1778-1889, 1778-1794, 1779-1795, 1780-1799, 1785-1800, 1794-1813, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831, 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821-1840, 1821-1844, 1821-1837, 1822-1843, 1822-1839, 1822-1837, 1823-1843, 1823-1838, 1824-1839, 1827-1846, 1861-1884, 1861-1880, 1865-1885, 1866-1881, 1867-1882, 1867-1886, 1868-1883, 1869-1885, 1869-1884, 1870-1885, 1871-1886, 1872-1887, 1874-1889, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891-1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921-1934, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381-2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892 и 3161-3182.

В некоторых вариантах реализации, антисмысловые соединения или олигонуклеотиды направлены на область нуклеиновой кислоты HBV. В некоторых вариантах реализации, такие соединения или олигонуклеотиды направлены на область нуклеиновой кислоты HBV, имеющую часть смежных нуклеооснований, которая комплементарна равной по длине части нуклеооснований указанной области. Например, эта часть может быть частью, содержащей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеооснований, комплементарной равной по длине части области, упомянутой в настоящем документе. В некоторых вариантах реализации такие соединения или олигонуклеотиды направлены на следующие нуклеотидные области последовательности SEQ ID NO:1: 58-73, 58-74, 58-77, 59-74, 60-75, 61-76, 62-77, 245-274; 245-260, 250-265, 251-266, 252-267, 253-268, 254-269, 255-270, 256-271, 256-272, 258-273, 259-274, 380-399, 382-401, 411-437, 411-427, 411-426, 412-427, 413-428, 413-432, 414-429, 415-430, 416-431, 417-432, 418-433, 419-434, 420-435, 421-436, 422-437, 457-472, 458-473, 639-754, 639-658, 639-654, 641-656, 642-657, 643-658, 670-754, 670-706, 670-685, 671-686, 672-687, 673-688, 678-693, 679-694, 680-695, 681-706, 681-696, 682-697, 683-698, 684-699, 685-700, 686-701, 687-702, 688-703, 689-704, 690-705, 691-706, 738-754, 738-753, 739-754, 1176-1285, 1176-1191, 1177-1192, 1261-1285, 1261-1276, 1262-1277, 1263-1278, 1264-1279, 1265-1280, 1266-1281, 1267-1282, 1268-1283, 1269-1284, 1270-1285, 1577-1606, 1577-1592, 1578-1593, 1579-1594, 1580-1595, 1581-1596, 1582-1597, 1583-1598, 1584-1599, 1585-1600, 1586-1601, 1587-1602, 1588-1603, 1589-1604, 1590-1605, 1591-1606, 1778-1889, 1778-1800, 1778-1793, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781-1796, 1782-1797, 1783-1798, 1784-1799, 1785-1800, 1822-1839, 1822-1837, 1823-1838, 1824-1839, 1866-1881, 1867-1882, 1868-1883, 1869-1884, 1870-1885, 1871-1886, 1872-1887 или 1874-1889, и причем по меньшей мере один нуклеозид соединения или модифицированного олигонуклеотида включает по меньшей мере один 2'-O-метоксиэтиловый или затрудненный этиловый (cEt) сахар.

В некоторых вариантах реализации антисмысловое соединение или олигонуклеотид, направленный на нуклеиновую кислоту HBV, комплементарен в пределах следующих нуклеотидных областей последовательности SEQ ID NO:1: 58-73, 58-74, 58-77, 59-74, 59-75, 60-75, 60-76, 61-76, 61-77, 62-77, 253-272, 253-269, 254-270, 255-271, 256-272, 411-437, 411-426, 411-427, 411-430, 412-427, 412-428, 412-431, 413-428, 413-429, 413-432, 414-429, 414-430, 414-433, 415-430, 415-431, 415-434, 416-431, 416-432, 416-435, 417-432, 417-433, 417-436, 418-433, 418-434, 418-437, 457-472, 457-473, 458-473, 670-706, 670-685, 670-686, 671-686, 671-687, 672-687, 672-688, 673-688, 687-702, 687-703, 687-706, 688-703, 688-704, 689-704, 689-705, 690-705, 690-706, 691-706, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1269-1284, 1269-1285, 1270-1285, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1794, 1779-1795, 1779-1798, 1780-1795, 1780-1796, 1780-1799, 1781-1796, 1781-1797, 1781-1800, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1799 и 1784-1800.

В некоторых вариантах реализации антисмысловое соединение или олигонуклеотид, направленный на нуклеиновую кислоту HBV, направлен на следующие нуклеотидные области последовательности SEQ ID NO:1: 58-73, 58-74, 58-77, 59-74, 59-75, 60-75, 60-76, 61-76, 61-77, 62-77, 253-272, 253-269, 254-270, 255-271, 256-272, 411-437, 411-426, 411-427, 411-430, 412-427, 412-428, 412-431, 413-428, 413-429, 413-432, 414-429, 414-430, 414-433, 415-430, 415-431, 415-434, 416-431, 416-432, 416-435, 417-432, 417-433, 417-436, 418-433, 418-434, 418-437, 457-472, 457-473, 458-473, 670-706, 670-685, 670-686, 671-686, 671-687, 672-687, 672-688, 673-688, 687-702, 687-703, 687-706, 688-703, 688-704, 689-704, 689-705, 690-705, 690-706, 691-706, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1269-1284, 1269-1285, 1270-1285, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1794, 1779-1795, 1779-1798, 1780-1795, 1780-1796, 1780-1799, 1781-1796, 1781-1797, 1781-1800, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1799 и 1784-1800.

В некоторых вариантах реализации, антисмысловые соединения или олигонуклеотиды направлены на область нуклеиновой кислоты HBV. В некоторых вариантах реализации, такие соединения или олигонуклеотиды направлены на область нуклеиновой кислоты HBV, имеющую часть смежных нуклеооснований, которая комплементарна равной по длине части нуклеооснований указанной области. Например, эта часть может быть частью, содержащей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеооснований, комплементарной равной по длине части области, упомянутой в настоящем документе. В некоторых вариантах реализации такие соединения или олигонуклеотиды направлены на следующие нуклеотидные области последовательности SEQ ID NO:1: 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-73, 58-74, 58-77, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-75, 60-76, 60-79, 61-76, 61-77, 61-80, 62-77, 63-84, 68-114, 101-123, 98-123, 113-138, 116-138, 131-150, 137-162, 152-186, 158-177, 167-186, 191-215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224, 200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-268, 251-269, 245-269, 245-266, 245-261, 250-266, 250-267, 250-268, 250-269, 251-270, 253-269, 253-272, 253-274, 254-270, 254-274, 255-271, 255-274, 255-401, 255-400, 255-274, 255-273, 255-272, 255-271, 256-275, 255-276, 256-272, 256-276, 253-275, 256-279, 257-276, 260-279, 262-281, 262-321, 262-315, 262-312, 265-312, 266-288, 266-291, 266-285, 281-321, 281-303, 290-321, 290-312, 292-311, 290-312, 293-312, 293-315, 293-321, 296-321, 302-321, 324-343, 339-361, 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385, 362-381, 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 384-433, 384-400, 384-401, 385-401, 405-424, 409-428, 405-428, 411-426, 411-427, 411-430, 411-431, 411-437, 412-431, 411-426, 411-427, 412-428, 412-431, 412-427, 413-433, 413-432, 413-428, 413-429, 413-432, 413-433, 414-427, 415-427, 414-429, 414-430, 414-433, 415-428, 415-429, 415-430, 415-431, 415-434, 416-431, 416-432, 416-429, 416-435, 417-432, 417-433, 417-436, 418-433, 418-435, 418-434, 418-437, 419-435, 419-434, 420-435, 419-432, 419-434, 422-441, 423-436, 425-465, 454-473, 454-472, 457-476, 457-472, 457-473, 454-476, 455-472, 457-485, 458-485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463-482, 457-491, 458-491, 459-491, 460-491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594, 584-606, 611-645, 617-363, 623-642, 617-645, 642-754, 653-672, 662-685, 665-685, 665-689, 668-687, 670-706, 670-685, 670-686, 670-689, 671-690, 671-691, 671-686, 671-687, 672-693, 672-697, 672-707, 672-687, 672-688, 673-688, 674-693, 679-707, 679-698, 679-701, 679-702, 679-707, 680-699, 679-699, 682-706, 682-707, 682-702, 682-701, 687-754, 688-704, 689-709, 689-710, 690-705, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-706, 684-703, 687-705, 687-702, 687-703, 687-706, 688-703, 688-704, 688-705, 689-704, 689-705, 689-708, 690-705, 690-706, 690-709, 691-706, 692-711, 693-716, 693-712, 695-715, 697-716, 697-716, 690-716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-754, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811-833, 811-844, 814-833, 811-906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 863-882, 863-885, 878-900, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951-1044, 951-1024, 951-1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 972-1015, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082-1101, 1088-1107, 1088-1134, 1094-1119, 1097-1119, 1112-1134, 1118-1143, 1118-1146, 1088-1146, 1121-1140, 1127-1146, 1127-1193,1150-1193, 1156-1187, 1165-1187, 1170-1192, 1171-1191, 1172-1191, 1176-1192, 1177-1192, 1176-1191, 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1245-1265, 1251-1280, 1262-1285, 1251-1285, 1259-1296, 1259-1290, 1259-1287, 1261-1296, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1296, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271-1290, 1271-1296, 1277-1296, 1261-1290, 1262-1290, 1268-1290, 1263-1305, 1259-1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281-1324, 1281-1336, 1282-1301, 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 1311-1336, 1311-1333, 1326-1345, 1353-1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602, 1518-1537, 1521-1563, 1521-1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571-1595, 1577-1605, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1578-1598, 1571-1598, 1579-1594, 1579-1594, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1580-1605, 1580-1602, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1582-1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1586-1652, 1642-1664, 1651-1720, 1651-1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1799, 1780-1796, 1780-1795, 1781-1797, 1781-1796, 1781-1796, 1781-1800, 1781-1797, 1782-1799, 1782-1797, 1782-1798, 1783-1798, 1783-1799, 1784-1800, 1784-1799, 1779-1799, 1778-1794, 1779-1795, 1780-1799, 1794-1813, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831, 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821-1840, 1821-1844, 1821-1837, 1822-1843, 1822-1839, 1823-1843, 1827-1846, 1861-1884, 1861-1880, 1865-1885, 1867-1886, 1869-1885, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891-1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921-1934, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381-2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892 и 3161-3182.

В некоторых вариантах реализации, антисмысловые соединения или олигонуклеотиды направлены на область нуклеиновой кислоты HBV. В некоторых вариантах реализации, такие соединения или олигонуклеотиды направлены на область нуклеиновой кислоты HBV, имеющую часть смежных нуклеооснований, которая комплементарна равной по длине части нуклеооснований указанной области. Например, эта часть может быть частью, содержащей по меньшей мере 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 смежных нуклеооснований, комплементарной равной по длине части области, упомянутой в настоящем документе. В некоторых вариантах реализации такие соединения или олигонуклеотиды направлены на следующие нуклеотидные области последовательности SEQ ID NO:1: 233-264, 242-263, 243-262, 244-263, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-268, 251-269, 245-269, 245-266, 245-261, 250-266, 250-267, 250-268, 250-269, 251-270, 253-272, 253-274, 254-274, 255-274, 255-401, 255-400, 255-274, 255-273, 255-272, 255-271, 256-275, 255-276, 256-276, 253-275, 256-279, 257-276, 260-279, 262-281, 262-321, 262-315, 262-312, 265-312, 266-288, 266-291, 266-285, 281-321, 281-303, 405-424, 409-428, 405-428, 411-430, 411-431, 411-431, 412-431, 411-426, 411-427, 412-428, 412-431, 412-427, 413-433, 413-432, 413-428, 413-433, 411-427, 414-427, 415-427, 415-428, 415-429, 416-432, 416-429, 418-435, 418-434, 419-435, 419-434, 420-435, 419-432, 419-434, 422-441, 423-436, 425-465, 584-606, 611-645, 617-363, 623-642, 617-645, 642-754, 653-672, и причем по меньшей мере один нуклеозид соединения или модифицированного олигонуклеотида включает по меньшей мере один 2'-O-метоксиэтиловый сахар.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 50% ингибирование: 1-20, 10-29, 10-56, 13-38, 13-35, 19-38, 25-47, 25-50, 25-56, 43-68, 43-63, 55-74, 58-77, 58-74, 58-73, 58-79, 58-80, 58-84, 59-74, 59-75, 59-80, 60-79, 60-75, 60-76, 61-80, 61-76, 61-77, 62-77, 63-84, 68-114, 101-123, 98-123, 113-138, 116-138, 131-150, 137-162, 152-186, 158-177, 167-186, 191-215, 196-224, 196-215, 196-218, 199-228, 199-218, 199-224,200-224, 205-224, 206-228, 218-237, 224-243, 233-264, 242-263, 243-262, 244-263, 245-264, 246-266, 247-266, 247-269, 247-270, 245-267, 251-267, 245-266, 250-269, 251-268, 251-269, 245-269, 245-266, 245-261, 250-265, 250-266, 250-267, 250-268, 250-269, 251-266, 251-270, 252-267, 253-268, 253-269, 253-272, 253-274, 254-269, 254-270, 254-274, 255-274, 255-401, 255-400, 255-274, 255-273, 255-272, 255-271, 255-270, 256-271, 256-272, 256-275, 255-276, 256-276, 253-275, 256-279, 257-276, 258-273, 259-274, 260-279, 262-281, 262-321, 262-315, 262-312, 265-312, 266-288, 266-291, 266-285, 281-321, 281-303, 290-321, 290-312, 292-311, 290-312, 293-312, 293-315, 293-321, 296-321, 302-321, 324-343, 339-361, 339-367, 348-367, 342-367, 358-392, 358-378, 360-392, 360-383, 360-388, 360-385, 362-381, 366-388, 369-388, 366-385, 366-392, 370-389, 370-392, 380-399, 382-401, 384-433, 384-400, 384-401, 385-401, 405-424, 409-428, 405-428, 411-430, 411-431, 411-431, 412-431, 411-426, 411-427, 411-430, 411-437, 412-428, 412-431, 412-427, 413-432, 413-428, 413-429, 413-433, 411-427, 414-427, 414-429, 414-430, 414-433, 415-427, 415-428, 415-429, 415-430, 415-431, 415-434, 416-435, 416-432, 416-431, 416-429, 417-432, 417-433, 417-436, 418-437, 418-435, 418-434, 418-433, 419-435, 419-434, 420-435, 419-432, 419-434, 421-436, 422-441, 422-437, 423-436, 425-465, 454-473, 454-472, 457-476, 454-476, 455-472, 457-485, 457-473, 457-472, 458-485, 458-483, 458-477, 458-473, 459-485, 460-485, 463-498, 463-485, 466-485, 463-482, 457-491, 458-491, 459-491, 460-491, 463-491, 466-491, 472-491, 472-493, 473-492, 475-491, 459-494, 460-494, 463-494, 466-494, 467-498, 472-494, 475-494, 457-473, 457-472, 458-494, 454-494, 457-494, 457-473, 485-513, 470-493, 476-519, 485-519, 500-519, 512-534, 512-550, 524-546, 536-559, 548-567, 548-570, 550-570, 548-594, 554-573, 548-576, 560-594, 584-606, 611-645, 617-363, 623-642, 617-645, 639-654, 641-656, 642-657, 642-754, 643-658, 653-672, 662-685, 665-685,665-689, 668-687, 670-689, 670-706, 670-685, 670-686, 671-686, 671-687, 671-690, 671-691, 672-687, 672-688, 672-693, 672-697, 672-707, 673-688, 674-693, 678-693, 679-707, 679-694, 679-698, 679-701, 679-702, 679-707, 680-699, 679-699, 680-695, 681-696, 682-706, 682-707, 682-702, 682-701, 682-697, 683-698, 684-699, 685-700, 686-701, 687-702, 687-703, 687-706, 687-754, 688-703, 688-704, 689-704, 689-705, 689-709, 689-710, 690-705, 690-706, 691-706, 679-705, 679-710, 679-706, 690-710, 691-710, 690-754, 690-706, 684-703, 687-705, 687-703, 687-706, 688-705, 689-708, 690-709, 692-711, 693-716, 693-712, 695-715, 697-716, 697-716, 690-716, 724-746, 724-752, 724-754, 724-758, 733-752, 738-753, 738-754, 739-758, 739-754, 739-775, 739-754, 740-754, 742-785, 742-773, 757-776, 757-785, 790-815, 793-812, 811-833, 811-844, 814-833, 811-906, 820-839, 822-844, 822-867, 823-842, 845-864, 845-867, 854-906, 845-909, 845-906, 854-876, 854-873, 863-882, 863-885, 878-900, 878-897, 887-906, 899-918, 899-933, 899-958, 905-927, 905-933, 914-933, 936-958, 936-955, 945-964, 951-970, 951-985, 951-1044, 951-1024, 951-1056, 951-997, 960-985, 963-1044, 963-1024, 963-997, 966-985, 972-1015, 978-997, 1025-1044, 1031-1056, 1037-1056, 1046-1083, 1049-1068, 1070-1089, 1070-1095, 1082-1101, 1081-1134, 1081-1143, 1082-1101, 1088-1107, 1088-1134, 1094-1119, 1097-1119, 1112-1134, 1118-1143, 1118-1146, 1088-1146, 1121-1140, 1127-1146, 1127-1193, 1150-1193, 1156-1187, 1165-1187, 1170-1192, 1171-1191, 1172-1191, 1176-1192, 1177-1192, 1176-1191, 1203-1297, 1206-1228, 1206-1255, 1209-1228, 1215-1255, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1265, 1251-1280, 1251-1285, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1296, 1259-1290, 1259-1287, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1261-1296, 1262-1277, 1262-1278, 1262-1281, 1262-1285, 1262-1296, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1264-1297, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1296, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1271-1290, 1271-1296, 1277-1296, 1261-1290, 1262-1290, 1268-1290, 1263-1305, 1259-1305, 1259-1305, 1266-1305, 1259-1302, 1275-1294, 1281-1306, 1281-1324, 1281-1336, 1782-1797, 1282-1301, 1286-1306, 1290-1324, 1293-1318, 1290-1324, 1293-1315, 1296-1315, 1311-1336, 1311-1333, 1326-1345, 1353-1381, 1359-1378, 1395-1414, 1498-1532, 1498-1523, 1498-1535, 1510-1529, 1515-1535, 1515-1563, 1515-1596, 1515-1605, 1515-1602, 1515-1540, 1515-1535, 1518-1605, 1518-1602, 1518-1537, 1521-1563, 1521-1540, 1550-1655, 1550-1563, 1550-1569, 1553-1578, 1553-1599, 1553-1590, 1565-1584, 1571-1595, 1577-1606, 1577-1605, 1577-1596, 1577-1592, 1577-1593, 1578-1593, 1578-1594, 1578-1597, 1578-1598, 1579-1594, 1579-1595, 1579-1598, 1571-1598, 1580-1605, 1580-1602, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1582-1602, 1553-1655, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1586-1652, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1642-1664, 1651-1720, 1651-1673, 1655-1679, 1695-1720, 1716-1738, 1743-1763, 1743-1768, 1764-1783, 1773-1792, 1777-1796, 1777-1800, 1778-1800, 1778-1793, 1778-1794, 1778-1797, 1779-1798, 1779-1797, 1779-1796, 1779-1795, 1779-1794, 1780-1796, 1781-1797, 1781-1796, 1781-1800, 1781-1797, 1782-1799, 1784-1800, 1779-1799, 1778-1794, 1779-1795, 1780-1799, 1794-1813, 1780-1795, 1780-1796, 1780-1799, 1781-1796, 1781-1797, 1781-1800, 1782-1798, 1783-1799, 1784-1799, 1784-1800, 1785-1800, 1806-1837, 1806-1828, 1806-1825, 1809-1828, 1812-1843, 1812-1837, 1812-1831, 1815-1843, 1815-1844, 1815-1840, 1815-1834, 1818-1837, 1821-1840, 1821-1844, 1821-1837, 1822-1843, 1822-1839, 1823-1843, 1827-1846, 1861-1884, 1861-1880, 1865-1885, 1867-1886, 1869-1885, 1876-1895, 1888-1914, 1888-1908, 1891-1910, 1891-1914, 1895-1938, 1895-1935, 1913-1935, 1898-1920, 1907-1929, 1913-1935, 1918-1934, 1919-1938, 1919-1934, 1921-1934, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2278-2297, 2281-2300, 2284-2303, 2368-2393, 2381-2397, 2368-2394, 2379-2394, 2381-2396, 2368-2397, 2368-2396, 2420-2439, 2458-2476, 2459-2478, 2819-2838, 2818-2838, 2873-2892 и 3161-3182.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 60% ингибирование: 1-20, 10-29, 10-53, 13-38, 25-50, 43-68, 55-74, 58-84, 58-77, 58-74, 58-73, 58-79, 59-80, 59-74, 59-75, 60-75, 60-76, 61-77, 61-76, 61-80, 62-77, 68-114, 98-123, 101-123, 113-138, 116-138, 131-150, 137-162, 152-186, 191-215, 196-224, 196-215, 199-228, 199-218, 200-223, 199-218, 205-224, 206-228, 218-237, 224-243, 233-263, 244-263, 245-264, 247-266, 250-265, 251-266, 252-267, 253-272, 253-269, 251-267, 253-274, 254-270, 255-276, 256-279, 256-276, 256-274, 256-272, 256-271, 258-273, 259-274, 265-388, 265-284, 266-291, 266-288, 260-279, 281-321, 281-303, 290-321, 290-312, 293-312, 296-315, 302-321, 324-343, 339-367, 339-361, 342-367, 348-367, 358-392, 358-378, 360-392, 360-379, 366-392, 366-385, 369-388, 370-392, 382-401, 405-428, 405-424, 409-428, 411-436, 411-433, 411-431, 411-426, 411-430, 411-427, 412-431, 412-428, 412-427, 413-428, 413-429, 413-433, 414-433, 414-430, 414-429, 414-433, 415-430, 415-431, 415-434, 415-435, 415-436, 416-429, 416-434, 416-431, 416-432, 416-436, 416-435, 417-436, 417-433, 417-432, 418-434, 418-433, 418-437, 419-434, 420-435, 421-436, 422-437, 423-436, 425-465, 454-472, 455-472, 457-476, 457-472, 457-473, 458-485, 458-473, 458-483, 463-498, 467-498, 463-482, 470-493, 472-491, 485-519, 485-513, 500-519, 512-534, 524-546, 536-558, 548-567, 554-573, 548-576, 560-594, 584-606, 608-648, 639-654, 640-656, 641-656, 642-657, 642-658, 643-658, 653-672, 662-685, 665-685, 670-706, 670-689, 670-685, 670-686, 671-690, 671-686, 671-687, 672-707, 672-697, 672-693, 672-687, 672-688, 673-688, 679-707, 679-698, 679-694, 680-695, 681-696, 682-697, 682-701, 683-698, 684-699, 685-700, 686-701, 687-754, 687-702, 687-705, 687-703, 687-706, 688-704, 688-703, 688-704, 688-705, 688-707, 689-710, 689-709, 689-705, 689-704, 690-754, 690-705, 690-706, 691-706, 691-710, 692-711, 697-716, 724-758, 724-754, 724-752, 724-746, 738-754, 738-753, 739-754, 742-785, 757-785, 790-815, 811-906, 811-844, 811-833, 822-867, 822-844, 823-842, 845-867, 854-906, 854-873, 878-897, 899-958, 899-933, 936-958, 945-964, 951-1044, 951-1024, 951-985, 951-997, 963-1044, 963-1024, 963-997, 966-985, 978-997, 1031-1056, 1046-1083, 1070-1095, 1081-1143, 1081-1134, 1082-1101, 1088-1146, 1088-1134, 1118-1146, 1118-1143, 1127-1193, 1170-1189, 1176-1192, 1176-1191, 1177-1192, 1203-1297, 1206-1255, 1209-1228, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1251-1270, 1251-1285, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1276, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1281, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1279, 1263-1282, 1264-1297, 1264-1279, 1264-1280, 1264-1283, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1287, 1269-1284, 1269-1285, 1270-1285, 1281-1336, 1281-1324, 1281-1306, 1286-1305, 1290-1324, 1311-1336, 1326-1345, 1353-1381, 1395-1414, 1498-1535, 1498-1532, 1515-1535, 1515-1534, 1521-1540, 1550-1655, 1553-1599, 1553-1590, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1595, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1642-1664, 1651-1720, 1716-1738, 1743-1763, 1764-1783, 1773-1792, 1777-1800, 1777-1797, 1655-1674, 1778-1794, 1778-1800, 1781-1800, 1781-1797, 1784-1800, 1779-1799, 1778-1794, 1778-1797, 1779-1795, 1779-1798, 1780-1795, 1780-1796, 1780-1799, 1781-1796, 1781-1797, 1781-1800, 1782-1797, 1794-1813, 1806-1837, 1806-1825, 1812-1837, 1812-1831, 1815-1844, 1815-1834, 1818-1837, 1821-1837, 1822-1838, 1827-1846, 1861-1884, 1821-1840, 1866-1885, 1867-1886, 1888-1914, 1888-1907, 1891-1914, 1895-1938, 1895-1935, 1919-1938, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2278-2297, 2281-2300, 2284-2303, 2368-2397, 2368-2396, 2368-2394, 2368-2393, 2379-2394, 2381-2396, 2420-2439, 2458-2476, 2819-2838, 2873-2892 и 3161-3182.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 65% ингибирование: 1-20, 10-29, 10-53, 13-38, 25-50, 43-68, 55-74, 58-84, 58-79, 58-74, 58-73, 58-77, 59-75, 59-80, 58-77, 60-75, 60-76, 61-77, 61-76, 61-80, 62-77, 68-114, 98-123, 101-123, 113-138, 116-138, 131-150, 137-162, 152-186, 191-215, 196-215, 199-228, 199-218, 200-223,199-218, 205-224, 206-228, 218-237, 224-243, 233-263, 244-263, 245-264, 250-265, 251-266, 253-269, 253-274, 255-276, 256-279, 256-276, 256-274, 256-272, 256-271, 247-266, 253-272, 258-273, 266-291, 266-288, 260-279, 281-321, 281-303, 290-321, 290-312, 296-315, 293-312, 302-321, 324-343, 339-367, 339-361, 342-367, 348-367, 358-392, 358-378, 360-392, 360-379, 366-392, 366-385, 369-388, 370-392, 382-401, 405-428, 405-424, 409-428, 411-433, 411-431, 411-430, 411-427, 411-426, 412-431, 412-428, 412-427, 413-433, 413-428, 413-429, 413-432, 414-433, 414-430, 414-429, 415-430, 415-431, 415-434, 415-435, 415-436, 416-434, 416-436, 416-435, 416-432, 416-431, 417-436, 417-433, 417-432, 418-433, 418-434, 418-437, 420-435, 422-437, 423-436, 425-465, 454-472, 455-472, 457-472, 458-485, 458-483, 458-473, 463-498, 467-498, 457-476, 470-493, 472-491, 485-519, 485-513, 500-519, 512-534, 524-546, 536-558, 548-567, 554-573, 548-576, 560-594, 584-606, 608-648, 639-654, 640-656, 641-656, 642-657, 642-658, 643-658, 653-672, 662-685, 665-685, 670-685, 670-706, 670-689, 670-686, 670-685, 671-686, 671-687, 671-690, 672-688, 672-687, 672-707, 672-697, 672-693, 673-688, 679-698, 680-695, 681-696, 682-697, 682-701, 683-698, 684-699, 685-700, 686-701, 687-702, 688-703, 688-707, 687-754, 690-754, 690-706, 690-705, 687-705, 687-703, 687-706, 687-702, 688-705, 688-703, 688-704, 689-705, 691-706, 692-711, 697-716, 724-758, 724-754, 724-752, 724-746, 738-754, 739-754, 742-785, 757-785, 790-815, 811-906, 811-844, 811-833, 822-867, 822-844, 823-842, 845-867, 854-906, 854-873, 878-897, 899-958, 899-933, 936-958, 945-964, 951-1044, 951-1024, 951-985, 951-997, 963-1044, 963-1024, 963-997, 966-985, 978-997, 1031-1056, 1046-1083, 1070-1095, 1081-1143, 1081-1134, 1082-1101, 1088-1146, 1088-1134, 1118-1146, 1118-1143, 1127-1193, 1170-1189, 1176-1192, 1177-1192, 1203-1297, 1206-1255, 1209-1228, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1251-1270, 1251-1285, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1281, 1262-1277, 1262-1278, 1263-1278, 1263-1279, 1263-1282, 1264-1297, 1264-1279, 1264-1280, 1264-1283, 1265-1280, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1287, 1269-1284, 1269-1285, 1270-1285, 1281-1336, 1281-1324, 1281-1306, 1290-1324, 1311-1336, 1326-1345, 1353-1381, 1395-1414, 1498-1535, 1498-1532, 1515-1535, 1515-1534, 1550-1655, 1553-1599, 1553-1590, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1595, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1642-1664, 1651-1720, 1655-1674, 1716-1738, 1743-1763, 1764-1783, 1773-1792, 1777-1800, 1777-1797, 1778-1800, 1778-1797, 1779-1799, 1778-1794, 1779-1794, 1779-1795, 1779-1798, 1780-1796, 1780-1799, 1780-1795, 1781-1796, 1781-1797, 1781-1800, 1782-1797, 1794-1813, 1806-1837, 1806-1825, 1812-1837, 1812-1831, 1815-1844, 1815-1834, 1818-1837, 1821-1837, 1822-1838, 1827-1846, 1861-1884, 1866-1885, 1867-1886, 1888-1914, 1888-1907, 1891-1914, 1895-1938, 1895-1935, 1919-1938, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2278-2297, 2281-2300, 2284-2303, 2368-2397, 2368-2396, 2368-2394, 2368-2393, 2379-2394, 2381-2396, 2420-2439, 2458-2476, 2819-2838, 2873-2892 и 3161-3182.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 70% ингибирование: 1-20, 10-29, 10-53, 13-38, 25-50, 43-68, 55-74, 58-84, 58-79, 58-74, 59-75, 59-80, 58-77, 60-75, 60-76, 61-77, 68-114, 98-123, 101-123, 113-138, 116-138, 131-150, 137-162, 152-186, 191-215, 199-228, 199-218, 200-223, 205-224, 206-228, 218-237, 224-243, 233-263, 244-263, 245-264, 253-269, 253-274, 255-276, 256-279, 256-276, 256-274, 256-272, 247-266, 250-265, 251-266, 253-272, 256-271, 266-291, 266-288, 260-279, 281-321, 281-303, 290-321, 290-312, 293-312, 302-321, 324-343, 339-367, 339-361, 342-367, 348-367, 358-392, 358-378, 360-392, 360-379, 366-392, 366-385, 370-392, 382-401, 405-428, 405-424, 409-428, 411-433, 411-431, 411-430, 411-427, 411-426, 412-431, 412-428, 412-427, 413-428, 413-429, 413-432, 414-433, 414-430, 414-429, 415-430, 414-433, 415-434, 415-435, 415-436, 416-431, 416-434, 416-436, 416-435, 416-432, 417-436, 417-433, 418-433, 418-437, 423-436, 425-465, 454-472, 455-472, 457-472, 457-476, 458-473, 458-485, 458-483, 463-498, 467-498, 457-476, 470-493, 470-493, 472-491, 485-519, 485-513, 485-519, 485-513, 500-519, 512-534, 524-546, 536-558, 548-567, 554-573, 548-576, 560-594, 584-606, 608-648, 639-654, 640-656, 641-656, 642-657, 642-658, 643-658, 653-672, 662-685, 665-685, 670-706, 670-689, 670-685, 670-686, 671-690, 671-686, 671-687, 672-687, 672-688, 672-707, 672-697, 672-693, 673-688, 679-698, 681-696, 682-697, 682-701, 683-698, 684-699, 686-701, 687-702, 687-754, 687-702, 688-703, 690-754, 690-706, 687-705, 687-703, 687-706, 692-711, 697-716, 724-758, 724-754, 724-752, 724-746, 738-754, 739-754, 738-754, 742-785, 757-785, 790-815, 811-906, 811-844, 811-833, 822-867, 822-844, 845-867, 854-906, 854-873, 878-897, 899-958, 899-933, 936-958, 945-964, 951-1044, 951-1024, 951-985, 951-997, 963-1044, 963-1024, 963-997, 966-985, 978-997, 1031-1056, 1046-1083, 1070-1095, 1081-1143, 1081-1134, 1082-1101, 1088-1146, 1088-1134, 1118-1146, 1118-1143, 1127-1193, 1170-1189, 1176-1192, 1177-1192, 1203-1297, 1206-1255, 1209-1228, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1251-1285, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1281, 1262-1277, 1262-1278, 1263-1278, 1263-1279, 1263-1282, 1264-1297, 1264-1279, 1264-1280, 1264-1283, 1265-1281, 1265-1284, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1287, 1269-1284, 1269-1285, 1270-1285, 1281-1336, 1281-1324, 1281-1306, 1290-1324, 1311-1336, 1326-1345, 1353-1381, 1395-1414, 1498-1535, 1498-1532, 1515-1535, 1550-1655, 1553-1599, 1553-1590, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1595, 1579-1598, 1580-1595, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1602, 1586-1605, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1642-1664, 1651-1720, 1716-1738, 1743-1763, 1764-1783, 1773-1792, 1777-1800, 1777-1797, 1778-1800, 1778-1797, 1779-1799, 1778-1794, 1779-1795, 1779-1798, 1780-1795, 1780-1796, 1780-1799, 1781-1800, 1782-1797, 1794-1813, 1806-1837, 1806-1825, 1812-1837, 1812-1831, 1815-1844, 1815-1834, 1818-1837, 1821-1837, 1822-1838, 1827-1846, 1861-1884, 1866-1885, 1867-1886, 1888-1914, 1888-1907, 1891-1914, 1895-1938, 1895-1935, 1919-1938, 1928-1956, 1957-1976, 2035-2057, 2083-2141, 2230-2261, 2278-2297, 2281-2300, 2284-2303, 2368-2397, 2368-2396, 2368-2394, 2368-2393, 2379-2394, 2381-2396, 2420-2439, 2458-2476, 2819-2838, 2873-2892 и 3161-3182.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 75% ингибирование: 13-32, 16-35, 19-38, 25-44, 28-47, 31-50, 43-62, 46-65, 49-68, 55-74, 58-82, 58-74, 58-77, 59-75, 60-75, 60-76, 61-77, 65-84, 98-117, 101-120, 104-123, 116-135, 119-138, 131-150, 137-156, 140-159, 143-162, 158-177, 161-180, 164-183, 167-186,200-219,203-226, 209-228, 218-237, 233-252, 236-255, 239-258, 242-264, 247-266, 251-266, 253-272, 255-276, 266-285, 269-288, 281-300, 284-303, 290-313, 298-317, 302-321, 324-343, 339-358, 342-361, 348-367, 358-381, 364-383, 366-386, 370-389, 373-392, 382-401, 405-424, 409-428, 411-430, 411-426, 411-427, 412-427, 412-431, 413-428, 413-429, 413-432, 414-436, 414-430, 414-429, 415-430, 416-431, 416-432, 417-433, 418-437, 422-441, 425-444, 428-447, 434-453, 440-459, 443-462, 446-465, 456-477, 458-473, 464-483, 470-493, 476-495, 479-498, 488-507, 491-510, 494-513, 500-519, 512-531, 515-534, 524-543, 527-546, 536-555, 539-558, 560-579, 566-585, 569-588, 572-591, 575-594, 584-603, 587-606, 608-627, 614-633, 617-636, 620-639, 623-642, 626-645, 629-648, 639-654, 641-656, 642-657, 643-658, 653-672, 665-684, 668-688, 670-706, 670-686, 670-685, 671-691, 671-687, 671-686, 672-688, 673-688, 679-703, 681-696, 682-697, 686-701, 686-706, 687-702, 687-703, 688-703, 689-708, 693-712, 695-714, 696-715, 697-716, 727-746, 739-754, 742-761, 748-767, 751-770, 754-773, 757-776, 760-779, 763-782, 766-785, 790-809, 793-812, 796-815, 811-830, 814-833, 817-836, 820-839, 822-844, 845-864, 854-873, 857-876, 863-882, 866-885, 872-891, 875-894, 878-897, 881-900, 884-903, 887-906, 899-918, 902-921, 905-924, 908-927, 911-930, 914-933, 936-955, 939-958, 951-970, 954-973, 957-976, 960-979, 963-982, 966-985, 969-988, 972-991, 975-994, 978-997, 996-1015, 1002-1021, 1025-1044, 1031-1050, 1034-1053, 1037-1056, 1046-1065, 1049-1068, 1052-1071, 1055-1074, 1058-1077, 1061-1080, 1064-1083, 1070-1089, 1073-1092, 1076-1095, 1082-1101, 1088-1107, 1094-1113, 1097-1116, 1100-1119, 1103-1122, 1106-1125, 1109-1128, 1112-1131, 1115-1134, 1121-1140, 1127-1146, 1153-1172, 1156-1175, 1159-1178, 1162-1181, 1165-1184, 1168-1191, 1174-1193, 1206-1225, 1209-1228, 1212-1231, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1239-1258, 1242-1261, 1245-1264, 1251-1270, 1254-1273, 1254-1279, 1257-1283, 1257-1276, 1258-1277, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1277, 1262-1278, 1263-1278, 1263-1279, 1263-1282, 1264-1279, 1264-1280, 1264-1283, 1265-1281, 1265-1284, 1266-1281, 1266-1282, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1268-1287, 1269-1284, 1269-1285, 1270-1285, 1272-1291, 1275-1294, 1282-1303, 1286-1306, 1290-1309, 1293-1312, 1296-1315, 1299-1318, 1305-1324, 1311-1330, 1314-1333, 1317-1336, 1353-1381, 1356-1375, 1359-1378, 1498-1517, 1501-1520, 1504-1523, 1510-1529, 1553-1572, 1556-1575, 1559-1578, 1562-1581, 1565-1584, 1571-1590, 1574-1599, 1577-1606, 1577-1592, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1594, 1579-1595, 1579-1598, 1580-1595, 1580-1596, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1598, 1582-1601, 1582-1602, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1600, 1584-1603, 1585-1600, 1585-1601, 1585-1604, 1586-1601, 1586-1605, 1586-1602, 1587-1602, 1587-1603, 1587-1606, 1588-1603, 1588-1604, 1589-1604, 1589-1605, 1590-1605, 1590-1606, 1591-1606, 1604-1623, 1607-1626, 1630-1649, 1633-1652, 1645-1664, 1651-1670, 1654-1674, 1657-1676, 1660-1679, 1663-1682, 1666-1685, 1689-1708, 1695-1714, 1698-1717, 1701-1720, 1716-1735, 1778-1797, 1778-1794, 1778-1797, 1779-1795, 1779-1798, 1780-1795, 1780-1796, 1780-1799, 1781-1800, 1794-1813, 1895-1914, 1898-1917, 1901-1920, 1907-1926, 1910-1929, 1913-1932, 1916-1935, 1919-1938, 2278-2297, 2281-2300 и 2284-2303.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 80% ингибирование: 13-32, 16-35, 19-38, 25-44, 28-47, 46-65, 49-68, 58-77, 59-80, 63-82, 98-120, 116-135, 137-159, 158-177, 167-186, 203-224, 205-224, 209-228, 218-237, 233-252, 236-263, 245-264, 253-272, 256-275, 257-276, 266-288, 281-300, 290-312, 293-312, 324-343, 339-358, 348-367, 358-378, 360-379, 361-383, 366-385, 373-392, 382-401, 405-424, 411-431, 411-426, 411-427, 411-430, 413-428, 414-433, 414-434, 415-430, 415-434, 416-431, 416-435, 417-436, 418-437, 422-441, 425-444, 434-453, 456-476, 458-473, 458-477, 464-483, 471-493, 488-507, 494-513, 512-531, 524-543, 527-546, 536-558, 560-579, 566-585, 572-591, 575-594, 584-603, 587-606, 608-627, 614-633, 617-636, 620-639, 623-642, 626-645, 629-648, 639-654, 641-656, 642-657, 643-658, 665-688, 670-687, 670-686, 671-686, 671-687, 671-691, 673-688, 679-699, 682-697, 682-706, 686-701, 687-702, 687-706, 687-703, 693-715, 727-746, 742-761, 748-767, 757-776, 766-785, 790-815, 814-833, 820-839, 822-844, 845-864, 854-873, 854-876, 863-885, 872-906, 878-897, 899-918, 905-933, 936-955, 951-979, 963-985, 966-985, 972-1015, 978-997, 1002-1021, 1025-1044, 1031-1056, 1049-1074, 1061-1083, 1070-1089, 1082-1101, 1088-11107, 1094-1119, 1109-1134, 1121-1140, 1127-1146, 1159-1187, 1171-1191, 1206-1228, 1209-1228, 1215-1255, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1264, 1251-1279, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1282, 1264-1279, 1264-1283, 1265-1284, 1266-1285, 1267-1282, 1267-1283, 1268-1283, 1268-1284, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1275-1294, 1282-1301, 1286-1306, 1293-1318, 1311-1333, 1326-1345, 1359-1378, 1553-1578, 1565-1584, 1571-1590, 1574-1599, 1577-1592, 1577-1596, 1577-1593, 1577-1596, 1578-1593, 1578-1594, 1578-1597, 1579-1595, 1579-1598, 1580-1596, 1580-1599, 1581-1596, 1581-1597, 1581-1600, 1582-1597, 1582-1601, 1582-1602, 1583-1598, 1583-1599, 1583-1602, 1584-1599, 1584-1603, 1585-1601, 1585-1604, 1586-1605, 1587-1602, 1587-1606, 1588-1603, 1589-1604, 1589-1605, 1657-1679, 1780-1795, 1780-1796, 1780-1799, 1913-1935, 2278-2297, 2281-2300 и 2284-2303.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 85% ингибирование: 13-32, 16-35, 19-38, 25-44, 46-65, 59-80, 101-120, 140-159, 158-177, 167-186, 200-219, 205-224, 209-228, 233-252, 242-263, 253-272, 266-285, 281-300, 290-311, 293-312, 359-379, 361-381, 370-389, 382-401, 411-426, 411-430, 411-427, 413-428, 414-433, 415-430, 416-435, 417-436, 422-441, 456-476, 458-473, 470-493, 512-531, 524-543, 536-558, 566-585, 575-594, 587-606, 608-627, 614-636, 623-645, 639-654, 665-687, 671-686, 671-687, 680-699, 682-703, 687-706, 687-703, 727-746, 742-761, 757-776, 793-812, 822-843, 854-876, 854-873, 863-885, 878-900, 878-897, 887-906, 899-918, 905-927, 914-933, 936-955, 951-985, 966-985, 972-1015, 978-997, 1002-1021, 1025-1044, 1037-1056, 1049-1074, 1064-1083, 1070-1089, 1088-1107, 1094-1119, 1109-1128, 1121-1140, 1156-1175, 1162-1187, 1172-1191, 1206-1228, 1209-1228, 1215-1255, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1264, 1251-1279, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261-1276, 1261-1277, 1261-1280, 1262-1277, 1262-1278, 1262-1281, 1263-1278, 1263-1282, 1264-1279, 1264-1283, 1265-1284, 1266-1285, 1267-1282, 1267-1283, 1268-1284, 1269-1284, 1269-1285, 1269-1288, 1270-1285, 1275-1294, 1282-1301, 1293-1315, 1311-1330, 1359-1378, 1574-1593, 1577-1592, 1577-1593, 1577-1596, 1577-1606, 1578-1593, 1578-1594, 1578-1597, 1579-1598, 1580-1596, 1580-1599, 1581-1597, 1581-1600, 1582-1601, 1583-1598, 1583-1602, 1584-1603, 1585-1601, 1585-1604, 1586-1605, 1587-1602, 1588-1603, 1780-1799, 1780-1796 и 2278-2297,2281-2300 и 2284-2303.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 90% ингибирование: 13-32, 16-35, 60-80, 140-159, 158-177, 167-186, 242-261, 292-311, 362-381, 370-389, 382-401, 411-427, 411-426, 413-428, 415-430, 416-435, 422-441, 473-492, 617-636, 623-642, 639-654, 668-687, 680-699, 682-701, 684-703, 687-706, 727-746, 757-776, 824-843, 854-873, 854-876, 863-882, 878-897, 878-900, 887-906, 899-918, 905-927, 914-933, 936-955, 951-970, 960-985, 966-985, 972-1015, 978-997, 1025-1044, 1037-1056, 1070-1089, 1097-1119, 1109-1128, 1121-1140, 1165-1187, 1172-1191, 1206-1228, 1209-1228, 1215-1234, 1215-1234, 1215-1255, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1264, 1251-1279, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261-1280, 1262-1278, 1261-1276, 1262-1281, 1262-1277, 1263-1282, 1263-1278, 1264-1283, 1265-1284, 1266-1285, 1268-1284, 1269-1284, 1269-1285, 1269-1288, 1296-1315, 1577-1605, 1577-1596, 1577-1593, 1577-1592, 1578-1597, 1581-1600, 1582-1601, 1583-1602, 1583-1598, 1585-1601, 1585-1604, 1586-1605, 1588-1603, 1780-1799, 1780-1796, 2278-2297, 2281-2300 и 2284-2303.

В некоторых вариантах реализации, следующие нуклеотидные области последовательности SEQ ID NO:1, при направленном действии антисмысловых соединений или олигонуклеотидов, демонстрируют по меньшей мере 95% ингибирование: 411-426, 411-427, 413-428, 617-636, 623-642, 668-687, 680-699, 682-701, 854-873, 878-897, 887-906, 914-933, 966-985, 978-997, 1209-1228, 1215-1234, 1218-1237, 1221-1240, 1224-1243, 1227-1246, 1230-1249, 1233-1252, 1236-1255, 1245-1264, 1251-1270, 1254-1273, 1254-1279, 1257-1276, 1258-1277, 1259-1278, 1260-1279, 1261-1285, 1261-1280, 1262-1281, 1263-1282, 1263-1278, 1264-1283, 1265-1284, 1266-1285, 1268-1284, 1269-1288, 1577-1592, 1577-1596, 1577-1601, 1583-1598, 1585-1601, 1588-1603, 1780-1799, 2278-2297, 2281-2300 и 2284-2303.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 50% ингибирование мРНК HBV, ISIS ID: 510088, 510089, 510090, 510092, 510096, 510097, 510098, 510099, 510100, 510101, 510102, 505330, 509928, 510104, 509929, 510105, 509930, 510106, 510107, 510108, 510111, 510115, 509931, 510116, 510117, 510118, 510119, 510120, 510121, 509932, 510122, 509933, 510123, 509934, 510124, 509935, 510125, 510126, 510127, 510128, 510140, 146779, 505314, 505315, 505316, 505317, 146821, 505318, 509922, 505319, 509925, 505320, 509952, 505321, 505322, 505323, 505324, 505325, 505326, 505327, 505328, 505329, 509956, 509957, 509927, 509958, 510038, 505330, 509959, 510039, 509960, 510040, 509961, 510041, 509962, 509963, 505331, 505332, 509968, 509969, 510050, 510052, 505333, 505334, 505335, 505336, 509972, 146823, 509974, 505338, 505339, 509975, 505340, 509978, 505341, 509979, 510058, 505342, 509981, 510061, 505344, 505345, 509983, 505346, 509984, 505347, 505348, 505350, 505352, 505353, 505354, 505355, 505356, 146786, 505357, 505358, 505359, 505360, 509985, 509986, 509987, 509988, 505363, 505364, 505365, 505366, 146787, 510079, 524410, 524411, 524413, 524414, 524415, 524416, 524417, 524418, 524419, 524420, 524421, 524422, 524424, 524425, 524426, 524427, 524428, 524429, 524431, 524432, 524433, 524434, 524435, 524436, 524439, 524440, 524442, 524444, 524446, 524447, 524448, 524450, 524451, 524452, 524453, 524454, 524455, 524456, 524457, 524458, 524459, 524460, 524461, 524462, 524464, 524466, 524467, 524468, 524469, 524470, 524471, 524472, 524473, 524474, 524475, 524477, 524478, 524479, 524480, 524481, 524482, 524483, 524484, 524485, 524486, 524487, 524489, 524490, 524491, 524492, 524493, 524494, 524495, 524496, 524498, 524499, 524500, 524501, 524502, 524503, 524504, 524506, 524507, 524508, 524509, 524510, 524511, 524512, 524513, 524514, 524515, 524516, 524517, 524518, 524519, 524520, 524521, 524522, 524523, 524524, 524525, 524526, 524527, 524528, 524529, 524530, 524531, 524532, 524533, 524534, 524535, 524536, 524537, 524538, 524539, 524540, 524541, 524543, 524544, 524546, 524547, 524548, 524549, 524550, 524551, 524552, 524553, 524554, 524555, 524556, 524557, 524558, 524559, 524560, 524561, 524562, 524563, 524564, 524565, 524568, 524569, 524570, 524571, 524572, 524573, 524574, 524575, 524576, 524577, 524578, 524579, 524580, 524581, 524582, 524584, 524585, 524586, 524587, 524588, 524589, 524590, 524591, 524592, 524593, 524594, 524595, 524598, 524599, 524600, 524601, 524602, 524603, 524604, 524605, 524606, 524607, 524608, 524609, 524610, 524611, 524614, 524615, 524616, 524617, 524618, 524619, 524620, 524621, 524622, 524623, 524624, 524625, 524626, 524627, 524629, 524632, 524633, 524634, 524635, 524636, 524637, 524638, 524639, 524640, 524641, 524642, 524643, 524644, 524646, 524647, 524648, 524649, 524650, 524651, 524652, 524654, 524656, 524657, 524658, 524659, 524660, 524661, 524662, 524663, 524664, 524665, 524666, 524667, 524668, 524669, 524670, 524672, 524673, 524675, 524676, 524678, 524679, 524680, 524682, 524683, 524684, 524685, 524686, 524687, 524688, 524689, 524690, 524691, 524692, 524693, 524694, 524695, 524696, 524697, 524698, 524699, 524700, 524701, 524702, 524703, 524704, 524705, 524706, 524707, 524708, 524709, 524710, 524712, 524713, 524714, 524715, 524716, 524717, 524718, 524719, 524721, 524722, 524723, 524724, 524726, 524727, 524728, 524729, 524730, 524731, 524732, 524733, 524734, 524735, 524736, 524737, 524738, 524739, 524740, 524741, 524742, 524743, 524744, 524745, 524746, 524747, 524748, 524749, 524750, 524751, 524752, 524753, 524754, 524755, 524756, 524757, 524758, 524759, 524760, 524761, 524762, 524763, 524764, 524765, 524766, 524767, 524768, 524769, 524770, 524771, 524772, 524773, 524774, 524775, 524776, 524777, 524778, 524779, 524780, 524781, 524782, 524783, 524784, 524785, 524786, 524787, 524788, 524789, 524790, 524791, 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524799, 524800, 524801, 524802, 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 524811, 524812, 524813, 524814, 524815, 524816, 524817, 524818, 524819, 524820, 524821, 524822, 524823, 524824, 524825, 524826, 524827, 524828, 524829, 524830, 524831, 524632, 524833, 524834, 524835, 524842, 524843, 524844, 524845, 524847, 524848, 524856, 524857, 524861, 524866, 524867, 524868, 524869, 524870, 524871, 524872, 524873, 524875, 524876, 524877, 524878, 524879, 524880, 524881, 524882, 524883, 524884, 524885, 524886, 524887, 524888, 524889, 524890, 524891, 524892, 524893, 524894, 524895, 524896, 524897, 524898, 524899, 524900, 524901, 524902, 524903, 524904, 524905, 524906, 524907, 524908, 524909, 524910, 524911, 524912, 524913, 524914, 524915, 524916, 524917, 524918, 524919, 524921, 524922, 524923, 524924, 524925, 524926, 524927, 524928, 524929, 524930, 524931, 524932, 524933, 524934, 524935, 524936, 524937, 524938, 524939, 524940, 524941, 524942, 524943, 524944, 524945, 524946, 524947, 524948, 524949, 524950, 524951, 524952, 524953, 524954, 524955, 524956, 524957, 524958, 524959, 524960, 524961, 524962, 524964, 524965, 524976, 524977, 524978, 524979, 524980, 524981, 524982, 524983, 524984, 524985, 524986, 524987, 524988, 524989, 524991, 524992, 524993, 524994, 524997, 524998, 525021, 525022, 525037, 525039, 525043, 525050, 525052, 525086, 525090, 525100, 551909, 551910, 551911, 551912, 551913, 551916, 551917, 551918, 551919, 551920, 551921, 551922, 551923, 551924, 551925, 551926, 551927, 551928, 551929, 551930, 551932, 551933, 551934, 551935, 551936, 551937, 551939, 551940, 551941, 551942, 551943, 551944, 551945, 551946, 551947, 551948, 551949, 551950, 551951, 551952, 551953, 551954, 551955, 551956, 551957, 551958, 551959, 551960, 551962, 551963, 551964, 551965, 551966, 551967, 551968, 551971, 551972, 551973, 551974, 551975, 551976, 551977, 551978, 551979, 551980, 551981, 551982, 551983, 551984, 551985, 551986, 551987, 551988, 551989, 551990, 551992, 551993, 551994, 551995, 551996, 551997, 551998, 551999, 552000, 552001, 552002, 552003, 552004, 552005, 552006, 552007, 552009, 552010, 552011, 552012, 552013, 552014, 552015, 552016, 552017, 552018, 552019, 552020, 552021, 552022, 552023, 552024, 552025, 552026, 552027, 552028, 552029, 552030, 552031, 552032, 552033, 552034, 552035, 552036, 552037, 552038, 552039, 552040, 552041, 552042, 552043, 552044, 552045, 552046, 552047, 552048, 552049, 552050, 552051, 552052, 552053, 552054, 552055, 552056, 552057, 552058, 552059, 552060, 552061, 552062, 552063, 552064, 552065, 552067, 552068, 552069, 552070, 552071, 552072, 552073, 552074, 552075, 552076, 552077, 552078, 552079, 552080, 552081, 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552090, 552091, 552092, 552093, 552094, 552095, 552096, 552097, 552098, 552099, 552100, 552101, 552102, 552114, 552115, 552116, 552117, 552118, 552119, 552122, 552123, 552124, 552125, 552126, 552127, 552128, 552129, 552131, 552132, 552133, 552134, 552135, 552136, 552137, 552138, 552139, 552140, 552141, 552142, 552143, 552144, 552145, 552146, 552147, 552148, 552149, 552150, 552151, 552152, 552153, 552154, 552155, 552158, 552159, 552160, 552161, 552162, 552163, 552164, 552165, 552167, 552168, 552169, 552170, 552171, 552175, 552176, 552177, 552178, 552179, 552180, 552181, 552182, 552183, 552185, 552186, 552187, 552188, 552189, 552191, 552192, 552193, 552194, 552195, 552196, 552197, 552198, 552199, 552200, 552201, 552202, 552203, 552204, 552205, 552206, 552207, 552208, 552209, 552210, 552211, 552212, 552213, 552214, 552215, 552216, 552217, 552218, 552220, 552222, 552224, 552225, 552230, 552239, 552240, 552241, 552242, 552243, 552246, 552247, 552248, 552249, 552250, 552251, 552252, 552253, 552254, 552255, 552256, 552257, 552258, 552259, 552260, 552261, 552262, 552263, 552264, 552265, 552266, 552267, 552268, 552269, 552270, 552271, 552279, 552285, 552288, 552293, 552294, 552295, 552296, 552297, 552300, 552301, 552302, 552303, 552304, 552305, 552306, 552307, 552308, 552309, 552310, 552312, 552313, 552314, 552315, 552316, 552317, 552318, 552319, 552320, 552321, 552322, 552323, 552325, 552326, 552330, 552331, 552332, 552333, 552337, 552338, 552339, 552340, 552341, 552342, 552343, 552344, 552345, 552347, 552348, 552349, 552350, 552351, 552352, 552354, 552355, 552356, 552357, 552358, 552359, 552360, 552361, 552362, 552363, 552364, 552365, 552366, 552367, 552368, 552369, 552370, 552371, 552372, 552373, 552374, 552375, 552376, 552377, 552378, 552379, 552380, 552385, 552386, 552390, 552391, 552393, 552394, 552395, 552396, 552397, 552398, 552399, 552400, 552401, 552402, 552403, 552408, 552409, 552410, 552411, 552412, 552413, 552414, 552415, 552416, 552417, 552418, 552419, 552420, 552421, 552422, 552423, 552424, 552425, 552428, 552430, 552431, 552432, 552433, 552440, 552442, 552443, 552444, 552445, 552446, 552447, 552448, 552449, 552450, 552452, 552453, 552455, 552456, 552458, 552459, 552464, 552465, 552466, 552467, 552468, 552469, 552470, 552471, 552472, 552473, 552474, 552475, 552476, 552477, 552478, 552479, 552480, 552481, 552482, 552484, 552485, 552486, 552487, 552488, 552490, 552491, 552493, 552497, 552499, 552500, 552501, 552502, 552503, 552504, 552505, 552506, 552508, 552509, 552510, 552511, 552512, 552513, 552514, 552515, 552516, 552517, 552520, 552521, 552522, 552523, 552525, 552526, 552527, 552528, 552529, 552530, 552531, 552532, 552533, 552534, 552535, 552538, 552539, 552540, 552541, 552542, 552544, 552547, 552548, 552553, 552554, 552555, 552557, 552558, 552559, 552561, 552562, 552565, 552566, 552567, 552568, 552569, 552570, 552571, 552572, 552576, 552577, 552578, 552579, 552580, 552581, 552582, 552583, 552584, 552585, 552586, 552587, 552588, 552589, 552590, 552591, 552592, 552594, 552595, 552596, 552597, 552598, 552600, 552606, 552608, 552787, 552788, 552789, 552790, 552791, 552794, 552795, 552796, 552797, 552798, 552799, 552800, 552801, 552802, 552803, 552804, 552805, 552806, 552807, 552808, 552809, 552810, 552811, 552812, 552813, 552814, 552815, 552816, 552817, 552818, 552819, 552820, 552821, 552822, 552823, 552824, 552825, 552826, 552827, 552828, 552829, 552830, 552831, 552832, 552833, 552834, 552835, 552836, 552837, 552838, 552839, 552840, 552841, 552842, 552843, 552844, 552845, 552846, 552847, 552848, 552849, 552850, 552851, 552852, 552853, 552854, 552855, 552856, 552857, 552858, 552859, 552860, 552861, 552862, 552863, 552864, 552865, 552866, 552868, 552870, 552871, 552872, 552876, 552889, 552890, 552891, 552892, 552893, 552894, 552895, 552896, 552898, 552899, 552901, 552902, 552903, 552904, 552905, 552907, 552908, 552909, 552910, 552911, 552912, 552913, 552914, 552915, 552916, 552917, 552918, 552919, 552922, 552923, 552925, 552926, 552927, 552928, 552929, 552930, 552931, 552932, 552933, 552934, 552935, 552936, 552937, 552938, 552939, 552940, 552941, 552942, 552943, 552944, 552945, 552946, 552947, 552948, 552950, 552951, 552953, 552954, 552955, 552956, 552957, 552958, 552959, 552960, 552961, 552965, 552966, 552969, 552970, 552971, 552972, 552973, 552974, 552975, 552976, 552977, 552979, 552980, 552981, 552982, 552983, 552984, 552987, 552988, 552989, 552990, 552991, 552992, 552993, 552994, 552995, 552996, 552997, 552998, 552999, 553000, 553001, 553002, 553003, 553004, 553005, 553006, 553007, 553008, 553009, 553010, 553011, 553012, 553014, 553015, 553016, 566828, 566829, 566830, 566831, 566832, 577120, 577121, 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577129, 577130, 577131, 577132, 577133, 577134, 577135, 577136, 582665 и 582666.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 50% ингибирование мРНК HBV, SEQ ID NO:5, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 33, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 74, 83, 85, 86, 87, 88, 89, 92, 96, 98, 99, 100, 102, 103, 104, 106, 108, 109, 111, 112, 115, 117,121, 122, 123, 124, 125, 126, 127, 128, 136, 137, 139, 140, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 153, 155, 157, 159, 161, 165, 166, 167, 168, 169, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 186, 187, 188, 189, 190, 191, 192, 193, 194, 197, 198, 199, 201, 203, 206, 207, 208, 209, 210, 211, 212, 213, 215, 217, 218, 220, 221, 222, 224, 225, 226, 227, 228, 230, 231, 232, 233, 234, 235, 236, 237, 240, 241, 242, 243, 244, 250, 283, 321, 322, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 335, 336, 337, 338, 339, 340, 342, 343, 344, 345, 346, 347, 350, 351, 353, 355, 357, 358, 359, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 399, 400, 401, 402, 403, 404, 405, 406, 408, 409, 410, 411, 412, 413, 414, 416, 417, 418, 419, 420 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 453, 454, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 473, 474, 475, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 539, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 564, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 582, 583, 585, 586, 588, 589, 590, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 622, 623, 624, 625, 626, 627, 628, 629, 631, 632, 633, 634, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 754, 755, 756, 757, 759, 760, 768, 769, 773, 777, 778, 779, 780, 781, 782, 783, 784, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 876, 877, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 903, 904, 905, 906, 909, 910, 933, 934, 949, 951, 955, 962, 964, 998, 1002, 1013, 1052, 1267, 1271, 1272, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311, 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1375 и 1376.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 60% ингибирование мРНК HBV, ISIS ID: 510090, 510100, 510102, 505330, 509928, 510104, 509929, 510105, 509930, 510106, 510107, 510111, 509931, 510116, 510117, 510118, 510119, 510120, 510121, 509932, 510122, 509933, 510123, 509934, 510124, 509935, 510125, 510128, 146779, 505314, 505315, 505316, 505317, 146821, 505318, 505319, 505322, 505323, 505324, 505325, 505326, 505327, 505328, 505329, 509956, 509957, 509958, 505330, 509959, 510041, 505332, 509968, 505333, 505335, 146823, 509974, 505338, 505339, 509975, 505340, 505341, 509979, 505342, 509981, 505344, 505345, 509983, 505346, 509984, 505347, 505348, 505353, 505354, 505356, 146786, 505357, 505358, 505359, 505360, 509985, 509986, 505363, 505366, 524410, 524413, 524414, 524415, 524416, 524417, 524418, 524419, 524420, 524421, 524422, 524424, 524425, 524426, 524428, 524431, 524432, 524433, 524434, 524435, 524439, 524440, 524446, 524447, 524448, 524451, 524452, 524453, 524454, 524455, 524456, 524457, 524459, 524460, 524461, 524464, 524466, 524467, 524468, 524469, 524471, 524472, 524473, 524474, 524475, 524477, 524478, 524479, 524480, 524481, 524482, 524485, 524486, 524487, 524489, 524490, 524491, 524492, 524493, 524494, 524495, 524496, 524499, 524500, 524501, 524502, 524503, 524504, 524506, 524507, 524508, 524509, 524510, 524511, 524512, 524513, 524514, 524515, 524516, 524517, 524519, 524520, 524521, 524523, 524525, 524526, 524527, 524528, 524529, 524532, 524533, 524534, 524535, 524536, 524537, 524538, 524539, 524540, 524541, 524543, 524546, 524547, 524549, 524550, 524552, 524553, 524554, 524555, 524556, 524557, 524558, 524559, 524560, 524561, 524562, 524563, 524564, 524565, 524568, 524569, 524570, 524571, 524572, 524573, 524574, 524575, 524576, 524577, 524578, 524579, 524580, 524581, 524582, 524585, 524586, 524587, 524588, 524589, 524590, 524591, 524593, 524594, 524595, 524598, 524599, 524600, 524602, 524603, 524604, 524605, 524606, 524607, 524610, 524611, 524614, 524615, 524616, 524617, 524618, 524619, 524620, 524621, 524622, 524623, 524625, 524627, 524629, 524632, 524633, 524634, 524635, 524636, 524637, 524638, 524639, 524640, 524641, 524642, 524643, 524644, 524646, 524647, 524648, 524649, 524650, 524651, 524654, 524656, 524657, 524658, 524659, 524661, 524662, 524663, 524664, 524665, 524666, 524667, 524668, 524669, 524670, 524673, 524675, 524676, 524678, 524679, 524680, 524683, 524684, 524685, 524686, 524687, 524688, 524689, 524690, 524691, 524692, 524694, 524695, 524696, 524697, 524698, 524699, 524700, 524701, 524702, 524703, 524704, 524705, 524706, 524707, 524708, 524709, 524710, 524713, 524714, 524715, 524716, 524717, 524718, 524719, 524721, 524722, 524724, 524726, 524727, 524728, 524729, 524730, 524731, 524732, 524733, 524734, 524735, 524736, 524737, 524738, 524739, 524741, 524742, 524743, 524744, 524746, 524747, 524748, 524749, 524750, 524751, 524752, 524753, 524754, 524755, 524756, 524757, 524758, 524759, 524760, 524761, 524762, 524763, 524764, 524765, 524766, 524767, 524768, 524769, 524770, 524771, 524772, 524773, 524774, 524775, 524776, 524777, 524778, 524779, 524780, 524781, 524782, 524783, 524784, 524785, 524787, 524788, 524789, 524790, 524791, 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524799, 524800, 524801, 524802, 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 524811, 524812, 524813, 524814, 524815, 524816, 524817, 524818, 524819, 524820, 524821, 524822, 524823, 524824, 524825, 524826, 524827, 524828, 524829, 524830, 524632, 524833, 524842, 524843, 524844, 524845, 524847, 524856, 524866, 524867, 524868, 524869, 524870, 524871, 524872, 524873, 524876, 524878, 524879, 524880, 524881, 524882, 524883, 524884, 524885, 524886, 524887, 524888, 524889, 524890, 524891, 524892, 524893, 524894, 524895, 524896, 524897, 524898, 524899, 524900, 524901, 524902, 524903, 524904, 524905, 524906, 524907, 524908, 524909, 524910, 524911, 524912, 524913, 524914, 524915, 524916, 524921, 524922, 524923, 524924, 524925, 524926, 524928, 524929, 524930, 524931, 524932, 524933, 524936, 524937, 524938, 524939, 524940, 524941, 524942, 524944, 524946, 524947, 524948, 524949, 524950, 524952, 524953, 524954, 524955, 524961, 524977, 524978, 524979, 524980, 524981, 524982, 524983, 524984, 524985, 524986, 524987, 524988, 524991, 524992, 524993, 524994, 525037, 525052, 551909, 551911, 551919, 551920, 551921, 551922, 551924, 551925, 551926, 551927, 551928, 551932, 551933, 551934, 551935, 551936, 551941, 551943, 551944, 551948, 551949, 551950, 551951, 551952, 551953, 551954, 551955, 551956, 551957, 551958, 551959, 551960, 551962, 551963, 551965, 551966, 551967, 551968, 551973, 551975, 551979, 551981, 551982, 551983, 551984, 551985, 551986, 551987, 551989, 551990, 551992, 551993, 551994, 551995, 551996, 551997, 551998, 551999, 552000, 552001, 552002, 552003, 552005, 552006, 552007, 552009, 552010, 552012, 552013, 552014, 552015, 552016, 552017, 552018, 552019, 552020, 552021, 552022, 552023, 552024, 552025, 552026, 552027, 552028, 552029, 552030, 552031, 552032, 552033, 552034, 552035, 552036, 552038, 552039, 552041, 552042, 552044, 552045, 552046, 552047, 552048, 552049, 552050, 552051, 552052, 552053, 552054, 552055, 552056, 552057, 552058, 552059, 552060, 552061, 552062, 552063, 552064, 552065, 552068, 552069, 552070, 552071, 552073, 552074, 552075, 552076, 552077, 552078, 552079, 552080, 552081, 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552090, 552091, 552092, 552093, 552094, 552095, 552096, 552097, 552098, 552099, 552100, 552101, 552102, 552114, 552115, 552116, 552117, 552118, 552119, 552123, 552124, 552125, 552126, 552127, 552128, 552129, 552131, 552132, 552133, 552134, 552135, 552136, 552138, 552139, 552140, 552141, 552143, 552144, 552145, 552146, 552147, 552148, 552149, 552150, 552151, 552152, 552153, 552155, 552158, 552159, 552160, 552162, 552163, 552168, 552169, 552170, 552171, 552176, 552178, 552179, 552180, 552182, 552183, 552185, 552187, 552188, 552191, 552192, 552193, 552194, 552195, 552196, 552197, 552198, 552199, 552200, 552201, 552202, 552203, 552204, 552205, 552206, 552207, 552208, 552209, 552210, 552211, 552212, 552213, 552214, 552215, 552216, 552222, 552224, 552225, 552239, 552240, 552242, 552246, 552247, 552248, 552252, 552253, 552254, 552255, 552256, 552257, 552258, 552259, 552261, 552263, 552265, 552266, 552268, 552285, 552293, 552294, 552295, 552296, 552301, 552302, 552303, 552306, 552307, 552308, 552309, 552310, 552312, 552313, 552314, 552315, 552316, 552317, 552318, 552320, 552321, 552322, 552323, 552325, 552326, 552331, 552332, 552337, 552338, 552339, 552340, 552343, 552345, 552347, 552348, 552349, 552351, 552354, 552355, 552356, 552358, 552359, 552360, 552361, 552362, 552363, 552364, 552365, 552366, 552367, 552368, 552369, 552370, 552371, 552372, 552373, 552374, 552375, 552376, 552377, 552378, 552379, 552396, 552397, 552398, 552403, 552408, 552409, 552410, 552411, 552412, 552414, 552416, 552418, 552419, 552420, 552421, 552422, 552423, 552424, 552431, 552442, 552445, 552449, 552455, 552456, 552459, 552464, 552465, 552466, 552467, 552469, 552472, 552473, 552474, 552475, 552477, 552478, 552479, 552480, 552484, 552487, 552497, 552508, 552509, 552511, 552512, 552515, 552516, 552520, 552521, 552522, 552523, 552526, 552527, 552528, 552529, 552530, 552531, 552534, 552540, 552541, 552542, 552559, 552567, 552568, 552569, 552570, 552572, 552576, 552577, 552578, 552579, 552582, 552583, 552584, 552585, 552586, 552587, 552588, 552590, 552595, 552596, 552597, 552788, 552789, 552790, 552791, 552796, 552800, 552801, 552803, 552804, 552805, 552806, 552807, 552808, 552809, 552811, 552812, 552813, 552814, 552815, 552816, 552817, 552818, 552819, 552820, 552821, 552822, 552823, 552824, 552826, 552827, 552828, 552829, 552830, 552831, 552832, 552833, 552834, 552835, 552836, 552837, 552838, 552839, 552841, 552842, 552843, 552844, 552845, 552846, 552847, 552848, 552849, 552850, 552851, 552852, 552853, 552854, 552855, 552856, 552857, 552858, 552859, 552860, 552861, 552862, 552863, 552864, 552865, 552866, 552872, 552891, 552892, 552893, 552894, 552902, 552903, 552904, 552905, 552907, 552908, 552909, 552910, 552911, 552912, 552913, 552914, 552915, 552916, 552917, 552918, 552922, 552923, 552925, 552927, 552928, 552929, 552930, 552931, 552932, 552933, 552934, 552935, 552936, 552937, 552938, 552939, 552940, 552941, 552942, 552943, 552944, 552945, 552946, 552951, 552955, 552956, 552957, 552958, 552960, 552961, 552966, 552969, 552971, 552972, 552973, 552974, 552975, 552976, 552977, 552979, 552980, 552981, 552982, 552983, 552984, 552988, 552989, 552990, 552991, 552992, 552993, 552994, 552995, 552996, 552998, 552999, 553000, 553001, 553002, 553003, 553004, 553005, 553006, 553007, 553008, 553009, 553010, 553011, 553012, 553016, 566828, 566829, 566830, 566831, 566832, 577120, 577121, 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577129, 577130, 577131, 577132, 577133, 577134, 577135, 577136 и 582666.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 60% ингибирование мРНК HBV, SEQ ID NO:7, 9, 10, 12, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 33, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 56, 83, 85, 86, 87, 88, 89, 92, 96, 98, 100, 102, 103, 112, 115, 117, 122, 123, 124, 125, 126, 127, 128, 136, 137, 139, 140, 142, 143, 145, 147, 149, 150, 151, 153, 155, 157, 159, 161, 166, 167, 168, 172, 174, 176, 177, 178, 179, 180, 181, 186, 187, 188, 189, 190, 191, 192, 193, 194, 198, 199, 201, 206, 207, 208, 209, 210, 211, 212, 213, 218, 220, 222, 224, 225, 226, 227, 228, 230, 231, 232, 233, 234, 240, 243, 321, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 335, 336, 337, 339, 342, 343, 344, 345, 346, 350, 351, 357, 358, 359, 362, 363, 364, 365, 366, 367, 368, 370, 371, 372, 375, 376, 377, 378, 379, 381, 382, 383, 384, 387, 388, 389, 390, 391, 392, 395, 396, 397, 399, 400, 401, 402, 403, 404, 405, 406, 409, 410, 411, 412, 413, 414, 416, 417, 418, 419, 420 421, 422, 423, 424, 425, 426, 427, 429, 430, 431, 433, 435, 436, 437, 438, 439, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 453, 456, 457, 459, 460, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 473, 474, 475, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 495, 496, 497, 498, 499, 500, 501, 503, 504, 505, 508, 509, 510, 512, 513, 514, 515, 516, 517, 520, 521, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 535, 537, 539, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 564, 566, 567, 568, 569, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 583, 585, 586, 588, 589, 590, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 623, 624, 625, 626, 627, 628, 629, 631, 632, 634, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 652, 653, 654, 655, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 740, 741, 742, 744, 745, 754, 755, 756, 757, 759, 768, 777, 778, 779, 780, 781, 782, 783, 784, 787, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 833, 834, 835, 836, 837, 838, 840, 841, 842, 843, 844, 845, 848, 849, 850, 851, 852, 853, 854, 856, 858, 859, 860, 861, 862, 864, 865, 866, 867, 873, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 903, 904, 905, 906, 949, 964, 1271, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311, 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372 и 1376.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 70% ингибирование мРНК HBV, ISIS ID: 510100, 505330, 509928, 509929, 509930, 510106, 509931, 510116, 510119, 510120, 510121, 509932, 510122, 509933, 510123, 509934, 510124, 509935, 146779, 505317, 146821, 505318, 505319, 505323, 505325, 505326, 505327, 509957, 505330, 505332, 505335, 509974, 505338, 505339, 509975, 505342, 509981, 505345, 505346, 505347, 505348, 146786, 505357, 505358, 505359, 505363, 524410, 524413, 524414, 524415, 524416, 524418, 524419, 524420, 524421, 524424, 524425, 524426, 524428, 524431, 524432, 524433, 524434, 524435, 524446, 524447, 524448, 524452, 524453, 524457, 524459, 524460, 524461, 524464, 524466, 524467, 524468, 524469, 524472, 524473, 524474, 524475, 524477, 524478, 524479, 524480, 524481, 524482, 524485, 524487, 524490, 524491, 524492, 524493, 524494, 524495, 524499, 524500, 524502, 524503, 524507, 524508, 524510, 524511, 524512, 524513, 524514, 524515, 524516, 524517, 524520, 524525, 524526, 524528, 524532, 524533, 524534, 524535, 524536, 524537, 524538, 524539, 524540, 524541, 524547, 524549, 524552, 524553, 524554, 524555, 524556, 524557, 524558, 524559, 524560, 524561, 524563, 524564, 524565, 524568, 524569, 524570, 524571, 524572, 524573, 524574, 524575, 524577, 524578, 524579, 524580, 524582, 524586, 524587, 524590, 524591, 524594, 524595, 524598, 524600, 524602, 524603, 524604, 524605, 524606, 524607, 524610, 524611, 524614, 524615, 524616, 524617, 524618, 524619, 524620, 524621, 524629, 524633, 524634, 524635, 524636, 524637, 524638, 524641, 524642, 524643, 524644, 524646, 524647, 524648, 524649, 524650, 524651, 524656, 524657, 524659, 524661, 524662, 524663, 524664, 524665, 524666, 524667, 524668, 524669, 524670, 524678, 524679, 524680, 524685, 524686, 524687, 524688, 524689, 524690, 524691, 524692, 524695, 524696, 524698, 524699, 524700, 524701, 524702, 524703, 524704, 524705, 524706, 524707, 524708, 524709, 524713, 524714, 524715, 524716, 524717, 524718, 524721, 524722, 524724, 524726, 524727, 524728, 524729, 524730, 524731, 524732, 524733, 524734, 524735, 524736, 524737, 524738, 524739, 524741, 524742, 524743, 524746, 524747, 524748, 524749, 524750, 524751, 524752, 524754, 524755, 524756, 524758, 524760, 524761, 524762, 524763, 524764, 524765, 524766, 524767, 524768, 524769, 524771, 524773, 524775, 524776, 524777, 524778, 524779, 524780, 524781, 524782, 524783, 524784, 524785, 524787, 524788, 524789, 524790, 524791, 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524799, 524800, 524801, 524802, 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 524811, 524812, 524813, 524814, 524815, 524816, 524817, 524818, 524819, 524821, 524822, 524823, 524824, 524825, 524826, 524827, 524828, 524829, 524830, 524833, 524842, 524843, 524844, 524845, 524856, 524866, 524867, 524868, 524869, 524870, 524871, 524873, 524879, 524880, 524881, 524882, 524883, 524884, 524885, 524886, 524887, 524888, 524889, 524890, 524891, 524892, 524893, 524894, 524895, 524896, 524897, 524898, 524899, 524900, 524902, 524903, 524905, 524906, 524907, 524908, 524909, 524910, 524911, 524912, 524913, 524914, 524915, 524916, 524921, 524922, 524930, 524931, 524932, 524937, 524940, 524942, 524948, 524980, 524981, 524982, 524983, 524984, 524985, 524986, 524987, 524988, 551919, 551921, 551922, 551924, 551925, 551926, 551933, 551941, 551950, 551951, 551952, 551953, 551955, 551956, 551957, 551958, 551966, 551983, 551984, 551985, 551986, 551987, 551989, 551990, 551992, 551993, 551994, 551995, 551996, 551997, 551998, 551999, 552000, 552005, 552006, 552009, 552012, 552013, 552014, 552015, 552017, 552018, 552019, 552020, 552021, 552022, 552023, 552024, 552025, 552026, 552027, 552028, 552029, 552030, 552031, 552032, 552033, 552034, 552038, 552039, 552041, 552044, 552046, 552047, 552049, 552050, 552051, 552052, 552053, 552054, 552055, 552056, 552057, 552058, 552059, 552060, 552061, 552062, 552063, 552064, 552065, 552068, 552069, 552070, 552071, 552073, 552074, 552075, 552076, 552077, 552078, 552079, 552080, 552081, 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552090, 552091, 552092, 552093, 552094, 552095, 552096, 552097, 552098, 552099, 552100, 552101, 552115, 552117, 552123, 552125, 552127, 552128, 552129, 552132, 552133, 552138, 552139, 552140, 552141, 552143, 552144, 552145, 552146, 552147, 552148, 552149, 552150, 552151, 552152, 552158, 552159, 552160, 552163, 552168, 552179, 552187, 552188, 552192, 552193, 552195, 552199, 552200, 552201, 552202, 552203, 552204, 552205, 552206, 552207, 552208, 552210, 552211, 552213, 552214, 552222, 552246, 552247, 552248, 552253, 552254, 552255, 552258, 552294, 552301, 552302, 552306, 552307, 552308, 552309, 552310, 552312, 552314, 552315, 552317, 552318, 552321, 552322, 552323, 552325, 552332, 552337, 552339, 552347, 552348, 552349, 552354, 552355, 552358, 552359, 552360, 552361, 552362, 552363, 552364, 552365, 552366, 552367, 552368, 552369, 552371, 552373, 552374, 552375, 552376, 552377, 552378, 552379, 552403, 552408, 552409, 552411, 552418, 552419, 552420, 552424, 552442, 552464, 552465, 552466, 552467, 552472, 552474, 552475, 552477, 552478, 552521, 552522, 552523, 552527, 552528, 552529, 552530, 552534, 552567, 552578, 552579, 552584, 552586, 552587, 552588, 552590, 552789, 552803, 552804, 552805, 552808, 552816, 552817, 552818, 552819, 552820, 552821, 552822, 552823, 552824, 552828, 552829, 552830, 552833, 552834, 552835, 552842, 552843, 552844, 552846, 552848, 552849, 552850, 552851, 552852, 552853, 552854, 552855, 552856, 552857, 552858, 552859, 552860, 552861, 552863, 552864, 552865, 552872, 552894, 552903, 552904, 552907, 552909, 552910, 552911, 552913, 552914, 552915, 552916, 552917, 552918, 552922, 552923, 552925, 552927, 552928, 552929, 552930, 552931, 552932, 552933, 552934, 552935, 552936, 552937, 552938, 552939, 552940, 552941, 552942, 552943, 552944, 552945, 552946, 552957, 552961, 552966, 552969, 552971, 552972, 552974, 552976, 552979, 552980, 552981, 552983, 552984, 552988, 552989, 552990, 552991, 552995, 552996, 552998, 552999, 553001, 553002, 553003, 553004, 553006, 553008, 553009, 553010, 553011, 553012, 566828, 566829, 566830, 566831, 566832, 577120, 577121, 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577129, 577130, 577131, 577132, 577133, 577134, 577135, 577136 и 582666.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 70% ингибирование мРНК HBV, SEQ ID NO:12, 17, 18, 20, 21, 22, 24, 25, 26, 27, 28, 29, 39, 40, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 83, 89, 92, 96, 98, 100, 103, 112, 123, 125, 126, 127, 136, 137, 139, 140, 142, 143, 145, 147, 149, 151, 153, 166, 167, 168, 174, 176, 177, 178, 179, 181, 186, 187, 188, 190, 198, 201, 207, 209, 210, 211, 212, 213, 224, 225, 226, 227, 232, 234, 240, 321, 324, 325, 326, 327, 329, 330, 331, 332, 335, 336, 337, 339, 342, 343, 344, 345, 346, 357, 358, 359, 363, 364, 368, 370, 371, 372, 375, 376, 377, 378, 379, 382, 383, 384, 387, 388, 389, 390, 391, 392, 395, 397, 400, 401, 402, 403, 404, 405, 409, 410, 412, 413, 417, 418, 420 421, 422, 423, 424, 425, 426, 427, 430, 435, 436, 438, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 457, 459, 462, 463, 464, 465, 466, 467, 468, 469, 470, 473, 474, 475, 478, 479, 480, 481, 482, 483, 484, 485, 487, 488, 489, 490, 492, 496, 497, 500, 501, 504, 505, 508, 510, 512, 513, 514, 515, 516, 517, 520, 521, 524, 525, 526, 527, 528, 529, 530, 531, 539, 543, 544, 545, 546, 547, 548, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 566, 567, 569, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 588, 589, 590, 595, 596, 597, 598, 599, 600, 601, 602, 605, 606, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 623, 624, 625, 626, 627, 628, 631, 632, 634, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 652, 653, 654, 657, 658, 659, 660, 661, 662, 663, 665, 666, 667, 669, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 682, 684, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 733, 734, 735, 736, 737, 738, 740, 741, 742, 745, 754, 755, 756, 757, 768, 777, 778, 779, 780, 781, 782, 784, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 814, 815, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 833, 834, 842, 843, 844, 849, 852, 854, 860, 892, 893, 894, 895, 896, 897, 898, 899, 900, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311, 1312, 1313, 1314, 1315, 1316, 1317, 1320, 1322, 1323, 1324, 1325, 1326, 1327, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349 и 1350, 1367, 1368, 1369, 1370, 1372 и 1376.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 80% ингибирование мРНК HBV, ISIS ID: 510100, 509931, 510116, 505317, 505319, 505323, 505326, 505327, 505330, 505339, 505346, 505347, 505358, 509934, 146786, 524414, 524415, 524416, 524418, 524419, 524425, 524426, 524431, 524432, 524434, 524446, 524447, 524452, 524459, 524460, 524466, 524469, 524475, 524477, 524478, 524479, 524482, 524485, 524490, 524491, 524492, 524493, 524494, 524495, 524499, 524502, 524503, 524507, 524510, 524511, 524512, 524520, 524525, 524528, 524532, 524533, 524534, 524535, 524536, 524540, 524541, 524547, 524552, 524553, 524556, 524561, 524564, 524565, 524568, 524570, 524571, 524572, 524573, 524578, 524580, 524586, 524590, 524591, 524594, 524595, 524602, 524604, 524606, 524607, 524610, 524611, 524614, 524616, 524617, 524618, 524619, 524620, 524621, 524633, 524634, 524635, 524636, 524637, 524641, 524643, 524644, 524646, 524649, 524650, 524651, 524657, 524662, 524664, 524667, 524670, 524678, 524679, 524680, 524686, 524688, 524690, 524691, 524692, 524695, 524698, 524699, 524701, 524702, 524704, 524705, 524706, 524707, 524708, 524709, 524713, 524715, 524716, 524717, 524718, 524721, 524726, 524727, 524728, 524729, 524730, 524731, 524733, 524734, 524735, 524737, 524739, 524741, 524742, 524743, 524747, 524748, 524749, 524751, 524752, 524754, 524758, 524760, 524762, 524763, 524764, 524767, 524768, 524769, 524771, 524773, 524777, 524778, 524779, 524780, 524781, 524783, 524784, 524788, 524789, 524791, 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524801, 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 524811, 524813, 524816, 524819, 524822, 524823, 524824, 524827, 524828, 524829, 524833, 524842, 524844, 524880, 524881, 524882, 524884, 524886, 524887, 524888, 524889, 524890, 524891, 524893, 524907, 524908, 524980, 524986, 524987, 551921, 551924, 551925, 551953, 551956, 551957, 551984, 551986, 551987, 551989, 551990, 551993, 551994, 551995, 551996, 551997, 551998, 551999, 552000, 552005, 552006, 552018, 552019, 552020, 552021, 552022, 552023, 552024, 552025, 552026, 552027, 552028, 552029, 552030, 552031, 552032, 552033, 552034, 552039, 552044, 552046, 552050, 552051, 552052, 552053, 552054, 552055, 552056, 552057, 552058, 552059, 552060, 552061, 552062, 552063, 552064, 552065, 552073, 552077, 552078, 552079, 552080, 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552090, 552091, 552092, 552093, 552094, 552095, 552096, 552097, 552098, 552138, 552139, 552145, 552146, 552147, 552149, 552192, 552193, 552199, 552200, 552201, 552207, 552246, 552247, 552253, 552301, 552307, 552308, 552310, 552317, 552347, 552348, 552354, 552355, 552360, 552361, 552362, 552363, 552364, 552365, 552366, 552367, 552371, 552375, 552464, 552465, 552521, 552808, 552816, 552817, 552818, 552819, 552820, 552822, 552824, 552834, 552844, 552849, 552850, 552851, 552852, 552853, 552854, 552916, 552922, 552923, 552925, 552930, 552931, 552932, 552933, 552936, 552937, 552938, 552939, 552942, 552943, 552944, 552980, 552988, 552989, 552996, 552998, 553002, 553003, 566828, 566829, 566830, 566831, 566832, 577120, 577121, 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577130, 577131, 577132, 577133, 577134, 577135, 577136 и 582666.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 80% ингибирование мРНК HBV, SEQ ID NO:17, 20, 22, 24, 26, 28, 39, 40, 50, 51, 83, 89, 103, 123, 126, 127, 136, 137, 143, 147, 149, 168, 176, 177, 178, 179, 187, 188, 210, 211, 212, 224, 225, 226, 227, 232, 325, 326, 327, 329, 330, 336, 337, 342, 343, 345, 357, 358, 363, 370, 371, 376, 379, 387, 388, 389, 392, 395, 400, 401, 402, 403, 404, 405, 409, 412, 413, 417, 420 421, 422, 430, 435, 438, 442, 443, 444, 445, 446, 450, 451, 457, 462, 463, 466, 474, 475, 478, 480, 481, 482, 483, 488, 490, 496, 500, 501, 504, 505, 512, 514, 516, 517, 520, 521, 524, 526, 527, 528, 529, 530, 531, 543, 544, 545, 546, 547, 551, 553, 554, 555, 559, 560, 561, 567, 572, 574, 577, 580, 588, 589, 590, 596, 598, 600, 601, 602, 605, 608, 609, 611, 612, 614, 615, 616, 617, 618, 619, 623, 625, 626, 627, 628, 631, 636, 637, 638, 639, 640, 641, 643, 644, 645, 646, 648, 650, 652, 653, 654, 658, 659, 660, 662, 663, 665, 669, 671, 673, 674, 675, 678, 679, 680, 682, 684, 688, 689, 690, 691, 692, 694, 695, 699, 700, 702, 703, 704, 705, 706, 707, 708, 709, 712, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 725, 728, 731, 734, 735, 736, 740, 741, 745, 756, 791, 792, 793, 795, 797, 798, 799, 800, 801, 802, 804, 805, 806, 807, 819, 820, 892, 898, 899, 1292, 1293, 1295, 1296, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1310, 1312, 1316, 1322, 1324, 1325, 1326, 1327, 1330, 1331, 1332, 1333, 1334, 1335, 1338, 1339, 1340, 1341, 1344, 1345, 1349, 1350, 1368, 1372 и 1376.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 90% ингибирование мРНК HBV, ISIS ID: 524414, 524415, 524432, 524460, 524466, 524469, 524475, 524477, 524493, 524512, 524535, 524540, 524552, 524561, 524572, 524617, 524619, 524634, 524641, 524644, 524657, 524667, 524691, 524698, 524699, 524701, 524706, 524707, 524709, 524713, 524715, 524716, 524718, 524721, 524726, 524729, 524730, 524731, 524733, 524734, 524735, 524739, 524743, 524754, 524763, 524764, 524767, 524771, 524780, 524781, 524784, 524788, 524789, 524791, 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524801, 524803, 524804, 524805, 524806, 524807, 524808, 524809, 524810, 524811, 524822, 524827, 524842, 551986, 551987, 551989, 552005, 552018, 552019, 552020, 552021, 552022, 552023, 552025, 552046, 552050, 552051, 552052, 552053, 552054, 552055, 552057, 552082, 552083, 552084, 552085, 552086, 552087, 552088, 552089, 552092, 552093, 552096, 552097, 552307, 552317, 552355, 552361, 552362, 552363, 552817, 552851, 552922, 552923, 566828, 566829, 566830, 566831, 566832, 577120, 577121, 577122, 577123, 577124, 577125, 577126, 577127, 577128, 577130, 577131, 577132, 577134, 577135, 577136 и 582666.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 90% ингибирование мРНК HBV, SEQ ID NO:17, 24, 50, 51, 137, 143, 147, 176, 211, 212, 224, 226, 227, 325, 326, 343, 371, 376, 379, 403, 422, 445, 450, 462, 482, 527, 529, 544, 551, 554, 567, 577, 601, 608, 609, 611, 616, 617, 619, 623, 625, 626, 628, 631, 636, 639, 640, 641, 643, 644, 645, 646, 650, 654, 665, 674, 675, 678, 682, 691, 692, 695, 699, 700, 702, 703, 704, 705, 706, 707, 708, 709, 712, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 735, 801, 804, 805, 807, 1296, 1302, 1303, 1304, 1312, 1325, 1326, 1332, 1334, 1340, 1345, 1349 и 1376.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 95% ингибирование мРНК HBV, ISIS ID: 524619, 524634, 524641, 505339, 524698, 524709, 524718, 524731, 524734, 524789, 524791, 524792, 524793, 524794, 524795, 524796, 524797, 524798, 524801, 524803, 524804, 524805, 524806, 505346, 146785, 524807, 505347, 524808, 524809, 524810, 524811, 146786, 525101, 525102, 525103, 525107, 525108, 525109, 525110, 525111, 525112, 525113, 525114, 525115, 525116, 525117, 525118, 525119, 525120, 552018, 552050, 552019, 552051, 552020, 552052, 551987, 552021, 552053, 552005, 552022, 552054, 551989, 552023, 552055, 552084, 552085, 552086, 552087, 552088, 552361, 552317, 566831, 577123, 577124, 566830, 566828, 566829, 577127, 577135, 577132, 577136, 566832 и 577122.

В некоторых вариантах реализации, следующие антисмысловые соединения или олигонуклеотиды направлены на определенную область нуклеиновой кислоты HBV и вызывают по меньшей мере 95% ингибирование мРНК HBV, SEQ ID NO:17, 50, 137, 143, 187, 210, 212, 224, 529, 544, 551, 608, 619, 628, 641, 645, 700, 702, 703, 704, 705, 706, 707, 708, 709, 712, 715, 716, 717, 718, 719, 720, 721, 722, 723, 1014, 1015, 1016, 1020, 1021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1236, 1302, 1312, 1334, 1340, 1345, 1349.

В некоторых вариантах реализации представлены способы лечения HBV-связанного заболевания, расстройства или состояния у животного, включающие введение животному, нуждающемуся в этом, соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид, состоящий из 10-30 связанных нуклеозидов и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:5-310, 321-802, 804-1272, 1288-1350, 1364-1372, 1375, 1376 и 1379.

В некоторых вариантах реализации представлены способы лечения HBV-связанного заболевания, расстройства или состояния у животного, включающие введение животному, нуждающемуся в этом, соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид, состоящий из 10-30 связанных нуклеозидов и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:17, 51, 86, 93, 95, 98, 100, 102, 104, 106, 109, 112, 115, 117, 137, 140, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 167, 168, 176, 177-179, 181, 188, 190-192, 194, 199, 201, 208, 209, 211, 226, 230-237, 244, 245, 247, 252, 254, 256, 258, 260, 262, 264, 266, 271, 1318-1347, 1364-1372, 1375, 1376 и 1379, при чем по меньшей мере один нуклеозид модифицированного олигонукеотида включает по меньшей мере один 2'-O-метоксиэтиловый сахар и/или затрудненный этиловый (cEt) сахар. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3 или 4 нуклеозида с модифицированным сахаром.

В некоторых вариантах реализации представлен способ снижения экспрессии HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной 10-30 связанных нуклеозидов, направленный на HBV и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:5-310, 321-802, 804-1272, 1288-1350, 1364-1372, 1375, 1376 и 1379.

В некоторых вариантах реализации представлен способ снижения экспрессии HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной 10-30 связанных нуклеозидов, направленный на HBV и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:17, 51, 86, 93, 95, 98, 100, 102, 104, 106, 109, 112, 115, 117, 137, 140, 143, 145, 147, 149,151, 153, 155, 157, 159, 161, 167, 168, 176, 177-179, 181, 188, 190-192, 194, 199, 201, 208, 209, 211, 226, 230-237, 244, 245, 247, 252, 254, 256, 258, 260, 262, 264, 266, 271, 1318-1347, 1364-1372, 1375 и 1376, причем по меньшей мере один нуклеозид модифицированного олигонуклеотида включает по меньшей мере один 2'-O-метоксиэтиловый сахар и/или затрудненный этиловый (cEt) сахар. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4 или 5 нуклеозидов с модифицированным сахаром.

В некоторых вариантах реализации представлен способ предотвращения, улучшения или лечения HBV-связанного заболевания, расстройства или состояния у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной 10-30 связанных нуклеозидов, направленный на HBV и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:17, 51, 86, 93, 95, 98, 100, 102, 104, 106, 109, 112, 115, 117, 137, 140, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 167, 168, 176, 177-179,181, 188, 190-192, 194, 199, 201, 208, 209, 211, 226, 230-237, 244, 245, 247, 252, 254, 256, 258, 260, 262, 264, 266, 271, 1318-1347, 1364-1372, 1375 и 1376, причем по меньшей мере один нуклеозид модифицированного олигонуклеотида включает по меньшей мере один 2'-O-метоксиэтиловый сахар и/или затрудненный этиловый (cEt) сахар. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4 или 5 нуклеозидов с модифицированным сахаром.

В некоторых вариантах реализации представлены способы лечения HBV-связанного заболевания, расстройства или состояния у животного, включающие введение животному, нуждающемуся в этом, соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид, состоящий из 10-30 связанных нуклеозидов и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:5, 15, 16, 33, 39-95, 123-135, 163-175, 180-310, 321-406, 413-455, 461-802 или 804-1272.

В некоторых вариантах реализации представлены способы лечения HBV-связанного заболевания, расстройства или состояния у животного, включающие введение животному, нуждающемуся в этом, соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид, состоящий из 10-30 связанных нуклеозидов и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:6-14, 17-32, 34-38, 96-122, 136-162, 176-179, 407-412, 456-462, 523-538, причем по меньшей мере один нуклеозид модифицированного олигонуклеотида включает по меньшей мере один 2'-O-метоксиэтиловый сахар.

В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 14 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-3 или 2 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4 или 5 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 17 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3-4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4, 5 или 6 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 18 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 3-5 или 4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 20 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5 или 5 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4, 5, 6, 7 или 8 нуклеозидов с модифицированным сахаром.

В некоторых вариантах реализации представлен способ снижения экспрессии HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной 10-30 связанных нуклеозидов, направленный на HBV и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:5-310, 321-802, 804-1272 или 1288-1350.

В некоторых вариантах реализации представлен способ снижения экспрессии HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной 10-30 связанных нуклеозидов, направленный на HBV и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:5, 15, 16, 33, 39-95, 123-135, 163-175, 180-310, 321-406, 413-455, 461-802 или 804-1272.

В некоторых вариантах реализации представлен способ снижения экспрессии HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной 10-30 связанных нуклеозидов, направленный на HBV и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:6-14, 17-32, 34-38, 96-122, 136-162, 176-179, 407-412, 456-462, 523-538, причем по меньшей мере один нуклеозид модифицированного олигонуклеотида включает по меньшей мере один 2'-O-метоксиэтиловый сахар.

В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 14 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-3 или 2 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4 или 5 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 17 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4, 5 или 6 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 17 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3-4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 18 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 3-5 или 4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 20 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4, 5, 6, 7 или 8 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 20 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5 или 5 нуклеозидов с модифицированным сахаром.

В некоторых вариантах реализации представлен способ предотвращения, улучшения или лечения HBV-связанного заболевания, расстройства или состояния у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной от 10 до 30 связанных нуклеозидов, нацеленный на HBV. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной 10-30 связанных нуклеозидов, направленный на HBV и имеющий последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:5-310, 321-802, 804-1272 или 1288-1350, причем по меньшей мере один нуклеозид модифицированного олигонуклеотида содержит по меньшей мере один 2'-O-метоксиэтиловый сахар. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:5-310, 321-802 или 804-1272. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет последовательность нуклеооснований, включающую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ Ю NO: 5, 15, 16, 33, 39-95, 123-135, 163-175, 180-310, 321-406, 413-455, 461-802 или 804-1272. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет последовательность нуклеооснований, содержащую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:6-14, 17-32, 34-38, 96-122, 136-162, 176-179, 407-412, 456-462, 523-538, причем по меньшей мере один нуклеозид модифицированного олигонуклеотида содержит по меньшей мере один 2'-O-метоксиэтиловый сахар. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 14 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-3 или 2 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4 или 5 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 17 нуклеозидов в длину и имеет сегмент гэп из 9 или 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4, 5 или 6 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 17 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3-4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 18 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 3-5 или 4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 20 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 2, 3, 4, 5, 6, 7 или 8 нуклеозидов с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 20 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5 или 5 нуклеозидов с модифицированным сахаром.

Примеры HBV-связанных заболеваний, расстройств или состояний включают, но не ограничиваясь этим, хроническую инфекцию HBV, желтуху, рак печени, воспаление печени, фиброз печени, цирроз печени, печеночную недостаточность, диффузное гепатоцеллюлярное воспалительное заболевание, гемофагоцитарный синдром, серозный гепатит, виремию HBV и состояния, имеющие симптомы, которые могут включать любой или все из следующих: болезнь, похожую на грипп, слабость, боли, головную боль, жар, потерю аппетита, диарею, тошноту и рвоту, боль в области печени, стул земляного или серого цвета, зуд по всему телу и мочу темного цвета, в сочетании с положительным тестом на присутствие вируса гепатита В, вирусного антигена гепатита В или положительным тестом на присутствие антитела, специфичного к вирусному антигену гепатита В.

В некоторых вариантах реализации представлен способ снижения экспрессии мРНК HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной от 10 до 30 связанных нуклеозидов, нацеленный на HBV. В некоторых вариантах реализации снижение экспрессии мРНК HBV у животного предупреждает, улучшает или лечит HBV-связанное заболевание, расстройство или состояние. В некоторых вариантах реализации снижение экспрессии мРНК HBV у животного предупреждает, улучшает или лечит заболевание печени. В некоторых вариантах реализации экспрессия мРНК HBV снижается по меньшей мере на 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100%.

В некоторых вариантах реализации представлен способ снижения уровня белка HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной от 10 до 30 связанных нуклеозидов, нацеленный на HBV. В некоторых вариантах реализации снижение уровня белка HBV у животного предупреждает, улучшает или лечит HBV-связанное заболевание, расстройство или состояние. В некоторых вариантах реализации снижение уровня белка HBV у животного предупреждает, улучшает или лечит заболевание печени. В некоторых вариантах реализации уровень белка HBV снижается по меньшей мере на 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100%.

В некоторых вариантах реализации представлен способ снижения уровня ДНК HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной от 10 до 30 связанных нуклеозидов, нацеленный на HBV. В некоторых вариантах реализации снижение уровня ДНК HBV у животного предупреждает, улучшает или лечит HBV-связанное заболевание, расстройство или состояние. В некоторых вариантах реализации млекопитающим может быть человек, а вирусом гепатита В может быть вирус гепатита В человека. Более конкретно, вирус гепатита В человека может быть любым из человеческих географических генотипов: А (Северо-Западная Европа, Северная Америка, Центральная Америка); В (Индонезия, Китай, Вьетнам); С (Восточная Азия, Корея, Китай, Япония, Полинезия, Вьетнам); D (Средиземноморский регион, Ближний восток, Индия); Е (Африка); F (коренные американцы, Полинезия); G (Соединенные Штаты, Франция); или Н (Центральная Америка). В некоторых вариантах реализации снижение уровня ДНК HBV у животного предупреждает, улучшает или лечит заболевание печени. В некоторых вариантах реализации уровень ДНК HBV снижается по меньшей мере на 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100%.

В некоторых вариантах реализации представлен способ снижения уровня антигена HBV у животного, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной от 10 до 30 связанных нуклеозидов, нацеленный на HBV. В некоторых вариантах реализации антиген представляет собой HBsAG или HBeAG. В некоторых вариантах реализации снижение уровня антигена HBV у животного предупреждает, улучшает или лечит HBV-связанное заболевание, расстройство или состояние. В некоторых вариантах реализации снижение уровня антигена HBV у животного предупреждает, улучшает или лечит заболевание печени. В некоторых вариантах реализации уровень антигена HBV снижается по меньшей мере на 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100%.

В некоторых вариантах реализации представлен способ снижения уровня ДНК HBV и антигена HBV у животного, инфицированного вирусом гепатита В, включающий введение этому животному соединения или композиции, описанной в настоящем документе. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной от 10 до 30 связанных нуклеозидов, нацеленный на HBV. В некоторых вариантах реализации антиген представляет собой HBsAG или HBeAG. В некоторых вариантах реализации количество антигена HBV может быть снижено достаточно для сероконверсии, которую определяют как отсутствие HBeAg в сыворотке плюс присутствие HBeAb в сыворотке, в случае мониторинга HBeAg как определителя сероконверсии, или которую определяют как отсутствие HBsAg в сыворотке, в случае мониторинга HBsAg как определителя сероконверсии, по результатам определения доступных в настоящее время пределов обнаружения коммерческих систем иммуноферментного твердофазного анализа (ELISA).

В некоторых вариантах реализации представлен способ лечения животного с HBV-связанным заболеванием, расстройством или состоянием, включающий: а) идентификацию указанного животного с HBV-связанным заболеванием, расстройством или состоянием, и b) введение указанному животному терапевтически эффективного количества соединения или композиции, содержащей модифицированный олигонуклеотид, состоящий из 14-20 связанных нуклеозидов и имеющий последовательность нуклеооснований по меньшей мере на 90% комплементарную любой из последовательностей SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363, по результатам измерения целостности указанного модифицированного олигонуклеотида. В некоторых вариантах реализации терапевтически эффективное количество соединения или композиции, введенной животному, лечит или уменьшает HBV-связанное заболевание, расстройство или состояние, или его симптом, у животного. В некоторых вариантах реализации HBV-связанное заболевание, расстройство или состояние представляет собой заболевание печени. В некоторых вариантах реализации, связанное заболевание, расстройство или состояние представляет собой хроническую инфекцию HBV, желтуху, рак печени, воспаление печени, фиброз печени, цирроз печени, печеночную недостаточность, диффузное гепатоцеллюлярное воспалительное заболевание, гемофагоцитарный синдром, серозный гепатит, виремию HBV или заболевание печени, связанное с трансплантацией.

В некоторых вариантах реализации представлен способ лечения животного с HBV-связанным заболеванием, расстройством или состоянием, включающий: а) идентификацию указанного животного с HBV-связанным заболеванием, расстройством или состоянием, и b) введение указанному животному терапевтически эффективного количества соединения или композиции, содержащей модифицированный олигонуклеотид, состоящий из 14-20 связанных нуклеозидов и имеющий последовательность нуклеооснований по меньшей мере на 90% комплементарную последовательности SEQ Ю NO:1, по результатам измерения целостности указанного модифицированного олигонуклеотида. В некоторых вариантах реализации терапевтически эффективное количество соединения или композиции, введенной животному, лечит или уменьшает HBV-связанное заболевание, расстройство или состояние, или его симптом, у животного. В некоторых вариантах реализации HBV-связанное заболевание, расстройство или состояние представляет собой заболевание печени. В некоторых вариантах реализации, связанное заболевание, расстройство или состояние представляет собой хроническую инфекцию HBV, желтуху, рак печени, воспаление печени, фиброз печени, цирроз печени, печеночную недостаточность, диффузное гепатоцеллюлярное воспалительное заболевание, гемофагоцитарный синдром, серозный гепатит, виремию HBV или заболевание печени, связанное с трансплантацией.

В некоторых вариантах реализации HBV имеет последовательность, представленную далее под номером доступа GenBank U95551.1 (включена в настоящий документ как SEQ ID NO:1) или любой ее вариант или фрагмент. В некоторых вариантах реализации HBV имеет усеченные части человеческой последовательности, как представлено далее в SEQ ID NO:1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1287, 1352, 1353, 1354, 1359, 1360, 1361, 1362 и 1363.

В некоторых вариантах реализации животное представляет собой человека.

В некоторых вариантах реализации соединения или композиции разработаны в качестве первого средства. В некоторых вариантах реализации способы включают введение первого средства и одного или нескольких вторых средств. В некоторых вариантах реализации способы включают введение первого средства и одного или нескольких вторых средств. В некоторых вариантах реализации первое средство и одно или несколько вторых средство вводят совместно. В некоторых вариантах реализации первое средство и одно или несколько вторых средств вводят совместно последовательно или параллельно.

В некоторых вариантах реализации одно или несколько вторых средств также представляют собой соединение или композицию, описанную в настоящем документе. В некоторых вариантах реализации одно или несколько вторых средств являются отличными от соединения или композиции, описанной в настоящем документе. Примеры одного или нескольких вторых средств включают, но не ограничиваясь этим, противовоспалительное средство, химиотерапевтическое средство или противоинфекционное средство.

В других родственных вариантах реализации, дополнительное терапевтическое средство может быть агентом HBV, агентом HCV, химиотерапевтическим средством, антибиотиком, анальгетиком, нестероидным противовоспалительным средством (NSAID), противогрибковым средством, антипаразитарным средством, средством против тошноты, средством против диареи или иммуноподавляющим средством.

В некоторых вариантах реализации одно или несколько вторых агентов представляют собой агент HBV. В некоторых вариантах реализации агент HBV может включать, но не ограничиваясь этим, интерферон альфа-2b, интерферон альфа-2а и интерферон альфакон-1 (пегилированный и не пегилированный), рибавирин; ингибитор репликации РНК HBV; второй антисмысловый олигомер; терапевтическую вакцину HBV; профилактическую вакцину HBV; ламивудин (3ТС); энтекавир (ETV); тенофовир диизопроксил-фумарат (TDF); телбивудин (LdT); адефовир; или любую терапию HBV антителами (моноклональными или поликлональными).

В некоторых вариантах реализации одно или несколько вторых агентов представляют собой агент HCV. В некоторых вариантах реализации агент HBV может включать, но не ограничиваясь этим, интерферон альфа-2b, интерферон альфа-2а и интерферон альфакон-1 (пегилированный и не пегилированный); рибавирин; ингибитор репликации РНК HCV (например, серии VP50406 производства ViroPharma); антисмысловый агент HCV; терапевтическую вакцину HCV; ингибитор протеазы HCV; ингибитор геликазы HCV; или терапию HCV моноклональными или поликлональными антителами.

В некоторых вариантах реализации одно или несколько вторых средств представляют собой противовоспалительное средство (то есть терапию, снижающую воспаление). В некоторых вариантах реализации терапия, снижающая воспаление, может включать, но не ограничиваясь этим, терапевтическое изменение образа жизни, стероид, NSAID или DMARD. Стероид может быть кортикостероидом. NSAID может быть аспирином, ацетаминофеном, ибупрофеном, напроксеном, ингибиторами СОХ, индометацином и тому подобными. DMARD может быть ингибитором TNF, ингибитором синтеза пурина, ингибитором кальциневрина, ингибитором синтеза пиримидина, сульфасалазином, метотрексатом и тому подобными.

В некоторых вариантах реализации одно или несколько вторых средств представляют собой химиотерапевтическое средство (то есть средство лечения рака). Химиотерапевтические средства могут включать, но не ограничиваясь этим, даунорубицин, дауномицин, дактиномицин, доксорубицин, эпирубицин, идарубицин, эзорубицин, блеомицин, мафосфамид, ифосфамид, цитозин арабинозид, бис-хлорэтилнитрозомочевину, бусульфан, митомицин С, актиномицин D, митрамицин, преднизон, гидроксипрогестерон, тестостерон, тамоксифен, дакарбазин, прокарбазин, гексаметилмеламин, пентаметилмеламин, митоксантрон, амсакрин, хлорамбуцил, метилциклогексилнитрозомочевину, азотные иприты, мелфалан, циклофосфамид, 6-меркаптопурин, 6-тиогуанин, цитарабин (СА), 5-азацитидин, гидроксимочевину, дезоксикоформицин, 4-гидроксипероксициклофосфорамид, 5-фторурацил (5-FU), 5-фтордезоксиуридин (5-FUdR), метотрексат (МТХ), колхицин, таксол, винкристин, винбластин, этопозид, триметрексат, тенипозид, цисплатин, гемцитабин и диэтилстильбэстрол (DES).

В некоторых вариантах реализации одно или несколько вторых агентов представляют собой противоинфекционное средство. Примеры противомикробных средств включают, но не ограничиваясь этим, антибиотики, противогрибковые лекарства и противовирусные лекарства.

В некоторых вариантах реализации, введение включает парентеральное введение.

В некоторых вариантах реализации представлен способ снижения количества мРНК, ДНК, белка HBV и/или антигена HBV у млекопитающего, инфицированного вирусом гепатита В, включающий введение терапевтически эффективного количества фармацевтической композиции, описанной выше, млекопитающему, нуждающемуся в этом, для снижения инфекции вируса гепатита В и антигена гепатита В, по сравнению с количеством мРНК, белка HBV и количеством антигена HBV у млекопитающего до лечения. В некоторых вариантах реализации млекопитающим может быть человек, а вирусом гепатита В может быть вирус гепатита В человека. Более конкретно, вирус гепатита В человека может быть любым из человеческих географических генотипов: А (Северо-Западная Европа, Северная Америка, Центральная Америка); В (Индонезия, Китай, Вьетнам); С (Восточная Азия, Корея, Китай, Япония, Полинезия, Вьетнам); D (Средиземноморский регион, Ближний восток, Индия); Е (Африка); F (коренные американцы, Полинезия); G (Соединенные Штаты, Франция); или Н (Центральная Америка).

В некоторых вариантах реализации представлен способ снижения количества мРНК, ДНК, белка HBV и/или антигена HBV у млекопитающего, инфицированного вирусом гепатита В, включающий введение терапевтически эффективного количества фармацевтической композиции, описанной выше, млекопитающему, нуждающемуся в этом, для снижения инфекции вируса гепатита В и антигена гепатита В, по сравнению с количеством мРНК, белка HBV и количеством антигена HBV у млекопитающего до лечения, причем количество мРНК снижается по меньшей мере на 70% по сравнению с количеством до введения модифицированного анисмыслового олигонуклеотида. В некоторых вариантах реализации представлен способ снижения количества мРНК, ДНК, белка HBV и/или антигена HBV у млекопитающего, инфицированного вирусом гепатита В, включающий введение терапевтически эффективного количества фармацевтической композиции, описанной выше, млекопитающему, нуждающемуся в этом, для снижения инфекции вируса гепатита В и антигена гепатита В, по сравнению с количеством мРНК, белка HBV и количеством антигена HBV у млекопитающего до лечения, причем количество мРНК снижается по меньшей мере на 75% по сравнению с количеством до введения модифицированного анисмыслового олигонуклеотида. В некоторых вариантах реализации представлен способ снижения количества мРНК, ДНК, белка HBV и/или антигена HBV у млекопитающего, инфицированного вирусом гепатита В, включающий введение терапевтически эффективного количества фармацевтической композиции, описанной выше, млекопитающему, нуждающемуся в этом, для снижения инфекции вируса гепатита В и антигена гепатита В, по сравнению с количеством мРНК, белка HBV и количеством антигена HBV у млекопитающего до лечения, причем количество мРНК снижается по меньшей мере на 80% по сравнению с количеством до введения модифицированного анисмыслового олигонуклеотида. В некоторых вариантах реализации представлен способ снижения количества мРНК, ДНК, белка HBV и/или антигена HBV у млекопитающего, инфицированного вирусом гепатита В, включающий введение терапевтически эффективного количества фармацевтической композиции, описанной выше, млекопитающему, нуждающемуся в этом, для снижения инфекции вируса гепатита В и антигена гепатита В, по сравнению с количеством мРНК, белка HBV и количеством антигена HBV у млекопитающего до лечения, причем количество мРНК снижается по меньшей мере на 85% по сравнению с количеством до введения модифицированного анисмыслового олигонуклеотида. В некоторых вариантах реализации представлен способ снижения количества мРНК, ДНК, белка HBV и/или антигена HBV у млекопитающего, инфицированного вирусом гепатита В, включающий введение терапевтически эффективного количества фармацевтической композиции, описанной выше, млекопитающему, нуждающемуся в этом, для снижения инфекции вируса гепатита В и антигена гепатита В, по сравнению с количеством мРНК, белка HBV и количеством антигена HBV у млекопитающего до лечения, причем количество мРНК снижается по меньшей мере на 90% по сравнению с количеством до введения модифицированного анисмыслового олигонуклеотида. В некоторых вариантах реализации представлен способ снижения количества мРНК, ДНК, белка HBV и/или антигена HBV у млекопитающего, инфицированного вирусом гепатита В, включающий введение терапевтически эффективного количества фармацевтической композиции, описанной выше, млекопитающему, нуждающемуся в этом, для снижения инфекции вируса гепатита В и антигена гепатита В, по сравнению с количеством мРНК, белка HBV и количеством антигена HBV у млекопитающего до лечения, причем количество мРНК снижается по меньшей мере на 95% по сравнению с количеством до введения модифицированного анисмыслового олигонуклеотида. В родственных способах антигеном HBV может быть HBsAg или может быть HBeAg, и более конкретно, количество антигена HBV может быть существенно снижено для сероконверсии, которую определяют как отсутствие HBeAg в сыворотке плюс присутствие HBeAb в сыворотке, в случае мониторинга HBeAg как определителя сероконверсии, или которую определяют как отсутствие HBsAg в сыворотке, в случае мониторинга HBsAg как определителя сероконверсии, по результатам определения доступных в настоящее время пределов обнаружения коммерческих систем иммуноферментного твердофазного анализа (ELISA).

В некоторых вариантах реализации представлен способ ускорения сероконверсии вируса гепатита В у млекопитающего, инфицированного HBV, включающий введение терапевтически эффективного количества фармацевтической композиции, описанной выше, млекопитающему, инфицированному гепатитом В; мониторинг присутствия HBeAg плюс HBeAb в образце сыворотки млекопитающего, или мониторинг присутствия HBsAg в образце сыворотки млекопитающего, как отсутствие HBeAg в сыворотке плюс присутствие HBeAb в образце сыворотки, в случае мониторинга HBeAg как определителя сероконверсии, или отсутствие HBsAg в образце сыворотки, в случае мониторинга HBsAg как определителя сероконверсии, по результатам определения доступных в настоящее время пределов обнаружения коммерческих систем иммуноферментного твердофазного анализа (ELISA), представляет собой показатель сероконверсии у млекопитающего.

В некоторых вариантах реализации представлено применение соединения или композиции, описанной в настоящем документе, для предупреждения, улучшения или лечения заболевания печени или его симптома у млекопитающего. В некоторых вариантах реализации, соединение или композиция содержит модифицированный олигонуклеотид длиной от 10 до 30 связанных нуклеозидов, нацеленный на HBV. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет последовательность нуклеооснований, включающую по меньшей мере 10 смежных нуклеооснований любой из последовательностей нуклеооснований SEQ ID NO:17, 51, 86, 93, 95, 98, 100, 102, 104, 106, 109, 112, 115, 117, 137, 140, 143, 145, 147, 149, 151, 153,155, 157, 159, 161, 167, 168, 176, 177-179, 181, 188, 190-192, 194, 199, 201, 208, 209, 211, 226, 230-237, 244, 245, 247, 252, 254, 256, 258, 260, 262, 264, 266, 271, 1318-1347, 1364- 1372, 1375, 1376 и 1379.

В некоторых вариантах реализации, соединения или композиции, описанные в настоящем документе, являются эффективными на основании того, что они имеют значение in vitro IC50 менее 250 нМ, менее 200 нМ, менее 150 нМ, менее 100 нМ, менее 90 нМ, менее 80 нМ, менее 70 нМ, менее 65 нМ, менее 60 нМ, менее 55 нМ, менее 50 нМ, менее 49 нМ, менее 47 нМ, менее 46 нМ, при доставке в клетки HepG2.2.1. В некоторых вариантах реализации, ингибирование измеряют при помощи набора затравочных зондов RTS3370, описанного в настоящем документе.

В некоторых вариантах реализации, соединения или композиции, описанные в настоящем документе, являются эффективными на основании того, что они имеют значение in vitro IC50 менее 250 нМ, менее 200 нМ, менее 100 нМ, менее 90 нМ, менее 80 нМ, менее 70 нМ, менее 60 нМ, менее 50 нМ, менее 40 нМ, менее 35 нМ, менее 34 нМ, менее 33 нМ, менее 32 нМ, менее 31 нМ, при доставке в клетки HepG2.2.1. В некоторых вариантах реализации, ингибирование измеряют при помощи набора затравочных зондов RTS3371, описанного в настоящем документе.

В некоторых вариантах реализации, соединения или композиции, описанные в настоящем документе, являются эффективными на основании того, что они имеют значение in vitro IC50 менее 20 мкМ, менее 10 мкМ, менее 9, 5 мкМ, менее 9,0 мкМ, менее 8, 5 мкМ, менее 8,0 мкМ, менее 7, 5 мкМ, менее 7,0 мкМ, менее 6, 5 мкМ, менее 6,0 мкМ, менее 5, 5 мкМ, менее 5,0 мкМ, менее 4, 5 мкМ, менее 4,0 мкМ, менее 3, 5 мкМ мегее 3,0 мкМ, менее 2, 5 мкМ, при доставке в клетки HepG2.2.1, как описано в настоящем документе.

В некоторых вариантах реализации, соединения или композиции, описанные в настоящем документе, являются высоко переносимыми, что демонстрируется тем, что они увеличивают по меньшей мере одно из значений ALT или AST не более чем в 4 раза, 3 раза или 2 раза по сравнению с животными, обработанными солевым раствором, или увеличивают вес печени, селезенки или почек не более чем на 30%, 20%, 15%, 12%, 10%, 5% или 2%. В некоторых вариантах реализации, соединения или композиции, описанные в настоящем документе, являются высоко переносимыми, что демонстрируется тем, что они не увеличивают ALT или AST по сравнению с животными, обработанными солевым раствором. В некоторых вариантах реализации, соединения или композиции, описанные в настоящем документе, являются высоко переносимыми, что демонстрируется тем, что они не увеличивают вес печени, селезенки или почек по сравнению с животными, обработанными солевым раствором. В некоторых вариантах реализации, эти соединения или композиции содержат ISIS 146779, ISIS 146786, ISIS 505317, ISIS 505329, ISIS 505332, ISIS 505346, ISIS 505347, ISIS 505358, ISIS 509926, ISIS 509927, ISIS 509932, ISIS 509934, ISIS 509960, ISIS 509974, ISIS 510038, ISIS 510039, ISIS 510040, ISIS 510041, ISIS 510050 ISIS 509975, ISIS 510100, ISIS 510106 и ISIS 510116. В некоторых вариантах реализации, такие соединения или композиции содержат соединения, содержащие последовательность нуклеооснований любой из последовательностей SEQ ID NO:5-310, 321-802 или 804-1272. В некоторых вариантах реализации, такие соединения или композиции содержат соединения, содержащие последовательность нуклеооснований любой из последовательностей SEQ ID NO:5, 15, 16, 33, 39-95, 123-135, 163-175, 180-310, 321-406, 413-455, 461-802 или 804-1272. В некоторых вариантах реализации, такие соединения или композици содержат последовательность нуклеооснований любой из последовательностей SEQ ID NO:6-14, 17-32, 34-38, 96-122, 136-162, 176-179, 407-412, 456-462, 523-538 (обновленные SEQ ID NO), причем по меньшей мере один нуклеозид модифицированного олигонуклеотида содержит по меньшей мере один 2'-O-метоксиэтиловый сахар. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 14 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-3 или 2 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 16 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 17 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 2-4 или 3-4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 18 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5, 3-5 или 4 нуклеозида с модифицированным сахаром. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет 20 нуклеозидов в длину и имеет сегмент гэп из 10 связанных нуклеозидов. В некоторых вариантах реализации, модифицированный олигонуклеотид имеет сегмент крыла на конце 5' и конце 3' сегмента гэп, каждый независимо имеет 1-5 или 5 нуклеозидов с модифицированным сахаром.

В некоторых вариантах реализации представлено применение соединения или композиции, описанной в настоящем документе, в производстве лекарственного средства для лечения, улучшения, отсрочки или предупреждения HBV-связанного заболевания, расстройства или состояния у животного.

В некоторых вариантах реализации представлено применение соединения или композиции, описанной в настоящем документе, в производстве лекарственного средства для лечения, улучшения, отсрочки или предупреждения заболевания печени у животного.

В некоторых вариантах реализации представлен набор для лечения, предупреждения или улучшения HBV-связанного заболевания, расстройства или состояния, или его симптома, как описано в настоящем документе, причем указанный набор включает: а) соединение или композиции, описанные в настоящем документе; и необязательно b) дополнительное средство или терапию, описанную в настоящем документе. Набор может дополнительно включать инструкции или этикетку по применнию набора для лечения, предупреждения или улучшения HBV-связанного заболевания, расстройства или состояния.

Антисмысловые соединения

Олигомерные соединения включают, но не ограничиваясь этим, олигонуклеотиды, олигонуклеозиды, олигонуклеотидные аналоги, олигонуклеотид-миметики, антисмысловые соединения, антисмысловые олигонуклеотиды и миРНК. Олигомерное соединение может быть «антисмысловым» для целевой нуклеиновой кислоты, что означает, что оно способно подвергаться гибридизации с целевой нуклеиновой кислотой посредством водородного связывания.

В некоторых вариантах реализации, антисмысловое соединение имеет последовательность нуклеооснований, которая, при прочтении в направлении от 5' к 3', содержит обратный комплемент целевого сегмента целевой нуклеиновой кислоты, на который он направлен. В некоторых таких вариантах реализации, антисмысловый олигонуклеотид имеет последовательность нуклеооснований, которая, при прочтении в направлении от 5' к 3', содержит обратный комплемент целевого сегмента целевой нуклеиновой кислоты, на который он направлен.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 10-30 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 12-30 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 12-22 субъединицы. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 14-30 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 14-20 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 15-30 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 15-20 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 16-30 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 16-20 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 17-30 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 17-20 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 18-30 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 18-21 субъединицы. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 18-20 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 20-30 субъединиц. Другими словами, такие антисмысловые соединения имеют от 12 до 30 связанных субъединиц, от 14 до 30 связанных субъединиц, от 14 до 20 связанных субъединиц, от 15 до 30 связанных субъединиц, от 15 до 20 связанных субъединиц, от 16 до 30 связанных субъединиц, от 16 до 20 связанных субъединиц, от 17 до 30 связанных субъединиц, от 17 до 20 связанных субъединиц, от 18 до 30 связанных субъединиц, от 18 до 20 связанных субъединиц, от 18 до 21 связанных субъединиц, от 20 до 30 связанных субъединиц или от 12 до 22 связанных субъединиц, соответственно. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 14 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 16 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 17 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 18 субъединиц. В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет длину 20 субъединиц. В других вариантах реализации, антисмысловое соединение имеет 8-80, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-22, 18-24, 18-30, 18-50, 19-22, 19-30, 19-50 или 20-30 связанных субъединиц. В некоторых таких вариантах реализации, антисмысловые соединения имеют длину 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 связанных субъединиц, или диапазон, определяемый любыми двумя из представленных выше значений. В некоторых вариантах реализации, антисмысловое соединение представляет собой антисмысловый олигонуклеотид, а связанные субъединицы являются нуклеотидами.

В некоторых вариантах реализации, антисмысловые олигонуклеотиды, направленные на нуклеиновую кислоту HBV, могут быть укорочены или усечены. Например, одна субъединица может быть удалена с конца 5' (усечение 5'), или, альтернативно, с конца 3' (усечение 3'). Укороченное или усеченное антисмысловое соединение, направленное на нуклеиновую кислоту HBV, может иметь две субъединицы, удаленные с конца 5', или, альтернативно, может иметь две субъединицы, удаленные с конца 3' антисмыслового соединения. Альтернативно, удаленные нуклеозиды могут быть рассредоточены в антисмысловом соединении, например, в антисмысловом соединении, имеющем один нуклеозид, удаленный с конца 5', и один нуклеозид, удаленный с конца 3'.

При наличии одной дополнительной субъединицы в удлиненном антисмысловом соединении, эта дополнительная субъединица может быть расположена на конце 5' или 3' антисмыслового соединения. При наличии двух или более дополнительных субъединиц, добавленные субъединицы могут быть соседними относительно друг друга, например, в антисмысловом соединении, имеющем две субъединицы, добавленные в конце 5' (присоединение 5'), или, альтернативно, в конце 3' (присоединение 3') антисмыслового соединения. Альтернативно,добавленные субъединицы могут быть рассредоточены в антисмысловом соединении, например, в антисмысловом соединении, имеющем одну субъединицу, присоединенную к концу 5', и одну субъединицу, присоединенную к концу 3'.

Можно увеличивать или уменьшать длину антисмыслового соединения, такого как антисмысловый олигонуклеотид, и/или внедрять несовпадающие основания без аннулирования активности. Например, в публикации Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), были испытаны серии антисмысловых олигонуклеотидов из 13-25 нуклеооснований на их способность вызывать расщепление целевой РНК в модели инъекции ооцита. Антисмысловые олигонуклеотиды длиной 25 нуклеооснований с 8 или 11 не совпадающими основаниями вблизи концов антисмысловых олигонуклеотидов были способны направлять специфическое расщепление целевой мРНК, хотя и в меньшей степени, чем антисмысловые олигонуклеотиды, не содержащие несовпадений. Точно так же, целевое специфическое расщепление было достигнуто с использованием антисмысловых олигонуклеотидов из 13 нуклеооснований, включая олигонуклеотиды с 1 или 3 несовпадениями.

Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) продемонстрировали способность олигонуклеотида, имеющего 100% комплементарность с мРНК bcl-2 и имеющего 3 несовпадения с мРНК bcl-xL, снижать экспрессию bcl-2 и bcl-xL in vitro и in vivo. Более того, этот олигонуклеотид показал потенциальную противоопухолевую активность т vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) исследовали серию последовательных антисмысловых олигонуклеотидов из 14 нуклеооснований, а также антисмысловые олигонуклеотиды из 28 и 42 нуклеооснований, включающих последовательность из двух или трех последовательных антисмысловых олигонуклеотидов, соответственно, на их способность блокировать трансляцию DHFR человека в анализе ретикулоцитов кроликов. Каждый из трех антисмысловых олигонуклеотидов из 14 нуклеооснований по отдельности был способен ингибировать трансляцию, хотя и на более слабом уровне, чем антисмысловые олигонуклеотиды из 28 или 42 нуклеооснований.

Мотивы антисмысловых соединений

В некоторых вариантах реализации, антисмысловые соединения, направленные на нуклеиновую кислоту HBV, содержали химически модифицированные субъединицы, расположенные в таких последовательностях, или мотивах, чтобы придавать антисмысловым соединениям такие свойства, как усиленная ингибирующая активность, повышенная связывающая аффиность к целевой нуклеиновой кислоте или устойчивость к разрушению под действием нуклеаз in vivo.

Химерные антисмысловые соединения обычно содержат по меньшей мере одну область, модифицированную так, чтобы придавать повышенную устойчивость к нуклеазному расщеплению, повышенное клеточное поглощение, повышенную связывающую аффинность к целевой нуклеиновой кислоте и/или повышенную ингибирующую активность. Вторая область химерного антисмыслового соединения может необязательно служить в качестве субстрата для клеточной эндонкулеазы РНазы Н, которая расщепляет цепь РНК дуплекса РНК: ДНК.

Антисмысловые соединения, имеющие мотив химерного олигонуклеотида, считают химерными антисмысловыми соединениями. В химерном олигонуклеотиде, внутренняя область, содержащая множество нуклеотидов, которые поддерживают расщепление РНазы Н, расположена между внешними областями, содержащими множество нуклеотидов, которые являются химически отличными от нуклеозидов внутренней области. В случае если антисмысловый олигонуклеотид имеет мотив химерного олигонуклеотида, то сегмент гэп обычно служит в качестве субстрата для эндонуклеазного расщепления, тогда как сегменты крыльев включают модифицированные нуклеозиды. В некоторых вариантах реализации, области химерного олигонуклеотида дифференцируются по типу сахарных фрагментов, составляющих кажду отдельную область. Типы сахарных фрагментов, которые используют для дифференциации областей химерного олигонуклеотида, могут, в некоторых вариантах реализации, включать β-D-рибонуклеозиды, β-D-дезоксирибонуклеозиды, 2'-модифицированные нуклеозиды (такие 2'-модифицированные нуклеозиды могут включать 2'-МОЕ и 2'-O-СН3, среди прочих) и модифицированные нуклеозиды с бициклическим сахаром (такие модифицированные нуклеозиды с бициклическим сахаром могут включать нуклеозиды, содержащие затрудненный этил). В некоторых вариантах реализации, нуклеозиды в крыльях могут включать несколько модифицированных сахарных фрагментов, включая, например, 2'-МОЕ и бициклические сахарные фрагменты, такие как затрудненный этил или БНК. В некоторых вариантах реализации, крылья могут включать несколько модифицированных и не модифицированных сахарных фрагментов. В некоторых вариантах реализации, крылья могут включать различные комбинации нуклеозидов 2'-МОЕ, бициклических сахарных фрагментов, таких как затрудненные этилнуклеозиды или БНК-нуклеозиды, и 2'-дезоксинуклеозидов.

Каждая отдельная область может включать одинаковые сахарные фрагменты, вариантные или измененные сахарные фрагменты. Мотив крыло-гэп-крыло зачастую описывают как «X-Y-Z», где «X» представляет собой длину 5'-крыла, «Y» представляет собой длину гэп, и «Z» представляет собой длину 3'-крыла. «X» и «Z» могут содержать одинаковые, вариантные или измененные сахарные фрагменты. В некоторых вариантах реализации, «X» и «Y» могут включать один или несколько 2'-дезоксинуклеозидов. «Y» может включать 2'-дезоксинуклеозиды. При использовании в настоящем документе, химерный олигонуклеотид, описанный как «X-Y-Z», имеет такую конфигурацию, что гэп расположен сразу возле каждого из 5'-крыла и 3'-крыла. Следовательно, между 5'-крылом и гэп, или между гэп и 3'-крылом нет промежуточных нуклеотидов. Любые антисмысловые соединения, описанные в настоящем документе, могут иметь мотив химерного олигонуклеотида. В некоторых вариантах реализации, «X» и «Z» являются одинаковыми; в других вариантах реализации они различные. В некоторых вариантах реализации, «Y» содержит от 8 до 15 нуклеозидов. X, Y или Z могут иметь 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 или более нуклеозидов.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 11-меры, имеющие мотив 1-9-1.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 12-меры, имеющие мотив 1-9-2, 2-9-1 или 1-10-1.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 13-меры, имеющие мотив 1-9-3, 2-9-2, 3-9-1, 1-10-2 или 2-10-1.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 14-меры, имеющие мотив 1-9-4, 2-9-3, 3-9-2, 4-9-1, 1-10-3, 2-10-2 или 3-10-1.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 15-меры, имеющие мотив 1-9-5, 2-9-4, 3-9-3, 4-9-2, 5-9-1, 1-10-4, 2-10-3, 3-10-2 или 4-10-1.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 16-меры, имеющие мотив 4-8-4, 2-9-5, 3-9-4, 4-9-3, 5-9-2, 1-10-5, 2-10-4, 3-10-3, 4-10-2, 3-8-5 или 5-10-1.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 17-меры, имеющие мотив 3-9-5, 3-10-4, 4-9-4, 5-9-3, 2-10-5, 3-10-4, 4-10-3, 5-10-2, 2-9-6, 5-8-4, 5-7-5, 6-7-4 или 6-9-2.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 18-меры, имеющие мотив 4-9-5, 5-9-4, 3-10-5, 4-10-4 или 5-10-3.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 19-меры, имеющие мотив 5-9-5, 4-10-5 или 5-10-4.

В некоторых вариантах реализации, химерные олигонуклеотиды, представленные в настоящем документе, содержат, например, 20-меры, имеющие мотив 5-10-5, 2-10-8, 8-10-2, 3-10-7, 7-10-3, 4-10-6 или 6-10-4.

В некоторых вариантах реализации, антисмысловое соединение содержит мотив «олигомера крыла», имеющий конфигурацию крыло-гэп или гэп-крыло, то есть конфигурацию X-Y или Y-Z, как описано выше для конфигурации химерного олигонуклеотида. Следовательно, конфигурации олигомера крыла, представленные в настоящем документе, включают, но не ограничиваясь этим, например, 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8 или 6-8.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 2-10-2.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 3-10-3.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 4-10-4.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 5-10-5.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 3-10-4.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 2-10-4.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 2-10-8.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 8-10-2.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 3-10-7.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 7-10-3.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 4-10-6.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 6-10-4.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 2-9-6.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 6-9-2.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 4-9-4.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 5-9-3.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 3-9-5.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 5-9-2.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 2-9-5.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 4-9-3.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида 3-9-4.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет гэп-расширенный мотив.

В некоторых вариантах реализации, антисмысловое соединение, направленное на нуклеиновую кислоту HBV, имеет мотив химерного олигонуклеотида, в котором гэп состоит из 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 или 16 связанных нуклеозидов.

В некоторых вариантах реализации, антисмысловые соединения, направленные на нуклеиновую кислоту HBV, содержат любой из следующих сахарных мотивов:

































причем k представляет собой затруденный этилнуклеозид, е представляет собой 2'-МОЕ замещенный нуклеозид, и d представляет собой 2'-дезоксинуклеозид.

В некоторых вариантах реализации, антисмысловый олигонуклеотид имеет сахарный мотив, описанный Формулой А, представленной ниже: (J)m-(B)n-(J)p-(B)r-(A)t-(D)g-(A)v-(B)w-(J)x-(B)y-(J)z


каждый А независимо представляет собой 2'-замещенный нуклеозид;

каждый В независимо представляет собой бициклический нуклеозид;

каждый J независимо представляет собой 2'-замещенный нуклеозид или 2'-дезоксинуклеозид;

каждый D представляет собой 2'-дезоксинуклеозид;

m равен O-4; n равен O-2; р равен O-2; r равен O-2; t равен O-2; v равен O-2; w равен O-4; х равен O-2; y равен O-2; z равен O-4; g равен 6-14;

при условии, что:

по меньшей мере, один из m, n и r является отличным от 0;

по меньшей мере, один из w и y является отличным от 0;

сумма m, n, р, r и t составляет от 2 до 5; и сумма v, w, х, y и z составляет от 2 до 5.

Целевые нуклеиновые кислоты, целевые области и нуклеотидные последовательности

Нуклеотидная последовательность, кодирующая HBV, включает, без ограничения, следующую: номер доступа GENBANK U95551.1 (в настоящий документ включена как SEQ ID NO:1).

Следует понимать, что последовательность, представленная далее в каждом SEQ ID NO в Примерах, содержащихся в настоящем документе, является не зависимой от любых модификаций сахарного фрагмента, межнуклеозидной связи или нуклеооснования. Поэтому антисмысловые соединения, определенные номером SEQ ID NO, могут включать, независимо, одну или несколько модификаций сахарного фрагмента, межнуклеозидной связи или нуклеооснования. Антисмысловые соединения, описанные этим номером Isis (Isis №), указывают комбинацию последовательности нуклеооснования и мотива.

В некоторых вариантах реализации, целевая область является структурно определенной областью целевой нуклеиновой кислоты. Например, целевая область может охватывать 3' не транслируемую область (UTR), 5' не транслируемую область, экзон, интрон, экзон-интронное сочленение, кодирующую область, область инициации трансляции, область обрыва трансляции или другую определенную область нуклеиновой кислоты. Структурно определенные области для HBV могут быть получены по номеру доступа из базы данных последовательностей, такой как NCBI, и такая информация включена в настоящий документ путем ссылки. В некоторых вариантах реализации, целевая область может охватывать последовательность от 5' целевого сайта любого целевого сегмента в пределах целевой области от 3' целевого сайта другого целевого сегмента в пределах той же целевой области.

Таргетинг включает определение по меньшей мере одного целевого сегмента, с которым гибридизуется антисмысловое соединение с возникновением заданного эффекта. В некоторых вариантах реализации заданный эффект представляет собой снижение уровней целевой нуклеиновой кислоты мРНК. В некоторых вариантах реализации, заданный эффект представляет собой снижение уровней белка, кодирующего целевую нуклеиновую кислоту или фенотипическое изменение, связанное с целевой нуклеиновой кислотой.

Целевая область може содержать один или несколько целевых сегментов. Несколько целевых сегментов в пределах целевой области могут перекрываться. Альтернативно, они могут не перекрываться. В некоторых вариантах реализации, целевые сегменты в пределах целевой области разделены не более чем около 300 нуклеотидами. В некоторых вариантах реализации, целевые сегменты в пределах целевой области разделены количеством нуклеотидов, которое составляет, или примерно равно, или не превышает, или примерно не превышает 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 или 10 нуклеотидов целевой нуклеиновой кислоты, или находится в диапазоне, определенном любыми из двух предшествующих значений. В некоторых вариантах реализации, целевые сегменты в пределах целевой области разделены не более чем или примерно не более чем 5 нуклеотидами целевой нуклеиновой кислоты. В некоторых вариантах реализации, целевые сегменты являются смежными. Подразумевается целевые области, определенные диапазоном, имеющим исходную нуклеиновую кислоту, то есть любой из 5' целевых сайтов или 3' целевых сайтов, перечисленных в настоящем документе.

Соответствующие целевые сегменты могут находиться в 5' не транслируемой области, кодирующей области, 3' не транслируемой области, интроне, экзоне или экзон-интронном сочленении. Целевые сегменты, содержащие инициирующий кодон или стоп-кодон, также являются пригодными целевыми сегментами. Соответствующий целевой сегмент может специально исключать некоторую структурно определенную область, такую как инициирующий кодон или стоп-кодон.

Определение соответствующих целевых сегментов может включать сравнение последовательности целевой нуклеиновой кислоты с другими последовательностями генома. Например, для определения областей сходства среди различных нуклеиновых кислот может быть использован алгоритм BLAST. Это сравнение может предотвращать выбор последовательностей антисмысловых соединений, которые могут гибридизоваться неспецифическим образом с последовательностями, отличными от выбранной целевой нуклеиновой кислоты (то есть нецелевыми последовательностями).

В пределах активной целевой области может наблюдаться изменение активности (например, по результатам определения процентного снижения уровней целевой нуклеиновой кислоты) антисмысловых соединений. В некоторых вариантах реализации, снижение уровней мРНК HBV является показателем ингибирования экспрессии HBV. Снижение уровней белка HBV также является показателем ингибирования экспрессии целевой мРНК. Кроме того, показателем ингибирования экспрессии HBV являются фенотипические изменения. В некоторых вариантах реализации, показателем ингибирования экспрессии HBV может быть уменьшение усталости, уменьшение симптомов, похожих на грипп, улучшение аппетита, снижение тошноты, уменьшение боли в суставах, уменьшение желтухи, уменьшение боли в животе, снижение слабости, снижение потери веса, уменьшение роста молочной железы у мужчин, уменьшение сыпи на пальцах, уменьшение проблем свертываемости крови, уменьшение цирроза, уменьшение пауковидных кровеносных сосудов на коже, повышение абсорбции витаминов А и D, снижение роста опухоли, снижение объема опухоли, уменьшение головной боли, уменьшение жара, уменьшение диареии, уменьшение боли в области печени организма, уменьшение стула земляного или серого цвета, уменьшение зуда, уменьшение мочи темного цвета и уменьшение тошноты и рвоты. В некоторых вариантах реализации, показателем ингибирования экспрессии HBV может быть улучшение симптомов, обусловленных HBV-связанными состояниями, заболеваниями и расстройствами. В некоторых вариантах реализации, показателем ингибирования экспрессии HBV является уменьшение цирроза. В некоторых вариантах реализации, показателем ингибирования экспрессии HBV является уменьшение маркеров рака печени.


В некоторых вариантах реализации, гибридизация происходит между антисмысловым соединением, описанным в настоящем документе, и нуклеиновой кислотой HBV. Наиболее общий механизм гибридизации включает водородное связывание (например, Уотсона-Крика, Хугстина или обратное водородное связывание Хугстина) между комплементарными нуклеооснованиями молекул нуклеиновых кислот.

Гибридизация может происходить при различных условиях. Обязательным условием является зависимость от последовательностей, и она определяется природой и составом молекул нуклеиновых кислот, подлежащих гибридизации.

Способы определения того, может ли определенная последовательность специфически гибридизоваться с целевой нуклеиновой кислотой, хорошо известны в данной области техники. В некоторых вариантах реализации, антисмысловые соединения, представленные в настоящем документе, могут специфически гибридизоваться с нуклеиновой кислотой HBV.


Антисмысловое соединение и целевая нуклеиновая кислоты комплементарны друг другу, если достаточное количество нуклеооснований антисмыслового соединения может быть связано водородной связью с соответствующими нуклеооснованиями целевой нуклеиновой кислоты, так что возникает заданный эффект (например, антисмысловое ингибирование целевой нуклеиновой кислоты, такой как нуклеиновая кислота HBV).

Не комплементарные нуклеооснования между антисмысловым соединением и нуклеиновой кислотой HBV могут быть допустимы при условии, что антисмысловое соединение остается способным специфически гибридизоваться с целевой нуклеиновой кислотой. Более того, антисмысловое соединение может гибридизоваться в одном или нескольких сегментах нуклеиновой кислоты HBV, так что промежуточные или соседние сегменты не участвуют в гибридизации (например, петлевая структура, не совпадающая или шпилечная структура).

В некоторых вариантах реализации, антисмысловое соединение, представленное в настоящем документе, или его определенная часть комплементарны или по меньшей мере на 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% комплементарны нуклеиновой кислоте HBV, целевой области, целевому сегменту или определенной их части. Процент комплементарности антисмыслового соединения с целевой нуклеиновой кислотой может быть определен стандартными способами.

Например, антисмысловое соединение, в котором 18 из 20 нуклеооснований указанного антисмыслового соединения комплементарны целевой области и, следовательно, будут специфически гибридизоваться, представляет 90 процентнов комплементарности. В этом примере оставшиеся не комплементарные нуклеооснования могут быть сгруппированы или перемежаться с комплементарными нуклеооснованиями, и не обязательно должны быть смежными друг с другом или с комплементарными нуклеооснованиями. Поэтому антисмысловое соединение длиной 18 нуклеооснований, имеющее четыре не комплементарных нуклеооснования, к которым примыкают две области полной комплементарности с целевой нуклеиновой кислотой, имеет общую комплементарность с целевой нуклеиновой кислотой 77,8%, и, следовательно, входит в рамки настоящего изобретения. Процент комплементарности антисмыслового соединения с областью целевой нуклеиновой кислоты может быть определен обычным способом с использованием программ BLAST (программ для обнаружения сходства последовательностей белков путем их локального выравнивания) и программ Power BLAST, известных в данной области техники (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Процент гомологичности, идентичности или комплементарности последовательности может быть определен, например, программой Gap (Wisconsin Sequence Analysis Package, версия 8 для Unix, Genetics Computer Group, University Research Park, Мэдисон, штат Висконсин), с использованием настроек по умолчанию, в которых используется алогритм Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

В некоторых вариантах реализации, антисмысловое соединение, представленное в настоящем документе, или определенная его часть полностью комплементарны (то есть на 100% комплементарны) целевой нуклеиновой кислоте или определенной ее части. Например, антисмысловое соединение может быть полностью комплементерно к нуклеиновой кислоте HBV, или ее целевой области, или целевому сегменту, или целевой последовательности. При использовании в настоящем документе, «полностью комплементарен» обозначает, что каждое нуклеооснование антисмыслового соединения может участвовать в точном спаривании оснований с соответствующими нуклеооснованиями целевой нуклеиновой кислоты. Например, антисмысловое соединение из 20 нуклеооснований полностью комплементарно целевой последовательности длиной 400 нуклеооснований, если существует соответствующая часть из 20 нуклеооснований целевой нуклеиновой кислоты, которая полностью комплементарна указанному антисмысловому соединению. Термин «полностью комплементарен» может быть использован также в отношении определенной части первой и/или второй нуклеиновой кислоты. Например, часть из 20 нуклеооснований антисмыслового соединения, состоящего из 30 нуклеооснований, может быть «полностью комплементарна» целевой последовательности длиной 400 нуклеооснований. Часть из 20 нулеооснований олигонуклеотида, состоящего из 30 нуклеооснований, полностью комплементерна целевой последовательности, если целевая последовательность имеет соответствующую часть из 20 нуклеооснований, в которой каждое нуклеооснование комплементарно части из 20 нуклеооснований указанного антисмыслового соединения. В то же время целое антисмысловое соединение из 30 нуклеооснований может быть или может не быть полностью комплементарным к целевой последовательности, в зависимости от того, являются ли оставшиеся 10 нуклеооснований антисмыслового соединения также комплементарными целевой последовательности.

Не комплементарное нуклеооснование может быть расположено у конца 5' или конца 3' антисмыслового соединения Альтернативно, не комплементарное нуклеооснование или нуклеооснования могут быть во внутреннем положении антисмыслового соединения. В случае наличия двух или более не комплементарных нуклеооснований, они могут быть смежными (то есть связанными) или не смежными. В одном варианте реализации, не комплементарное нуклеооснование расположено в сегменте крыла химерного антисмыслового олигонуклеотида.

В некоторых вариантах реализации, антисмысловые соединения, которые имеют длину или которые содержат до 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеооснований, содержат не более 4, не более 3, не более 2 или не более 1 не комплементарного нуклеооснования(ий) относительно целевой нуклеиновой кислоты, такой как нуклеиновая кислота HBV, или ее определенная часть.

В некоторых вариантах реализации, антисмысловые соединения, которые имеют длину или которые содержат до 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеооснований, содержат не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 не комплементарного нуклеооснования(ий) относительно целевой нуклеиновой кислоты, такой как нуклеиновая кислота HBV, или ее определенная часть.

Представленные антисмысловые соединения включают также те, которые комплементарны части целевой нуклеиновой кислоты. При использовании в настоящем документе, «часть» относится к определенному количеству смежных (то есть связанных) нуклеооснований в пределах области или сегмента целевой нуклеиновой кислоты. «Часть» может также относиться к определенному количеству смежных нуклеооснований антисмыслового соединения. В некоторых вариантах реализации, антисмысловые соединения комплементарны части целевого сегмента по меньшей мере из 8 нуклеооснований. В некоторых вариантах реализации, антисмысловые соединения комплементарны части целевого сегмента по меньшей мере из 9 нуклеооснований. В некоторых вариантах реализации, антисмысловые соединения комплементарны части целевого сегмента по меньшей мере из 10 нуклеооснований. В некоторых вариантах реализации, антисмысловые соединения комплементарны части целевого сегмента по меньшей мере из 11 нуклеооснований. В некоторых вариантах реализации, антисмысловые соединения комплементарны части целевого сегмента по меньшей мере из 12 нуклеооснований. В некоторых вариантах реализации, антисмысловые соединения комплементарны части целевого сегмента по меньшей мере из 13 нуклеооснований. В некоторых вариантах реализации, антисмысловые соединения комплементарны части целевого сегмента по меньшей мере из 14 нуклеооснований. В некоторых вариантах реализации, антисмысловые соединения комплементарны части целевого сегмента по меньшей мере из 15 нуклеооснований. Также подразумеваются антисмысловые соединения, которые комплементарны части целевого сегмента по меньшей мере из 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или более нуклеооснований, или в диапазоне между любыми из двух этих значений.


Антисмыловые соединения, представленные в настоящем документе, также могут иметь определенный процент идентичности с определенной нуклеотидной последовательностью, SEQ ID NO или соединением, представленным номером Isis, или их частью. При использовании в настоящем документе, антисмысловое соединение является идентичным к последовательности, описанной в настоящем документе, если оно имеет такую же способность к спариванию нуклеооснований. Например, РНК, которая содержит урацил вместо тимидина в описанной последовательности ДНК, считается идентичной к этой последовательности ДНК, поскольку и урацил, и тимидин спариваются с аденином. Подразумеваются также укороченные и удлиненные версии антисмысловых соединений, описанных в настоящем документе, а также соединения, имеющие не идентичные основания по сравнению с антисмысловыми соединениями, представленными в настоящем документе. Не идентичные основания могут быть соседними друг к другу или рассредоточены в антисмысловом соединении. Процент идентичности антисмыслового соединения рассчитывают по количеству оснований, имеющих идентичное спаривание оснований, по сравнению с последовательностью, с которой его сравнивают.

В некоторых вариантах реализации, антисмысловые соединения или их части являются по меньшей мере на 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичными к одному или нескольким антисмысловым соединениями или последовательностям SEQ ID NO, или их частям, описанным в настоящем документе.

В некоторых вариантах реализации, часть антисмыслового соединения сравнивают с частью целевой нуклеиновой кислоты такой же длины. В некоторых вариантах реализации сравнивают часть из 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 нуклеооснований с равной по длине частью целевой нуклеиновой кислоты.

В некоторых вариантах реализации, часть антисмыслового олигонуклеотида сравнивают с частью целевой нуклеиновой кислоты такой же длины. В некоторых вариантах реализации сравнивают часть из 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 нуклеооснований с равной по длине частью целевой нуклеиновой кислоты.


Нуклеозид представляет собой комбинацию основания и сахара. Часть нуклеооснования (известная также как основание) нуклеозида, как правило, представляет собой фрагмент гетероциклического основания. Нуклеотиды представляют собой нуклеозиды, которые дополнительно включают фосфатную группу, ковалентно связанную с сахарной частью нуклеозида. Для тех нуклеозидов, которые включают пентафуранозный сахар, фосфатная группа может быть связана с 2', 3' или 5' гидроксильным фрагментом сахара. Олигонуклеотиды образуются посредством ковалентного связывания соседних нуклеозидов друг с другом с образованием линейного полимерного олигонуклеотида. В пределах олигонуклеотидной структуры, фосфатные группы обычно упоминают как образующие межнуклеозидные связи олигонуклеотида.

Модификации антисмысловых соединений включают замещения или изменения межнуклеозидных связей, сахарных фрагментов или нуклеооснований. Модифицированные антисмысловые соединения зачастую являются предпочтительными по сравнению с нативными формами за счет желательных свойств, таких как, например, усиленное клеточное поглощение, усиленная аффинность к целевой нуклеиновой кислоте, увеличенная устойчивость в присутствии нуклеаз или увеличенная ингибирующая активность.

Химически модифицированные нуклеозиды также могут быть использованы для увеличения связывающей аффинности укороченного или усеченного антисмыслового соединения к его целевой нуклеиновой кислоте. Следовательно, зачастую могут быть получены сравнимые результаты с укороченными антисмысловыми соединениями, которые имеют такие химически модифицированные нуклеозиды.

Модифицированные межнуклеозидные связи

Природная межнуклеозидная связь РНК и ДНК представляет собой фосфодиэфирную связь 3' с 5'. Антисмысловые соединения, имеющие одну или несколько модифицированных, то есть неприродных, межнуклеозидных связей, зачастую выбирают вместо антисмысловых соединений, имеющих природные межнуклеозидные связи из-за желательных свойств, таких как, например, усиленное клеточное полощение, усиленная аффиность к целевым нуклеиновым кислотам и увеличенная устойчивость в присутствии нуклеаз.

Олигонуклеотиды, имеющие модифицированные межнуклеозидные связи, включают межнуклеозидные связи, которые сохраняют атом фосфора, а также межнуклеозидные связи, которые не имеют атома фосфора. Иллюстративные межнуклеозидные связи, содержащие фосфор, включают, но не ограничиваясь этим, фосфодиэфиры, фосфотриэфиры, метилфосфонаты, фосфорамидаты и фосфотиоаты. Хорошо известны способы получения фосфоросодержащих и не фосфоросодержащих связей.

В некоторых вариантах реализации, антисмысловые соединения, направленные на нуклеиновую кислоту HBV, содержат одну или несколько модифицированных межнуклеозидных связей. В некоторых вариантах реализации, модифицированные межнуклеозидные связи представляют собой фосфотиоатные связи. В некоторых вариантах реализации, каждая межнуклеозидная связь антисмыслового соединения представляет собой фосфотиоатную межнуклеозидную связь.

Модифицированные сахарные фрагменты

Антисмысловые соединения, представленные в настоящем документе, могут необязательно содержать один или несколько нуклеозидов, в которых модифицирована сахарная группа. Такие нуклеозиды с модифицированным сахаром могут придавать улучшенную устойчивость к действию нуклеаз, увеличенную связывающую аффинность или какое-либо другое преимущественное биологическое свойство антисмысловым соединениям. В некоторых вариантах реализации, нуклеозиды включают химически модифицированный рибофуранозный кольцевой фрагмент.Примеры химически модифицированных рибофуранозных колец включают, без ограничения, добавление групп заместителей (включая 5' и 2' группы заместителей); связывание мостиком не геминальных кольцевых атомов с образованием бициклических нуклеиновых кислот (БцНК); замену рибозильного кольцевого кислородного атома на S, N(R) или C(R1)(R)2 (R=Н, С112 алкил или защитная группа); и их комбинации. Примеры химически модифицированных сахаров включают 2'-F-5'-метил-замещенный нуклеозид (смотри Международную заявку РСТ WO 2008/101157, опубликованную 8/21/08, где описаны другие 5', 2'-бис-замещенные нуклеозиды), замену рибозильного кольцевого кислородного атома на S с дополнительным замещением в 2'-положении (смотри опубликованную заявку на патент США US2005/0130923, опубликованную 16 июня 2005 года), или, альтернативно, 5'-замещение БцНК (смотри Международную заявку РСТ WO 2007/134181, опубликованную 11/22/07, в которой БНК замещена, например, 5'-метиловой или 5'-виниловой группой).

Примеры нуклеозидов, имеющих модифицированные сахарные фрагменты включают, без ограничения, нуклеозиды, включающие 5'-винил, 5'-метил (R или S), 4'-S, 2'-F, 2'-ОСН3 и 2'-O(СН2)2OCH3 группы заместителей. Заместитель в 2' положении также может быть выбран из аллила, амино, азидо, тио, O-аллила, O-C110 алкила, OCF3, O(СН2)2SCH3, O(CH2)2-O-N(Rm)(Rn) и O-CH2-C(=0)-N(Rm)(Rn), причем каждый Rm и Rn независимо представляет собой Н или замещенный или незамещенный C110 алкил.

При использовании в настоящем документе, «бициклические нуклеозиды» относятся к модифицированным нуклеозидам, содержащим бициклический сахарный фрагмент. Примеры бициклических нуклеозидов включают, без ограничения, нуклеозиды, содержащие мостик между 4' и 2' рибозильными кольцевыми атомами. В некоторых вариантах реализации, антисмысловые соединения, представленные в настоящем документе, содержат один или несколько бициклических нуклеозидов, причем мостик содержит бициклический нуклеозид 4'-2'. Примеры таких бициклических нуклеозидов 4'-2' включают, но не ограничиваясь этим, нуклеозиды формул: 4'-(CH2)-O-2' (БНК); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-СН(СН3)-O-2' (cEt) и 4'-СН(СН20СНз)-O-2', и их аналоги (смотри патент США 7399845, опубликованный 15 июля 2008 года; 4'-С(СН3)(СН3)-O-2', и его аналоги (смотри опубликованную Международную заявку РСТ W02009/006478, опубликованную 8 января 2009 года); 4'-СН2-N(ОСН3)-2', и его аналоги (смотри опубликованную Международную заявку РСТ WO 2008/150729, опубликованную 11 декабря 2008 года); 4'-СН2-O-N(СН3)-2' (смотри опубликованную заявку на патент США US 2004/0171570, опубликованную 2 сентября 2004 года); 4'-CH2-N(R)-O-2', причем R представляет собой Н, С112 алкил или защитную группу (смотри патент США 7427672, опубликованный 23 сентября 2008 года); 4'-СН2-С(Н)(СН3)-2' (смотри публикацию Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); и 4'-СН2-С(=СН2)-2', и его аналоги (смотри опубликованную Международную заявку РСТ WO 2008/154401, опубликованную 8 декабря 2008 года). Также смотри, например: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; патенты США №№ U.S. 6670461, 7053207, 6268490, 6770748, 6794499, 7034133, 6525191, 7399845; опубликованный Международные заявки РСТ WO 2004/106356, WO 94/14226, WO 2005/021570 и WO 2007/134181; публикации патентов США №№US 2004/0171570, US 2007/0287831 и US 2008/0039618; и патенты США серийных №№12/129154, 60/989574, 61/026995, 61/026998, 61/056564, 61/086231, 61/097787 и 61/099844; а также Международный заявки РСТ №№PCT/US2008/064591, PCT/US2008/066154 и PCT/US2008/068922. Каждый из представленных выше бициклических нуклеозидов может быть получен с одним или несколькими стереохимическими конфигурациями сахара, включая, например, α-L-рибофуранозу и β-D-рибофуранозу (смотри Международную заявку РСТ PCT/DK98/00393, опубликованную 25 марта 1999 года как WO 99/14226).

В некоторых вариантах реализации, бициклические сахарные фрагменты БцНК нуклеозидов включают, но не ограничиваясь этим, соединения, имеющие по меньшей мере один мостик между положением 4' и 2' пентафуранозного сахарного фрагмента, причем такие мостики независимо содержат 1 или от 2 до 4 связанных групп, независимо выбранных из -[С(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x- и -N(Ra)-;


x равен 0, 1 или 2;

n равен 1, 2, 3 или 4;

каждый Ra и Rb независимо представляет собой Н, защитную группу, гидроксил, C2-C12 алкил, замещенный C112 алкил, C2-C12 алкенил, замещенный C112 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, С520 арил, замещенный С520 арил, гетероциклический радикал, замещенный гетероциклический радикал, гетероарил, замещенный гетероарил, C5-C7 алициклический радикал, замещенный C5-C7 алициклический радикал, галоген, OJ1, NJ1J2, SJ1, N3, COOJ1, ацил (С(=O)-Н), замещенный ацил, CN, сульфонил (S(=O)2-J1) или сульфоксил (S(=O)2-J1); и

каждый J1 и J2 независимо представляет собой, Н, С112 алкил, замещенный C212 алкил, С2-C12 алкенил, замещенный С212 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C5-C20 арил, замещенный С520 арил, ацил (С(=O)-Н), замещенный ацил, гетероциклический радикал, замещенный гетероциклический радикал, C112 аминоалкил, замещенный C1-C12 аминоалкил или защитную группу.

В некоторых вариантах реализации, мостик бициклического сахарного фрагмента представляет собой -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(RaRb)-N(R)-O- или -C(RaRb)-O-N(R)-. В некоторых вариантах реализации, мостик представляет собой 4'-СН2-2', 4'-(СН2)2-2', 4'-(СН2)3-2', 4'-СН2-O-2', 4'-(СН2)2-O-2', 4'-CH2-O-N(R)-2' и 4'-CH2-N(R)-O-2'-, причем каждый R независимо представляет собой Н, защитную группу или C1-C12 алкил.

В некоторых вариантах реализации, бициклические нуклеозиды дополнительно определены по изомерной конфигурации. Например, нуклеозид, содержащий 4'-2' метиленокси-мостик, может быть в α-L конфигурации или β-D конфигурации. Ранее в антисмысловые олигонуклеотиды, демонстрирующие антисмысловую активность, были внедрены a-L-метиленокси (4'-СН2-O-2') БцНК (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

В некоторых вариантах реализации, бициклические нуклеозиды включают, но не ограничиваясь этим, (А) α-L-метиленокси (4'-СН2-O-2') БцНК, (В) β-D-метиленокси (4'-СН2-O-2') БцНК, (С) этиленокси (4'-(СН2)2-O-2') БцНК, (D) аминоокси (4'-CH2-O-N(R)-2') БцНК, (Е) оксиамино (4'-CH2-N(R)-O-2') БцНК, (F) метил(метиленокси) (4'-СН(СН3)-O-2') БцНК, (G) метилен-тио (4'-СН2-S-2') БцНК, (Н) метилен-амино (4'-CH2-N(R)-2') БцНК, (I) метил-карбоциклические (4'-СН2-СН(СН3)-2') БцНК и (J) пропилен-карбоциклические (4'-(СН2)3-2') БцНК, изображенные ниже.

причем Вх представляет собой фрагмент основания, a R независимо представляет собой Н, защитную группу или C1-C12 алкил.

В некоторых вариантах реализации, бициклический нуклеозид имеет Формулу I:


Вх представляет собой фрагмент гетероциклического основания;

-Qa-Qb-Qc- представляет собой -CH2-N(Rc)-CH2-, -C(=O)-N(Rc)-CH2-, -CH2-O-N(Rc)-, -СН2-N(Rc)-O- или -N(Rc)-O-CH2;

Rc представляет собой C1-C12 алкил или амино-защитную группу; и

Та и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, сопряженную группу, химически активную фосфорную группу, фосфорный фрагмент или ковалентное связывание со стабилизирующей средой.

В некоторых вариантах реализации, бициклический нуклеозид имеет Формулу II:


Вх представляет собой фрагмент гетероциклического основания;

Та и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, сопряженную группу, химически активную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

Za представляет собой C16 алкил, С26 алкенил, C26 алкинил, замещенный C16 алкил, замещенный С36 алкенил, замещенный С26 алкинил, ацил, замещенный ацил, замещенный амид, тиол или замещенный тио.

В одном варианте реализации, каждая из замещенных групп независимо представляет собой моно- или полизамещенную группу с группами заместителей, независимо выбранными из галогена, оксо, гидроксила, OJc, NJcJd, SJc, N3, OC(=X)Jc и NJcC(=X)NJcJd, причем каждый Jc, Jd и Jc независимо представляют собой Н, C16 алкил ил изамещенный C16 алкил, и Х представляет собой О или NJc.

В некоторых вариантах реализации, бициклический нуклеозид имеет Формулу III:


Вх представляет собой фрагмент гетероциклического основания;

Та и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, сопряженную группу, химически активную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

Zb представляет собой C16 алкил, С26 алкенил, С26 алкинил, замещенный C16 алкил, 5 замещенный C16 алкенил, замещенный С26 алкинил или замещенный ацил (С(=O)-). В некоторых вариантах реализации, бициклический нуклеозид имеет Формулу IV:


Вх представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, сопряженную группу, химически активную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

Rd представляет собой C16 алкил, замещенный C16 алкил, С26 алкенил, замещенный C16 алкенил, С26 алкинил или замещенный С26 алкинил;

каждый qa, qb, qc и qd независимо представляет собой Н, галоген, C16 алкил, замещенный С16 алкил, С26 алкенил, замещенный С26 алкенил, С26 алкинил или замещенный С26 алкинил, C16 алкоксил, замещенный C16 алкоксил, ацил, замещенный ацил, C16 аминоалкил или замещенный C16 аминоалкил;

В некоторых вариантах реализации, бициклический нуклеозид имеет Формулу V:


Вх представляет собой фрагмент гетероциклического основания;

Та и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, сопряженную группу, химически активную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

qa, qb, qe и qf, каждый независимо, представляют собой водород, галоген, С112 алкил, замещенный C112 алкил, С212 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C1-C12 алкокси, замещенный C1-C12 алкокси, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или N(H)C(=S)NJjJk;

или qe и qf вместе представляют собой =C(qg)(qh);

qg и qh, каждый независимо, представляют собой Н, галоген, C112 алкил или замещенный C1-C12 алкил.

Были описаны синтез и получение метиленокси (4'-СН2-O-2') БцНК мономеров аденина, цитозина, гуанина, 5-метил-цитозина, тимина и урацила, а также их олигомеризация и свойства распознавания нуклеиновых кислот (смотри, например, Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). БцНК и их получение описаны также в WO 98/39352 и WO 99/14226.

Также были получены аналоги метиленокси (4'-СН2-O-2') БцНК, метиленокси (4'-СН2-O-2') БцНК и 2'-тио-БцНК (смотри, например, Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Было описано также получение блокированных нуклеозидных аналогов, включающих олигодезоксирибонуклеотидные дуплексы в качестве субстратов для полимераз нуклеиновых кислот (смотри, например, Wengel et al., WO 99/14226). Кроме того, в данной области техники описан синтез 2'-амино-БцНК, нового конформационно ограниченного олигонуклеотидного аналога с высокой аффинностью (смотри, например, Singh et al., J. Org. Chem., 1998, 63, 10035-10039). Кроме того, ранее были описаны 2'-амино- и 2'-метиламино-БцНк, а также термическая устойчивость их дуплексов с комплементарными цепями РНК и ДНК.

В некоторых вариантах реализации, бициклический нуклеозид имеет Формулу VI:


Вх представляет собой фрагмент гетероциклического основания;

Та и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, сопряженную группу, химически активную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

каждый qi, qj, qk и qj независимо, представляет собой Н, галоген, C1-C12 алкил, замещенный C1-C12 алкил, С212 алкенил, замещенный С212 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C1-C12 алкоксил, замещенный C1-C12 алкоксил, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=0)NJjJk или N(Н)С(=S)NJjJk; и

qi и qj иди qi и qk вместе представляют собой =C(qg)(qh), причем qg и qh, каждый независимо, представляют собой Н, галоген, C1-C12 алкил или замещенный C1-C12 алкил.

Описан один карбоциклический бициклический нуклеозид, имеющий мостик 4'-(СН2)3-2', и алкениловый аналог, мостик 4'-СН=СН-СН2-2' (смотри, например, Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 и Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). Также был описан синтез и получение карбоциклических бициклических нуклеозидов, их олигомеризация и биохимические исследования (смотри, например, Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

При использовании в настоящем документе, «бициклический нуклеозид» относится к нуклеозиду, содержащему мостиковое соединение двух атомов углерода сахарного кольца, с образованием посредством этого бициклического сахарного фрагмента. В некоторых вариантах реализации, мостик соединяет 2' углерод и другой углерод сахарного кольца.

При использовании в настоящем документе, «4'-2' бициклический нуклеозид» или «4'-2' бициклический нуклеозид» относится к бициклическому нуклеозиду, содержащему фуранозное кольцо, содержащее мостиковое соединение 2' углеродного атома и 4' углеродного атома.

При использовании в настоящем документе, «моноциклические нуклеозиды» относятся к нуклеозидам, содержащим модифицированные сахарные фрагменты, которые не являются бициклическими сахарными фрагментами. В некоторых вариантах реализации, сахарный фрагмент или аналог сахарного фрагмента нуклеозида может быть модифицированным или замещенным в любом положении.

При использовании в настоящем документе, «2'-модифицированный сахар» обозначает фуранозный сахар, модифицированный в 2'-положении. В некоторых вариантах реализации, такие модификации включают заместители, выбранные из: галогенида, включая, но не ограничиваясь этим, замещенный и незамещенный алкокси, замещенный и незамещенный тиоалкил, замещенный и незамещенный аминоалкил, замещенный и незамещенный алкил, замещенный и незамещенный аллил, и замещенный и незамещенный алкинил. В некоторых вариантах реализации, 2'-модификации выбраны из заместителей, включающих, но не ограничиваясь этим: O[(СН2)nO]mCH3, O(CH2)nNH2, O(СН2)nCH3, O(CH2)nONH2, ОСН2С(=O)n(Н)СН3 и O(СН2)nO|N[(СН2)nCH3]2, причем пит равны от 1 до около 10. Другие группы 2'-заместителей также могут быть выбраны из: C1-C12 алкила; замещенного алкила; алкенила; алкинила; алкарила; аралкила; O-алкарила или O-аралкила; SH; SCH3; OCN; Cl; Br; CN; CF3; OCF3; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; гетероциклоалкила; гетероциклоалкарила; аминоалкиламино; полиалкиламино; замещенного силила; РНК-расщепляющей группы; репортерной группы; интеркалятора; групп для улучшения фармакокинетических свойств; и групп для улучшения фармакодинамических свойств антисмыслового соединения, а также других заместителей, имеющих аналогичные свойства. В некоторых вариантах реализации, модифицированные нуклеозиды включают боковую цепь 2'-МОЕ (смотри, например. Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Такое 2'-МОЕ замещение может быть описано как обладающее улучшенной связывающей аффинностью по сравнению с не модифицированными нуклеозидами и с другими модифицированными нуклеозидами, такими как 2'-O-метил, O-пропил и O-аминопропил. Было также показано, что олигонуклеотиды, имеющие заместитель 2'-МОЕ, являются антисмысловыми ингибиторами генной экспрессии с многообещающими характеристиками для применения in vivo (смотри, например, Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; и Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

При использовании в настоящем документе, «модифицированный тетрагидропирановый нуклеозид» или «модифицированный ТГП нуклеозид» обозначает нуклеозид, имеющий шестичленный тетрагидропирановый «сахар», замещающий пентафуранозный остаток в нормальных нуклеозидах (заменитель сахара). Модифицированные ТГП нуклеозиды включают, но не ограничиваясь этим, так называемые гекситоловые нуклеиновые кислоты (ГНК), анитоловые нуклеиновые кислоты (АНК), маннитоловые нуклеиновые кислоты (МНК) (смотри Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), фтор-ГНК (F-ГНК) или соединения, имеющие Формулу X:

Формула X:

причем независимо для каждого из упомянутого по меньшей мере одного тетрагидропиранового нуклеозидного аналога Формулы X:

Вх представляет собой фрагмент гетероциклического основания;

Т3 и Т4, каждый независимо, межнуклеозидная связывающая группа, связывающая тетрагидропирановый нуклеозидный аналог с антисмысловым соединением или одним из Т3 и Т4, представляет собой межнуклеозидную связывающую группу, связывающую тетрагидропирановый нуклеозидный аналог с антисмысловым соединением, а другой из Т3 и Т4 представляет собой Н, гидрокси-защитную группу, связанную сопряженную группу или 5' или 3'-концевую группу;

q1, q2, q3, q4, q5, q6 и q7, каждый независимо, представляет собой, Н, C16 алкил, замещенный C16 алкил, С26 алкенил, замещенный С26 алкенил, С26 алкинил или замещенный С26 алкинил; и

один из R1 и R2 представляет собой водород, а другой выбран из галогена, замещенного или незамещенного алкокси, NJ1J2, SJ1, N3, OC(=X)J1, ОС(=Х)NJ1J2, NJ3C(=X)NJ1J2 и CN, причем X представляет собой О, S или NJ1, и каждый J1, J2 и J3 независимо представляет собой Н или C16 алкил.

В некоторых вариантах реализации, представлены модифицированные ТГП нуклеозиды Формулы X, в которых каждый qm, qn, qp, qr, qs, qt и qu представляет собой Н. В некоторых вариантах реализации по меньшей мере один из qm, qn, qp, qr, qs, qt и qu является отличным от Н. В некоторых вариантах реализации, по меньшей мере один из qm, qn, qp, qr, qs, qt и qu представляет собой метил. В некоторых вариантах реализации представлены ТГП нуклеозиды Формулы X, в которых один из R1 и R2 представляет собой F. В некоторых вариантах реализации R1 представляет собой фтор, a R2 представляет собой Н, R1 представляет собой метокси, а R2 представляет собой Н, и R1 представляет собой метоксиэтокси, а R2 представляет собой Н.

При использовании в настоящем документе, «2'-модифицированный нуклеозид» или «2'-замещенный нуклеозид» относится к нуклеозиду, включающему сахар, содержащий заместитель в 2'-положении фуранозного кольца, отличный от Н или ОН. 2'-модифицированные нуклеозиды включают, но не ограничиваясь этим, бициклические нуклеозиды, в которых мостик, соединяющий два углеродных атома сахароного кольца, соединяет 2' углерода и другой углерод сахарного кольца, а также нуклеозиды с немостиковыми 2' заместителями, такими как аллил, амино, азидо, тио, O-аллил, O-C1-C10 алкил, -OCF3, O-(СН2)2-O-СН3, 2'-O(СН2)2SCH3, O-(CH2)2-O-N(Rm)(Rn) или O-СН2-С(=O)-N(Rm)(Rn), причем каждый Rm и Rn независимо представляет собой Н или замещенный или незамещенный C110 алкил. 2'-модифицированные нуклеозиды могут дополнительно содержать другие модификации, например, в других положениях сахара и/или в нуклеоосновании.

При использовании в настоящем документе, «2'-F» относится к сахару, содержащему фтор-группу в 2'-положении.

При использовании в настоящем документе, «2'-ОМе» или «2'-ОСН3», или «2'-O-метил», каждый относится к нуклеозиду, включающему сахар, содержащий группу -ОСН3 в 2'-положении сахарного кольца.

При использовании в настоящем документе, «олигонуклеотид» относится к соединению, содержащему множество связанных нуклеозидов. В некоторых вариантах реализации, один или несколько из множества нуклеозидов являются модифицированными. В некоторых вариантах реализации, олигонуклеотид содержит один или несколько рибонуклеозидов (РНК) и/или дезоксирибонуклеозидов (ДНК).

В данной области техники известны многие другие бициклические и трициклические кольцевые системы, заменяющие сахар, которые могут быть использованы для модификации нуклеозидов для внедрения в антисмысловые соединения (смотри, например, обзорную статью: Leumann, J.С, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854). Такие кольцевые системы могут подвергаться различным дополнительным замещениям для усиления активности.

Специалистам в данной области хорошо известны способы получения модифицированных сахаров.

В нуклеотидах, имеющих модифицированные сахарные фрагменты, фрагменты нуклеооснования (природные, модифицированные или их комбинации) сохраняются для гибридизации с соответствующей мишенью нуклеиновой кислоты.

В некоторых вариантах реализации, антисмысловые соединения содержат один или несколько нуклеотидов, имеющих модифицированные сахарные фрагменты. В некоторых вариантах реализации, модифицированный сахарный фрагмент представляет собой 2'-МОЕ. В некоторых вариантах реализации, 2'-МОЕ модифицированные нуклеотиды расположены в мотиве химерного олигонуклеотида. В некоторых вариантах реализации, модифицированный сахарный фрагмент представляет собой cEt. В некоторых вариантах реализации cEt модифицированные нуклеотиды расположены в крыльях мотива химерного олигонуклеотида.

Композиции и способы составления фармацевтических композиций

Антисмысловые олигонуклеотиды могут быть смешаны с фармацевтически приемлемыми активными или инертными веществами для получения фармацевтических композиций или рецептур. Композиции и способы составления фармацевтических композиций зависят от ряда критериев, включая, но не ограничиваясь этим, способ введения, степень заболевания или дозу, подлежащую введению.

Антисмысловое соединение, направленное на нуклеиновую кислоту HBV, может быть использовано в фармацевтических композициях путем смешивания указанного антисмыслового соединения с соответствующим фармацевтически приемлемым разбавителем или носителем. Фармацевтически приемлемый разбавитель включает фосфатно-солевой буферный раствор (PBS). PBS представляет собой разбавитель, пригодный для применения в композициях, доставляемых парентерально. Соответственно, в одном варианте реализации, используемом в способах, описанных в настоящем документе, представлена фармацевтическая композиция, включающая антисмысловое соединение, направленное на нуклеиновую кислоту HBV, и фармацевтически приемлемый разбавитель. В некоторых вариантах реализации, фармацевтически приемлемый разбавитель представляет собой PBS. В некоторых вариантах реализации, антисмысловое соединение представляет собой антисмысловый олигонуклеотид.

Фармацевтические композиции, включающие антисмысловые соединения, охватывают любые фармацевтически приемлемые соли, сложные эфиры или соли таких сложных эфиров, или любые другие олигонуклеотиды, которые, при введении животному, включая человека, могут обеспечивать (прямо или косвенно) биологически активный метаболит или его остаток. Соответственно, например, настоящее описание относится также к фармацевтически приемлемым солям антисмысловых соединений, пролекарствам, фармацевтически приемлемым солям таких пролекарств и другим биоэквивалентам. Применимые фармацевтически приемлемые соли включают, но не ограничиваясь этим, соли натрия и калия.

Пролекарство может включать внедрение дополнительных нуклеозидов с одного или с обоих концов антисмыслового соединения, которые расщепляются под действием эндогенных нуклеаз в организме, с образованием активного антисмыслового соединения.

Сопряженные антисмысловые соединения

Антисмысловые соединения могут быть ковалентно связаны с одним или несколькими фрагментами или конъюгатами, которые усиливают активность, клеточное распределение или клеточное поглощение образующихся антисмысловых олигонуклеотидов. Типичные сопряженные группы включают холестериновые фрагменты и жировые фрагменты. Дополнительные сопряженные группы включают углеводы, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины и красители.

Антисмысловые соединения могут быть также модифицированы для получения одной или нескольких стабилизирующих групп, которые обычно присоединяются к одному или к обоим концам антисмысловых соединений для усиления свойств, таких как, например, устойчивость к действию нуклеаз. В стабилизирующие группы включены кэп-структуры. Эти концевые модификации защищают антисмысловое соединение, имеющее концевую нуклеиновую кислоту, от экзонуклеазного расщепления, и могут способствовать доставке и/или локализации в клетке. Кэп может присутствовать на 5'-конце (5'-кэп) или на 3'-конце (3'-кэп), или может присутствовать на обоих концах. Кэп-структуры хорошо известны в данной области и включают, например, инвертированные дезокси-кэпы с удаленными азотистыми основаниями. Дополнительные 3' и 5'-стабилизирующие группы, которые могут быть использованы для закрывания одного или обоих концов антисмыслового соединения, чтобы обеспечить устойчивость к действию нуклеаз, включают группы, описанные в WO 03/004602, опубликованной 16 января 2003 года.

Клеточная культура и обработка антисмысловыми соединениями

Влияние антисмысловых соединений на уровень, активность или экспрессию нуклеиновых кислот HBV может быть испытана in vitro в различных типах клеток. Клеточные, используемые для таких анализов, доступны в продаже у коммерческих поставщиков (например, American Type Culture Collection, Manassus, штат Вирджиния; Zen-Bio, Inc., Research Triangle Park, штат Северная Калифорния; Clonetics Corporation, Walkersville, штат Мэриленд), и их выращивают в соответствии с инструкциями поставщика с использованием имеющихся в продаже реактивов (например, Invitrogen Life Technologies, Carlsbad, штат Калифорния). Иллюстративные клеточные типы включают, но не ограничиваясь этим, клетки HuVEC, клетки b.END, клетки HepG2, клетки Нер3В и первичные гепатоциты.

In vitro испытание антисмысловых олигонуклеотидов

В настоящем документе описаны способы обработки клеток антисмысловыми олигонуклеотидами, которые могут быть модифицированы соответствующим образом для обаботки другими антисмысловыми соединениями.

Клетки могут быть обработаны антисмысловыми олигонуклеотидами, когда клетки достигают примерно 60-80% слияния в культуре.

Один реагент, которые обычно используют для введения антисмысловых олигонуклеотидов в выращенные клетки, включает катионный липидный реагент трансфекции LIPOFECTIN (Invitrogen, Карлсбад, штат Калифорния). Антисмысловые олигонуклеотиды могут быть смешаны с LIPOFECTIN в среде OPTI-MEM 1 (Invitrogen, Карлсбад, штат Калифорния) для достижения заданной конечной концентрации антисмыслового олигонуклеотида и концентрации LIPOFECTIN, которая может находиться в диапазоне от 2 до 12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Другой реагент, используемый для введения антисмысловых олигонуклеотидов в выращенные клетки, включает LIPOFECTAMINE (Invitrogen, Карлсбад, штат Калифорния). Антисмысловый олигонуклеотид может быть смешан с LIPOFECTAMINE в среде OPTI-MEM 1 с пониженным содержанием сыворотки (Invitrogen, Карлсбад, штат Калифорния) для достижения заданной концентрации антисмыслового олигонуклеотида и концентрации LIPOFECTAMINE, которая может находиться в диапазоне от 2 до 12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Другие методики, используемые для введения антисмысловых олигонуклеотидов в выращенные клетки, включают электропорацию.

Клетки обрабатывают антисмысловыми олигонуклеотидами стандартами способами. Клетки могут быть собраны через 16-24 часа после обработки антисмысловым олигонуклеотидов, и в это время измеряют уровни РНК или белка целевых нуклеиновых кислот по способам, известным в данной области техники и описанным в настоящем документе. Как правило, при выполнении обработки в нескольких экземплярах, данные представляют как среднее значение повторных обработок.

Используемая концентрация антисмыслового олигонуклеотида варьируется от одной клеточной линии к другой. Способы определения оптимальной концентрации антисмыслового олигонуклеотида для конкретной клеточной линии хорошо известны в данной области. Антисмысловые олигонуклеотиды, как правило, используют в концентрациях от 1 нМ до 300 нМ, при трансфекции с LIPOFECTAMINE. Антисмысловые олигонуклеотиды использую в более высоких концентрациях, от 625 до 20000 нМ, при трансфекции при помощи электропорации.

Выделение РНК

Анализ РНК может быть выполнен на общей клеточной РНК или поли(А)+мРНК. В данной области техники известны способы выделения РНК. РНК готовят с использованием способов, хорошо известных в данной области, например, используя реагент TRIZOL (Invitrogen, Карлсбад, штат Калифорния) по методикам, рекомендованным производителем.

Анализ ингибированш уровней или экспрессии мишени

Ингибирование уровней или экспрессии нуклеиновой кислоты HBV может быть анализировано различными способами, известными в данной области. Нарпимер, уровни целевой нуклеиновой кислоты могут быть количественно определены, например, нозерн-блоттингом, сравнительной полимеразной цепной реакцией (ПЦР) или количественной ПЦР в реальном времени. Анализ РНК может быть выполнен на общей клеточной РНК или поли(А)+мРНК. Способы выделения РНК хорошо известны в данной области. Анализ нозерн-блоттинга также является стандартным в данной области. Количественная ПЦР в реальном времени может быть легко осуществлена с использованием имеющейся в продаже системы обнаружения последовательностей ABI PRISM 7600, 7700 или 7900 производства PE-Applied Biosystems, Фостер-сити, штат Калифорния, которую используют в соответствии с инструкциями производителя.

Количественный анализ ПЦР в реальном времени уровней целевой РНК

Количественное определение уровней целевой РНК может быть осуществлено количественной ПЦР в реальном времени с использованием системы обнаружения последовательностей ABI PRISM 7600, 7700 или 7900 (PE-Applied Biosystems, Фостер-сити, штат Калифорния) по инструкциям производителя. Способы количественной ПЦР в реальном времени хорошо известны в данной области техники.

Перед ПЦР в реальном времени, выделенную РНК подвергают реакции с обратной транскриптазой (RT), в результате чего образуется комплементарная ДНК (кДНК), которую затем используют как субстрат для амплификации ПЦР в реальном времени. Реакции RT и ПЦР в реальном времени выполняют последовательно в одной и той же лунке с образцом. Реактивы для RT и ПЦР в реальном времени можно приобрести у компании Invitrogen (Карлсбад, штат Калифорния). Реакции RT и ПЦР в реальном времени выполняют по способам, хорошо известным специалистам в данной области.

Количества целевого гена (или РНК), полученные по ПЦР в реальном времени, нормализуют с использованием уровня экспрессии гена, экспрессия которого является постоянной, такого как циклофилин А, или количественным определением общей РНК, используя RIBOGREEN (Invitrogen Inc., Карлсбад, штат Калифорния). Экспрессию циклофилина А количественно определяют по ПЦР в реальном времени, которую осуществляют одновременно с мишенью, поочередно или отдельно. Общую РНК количественно определяют с использованием реагента для количественного определения РНК RIBOGREEN (Invetrogen Inc., Юджин, штат Орегон). Способы количественного определения РНК при помощи RIBOGREEN описаны в публикации Jones, L.J., et al., (Analytical Biochemistry, 1998, 265, 368-374). Для измерения флуоресценции RIBOGREEN используют прибор CYTOFLUOR 4000 (РЕ Applied Biosystems).

Образцы и праймеры предназначены для гибридизации с нуклеиновой кислотой HBV. Способы разработки образцов и праймеров для ПЦР в реальном времени хорошо известны в данной области, и могут включать применение программного обеспечения, такого как программа PRIMER EXPRESS (Applied Biosystems, Фостер-сити, штат Калифорния).

Количественный анализ ПЦР в реальном времени уровней целевой ДНК

Количественное определение уровней целевой ДНК может быть осуществлено количественной ПЦР в реальном времени с использованием системы обнаружения последовательностей ABI PRISM 7600, 7700 или 7900 (PE-Applied Biosystems, Фостер-сити, штат Калифорния) по инструкциям производителя. Способы количественной ПЦР в реальном времени хорошо известны в данной области техники.

Количества целевого гена (или ДНК), полученные по ПЦР в реальном времени, нормализуют с использованием уровня экспрессии гена, экспрессия которого является постоянной, такого как циклофилин А, или количественным определением общей ДНК, используя RIBOGREEN (Invitrogen Inc., Карлсбад, штат Калифорния). Экспрессию циклофилина А количественно определяют по ПЦР в реальном времени, которую осуществляют одновременно с мишенью, поочередно или отдельно. Общую ДНК количественно определяют с использованием реагента для количественного определения РНК RIBOGREEN (Invetrogen Inc., Юджин, штат Орегон). Способы количественного определения ДНК при помощи RIBOGREEN описаны в публикации Jones, L.J., et al., (Analytical Biochemistry, 1998, 265, 368-374). Для измерения флуоресценции RIBOGREEN используют прибор CYTOFLUOR 4000 (РЕ Applied Biosystems).

Образцы и праймеры предназначены для гибридизации с нуклеиновой кислотой HBV. Способы разработки образцов и праймеров для ПЦР в реальном времени хорошо известны в данной области, и могут включать применение программного обеспечения, такого как программа PRIMER EXPRESS (Applied Biosystems, Фостер-сити, штат Калифорния).

Анализ уровней белка

Антисмысловое ингибирование нуклеиновых кислот HBV может быть определено измерением уровней белка HBV. Уровни белка HBV могут быть оценены или количественно определены различными способами, хорошо известными в данной области, такими как иммунопреципитация, анализ вестерн-блоттинга (иммуноблоттинг), иммуноферментный твердофазный анализ (ELISA), количественные анализы белка, анализы активности белка (например, анализы активности каспазы), иммуногистохимия, иммуноцитохимия или сортировка флуоресцентно-активированных клеток (FACS). Антитела, направленные на мишень, могут быть идентифицированы и получены из различных источников, таких как каталог антител MSRS (Aerie Corporation, Бирмингем, штат Мичиган), или могут быть получены стандартными способами получения моноклональных или поликлональных антител, хорошо известными в данной области.

In vivo исследование антисмысловых соединений

Антисмысловые соединения, например, антисмысловые олигониклеотиды, испытывают на животных для оценки их способности ингибировать экспрессию HBV и вызывать фенотипические изменения. Испытание может быть выполнено на здоровых животных или в экспериментальных моделях заболеваний. Для введения животным, антисмысловые олигонуклеотиды составляют в композицию в фармацевтически приемлемом разбавителе, таком как фосфатно-солевой буферный раствор. Введение включает парентеральные пути введения, такие как внутрибрюшинное, внутривенное, подкожное, интратекальное и интрацеребровентрикулярное. Расчет дозы антисмыслового олигонуклеотида и частоты доз находится в рамках возможностей специалистов в данной области и зависит от таких факторов, как способ введения и вес тела животного. После периода обработки антисмысловыми олигонуклеотидами, РНК выделяют из печеночной ткани и измеряют изменения экспрессии нуклеиновой кислоты HBV. Измеряют также изменения уровней ДНК HBV. Измеряют также изменения уровней белка HBV. Измеряют также изменения уровней HBeAg HBV. Измеряют также изменения уровней HBsAg HBV.

Некоторые показания

В некоторых вариантах реализации, в настоящем документе представлены способы, соединения и композиции для лечения пациента, включающие введение одной или нескольких фармацевтических композиций, представленных в настоящем документе. В некоторых вариантах реализации, пациент страдает HBV-связанным состоянием. В некоторых вариантах реализации, хроническая инфекция HBV, воспаление, фиброз, цирроз, рак печени, серозный гепатит, желтуха, рак печени, воспаление печени, фиброз печени, цирроз печени, печеночная недостаточность, диффузное гепатоцеллюлярное воспалительное заболевание, гепофагоцитарный синдром, серозный гепатит и виремия HBV. В некоторых вариантах реализации, HBV-связанное состояние может включать любое или все из следующих: болезнь, похожую на грипп, слабость, боли, головную боль, жар, потерю аппетита, диарею, желтуху, тошноту и рвоту, боль в области печени, стул земляного или серого цвета, зуд по всему телу и мочу темного цвета, в сочетании с положительным тестом на присутствие вируса гепатита В, вирусного антигена гепатита В или положительным тестом на присутствие антитела, специфичного к вирусному антигену гепатита В. В некоторых вариантах реализации, пациент имеет риск HBV-связанного состояния. Сюда входят пациенты, имеющие один или несколько факторов риска для развития HBV-связанного состояния, включая половые отношения с пациентом, инфицированным вирусом гепатита В, проживание в одном доме с пациентом с хронической инфекцией вируса гепатита В, воздействие крови человека, инфицированного вирусом гепатита В, инъекция запрещенных лекарств, заболевание гемофилией и посещение мест распространения гепатита В. В некоторых вариантах реализации, пациента определяют как нуждающегося в лечении HBV-связанного состояния. В некоторых вариантах реализации, в настоящем документе представлены способы профилактического снижения экспрессии HBV у пациента. Некоторые варианты реализации включают лечение пациента, нуждающегося в этом, путем введения пациенту терапевтически эффективного количества антисмыслового соединения, направленного на нуклеиновую кислоту HBV.

За счет пересечения путей передачи, многие люди подвергаются воздействию вируса гепатита В (HBV) и вируса гепатита С (HCV), и меньшая часть является хронически инфицированной обоими вирусами, особенно в таких регионах, как Азия, где HBV является эндемичным. По оценкам, до 10% людей с HCV могут также страдать HBV, тогда как, вероятно, 20% людей с HBV инфицированы также HCV. Однако лечение гепатита В или гепатита В у пациентов, инфицированных одновременно HBV-HCV, не было хорошо изучено. Лечение усложняется тем фактом, что HCV и HBV ингибируют репликацию друг друга (хотя это взаимодействие наблюдалось не во всех исследованиях). Следовательно, лечение, которое полностью подавляет HBV, может потенциально снижать рецидив HCV или наоборот. Поэтому соединения и композиции, описанные в настоящем документе, могут быть преимущественно использованы для лечения пациентов, инфицированных одновременно HBV и HCV. Примеры возможностей лечения гепатита С (HCV) включают интерфероны, например, интерферон-альфа-2b, интерферон альфа-2а и интерферон альфакон-1. Более редкая частота дозирования интерферона может быть достигнута при использовании пегилированного интерферона (интерферона, присоединенного к полиэтиленгликольному фрагменту, что улучшает его фармакокинетический профиль). Было также показано, что комплексная терапия с интерфероном альфа-2b (пегилированным и не пегилированным) и рибавирином является преимущественной для некоторых групп пациентов. Другие средства, разработанные в настоящее время, включают ингибиторы репликации РНК HCV (например, серии VP50406 производства ViroPharma), антисмысловые агенты HCV, терапевтические вакцины HCV, ингибиторы протеазы HCV, ингибиторы геликазы HCV и терапию антителами HCV (моноклональными или поликлональными).

В некоторых вариантах реализации, лечение способами, соединениями и композициями, описанными в настоящем документе, применимо для предупреждения HBV-связанного состояния, обусловленного наличием вируса гепатита В. В некоторых вариантах реализации, лечение способами, соединениями и композициями, описанными в настоящем документе, применимо для предупреждения HBV-связанного состояния.

В одном варианте реализации, введение терапевтически эффективного количества антисмыслового соединения, направленного на нуклеиновую кислоту HBV, сопровождается контролированием уровней мРНК HBV в сыворотке пациента для определения реакции пациента на введение антисмыслового соединения. В некоторых вариантах реализации, введение терапевтически эффективного количества антисмыслового соединения, направленного на нуклеиновую кислоту HBV, сопровождается контролированием уровней ДНК HBV в сыворотке пациента для определения реакции пациента на введение антисмыслового соединения. В некоторых вариантах реализации, введение терапевтически эффективного количества антисмыслового соединения, направленного на нуклеиновую кислоту HBV, сопровождается контролированием уровней белка HBV в сыворотке пациента для определения реакции пациента на введение антисмыслового соединения. В некоторых вариантах реализации, введение терапевтически эффективного количества антисмыслового соединения, направленного на нуклеиновую кислоту HBV, сопровождается контролированием уровней антигена S HBV (HbsAg) в сыворотке пациента для определения реакции пациента на введение антисмыслового соединения. В некоторых вариантах реализации, введение терапевтически эффективного количества антисмыслового соединения, направленного на нуклеиновую кислоту HBV, сопровождается контролированием уровней антигена Е HBV (HBeAg) в сыворотке пациента для определения реакции пациента на введение антисмыслового соединения. Реакцию пациента на введение антисмыслового соединения врач использует для определения количества и продолжительности терапевтического вмешательства.

В некоторых вариантах реализации, введение антисмыслового соединения, направленного на нуклеиновую кислоту HBV, приводит к снижению экспрессии HBV по меньшей мере на 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 99%, или в диапазоне, определенном двумя из этих значений. В некоторых вариантах реализации, введение антисмыслового соединения, направленного на нуклеиновую кислоту HBV, приводит к уменьшению симптомов, связанных с HBV-связанным состоянием, и к снижению HBV-связанных маркеров в крови. В некоторых вариантах реализации, введение антисмыслового соединения HBV снижает уровни РНК HBV, уровни ДНК HBV, уровни белка HBV, уровни HBsAg или уровни HBeAg по меньшей мере на 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 99%, или в диапазоне, определенном двумя из этих значений.

В некоторых вариантах реализации, фармацевтические композиции, содержащие антисмысловое соединение, направленное на HBV, используют для получения лекарственных средств для лечения пациента, страдающего или восприимчивого к HBV-связанному состоянию.

Некоторые комплексные терапии

В некоторых вариантах реализации, одну или несколько фармацевтических композиций, представленных в настоящем документе, вводят совместно с одним или несколькими другими фармацевтическими средствами. В некоторых вариантах реализации, такое одно или несколько других фармацевтических средств предназначены для лечения того же заболевания, расстройства или состояния, что и одна или несколько фармацевтических композиций, представленных в настоящем документе. В некоторых вариантах реализации, такое одно или несколько других фармацевтических средств предназначены для лечения другого заболевания, расстройства или состояния, чем одна или несколько фармацевтических композиций, представленных в настоящем документе. В некоторых вариантах реализации, такое одно или несколько других фармацевтических средств предназначены для лечения нежелательного побочного действия одной или нескольких фармацевтических композиций, представленных в настоящем документе. В некоторых вариантах реализации, одну или несколько фармацевтических композиций, представленных в настоящем документе, вводят совместно с другим фармацевтическим средством для лечения нежелательного действия этого другого фармацевтического средства. В некоторых вариантах реализации, одну или несколько фармацевтических композиций, представленных в настоящем документе, вводят совместно с другим фармацевтическим средством для получения комбинационного эффекта. В некоторых вариантах реализации, одну или несколько фармацевтических композиций, представленных в настоящем документе, вводят совместно с другим фармацевтическим средством для получения синергетического эффекта.

В некоторых вариантах реализации, одну или несколько фармацевтических композиций, представленных в настоящем документе, и один или несколько других фармацевтических средств вводят одновременно. В некоторых вариантах реализации, одну или несколько фармацевтических композиций, представленных в настоящем документе, и один или несколько других фармацевтических средств вводят в разное время. В некоторых вариантах реализации, одну или несколько фармацевтических композиций, представленных в настоящем документе, и один или несколько других фармацевтических средств готовят вместе в одной композиции. В некоторых вариантах реализации, одну или несколько фармацевтических композиций, представленных в настоящем документе, и один или несколько других фармацевтических средств готовят по отдельности. В некоторых вариантах реализации, описанные антисмысловые олигонуклеотиды вводят в комбинации с HCV агентом. В следующих вариантах реализации, HCV соединение вводят одновременно с антисмысловым соединением; в других вариантах реализации, HCV соединение вводят отдельно; так, чтобы дозы HCV агента и антисмыслового соединения перекрывались, по времени, в организме пациента. В родственных вариантах реализации, агент HCV может быть выбран из интерферона альфа-2b, интерферона альфа-2а и интерферона альфакон-1 (пегилированного и не пегилированного); рибавирина; ингибитора репликации РНК HCV (например, серии VP50406 производства ViroPharma); антисмыслового агента HCV; терапевтической вакцины HCV; ингибитора протеазы HCV; ингибитора геликазы HCV; и терапии HCV антителами (моноклональными или поликлональными антителами).

В других вариантах реализации, антисмысловое соединение HBV настоящего изобретения может быть введено пациенту, инфицированному HBV, в комбинации с одним или несколькими HBV терапевтическими средствами, причем одно или несколько HBV терапевтических средств могут быть введены в той же лекарственной композиции, что и соединение антисмыслового олигонуклеотида HBV, или могут быть введены в отдельной композиции. Одно или несколько HBV терапевтических средств могут быть введены одновременно с соединением антисмыслового олигонуклеотида HBV, или могут быть введены отдельно, так, чтобы дозы соединения антисмыслового олигонуклеотида HBV и терапевтического агента HBV перекрывались, по времени, в организме пациента. В родственных вариантах реализации, одно или несколько HBV терапевтических средств могут быть выбраны из интерферона альфа-2b, интерферона альфа-2а и интерферона альфакон-1 (пегилированного и не пегилированного), рибавирина; ингибитора репликации РНК HBV; второго антисмыслового соединения HBV; терапевтической вакцины HBV; профилактической вакцины HBV; ламивудина (3ТС); энтекавира (ETV); тенофовира; телбивудина (LdT); адефовира; и терапии HBV антителами (моноклональными или поликлональными).


Исключение ограничения настоящего описания и включение путем ссылки

Хотя некоторые соединения, композиции и способы, описанные в настоящем документе, были описаны с особенностями в соответствии с некоторыми вариантами реализации, следующие примеры служат лишь для иллюстрации соединений, описанных в настоящем документе, и не предназначены для их ограничения. Каждая ссылка, цитируемая в настоящей заявке, включена в настоящий документ путем ссылки в полном объеме.

Пример 1: Антисмысловое ингибирование вирусной мРНК HBV в клетках HepG2.2.15 химерными олигонуклеотидами МОЕ

Антисмысловые олигонуклеотиды были разработаны для направленного действия на вирусную нуклеиновую кислоту HBV, и были испытаны на их действие на мРНК HBV in vitro. Культивированные клетки HepG2.2.15 при плотности 25000 клеток на лунку трансфицировали при помощи электропорации 15000 нМ антисмыслового олигонуклеотида. После примерно 24 часов обработки, РНК выделили из клеток и измерили уровни мРНК HBV количественной ПЦР в реальном времени. Набор вирусных затравочных зондов RTS3370 (прямая последовательность CTTGGTCATGGGCCATCAG, в настоящем документе обозначена как SEQ ID NO:2; обратная последовательность CGGCTAGGAGTTCCGCAGTA, в настоящем документе обозначена как SEQ ID NO:3; последовательность зонда TGCGTGGAACCTTTTCGGCTCC, в настоящем документе обозначена как SEQ ID NO:4) использовали для измерения уровней мРНК. Уровни мРНК HBV скорректировали в соответствии с общим содержанием РНК, по результатам измерения с RIBOGREEN®. Результаты представлены как процентное ингибирование HBV, по сравнению с не обработанными контрольными клетками.

Новые разработанные химерные антисмысловые олигонуклеотиды в Таблице 1 разработали как 5-10-5 МОЕ химерные олигонуклеотиды или 3-10-4 МОЕ химерные олигонуклеотиды. 5-10-5 МОЕ химерные олигонуклеотиды имеют 20 нуклеозидов в длину, причем центральный сегмент гэп содержит десять 2'-дезоксинуклеозидов, к которому с обоеих сторон (в направлениях 5' и 3') присоединены крылья, содержащие по пять нуклеозидов. 3-10-4 МОЕ химерные олигонуклеотиды имеют 17 нуклеозидов в длину, причем центральный сегмент гэп содержит десять 2'-дезоксинуклеозидов, к которому с обоеих сторон (в направлениях 5' и 3') присоединены крылья, содержащие три и 4 нуклеозида, соответственно. Каждый нуклеозид в 5' сегменте крыла, и каждый нуклеозид в 3' сегменте крыла имеет МОЕ модификацию сахара. Каждый нуклеозид в центральном сегменте гэп имеет дезокси-сахарную модификацию. Межнуклеозидные связи в каждом химерном олигонуклеотиде представляют собой фосфотиоатные (P=S) связи. Все цитозиновые остатки в каждом химерном олигонуклеотиде представляют собой 5-метилцитозины.

«Вирусный целевой сайт инициации» указывает 5'-основной нуклеотид, на который направлен химерный олигонуклеотид в последовательности вирусного гена. «Вирусный целевой терминирующий сайт» указывает 3'-основной нуклеотид, на который направлен химерный олигонуклеотид в последовательности вирусного гена. Колонка «мотив» указывает структуру гэп и крыльев каждого химерного олигонуклеотида. Каждый химерный олигонуклеотид, перечисленный в Таблице 1, направлен на вирусную геномную последовательность, обозначенную в настоящем документе как SEQ ID NO:1 (доступ GENBANK №U95551.1).

Таблица 1
Ингибирование уровней мРНК HBV действием МОЕ химерных олигонуклеотидов, направленных на SEQ ID NO:1
Вирусный сайт инициации Вирусный терминирующий сайт ISIS № Последовательность Мотив % ингибирование SEQ ID NO
245 261 510088 CCACGAGTCTAGACTCT 3-10-4 55 5
250 266 510089 GTCCACCACGAGTCTAG 3-10-4 59 6
251 267 510090 AGTCCACCACGAGTCTA 3-10-4 60 7
252 268 510091 AAGTCCACCACGAGTCT 3-10-4 47 8
253 269 510092 GAAGTCCACCACGAGTC 3-10-4 59 9
254 270 510093 AGAAGTCCACCACGAGT 3-10-4 32 10
255 271 510094 GAGAAGTCCACCACGAG 3-10-4 41 11
256 272 510095 AGAGAAGTCCACCACGA 3-10-4 44 12
257 273 510096 GAGAGAAGTCCACCACG 3-10-4 54 13
258 274 510097 TGAGAGAAGTCCACCAC 3-10-4 57 14
384 400 510098 TGATAAAACGCCGCAGA 3-10-4 55 15
385 401 510099 ATGATAAAACGCCGCAG 3-10-4 59 16
411 427 510100 GGCATAGCAGCAGGATG 3-10-4 85 17
412 428 510101 AGGCATAGCAGCAGGAT 3-10-4 51 18
413 429 510102 GAGGCATAGCAGCAGGA 3-10-4 69 19
414 433 505330 AGATGAGGCATAGCAGCAGG 5-10-5 74 20
414 430 510103 TGAGGCATAGCAGCAGG 3-10-4 12 21
415 434 509928 AAGATGAGGCATAGCAGCAG 5-10-5 71 22
415 431 510104 ATGAGGCATAGCAGCAG 3-10-4 69 23
416 435 509929 GAAGATGAGGCATAGCAGCA 5-10-5 78 24
416 432 510105 GATGAGGCATAGCAGCA 3-10-4 69 25
417 436 509930 AGAAGATGAGGCATAGCAGC 5-10-5 72 26
417 433 510106 AGATGAGGCATAGCAGC 3-10-4 77 27
418 437 146783 AAGAAGATGAGGCATAGCAG 5-10-5 15 28
418 434 510107 AAGATGAGGCATAGCAG 3-10-4 69 29
419 435 510108 GAAGATGAGGCATAGCA 3-10-4 59 30
420 436 510109 AGAAGATGAGGCATAGC 3-10-4 0 31
421 437 510110 AAGAAGATGAGGCATAG 3-10-4 38 32
457 473 510111 ACGGGCAACATACCTTG 3-10-4 62 33
639 658 146784 CTGAGGCCCACTCCCATAGG 5-10-5 5 34
639 655 510112 AGGCCCACTCCCATAGG 3-10-4 44 35
640 656 510113 GAGGCCCACTCCCATAG 3-10-4 27 36
641 657 510114 TGAGGCCCACTCCCATA 3-10-4 44 37
642 658 510115 CTGAGGCCCACTCCCAT 3-10-4 52 38
687 706 509931 CGAACCACTGAACAAATGGC 5-10-5 89 39
687 703 510116 ACCACTGAACAAATGGC 3-10-4 89 40
688 704 510117 AACCACTGAACAAATGG 3-10-4 69 41

689 705 510118 GAACCACTGAACAAATG 3-10-4 63 42
690 706 510119 CGAACCACTGAACAAAT 3-10-4 74 43
738 754 510120 АССАСАТСАТССАТАТА 3-10-4 71 44
1176 1192 510121 TCAGCAAACACTTGGCA 3-10-4 73 45
1778 1797 509932 AATTTATGCCTACAGCCTCC 5-10-5 76 46
1778 1794 510122 TTATGCCTACAGCCTCC 3-10-4 76 47
1779 1798 509933 CAATTTATGCCTACAGCCTC 5-10-5 72 48
1779 1795 510123 TTTATGCCTACAGCCTC 3-10-4 75 49
1780 1799 509934 CCAATTTATGCCTACAGCCT 5-10-5 75 50
1780 1796 510124 ATTTATGCCTACAGCCT 3-10-4 73 51
1781 1800 509935 ACCAATTTATGCCTACAGCC 5-10-5 72 52
1781 1797 510125 AATTTATGCCTACAGCC 3-10-4 69 53
1782 1798 510126 CAATTTATGCCTACAGC 3-10-4 59 54
1783 1799 510127 CCAATTTATGCCTACAG 3-10-4 58 55
1784 1800 510128 ACCAATTTATGCCTACA 3-10-4 60 56
1822 1838 510129 AGGCAGAGGTGAAAAAG 3-10-4 47 57
1823 1839 510130 TAGGCAGAGGTGAAAAA 3-10-4 30 58
1865 1884 509936 GCACAGCTTGGAGGCTTGAA 5-10-5 39 59
1865 1881 510131 CAGCTTGGAGGCTTGAA 3-10-4 4 60
1866 1885 509937 GGCACAGCTTGGAGGCTTGA 5-10-5 35 61
1866 1882 510132 ACAGCTTGGAGGCTTGA 3-10-4 0 62
1867 1886 505370 AGGCACAGCTTGGAGGCTTG 5-10-5 36 63
1867 1883 510133 CACAGCTTGGAGGCTTG 3-10-4 12 64
1868 1887 509938 AAGGCACAGCTTGGAGGCTT 5-10-5 7 65
1868 1884 510134 GCACAGCTTGGAGGCTT 3-10-4 20 66
1869 1888 509939 CAAGGCACAGCTTGGAGGCT 5-10-5 36 67
1869 1885 510135 GGCACAGCTTGGAGGCT 3-10-4 22 68
1870 1889 505371 CCAAGGCACAGCTTGGAGGC 5-10-5 35 69
1870 1886 510136 AGGCACAGCTTGGAGGC 3-10-4 14 70
1871 1887 510137 AAGGCACAGCTTGGAGG 3-10-4 0 71
1872 1888 510138 CAAGGCACAGCTTGGAG 3-10-4 6 72
1873 1889 510139 CCAAGGCACAGCTTGGA 3-10-4 17 73
1918 1934 510140 GCTCCAAATTCTTTATA 3-10-4 59 74
2378 2397 509940 TCTGCGAGGCGAGGGAGTTC 3-10-4 10 75
2378 2394 510141 GCGAGGCGAGGGAGTTC 3-10-4 5 76
2379 2395 510142 TGCGAGGCGAGGGAGTT 3-10-4 0 77
2380 2396 510143 CTGCGAGGCGAGGGAGT 3-10-4 8 78
2381 2397 510144 TCTGCGAGGCGAGGGAG 3-10-4 17 79
2820 2836 510145 TTCCCAAGAATATGGTG 3-10-4 22 80
2821 2837 510146 GTTCCCAAGAATATGGT 3-10-4 11 81
2822 2838 510147 TGTTCCCAAGAATATGG 3-10-4 21 82

Пример 2: Антисмысловое ингибирование вирусной мРНК ИВУ в клетках HepG2.2.15 химерными олигонуклеотидами МОЕ

Дополнительные антисмысловые олигонуклеотиды были разработаны для направленного действия на вирусную нуклеиновую кислоту HBV, и были испытаны на их действие на мРНК HBV in vitro. Культивированные клетки HepG2.2.15 при плотности 25000 клеток на лунку трансфицировали при помощи электропорации 15000 нМ антисмыслового олигонуклеотида. После примерно 24 часов обработки, РНК выделили из клеток и измерили уровни мРНК HBV количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор вирусных затравочных зондов RTS3370. RTS3370 обнаружил первичную мРНК и вторичные части транскриптов мРНК pre-S1, pre-S2 и pre-C. Химерные олигонуклеотиды испытали также с дополнительными наборами затравочных зондов. Набор вирусных затравочных зондов RTS3371 (прямая последовательность CCAAACCTTCGGACGGAAA, в настоящем документе обозначена как SEQ ID NO:311; обратная последовательность TGAGGCCCACTCCCATAGG, в настоящем документе обозначена как SEQ ID NO: 312; последовательность зонда CCCATCATCCTGGGCTTTCGGAAAAT, в настоящем документе обозначена как SEQ ID NO:313) также использовали для измерения уровней мРНК. RTS3371 обнаружил первичную мРНК и вторичные части транскриптов мРНК pre-S1, pre-S2 и pre-C, аналогичные RTS3370, но в других областях. Набор вирусных затравочных зондов RTS3372 (прямая последовательность ATCCTATCAACACTTCCGGAAACT, в настоящем документе обозначена как SEQ ID NO:314; обратная последовательность CGACGCGGCGATTGAG, в настоящем документе обозначена как SEQ ID NO:315; последовательность зонда AAGAACTCCCTCGCCTCGCAGACG, в настоящем документе обозначена как SEQ ID NO:316) использовали для измерения уровней мРНК. RTS3372 обнарружил первичную геномную последовательность. Набор вирусных затравочных зондов RTS3373MGB (прямая последовательность CCGACCTTGAGGCATACTTCA, в настоящем документе обозначена как SEQ ID NO:317; обратная последовательность AATTTATGCCTACAGCCTCCTAGTACA, в настоящем документе обозначена как SEQ ID NO:318; последовательность зонда TTAAAGACTGGGAGGAGTTG, в настоящем документе обозначена как SEQ ID NO:319) использовали для измерения уровней мРНК. RTS3373MGB обнаружил первичную мРНК и вторичные части транскриптов мРНК pre-S 1, pre-S2, pre-C и pre-Х.

Уровни мРНК HBV скорректировали в соответствии с общим содержанием РНК, по результатам измерения с RIBOGREEN®. Результаты представлены как процентное ингибирование HBV, по сравнению с не обработанными контрольными клетками.

Новые разработанные химерные антисмысловые олигонуклеотиды в Таблице 2 разработали как 5-10-5 МОЕ химерные олигонуклеотиды или 3-10-3 МОЕ химерные олигонуклеотиды, или 2-10-2 МОЕ химерные олигонуклеотиды. 5-10-5 МОЕ химерные олигонуклеотиды имеют 20 нуклеозидов в длину, причем центральный сегмент гэп содержит десять 2'-дезоксинуклеозидов, к которому с обоеих сторон (в направлениях 5' и 3') присоединены крылья, содержащие по пять нуклеозидов. 3-10-3 МОЕ химерные олигонуклеотиды имеют 16 нуклеозидов в длину, причем центральный сегмент гэп содержит десять 2'-дезоксинуклеозидов, к которому с обоеих сторон (в направлениях 5' и 3') присоединены крылья, содержащие по три нуклеозида. 2-10-2 МОЕ химерные олигонуклеотиды имеют 14 нуклеозидов в длину, причем центральный сегмент гэп содержит десять 2'-дезоксинуклеозидов, к которому с обоеих сторон (в направлениях 5' и 3') присоединены крылья, содержащие по два нуклеозида. Каждый нуклеозид в 5' сегменте крыла, и каждый нуклеозид в 3' сегменте крыла имеет МОЕ модификацию сахара. Каждый нуклеозид в центральном сегменте гэп имеет дезокси-сахарную модификацию. Межнуклеозидные связи в каждом химерном олигонуклеотиде представляют собой фосфотиоатные (P=S) связи. Все цитозиновые остатки в каждом химерном олигонуклеотиде представляют собой 5-метилцитозины.

«Сайт инициации» указывает 5'-основной нуклеотид, на который направлен химерный олигонуклеотид в последовательности вирусного гена. «Терминирующий сайт» указывает 3'-основной нуклеотид, на который направлен химерный олигонуклеотид в последовательности вирусного гена. Колонка «мотив» указывает структуру гэп и крыльев каждого химерного олигонуклеотида. Каждый химерный олигонуклеотид, перечисленный в Таблице 2, направлен на вирусную геномную последовательность, обозначенную в настоящем документе как SEQ ID NO:1 (доступ GENBANK №U95551.1).

Таблица 2
Ингибирование уровней мРНК HBV действием МОЕ химерных олигонуклеотидов, направленных на SEQ ID NO:1 (обнаружено по RTS3370, RTS3371, RTS3372 и RTS3373MGB)
Сайт инициации Терминирующий сайт № ISIS Последовательность RTS3370% ингибирование RTS3371% ингибирование RTS3372% ингибирование RTS3373 MGB % ингибирование Мотив SEQ ID NO
58 77 146779 GAACTGGACCACCAGCAGG 76 80 82 81 5-10-5 83
58 71 510019 GAGCCACCAGCAGG 38 32 45 31 2-10-2 84
61 80 505314 CCTGAACTGGAGCCACCAGC 68 71 67 66 5-10-5 85
62 77 509941 GAACTGGAGCCACCAG 36 32 71 53 3-10-3 86
196 215 505315 AAAAACCCCGCCTGTAACAC 69 74 80 88 5-10-5 87

199 218 505316 AAGAAAAACCCCGCCTGTAA 60 60 64 64 5-10-5 88
205 224 505317 GTCAACAAGAAAAACCCCGC 85 83 79 85 5-10-5 89
228 241 510020 GTATTGTGAGGATT 28 18 0 16 2-10-2 90
229 242 510021 GGTATTGTGAGGAT 40 37 19 34 2-10-2 91
244 263 146821 CACCACGAGTCTAGACTCTG 74 73 62 75 5-10-5 92
245 260 509942 CACGAGTCTAGACTCT 18 15 45 46 3-10-3 93
245 258 510022 CGAGTCTAGACTCT 32 26 23 19 2-10-2 94
246 261 509943 CCACGAGTCTAGACTC 34 35 63 60 3-10-3 95
247 266 505318 GTCCACCACGAGTCTAGACT 75 77 64 75 5-10-5 96
250 269 509921 GAAGTCCACCACGAGTCTAG 46 46 39 40 5-10-5 97
250 265 509944 TCCACCACGAGTCTAG 38 39 65 59 3-10-3 98
251 270 509922 AGAAGTCCACCACGAGTCTA 55 56 17 38 5-10-5 99
251 266 509945 GTCCACCACGAGTCTA 34 35 64 51 3-10-3 100
252 271 509923 GAGAAGTCCACCACGAGTCT 39 38 39 33 5-10-5 101
252 267 509946 AGTCCACCACGAGTCT 47 51 50 45 3-10-3 102
253 272 505319 AGAGAAGTCCACCACGAGTC 88 83 80 78 5-10-5 103
253 268 509947 AAGTCCACCACGAGTC 46 50 56 46 3-10-3 104
254 273 509924 GAGAGAAGTCCACCACGAGT 43 40 49 44 5-10-5 105
254 269 509948 GAAGTCCACCACGAGT 41 46 51 44 3-10-3 106
254 267 510023 AGTCCACCACGAGT 41 32 47 48 2-10-2 107
255 274 509925 TGAGAGAAGTCCACCACGAG 50 57 55 55 5-10-5 108

255 270 509949 AGAAGTCCACCACGAG 40 41 52 34 3-10-3 109
255 268 510024 AAGTCCACCACGAG 26 29 19 23 2-10-2 110
256 275 505320 TTGAGAGAAGTCCACCACGA 51 57 55 66 5-10-5 111
256 271 509950 GAGAAGTCCACCACGA 30 31 43 33 3-10-3 112
256 269 510025 GAAGTCCACCACGA 44 38 53 54 2-10-2 113
257 270 510026 AGAAGTCCACCACG 39 42 32 25 2-10-2 114
258 273 509952 GAGAGAAGTCCACCAC 54 52 60 48 3-10-3 115
258 271 510027 GAGAAGTCCACCAC 29 30 25 19 2-10-2 116
259 274 509953 TGAGAGAAGTCCACCA 39 44 47 38 3-10-3 117
259 272 510028 AGAGAAGTCCACCA 31 29 3 15 2-10-2 118
260 273 510029 GAGAGAAGTCCACC 21 19 23 18 2-10-2 119
261 274 510030 TGAGAGAAGTCCAC 16 22 21 20 2-10-2 120
262 281 505321 AGAAAATTGAGAGAAGTCCA 53 58 52 56 5-10-5 121
265 284 505322 CCTAGAAAATTGAGAGAAGT 62 65 69 67 5-10-5 122
293 312 505323 ATTTTGGCCAAGACACACGG 86 84 81 85 5-10-5 123
296 315 505324 CGAATTTTGGCCAAGACACA 67 67 69 64 5-10-5 124
302 321 505325 GGACTGCGAATTTTGGCCAA 77 75 73 76 5-10-5 125
360 379 505326 TCCAGCGATAACCAGGACAA 89 90 77 91 5-10-5 126
366 385 505327 GACACATCCAGCGATAACCA 83 85 75 86 5-10-5 127
369 388 505328 GCAGACACATCCAGCGATAA 65 68 49 57 5-10-5 128
384 399 509954 GATAAAACGCCGCAGA 37 46 53 35 3-10-3 129

384 397 510031 TAAAACGCCGCAGA 36 36 33 33 2-10-2 130
385 398 510032 ATAAAACGCCGCAG 12 7 19 15 2-10-2 131
386 401 509955 ATGATAAAACGCCGCA 49 55 57 53 3-10-3 132
386 399 510033 GATAAAACGCCGCA 39 39 45 37 2-10-2 133
387 400 510034 TGATAAAACGCCGC 40 37 29 39 2-10-2 134
388 401 510035 ATGATAAAACGCCG 22 24 9 22 2-10-2 135
411 430 505329 TGAGGCATAGCAGCAGGATG 60 64 47 55 5-10-5 136
411 426 509956 GCATAGCAGCAGGATG 62 64 71 60 3-10-3 137
411 424 510036 ATAGCAGCAGGATG 44 34 30 48 2-10-2 138
412 431 509926 ATGAGGCATAGCAGCAGGAT 45 54 71 62 5-10-5 139
412 427 509957 GGCATAGCAGCAGGAT 72 75 80 71 3-10-3 140
412 425 510037 CATAGCAGCAGGAT 29 24 24 20 2-10-2 141
413 432 509927 GATGAGGCATAGCAGCAGGA 54 58 54 49 5-10-5 142
413 428 509958 AGGCATAGCAGCAGGA 63 66 68 64 3-10-3 143
413 426 510038 GCATAGCAGCAGGA 55 54 37 46 2-10-2 144
414 433 505330 AGATGAGGCATAGCAGCAGG 85 87 74 82 5-10-5 20
414 429 509959 GAGGCATAGCAGCAGG 64 64 80 68 3-10-3 145
414 427 510039 GGCATAGCAGCAGG 58 54 41 45 2-10-2 146
415 430 509960 TGAGGCATAGCAGCAG 59 59 66 64 3-10-3 147
415 428 510040 AGGCATAGCAGCAG 58 55 38 41 2-10-2 148
416 431 509961 ATGAGGCATAGCAGCA 56 54 65 56 3-10-3 149
416 429 510041 GAGGCATAGCAGCA 64 62 64 57 2-10-2 150
417 432 509962 GATGAGGCATAGCAGC 57 52 58 49 3-10-3 151

417 430 510042 TGAGGCATAGCAGC 48 50 55 48 2-10-2 152
418 433 509963 AGATGAGGCATAGCAG 50 52 64 51 3-10-3 153
418 431 510043 ATGAGGCATAGCAG 36 31 36 26 2-10-2 154
419 434 509964 AAGATGAGGCATAGCA 48 47 72 65 3-10-3 155
419 432 510044 GATGAGGCATAGCA 44 28 0 14 2-10-2 156
420 435 509965 GAAGATGAGGCATAGC 45 41 65 62 3-10-3 157
420 433 510045 AGATGAGGCATAGC 41 43 37 29 2-10-2 158
421 436 509966 AGAAGATGAGGCATAG 32 29 64 51 3-10-3 159
421 434 510046 AAGATGAGGCATAG 21 18 26 27 2-10-2 160
422 437 509967 AAGAAGATGAGGCATA 21 17 55 46 3-10-3 161
422 435 510047 GAAGATGAGGCATA 25 24 23 25 2-10-2 162
423 436 510048 AGAAGATGAGGCAT 21 17 25 19 2-10-2 163
424 437 510049 AAGAAGATGAGGCA 17 11 38 27 2-10-2 164
454 473 505331 ACGGGCAACATACCTTGATA 55 57 65 60 5-10-5 165
457 476 505332 CAAACGGGCAACATACCTTG 73 77 77 74 5-10-5 166
457 472 509968 CGGGCAACATACCTTG 60 61 73 70 3-10-3 167
458 473 509969 ACGGGCAACATACCTT 58 63 64 58 3-10-3 168
458 471 510050 GGGCAACATACCTT 58 56 57 46 2-10-2 169
459 472 510051 CGGGCAACATACCT 49 43 47 37 2-10-2 170
460 473 510052 ACGGGCAACATACC 50 50 54 51 2-10-2 171
463 482 505333 AGAGGACAAACGGGCAACAT 64 68 64 71 5-10-5 172
466 485 505334 ATTAGAGGACAAACGGGCAA 59 62 42 69 5-10-5 173
472 491 505335 CCTGGAATTAGAGGACAAAC 78 81 73 86 5-10-5 174

475 494 505336 GATCCTGGAATTAGAGGACA 56 65 61 72 5-10-5 175
639 654 509970 GGCCCACTCCCATAGG 38 55 74 48 3-10-3 176
641 656 509971 GAGGCCCACTCCCATA 30 46 77 54 3-10-3 177
642 657 509972 TGAGGCCCACTCCCAT 58 57 84 66 3-10-3 178
643 658 509973 CTGAGGCCCACTCCCA 38 53 70 66 3-10-3 179
670 689 146823 GGCACTAGTAAACTGAGCCA 61 64 63 63 5-10-5 180
670 685 509974 CTAGTAAACTGAGCCA 71 71 78 80 3-10-3 181
670 683 510053 AGTAAACTGAGCCA 49 48 52 53 2-10-2 182
671 684 510054 TAGTAAACTGAGCC 41 38 19 30 2-10-2 183
672 685 510055 CTAGTAAACTGAGC 25 27 42 47 2-10-2 184
673 692 505337 AATGGCACTAGTAAACTGAG 34 46 49 52 5-10-5 185
679 698 505338 TGAACAAATGGCACTAGTAA 74 77 71 80 5-10-5 186
682 701 505339 CACTGAACAAATGGCACTAG 82 83 71 82 5-10-5 187
687 702 509975 CCACTGAACAAATGGC 72 73 76 80 3-10-3 188
688 707 505340 ACGAACCACTGAACAAATGG 69 69 78 76 5-10-5 189
688 703 509976 ACCACTGAACAAATGG 47 48 67 65 3-10-3 190
689 704 509977 AACCACTGAACAAATG 33 33 39 41 3-10-3 191
690 705 509978 GAACCACTGAACAAAT 50 49 63 48 3-10-3 192
691 710 505341 CCTACGAACCACTGAACAAA 64 70 70 72 5-10-5 193
691 706 509979 CGAACCACTGAACAAA 67 66 78 77 3-10-3 194
691 704 510056 AACCACTGAACAAA 36 36 23 32 2-10-2 195
692 705 510057 GAACCACTGAACAA 45 44 51 43 2-10-2 196

693 706 510058 CGAACCACTGAACA 59 52 48 49 2-10-2 197
697 716 505342 GAAAGCCCTACGAACCACTG 76 80 73 83 5-10-5 198
738 753 509980 ССАСАТСАТССАТАТА 40 33 62 54 3-10-3 199
738 751 510059 АСАТСАТССАТАТА 19 9 30 27 2-10-2 200
739 754 509981 АССАСАТСАТССАТАТ 76 78 93 85 3-10-3 201
739 752 510060 САСАТСАТССАТАТ 45 35 24 17 2-10-2 202
740 753 510061 ССАСАТСАТССАТА 52 49 43 40 2-10-2 203
741 754 510062 АССАСАТСАТССАТ 44 45 48 47 2-10-2 204
756 775 505343 TGTACAGACTTGGCCCCCAA 47 56 55 68 5-10-5 205
823 842 505344 AGGGTTTAAATGTATACCCA 66 71 64 72 5-10-5 206
1170 1189 505345 GCAAACACTTGGCACAGACC 76 80 35 70 5-10-5 207
1176 1191 509982 CAGCAAACACTTGGCA 42 44 56 54 3-10-3 208
1177 1192 509983 TCAGCAAACACTTGGC 60 54 74 70 3-10-3 209
1259 1278 505346 CCGCAGTATGGATCGGCAGA 88 82 57 80 5-10-5 210
1261 1276 509984 GCAGTATGGATCGGCA 61 58 65 72 3-10-3 211
1262 1281 505347 GTTCCGCAGTATGGATCGGC 84 81 71 83 5-10-5 212
1268 1287 505348 CTAGGAGTTCCGCAGTATGG 78 68 70 79 5-10-5 213
1271 1290 505349 CGGCTAGGAGTTCCGCAGTA 47 54 59 61 5-10-5 214
1277 1296 505350 AACAAGCGGCTAGGAGTTCC 55 62 69 69 5-10-5 215
1280 1299 505351 CAAAACAAGCGGCTAGGAGT 20 49 49 54 5-10-5 216

1283 1302 505352 GAGCAAAACAAGCGGCTAGG 53 83 73 87 5-10-5 217
1286 1305 505353 TGCGAGCAAAACAAGCGGCT 64 73 68 78 5-10-5 218
1413 1426 510063 ACAAAGGACGTCCC 14 8 0 0 2-10-2 219
1515 1534 505354 GAGGTGCGCCCCGTGGTCGG 68 81 61 80 5-10-5 220
1518 1537 505355 AGAGAGGTGCGCCCCGTGGT 59 75 75 84 5-10-5 221
1521 1540 505356 TAAAGAGAGGTGCGCCCCGT 63 76 83 78 5-10-5 222
1550 1563 510064 AAGGCACAGACGGG 35 38 25 32 2-10-2 223
1577 1596 146786 GTGAAGCGAAGTGCACACGG 88 91 84 93 5-10-5 224
1580 1599 505357 GAGGTGAAGCGAAGTGCACA 70 75 71 82 5-10-5 225
1583 1602 505358 GCAGAGGTGAAGCGAAGTGC 77 82 72 84 5-10-5 226
1586 1605 505359 CGTGCAGAGGTGAAGCGAAG 72 73 67 80 5-10-5 227
1655 1674 505360 AGTCCAAGAGTCCTCTTATG 66 68 54 68 5-10-5 228
1706 1719 510065 CAGTCTTTGAAGTA 19 19 26 17 2-10-2 229
1778 1793 509985 TATGCCTACAGCCTCC 64 60 64 63 3-10-3 230
1779 1794 509986 TTATGCCTACAGCCTC 66 66 77 73 3-10-3 231
1780 1795 509987 TTTATGCCTACAGCCT 56 55 68 67 3-10-3 232
1781 1796 509988 ATTTATGCCTACAGCC 52 52 68 63 3-10-3 233
1782 1797 509989 AATTTATGCCTACAGC 48 44 70 59 3-10-3 234
1783 1798 509990 CAATTTATGCCTACAG 24 18 39 40 3-10-3 235
1784 1799 509991 CCAATTTATGCCTACA 37 37 55 55 3-10-3 236
1785 1800 509992 ACCAATTTATGCCTAC 35 36 60 55 3-10-3 237

1806 1825 505361 AAAGTTGCATGGTGCTGGTG 42 55 75 61 5-10-5 238
1809 1828 505362 GAAAAAGTTGCATGGTGCTG 45 56 64 53 5-10-5 239
1812 1831 505363 GGTGAAAAAGTTGCATGGTG 71 70 80 72 5-10-5 240
1815 1834 505364 AGAGGTGAAAAAGTTGCATG 51 57 77 82 5-10-5 241
1818 1837 505365 GGCAGAGGTGAAAAAGTTGC 54 63 76 78 5-10-5 242
1821 1840 505366 TTAGGCAGAGGTGAAAAAGT 61 65 80 66 5-10-5 243
1822 1837 509993 GGCAGAGGTGAAAAAG 47 51 74 54 3-10-3 244
1823 1838 509994 AGGCAGAGGTGAAAAA 47 40 76 54 3-10-3 245
1824 1843 505367 TGATTAGGCAGAGGTGAAAA 41 39 62 29 5-10-5 246
1824 1839 509995 TAGGCAGAGGTGAAAA 46 42 79 59 3-10-3 247
1826 1839 510066 TAGGCAGAGGTGAA 40 33 44 31 2-10-2 248
1827 1846 505368 AGATGATTAGGCAGAGGTGA 27 46 62 51 5-10-5 249
1861 1880 146787 AGCTTGGAGGCTTGAACAGT 59 61 65 72 5-10-5 250
1864 1883 505369 CACAGCTTGGAGGCTTGAAC 11 21 48 31 5-10-5 251
1865 1880 509996 AGCTTGGAGGCTTGAA 13 1 45 40 3-10-3 252
1865 1878 510067 CTTGGAGGCTTGAA 22 17 20 14 2-10-2 253
1866 1881 509997 CAGCTTGGAGGCTTGA 29 19 51 45 3-10-3 254
1866 1879 510068 GCTTGGAGGCTTGA 24 25 37 32 2-10-2 255
1867 1886 505370 AGGCACAGCTTGGAGGCTTG 32 36 58 33 5-10-5 63
1867 1882 509998 ACAGCTTGGAGGCTTG 1 4 23 12 3-10-3 256

1867 1880 510069 AGCTTGGAGGCTTG 23 24 17 23 2-10-2 257
1868 1883 509999 CACAGCTTGGAGGCTT 5 1 48 41 3-10-3 258
1868 1881 510070 CAGCTTGGAGGCTT 21 20 0 18 2-10-2 259
1869 1884 510000 GCACAGCTTGGAGGCT 14 10 50 37 3-10-3 260
1869 1882 510071 ACAGCTTGGAGGCT 19 22 24 27 2-10-2 261
1870 1889 505371 CCAAGGCACAGCTTGGAGGC 27 40 68 38 5-10-5 69
1870 1885 510001 GGCACAGCTTGGAGGC 10 12 43 16 3-10-3 262
1870 1883 510072 CACAGCTTGGAGGC 28 31 33 30 2-10-2 263
1871 1886 510002 AGGCACAGCTTGGAGG 24 20 46 25 3-10-3 264
1871 1884 510073 GCACAGCTTGGAGG 20 18 22 15 2-10-2 265
1872 1887 510003 AAGGCACAGCTTGGAG 6 0 45 24 3-10-3 266
1872 1885 510074 GGCACAGCTTGGAG 18 18 32 23 2-10-2 267
1873 1892 505372 CACCCAAGGCACAGCTTGGA 18 8 55 16 5-10-5 268
1873 1888 510004 CAAGGCACAGCTTGGA 9 0 31 15 3-10-3 269
1873 1886 510075 AGGCACAGCTTGGA 23 9 27 10 2-10-2 270
1874 1889 510005 CCAAGGCACAGCTTGG 0 0 39 25 3-10-3 271
1876 1895 505373 AGCCACCCAAGGCACAGCTT 47 50 69 56 5-10-5 272
1879 1898 505374 CAAAGCCACCCAAGGCACAG 27 27 55 30 5-10-5 273
1882 1901 505375 CCCCAAAGCCACCCAAGGCA 34 40 54 39 5-10-5 274
1885 1904 505376 ATGCCCCAAAGCCACCCAAG 41 43 54 52 5-10-5 275
1888 1907 505377 TCCATGCCCCAAAGCCACCC 40 42 72 40 5-10-5 276
1891 1910 505378 ATGTCCATGCCCCAAAGCCA 35 33 70 40 5-10-5 277

1918 1933 510006 СТССАААТТСТТТАТА 9 2 53 41 3-10-3 278
1918 1931 510076 ССАААТТСТТТАТА 28 22 7 22 2-10-2 279
1919 1934 510007 GCTCCAAATTCTTTAT 43 39 72 57 3-10-3 280
1919 1932 510077 ТССАААТТСТТТАТ 19 11 0 2 2-10-2 281
1920 1933 510078 СТССАААТТСТТТА 19 11 0 0 2-10-2 282
1921 1934 510079 GCTCCAAATTCTTT 50 48 61 55 2-10-2 283
1957 1976 505379 GGAAAGAAGTCAGAAGGCAA 17 14 81 39 5-10-5 284
2270 2285 510008 GTGCGAATCCACACTC 21 4 36 11 3-10-3 285
2270 2283 510080 GCGAATCCACACTC 32 29 41 33 2-10-2 286
2271 2284 510081 TGCGAATCCACACT 28 20 25 11 2-10-2 287
2272 2285 510082 GTGCGAATCCACAC 28 20 32 22 2-10-2 288
2368 2387 505380 GAGGGAGTTCTTCTTCTAGG 24 22 90 48 5-10-5 289
2378 2393 510009 CGAGGCGAGGGAGTTC 12 1 65 10 3-10-3 290
2378 2391 510083 AGGCGAGGGAGTTC 17 18 29 25 2-10-2 291
2379 2394 510010 GCGAGGCGAGGGAGTT 18 13 82 37 3-10-3 292
2379 2392 510084 GAGGCGAGGGAGTT 29 22 54 30 2-10-2 293
2380 2395 510011 TGCGAGGCGAGGGAGT 13 11 69 44 3-10-3 294
2380 2393 510085 CGAGGCGAGGGAGT 25 20 53 42 2-10-2 295
2381 2396 510012 CTGCGAGGCGAGGGAG 17 14 79 53 3-10-3 296
2381 2394 510086 GCGAGGCGAGGGAG 33 29 66 48 2-10-2 297
2382 2397 510013 TCTGCGAGGCGAGGGA 18 4 77 47 3-10-3 298
2420 2439 505381 CCGAGATTGAGATCTTCTGC 12 18 83 28 5-10-5 299
2459 2478 505382 CCCACCTTATGAGTCCAAGG 14 19 80 36 5-10-5 300

2819 2838 505383 TGTTCCCAAGAATATGGTGA 29 32 78 44 5-10-5 301
2820 2835 510014 TCCCAAGAATATGGTG 10 10 68 40 3-10-3 302
2821 2836 510015 TTCCCAAGAATATGGT 5 0 62 24 3-10-3 303
2822 2837 510016 GTTCCCAAGAATATGG 6 2 42 16 3-10-3 304
2823 2838 510017 TGTTCCCAAGAATATG 18 18 47 18 3-10-3 305
2824 2839 510018 TTGTTCCCAAGAATAT 7 5 57 19 3-10-3 306
2825 2838 510087 TGTTCCCAAGAATA 25 20 44 25 2-10-2 307
2873 2892 505384 GAAAGAATCCCAGAGGATTG 8 4 61 22 5-10-5 308
3161 3180 146833 ACTGCATGGCCTGAGGATGA 47 46 82 54 5-10-5 309
3163 3182 505385 CCACTGCATGGCCTGAGGAT 25 34 69 19 5-10-5 310

Пример 3: Антисмысловое ингибирование вирусной мРНК HBV в клетках HepAD38 (Tet-HBV) химерными олигонуклеотидами МОЕ

Некоторые антисмысловые олигонуклеотиды, выбранные из исследования, описанного в Примере 2, испытали на их влияние на мРНК HBV в другой клеточной линии, клетках гепатомы человека HepAD38, в которых выработка HBV контролируется тетрациклин-регулируемым промотором. Культивированные клетки HepAD38 (Tet-HBV) при плотности 45000 клеток на лунку трансфицировали при помощи электропорации 15000 нМ антисмыслового олигонуклеотида. После примерно 24 часов обработки, РНК выделили из клеток и измерили уровни мРНК HBV количественной ПНР в реальном времени. Наборы вирусных затравочных зондов RTS3372 и RTS3373MGB использовали по отдельности для измерения уровней мРНК. Уровни мРНК HBV скорректировали в соответствии с общим содержанием РНК, по результатам измерения с RIBOGREEN®. Результаты представлены в Таблице 3 как процентное ингибирование HBV, по сравнению с не обработанными контрольными клетками.

Таблица 3
Ингибирование уровней вирусной мРНК HBV МОЕ химерными олигонуклеотидами в клетках HepAD38 (Tet-HBV) (обнаружено по RTS3372 и RTS3373MGB)
Сайт инициации Терминирующий сайт № ISIS Мотив RTS3373MGB % ингибирование RTS3372% ингибирование SEQ ID NO

58 77 146779 5-10-5 76 82 83
58 71 510019 5-10-5 0 9 84
61 80 505314 5-10-5 65 75 85
196 215 505315 5-10-5 46 65 87
199 218 505316 5-10-5 57 71 88
205 224 505317 5-10-5 83 87 89
228 241 510020 2-10-2 6 0 90
229 242 510021 2-10-2 19 24 91
244 263 146821 5-10-5 72 71 92
245 258 510022 2-10-2 6 24 94
247 266 505318 5-10-5 68 77 96
250 269 509921 5-10-5 25 47 97
251 270 509922 5-10-5 28 46 99
252 271 509923 5-10-5 19 40 101
253 272 505319 5-10-5 69 66 103
254 273 509924 5-10-5 9 39 105
254 267 510023 2-10-2 19 15 107
255 274 509925 5-10-5 26 55 108
255 268 510024 2-10-2 0 5 110
256 275 505320 5-10-5 62 68 111
256 269 510025 2-10-2 0 8 113
257 270 510026 2-10-2 7 21 114
258 271 510027 2-10-2 0 0 116
259 272 510028 2-10-2 0 0 118
260 273 510029 2-10-2 0 9 119
261 274 510030 2-10-2 0 0 120
262 281 505321 5-10-5 53 54 121
265 284 505322 5-10-5 59 60 122
293 312 505323 5-10-5 65 77 123
296 315 505324 5-10-5 78 83 124
302 321 505325 5-10-5 71 80 125
360 379 505326 5-10-5 76 84 126
366 385 505327 5-10-5 77 83 127
369 388 505328 5-10-5 65 78 128
384 397 510031 2-10-2 0 16 130
385 398 510032 2-10-2 0 0 131
386 399 510033 2-10-2 1 21 133
387 400 510034 2-10-2 8 28 134
388 401 510035 2-10-2 0 0 135
411 430 505329 5-10-5 58 72 136
411 424 510036 2-10-2 6 11 138
412 431 509926 5-10-5 20 54 139
412 425 510037 2-10-2 0 10 141

413 432 509927 5-10-5 56 76 142
413 426 510038 2-10-2 54 68 144
414 433 505330 5-10-5 66 81 20
414 427 510039 2-10-2 60 74 146
415 428 510040 2-10-2 33 39 148
416 429 510041 2-10-2 30 58 150
417 430 510042 2-10-2 34 57 152
418 431 510043 2-10-2 0 2 154
419 432 510044 2-10-2 0 29 156
420 433 510045 2-10-2 3 31 158
421 434 510046 2-10-2 0 0 160
422 435 510047 2-10-2 0 0 162
423 436 510048 2-10-2 0 0 163
424 437 510049 2-10-2 0 0 164
454 473 505331 5-10-5 60 77 165
457 476 505332 5-10-5 55 74 166
458 471 510050 2-10-2 47 47 169
459 472 510051 2-10-2 35 55 170
460 473 510052 2-10-2 27 41 171
463 482 505333 5-10-5 66 78 172
466 485 505334 5-10-5 53 63 173
472 491 505335 5-10-5 70 76 174
475 494 505336 5-10-5 64 77 175
670 689 146823 5-10-5 74 79 180
670 683 510053 2-10-2 18 20 182
671 684 510054 2-10-2 13 21 183
672 685 510055 2-10-2 4 2 184
673 692 505337 5-10-5 60 72 185
679 698 505338 5-10-5 62 75 186
682 701 505339 5-10-5 81 90 187
688 707 505340 5-10-5 67 81 189
691 710 505341 5-10-5 68 80 193
691 704 510056 2-10-2 0 0 195
692 705 510057 2-10-2 37 48 196
693 706 510058 2-10-2 44 59 197
697 716 505342 5-10-5 80 87 198
738 751 510059 2-10-2 0 0 200
739 752 510060 2-10-2 0 0 202
740 753 510061 2-10-2 23 19 203
741 754 510062 2-10-2 25 30 204
756 775 505343 5-10-5 62 71 205
823 842 505344 5-10-5 52 66 206
1170 1189 505345 5-10-5 83 81 207

1259 1278 505346 5-10-5 84 81 210
1262 1281 505347 5-10-5 89 84 212
1268 1287 505348 5-10-5 78 78 213
1271 1290 505349 5-10-5 74 77 214
1277 1296 505350 5-10-5 75 77 215
1280 1299 505351 5-10-5 49 62 216
1283 1302 505352 5-10-5 70 66 217
1286 1305 505353 5-10-5 62 60 218
1413 1426 510063 2-10-2 0 0 219
1515 1534 505354 5-10-5 85 75 220
1518 1537 505355 5-10-5 81 74 221
1521 1540 505356 5-10-5 57 52 222
1550 1563 510064 2-10-2 0 0 223
1577 1596 146786 5-10-5 94 85 224
1580 1599 505357 5-10-5 86 79 225
1583 1602 505358 5-10-5 89 79 226
1586 1605 505359 5-10-5 82 68 227
1655 1674 505360 5-10-5 84 74 228
1706 1719 510065 2-10-2 0 0 229
1806 1825 505361 5-10-5 66 66 238
1809 1828 505362 5-10-5 52 59 239
1812 1831 505363 5-10-5 72 75 240
1815 1834 505364 5-10-5 73 80 241
1818 1837 505365 5-10-5 68 82 242
1821 1840 505366 5-10-5 50 76 243
1824 1843 505367 5-10-5 58 76 246
1826 1839 510066 2-10-2 0 31 248
1827 1846 505368 5-10-5 71 84 249
1861 1880 146787 5-10-5 25 35 250
1864 1883 505369 5-10-5 29 65 251
1865 1878 510067 2-10-2 0 0 253
1866 1879 510068 2-10-2 0 20 255
1867 1886 505370 5-10-5 45 70 63
1867 1880 510069 2-10-2 0 0 257
1868 1881 510070 2-10-2 0 0 259
1869 1882 510071 2-10-2 0 0 261
1870 1889 505371 5-10-5 48 66 69
1870 1883 510072 2-10-2 0 0 263
1871 1884 510073 2-10-2 0 0 265
1872 1885 510074 2-10-2 0 2 267
1873 1892 505372 5-10-5 48 67 268
1873 1886 510075 2-10-2 0 0 270
1876 1895 505373 5-10-5 23 48 272

1879 1898 505374 5-10-5 0 34 273
1882 1901 505375 5-10-5 39 66 274
1885 1904 505376 5-10-5 0 40 275
1888 1907 505377 5-10-5 4 47 276
1891 1910 505378 5-10-5 65 77 277
1918 1931 510076 2-10-2 0 0 279
1919 1932 510077 2-10-2 0 0 281
1920 1933 510078 2-10-2 0 0 282
1921 1934 510079 2-10-2 18 50 283
1957 1976 505379 5-10-5 42 84 284
2270 2283 510080 2-10-2 0 0 286
2271 2284 510081 2-10-2 0 0 287
2272 2285 510082 2-10-2 0 10 288
2368 2387 505380 5-10-5 29 79 289
2378 2391 510083 2-10-2 0 0 291
2379 2392 510084 2-10-2 31 17 293
2380 2393 510085 2-10-2 0 8 295
2381 2394 510086 2-10-2 10 2 297
2420 2439 505381 5-10-5 30 86 299
2459 2478 505382 5-10-5 16 87 300
2819 2838 505383 5-10-5 26 81 301
2825 2838 510087 2-10-2 0 0 307
2873 2892 505384 5-10-5 31 59 308
3161 3180 146833 5-10-5 55 76 309
3163 3182 505385 5-10-5 58 83 310

Пример 4: Антисмысловое ингибирование вирусной мРНК HBV в клетках HepAD38 (Tet-HBV) химерными олигонуклеотидами МОЕ

Некоторые антисмысловые олигонуклеотиды из исследования, описанного в Примерах 1 и 2, испытали на их влияние на мРНК HBV in vitro. Культивированные клетки HepAD38 (Tet-HBV) при плотности 45000 клеток на лунку трансфицировали при помощи электропорации 15000 нМ антисмыслового олигонуклеотида. После примерно 24 часов обработки, РНК выделили из клеток и измерили уровни мРНК HBV количественной ПНР в реальном времени. Для измерения уровней мРНК использовали набор вирусных затравочных зондов RTS3372. При помощи набора затравочных зондов RTS3373MGB измерили также уровни мРНК. Уровни мРНК HBV скорректировали в соответствии с общим содержанием РНК, по результатам измерения с RIBOGREEN®. Результаты представлены в Таблице 4 как процентное ингибирование HBV, по сравнению с не обработанными контрольными клетками.

Таблица 4
Ингибирование уровней вирусной мРНК HBV МОЕ химерными олигонуклеотидами (RTS3372 и RTS3373MGB)
Сайт инициации Терминирующий сайт № ISIS Мотив RTS3372% ингибирование RTS3373MGB % ингибирование SEQ ID NO
62 77 509941 3-10-3 36 5 86
245 260 509942 3-10-3 3 0 93
245 261 510088 3-10-4 24 10 5
246 261 509943 3-10-3 27 13 95
250 265 509944 3-10-3 46 34 98
250 266 510089 3-10-4 61 33 6
251 266 509945 3-10-3 54 43 100
251 267 510090 3-10-4 58 32 7
252 267 509946 3-10-3 50 28 102
252 268 510091 3-10-4 60 42 8
253 268 509947 3-10-3 49 40 104
253 269 510092 3-10-4 40 9 9
254 269 509948 3-10-3 13 22 106
254 270 510093 3-10-4 39 2 10
255 270 509949 3-10-3 33 24 109
255 271 510094 3-10-4 40 16 11
256 271 509950 3-10-3 31 23 112
256 272 510095 3-10-4 24 6 12
257 273 510096 3-10-4 62 44 13
258 273 509952 3-10-3 42 40 115
258 274 510097 3-10-4 65 48 14
259 274 509953 3-10-3 35 29 117
384 399 509954 3-10-3 35 18 129
384 400 510098 3-10-4 62 43 15
385 401 510099 3-10-4 67 50 16
386 401 509955 3-10-3 44 37 132
411 426 509956 3-10-3 67 53 137
411 427 510100 3-10-4 88 69 17
412 427 509957 3-10-3 86 76 140
412 428 510101 3-10-4 71 46 18
413 428 509958 3-10-3 78 74 143
413 429 510102 3-10-4 77 52 19
414 433 505330 5-10-5 81 60 20
414 429 509959 3-10-3 62 49 145
414 430 510103 3-10-4 9 5 21
415 434 509928 5-10-5 81 66 22
415 430 509960 3-10-3 67 57 147
415 431 510104 3-10-4 71 57 23

416 435 509929 5-10-5 82 69 24
416 431 509961 3-10-3 62 43 149
416 432 510105 3-10-4 81 64 25
417 436 509930 5-10-5 74 45 26
417 432 509962 3-10-3 59 48 151
417 433 510106 3-10-4 86 70 27
418 437 146783 5-10-5 19 3 28
418 433 509963 3-10-3 48 28 153
418 434 510107 3-10-4 74 51 29
419 434 509964 3-10-3 50 39 155
419 435 510108 3-10-4 67 50 30
420 435 509965 3-10-3 49 38 157
420 436 510109 3-10-4 12 13 31
421 436 509966 3-10-3 23 22 159
421 437 510110 3-10-4 34 16 32
422 437 509967 3-10-3 3 12 161
457 472 509968 3-10-3 56 38 167
457 473 510111 3-10-4 68 51 33
458 473 509969 3-10-3 53 39 168
639 658 146784 5-10-5 0 0 34
639 654 509970 3-10-3 51 15 176
639 655 510112 3-10-4 66 32 35
640 656 510113 3-10-4 70 31 36
641 656 509971 3-10-3 54 31 177
641 657 510114 3-10-4 67 45 37
642 657 509972 3-10-3 51 25 178
642 658 510115 3-10-4 73 50 38
643 658 509973 3-10-3 49 32 179
670 685 509974 3-10-3 74 67 181
687 706 509931 5-10-5 92 83 39
687 702 509975 3-10-3 72 71 188
687 703 510116 3-10-4 83 74 40
688 703 509976 3-10-3 46 52 190
688 704 510117 3-10-4 71 57 41
689 704 509977 3-10-3 18 22 191
689 705 510118 3-10-4 71 50 42
690 705 509978 3-10-3 57 37 192
690 706 510119 3-10-4 80 64 43
691 706 509979 3-10-3 65 55 194
738 753 509980 3-10-3 48 44 199
738 754 510120 3-10-4 70 54 44
739 754 509981 3-10-3 54 45 201
1176 1191 509982 3-10-3 44 36 208

1176 1192 510121 3-10-4 74 69 45
1177 1192 509983 3-10-3 57 53 209
1261 1276 509984 3-10-3 57 50 211
1778 1797 509932 5-10-5 30 76 46
1778 1793 509985 3-10-3 0 46 230
1778 1794 510122 3-10-4 0 60 47
1779 1798 509933 5-10-5 54 78 48
1779 1794 509986 3-10-3 56 81 231
1779 1795 510123 3-10-4 74 85 49
1780 1799 509934 5-10-5 69 84 50
1780 1795 509987 3-10-3 52 78 232
1780 1796 510124 3-10-4 75 84 51
1781 1800 509935 5-10-5 72 85 52
1781 1796 509988 3-10-3 57 68 232
1781 1797 510125 3-10-4 68 72 53
1782 1797 509989 3-10-3 46 41 234
1782 1798 510126 3-10-4 56 51 54
1783 1798 509990 3-10-3 16 25 234
1783 1799 510127 3-10-4 61 69 55
1784 1799 509991 3-10-3 41 41 236
1784 1800 510128 3-10-4 61 68 56
1785 1800 509992 3-10-3 43 43 237
1822 1837 509993 3-10-3 72 44 244
1822 1838 510129 3-10-4 66 33 57
1823 1838 509994 3-10-3 79 32 245
1823 1839 510130 3-10-4 49 31 58
1824 1839 509995 3-10-3 63 30 247
1865 1884 509936 5-10-5 74 59 59
1865 1880 509996 3-10-3 36 0 252
1865 1881 510131 3-10-4 26 0 60
1866 1885 509937 5-10-5 78 63 61
1866 1881 509997 3-10-3 5 0 254
1866 1882 510132 3-10-4 37 4 62
1867 1886 505370 5-10-5 54 17 63
1867 1882 509998 3-10-3 13 0 256
1867 1883 510133 3-10-4 42 25 64
1868 1887 509938 5-10-5 9 6 65
1868 1883 509999 3-10-3 47 6 258
1868 1884 510134 3-10-4 56 27 66
1869 1888 509939 5-10-5 64 29 67
1869 1884 510000 3-10-3 24 1 260
1869 1885 510135 3-10-4 70 43 68
1870 1889 505371 5-10-5 63 46 69

1870 1885 510001 3-10-3 39 12 262
1870 1886 510136 3-10-4 52 23 70
1871 1886 510002 3-10-3 10 0 264
1871 1887 510137 3-10-4 28 0 71
1872 1887 510003 3-10-3 21 0 266
1872 1888 510138 3-10-4 25 7 72
1873 1888 510004 3-10-3 21 38 269
1873 1889 510139 3-10-4 18 0 73
1874 1889 510005 3-10-3 8 0 271
1918 1933 510006 3-10-3 0 0 278
1918 1934 510140 3-10-4 81 67 74
1919 1934 510007 3-10-3 69 66 280
2270 2285 510008 3-10-3 23 0 285
2378 2397 509940 3-10-4 66 7 75
2378 2393 510009 3-10-3 23 0 290
2378 2394 510141 3-10-4 10 11 76
2379 2394 510010 3-10-3 39 6 292
2379 2395 510142 3-10-4 46 24 77
2380 2395 510011 3-10-3 33 23 294
2380 2396 510143 3-10-4 59 36 78
2381 2396 510012 3-10-3 38 22 296
2381 2397 510144 3-10-4 54 20 79
2382 2397 510013 3-10-3 42 0 298
2820 2835 510014 3-10-3 51 9 302
2820 2836 510145 3-10-4 68 19 80
2821 2836 510015 3-10-3 35 2 303
2821 2837 510146 3-10-4 65 15 81
2822 2837 510016 3-10-3 9 0 304
2822 2838 510147 3-10-4 30 0 85
2823 2838 510017 3-10-3 18 0 305
2824 2839 510018 3-10-3 24 5 306

Пример 5: Зависимое от дозы ингибирование вирусной РНК HBV в клетках HepG2.2.15 химерными олигонуклеотидами МОЕ

Некоторые химерные олигонуклеотиды из исследования, описанного в Примерах 3 и 4, испытали при различных дозах в клетках HepG2.2.15 человека. Клетки поместили на планшет при плотности 25000 клеток на лунку и трансфицировали электропорацией антисмысловыми олигонуклеотидами в концентрациях 2, 5 мкМ, 5,0 мкМ, 10,0 мкМ и 20,0 мкМ, как показано в Таблице 5. Примерно через 16 часов обработки, РНК выделили из клеток, и измерили уровни мРНК HBV количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор вирусных затравочных зондов RTS3370. Уровни мРНК HBV скорректировали в соответствии с общим содержанием РНК, по результатам измерения с RIBOGREEN®. Результаты представлены как процентное ингибирование HBV, по сравнению с не обработанными контрольными клетками.

Полумаксимальные ингибирующие концентрации (IC50) каждого олигонуклеотида также представлены в Таблице 5. Как показано в Таблице 5, в клетках, обработанных антисмысловыми олигонуклеотидами, существенно снизились уровни мРНК HBV зависимым от дозы образом.

Таблица 5
Зависимое от дозы антисмысловое ингибирование РНК HBV в клетках HepG2.2.15 с использованием RTS3370
№ ISIS 2, 5 мкМ 5,0 мкМ 10,0 мкМ 20,0 мкМ IC50 (мкМ)
146786 33 50 54 81 5,7
505317 35 40 63 67 6,6
505323 16 33 48 63 11,1
505326 27 44 64 67 6,9
509929 21 44 60 62 8,4
509931 51 63 75 75 <2, 5
509957 37 53 57 70 5,4
509974 25 35 54 63 9, 5
509975 36 55 62 81 4,7
509981 7 23 35 52 18,8
510039 27 46 60 69 6,9
510040 10 28 43 59 13,4
510041 29 41 53 66 8,3
510058 9 34 42 63 11,9

Пример б: Зависимое от дозы ингибирование вирусной РНК HBV в клетках HepG2.2.15 химерными олигонуклеотидами МОЕ

Дополнительные химерные олигонуклеотиды из исследования, описанного в Примерах 3 и 4, дополнительно испытали при различных дозах в клетках HepG2.2.15 человека. Клетки поместили на планшет при плотности 28000 клеток на лунку и трансфицировали при помощи реагента LipofectAMINE 2000® антисмысловыми олигонуклеотидами в концентрациях 15,625 нМ, 31,25 нМ, 62, 5 нМ, 125,0 нМ и 250,0 нМ, как показано в Таблице 6. Примерно через 16 часов обработки, РНК выделили из клеток, и измерили уровни мРНК HBV количественной ПЦР в реальном времени. Для измерения уровней мРНК использовали набор вирусных затраво