Диагностические анализы и наборы для детекции фолатного рецептора 1



Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
Диагностические анализы и наборы для детекции фолатного рецептора 1
G01N2333/705 - Исследование или анализ материалов путем определения их химических или физических свойств (разделение материалов вообще B01D,B01J,B03,B07; аппараты, полностью охватываемые каким-либо подклассом, см. в соответствующем подклассе, например B01L; измерение или испытание с помощью ферментов или микроорганизмов C12M,C12Q; исследование грунта основания на стройплощадке E02D 1/00;мониторинговые или диагностические устройства для оборудования для обработки выхлопных газов F01N 11/00; определение изменений влажности при компенсационных измерениях других переменных величин или для коррекции показаний приборов при изменении влажности, см. G01D или соответствующий подкласс, относящийся к измеряемой величине; испытание
C07K2317/21 - Пептиды (пептиды в пищевых составах A23, например получение белковых композиций для пищевых составов A23J, препараты для медицинских целей A61K; пептиды, содержащие бета-лактамовые кольца, C07D; циклические дипептиды, не содержащие в молекуле любого другого пептидного звена, кроме образующего их кольцо, например пиперазин-2,5-дионы, C07D; алкалоиды спорыньи циклического пептидного типа C07D519/02; высокомолекулярные соединения, содержащие статистически распределенные аминокислотные единицы в молекулах, т.е. при получении предусматривается не специфическая, а случайная последовательность аминокислотных единиц, гомополиамиды и блоксополиамиды, полученные из аминокислот, C08G 69/00; высокомолекулярные продукты, полученные из протеинов, C08H 1/00; получение

Владельцы патента RU 2668824:

ИММЬЮНОДЖЕН ИНК. (US)

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, способные к специфическому связыванию с фолатным рецептором человека 1 (FOLR1). Также рассмотрена молекула нуклеиновой кислоты, способ детекции белка FOLR1 в образце, клетка и способ получения антитела или его антигенсвязывающего фрагмента. Кроме того, описан набор для иммуноанализа для детекции белка FOLR1 в образце. Данное изобретение может найти дальнейшее применение в диагностике и лечении рака. 6 н. и 8 з.п. ф-лы, 15 ил., 6 табл., 9 пр.

 

ОБЛАСТЬ ТЕХНИКИ

[001] Область техники настоящего изобретения в целом относится к антителам, которые связываются с фолатным рецептором человека 1 (FOLR1), способам детектирования FOLR1, способам диагностики и лечения рака и диагностическим анализам и наборам для лечения на основе FOLR1.

УРОВЕНЬ ТЕХНИКИ

[002] Рак является одной из ведущих причин смерти в развитых странах мира с более чем одним миллионом человек, которым установлен диагноз ракового заболевания и 500000 смертей в год только в Соединенных Штатах Америки. В целом, по оценкам, у более 1 из 3 человек в течение жизни будет развиваться какая-либо форма рака. Существует более чем 200 различных типов рака, на четыре из которых - рак молочной железы, легких, толстой кишки и предстательной железы - приходится более половины всех новых случаев (Jemal et al., 2003, Cancer J. Clin. 53: 5-26).

[003] Фолатный рецептор 1 (FOLR1), также известный как фолатный рецептор-альфа или белок, связывающий фолат, представляет собой N-гликозилированный белок, который экспрессируется на плазматической мембране клеток. FOLR1 обладает высокой аффинностью к фолиевой кислоте и к нескольким восстановленным производным фолиевой кислоты. FOLR1 опосредует доставку физиологического фолата, 5-метилтетрагидрофолата внутрь клеток.

[004] FOLR1 избыточно экспрессируется при подавляющем большинстве случаев рака яичников, а также при многих видах рака матки, эндометрия, поджелудочной железы, почек, легких и молочной железы, в то время как экспрессия FOLR1 в нормальных тканях ограничена апикальной мембраной эпителиальных клеток в проксимальных почечных канальцах, альвеолярных пневмоцитах легкого, мочевого пузыря, яичек, сосудистого сплетения и щитовидной железы (Weitman SD, et al, Cancer Res 52: 3396-3401 (1992); Antony AC, Annu Rev Nutr 16: 501-521 (1996); Kalli KR, et al. Gynecol Oncol 108: 619-626 (2008)). Паттерн экспрессии FOLR1 делает его желательной мишенью для направленной на FOLR1 терапии рака.

[005] Из-за того, что рак яичников, как правило, до поздней стадии протекает бессимптомно, он часто диагностируется на поздней стадии и имеет плохой прогноз при лечении посредством доступных в настоящее время процедур, как правило, химиотерапевтических лекарственных средств после хирургической циторедукции (von Gruenigen V et al, Cancer 112: 2221-2227 (2008); Ayhan A et al., Am J Obstet Gynecol 196: 81 e81-86 (2007); Harry VN et al., Obstet Gynecol Surv 64: 548-560 (2009)). Таким образом, существует явно неудовлетворенная медицинская потребность в более эффективных терапевтических средствах для лечения рака яичников.

[006] Некоторые предыдущие анализы, используемые для детекции слущивающегося FOLR1, являются недостаточно специфичными для FOLRJ. Например, некоторые анализы не делают различий между FOLR1 и другими представителями семейства фолатных рецепторов (FOLR2, 3 и 4) или регистрируют значения общего ФСБ (фолат-связывающего белка). Кроме того, некоторые анализы требуют, чтобы образцы человека (например, плазма) на стадии промывки были предварительно обработаны слабой кислотой для диссоциации фолиевой кислоты от рецептора. Некоторые результаты анализов могут также иметь неточности, вызванные конкурентными эффектами между терапевтическим антителом и диагностическим антителом. Кроме того, многие коммерчески доступные наборы являются традиционно ненадежными, как в отношении их реагентов, так и в отношении их стабильности от партии к партии. Оценки этих наборов дали весьма противоречивые результаты, и предназначены только для исследовательских целей. Многие требуют, чтобы образец от человека был предварительно разбавлен перед анализом, чтобы снизить вероятность ложно-положительных результатов из-за "матричного эффекта." Таким образом, существует явная потребность в высокочувствительных и точных диагностических анализах в качестве сопровождения для лечения на основе FOLR1.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

[007] Настоящее изобретение относится к способам детекции FOLR1 в образце и может быть использовано, например, для стратификации пациентов. Таким образом, в одном варианте реализации настоящее изобретение относится к способу лечения пациента, имеющего заболевание, опосредованное фолатным рецептором 1, включающему: (а) измерение уровня экспрессии слущивающегося фолатного рецептора 1 (FOLR1) или FOLR1 в циркулирующих опухолевых клетках (ЦОК) в образце, полученном от пациента, по сравнению с уровнем слущивающегося или ЦОК FOLR1 в эталонном образце с использованием антитела или его антиген-связывающего фрагмента, которые конкурентно не ингибируют связывание антитела huMov19 с FOLR1; и (b) введение пациенту фиксированной дозы антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1, если уровень слущивающегося или ЦОК FOLR1 у пациента повышен; при этом фиксированная доза антитела или его фрагмента эффективно лечит заболевание или расстройство.

[008] В другом варианте реализации настоящее изобретение относится к способу лечения пациента, имеющего заболевание или расстройство, опосредованное FOLR1, включающему: (а) введение пациенту, имеющему заболевание или расстройство, опосредованное FOLR1, фиксированной дозы антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1; (b) измерение уровня экспрессии слущивающегося или ЦОК FOLR1 у пациента, по сравнению с уровнем FOLR1 в эталонном образце с использованием антитела или его антиген-связывающего фрагмента, которые конкурентно не ингибируют связывание антитела huMov19 с FOLR1; и (с) увеличение количества или частоты последующих фиксированных доз, если уровень слущивающегося или ЦОК FOLR1 у пациента повышен; при этом увеличение (например, из-за того, что повышенная гибель клеток приводит к повышенному высвобождению слущивающегося FOLR1) или снижение уровней FOLR1 у пациента свидетельствует об эффективности лечения. В другом варианте реализации повышают количество или частоту последующих фиксированных доз, если уровень слущивающегося или ЦОК FOLR1 у пациента снижается.

[009] В другом варианте реализации настоящее изобретение относится к способу снижения экспрессии FOLR1 у пациента, включающему: (а) измерение уровня слущивающегося или ЦОК FOLR1 в образце, полученном от пациента, имеющего заболевание или расстройство, опосредованное FOLR1, по сравнению с уровнем FOLR1 в эталонном образце с использованием антитела или его антиген-связывающего фрагмента, которые конкурентно не ингибируют связывание антитела huMov19 с FOLR1; и (b) введение пациенту фиксированной дозы антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1, если уровень слущивающегося или ЦОК FOLR1 у пациента повышен; при этом введение антитела или его антиген-связывающего фрагмента повышает (например, из-за того, что повышенная гибель клеток приводит к повышенному высвобождению слущивающегося FOLR1) или снижает FOLR1 у пациента.

[0010] В другом варианте реализации настоящее изобретение относится к способу снижения экспрессии FOLR1 у пациента, включающему: (а) введение пациенту, имеющему заболевание или расстройство, опосредованное FOLR1, фиксированной дозы антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1; (b) измерение уровня слущивающегося или ЦОК FOLR1 у пациента, по сравнению с уровнем FOLR1 в эталонном образце; и (с) увеличение количества или частоты последующих фиксированных доз, если уровень слущивающегося или ЦОК FOLR1 у пациента повышен; при этом введение антитела или его антиген-связывающего фрагмента повышает (например, из-за того, что повышенная гибель клеток приводит к повышенному высвобождению слущивающегося FOLR1) или снижает уровни FOLR1 у пациента.

[0011] В одном варианте реализации изобретения заболевание представляет собой рак. В другом варианте реализации указанный рак представляет собой рак с повышенным уровнем FOLR1, выбранный из группы, состоящей из: рака яичников, немелкоклеточного рака легкого, рака матки, эндометрия, поджелудочной железы, почек, легких и молочной железы. В другом варианте реализации указанный рак представляет собой рак яичников, который устойчив к лечению платиной или невосприимчив к лечению платиной.

[0012] Настоящее изобретение также относится к способу контроля терапевтической эффективности фиксированной дозы антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1 у пациента, включающему: (а) измерение первого уровня слущивающегося или ЦОК FOLR1 в образце, полученном от пациента, имеющего заболевание или расстройство, опосредованное FOLR1, с использованием антитела или его антиген-связывающего фрагмента, которые конкурентно не ингибируют связывание антитела huMov19 с FOLR1; (b) введение пациенту фиксированной дозы антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1; (с) измерение второго уровня слущивающегося или ЦОК FOLR1 в образце, полученном от этого пациента после введения антитела с использованием антитела или его антиген-связывающего фрагмента, которые конкурентно не ингибируют связывание антитела huMov19 с FOLR1; и (d) сравнение второго уровня FOLR1 с первым уровнем FOLR1; при этом увеличение (например, из-за того, что повышенная гибель клеток приводит к повышенному высвобождению слущивающегося FOLR1) или снижение показателей FOLR1 между первым и вторым измерениями свидетельствует о терапевтической эффективности.

[0013] В одном варианте реализации изобретения уровень экспрессии FOLR1 измеряется в биологической жидкости организма. В другом варианте реализаций изобретения биологическая жидкость организма представляет собой асцитную жидкость. В другом варианте реализации изобретения биологическая жидкость организма представляет собой сыворотку, кровь или плазму. В другом варианте реализации изобретения уровень экспрессии FOLR1 измеряется в образце периферической крови.

[0014] В одном варианте реализации изобретения пациент имеет рак. В другом варианте реализации изобретения указанный рак представляет собой рак с повышенным уровнем FOLR1, выбранный из группы, состоящей из рака яичников, немелкоклеточного рака легкого, рака матки, эндометрия, поджелудочной железы, почек, легких и молочной железы. В другом варианте реализации указанный рак представляет собой рак яичников, который устойчив к лечению платиной или невосприимчив к лечению платиной.

[0015] В одном варианте реализации изобретения экспрессию FOLR1 измеряют с использованием по меньшей мере одного дополнительного антитела к FOLR1 или его антиген-связывающего фрагмента. В другом варианте реализации изобретения экспрессию FOLR1 измеряют с использованием двух антител к FOLR1 или их антиген-связывающих фрагментов. В другом варианте реализации изобретения антитело представляет собой мышиное, химерное, гуманизированное или человеческое антитело. В другом варианте реализации антитело или его антиген-связывающий фрагмент связываются с фолатным рецептором человека 1 с Kd от около 1,0 до около 10 нМ. В другом варианте реализации антитело или его антиген-связывающий фрагмент связываются с фолатным рецептором человека 1 с Kd от около 0,5 нМ до около 5 нМ. В другом варианте реализации аффинность связывания измеряется посредством цитометрии, анализа Biacore, ELISA или радиоиммуноанализа. В другом варианте реализации цитометрия представляет собой проточную цитометрию.

[0016] В одном варианте реализации изобретения антитело или его антиген-связывающий фрагмент не связываются с фолатным рецептором 2 или фолатным рецептором 3.

[0017] В одном варианте реализации изобретения по меньшей мере одно антитело или его антиген-связывающий фрагмент связаны с твердой подложкой. В другом варианте реализации по меньшей мере одно антитело или его антиген-связывающий фрагмент связаны с микротитрационным планшетом. В другом варианте реализаций по меньшей мере одно антитело или его антиген-связывающий фрагмент включают в себя средство детекции. В другом варианте реализации средство детекции представляет собой хромогенное средство детекции, флуорогенное средство детекции, ферментное средство детекции или электрохемилюминесцентное средство детекции. В другом варианте реализации средство детекции представляет собой пероксидазу хрена (ПХ).

[0018] В одном варианте реализации изобретения уровни FOLR1 определяются с использованием твердофазного иммуноферментного анализа (ELISA) или цитометрии (например, проточной цитометрии). В другом варианте реализации ELISA представляет собой анализ ELISA "сэндвич"-типа.

[0019] В одном варианте реализации изобретения по меньшей мере одно антитело или его антиген-связывающий фрагмент специфически связываются с тем же эпитопом FOLR1, что и антитело выбранное из группы, состоящей из: (а) антитела, содержащего полипептид SEQ ID NO: 25 и полипептид SEQ ID NO: 29; (b) антитела, содержащего полипептид SEQ ID NO: 26 и полипептид SEQ ID NO: 30; (с) антитела, содержащего полипептид SEQ ID NO: 27 и полипептид SEQ ID NO: 31; и (d) антитела, содержащего полипептид SEQ ID NO: 28 и полипептид SEQ ID NO: 32.

[0020] В одном варианте реализации изобретения по меньшей мере одно антитело или его антиген-связывающий фрагмент специфически связывается с FOLR1, при этом антитело или его фрагмент конкурентно ингибируют связывание FOLR1 с антителом, выбранным из группы, состоящей из: (а) антитела, содержащего полипептид SEQ ID NO: 25 и полипептид SEQ ID NO: 29; (b) антитела, содержащего полипептид SEQ ID NO: 26 и полипептид SEQ ID NO: 30; (с) антитела, содержащего полипептид SEQ ID NO: 27 и полипептид SEQ ID NO: 31; и (d) антитела, содержащего полипептид SEQ ID NO: 28 и полипептид SEQ ID NO: 32.

[0021] В одном варианте реализации изобретения по меньшей мере одно антитело или его антиген-связывающий фрагмент специфически связываются с FOLR1, при этом антитело содержит последовательности полипептидов, выбранные из группы, состоящей из: (a) SEQ ID NO: 1, 2 и 3 и SEQ ID NO: 13, 14 и 15; (b) SEQ ID NO: 4, 5 и 6 и SEQ ID NO: 16, 17 и 18; (с) SEQ ID NO: 7, 8 и 9 и SEQ ID NO: 19, 20 и 21; (d) SEQ ID NO: 10, 11 и 12 и SEQ ID NO: 22, 23 и 24; и (e) вариантов (a)-(d), содержащих 1, 2, 3 или 4 консервативные аминокислотные замены.

[0022] В одном варианте реализации изобретения по меньшей мере одно антитело или его антиген-связывающий фрагмент мечены детектируемой меткой.

[0023] В одном варианте реализации изобретения антитело, которое вводят, содержит антитело к FOLR1 huMov19.

[0024] В одном варианте реализации изобретения huMov19 вводят в виде конъюгата антитела и майтанзиноида. В одном варианте реализации изобретения конъюгат антитела и майтанзиноида содержит майтанзиноид DM4 и расщепляемый линкер сульфо-SPDB (IMGN853).

[0025] Настоящее изобретение также относится к способу лечения пациента, имеющего заболевание или расстройство, опосредованное FOLR1, включающему: (а) введение пациенту, имеющему заболевание или расстройство, опосредованное FOLR1, фиксированной дозы антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1; (b) предоставление образца, полученного от пациента, для измерения уровня экспрессии FOLR1; (с) определение из результатов измерения повышен ли уровень слущивающегося или ЦОК FOLR1 у пациента по сравнению с уровнем FOLR1 в эталонном образце; и (d) увеличение количества или частоты последующих фиксированных доз, если уровень слущивающегося или ЦОК FOLR1 у пациента повышен.

[0026] Настоящее изобретение также относится к способу лечения пациента, имеющего заболевание или расстройство, опосредованное FOLR1, включающему: (а) введение пациенту, имеющему заболевание или расстройство, опосредованное FOLR1, фиксированной дозы антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1; (b) предоставление образца, полученного от пациента, для измерения уровня слущивающегося или ЦОК FOLR1 и сравнение с уровнем FOLR1 в эталонном образце; и (с) увеличение количества или частоты последующих фиксированных доз, если уровень слущивающегося или ЦОК FOLR1 у пациента повышен; при этом увеличение (например, из-за того, что повышенная гибель клеток приводит к повышенному высвобождению слущивающегося FOLR1) или уменьшение уровней FOLR1 у пациента свидетельствует об эффективности лечения.

[0027] В одном варианте реализации изобретения антитело, которое вводят, содержит антитело к FOLR1 huMov19. В другом варианте реализации huMov19 вводят в виде конъюгата антитела и майтанзиноида. В одном варианте реализации изобретения конъюгат антитела и майтанзиноида содержит майтанзиноид DM4 и расщепляемый линкер сульфо-SPDB (IMGN853).

[0028] Настоящее изобретение также относится к способу лечения пациента, имеющего заболевание или расстройство, опосредованное FOLR1 включающему: (а) получение образца от пациента, имеющего заболевание или расстройство, опосредованное FOLR1, при этом пациент получил фиксированную дозу антитела или его антиген-связывающего фрагмента, которая модулирует активность FOLR1; (b) измерение уровня слущивающегося или ЦОК FOLR1 в образце с использованием антитела или его антиген-связывающего фрагмента, которые конкурентно не ингибируют связывание антитела huMov19 с FOLR1; (с) определение того, повышен ли уровень слущивающегося или ЦОК FOLR1 у пациента по сравнению с уровнем FOLR1 в эталонном образце; (d) инструктирование лечащего врача об увеличении количества или частоты последующих фиксированных доз, если уровень слущивающегося или ЦОК FOLR1 у пациента повышен; при этом увеличение (например, из-за того, что повышенная гибель клеток приводит к повышенному высвобождению слущивающегося FOLR1) или уменьшение уровней FOLR1 у пациента свидетельствует об эффективности лечения.

[0029] Настоящее изобретение также обеспечивает набор для иммуноанализа для детекции слущивающегося или ЦОК FOLR1 в образце, при этом набор включает: (а) антитело захвата к FOLR1 человека, при этом антитело захвата или его антиген-связывающий фрагмент конкурентно не ингибирует связывание huMov19 с FOLR1 и (б) реагент для детекции. В другом варианте реализации набор дополнительно включает твердую подложку для реагента захвата. В другом варианте реализации реагент захвата иммобилизован на твердой подложке. В другом варианте реализации реагент захвата нанесен на микротитрационный планшет. В другом варианте реализации реагент для детекции представляет собой второе антитело к FOLR1. В другом варианте реализации первое и/или второе антитело к FOLR1 содержит последовательности полипептидов, выбранные из группы, состоящей из: (a) SEQ ID NO: 1, 2 и 3 и SEQ ID NO: 13, 14 и 15; (b) SEQ ID NO: 4, 5 и 6 и SEQ ID NO: 16, 17 и 18; (с) SEQ ID NO: 7, 8 и 9 и SEQ ID NO: 19, 20 и 21; (d) SEQ ID NO: 10, 11 и 12 и SEQ ID NO: 22, 23 и 24; и (e) вариантов (a)-(d), содержащих 1, 2, 3 или 4 консервативные аминокислотные замены.

[0030] В одном варианте реализации изобретения реагент для детекции обнаруживается с помощью видоспецифического антитела. В другом варианте реализации набор дополнительно включает средство детекции для детектируемых антител. В другом варианте реализации средство детекции является колориметрическим. В другом варианте реализации набор дополнительно включает полипептид FOLR1 в качестве стандарта антигена. В другом варианте реализации полипептид FOLR1 представляет собой FOLR1-Fc.

[0031] Настоящее изобретение также относится к антителу или его антиген-связывающему фрагменту, которые специфически связываются с тем же эпитопом FOLR1, что и антитело, выбранное из группы, состоящей из: (а) антитела, содержащего полипептид SEQ ID NO: 25 и полипептид SEQ ID NO: 29; (b) антитела, содержащего полипептид SEQ ID NO: 26 и полипептид SEQ ID NO: 30; (с) антитела, содержащего полипептид SEQ ID NO: 27 и полипептид SEQ ID NO: 31; и (d) антитела, содержащего полипептид SEQ ID NO: 28 и полипептид SEQ ID NO: 32.

[0032] Настоящее изобретение также относится к антителу или его антиген-связывающему фрагменту, которые специфически связываются с FOLR1, при этом антитело или его фрагмент конкурентно ингибируют связывание FOLR1 с антителом, выбранным из группы, состоящей из: (а) антитела, содержащего полипептид SEQ ID NO: 25 и полипептид SEQ ID NO: 29; (b) антитела, содержащего полипептид SEQ ID NO: 26 и полипептид SEQ ID NO: 30; (с) антитела, содержащего полипептид SEQ ID NO: 27 и полипептид SEQ ID NO: 31; и (d) антитела, содержащего полипептид SEQ ID NO: 28 и полипептид SEQ ID NO: 32.

[0033] Настоящее изобретение также относится к антителу или его антиген-связывающему фрагменту, которые специфически связываются с FOLR1, при этом антитело содержит последовательности полипептидов, выбранные из группы, состоящей из: (a) SEQ ID NO: 1, 2 и 3 и SEQ ID NO: 13, 14 и 15; (b) SEQ ID NO: 4, 5 и 6 и SEQ ID NO: 16, 17 и 18; (с) SEQ ID NO: 7, 8 и 9 и SEQ ID NO: 19, 20 и 21; (d) SEQ ID NO: 10, 11 и 12 и SEQ ID NO: 22, 23 и 24; и (e) вариантов (a)-(d), содержащих 1, 2, 3 или 4 консервативные аминокислотные замены.

[0034] В одном варианте реализации изобретения антитело содержит полипептидные последовательности, которые по меньшей мере на 90% идентичны полипептидным последовательностям, выбранным из группы, состоящей из: (a) SEQ ID NO: 25 и SEQ ID NO: 29; (b) SEQ ID NO: 26 и SEQ ID NO: 30; (с) SEQ ID NO: 27 и SEQ ID NO: 31; и (d) SEQ ID NO: 28 и SEQ ID NO: 32. В другом варианте реализации полипептидные последовательности по меньшей мере на 95% идентичны полипептидным последовательностям, выбранным из группы, состоящей из: (a) SEQ ID NO: 25 и SEQ ID NO: 29; (b) SEQ ID NO: 26 и SEQ ID NO: 30; (с) SEQ ID NO: 27 и SEQ ID NO: 31; и (d) SEQ ID NO: 28 и SEQ ID NO: 32. В другом варианте реализации полипептидные последовательности по меньшей мере на 99% идентичны полипептидным последовательностям, выбранным из группы, состоящей из: (a) SEQ ID NO: 25 и SEQ ID NO: 29; (b) SEQ ID NO: 26 и SEQ ID NO: 30; (с) SEQ ID NO: 27 и SEQ ID NO: 31; и (d) SEQ ID NO: 28 и SEQ ID NO: 32.

[0035] В одном варианте реализации изобретения антитело или его антиген-связывающий фрагмент является мышиным, не относящимся к человеку, гуманизированным, химерным, с измененной поверхностью или человеческим. В другом варианте реализации изобретения антитело связывается с FOLR1 человека, но не с FOLR2 или FOLR3. В другом варианте реализации изобретения антитело представляет собой полноразмерное антитело или антиген-связывающий фрагмент. В другом варианте реализации антитело или его антиген-связывающий фрагмент содержит Fab, Fab', F(ab')2, Fd, одноцепочечный Fv или scFv, дисульфидно-связанный Fv, домен V-NAR, IgNar, интратело, IgGΔCH2, минитело, F(ab F0LR2)3, тетратело, триатело, диатело, однодоменное антитело, DVD-Ig, Fcab, mAb2, (scFv)2 или scFv-Fc.

[0036] Настоящее изобретение также относится к полипептиду, который специфически связывается с FOLR1, при этом полипептид содержит последовательности, выбранные из группы, состоящей из: (a) SEQ ID NO: 1, 2 и 3 и SEQ ID NO: 13, 14 и 15; (b) SEQ ID NO: 4, 5 и 6 и SEQ ID NO: 16, 17 и 18; (с) SEQ ID NO: 7, 8 и 9 и SEQ ID NO: 19, 20 и 21; (d) SEQ ID NO: 10, 11 и 12 и SEQ ID NO: 22, 23 и 24; и (e) вариантов (a)-(d), содержащих 1, 2, 3 или 4 консервативные аминокислотные замены. В другом варианте реализации полипептид содержит последовательности, которые по меньшей мере на 90% идентичны последовательностям, выбранным из группы, состоящей из: (a) SEQ ID NO: 25 и SEQ ID NO: 29; (b) SEQ ID NO: 26 и SEQ ID NO: 30; (с) SEQ ID NO: 27 и SEQ ID NO: 31; и (d) SEQ ID NO: 28 и SEQ ID NO: 32. В другом варианте реализации последовательности по меньшей мере на 95% идентичны последовательностям, выбранным из группы, состоящей из: (a) SEQ ID NO: 25 и SEQ ID NO: 29; (b) SEQ ID NO: 26 и SEQ ID NO: 30; (с) SEQ ID NO: 27 и SEQ ID NO: 31; и (d) SEQ ID NO: 28 и SEQ ID NO: 32. В другом варианте реализации последовательности по меньшей мере на 99% идентичны последовательностям, выбранным из группы, состоящей из: (a) SEQ ID NO: 25 и SEQ ID NO: 29; (b) SEQ ID NO: 26 и SEQ ID NO: 30; (с) SEQ ID NO: 27 и SEQ ID NO: 31; и (d) SEQ ID NO: 28 и SEQ ID NO: 32.

[0037] В одном варианте реализации изобретения антитело или полипептид связывается с фолатным рецептором 1 человека с Kd от около 1,0 до около 10 нМ. В другом варианте реализации антитело или полипептид связывается с фолатным рецептором 1 человека с Kd около 1,0 нМ или лучше. В другом варианте реализации аффинность связывания измеряется посредством цитометрии, анализа Biacore, ELISA или радиоиммуноанализа. В другом варианте реализации цитометрия представляет собой проточную цитометрию.

[0038] Настоящее изобретение также относится к способу детекции экспрессии FOLR1 в образце, включающему контактирование образца с антителом или его антиген-связывающим фрагментом или полипептидом по настоящему изобретению. В другом варианте реализации антитело или его антиген-связывающий фрагмент мечены детектируемой меткой. В другом варианте реализации метка выбрана из группы, состоящей из иммунофлуоресцентной метки, хемилюминесцентной метки, фосфоресцирующей метки, ферментной метки, радиоактивной метки, авидина/биотина, частиц коллоидного золота, окрашенных частиц и магнитных частиц. В другом варианте реализации экспрессию FOLR1 определяют с помощью радиоиммуноанализа, вестерн-блоттинга, иммунофлуоресцентного анализа, иммуноферментного анализа, анализа иммунопреципитации, хемилюминесцентного анализа или иммуногистохимического анализа. В другом варианте реализации экспрессию FOLR1 определяют с помощью анализа циркулирующих опухолевых клеток (ЦОК), где ЦОК обогащают из образца крови, плазмы или сыворотки и окрашивают для экспрессии FOLR1 с использованием антитела или его антиген-связывающего фрагмента по настоящему изобретению. Неограничивающие примеры антител, используемых для анализа ЦОК, включают FR1-9 и FR1-13. Анализы ЦОК с использованием антитела по настоящему изобретению могут быть полезны для идентификации субъекта, который вероятно ответит на терапию на основе FOLR1.

[0039] Настоящее изобретение также относится к выделенной клетке, продуцирующей антитело или его антиген-связывающий фрагмент или полипептид по настоящему изобретению.

[0040] Настоящее изобретение также относится к способу получения антитела или его антиген-связывающего фрагмента или полипептида по настоящему изобретению, включающему (а) культивирование клетки, экспрессирующей указанное антитело или его антиген-связывающий фрагмент, или полипептид по настоящему изобретению.

[0041] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1 для применения в способе лечения рака, при этом повышенная экспрессия белка FOLR1 была измерена в раковом образце от субъекта с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе перед введением активного средства.

[0042] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для применения в способе лечения заболевания или расстройства, опосредованного FOLR1, включающем: (а) измерение уровня белка FOLR1 в образце от пациента с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе; и (b) введение пациенту фиксированной дозы активного средства, если у пациента уровень белка FOLR1 повышен по сравнению с эталонным уровнем белка FOLR1.

[0043] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для применения в способе лечения заболевания или расстройства, опосредованного FOLR1, включающем: (а) введение пациенту, имеющему заболевание или расстройство, опосредованное FOLR1, фиксированной дозы активного средства; (b) измерение уровня белка FOLR1 у пациента с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе; и (с) увеличение количества или частоты последующих фиксированных доз, если уровень белка FOLR1 у пациента повышен по сравнению с эталонным уровнем белка FOLR1.

[0044] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для применения в способе лечения заболевания или расстройства, опосредованного FOLR1, при этом (а) уровень белка FOLR1, измеренный в образце полученном от пациента, сравнивают с эталонным уровнем белка FOLR1 с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе; и (b) вводят фиксированную дозу активного средства, если у пациента уровень белка FOLR1 повышен по сравнению с эталонным уровнем белка FOLR1, при этом введение активного средства снижает уровень белка FOLR1.

[0045] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1 для применения в способе лечения заболевания или расстройства, опосредованного FOLR1, при этом у пациента уменьшено количество клеток, экспрессирующих FOLR1, при этом (а) пациенту вводят фиксированную дозу активного средства; (b) уровень белка FOLR1, измеренный в образце, полученном от пациента, сравнивают с эталонным уровнем белка FOLR1 с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе; и (с) повышают количество или частоту последующих фиксированных доз, если уровень белка FOLR1 у пациента повышен по сравнению с эталонным уровнем белка FOLR1; при этом введение активного средства снижает уровень белка FOLR1.

[0046] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для использования в способе контроля терапевтической эффективности фиксированной дозы активного средства у пациента, включающем: (а) измерение первого уровня белка FOLR1 в образце, полученном от пациента, имеющего заболевание или расстройство, опосредованное FOLR1, с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе; (b) введение пациенту фиксированной дозы активного средства; (с) измерение второго уровня белка FOLR1 в образце, полученном от пациента, после введения активного средства с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе; и (d) сравнение второго уровня белка FOLR1 с первым уровнем белка FOLR1; при этом снижение уровней белка FOLR1 между первым и вторым измерениями свидетельствует о терапевтической эффективности.

[0047] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для применения в способе лечения заболевания или расстройства, опосредованного FOLR1 у пациента, включающем: (а) введение фиксированной дозы активного средства пациенту, имеющему заболевание или расстройство, опосредованное FOLR1; (b) предоставление образца, полученного от пациента, для измерения уровня белка FOLR1 с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе; (с) определение из результатов измерения повышен ли уровень белка FOLR1 у пациента по сравнению с эталонным уровнем белка FOLR1; и, (d) увеличение количества и/или частоты последующих фиксированных доз, если уровень белка FOLR1 у пациента повышен по сравнению с эталонным уровнем белка FOLR1.

[0048] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для применения в способе лечения заболевания или расстройства, опосредованного FOLR1, включающем: (а) введение фиксированной дозы активного средства пациенту, имеющему заболевание или расстройство, опосредованное FOLR1; (b) предоставление образца, полученного от пациента, для измерения уровня белка FOLR1 с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе, и сравнение измеренного уровня белка FOLR1 с эталонным уровнем белка FOLR1; и (с) увеличение количества или частоты последующих фиксированных доз, если уровень белка FOLR1 у пациента повышен по сравнению с эталонным уровнем белка FOLR1; при этом снижение уровней FOLR1 у пациента свидетельствует об эффективности лечения.

[0049] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для применения в способе лечения заболевания или расстройства, опосредованного FOLR1, включающем: (а) получение образца от пациента, имеющего заболевание или расстройство, опосредованное FOLR1, при этом пациент получил фиксированную дозу активного средства; (b) измерение уровня белка FOLR1 в образце с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе; (с) определение того, повышен ли уровень белка FOLR1 у пациента по сравнению с эталонным уровнем белка FOLR1; (d) увеличение или инструктирование лечащего врача об увеличении количества и/или частоты последующих фиксированных доз если уровень белка FOLR1 у пациента повышен по сравнению с эталонным уровнем белка FOLR1; при этом снижение уровня FOLR1 у пациента свидетельствует об эффективности лечений.

[0050] Настоящее изобретение также относится к активному средству, содержащему антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для применения в способе лечения заболевания или расстройства, опосредованного FOLR1, при этом повышенная экспрессия FOLR1 была измерена в образце, полученном от субъекта, с использованием антитела, его антиген-связывающего фрагмента или полипептида, представленного в настоящем документе перед введением активного средства.

[0051] В некоторых вариантах реализации изобретения измеренный белок FOLR1 представляет собой слущивающийся FOLR1. В некоторых вариантах реализации изобретения измеренный белок FOLR1 находится на циркулирующей опухолевой клетке.

[0052] В некоторых вариантах реализации изобретения уровень белка FOLR1 измеряется в биологической жидкости организма. В некоторых вариантах реализации изобретения биологическая жидкость организма представляет собой асцитную жидкость. В некоторых вариантах реализации изобретения биологическая жидкость организма представляет собой сыворотку, кровь или плазму. В некоторых вариантах реализации изобретения уровень белка FOLR1 измеряется в образце периферической крови.

[0053] В некоторых вариантах реализации изобретения пациент имеет рак. В некоторых вариантах реализации изобретения заболевание или расстройство, опосредованное FOLR1 представляет собой рак. В некоторых вариантах реализации изобретения указанный рак представляет собой рак с повышенным уровнем FOLR1, выбранный из группы, состоящей из: рака яичников, немелкоклеточного рака легкого, рака матки, эндометрия, поджелудочной железы, почек, легких и молочной железы. В некоторых вариантах реализации изобретения рак яичников устойчив к лечению платиной или невосприимчив к лечению платиной. В некоторых вариантах реализации изобретения рак легких представляет собой немелкоклеточный рак легких (НМКРЛ). В некоторых вариантах реализации изобретения рак представляет собой рак эндометрия.

[0054] В некоторых вариантах реализации изобретения уровень белка FOLR1 измеряют с использованием двух различных антител или их антиген-связывающих фрагментов или полипептидов, которые специфически связываются с FOLR1. В некоторых вариантах реализации изобретения антитело, его антиген-связывающий фрагмент или полипептид, используемый для детекции белка FOLR1, связан с твердой подложкой. В некоторых вариантах реализации изобретения твердая подложка представляет собой микротитрационный планшет.

[0055] В некоторых вариантах реализации изобретения антитело, его антиген-связывающий фрагмент или полипептид, используемый для детекции белка FOLR1 содержит средство детекции. В некоторых вариантах реализации изобретения средство детекции представляет собой хромогенное средство детекции, флуорогенное средство детекции, ферментное средство детекции или электрохемилюминесцентное средство детекции. В некоторых вариантах реализации изобретения средство детекции представляет собой пероксидазу хрена (ПХ).

[0056] В некоторых вариантах реализации изобретения уровни белка FOLR1 определяют с использованием твердофазного иммуноферментного анализа (ELISA). В некоторых вариантах реализации изобретения ELISA представляет собой анализ ELISA "сэндвич"-типа.

[0057] В некоторых вариантах реализации изобретения активное средство содержит антитело huMov19 к FOLR1. В некоторых вариантах реализации изобретения huMov19 конъюгирован с цитотоксическим средством. В некоторых вариантах реализации изобретения huMov19 вводят в виде конъюгата антитела и майтанзиноида, который дополнительно содержит майтанзиноид DM4 и расщепляемый линкер сульфо-SPDB (IMGN853).

[0058] Настоящее изобретение также относится к антителу, его антиген-связывающему фрагменту или полипептиду, представленному в данном описании для использования в качестве диагностического средства.

[0059] Настоящее изобретение также относится к антителу, его антиген-связывающему фрагменту или полипептиду, представленным в настоящем документе, например, антителу или его антиген-связывающему фрагменту, которые конкурентно не ингибируют связывание с FOLR1 активного средства, содержащего антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, для применения в лечении заболевания или расстройства, опосредованного FOLR1, с помощью активного средства, содержащего антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1 и/или для контроля терапевтической эффективности фиксированной дозы активного средства, содержащего антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1.

[0060] Настоящее изобретение также относится к антителу, его антиген-связывающему фрагменту или полипептиду, представленным в настоящем документе для применения в способе диагностики (i) заболевания или расстройства, опосредованного FOLR1 и/или (ii) ответа на лечение заболевания или расстройства, опосредованного FOLR1, фиксированной дозой активного средства, содержащего антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1 и/или (iii) терапевтическую эффективность лечения фиксированной дозой активного средства, содержащего антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1. В некоторых вариантах реализации изобретения антитело, его антиген-связывающий фрагмент или полипептид предназначены для использования в способе диагностики рака у пациента, страдающего от этого заболевания. В некоторых вариантах реализации изобретения рак связан с повышенными уровнями FOLR1. В некоторых вариантах реализации изобретения антитело, его антиген-связывающий фрагмент или полипептид содержат средство детекции. В некоторых вариантах реализации изобретения средство детекции представляет собой хромогенное средство детекции, флуорогенное средство детекции, ферментное средство детекции или электрохемилюминесцентное средство детекции.

[0061] Настоящее изобретения также относится к способам, в которых заболевание, опосредованное FOLR-1, представляет собой рак, при этом активное средство содержит IMGN853, и при этом уровень слущивающегося белка FOLR1 измеряют посредством анализа ELISA с использованием по меньшей мере двух антител к FOLR1, которые конкурентно не ингибируют связывание активного средства с FOLR1, при этом каждое из по меньшей мере двух антител к FOLR1 содержит аминокислотные последовательности, выбранные из группы, состоящей из: (a) SEQ ID NO: 1, 2 и 3 и SEQ ID NO: 13, 14 и 15; (b) SEQ ID NO: 4, 5 и 6 и SEQ ID NO: 16, 17 и 18; (с) SEQ ID NO: 7, 8 и 9 и SEQ ID NO: 19, 20 и 21; и (d) SEQ ID NO: 10, 11 и 12 и SEQ ID NO: 22, 23 и 24.

[0062] Настоящее изобретения также относится к способам, в которых заболевание, опосредованное FOLR-1, представляет собой рак, при этом активное средство содержит IMGN853, при этом антитело к FOLR1, которое конкурентно не ингибирует связывание активного средства с FOLR1, содержит аминокислотные последовательности (a) SEQ ID NO: 1, 2 и 3 и SEQ ID NO: 13, 14 и 15; (b) SEQ ID NO: 4, 5 и 6 и SEQ ID NO: 16, 17 и 18; (с) SEQ ID NO: 7, 8 и 9 и SEQ ID NO: 19, 20 и 21; или (d) SEQ ID NO: 10, 11 и 12 и SEQ ID NO: 22, 23 и 24; и при этом белок FOLR1 детектируют посредством цитометрии.

[0063] В некоторых вариантах реализации способов по изобретению рак представляет собой рак яичников. В некоторых вариантах реализации изобретения рак яичников устойчив к лечению платиной или невосприимчив к лечению платиной. В некоторых вариантах реализации изобретения рак представляет собой НМКРЛ. В некоторых вариантах реализации изобретения рак представляет собой рак эндометрия.

[0064] Настоящее изобретения также относится к активным средствам, при этом заболевание, опосредованное FOLR-1, представляет собой рак, при этом активное средство содержит IMGN853, и при этом уровень слущивающегося белка FOLR1 измеряют посредством анализа ELISA с использованием по меньшей мере двух антител к FOLR1, которые конкурентно не ингибируют связывание активного средства с FOLR1, при этом каждое из по меньшей мере двух антител к FOLR1 содержит аминокислотные последовательности, выбранные из группы, состоящей из: (a) SEQ ID NO: 1, 2 и 3 и SEQ ID NO: 13, 14 и 15; (b) SEQ ID NO: 4, 5 и 6 и SEQ ID NO: 16, 17 и 18; (с) SEQ ID NO: 7, 8 и 9 и SEQ ID NO: 19, 20 и 21; и (d) SEQ ID NO: 10, 11 и 12 и SEQ ID NO: 22, 23 и 24.

[0065] Настоящее изобретения также относится к активным средствам, при этом заболевание, опосредованное FOLR-1, представляет собой рак, при этом активное средство содержит IMGN853, и при этом уровень слущивающегося белка FOLR1 измеряют посредством анализа ELISA с использованием по меньшей мере двух антител к FOLR1, которые конкурентно не ингибируют связывание активного средства с FOLR1, при этом каждое из по меньшей мере двух антител к FOLR1 содержит аминокислотные последовательности, выбранные из группы, состоящей из: (a) SEQ ID NO: 1, 2 и 3 и SEQ ID NO: 13, 14 и 15; (b) SEQ ID NO: 4, 5 и 6 и SEQ ID NO: 16, 17 и 18; (с) SEQ ID NO: 7, 8 и 9 и SEQ ID NO: 19, 20 и 21; и (d) SEQ ID NO: 10, 11 и 12 и SEQ ID NO: 22, 23 и 24.

[0066] В некоторых вариантах реализации активных средств рак представляет собой рак яичников. В некоторых вариантах реализации изобретения рак яичников устойчив к лечению платиной или невосприимчив к лечению платиной. В некоторых вариантах реализации изобретения рак представляет собой НМКРЛ. В некоторых вариантах реализации изобретения рак представляет собой рак эндометрия.

[0067] Настоящее изобретение также относится к способу лечения рака, включающему введение активного средства, содержащего антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, пациенту с повышенными уровнями слущивающегося белка FOLR1 по сравнению с эталонным уровнем белка FOLR1, при этом уровни белка FOLR1 у пациента были измерены с помощью антитела, антиген-связывающего фрагмента или полипептида, представленного в настоящем документе.

[0068] Настоящее изобретение также относится к способу лечения рака включающему введение активного средства, содержащего антитело или его антиген-связывающий фрагмент, которое модулирует активность FOLR1, пациенту с повышенными уровнями белка FOLR1 в циркулирующих опухолевых клетках по сравнению с эталонным уровнем белка FOLR1, при этом уровни белка FOLR1 у пациента были измерены с помощью антитела, антиген-связывающего фрагмента или полипептида, представленного в настоящем документе. В некоторых вариантах реализации изобретения активное средство содержит IMGN853. В некоторых вариантах реализации изобретения рак представляет собой рак яичников. В некоторых вариантах реализации изобретения рак яичников устойчив к лечению платиной или невосприимчив к лечению платиной. В некоторых вариантах реализации изобретения рак представляет собой НМКРЛ. В некоторых вариантах реализации изобретения рак представляет собой рак эндометрия.

[0069] Настоящее изобретение также относится к использованию антитела, его антиген-связывающего фрагмента или полипептида, представленных в настоящем документе для измерения уровня белка FOLR1 в образце in vitro.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

[0070] Фигура 1. Схематическое представление анализа слущивающегося антигена FOLR1.

[0071] Фигура 2. (А) Схематическое представление конкурентного анализа ELISA Mov19. (В) Определение аффинности связывания muFR1-13 посредством анализа ELISA "сэндвич"-типа с использованием Mov19.

[0072] Фигура 3. (А) Схематическое представление прямого связывания конкурентного анализа ELISA для определения не конкурирующих эпитопов, связывающих FOLR1. (В) Логарифмически преобразованный график результатов конкурентного анализа ELISA для скрининга помех связывания антител к FOLR1 с Mov19.

[0073] Фигура 4. Логарифмически преобразованный график результатов конкурентного анализа ELISA для скрининга помех связывания антител к FOLR1 с muFR1-13.

[0074] Фигура 5. Аффинность связывания антител к FOLR1 посредством анализа ELISA "сэндвич"-типа.

[0075] Фигура 6. Аффинность связывания FR1-13 посредством как (А) проточной цитометрии, так и (В) анализа ELISA "сэндвич"-типа.

[0076] Фигура 7. Логарифмически преобразованный график результатов (А) связывания антитела с FOLR2 и (В) FOLR3 посредством анализа ELISA "сэндвич"-типа.

[0077] Фигура 8. Влияние предварительно связанной с FOLR1 фолиевой кислоты на детекцию слущивающегося антигена FOLR1 с использованием FR1-9 и FR1-13.

[0078] Фигура 9. Анализ образцов асцитной жидкости человека на наличие FOLR1 и наличие препятствующих анализу белков.

[0079] Фигура 10. Анализ образцов нормальной объединенной в пул плазмы человека на наличие FOLR1 и наличие препятствующих анализу белков.

[0080] Фигура 11. Определение концентрации FOLR1 в образцах плазмы пациента с раком яичников с использованием "сэндвич"-анализа ELISA FOLR1.

[0081] Фигура 12. Схематическое представление интерполяции количества FOLR1 в образце от пациента на основе 4PL сигмоидальной кривой "доза-эффект", соответствующей серийно разведенному стандарту очищенного гибридного белка FOLR1-Fc.

[0082] Фигура 13. Титрование антител к FOLR1 с использованием клеточных линий с различными уровнями экспрессии FOLR1. Для каждой линии клеток и разбавления проводили окрашивание в трех повторностях. Среднюю интенсивность флуоресценции (СИФ) измеряли для экспрессии FRA и усредняли, данные и представлены в таблице (ошибка представляет собой СОС).

[0083] Фигура 14. Гистограммы, демонстрирующие экспрессию FOLR1 в клеточных линиях с использованием оптимальных разведений антител к FOLR1.

[0084] Фигура 15. График, демонстрирующий конкуренцию между антителами к FOLR1 и IMGN853.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

[0085] Настоящее изобретение относится к новому способу детекции слущивающегося фолатного рецептора человека 1 (FOLR1) или FOLR1 в циркулирующих опухолевых клетках в образце, полученном от пациента. FOLR1 может быть детектирован с использованием антител, которые конкурентно не ингибируют связывание активного средства, включающего антитело к FOLR1 (например, активного средства, содержащего антитело huMov19) с FOLR1. Антитела, которые конкурентно не ингибируют связывание активного средства, включающего антитело к FOLR1, особенно полезны в детекции FOLR1 (например, слущивающегося FOLR1 или FOLR1 в циркулирующих опухолевых клетках) в образцах, полученных от пациентов, которые были пролечены активным средством анти-FOLR1. Слущивающийся FOLR1 или FOLR1 в циркулирующих опухолевых клетках может быть использован для контроля или определения терапевтической эффективности или вероятности ответа на лечение рака, характеризующегося избыточной экспрессией FOLR1. Также раскрыты новые полипептиды, связывающие FOLR1, такие как антитела, которые используются в способах детекции слущивающегося FOLR1, а также в дополнительных способах детекции FOLR1 (например, ИГС для анализов связанного с мембраной и связанного с клетками FOLR1 и ЦОК). Также представлены родственные полипептиды и полинуклеотиды, композиции, содержащие средства, связывающие FOLR1 и способы получения средств, связывающих FOLR1. Кроме того, способы, представленные в настоящем документе, могут быть использованы для стратификации пациентов.

I. Определения

[0086] Для облегчения понимания настоящего изобретения, ряд терминов и фраз определены ниже.

[0087] Термины "фолатный рецептор человека 1", "FOLR1" или "фолатный рецептор альфа (FR-α)", используемые в настоящем документе, относятся к любому нативному FOLR1 человека, если не указано иное. Таким образом, все эти термины могут относиться либо к белку или к последовательности нуклеиновой кислоты, как указано в данном описании. Термин "FOLR1" охватывает "полноразмерный" необработанный FOLR1, а также любую форму FOLR1, которая является результатом обработки внутри клетки. Термин также охватывает встречающиеся в природе варианты FOLR1, например, варианты сплайсинга (за исключением тех вариантов, которые охватывают FOLR2, FOLR3 или FOLR4), аллельные варианты и изоформы. Полипептиды FOLR1, описанные в настоящем документе, могут быть выделены из различных источников, например, из типов тканей человека или из другого источника, или получены с помощью рекомбинантных или синтетических способов. Примеры последовательностей FOLR1 включают, но не ограничиваясь перечисленным: референтные номера доступа в Национальном центре биотехнологической информации (NCBI) Р15328, NP_001092242.1, ААХ29268.1, ААХ37119.1, NP_057937.1 и NP_057936.1. Последовательность FOLR1 человека являтся следующей:

[0088] Термины "сл ушивающийся антиген" и "слущивающийся FOLR1" используются в настоящем документе взаимозаменяемо. Эти термины относятся к белку FOLR1, который является растворимым и не связан с клетками. В некоторых вариантах реализации изобретения он включает в себя внеклеточный домен (ВКД) и гликозилфосфатидилинозитный (ГФИ) линкер. В одном варианте реализации изобретения слущивающийся FOLR1 включает только ВКД. FOLR1 включает сигнальный пептид (аминокислоты 1-24), цепь белка FOLR1 (аминокислоты 25 - 233 или 234) и пропептид, который может отщепляться (аминокислоты 235-257). Слущивающийся FOLR может включать аминокислоты 1 - 257, 1 - 233, 1 - 234, 25 - 233, 25 - 234 или их любые другие фрагменты. В некоторых вариантах реализации изобретения сигнальная последовательность отщепляется. В других вариантах реализации изобретения ВКД и часть ГФИ могут быть встроены в мембрану (например, растворимый липидный плот). В одном варианте реализации изобретения слущивающийся FOLR1 может включать аминокислоты 1-233 или их фрагмент.

[0089] Термин "антитело" используют для обозначения молекулы иммуноглобулина, которая распознает и специфически связывается с мишенью, такой как белок, полипептид, пептид, углевод, полинуклеотид, липид или комбинации вышеупомянутого посредством по меньшей мере одного участка узнавания антигена внутри вариабельной области молекулы иммуноглобулина. Используемый в настоящем описании, термин "антитело" охватывает интактные поликлональные антитела, интактные моноклональные антитела, фрагменты антител (такие как фрагменты Fab, Fab', F(ab')2 и Fv), одноцепочечные мутанты Fv (scFv), мультиспецифические антитела, такие как биспецифические антитела, химерные антитела, гуманизированные антитела, антитела человека, слитые белки, содержащие узнающую антиген часть антитела, и любую другую модифицированную молекулу иммуноглобулина, содержащую участок узнавания антигена до тех пор, пока антитела демонстрируют желаемую биологическую активность. Антитело может относиться к любому из пяти главных классов иммуноглобулинов: IgA, IgD, IgE, IgG и IgM, или их подклассов (изотипов) (например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2), на основе идентичности константных доменов их тяжелых цепей, обозначаемых как альфа, дельта, эпсилон, гамма и мю, соответственно. Различные классы иммуноглобулинов обладают различными и хорошо известными субъединичными структурами и трехмерными конфигурациями. Антитела могут являться голыми или конъюгированными с другими молекулами, такими как токсины, радиоактивные изотопы и т.д.

[0090] В некоторых вариантах реализации изобретения антитело представляет собой не встречающееся в природе антитело. В некоторых вариантах реализации антитело очищают из натуральных компонентов. В некоторых вариантах реализации изобретения антитело получено рекомбинантным способом. В некоторых вариантах реализации изобретения антитело продуцируется гибрид омой.

[0091] "Блокирующее" антитело или антитело - "антагонист" представляет собой антитело, которое ингибирует или снижает биологическую активность антигена, который оно связывает, например, FOLR1. В некоторых вариантах реализации изобретения блокирующие антитела или антитела-антагонисты в значительной степени или полностью ингибируют биологическую активность антигена. Желательно, чтобы биологическая активность снижалась на 10%, 20%, 30%, 50%, 70%, 80%, 90%, 95% или даже 100%.

[0092] Термин "антитело к FOLR1" или "антитело, которое связывается с FOLR1" относится к антителу, которое способно связываться с FOLR1 с достаточной аффинностью, так что это антитело является полезным в качестве диагностического и/или терапевтического средства для таргетинга FOLR1. Степень связывания антитела к FOLR1 с неродственным, не являющимся FOLR1 белком, составляет менее чем около 10% от связывания антитела с FOLR1, как измерено, например, с помощью радиоиммуноанализа (РИА). В некоторых вариантах реализации изобретения антитело, которое связывается с FOLR1, имеет константу диссоциации (Kd)≤1 мкМ, ≤100 нМ, ≤10 нМ, ≤1 нМ или ≤0,1 нМ. В одном варианте реализации изобретения антитело к FOLR1 не связывается с FOLR2, FOLR3, FOLR4 или фолиевой кислотой.

[0093] Термин "фрагмент антитела" относится к части интактного антитела и относится к узнающим антиген вариабельным областям интактного антитела. Примеры фрагментов антител включают, но не ограничиваясь перечисленным, фрагменты Fab, Fab', F(ab')2 и Fv, линейные антитела, одноцепочечные антитела и мультиспецифические антитела, сформированные из фрагментов антител. Термин "моноклональное антитело" по данному описанию относится к антителу, полученному от популяции практически гомогенных антител, т.е. индивидуальные антитела, составляющие популяцию являются идентичными, за исключением возможных мутаций, например, встречающихся в природе мутаций, которые могут присутствовать в минорных количествах. Таким образом, модификатор "моноклональное" показывает характер антитела, не являющегося смесью отдельных антител. В отдельных вариантах реализации изобретения, такое моноклональное антитело обычно включает в себя антитело, содержащее полипептидную последовательность, которая связывает мишень, где связывающая мишень полипептидная последовательность была получена в процессе, который включает в себя селекцию одной мишень-связывающей полипептидной последовательности из множества полипептидных последовательностей. Например, процесс селекции может представлять собой селекцию уникального клона из множества клонов, такого как пул гибридомных клонов, фаговых клонов или клонов с рекомбинантной ДНК. Следует понимать, что выбранная последовательность, связывающая мишень, может быть дополнительно изменена, например, для того чтобы улучшить аффинность к мишени, гуманизировать последовательность, связывающую мишень, улучшить ее продукцию в культуре клеток, уменьшить ее иммуногенность in vivo, получить мультиспецифическое антитело и т.п., и что антитело, содержащее измененную последовательность, связывающую мишень, также представляет собой моноклональное антитело настоящего изобретения. В отличие от препаратов поликлональных антител, которые обычно включают в себя различные антитела, направленные против различных детерминант (эпитопов), каждое моноклональное антитело из препарата моноклональных антител представляет собой направленное против одной детерминанты антигена. В дополнение к их специфичности, препараты моноклональных антител являются предпочтительными благодаря тому, что они обычно не содержат примесей других иммуноглобулинов.

[0094] Модификатор "моноклональное" указывает на характер антитела как полученного из практически гомогенной популяции антител, и его не следует истолковывать как требование получать антитело каким-либо конкретным способом. Например, моноклональные антитела для применения по настоящему изобретению можно получать различными способами, включая, например гибридомный способ (например, Kohler and Milstein, Nature, 256: 495-97 (1975); Hongo et al., Hybridoma, 14 (3): 253-260 (1995), Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2-е изд. 1988); Hammerling et al., в: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981)), способы рекомбинантной ДНК (см., например, патент США №4816567), способы фагового дисплея (см., например, публикации Clackson et al., Nature, 352: 624-628 (1991); Marks et al., J. Mol. Biol. 222: 581-597 (1992); Sidhu et al., J. Mol. Biol. 338(2): 299-310 (2004); Lee et al., J. Mol. Biol. 340(5): 1073-1093 (2004); Fellouse, Proc. Natl. Acad. Sci. USA 101(34): 12467-12472 (2004); и Lee et al., J. Immunol. Methods 284(1-2): 119-132(2004), и технологии получения человеческих или подобных человеческим антител у животных, которые содержат части или все локусы или гены иммуноглобулина человека, кодирующие последовательности иммуноглобулина человека (см., например, WO 1998/24893; WO 1996/34096; WO 1996/33735; WO 1991/10741; Jakobovits et al., Proc. Natl. Acad. Sci. USA 90: 2551 (1993); Jakobovits et al., Nature 362: 255-258 (1993); Bruggemann et al., Year in Immunol. 7:33 (1993); патенты США под номерами 5545807; 5545806; 5569825; 5625126; 5633425 и 5661016; Marks et al., Bio/Technology 10: 779-783 (1992); Lonberg et al., Nature 368: 856-859 (1994); Morrison, Nature 368: 812-813 (1994); Fishwild et al., Nature Biotechnol. 14: 845-851 (1996); Neuberger, Nature Biotechnol. 14: 826 (1996); и Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995).

[0095] Термин "гуманизированное антитело" относится к формам антител от источника, не являющегося человеком (например, мыши), которые представляют собой цепи специфических иммуноглобулинов, химерные иммуноглобулины или их фрагменты, содержащие минимальные последовательности от источника, не являющегося человеком (например, мышиные). Обычно гуманизированные антитела представляют собой человеческие иммуноглобулины, в которых остатки гипервариабельного участка (CDR) заменены остатками CDR видов, не являющихся людьми (например, мышь, крыса, кролик, хомячок), имеющих желаемую специфичность, аффинность и емкость (Jones et al., 1986, Nature, 321: 522-525; Riechmann et al., 1988, Nature, 332:323-327; Verhoeyen et al., 1988, Science, 239:1534-1536). В некоторых случаях остатки Fv каркасной области (FR) иммуноглобулина человека заменены соответствующими остатками антитела из видов, не относящихся к человеку, обладающего желаемой специфичностью, аффинностью и емкостью. Гуманизированное антитело может быть дополнительно модифицировано посредством замены дополнительных остатков или в остатках Fv каркасной области и/или внутри замещенных не относящихся к человеку остатков для улучшения и оптимизации специфичности, аффинности и/или емкости антитела. Как правило, гуманизированное антитело будет содержать, по существу, все из по меньшей мере из одного и, как правило, двух, или трех вариабельных доменов, содержащих все или по существу все из участков CDR, соответствующих не относящемуся к человеку иммуноглобулину, в то время как все или в основном все области FR являются областями с консенсусной последовательностью иммуноглобулина человека. Гуманизированное антитело может также содержать по меньшей мере часть константной области или домена (Fc), как правило, из иммуноглобулина человека. Примеры способов, применяемых для получения гуманизированных антител, описаны в патентах США №5225539 или 5639641. "Изменение поверхности" антител включает в себя идентификацию поверхностных остатков вариабельного участий каркасной области как в легких, так и в тяжелых цепях и замену их человеческими эквивалентами. Способы изменения поверхности антител представлены, например, в публикациях Roguska et al., Proc. Natl. Acad. Sci., USA, 91(3): 969-973 (1994) и Roguska et al., Protein Eng. 9(10): 895-904 (1996), которые включены в настоящее описание посредством ссылки во всей своей полноте.

[0096] "Вариабельная область" антитела относится к вариабельной области легкой цепи антитела или вариабельной области тяжелой цепи антитела, самим по себе или в комбинации. Каждая вариабельная область тяжелой и легкой цепи состоит из четырех каркасных областей (FR), соединенных тремя областями, определяющими комплементарность (CDR), также известными как гипервариабельные участки. В каждой цепи FR удерживают CDR вместе в непосредственной близости, и они вместе с CDR из другой цепи вовлечены в образование антиген-связывающего сайта антител. Существует по меньшей мере две методики определения CDR: (1) подход, основанный на межвидовой вариабельности последовательности (т.е. Kabat et al. Sequences of Proteins of Immunological Interest, (5-е изд., 1991, National Institutes of Health, Bethesda Md.)); и (2) подход, основанный на кристаллографических исследованиях комплексов антиген-антитело (Al-lazikani et al. (1997) J. Molec. Biol. 273:927-948)). Кроме того, для определения CDR в данной области техники иногда используются комбинации этих двух подходов.

[0097] Система нумерации Kabat обычно применяется по отношению к остатку в вариабельном домене (примерно, остатки 1-107 легкой цепи и остатки 1-113 тяжелой цепи) (например, Kabat et al., Sequences of Immunological Interest. 5-е изд. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)).

[0098] Выражение "нумерация положений аминокислот по Kabat" относится к системе нумерации, используемой для вариабельных доменов тяжелой цепи или вариабельных доменов легкой цепи при составлении антител в Kabat et al., Sequences of Proteins of Immunological Interest, 5-е изд. Public Health Service, National Institutes of Health, Bethesda, Md. (1991). При использовании этой системы нумерации действительная линейная аминокислотная последовательность может содержать меньшее или дополнительное число аминокислот, соответствующее укорочению или инсерции в FR или CDR вариабельного домена. Например, вариабельный домен тяжелой цепи может включать инсерцию единственной аминокислоты (остаток 52а по Kabat) после остатка 52 участка Н2 и инсерции остатков (например, 82а, 82b и 82с и т.д. по Kabat) после остатка 82 FR тяжелой цепи. Нумерацию остатков по Kabat можно определить для данного антитела посредством выравнивания в областях гомологии последовательности антитела с последовательностью со "стандартной" нумерацией по Kabat. Напротив, Chothia обращает внимание на локализацию структурных петель (Chothia and Lesk J. Mol. Biol. 196: 901-917 (1987)). Конец петли CDR-H1 по Chothia, при нумерации в соответствии с нумерацией Kabat, варьируется между положениями Н32 и Н34 в зависимости от длины петли (это происходит потому, что в соответствии со схемой нумерации по Kabat инсерции находятся в положениях Н35А и Н35В; при этом, если не присутствует ни 35А, ни 35В, то петля заканчивается в положении 32; если присутствует только 35А, то петля заканчивается в положении 33; а если присутствуют 35А и 35В, то петля заканчивается в положении 34). Гипервариабельные участки AbM представляют компромисс между CDR по Kabat и структурными петлями по Chothia, и используются в программном обеспечении по моделированию антител Oxford Molecular's AbM.

[0099] Термин "антитело человека" означает антитело, продуцируемое человеком, или антитело, обладающее аминокислотной последовательностью, соответствующей антителу, продуцируемому человеком, полученное с использованием любого способа, известного в данной области техники. Это определение антитела человека охватывает интактные или полноразмерные антитела, их фрагменты, и/или антитела, содержащие по меньшей мере один полипептид тяжелой и/или легкой цепи человека, например, антитело, содержащее полипептиды легкой цепи мыши и тяжелой цепи человека.

[00100] Термин "химерные антитела" относится к антителам, в которых аминокислотная последовательность молекулы иммуноглобулина получена из двух или более видов. Как правило, вариабельная область как легкой, так и тяжелой цепей соответствует вариабельной области антител, полученных из одного вида млекопитающих (например, мышь, крыса, кролик и т.д.), с желаемой специфичностью, аффинностью и емкостью, в то время как константные области являются гомологичными последовательностям антител, полученных из другого вида (обычно человек), чтобы избежать вызывания иммунного ответа у этих видов.

[00101] Термины "эпитоп" или "антигенная детерминанта" используют в настоящем документе взаимозаменяемо, и они обозначают ту часть антигена, которую может узнавать и специфически связывать конкретное антитело. Когда антиген представляет собой полипептид, эпитопы могут быть сформированы как из соседних аминокислот, так и не из соседних аминокислот, располагаемых рядом посредством третичной укладки белка. Эпитопы, сформированные из соседних аминокислот, как правило, сохраняются при денатурации белка, в то время как эпитопы, сформированные посредством третичной укладки, как правило, теряются при денатурации белка. Эпитоп, как правило, содержит по меньшей мере 3 и более обычно по меньшей мере 5 или 8-10 аминокислот в уникальной пространственной конформации.

[00102] "Аффинность связывания", как правило, относится к силе совокупности нековалентных взаимодействий между одним участком связывания молекулы (например, антитела) и ее партнером по связыванию (например, антигеном). Если не указано иное, как использовано в данном документе, "аффинность связывания" относится к истинной связывающей аффинности, которая отражает 1:1 взаимодействие между членами пары связывания (например, антителом и антигеном). Аффинность молекулы X для ее партнера Y, как правило, может быть представлена константой диссоциации (Kd). Аффинность может быть измерена обычными способами, известными в данной области техники, включая описанные в данном документе. Антитела с низкой аффинностью, как правило, связывают антиген медленно и склонны легко диссоциировать, тогда как антитела с высокой аффинностью, как правило, более быстро связывают антиген и склонны дольше оставаться связанными. Различные способы измерения аффинности связывания известны в данной области техники, любой из которых можно использовать для целей настоящего изобретения. Конкретные наглядные варианты осуществления описаны ниже.

[00103] Выражение "или лучше" при использовании в данном документе для обозначения аффинности связывания относится к более сильному связыванию между молекулой и ее партнером по связыванию. Выражение "или лучше" при использовании в данном документе относится к более сильному связыванию, представленному меньшим числовым значением Kd. Например, антитело, которое обладает аффинностью к антигену "0,6 нМ или лучше" означает аффинность антитела к антигену <0,6 нМ, т.е. 0,59 нМ, 0,58 нМ, 0,57 нМ и т.д. или любое значение меньше чем 0,6 нМ. В одном варианте реализации изобретения аффинность антитела, определенная посредством Kd будет находиться в диапазоне от около 10-3 до около 10-12 М, в диапазоне от около 10-6 до около 10-11 М, в диапазоне от около 10-6 до около 10-10 М, в диапазоне от около 10-6 до около 10-9 М, в диапазоне от около 10-6 до около 10-8 M или в диапазоне от около 10-6 до около 10-7 М.

[00104] Фраза "по существу сходный" или "по существу одинаковый", используемая в настоящем документе, обозначает достаточно высокую степень сходства между двумя числовыми величинами (обычно одна связана с антителом по изобретению, а другая связана с эталонным антителом/антителом для сравнения) так, что специалист в данной области техники может считать, что различие между двумя величинами является незначительным, или отсутствует биологическая и/или статистическая значимость в контексте биологических характеристик, измеренных при помощи указанных величин (например, величин Kd). Различие между указанными двумя величинами составляет менее чем около 50%, менее чем около 40%, менее чем около 30%, менее чем около 20% и/или менее чем около 10% в виде функции от величины для эталонного/сравнительного антитела.

[00105] Полипептид, антитело, полинуклеотид, вектор, клетка или композиция, которые являются "выделенными" представляют собой полипептид, антитело, полинуклеотид, вектор, клетку, или композицию, которые находятся в форме, не встречающейся в природе. Выделенные полипептиды, антитела, полинуклеотиды, векторы, клетки или композиции включают те, которые были очищены до такой степени, что они больше не находятся в форме, в которой они встречаются в природе. В некоторых вариантах реализации изобретения антитело, полинуклеотид, вектор, клетка или композиция которые изолированы являются по существу чистыми.

[00106] Как используется в настоящем документе, "по существу чистый" относится к материалу, который является по меньшей мере на 50% чистым (т.е., свободным от загрязняющих веществ), по меньшей мере, на 90% чистым, по меньшей мере на 95% чистым, по меньшей мере на 98% чистым или по меньшей мере на 99% чистым.

[00107] Термин "повышенная экспрессия" FOLR1 относится к образцу, который содержит повышенные уровни экспрессии FOLR1 по сравнению с эталонным образцом, эталонным уровнем FOLR1, или предыдущим уровнем FOLR1, обнаруженным у того же субъекта. Так, например, "повышенные уровни белка FOLR1" в образце от пациента могут быть уровнями белка FOLR1, которые выше, чем уровни белка FOLR1 в нераковом эталонном образце "Повышенные уровни белка FOLR1" в образце от пациента могут также быть уровнями белка FOLR1, которые равны уровням белка FOLR1 в раковом образце В некоторых вариантах реализации изобретения "повышенные уровни белка FOLR1" детектируют тогда, когда уровень белка FOLR1 у пациента по меньшей мере на около 5%, по меньшей мере на около 10%, по меньшей мере на около 15%, по меньшей мере на около 20% или по меньшей мере на около 25%, по меньшей мере на около 30% или по меньшей мере на около 50% больше чем, например, предыдущий уровень FOLR1, детектированный у того же субъекта. В анализе циркулирующих опухолевых клеток "повышенные уровни белка FOLR1" могут относиться к образцам, в которых FOLR1 детектируется в более высоком проценте клеток или к образцам, в которых детектируются более высокие уровни FOLR1 на клетках. Таким образом, в некоторых вариантах реализации изобретения "повышенные уровни белка FOLR1" детектируются в анализах ЦОК, в которых по меньшей мере на около 5%, по меньшей мере на около 10%, по меньшей мере на около 15%, по меньшей мере на около 20% или по меньшей мере на около 25%, по меньшей мере на около 30% или по меньшей мере около на 50% больше клеток демонстрируют экспрессию FOLR1. Кроме того, в некоторых вариантах реализации изобретения "повышенные уровни белка FOLR1" детектируются в анализах ЦОК, в которых по меньшей мере на около 5%, по меньшей мере на около 10%), по меньшей мере на около 15%, по меньшей мере на около 20% или по меньшей мере на около 25%, по меньшей мере на около 30% или по меньшей мере около на 50%) больше FOLR1 детектируют на клетках.

[00108] "Эталонный образец" может быть использован для корреляции и сравнения результатов, полученных в способах по настоящему изобретению из тестируемого образца. Эталонные образцы могут представлять собой клетки (например, клеточные линии, клеточные осадки), биологические жидкости организма или ткани. Уровни FOLR1 в "эталонном образце" могут представлять собой абсолютное или относительное количество, диапазон количества, минимальное и/или максимальное количество, среднее количество и/или медианное количество FOLR1. "Эталонный образец" также может служить в качестве исходного уровня экспрессии FOLR1 с которым сравнивают тестируемый образец. "Эталонный образец" может включать в себя предыдущий образец или исходный образец от того же пациента, эталон нормального уровня или эталон из релевантной популяции пациентов. Как правило, уровни FOLR1 экспрессируются в виде значений на стандартной кривой. Стандартная кривая является количественным способом построения графика данных анализа для определения концентрации FOLR1 в образце. В одном варианте реализации изобретения эталонный образец является антигенным стандартом, который содержит очищенный FOLR1 или FOLR1-Fc. Диагностические способы по настоящему изобретению включают сравнение между уровнями экспрессии FOLR1 в тестируемом образце с "эталонным значением" или "эталонным уровнем". В некоторых вариантах реализации изобретения эталонное значение представляет собой уровень экспрессии FOLR1 в эталонном образце. Эталонное значение может представлять собой предварительно определенное значение, а также может быть определено из эталонных образцов (например, контрольных биологических образцов), протестированных параллельно с исследуемыми образцами. Эталонное значение может быть одним пороговым значением, таким как медиана или среднее или диапазон значений, например доверительный интервал. Эталонные значения могут быть установлены для различных подгрупп индивидуумов, таких, как индивидуумы, предрасположенные к раковому заболеванию, индивидуумы, имеющие раннюю или позднюю стадию ракового заболевания, индивидуумы мужского и/или женского пола или индивидуумы, подвергающиеся терапии рака. Примеры нормальных эталонных образцов или значений и положительных эталонных образцов или значений описаны в настоящем документе.

[00109] Термин "первичное антитело" в данном описании относится к антителу, которое специфически связывается с антигеном белка-мишени в образце. Первичное антитело, как правило, представляет собой первое антитело, используемое в анализе ELISA. В одном варианте реализации изобретения первичное антитело является единственным антителом, используемым в процедуре ИГС. Термин "вторичное антитело" в данном описании относится к антителу, которое специфически связывается с первичным антителом, образуя тем самым мост между первичным антителом и последующим реагентом, если таковой имеется. Вторичное антитело, как правило, представляет собой второе антитело, которое используют в иммуногистохимической процедуре.

[00110] Как используется в данном описании, "иммуногистохимия" относится к гистохимическому и иммунологическому способам, используемым для анализа, например, клеток или тканей. Таким образом, термины "иммуногистохимия" "иммуноцитохимия" и "иммунохимия" используются взаимозаменяемо.

[00111] "Образец" или "биологический образец" по настоящему изобретению имеет биологическое происхождение, в конкретных вариантах реализации изобретения, например, из эукариотических организмов. В предпочтительных вариантах реализации изобретения образец представляет собой образец, полученный от человека, но образцы от животных также могут быть использованы в практике настоящего изобретения. Неограничивающие источники образца для использования в настоящем изобретении включают твердые ткани, аспираты биопсии, асцитные жидкости, жидкостные экстракты, кровь, плазму, сыворотку, спинномозговую жидкость, лимфатическую жидкость, наружные срезы кожи, дыхательного, кишечного и мочеполового трактов, слезы, слюну, молоко, опухоли, органы, клеточные культуры и/или компоненты клеточной культуры, например. Настоящее изобретение особенно пригодно для образцов рака, которые обычно содержат жидкости организма, такие как асцитная, где количество доступного материала является небольшим. Способ может быть использован для исследования аспекта экспрессии FOLR1 или состояния образца, в том числе, но не ограничиваясь этим, для сравнения разных типов клеток или тканей, сравнения разных стадий развития и детекции или определения наличия и/или типа заболевания или патологии.

[00112] Термин "реагент захвата" обозначает реагент, способный к связыванию и захвату молекулы-мишени в образце, так чтобы при подходящих условиях комплекс в виде реагента захвата и молекулы-мишени мог отделяться от остальной части образца. В одном варианте реализации изобретения реагент захвата является иммобилизованным. В одном варианте реализации изобретения в иммуноанализе "сэндвич"-типа реагент захвата представляет собой антитело или смесь различных антител против антигена-мишени.

[00113] Термин "детектируемое антитело" обозначает антитело, которое может быть детектировано либо непосредственно с помощью метки, амплифицированной с помощью средств детекции, или косвенно - с помощью, например, другого меченого антитела. Для прямого мечения антитело обычно конъюгируется с фрагментом, который детектируется с помощью некоторых средств. В одном варианте реализации изобретения детектируемое антитело представляет собой биотинилированное антитело.

[00114] Используемое в дан5ном описании слово "метка" обозначает детектируемое соединение или композицию, которые могут быть конъюгированы непосредственно или косвенно с антителом, чтобы получать "меченое" антитело. Метка может быть детектирована сама по себе (например, радиоизотопные метки или флуоресцентные метки) или, в случае ферментной метки, может катализировать химическое изменение соединения или композиции субстрата, которые могут быть детектированы.

[00115] Используемый в данном описании термин "средство детекции" обозначает фрагмент или способ, используемый для детекции присутствия детектируемого антитела в настоящем анализе ELISA, и включает средства детекции, которые амплифицируют иммобилизованную метку, такую как метка, захваченная на титрационном микропланшете. В одном варианте реализации изобретения средство детекции представляет собой средство флуориметрической детекции, такое как авидин или стрептавидин.

[00116] Обычно в анализе "сэндвич-ELISA" используют следующие стадии: (1) микротитрационный планшет покрывают антителом захвата; (2) добавляют образец и любой присутствующий антиген связывается с антителом захвата; (3) добавляют детектирующее антитело и оно связывается с антигеном; (4) добавляют фермент-связанное вторичное антитело и оно связывается с детектирующим антителом; и (5) добавляют субстрат и он преобразуется посредством фермента в детектируемую форму.

[00117] Под термином "коррелировать" или "корреляция" подразумевается сравнение, любым образом, производительности и/или результатов первого анализа с производительностью и/или результатами второго анализа. Например, можно использовать результаты первого анализа при проведении второго анализа, и/или можно использовать результаты первого анализа, чтобы определить, следует ли выполнять второй анализ, и/или можно сравнить результаты первого анализа с результатами второго анализа. В одном варианте реализации изобретения повышенная экспрессия FOLR1 коррелирует с повышенной вероятностью эффективности нацеленной на FOLR1 противораковой терапии.

[00118] Термины "рак" и "раковый" относятся к физиологическому состоянию или описывают физиологическое состояние у млекопитающих, у которых популяция клеток характеризуется неконтролируемым ростом клеток. Примеры рака включают, но не ограничиваются перечисленным, карциному, лимфому, бластому, саркому и лейкемию. Более конкретные примеры таких типов рака включают в себя типы рака эндотелиального, мезенхимального или эпителиального происхождения, такие как рак легких (например, плоскоклеточный рак, мелкоклеточный рак легкого, немелкоклеточный рак легкого, аденокарцинома легкого, мезотелиома и плоскоклеточная карцинома легкого), рак брюшины (например, первичный перитонеальный), гепатоцеллюлярный рак, рак желудочно-кишечного тракта, рак поджелудочной железы, глиобластома, рак шейки матки, рак яичника, рак печени, рак мочевого пузыря, гепатома, рак молочной железы, рак толстого кишечника, колоректальный рак, карцинома эндометрия (например аденокарцинома эндометрия) или матки, карцинома слюнной железы, рак почек, рак печени, рак предстательной железы, рак вульвы, рак щитовидной железы, карцинома печени, рак головного мозга (например, глиобластома, опухоли сосудистого сплетения) и различные типы рака головы и шеи, а также опухоли кровеносных сосудов и маточных труб. Типы рака также охватывают типы рака, которые содержат клетки, имеющие повышенные уровни экспрессии FOLR1. Такие типы рака с повышенными уровнями FOLR1 включают, но не ограничиваясь перечисленным, рак яичников, немелкоклеточный рак легкого, рак матки, эндометрия, поджелудочной железы, почек, легких и молочной железы.

[00119] Термины "опухоль" и "неоплазия" относятся к любой массе ткани, образованной в результате избыточного роста или пролиферации клеток, либо доброкачественной (не раковой), либо злокачественной (раковой), включая предраковые очаги.

[00120] Термины "раковая клетка", "опухолевая клетка" и грамматические эквиваленты относятся к общей популяции клеток, полученных из опухоли или предракового очага, включая как не вызывающие образование опухоли клетки, составляющие большинство популяции опухолевых клеток, так и вызывающие образование опухоли стволовые клетки (раковые стволовые клетки) Как используется в настоящем документе, термин "опухолевая клетка" будет модифицирован термином "не вызывающая образование опухоли", когда речь идет только о тех опухолевых клетках, у которых отсутствует потенциал для обновления и дифференцировки, чтобы отличать эти опухолевые клетки от раковых стволовых клеток.

[00121] Термин "субъект" относится к любому животному (например, млекопитающему), включая, но не ограничиваясь перечисленным, человека, не являющихся людьми приматов, грызунов и т.п., которое предназначено быть реципиентом конкретного лечения. Как правило, термины "субъект" и "пациент" используют в данном описании взаимозаменяемо по отношению к субъекту-человеку.

[00122] Термин "фармацевтический состав" относится к препарату, находящемуся в такой форме, которая способствует эффективной биологической активности активного ингредиента и которая не содержит дополнительных компонентов с неприемлемой токсичностью по отношению к субъекту, которому этот состав должен вводиться. Такие составы могут быть стерильными.

[00123] "Эффективное количество" антитела, раскрытого в настоящем документе представляет собой количество которое является достаточным, чтобы привести к достижению конкретно обозначенной цели. "Эффективное количество" может быть определено эмпирически и обычным образом относительно обозначенной цели.

[00124] Термин "терапевтически эффективное количество" или "фиксированная доза" относится к количеству антитела или другого лекарственного средства, эффективного для "лечения" заболевания или расстройства у субъекта или млекопитающего. В случае рака терапевтически эффективное количество лекарственного средства может уменьшать число раковых клеток; уменьшать размер опухоли; ингибировать (т.е. до некоторой степени замедлять и в некоторых вариантах реализации изобретения останавливать) инфильтрацию раковых клеток в периферические органы; ингибировать (т.е. до некоторой степени замедлять и в некоторых вариантах реализации изобретения останавливать) метастазирование опухоли; ингибировать до некоторой степени рост опухоли; облегчать до некоторой степени один или более симптомов, связанных с раком; и/или привести к благоприятному ответу, такому как, например увеличение выживаемости без прогрессирования (ВБП), безрецидивной выживаемости (БРВ), или общей выживаемости (ОВ), полный ответ (ПО), частичный ответ (ЧО), или, в некоторых случаях, стабилизация заболевания (СЗ), уменьшение прогрессирования заболевания (ПЗ), сокращение времени до прогрессирования (ВПО), уменьшение CA125 в случае рака яичников, или любую их комбинацию. См определение "лечения" в настоящем документе. В тех случаях, когда лекарственное средство предупреждает рост существующих раковых клеток и/или убивает их, оно может быть цито статическим и/или цитотоксическим. "Профилактически эффективное количество" относится к количеству, эффективному, в дозировках и в течение необходимых периодов времени, для достижения желаемого профилактического результата. Обычно, но не обязательно, так как профилактическая доза используется у субъектов перед или на ранней стадии заболевания, профилактически эффективное количество будет меньшим, чем терапевтически эффективное количество.

[00125] ВБП, БРВ и ОВ могут быть измерены по стандартам, установленным Национальным институтом рака и Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов для утверждения новых лекарственных средств. См. публикацию Johnson et al., (2003) J. Clin. Oncol. 21(7): 1404-1411.

[00126] "Выживаемость без прогрессирования" (ВБП) относится ко времени от регистрации до прогрессирования заболевания или смерти. ВБП обычно измеряется с помощью способа Каплана-Мейера и стандартов 1.1 Критериев оценки ответа солидных опухолей (RECIST). Как правило, выживаемость без прогрессирования относится к ситуации, в которой пациент остается живым, без ухудшения ракового заболевания.

[00127] "Время до прогрессирования опухоли" (ВПО) определяется как время от регистрации до прогрессирования заболевания. ВПО обычно измеряется с помощью критерия 1.1 RECIST.

[00128] "Полный ответ" или "полная ремиссия" или "ПО" указывает на исчезновение всех признаков опухоли или рака в ответ на лечение. Это не всегда означает, что рак был вылечен.

[00129] "Частичный ответ" или "ЧО" относится к уменьшению размера или объема одной или нескольких опухолей или поражений, или степени рака в организме в ответ на лечение.

[00130] "Стабильное заболевание" относится к заболеванию без прогрессирования или рецидива. При стабильном заболевании нет ни достаточного уменьшения размеров опухоли, чтобы квалифицировать это как частичный ответ, ни достаточного увеличения опухоли, чтобы квалифицировать это как прогрессирование заболевания.

[00131] "Прогрессирование заболевания" относится к появлению одного и более новых поражений или опухолей и/или явной прогрессии существующих нецелевых поражений. Прогрессирование заболевания может также относиться к росту опухоли более чем на 20 процентов по сравнению с периодом начала лечения, либо из-за увеличения массы или распространения опухоли.

[00132] "Безрецидивная выживаемость" (БРВ) относится к продолжительности времени во время и после лечения, когда у пациента отсутствует заболевание.

[00133] "Общая выживаемость" (ОВ) относится ко времени от регистрации пациента до смерти или цензурированию на последнюю известную дату жизни. ОВ включает в себя продление продолжительности жизни по сравнению с наивными или непролеченными индивидуумами или пациентами. Общая выживаемость относится к ситуации, в которой пациент остается живым в течение определенного периода времени, например в течение одного года, пяти лет и т.п., например, с момента установления диагноза или проведения лечения.

[00134] "Снижение уровней СА125" может быть оценено в соответствии с руководствами Международной интергруппы гинекологического рака (GCIG). Например, уровни CA125 могут быть измерены до начала лечения для установления исходного уровня CA125. Уровни CA125 могут быть измерены один или более раз во время или после лечения и снижение уровней CA125 с течением времени по сравнению с исходным уровнем считается снижением уровней CA125.

[00135] Такие термины, как "лечение" или "обработка", или "лечить", или "облегчение", или "облегчать" относятся как к 1) терапевтическим мерам, которые излечивают, замедляют, уменьшают симптомы и/или останавливают прогрессирование диагностированного патологического состояния или нарушения, так и к 2) профилактическим или предупреждающим мерам, которые предупреждают и/или замедляют развитие целевого патологического состояния или расстройства. Таким образом, те, кто нуждается в лечении, включают в себя тех, кто уже имеет расстройство, тех, кто предрасположен к приобретению расстройства, и тех, кто подлежит предупреждению расстройства. В некоторых вариантах реализации изобретения субъекта успешно "лечат" согласно способам по настоящему изобретению, если пациент демонстрирует одно или более из следующего: уменьшение кахексии, увеличение времени выживаемости, продление времени до прогрессирования опухоли, уменьшение массы опухоли, уменьшение опухолевой нагрузки и/или продление времени до метастазирования опухоли, время до рецидива опухоли, опухолевый ответ, полный ответ, частичный ответ, стабилизация заболевания, прогрессирование заболевания, выживаемость без прогрессирования (ВБП), общая выживаемость (ОВ), каждый показатель измеряется в соответствии стандартами, установленными Национальным институтом рака и Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов для утверждения новых лекарственных средств. См. публикацию Johnson et al., (2003) J. Clin. Oncol. 21 (7): 1404-1411.

[00136] Термины "полинуклеотид" или "нуклеиновая кислота", используемые в настоящем документе взаимозаменяемо, относятся к полимерам любой длины состоящим из нуклеотидов, и включают ДНК или РНК. Нуклеотиды могут представлять собой дезоксирибонуклеотиды, рибонуклеотиды, модифицированные нуклеотиды или основания, и/или их аналоги, или любой субстрат, который можно включить в полимер с помощью ДНК- или РНК-полимеразы. Полинуклеотид может содержать модифицированные нуклеотиды, такие как метилированные нуклеотиды и их аналоги. В случае ее присутствия модификацию нуклеотидной структуры можно осуществлять до или после сборки полимера. Последовательность нуклеотидов может прерываться ненуклеотидными компонентами. Полинуклеотид может быть дополнительно модифицирован после полимеризации, например, конъюгирован с метящим компонентом. Другие типы модификации включают, например, "кэпы", замену одного или более встречающихся в природе нуклеотидов на аналог, межнуклеотидные модификации, например, такие как модификации за счет не имеющих заряда связей (например, метилфосфонаты, фосфотриэфиры, фосфоамидаты, карбаматы и т.д.) и за счет имеющих заряд связей (например, фосфоротиоаты, фосфородитиоаты и т.д.), модификации, содержащие выступающие группы, например, такие как белки (например, нуклеазы, токсины, антитела, сигнальные пептиды, ply-L-лизин и т.д.), модификации с интеркалирующими веществами (например, акридин, псорален и т.д.), модификации, содержащие хелатирующие вещества (например, металлы, радиоактивные металлы, бор, окислительные металлы и т.д.), модификации, содержащие алкилирующие вещества, модификации с модифицированными связями (например, альфа аномерные нуклеиновые кислоты и т.д.), а также немодифицированные формы полинуклеотида(-ов). Кроме того, любая из гидроксильных групп, обычно имеющаяся в сахарах, может быть замещена, например, фосфонатными группами, фосфатными группами, защищена стандартными защитными группами или активирована с целью образования дополнительных связей с другими нуклеотидами, или может быть конъюгирована с твердыми подложками. 5' и 3' концевые группы ОН могут быть фосфорилированными или могут быть заменены аминами или фрагментами органических кэппирующих групп, содержащими от 1 до 20 углеродных атомов. Другие гидроксилы также могут быть дериватизированы в стандартные защитные группы. Полинуклеотиды могут также содержать формы аналогов сахаров рибозы или дезоксирибозы, которые обычно известны в данной области техники, включая, например, 2'-O-метил-, 2'-O-аллил, 2'-фтор- или 2'-азидорибозу, карбоциклические аналоги сахаров, альфа-аномерные сахара, эпимерные сахара, такие как арабиноза, ксилозы или ликсозы, пиранозные сахара, фуранозные сахара, седогептулозы, ациклические аналоги и абазические нуклеозидные аналоги, такие как метилрибозид. Одну или более фосфодиэфирных связей можно заместить альтернативными связывающими группами. Эти альтернативные связывающие группы включают, но не ограничиваются перечисленным, варианты реализации изобретения, в которых фосфатная группа заменена на P(O)S ("тиоат"), P(S)S ("дитиоат"), (O)NR2 ("амидат"), P(O)R, P(O)OR', СО или СН2 ("формацеталь"), где каждый R или R', независимо представляет собой H или замещенный или незамещенный алкил (1-20 С), необязательно содержащий эфирную (--О--) связь, арил, алкенил, циклоалкил, циклоалкенил или аралдил. Необязательно все связи в полинуклеотиде должны быть идентичными. Приведенное выше описание применимо ко всем полинуклеотидам по данному описанию, включая РНК и ДНК

[00137] Термин "вектор" означает конструкцию, позволяющую доставлять и экспрессировать один или более ген(-ов) или последовательность(-ей), представляющих интерес в клетку-хозяина. Примеры векторов включают, но не ограничиваясь перечисленным, вирусные векторы, векторы экспрессии из депротеинизированной ДНК или РНК, плазмидные, космидные или фаговые векторы, ДНК- или РНК-векторы экспрессии, связанные с катионными конденсирующими средствами, ДНК- или РНК-векторы экспрессии, инкапсулированные в липосомы, и определенные эукариотические клетки, такие как клетки-продуценты.

[00138] Термины "полипептид", "пептид" и "белок" используются в настоящем документе взаимозаменяемо для ссылки на полимеры аминокислот любой длины. Полимер может быть линейным или разветвленным, он может содержать модифицированные аминокислоты и он может быть прерван компонентами, не являющимися аминокислотами. Эти термины также охватывают аминокислотный полимер, который был модифицирован естественным путем или путем вмешательства; например, такого как образование дисульфидной связи, гликозилирование, липидизация, ацетилирование, фосфорилирование или любая другая манипуляция или модификация, такая как конъюгирование с метящим компонентом. Также в определение включены, например, полипептиды, содержащие один или более аналог аминокислоты (включающий, например, не встречающиеся в природе аминокислоты и т.д.), а также другие модификации, известные в данной области техники. Следует понимать, что поскольку полипептиды по данному изобретению основаны на антителах, в некоторых вариантах реализации изобретения данные полипептиды могут существовать в виде единичных цепей или связанных цепей. В некоторых вариантах реализации изобретения полипептид, пептид или белок является не встречающимся в природе. В некоторых вариантах реализации изобретения полипептид, пептид или белок является очищенным из других компонентов, которые встречаются в природе. В некоторых вариантах реализации изобретения полипептид, пептид или белок получен рекомбинантным способом.

[00139] Термины "идентичный" или процент "идентичности" в контексте двух или более нуклеиновых кислот или полипептидов означает две или более последовательности или субпоследовательности, одинаковых или содержащих указанное процентное количество одинаковых нуклеотидов или аминокислотных остатков при сравнении и выравнивании (с введением, при необходимости, пробелов) для максимального соответствия, без учета любых консервативных аминокислотных замен как части идентичности последовательности. Процент идентичности может быть определен с помощью программного обеспечения или алгоритмов для сравнения последовательностей или посредством визуального изучения. Различные алгоритмы и программное обеспечение, которые могут быть использованы. Для получения выравнивания аминокислотных или нуклеотидных последовательностей, известны в данной области техники. Одним таким неограничивающим примером алгоритма выравнивания последовательности является алгоритм, описанный в публикации Karlin et al., 1990, Proc. Natl. Acad. Set, 87: 2264-2268, модифицированный как в публикации Karlin et al., 1993, Proc. Natl. Acad. Set, 90:5873-5877 и включенный в программы NBLAST и XBLAST (Altschul et al., 1991, Nucleic Acids Res., 25: 3389-3402). В некоторых вариантах реализации изобретения может быть использована программа Gapped BLAST, описанная в публикации Altschul et al., 1997, Nucleic Acids Res. 25: 3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266: 460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) или Megalign (DNASTAR) являются дополнительными общедоступными программами, которые могут быть использованы для выравнивания последовательностей. В некоторых вариантах реализации изобретения процент идентичности между двумя нуклеотидными последовательностями можно определить с помощью программы GAP программного обеспечения GCG (например, используя матрицу NWSgapdna. CMP и значения параметра "вес пробела" 40, 50, 60, 70 или 90, и значения параметра "вес длины " 1, 2, 3, 4, 5 или 6). В некоторых альтернативных вариантах реализации изобретения программа GAP программного пакета GCG, который включает в себя алгоритм, предложенный Needleman и Wunsch (J. Mol. Biol. (48): 444-453 (1970)), может быть использована для определения процента идентичности между двумя аминокислотными последовательностями (например, используя либо матрицу Blossum 62 или матрицу РАМ250 и значения параметра "вес пробела" 16, 14, 12, 10, 8, 6 или 4 и значения параметра "вес длины" 1, 2, 3, 4, 5). В качестве альтернативы, в некоторых вариантах реализации изобретения процент идентичности между нуклеотидными или аминокислотными последовательностями определяют с помощью алгоритма, предложенного Myers и Miller (CABIOS, 4: 11-17 (1989)). Например, процент идентичности может быть определен с помощью программы ALIGN (версия 2.0) и с использованием РАМ 120 с таблицей остатков, штрафом за длину пробела 12 и штрафом за пробел 4. Соответствующие параметры для максимального выравнивания с помощью конкретного программного обеспечения для выравнивания могут быть определены специалистом в данной области техники. В некоторых вариантах реализации изобретения используются параметры программного обеспечения для выравнивания по умолчанию. В некоторых вариантах реализации изобретения процент идентичности "X" первой аминокислотной последовательности и второй аминокислотной последовательностей может быть рассчитан, как 100 × (Υ/Ζ), где Y представляет собой количество аминокислотных остатков, отмеченных как идентичные совпадения в выравнивании первой и второй последовательности (при выравнивании с помощью визуального изучения или программы выравнивания последовательностей), и Ζ представляет собой общее количество аминокислотных остатков во второй последовательности. Если длина первой последовательности больше, чем второй последовательности, процент идентичности первой последовательности второй последовательности будет больше, чем процент идентичности второй последовательности первой последовательности.

[00140] В качестве не ограничивающего примера, определить имеет ли какой-либо конкретный полинуклеотид определенный процент идентичности последовательности (например, по меньшей мере, 80% идентичности, по меньшей мере 85% идентичности, по меньшей мере 90% идентичности и в некоторых вариантах реализации изобретения по меньшей мере, 95%, 96%, 97%, 98% или 99% идентичности) эталонной последовательности можно в некоторых вариантах реализации изобретения с помощью программы Bestfit (Wisconsin Sequence Analysis Package, версия 8 для Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). В программе Bestfit использован алгоритм локальной гомологии, представленный в публикации Smith and Waterman, Advances in Applied Mathematics 2: 482 489 (1981), который предназначен для поиска лучшего гомологичного сегмента в двух последовательностях. При использовании программы Bestfit или любой другой программы для выравнивания последовательностей с целью определения того, что конкретная последовательность, например, на 95% идентична эталонной последовательности по настоящему изобретению, параметры задают с возможностью вычисления процентного значения идентичности на протяжении всей длины эталонной нуклеотидной последовательности, при этом допускаются пробелы гомологии до 5% от общего числа нуклеотидов в эталонной последовательности.

[0100] В некоторых вариантах реализации изобретения две нуклеиновые кислоты или полипептиды по настоящему изобретению являются по существу идентичными, то есть они имеют по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90% и в некоторых вариантах осуществления по меньшей мере 95%, 96%, 97%, 98%, 99% идентичности нуклеотидов или аминокислотных остатков при сравнении и выравнивании для максимального соответствия, как измерено с использованием алгоритма сравнения последовательностей или путем визуального изучения. В некоторых вариантах реализации изобретения идентичность существует на участке последовательностей, который состоит из по меньшей мере около 10, около 20, около 40-60 остатков в длину или любого целого значения между ними, или на участке более длинном, чем 60-80 остатков, по меньшей мере около 90-100 остатков, или последовательности являются по существу идентичными по всей длине сравниваемых последовательностей, как, например, в кодирующей области нуклеотидной последовательности.

[0101] "Консервативная аминокислотная замена" является такой, в которой один аминокислотный остаток замещен на другой аминокислотный остаток, имеющий сходную боковую цепь. Семейства аминокислотных остатков, имеющих сходные боковые цепи, были определены в данной области техники, включая основные боковые цепи (например, лизин, аргинин, гистидин), кислые боковые цепи (например, аспарагиновая кислота, глутаминовая кислота), незаряженные полярные боковые цепи (например, аспарагин, глутамин, серии, треонин, тирозин, цистеин), неполярные боковые цепи (например, глицин, аланин, валин, лейцин, изолецин, пролин, фенилаланин, метионин, триптофан), бета-разветвленные боковые цепи (например, треонин, валин, изолейцин) и ароматические боковые цепи (например, тирозин, фенилаланин, триптофан, гистидин). Например, замена фенилаланина тирозином является консервативной заменой. В некоторых вариантах реализации изобретения консервативные замены в последовательностях полипептидов и антител по настоящему изобретению не отменяют связывание полипептида или антитела, содержащего указанную аминокислотную последовательность, с антигеном(-ами), т.е. с FOLR1, с которым полипептид или антитело связывается. Cnocofei идентификации нуклеотидных и аминокислотных консервативных замен, которые не устраняют связывание с антигеном, хорошо известны в данной области техники (см., например, Brummell et al., Biochem. 32: 1180-1187 (1993); Kobayashi et al. Protein Eng. 12(10): 879-884 (1999); и Burks et al. Proc. Natl. Acad. Sci. USA 94:. 412-417 (1997)).

[0102] Используемые в данном описании и формуле изобретения слова в единственном числе означают также и множественное число, если в контексте четко не указывается иное.

[0103] Понятно, что там, где варианты реализации изобретения описаны в настоящем документе языком "содержащий" другие аналогичные варианты реализации изобретения, описанные терминами "состоящий из" и/или "состоящий по существу из", также представлены.

[0104] Термин "и/или", используемый в такой фразе, как "А и/или В" в данном описании предназначен для включения как "А и В", "А или В", "А" и "В". Таким же образом термин "и/или", используемый в такой фразе, как "А, В и/или С" предназначен для охвата каждого из следующих вариантов: А, В, и С; А, В, или С; А или С; А или В; В или С; А и С; А и В; В и С; А (один); В (один); и С (один).

II. Анализ слущивающегося антигена

[00141] Конъюгат антитела и майтанзиноида (АМК), IMGN853, содержит моноклональное антитело, которое связывается с FOLR1, huMov19 (М9346А), конъюгированное с майтанзиноидом, DM4 (N(2')-деацетил-N2'-(4-меркапто-4-метил-1-оксопентил)-майтанзин), прикрепленный через отщепляемый линкер сульфо-SPDB (N-сукцинимидил 4-(2-пиридилдитио)-2-сульфобутаноат). IMGN853 и huMov19 описаны в совместно рассматриваемой публикации заявки США. Т 2012/0009181, которая включена в настоящий документ посредством ссылки во всей своей полноте. Антиген FOLR1 содержит единственный эпитоп, распознаваемый Mov19. В одном варианте реализации изобретения антитело huMov19 содержит тяжелые и легкие цепи со следующими последовательностями:

[0105] В некоторых вариантах реализации изобретения активное средство анти-FOLR1, такое как IMGN853, модулирует активность FOLR1, например, снижает активность белка FOLR1.

[0106] IMGN853 в настоящее время находится в клинической разработке для различных терапевтических показаний, которые включают FOLR1-положительный рак яичников, немелкоклеточный рак легких, рак эндометрия, рак почек и другие эпителиальные злокачественные опухоли. Виды рака яичников демонстрируют наибольшую проницаемость FOLR1 и считаются основными показаниями для лечения с IMGN853 (Antony AC. Ann Rev Nutr 16: 501-21 (1996); Yuan Y et al. Hum Pathol 40(10): 1453-1460 (2009)).

[0107] Измерение уровней циркулирующего антигена в образцах плазмы пациентов (слущивающегося антигена) может помочь идентифицировать популяции пациентов, которые более вероятно ответят на лечение АМК. Было зарегистрировано, что высокие уровни слущивающегося антигена заметно влияют на фармакокинетику терапевтических антител (Tolcher A. et al. 20th Symposium on Molecular Targets and Cancer Therapeutics; 21-24 октября 2008 г.; Geneva, Switzerland: EORTC-NCI-AACR, стр 163, #514; Baselga J, et al. J Clin Oncol 14: 737-744 (1996)). Вполне вероятно, что уровни слущивающегося антигена из образцов плазмы пациентов будут меняться в зависимости от таких факторов, как антиген-мишень, признаки заболевания и течение заболевания. До настоящего времени уровни слущивающегося антигена в показаниях заболеваний для IMGN853 были изучены недостаточно, тогда как корреляция с экспрессией твердой опухоли ограничена. В то время как сообщалось о повышении FOLR1 при аденокарциноме яичников, данные свидетельствуют о том, что он не повышен при других признаках FOLR1 + опухоль, таких как мелкоклеточный рак легких (Mantovani LT, et al. Eur J Cancer 30A(3):363-9 (1994); Basal E, et al. PLoS ONE 4(7): e6292 (2009)). Настоящий способ позволяет детектировать рецептор FOLR1 в присутствии высокой концентрации фолиевой кислоты. В предыдущих анализах в разработке анализа использовали Mov19. Поскольку IMGN853 содержит Mov19 и в одном варианте реализации представляет сбой направленную терапию по настоящему изобретению, очень важно, чтобы способ детектировал FOLR1 в присутствии или в отсутствии Mov19 в тех вариантах реализации изобретения, в которых IMGN853 вводят до детекции FOLR1. Предыдущие анализы, в которых используется Mov19 имеют конкурентные эффекты, и в них будет обнаруживаться значительно меньше или вообще не будет обнаруживаться FOLR1 у пациентов, получающих лечение IMGN853.

[0108] В одном варианте реализации способа по настоящему изобретению для детекции FOLR1 в образцах жидкости от человека, используется традиционный "сэндвич"-формат анализа ELISA (Фигура 1). В одном варианте реализации изобретения в способе используется средство захвата (т.е. антитело, другой белок) FOLR1, присоединенное к твердой подложке. В одном варианте реализации изобретения твердая подложка представляет собой микротитрационный планшет. Для этого образец (асцитные жидкости, кровь, сыворотку, плазму и т.п.) добавляют без разбавления и детектируют другим средством детекции (другим антителом или белком), которое не мешает связыванию первого средства захвата. Затем средство детекции детектируют посредством использования вторичного средства детекции (биотин/стрептавидин, вторичное античеловеческое моно- или поликлональное антитело, и т.д.), которое может связываться с первым средством детекции более одного раза, тем самым амплифицируя сигнал детекции. Вторичное средство детекции затем определяют количественно с использованием некоторых других средств (например, ТМБ/пероксидаза, сцинтилляционный счетчик, флуоресцентные зонды и т.п.). Кроме того, анализ детектирует FOLR1 и не подвергается негативному влиянию вследствие присутствия Mov19, IMGN853, других представителей семейства FOLR1 или фолиевой кислоты.

[0109] Анализы по настоящему изобретению включают анализы как для отбора пациентов, подходящих для получения терапии на основе FOLR1, так и анализы для контроля ответа пациента. Анализы для прогнозирования ответа выполняются перед выбором терапии, и уровни слущивающегося FOLR1 могут повлиять на решения по выбору терапии. Для контроля ответа пациента анализ выполняется при инициировании терапии для установления исходного (или предварительно определенного) уровней FOLR1 в образце. Такой же образец затем подвергают анализу и уровни FOLR1 сравнивают с исходным или предварительно определенным. Как используется здесь, термин "предварительно определенный уровень" относится в целом к пороговому значению анализа, которое используется для оценки результатов диагностики путем сравнения результатов анализа с предварительно определенный уровнем и где предварительно определенный уровень уже был связан или ассоциирован с различными клиническими параметрами (например, контроль того достигнут ли эффективный уровень лекарственного средства в крови субъекта, пролеченного лекарственным средством, контроль ответа субъекта, получающего лечение по поводу рака противораковым лекарственным средством, контроль ответа опухоли у субъекта, получающего лечение упомянутой опухоли и т.д.). Предварительно определенный уровень может представлять собой либо абсолютное значение или значение нормализованное путем вычитания значения, полученного от пациента до начала терапии. Примером предварительно определенного уровня, который может быть использован, является исходный уровень, полученный от одного или более субъектов, которые могут необязательно иметь одно или более заболеваний или состояний. Сравнение (или информационный анализ) уровня анализируемого биомаркера с исходным или предварительно определенным уровнем может быть выполнено с помощью автоматизированной системы, такой как программное обеспечение или система искусственного интелекта, которые являются частью или совместимы с оборудованием, (например, компьютерной платформой), на котором выполняют анализ. В качестве альтернативы, это сравнение или информационный анализ может быть выполнен врачом. В одном варианте реализации изобретения, в котором уровни остаются такими же или уменьшаются, терапия может быть эффективной и может быть продолжена. При значительном увеличении по сравнению с исходным уровнем (или предварительно определенным уровнем), пациент может быть не отвечающим на терапию. В другом варианте реализации увеличение уровней слущивающегося FOLR1 может свидетельствовать о повышенной гибели клеток и увеличенном высвобождении слущивающегося FOLR1. В этом варианте реализации изобретения увеличение уровней слущивающегося FOLR1 свидетельствует о терапевтической эффективности. Соответственно, в некоторых вариантах реализации изобретения измеряется слущивающийся FOLR1 и измеряется гибель клеток. Анализы для измерения гибели клеток известны в данной области техники и включают, например, обнаружение антигена МЗО (цитокератина, расщепляемого каспазой), маркеров повреждения ДНК, таких как γ-Н2АХ или морфологических особенностей клеток, таких как фрагментированные и/или конденсированные окрашенные ДАФИ ядра.

[0110] Анализы по настоящему изобретению могут быть выполнены с помощью любых способов анализа белка. Способы анализа белка, используемые в настоящем изобретении, хорошо известны в данной области техники и включают способы иммуноанализа с участием связывания специфического немеченого или меченого антитела или белка с экспрессируемым белком или фрагментом FOLR1. Пригодные способы иммуноанализа включают в себя как анализы жидкой фазы, которые проводят с использованием любого формата, известного в данной области техники, такого как, но не ограничиваясь перечисленным, Biacore, разрешенный во времени перенос энергии флуоресценции (TR-FRET), формат ELISA ("сэндвич", прямое и обратное конкурентное ингибирование) или формат поляризации флуоресценции и твердофазные анализы, такие как иммуногистохимический анализ. Средства, связывающие FOLR-1, приведенные ниже, являются особенно пригодными для этих способов иммуноанализа.

III. Средства, связывающие FOLR-1

[0111] Настоящее изобретение относится к средствам, которые специфически связывают FOLR1 человека. Эти средства упоминаются в настоящем документе как "средства, связывающие FOLR-1."

[0112] Средства, связывающие FOLR-1 включают в себя средства, связывающие FOLR-1, которые содержат последовательности CDR тяжелой и легкой цепи muFRl-9, muFRl-13, muFRl-53, muFRl-62 и muFRl-64. Последовательности CDR muFRl-9, muFRl-13, muFRl-53 и muFRl-62 описаны в Таблицах 1 и 2 ниже.

[0113] Молекулы, связывающие FOLR1 могут представлять собой антитела или антиген-связывающие фрагменты, которые специфически связываются с FOLR1, содержащим CDR muFR1-9, muFR1-13, muFR1-53, muFR1-62 или muFR1-64, которые состоят из вплоть до четырех (то есть 0, 1, 2, 3 или 4) консервативных аминокислотных замен в CDR.

[0114] Полипептиды могут содержать одну из отдельных вариабельных легких цепей или вариабельных тяжелых цепей, описанных в настоящем документе. Антитела, и полипептиды могут также содержать как вариабельную легкую цепь, так и вариабельную тяжелую цепь. Последовательности вариабельной легкой цепи и вариабельной тяжелой цепи мышиных антител muFR1-9, muFR1-13, muFR1-53 и muFR1-62 представлены в Таблицах 3 и 4 ниже.

[0115] Также представлены полипептиды, которые содержат: (а) полипептид, имеющий по меньшей мере около 90% идентичности последовательности с SEQ ID NO: 25-28; и/или (b) полипептид, имеющий по меньшей мере около 90% идентичности последовательности с SEQ ID NO: 29-32. В некоторых вариантах реализации изобретения полипептид содержит полипептид, имеющий по меньшей мере около 95%, по меньшей мере около 96%, по меньшей мере около 97%, по меньшей мере около 98%) или по меньшей мере около 99% идентичности последовательности с SEQ ID NO: 25-32. Таким образом, в некоторых вариантах реализации изобретения полипептид содержит (а) полипептид, имеющий по меньшей мере около 95% идентичности последовательности с SEQ ID NO: 25-28 и/или (b) полипептид, имеющий по меньшей мере около 95% идентичности последовательности с SEQ ID NO: 29-32. В некоторых вариантах реализации изобретения полипептид содержит (а) полипептид, имеющий аминокислотную последовательность SEQ ID NO: 25-28; и/или (b) полипептид, имеющий аминокислотную последовательность SEQ ID NO: 29-32. В некоторых вариантах реализации изобретения полипептид представляет собой антитело и/или полипептид, который специфически связывается с FOLR1. В некоторых вариантах реализации изобретения полипептид представляет собой мышиное, химерное или гуманизированное антитело, которое специфически связывается с FOLR1. В некоторых вариантах реализации изобретения полипептид, имеющий определенный процент идентичности последовательности с SEQ ID NO: 25-32, отличается от SEQ ID NO: 25-32 только консервативными аминокислотными заменами.

[0116] Полипептиды могут содержать одну из отдельных легких цепей или тяжелых цепей, описанных в настоящем документе. Антитела и полипептиды могут также содержать как легкую цепь, так и тяжелую цепь. Последовательности легкой цепи и вариабельной цепи мышиных антител muFR1-9, muFR1-13, muFR1-53 и muFR1-62 представлены в Таблицах 5 и 6 ниже.

[0117] Также представлены полипептиды, которые содержат: (а) полипептид, имеющий по меньшей мере около 90% идентичности последовательности с SEQ ID NO: 33-36; и/или (b) полипептид, имеющий по меньшей мере около 90% идентичности последовательности с SEQ ID NO: 37-40. В некоторых вариантах реализации изобретения полипептид содержит полипептид, имеющий по меньшей мере около 95%, по меньшей мере около 96%, по меньшей мере около 97%, по меньшей мере около 98% или по меньшей мере около 99% идентичности последовательности с SEQ ID NO: 33-40. Таким образом, в некоторых вариантах реализации изобретения полипептид содержит (а) полипептид, имеющий по меньшей мере около 95% идентичности последовательности с SEQ ID NO: 33-36 и/или (b) полипептид, имеющий по меньшей мере около 95% идентичности последовательности с SEQ ID NO: 37-40. В некоторых вариантах реализации изобретения полипептид содержит (а) полипептид, имеющий аминокислотную последовательность SEQ ID NO: 33-36; и/или (b) полипептид, имеющий аминокислотную последовательность SEQ ID NO: 37-40. В некоторых вариантах реализации изобретения полипептид представляет собой антитело и/или полипептид, который специфически связывается с FOLR1. В некоторых вариантах реализации изобретения полипептид представляет собой мышиное, химерное или гуманизированное антитело, которое специфически связывается с FOLR1. В некоторых вариантах реализации изобретения полипептид, имеющий определенный процент идентичности последовательности с SEQ ID NO: 33-40, отличается от SEQ ID NO: 33-40 только консервативными аминокислотными заменами.

[0118] Аффинность или авидность антитела к антигену может быть определена экспериментально с использованием любого подходящего способа, хорошо известного в данной области техники, например, цитометрии (в том числе проточной цитометрии), твердофазного иммуноферментного анализа (ELISA) или радиоиммуноанализа (РИА) или анализа кинетики (например, анализа поверхностной плазмонной резонансной спектроскопии (BIACORE™)). Могут быть легко использованы анализы прямого связывания, а также форматы анализа конкурентного связывания. (См., например, публикацию Berzofsky, et al., "Antibody-Antigen Interactions," In Fundamental Immunology, Paul, W. E., Ed., Raven Press: New York, N.Y. (1984); Kuby, Janis Immunology, W. H. Freeman and Company: New York, N.Y. (1992); и способы, описанные в настоящем документе. Измеренная аффинность конкретного взаимодействия антитело-антиген может изменяться, при проведении измерений в различных условиях (например, концентрация соли, рН, температура). Таким образом, измерения аффинности и других антигенсвязывающих параметров (например, KD или Kd, Kon, Koff) выполняют со стандартизированными растворами антитела и антигена и стандартизированным буферным раствором, как известно в данной области техники, и таким, как буферный раствор, описанный в настоящем документе.

[0119] В одном аспекте анализы связывания могут быть выполнены с использованием цитометрии (например, проточной цитометрии) в клетках, экспрессирующих на поверхности антиген FOLR1. Например, FOLR1-позитивные клетки, такие как SKOV3, инкубировали с различными концентрациями антител к FOLR1 с использованием 1×105 клеток на образец в 100 мкл буфера ФАКС (среда RPMI-1640 с добавлением 2% нормальной козьей сыворотки). Затем клетки осаждали, промывали и инкубировали в течение 1 часа со 100 мкл ФИТЦ-конъюгированного козьего антитела к IgG мыши или козьего антитела к IgG человека (например, может быть получен от компании Jackson Laboratory, 6 мкг/мл в буфере ФАКС). Клетки снова осаждали, промывали буферным раствором ФАКС и ресуспендировали в 200 мкл ФСБ, содержащего 1% формальдегида. Образцы получали, например, с использованием проточного цитометра FACSCalibur с многолуночным пробоотборником HTS и анализировали с использованием программного обеспечения CellQuest Pro (все от компании BD Biosciences, Сан Диего, США). Для каждого образца среднюю интенсивность флуоресценции FL1 (СИФ) экспортировали и наносили на график зависимости от концентрации антител на график в полулогарифмическом масштабе, чтобы получить кривую связывания. Сигмоидальную кривую доза-ответ подгоняли к кривым связывания и рассчитывали значения ЕС50 с использованием таких программ, как GraphPad Prism v4 с параметрами по умолчанию (программное обеспечение GraphPad, San Diego, СА). Значения ЕС 50 могут быть использованы в качестве меры кажущейся константы диссоциации "Kd" или "KD" для каждого антитела.

[0120] Моноклональные антитела могут быть получены с использованием способов гибридомы, таких как те, что описаны в публикации Kohler and Milstein (1975) Nature 256:495. Используя способ гибридомы иммунизируют мышь, хомяка или другое подходящее животное-хозяина, как описано выше, чтобы вызвать выработку лимфоцитами антител, которые специфически связываются с иммунизирующим антигеном. Лимфоциты также могут быть иммунизированы in vitro. После иммунизации лимфоциты выделяют и сливают с подходящей миеломной клеточной линией, используя, например, полиэтиленгликоль, с образованием клеток гибридомы, которые затем могут быть отобраны от неслитых лимфоцитов и клеток миеломы. Гибридомы, которые продуцируют моноклональные антитела, направленные конкретно против выбранного антигена, как определено с помощью анализа иммунопреципитации, иммуноблоттинга, или с помощью анализа связывания in vitro (например, радиоиммуноанализа (РИА); твердофазного иммуноферментного анализа (ELISA)) могут быть затем размножены или в культуре in vitro с использованием стандартных способов (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, 1986) или in vivo в виде асцитных опухолей у животного. Моноклональные антитела могут быть затем очищены из культуральной среды или асцитной жидкости, как описано для поликлональных антител.

[0121] В качестве альтернативы моноклональные антитела также могут быть получены с использованием способов рекомбинантной ДНК, как описано в патенте США №4816567. Полинуклеотиды, кодирующие моноклональное антитело выделяют из зрелых В-клеток или клеток гибридомы, например, посредством ОТ-ПЦР с использованием олигонуклеотидных праймеров, которые специфично амплифицируют гены, кодирующие тяжелые и легкие цепи антитела, и их последовательность определяется с использованием обычных процедур. Выделенные полинуклеотиды, кодирующие тяжелую и легкую цепи затем клонируют в подходящих векторах экспрессии, которые при трансфекции в клетки-хозяева, такие как клетки E.coli, клетки COS обезьяны, клетки яичника китайского хомячка (СНО) или клетки миеломы, в других случаях не продуцирующие иммуноглобулиновый белок, моноклональные антитела вырабатывают клетки-хозяева. Рекомбинантные моноклональные антитела или их фрагменты из желаемых видов можно также выделять из библиотек фагового дисплея, экспрессирующих CDR из желаемого вида, как описано в публикации (McCafferty et al., 1990, Nature, 348: 552-554; Clackson et al., 1991, Nature, 352:624-628; и Marks et al., 1991, J. Mol. Biol., 222: 581-597).

[0122] Полинуклеотид(ы), кодирующие моноклональное антитело, можно дополнительно модифицировать рядом различных способов с использованием способа рекомбинантной ДНК для получения альтернативных антител. В некоторых вариантах реализации изобретения константные домены легкой и тяжелой цепей, например, из моноклонального антитела мыши, можно заменять на 1) эти области, например, из антитела человека для получения химерного антитела или 2) на не относящийся к иммуноглобулинам полипептид для получения слитого антитела. В некоторых вариантах реализации изобретения константные области укорачивают или удаляют для получения желаемого фрагмента антитела из моноклонального антитела. Сайт-направленный или высокой плотности мутагенез вариабельной области можно использовать для оптимизации специфичности, аффинности и т.д. моноклонального антитела.

[0123] В некоторых вариантах реализации изобретения моноклональное антитело к FOLR1 человека представляет собой гуманизированное антитело. В некоторых вариантах реализации изобретения такие антитела используют терапевтически для уменьшения антигенности и ответов НАМА (антитело человека против антитела мыши) при введении субъекту-человеку.

[0124] Способы конструирования, гуманизации или изменения поверхности, антител не относящихся к антителам человека или антител человека также могут быть использованы и хорошо известны в данной области техники. Гуманизированное с измененной поверхностью или аналогичным образом сконструированное антитело может иметь один или более аминокислотных остатков из источника, который не является человеком, например, не ограничиваясь перечисленным, из мыши, крысы, кролика, примата, не являющегося человеком, или другого млекопитающего. Эти не являющиеся человеческими аминокислотные остатки заменяют остатками, которые часто называют "импортными" остатками, которые обычно берут из "импортного" вариабельного, константного или другого домена известной человеческой последовательности.

[0125] Такие импортированные последовательности могут быть использованы для уменьшения иммуногенности или уменьшения, улучшения или модификации связывания, аффинности, скорости ассоциации, скорости диссоциации, авидности, специфичности, периода полураспада, или любой другой подходящей характеристики, как известно в данной области техники. В общем, остатки CDR непосредственно и наиболее существенно участвуют во влиянии на связывание FOLR1. Как правило, сохраняются часть или все отличные от человеческих и человеческие CDR последовательности, в то время как отличные от человеческих последовательности вариабельной и константной областей могут заменяться на человеческие или другие аминокислоты.

[0126] Антитела могут также быть необязательно гуманизированными, с измененной поверхностью, сконструированными или человеческими антителами с сохранением высокой аффинности в отношении антигена FOLR.1 и других благоприятных биологических свойств. Для достижения этой цели гуманизированные (или человеческие) или сконструированные антитела к FOLR1 и антитела с измененной поверхностью могут быть необязательно получены путем анализа исходных последовательностей и различных концептуальных гуманизированных и сконструированных продуктов с использованием трехмерных моделей родительских, сконструированных и гуманизированных последовательностей. Трехмерные иммуноглобулиновые модели являются общедоступными и хорошо известны специалистам в данной области техники. Существуют компьютерные программы, которые иллюстрируют и отображают с выведением на экран вероятные трехмерные конформационные структуры отобранных последовательностей-кандидатов иммуноглобулинов. Просмотр этих отображений позволяет проанализировать вероятную роль данных остатков в функционировании последовательностей-кандидатов иммуноглобулина, т.е. выполнить анализ остатков, которые влияют на способность иммуноглобулина-кандидата связываться с его антигеном, таким как FOLR1. Таким образом, остатки каркасной области (FR) могут быть выбраны из консенсусных и импортных последовательностей и объединены, в результате чего может быть получено желаемое антитело с нужными свойствами, такими как повышенная аффинность по отношению к антигену(ам)-мишени(ям).

[0127] Гуманизацию, изменение поверхности или конструирование антител настоящего изобретения можно осуществить с использованием любого известного способа, такого как, без ограничения, описанного в публикациях Winter (Jones et al., Nature 321:522 (1986); Riechmann et al, Nature 332:323 (1988); Verhoeyen et al., Science 239:1534 (1988)), Sims et al., J. Immunol. 151: 2296 (1993); Chothia and Lesk, J. Mol. Biol. 196:901 (1987), Carter et al., Proc. Natl. Acad. Sci. U.S.A. 89:4285 (1992); Presta et al., J. Immunol. 151:2623 (1993), Roguska et al., Proc. Natl. Acad. Sci., USA, 91(3):969-973 (1994), Roguska et al., Protein Eng. 9(10): 895-904 (1996), патентах США под номерами. 5639641, 5723323; 5976862; 5824514; 5817483; 5814476; 5763192; 5723323; 5766886; 5714352; 6204023; 6180370; 5693762; 5530101; 5585089; 5225539; 4816567; РСТ/: US 98/16280; US 96/18978; US 91/09630; US 91/05939; US 94/01234; GB 89/01334; GB 91/01134; GB 92/01755; WO 90/14443; WO 90/14424; WO 90/14430; ЕР 229246; 7557189; 7538195; и 7342110, включенных в данное описание в качестве ссылок, включая ссылки, цитированные в них.

[0128] В некоторых альтернативных вариантах реализации изобретения антитело к FOLR1 является человеческим антителом. Человеческие антитела можно получить напрямую с использованием различных способов, известных в данной области техники. Можно получить иммортализованные В-лимфоциты человека, иммунизированные in vitro или выделенные из иммунизированного индивидуума, продуцирующие антитело, направленное против антигена-мишени (см., например, публикации Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, стр. 77 (1985); Boemer et al., 1991, J. Immunol., 147 (1): 86-95; и патент США №5750373). Антитело человека можно также отбирать из фаговой библиотеки, где фаговая библиотека экспрессирует антитела человека, как описано, например в публикациях Vaughan et al., 1996, Nat. Biotech., 14: 309-314, Sheets et al., 1998, Proc. Nat'l. Acad. Sci., 95: 6157-6162, Hoogenboom and Winter, 1991, J. Mol. Biol., 227:381 и Marks et al., 1991, J. Mol. Biol., 222:581). Способы получения и использования фаговых библиотек антител также описаны в патентах США под номерами. 5969108, 6172197, 5885793, 6521404; 6544731; 6555313; 6582915; 6593081; 6300064; 6653068; 6706484; и 7264963; и в публикации Rothe et al., 2007, J. Mol. Bio., doi:10.1016/j.jmb.2007.12.018 (каждый из которых включен в настоящий документ посредством ссылки во всей своей полноте). Стратегии созревания аффинности и стратегии перестановки цепей (Marks et al., 1992, Bio/Technology 10: 779-783, включены в качестве ссылки в полном объеме), известны в данной области техники и могут быть использованы для получения антител человека с высокой аффинностью.

[0129] Гуманизированные антитела можно также получать в трансгенных мышах, содержащих локусы иммуноглобулинов человека, которые способны после иммунизации продуцировать полный репертуар антител человека в отсутствие продукции эндогенных иммуноглобулинов. Этот подход описан в патентах США под номерами 5545807; 5545806; 5569825; 5625126; 5633425 и 5661016.

[0130] Это изобретение относится также к биспецифическим антителам, специфически узнающим фолатный рецептор человека 1. Биспецифические антитела представляют собой антитела, способные специфически узнавать и связывать по меньшей мере два различных эпитопа. Различные эпитопы могут находиться либо внутри одной и той же молекулы (например, одного и того же фолатного рецептора человека 1), либо на различных молекулах, так что, например, антитела могут специфически узнавать и связывать фолатный рецептор человека 1, а также, например, 1) эффекторную молекулу на лейкоците, такую как Т-клеточный рецептор (например, CD3) или Fc рецептор (например, CD64, CD32 или CD16), или 2) цитотоксическое средство, как подробно описано ниже.

[0131] Типичные биспецифические антитела могут связываться с двумя различными эпитопами по меньшей мере один из которых происходит из полипептида по настоящему изобретению. В качестве альтернативы, анти-антигенное плечо молекулы иммуноглобулина можно объединять с плечом, которое связывается с запускающей молекулой на лейкоците, такой как молекула Т-клеточного рецептора (например, CD2, CD3, CD28 или В7), или Fc рецепторах для IgG, так чтобы сфокусировать клеточные механизмы защиты на клетке, экспрессирующей конкретный антиген. Биспецифические антитела можно также использовать, чтобы направлять цитотоксические средства к клеткам, которые экспрессируют конкретный антиген. Эти антитела обладают антигенсвязывающим плечом и плечом, связывающим цитотоксическое средство или хелатор радиоактивного изотопа, такой как EOTUBE, DPTA, DOTA или TETA. Способы получения биспецифических антител являются общепринятыми в данной области техники (Millstein et al., 1983, Nature 305: 537-539; Brennan et al., 1985, Science 229:81; Suresh et al, 1986, Methods in Enzymol. 121:120; Traunecker et al., 1991, EMBO J. 10: 3655-3659; Shalaby et al., 1992, J. Exp.Med. 175: 217-225; Kostelny et al., 1992, J. Immunol. 148: 1547-1553; Gruber et al., 1994, J. Immunol. 152:5368; и патенте США №5731168). Предусматриваются также антитела более чем с двумя валентностями. Например, можно получать триспецифические антитела (Tutt et al., J. Immunol. 147:60 (1991)). Таким образом, в некоторых вариантах реализации изобретения антитела к FOLR1 являются мультиспецифическими.

[0132] В конкретных вариантах реализации изобретения представлен фрагмент антитела, например, для увеличения проникновения в опухоль. Известны различные способы для получения фрагментов антител. Традиционно эти фрагменты получают посредством протеолитического расщепления интактных антител (например, Morimoto et al., 1993, Journal of Biochemical and Biophysical Methods 24: 107-117; Brennan et al., 1985, Science, 229:81). В некоторых вариантах реализации изобретения фрагменты антител получают рекомбинантным способом. Фрагменты антител Fab, Fv и scFv все можно экспрессировать в E.coli и секретировать из нее или других клеток-хозяев, таким образом, обеспечивая получение больших количеств этих фрагментов. Такие фрагменты антител можно также выделять из фаговых библиотек антител, обсуждаемых выше. Фрагмент антитела может также представлять собой линейные антитела, как описано, например, в патенте США №5641870, и может являться моноспецифическим или биспецифическим. Другие способы для получения фрагментов антител будут очевидными практикующему специалисту в данной области техники.

[0133] В соответствии с настоящим изобретением способы можно адаптировать для получения одноцепочечных антител, специфических для фолатного рецептора человека 1 (см. патент США №4946778). Кроме того, способы можно адаптировать для конструирования экспрессирующих библиотек Fab (Huse, et al., Science 246:1275-1281 (1989), чтобы позволять быструю и эффективную идентификацию моноклональных фрагментов Fab с желаемой специфичностью для фолатного рецептора 1 или его производных, фрагментов, аналогов или гомологов. Фрагменты антител можно получать способами из данной области, включая без ограничений: (а) фрагмент F(ab')2, полученный расщеплением пепсином молекулы антитела; (b) фрагмент Fab, полученный восстановлением дисульфидных мостиков фрагмента F(ab')2; (с) фрагмент Fab, полученный обработкой молекулы антитела папаином и восстанавливающим средством, и (d) фрагменты Fv.

[0134] Может дополнительно являться желательным, особенно в случае фрагментов антител, модифицировать антитело, чтобы увеличить время его полураспада в сыворотке. Этого можно достигать, например, включением эпитопа связывания рецептора спасения во фрагмент антитела посредством мутации соответствующей области фрагмента антитела или посредством включения эпитопа в пептидную метку, которую затем сливают с фрагментом антитела либо на конце, либо в середине (например, посредством синтеза ДНК или пептида).

[0135] Гетероконъюгированные антитела также входят в объем настоящего изобретения. Гетероконъюгированные антитела составлены из двух ковалентно связанных антител. Такие антитела предложены, например, для нацеливания иммунных клеток на нежелательные клетки (патент США №4676980). Предусмотрено, что антитела можно получать in vitro с использованием известных способов химии синтеза белка, включая способы, включающие в себя средства для перекрестного сшивания. Например, иммунотоксины можно конструировать с использованием реакции дисульфидного обмена или посредством формирования тиоэфирной связи. Примеры подходящих реагентов для этой цели включают в себя иминотиолат и метил-4-меркаптобутиримидат.

[0136] Для целей настоящего изобретения следует принимать во внимание, что модифицированные антитела могут содержать любой тип вариабельной области, который обеспечивает связь антитела с полипептидами FOLR1 человека. В этом отношении вариабельная область может содержаться в любом типе или быть полученной из любого типа млекопитающего, которого можно индуцировать для подъема гуморального ответа и получения иммуноглобулинов против желаемого связанного с опухолью антигена. Таким образом, вариабельная область модифицированных антител может быть, например, человеческого, мышиного, не относящегося к человеку примата (например, яванских макак, макак и т.д.) или волчьего происхождения. В некоторых вариантах реализации изобретения как вариабельные, так и константные области модифицированных иммуноглобулинов являются человеческими. В других вариантах реализации изобретения вариабельные области подходящих антител (как правило, полученных из не относящегося к человеку источника) можно конструировать или специфически приспосабливать для улучшения свойств связывания или уменьшения иммуногенности молекулы. В этом отношении вариабельные области, применимые по настоящему изобретению, можно гуманизировать или другим образом изменять посредством включения импортируемых последовательностей аминокислот.

[0137] В некоторых вариантах реализации изобретения вариабельные домены как в тяжелых, так и в легких цепях изменяют, по меньшей мере, частичной заменой одной или более CDR и, если необходимо, частичной заменой каркасной области и изменением последовательности. Хотя CDR можно получать из антитела того же класса или даже подкласса, что и антитело, из которого получены каркасные области, предусматривают, что CDR будут получены из антитела другого класса и в конкретных вариантах реализации изобретения предпочтительно из антитела из других видов. Может не являться необходимым, заменять все CDR на полные CDR из донорной вариабельной области для переноса антигенсвязывающей способности одного вариабельного домена к другому. Скорее, может являться необходимым только перенести те остатки, которые необходимы для поддержания активности участка связывания антигена. Принимая во внимание объяснения, приведенные в патентах США под номерами 5585089, 5693761 и 5693762, это будет полностью в пределах компетенции специалистов в данной области техники, либо посредством выполнения общепринятых экспериментов, либо посредством тестирования методом проб и ошибок для получения функционального антитела с уменьшенной иммуногенностью.

[0138] Несмотря на изменения в вариабельной области, специалисты в данной области техники будут принимать во внимание, что модифицированные антитела по этому изобретению будут включать в себя антитела (например, полноразмерные антитела или их иммунореактивные фрагменты), в которых по меньшей мере часть из одного или более доменов константной области удалены или другим образом изменены для обеспечения желательных биохимических характеристик, таких как улучшенная локализация опухоли или уменьшенное время полураспада в сыворотке по сравнению с антителом приблизительно с такой же иммуногенностью, содержащем нативную или неизмененную константную область. В некоторых вариантах реализации изобретения константная область модифицированного антитела будет содержать человеческую константную область. Модификации константной области, совместимые с этим изобретением, включают в себя добавления, удаления или замены одной или более аминокислот в одном или более доменах. То есть модифицированные антитела, раскрытые в настоящем документе, могут содержать изменения или модификации одного или более из трех константных доменов тяжелой цепи (CH1, СН2 или СН3) и/или константного домена легкой цепи (CL). В некоторых вариантах реализации изобретения предусматривают модифицированные константные области, в которых один или несколько доменов являются частично или полностью удаленными. В некоторых вариантах реализации изобретения модифицированные антитела будут содержать конструкции или варианты с удаленными доменами, в которых удален целый домен СН2 (конструкции АСН2). В некоторых вариантах реализации изобретения удаленный домен константной области будут заменять на короткий аминокислотный спейсер (например, 10 остатков), обеспечивающий некоторую часть гибкости молекулы, как правило, обеспечиваемой отсутствующей константной областью.

[0139] Следует отметить, что в некоторых вариантах реализации изобретения модифицированные антитела могут быть сконструированны для слияния домена СН3 непосредственно с шарнирной областью соответствующего модифицированного антитела. В других конструкциях может являться желательным предоставить пептидный спейсер между шарнирной областью и модифицированными доменами СН2 и/или СН3. Например, можно экспрессировать совместимые конструкции, где домен СН2 удален, а оставшийся домен СН3 (модифицированный или немодифицированный) присоединен к шарнирной области с помощью спейсера из 5-20 аминокислот. Такой спейсер можно добавлять, например, чтобы гарантировать, что регуляторные элементы константного домена остаются свободными и доступными или что шарнирная область остается гибкой. Однако следует отметить, что в некоторых случаях можно доказать, что аминокислотные спейсеры являются иммуногенными и вызывают нежелательный иммунный ответ против конструкции. Соответственно, в некоторых вариантах реализации изобретения любой спейсер; добавляемый к конструкции, должен являться относительно неиммуногенным или даже совсем исключенным, так чтобы сохранить желательные биохимические качества модифицированного антитела.

[0140] Следует понимать, что помимо удаления целых доменов константной области, антитела по настоящему изобретению можно получать посредством частичного удаления или замены нескольких или даже единственной аминокислоты. Например, мутация отдельной аминокислоты в выбранных областях домена СН2 может являться достаточной, чтобы в основном уменьшить связывание Fc и, таким образом, улучшить локализацию опухоли. Подобным образом, может являться желательным просто удалить ту часть одного или более доменов константной области, которая контролирует эффекторную функцию (например, связывание комплемента C1Q), подлежащую модуляции. Такие частичное удаление константных областей может улучшать выбранные характеристики антитела (время полураспада в сыворотке), в то же время оставляя интактными другие желательные функции, связанные с рассматриваемым доменом константной области. Более того, как упомянуто выше, константные области раскрытых антител можно модифицировать посредством мутации или замены одной или нескольких аминокислот, что улучшает профиль полученной в результате конструкции. В этом отношении может являться возможным нарушить активность, обеспечиваемую консервативным участком связывания (например, связывание Fc), в то же время по существу сохраняя конфигурацию и иммуногенный профиль модифицированного антитела. Конкретные варианты реализации изобретения могут содержать добавление одной или более аминокислот к константной области для усиления желательных характеристик, таких как снижение или увеличение эффекторной функции, или обеспечение большего присоединения цитотоксина или углевода. В таких вариантах реализации изобретения может являться желательным вставлять или повторять специфические последовательности, полученные из выбранных доменов константной области.

[0141] Настоящее изобретение дополнительно относится к вариантам и эквивалентам, которые являются, по существу, гомологичными химерным, гуманизированным и человеческим антителам или фрагментам этих антител, указанным здесь. Они могут содержать, например, мутации - консервативные замены, т.е. замену одной или более аминокислот на сходные аминокислоты. Например, консервативная замена относится к замене одной аминокислоты на другую внутри одного и того же общего класса, например, одной кислой аминокислоты на другую кислую аминокислоту, одной основной аминокислоты на другую основную аминокислоту или одной нейтральной аминокислоты на другую нейтральную аминокислоту. Что подразумевают под консервативной аминокислотной заменой, хорошо известно в данной области техники.

[0142] Полипептиды по настоящему изобретению могут представлять собой рекомбинантные полипептиды, природные полипептиды или синтетические полипептиды, включая антитело или его фрагмент против FOLR1 человека. В данной области известно, что некоторые последовательности аминокислот по настоящему изобретению могут быть изменены без значительного влияния на структуру или функцию белка. Таким образом, изобретение дополнительно относится к вариантам полипептидов, которые обладают значительной активностью или которые содержат области антитела или его фрагмента против белка фолатного рецептора человека. Такие мутанты включают в себя делеции, инсерции, инверсии, повторы и замены типа.

[0143] Полипептиды и аналоги можно дополнительно модифицировать, чтобы они содержали дополнительные химические группы, в норме не составляющие часть белка. Эти дериватизированные группы могут улучшать растворимость, биологическое время полураспада или всасывание белка. Эти группы могут также уменьшать или исключать любые желательные побочные эффекты белков и т.п. Обзор этих групп можно найти в REMINGTON'S PHARMACEUTICAL SCIENCES, 20th ed., Mack Publishing Co., Easton, PA (2000).

[0144] Выделенные полипептиды, описанные в настоящем документе, можно получать любым подходящим способом, известным в данной области техники. Такие способы лежат в диапазоне от способов прямого синтеза белка до конструирования последовательности ДНК, кодирующей выделенные последовательности полипептида, и экспрессии этих последовательностей в подходящем трансформируемом хозяине. В некоторых вариантах реализации изобретения последовательность ДНК конструируют с использованием рекомбинантного способа посредством выделения или синтеза последовательности ДНК, кодирующей интересующий белок дикого типа. Необязательно последовательность можно подвергать мутагенезу посредством сайт-специфического мутагенеза для получения ее функциональных аналогов. См., например, публикацию Zoeller et al., Proc. Nat'l. Acad. Sci. USA 81: 5662-5066 (1984) и патент США №4588585.

[0145] В некоторых вариантах реализации изобретения последовательность ДНК, кодирующую интересующий полипептид, будут конструировать посредством химического синтеза с использованием синтезатора олигонуклеотидов. Такие олигонуклеотиды могут быть сконструированы на основании аминокислотной последовательности желаемого полипептида и с выбором тех кодонов, которые являются предпочтительными в клетке-хозяине, в которой будут продуцировать интересующий рекомбинантный полипептид. Стандартные способы можно применять для синтеза выделенной последовательности полинуклеотида, кодирующей интересующий выделенный полипептид. Например, полную аминокислотную последовательность можно использовать для конструирования обратно транслированного гена. Дополнительно, можно синтезировать олигомер ДНК, содержащий нуклеотидную последовательность, кодирующую конкретный выделенный полипептид. Например, несколько небольших олигонуклеотидов, кодирующих части желаемого полипептида, можно синтезировать и затем лигировать. Индивидуальные олигонуклеотиды, как правило, содержат 5' или 3' выступающие концы для комплементарной сборки.

[0146] После сборки (посредством синтеза, сайт-направленного мутагенеза или другого способа) последовательности полинуклеотида, кодирующего конкретный выделенный интересующий полипептид, будут вставлять в экспрессирующий вектор и функционально связывать с контролирующей экспрессию последовательностью, подходящей для экспрессии белка в желаемом хозяине. Правильную сборку можно подтверждать нуклеотидным секвенированием, рестрикционным картированием и экспрессией биологически активного полипептида в подходящем хозяине. Как хорошо известно в данной области техники, для того, чтобы получить высокие уровни экспрессии трансфицированного гена в хозяине, указанный ген необходимо функционально связывать с последовательностями для транскрипционного и трансляционного контроля экспрессии, которые являются функциональными в выбранном экспрессирующем хозяине.

[0147] В некоторых вариантах реализации изобретения рекомбинантные экспрессирующие векторы используют для амплификации и экспрессии ДНК, кодирующей антитела или их фрагменты против FOLR1 человека. Рекомбинантные экспрессирующие векторы представляют собой способные к репликации конструкции ДНК, обладающие синтетическими или полученными из кДНК фрагментами ДНК, кодирующими полипептидную цепь антитела к FOLR1 или его фрагмента, функционально связанную с подходящими регуляторными элементами для транскрипции или трансляции, полученными из генов млекопитающих, микроорганизмов, вирусов или насекомых. Транскрипционная единица, как правило, содержит совокупность (1) генетического элемента или элементов, обладающих регуляторной ролью в экспрессии генов, например, транскрипционные промоторы или энхансеры, (2) структурной или кодирующей последовательности, транскрибируемой в мРНК и транслируемой в белок, и (3) подходящих последовательностей инициации и терминации транскрипции и трансляции, как подробно описано ниже. Такие регуляторные элементы могут включать в себя последовательность оператора для контроля транскрипции. Способность к репликации в хозяине обычно придает точка начала репликации, и можно дополнительно включать селективный ген для облегчения распознавания трансформантов. Области ДНК являются функционально связанными, когда они функционально связаны друг с другом. Например, ДНК для сигнального пептида (секреторный лидер) является функционально связанной с ДНК для полипептида, если она экспрессируется в виде предшественника, принимающего участие в секреции полипептида; промотор является функционально связанным с кодирующей последовательностью, если он контролирует транскрипцию последовательности; или сайт связывания рибосомы является функционально связанным с кодирующей последовательностью, если он расположен так, чтобы позволять трансляцию. Структурные элементы, предназначенные для использования в дрожжевых системах экспрессии, включают в себя лидерную последовательность, позволяющую внеклеточную секрецию транслированного белка клеткой-хозяином. В качестве альтернативы, когда рекомбинантный белок экспрессируется без лидерной или транспортной последовательности, он может содержать N-концевой остаток метионина. Этот остаток можно, необязательно, затем отщеплять от экспрессированного рекомбинантного белка для получения конечного продукта.

[0148] Выбор последовательности для контроля экспрессии и экспрессирующего вектора будет зависеть от выбора хозяина. Можно применять широкое разнообразие сочетаний экспрессирующий хозяин/вектор. Применимые экспрессирующие векторы для эукариотических хозяев включают в себя, например, векторы, содержащие последовательности для контроля экспрессии из SV40, вируса бычьей папилломы, аденовируса и цитомегаловируса. Применимые экспрессирующие векторы для бактериальных хозяев включают в себя известные бактериальные плазмиды, такие как плазмиды из Esherichia coli, включая pCR1, pBR322, рМВ9 и их производные, плазмиды с широким спектром хозяев, такие как М13 и нитевидные фаги с одноцепочечной ДНК.

[0149] Подходящие клетки-хозяева для экспрессии полипептида или антитела, связывающего FOLR1 (или белок FOLR1 для использования в качестве антигена) включают в себя прокариоты, дрожжи, насекомых или клетки высших эукариот под контролем соответствующих промоторов. Прокариоты включают в себя грамотрицательные или грамположительные организмы, например, E.coli или бациллы. Клетки высших эукариот включают в себя стабильные линии клеток, происходящих из млекопитающих, как описано ниже. Можно применять также бесклеточные системы трансляции. Подходящие векторы клонирования и экспрессии для использования с клетками-хозяевами бактерий, грибов, дрожжей и млекопитающих описаны в публикации Pouwels et al. Pouwels et al. (Cloning Vectors: A Laboratory Manual, Elsevier, Ν.Y., 1985), релевантное описание которого таким образом приведено в настоящем документе в качестве ссылки. Дополнительную информацию в отношении способов получения белка, в том числе получения антител, можно найти, например, в патентной публикации США №2008/0187954, патентах США под номерами 6413746 и 6660501 и в международной патентной публикации №WO 04009823, каждый из которых включен в настоящее описание в качестве ссылки во всей своей полноте.

[0150] Различные системы культур клеток млекопитающих или насекомых также преимущественно используют для экспрессии рекомбинантного белка. Экспрессию рекомбинантных белков можно осуществлять в клетках млекопитающих, поскольку такие белки, как правило, являются правильно свернутыми, соответствующим образом модифицированными и полностью функциональными. Примеры подходящих линий клеток-хозяев млекопитающих включают в себя HEK-293 и HEK-293Т, линии COS-7 клеток почек обезьяны, описанные в публикации Gluzman (Cell. 23:175, 1981), и другие линии клеток, включая, например, L-клетки, линии клеток С127, 3Т3, яичника китайского хомячка (СНО), HeLa и ВНК. Экспрессирующие векторы млекопитающих могут содержать нетранскрибируемые элементы, такие как точка начала репликации, подходящие промотор и энхансер, присоединенные к подлежащему экспрессии гену, и другие 5'- или 3'-фланкирующие нетранскрибируемые последовательности, и 5'- или 3'-нетранслируемые последовательности, такие как необходимые сайты связывания рибосомы, сайт полиаденилирования, донорные и акцепторные сайты сплайсинга, и последовательности терминации транскрипции. Обзор бакуловирусных систем для продукции гетерологичных белков в клетках насекомых приведен в публикации Luckow and Summers, Bio/Technology. 6: 47 (1988).

[0151] Белки, продуцируемые трансформированным хозяином, можно очищать в соответствии с любым подходящим способом. Такие стандартные способы включают в себя хроматографию (например, ионообменную, аффинную и разделяющую по размеру колоночную хроматографию), центрифугирование, дифференциальную растворимость или любой другой стандартный способ очистки белка. Аффинные метки, такие как гексагистидин, связывающий мальтозу домен, последовательности оболочки вируса гриппа и глутатион- S-трансфераза, можно присоединять к белку, чтобы обеспечивать легкую очистку посредством пропускания через соответствующую аффинную колонку. Выделенные белки могут быть также охарактеризованы физически с использованием таких способов, как протеолиз, ядерный магнитный резонанс и рентгеновская кристаллография.

[0152] Например, супернатанты из систем, секретирующих рекомбинантный белок в культуральную среду, можно сначала концентрировать с использованием коммерчески доступного фильтра для концентрирования белка, например, устройства для ультрафильтрации Amicon или Millipore Pellicon. После стадии концентрирования концентрат можно наносить на подходящую матрицу для очистки. В качестве альтернативы, можно применять анионообменную смолу, например, матрицу или субстрат, обладающие выступающими группами диэтиламиноэтила (ДЭАЭ). Матрицы могут представлять собой акриламид, агарозу, декстран, целлюлозу или другие типы, обычно применяемые для очистки белка. В качестве альтернативы, можно применять стадию катионного обмена. Подходящие катионообменники включают в себя различные нерастворимые матрицы, содержащие сульфопропильные или карбоксиметильные группы. Наконец, одну или несколько стадий обращенно-фазовой высокоэффективной жидкостной хроматографии (ОФ-ВЭЖХ), включающих в себя гидрофобную среду ОФ-ВЭЖХ, например, силикагель, обладающий выступающими метальными или другими алифатическими группами, можно применять для дополнительной очистки средства, связывающего FOLR1. Некоторое или все из вышеупомянутых стадий очистки, в различных комбинациях, также можно применять для получения гомогенного рекомбинантного белка.

[0153] Рекомбинантный белок, продуцированный в бактериальной культуре, можно выделять, например, посредством исходной экстракции из осадков клеток с последующими одной или несколькими стадиями концентрирования, высаливания, ионного обмена в водных растворах или эксклюзионной хроматографии. Высокоэффективную жидкостную хроматографию (ВЭЖХ) можно применять для конечных стадий очистки. Клетки микроорганизмов, применяемые для экспрессии рекомбинантного белка, можно разрушать любым подходящим способом, включая циклы замораживания и оттаивания, обработку ультразвуком, механическое разрушение или применение средств для лизиса клеток.

[0154] Известные в данной области техники способы для очистки антител и других белков также включают, например, те, что описаны в патентных публикациях США под номерами 2008/0312425, 2008/0177048 и 2009/0187005, каждая из которых включена в настоящее описание в качестве ссылки во всей своей полноте.

IV. Полинуклеотиды

[0155] В некоторых вариантах реализации настоящее изобретение охватывает полинуклеотиды, содержащие полинуклеотиды, которые кодируют полипептид, специфически связывающий рецептор FOLR1 человека или фрагмент такого полипептида. Например, настоящее изобретение обеспечивает полинуклеотид, содержащий последовательность нуклеиновой кислоты, которая кодирует антитело к FOLR1 человека или кодирует фрагмент такого антитела. Полинуклеотиды по изобретению могут быть в форме РНК или в форме ДНК. ДНК включает в себя кДНК, геномную ДНК и синтетическую ДНК и может являться двухцепочечной или одноцепочечной и, если является одноцепочечной, может представлять собой кодирующую цепь или некодирующую (антисмысловую) цепь. В некоторых вариантах реализации изобретения полинуклеотид представляет собой кДНК или ДНК с отсутствующим одним или большим количеством эндогенных интронов.

[0156] В некоторых вариантах реализации изобретения полинуклеотид представляет собой не встречающийся в природе полинуклеотид. В некоторых вариантах реализации изобретения полинуклеотид получен рекомбинантным способом.

[0157] В некоторых вариантах реализации изобретения полинуклеотиды являются выделенными. В некоторых вариантах реализации изобретения полинуклеотиды являются по существу чистыми. В некоторых вариантах реализации изобретения полинуклеотид очищают из натуральных компонентов.

[0158] Настоящее изобретение относится к полинуклеотиду, содержащему полинуклеотид, кодирующий полипептид, включающий последовательность выбранную из группы, состоящей из SEQ ID NO: 1-40. Также представлен полинуклеотид, кодирующий полипептид, имеющий по меньшей мере около 95%, по меньшей мере около 96%, по меньшей мере около 97%, по меньшей мере около 98% или по меньшей мере около 99% идентичности последовательности с SEQ ID NO: 1-40.

[0159] В конкретных вариантах реализации изобретения полинуклеотиды содержат кодирующую последовательность для зрелого полипептида, слитого в той же самой рамке считывания с полинуклеотидом, помогающим, например, экспрессии и секреции полипептида из клетки-хозяина (например, лидерная последовательность, которая функционирует как секреторная последовательность для контроля транспорта полипептида из клетки). Полипептид, обладающий лидерной последовательностью, представляет собой пребелок и может обладать лидерной последовательностью, отщепляемой клеткой-хозяином для формирования зрелой формы полипептида. Полинуклеотиды могут также кодировать пробелок, который представляет собой зрелый белок плюс дополнительные 5'-остатки аминокислот. Зрелый белок, обладающий пропоследовательностью, представляет собой пробелок и является неактивной формой белка. После отщепления пропоследовательности остается активный зрелый белок.

[0160] В конкретных вариантах реализации изобретения полинуклеотиды содержат кодирующую последовательность для зрелого полипептида, слитую в одной и той же рамке считывания с маркерной последовательностью, которая позволяет, например, очистку кодируемого полипептида. Например, маркерная последовательность может представлять собой гексагистидиновую метку, предоставляемую вектором pQE-9, для обеспечения очистки зрелого полипептида, слитого с маркером, в случае бактериального хозяина, или маркерная последовательность может представлять собой гемагглютининовую метку (ГА), полученную из белка гемагглютинина гриппа, при использовании хозяина-млекопитающего (например, клетки COS-7).

[0161] Настоящее изобретение дополнительно относится к вариантам описанных здесь выше полинуклеотидов, кодирующих, например, фрагменты, аналоги и производные.

[0162] Варианты полинуклеотида могут содержать изменения в кодирующих областях, некодирующих областях, или в тех и других. В некоторых вариантах реализации изобретения варианты полинуклеотида содержат изменения, которое приводят к молчащим заменам, добавлениям или делениям, но не изменяют свойства или активности кодируемого полипептида. В некоторых вариантах реализации изобретения варианты нуклеотида получены посредством молчащих мутаций из-за вырожденности генетического кода. Варианты полинуклеотида можно получать по множеству причин, например, для оптимизации экспрессии кодонов для конкретного хозяина (изменения кодонов в мРНК человека на кодоны, предпочтительные для бактериального хозяина, такого как E.coli).

[0163] Также представлены векторы и клетки, содержащие полинуклеотиды, описанные в данном документе.

V. Детекция

[0164] При использовании "сэндвич"-формата ELISA, антитело захвата будет немеченым. Антитело детектирования будет либо непосредственно меченым или будет детектироваться косвенно посредством добавления (после смывания избытка антитела детектирования) молярного избытка второго меченого антитела, направленного против первого антитела.

[0165] Используемая метка для антитела детектирования представляет собой любую детектируемую функциональную группу, которая не препятствует связыванию с антителами к FOLR1. Примеры подходящих меток представляют собой многочисленные метки, известные по использованию в иммуноанализе, включающие компоненты, которые могут детектироваться прямо, такие как флуорохромные, хемилюминисцентные и радиоактивные метки, а также компоненты, такие как ферменты, которые для детекции должны вступать в реакцию или дериватизироваться. Примеры таких меток включают радиоизотопы 32Р, 14С, 125I, 3Н и 131I, флуорофоры, такие как хелаты редкоземельных металлов или флуоресцеин и их производные, родамин и его производные, дансил, умбеллиферон, люциферазы, например люцифераза светляка и бактериальная люцифераза (Патент США №4737456), люциферин, 2,3-дигидрофталазиндионы, пероксидаза хрена (ПХ), щелочная фосфатаза, β-галактозидаза, глюкоамилаза, лизоцим, сахаридооксидазы, например, глюкозооксидаза, галактозооксидаза и глюкозо-6-фосфат дегидрогеназа, гетероциклические оксидазы, такие как уриказа и ксантиноксидаза, связанные с ферментом, который использует пероксид водорода для окисления предшественника красителя, такого как ПХ, лактопероксидаза или микропероксидаза, биотин/авидин, биотин/стрептавидин, биотин/стрептавидин-β-галактозидаза с MUG, спин-метки, бактериофаговые метки, стабильные свободные радикалы и т.п. Как указано выше, флуоресцентная детекция представляет собой только один пример.

[0166] Для ковалентного связывания этих меток с белками или полипептидами доступны подходящие способы. Например, для мечения антител с вышеописанными флуоресцентными, хемилюминесцентными и ферментными метками могут использоваться связывающие средства, такие как диальдегиды, карбодиимиды, дималеимиды, бис-имидаты, бис-диазотированный бензидин и им подобные. См., например, патенты США под номерами 3940475 (флуоресценция) и 3645090 (ферменты); Hunter et al. Nature 144:945 (1962); David et al. Biochemistry 13: 1014-1021 (1974); Pain et al. J. Immunol. Methods 40:219-230 (1981); и Nygren J. Histochem. arid Cytochem. 30: 407-412 (1982). В некоторых вариантах реализации изобретения метки, используемые здесь, представляют собой флуоресцентные метки для увеличения амплификации и чувствительности до 8 пг/мл, более предпочтительно, представляют собой биотин вместе с стрептавидин-β-галактозидазой и MUG для амплификации сигнала. В некоторых вариантах реализации изобретения используется колориметрическая метка, например в случае, где детектируемое антитело является биотинилированным, и средство детекции представляет собой авидин или стрептавидин-пероксидазу и 3,3',5,5'-тетраметилбензидин.

[0167] Для специалиста в области способов иммуноанализа конъюгирование такой метки, включающей ферменты, с антителом представляет собой стандартно проводимую процедуру. См., например, публикацию O'Sullivan et al. "Methods for the Preparation of Enzyme-antibody Conjugates for Use in Enzyme Immunoassay," в Methods;in Enzymology, ed. J. J. Langone and H. Van Vunakis, том 73 (Academic Press, New York, N.Y., 1981), стр. 147-166.

[0168] После добавления последнего меченого антитела количество связанного антитела определяется с помощью удаления избытка несвязанного меченого антитела посредством промывания и затем измерения количества присоединенной метки с использованием способа детекции, подходящего для метки, и корреляции измеренного количества с количеством слущивающегося FOLR1 или FOLR1 в циркулирующих опухолевых клетках в биологическом образце. Например, в случае ферментов, проявленное и измеренное количество окрашивания представляет собой прямое измерение количества присутствующего слущивающегося FOLR1 или присутствующего в циркулирующих опухолевых клетках FOLR1. Конкретно, если меткой является ПХ, окрашивание может детектироваться с использованием субстрата 3,3',5,5'-тетраметилбензидина с поглощением при 450 нм.

VI. Анализы циркулирующих опухолевых клеток

[0169] Антитела к FOLR1, описанные в настоящем документе, также могут быть использованы для детекции FOLR1 в анализе циркулирующих опухолевых клеток. Циркулирующие опухолевые клетки (ЦОК) представляют собой клетки, которые слущились в сосудистую систему из опухоли и циркулируют в кровотоке. ЦОК присутствуют в кровотоке в очень низких концентрациях. В общем, ЦОК обогащают из крови или плазмы пациента с помощью различных способов, известных в данной области техники. ЦОК можно окрашивать для конкретных маркеров с использованием способов, известных в данной области техники, включая, но не ограничиваясь перечисленным, способы на основе цитометрии (например, проточной цитометрии) и способы на основе ИГС.ЦОК могут быть окрашены на белковые маркеры, уникальные для опухолевых клеток, что позволяет идентификацию и различение ЦОК от нормальных клеток крови. ЦОК могут быть также окрашены на FOLR1 с использованием антител по настоящему изобретению, включая, но не ограничиваясь перечисленным FR1-9 и FR1-13. Анализ ЦОК может также включать в себя количественный анализ количества ЦОК и/или количества ЦОК, положительных в отношении FOLR1. В настоящем изобретении, антитела к FOLR1, описанные здесь, могут быть использованы для окрашивания ЦОК, выделенных от субъекта, имеющего раковое заболевание, чтобы измерить присутствующий в ЦОК FOLR1. Увеличение количества ЦОК, экспрессирующих FOLR1 может помочь идентифицировать субъекта, как имеющего рак, который, скорее всего, будет отвечать на терапию на основе FOLR1 или позволит оптимизировать схемы лечения с антителом FOLR1 или иммуноконъюгатом. Количественное определение ЦОК, экспрессирующих FOLR1, может предоставить информацию о стадии опухоли, ответе на терапию и/или прогрессировании заболевания. Этот анализ может быть использован в качестве прогностического предиктивного или фармакодинамического биомаркера. Кроме того, окрашивание ЦОК в отношении конкретных маркеров, в том числе, но не ограничиваясь перечисленным, FOLR1, молено использовать в виде жидкой биопсии отдельно, либо в сочетании с дополнительным анализом маркера опухоли твердых образцов биопсии.

VII. Наборы

[0170] Для удобства способ анализа по настоящему изобретению может быть представлен в форме набора. Такой набор представляет собой упакованную комбинацию, включающую основные элементы: (а) первый реагент, который может представлять собой реагент захвата, состоящий из моноклональных антител против FOLR1 человека; и/или (b)второй реагент, который представляет собой реагент детекции. Реагент детекции может также содержать моноклональные антитела к FOLR1, но также может содержать детектируемые (меченые или немеченые) антитела, которые связываются с FOLR1. Эти основные элементы определяются в настоящем документе выше и далее в Примерах.

[0171] В одном варианте реализации изобретения, в котором первый реагент и второй реагент являются антителами, их антигенсвязывающими фрагментами, или полипептидами, которые связываются с FOLR1, первый и второй реагенты представляют собой различные антитела, их антигенсвязывающие фрагменты или полипептиды. В одном варианте реализации изобретения первый реагент связывается с другим эпитопом FOLR1, чем второй реагент FOLR1. В одном варианте реализации изобретения ни первый реагент ни второй реагент конкурентно не ингибируют связывание активного средства, (например, активного средства, содержащего антитело huMOv19 или его антиген-связывающий фрагмент) от связывания с FOLR1.

[0172] В одном варианте реализации изобретения набор дополнительно включает твердую подложку для реагентов захвата, которая может предлагаться в виде отдельного элемента, или на которой уже иммобилизованы реагенты захвата. Следовательно', антитела захвата в наборе могут быть иммобилизованы на твердой подложке или они могут быть иммобилизованы на такой подложке, которая включена в набор или предлагается отдельно от набора.

[0173] В одном варианте реализации изобретения реагент захвата нанесен на микротитрационный планшет. Реагент детекции может представлять собой меченые антитела, детектируемые прямо, или немеченые антитела, которые детектируются с помощью меченых антител, направленных против немеченых антител; с происхождением из других видов. В том случае, если метка представляет собой фермент, набор обычно включает субстраты и кофакторы, требуемые для фермента, а в случае, когда метка представляет собой флуорофор, набор обычно включает предшественник красителя, с помощью которого получают детектируемый хромофор. В том случае, если реагент детекции является немеченым, набор может дополнительно включать средство детекции для детектируемых антител, такое как меченые антитела, направленные против немеченых антител, например, в формате флуоресцентной детекции. В случае, где метка представляет собой фермент, набор обычно включает субстраты и кофакторы, требуемые для фермента, в случае, где метка представляет собой флуорофор, набор обычно включает предшественник красителя, с помощью которого получают детектируемый хромофор и, в случае, где метка представляет собой биотин, набор обычно включает авидин, такой как авидин, стрептавидин или стрептавидин, конъюгированный с ПХ, или β-галактозидазу с MUG.

[0174] В одном варианте реализации изобретения реагент захвата представляет собой антитело FR1-9 к FOLR1, а реагент для обнаружения представляет собой антитело FR1-13 к FOLR1. В другом варианте реализации антитело FR1-13 является биотинилированным.

[0175] Набор также обычно содержит инструкции по проведению анализа и/или белок FOLR1, или его фрагменты (например, внеклеточный домен FOLR1 или внеклеточный домен FOLR1 и весь или часть связывающего домена ГФИ) в качестве стандарта антигена, а также другие добавки, такие как стабилизаторы, буферы для промывания и инкубации и т.п. В одном варианте реализации изобретения стандартный антиген FOLR1 представляет собой иммуноадгезин FOLR1-Fc. Набор также может включать в себя инструкции для детекции и оценки экспрессии FOLR1.

[0176] Компоненты набора предлагаются в определенных соотношениях, с относительными количествами разнообразных реагентов, которые подходящим образом варьируются с получением в растворе концентраций реагентов, которые, по существу, увеличивают до максимума чувствительность анализа. Конкретно, реагенты могут предлагаться в виде сухих порошков, обычно лиофилизованных, включая вспомогательные вещества, с помощью которых при растворении получают раствор реагентов, имеющий подходящую концентрацию для объединения с тестируемым образцом.

[0177] Варианты реализации из настоящего раскрытия можно дополнительно определить, со ссылкой на следующие неограничивающие примеры, в которых подробно описывается получение конкретных антител по настоящему раскрытию и способы использования антител по настоящему описанию. Специалистам в данной области техники будет очевидно, что на практике можно осуществлять множество модификаций, как материалов, так и способов, без отклонения от объема настоящего описания.

ПРИМЕРЫ

[0178] Понятно, что примеры и варианты реализации, описанные здесь, представлены только с целью иллюстрации и что, в свете этого, специалистам в данной области техники будут предложены разнообразные модификации или изменения, которые подлежат включению в сущность и область действия настоящей заявки.

Пример 1

Разработка мышиных антител к FOLR1

[0179] Были проведены две разные серии иммунизации/скрининга. В первой серии мышей подкожно иммунизировали примерно 5×106 KB клеток, экспрессирующих FOLR1 (Американская коллекция типовых культур, АТСС CCL-17). Во второй серии для иммунизации мышей были использованы клетки 300-19, экспрессирующие на поверхности FOLR1 человека. Для получения этих клеток, аминокислотную последовательность FOLR1 человека получали с вебсайта NCBI (номер доступа NP 057937), затем она была кодон-оптимизированна и синтезирована в Blue Heron biotechnologies, фланкирована сайтами рестрикции EcoRI и Xbal для облегчения клонирования в вектор экспрессии млекопитающих pSRa. Клетки 300-19, линии предшественников В-клеток, полученные от мышей линии Balb/c (Reth et al., Nature, 317:353-355 (1985)), трансфицировали с плазмидой экспрессии pSRa-FolR1 для стабильной экспрессии высоких уровней FOLR1 человека на поверхности клетки. Для обеих серий применяли стандартные протоколы иммунизации, известные специалистам, например, такие как те, которые используются в компании ImmunoGen, Inc. Для получения гибридомы иммунизированных мышей повторно иммунизировали антигеном в течение трех дней, а потом умерщвляли. Селезенки мышей собирали в соответствии со стандартными протоколами для животных, такими как, например, растирание ткани между двумя стерильными матовыми предметными стеклами, чтобы получить суспензию отдельных клеток в среде RPMI-1640. Клетки селезенки центрифугировали, осаждали, промывали и сливали с клетками мышиной миеломы, такими как, например, P3X63Ag8.653 (Kearney et al., J. Immunol., 123: 1548-1550 (1979)) с использованием полиэтиленгликоля-1500 (Roche 783 641). Слитые клетки ресуспендировали в селективной среде RPMI-1640, содержащей гипоксантин-аминоптерин-тимидин (ГАТ) (Sigma Н-0262) и отбирали для роста в 96-луночных плоскодонных планшетах для культивирования (Corning-Costar 3596, 0,2 мл клеточной суспензии на лунку) при 37°С с 5% СО2. Спустя 5 дней инкубации из каждой лунки удаляли 0,1 мл супернатанта культуры и заменяли на 0,1 мл среды RPMI-1640, содержащей добавку гипоксантин-тимидин (ГТ) (Sigma Н-0137). Продолжали инкубацию при 37°С с 5% СО2 до тех пор, пока гибридомные клоны не были готовы для скрининга антител. Также могут использоваться другие способы иммунизации и получения гибридом, в том числе те, которые описаны в публикациях Langone et al. (Eds., "Immunochemical Techniques, Part I", Methods in Enzymology, Academic Press, том 121, Florida) и Harlow et al. ("Antibodies: A Laboratory Manual"; Cold Spring Harbor Laboratory Press, New York (1988)).

Пример 2

Скрининг и селекция гибридомы

[0180] Клетки FOLR1-300-19 трансфицировали FOLR1 человека, а клетки KB использовали в первой и второй сериях скринингов, соответственно. Супернатанты культуры от гибридомы с помощью проточной цитометрии подвергали скринингу на секрецию мышиных моноклональных антител, которые связываются с FOLR1-положительными клетками, такими как экспрессирующие FOLR1 клетки 300-19 или КВ-клетки, но не с FOLR1-отрицательными клетками, такими как нетрансфицированные клетки 300-19. 0,1 мл супернатантов гибридомы инкубировали в течение 3 ч либо с FOLR1- положительными клетками, или с нетрансфицированными клетками 300-19 (1×105 клеток на образец) в 0,1 мл буфера ФАКС (среда RPMI-1640 с добавлением 2% нормальной козьей сыворотки). Затем клетки центрифугировали, осаждали, промывали и инкубировали в течение 1 часа с 0,1 мл конъюгированного с ФЭ козьего антитела к IgG мыши (например, может быть получен от компании Jackson Laboratory, 6 мкг/мл в буфере ФАКС). Клетки снова центрифугировали, осаждали, промывали буферным раствором ФАКС и ресуспендировали в 0,2 мл ФСБ, содержащего 1% формальдегида. Связанную с клетками флуоресценцию измеряли с использованием проточного цитометра FACSCalibur с многолуночным пробоотборником HTS или с помощью проточного цитометра FACS array и анализировали с использованием программного обеспечения CellQuest Pro (все от компании BD Biosciences, Сан Диего, США). Положительные клоны гибридомы субклонировали путем предельного разведения. Один субклон из каждой гибридомы, который посредством проточной цитометрии показал такую же реакционную способность против FOLR1, что и родительские клетки, были выбраны для последующего анализа. Стабильные субклоны культивировали, и идентифицировали изотип каждого секретируемого антитела к FOLR1 с использованием коммерческих реагентов для изотипирования (Roche 1493027). Мышиные антитела очищали с помощью белка А из очищенной гибридомной среды, как описано выше. Эти антитела были определены как FR-1 антитела.

[0181] Один клон, muFR1-13, был идентифицирован как клон анти-FOLR1, который (1) не конкурирует или препятствует связыванию Mov19 одновременно с тем же антигеном и (2) имеет высокую специфичность связывания с мишенью, как показано общепринятым способом проточной цитометрии (Фигура 2А и 2В). Эти две характеристики были необходимы для разработки данного анализа и таким образом для использования в анализе был выбран клон muFR1-13.

[0182] Из оставшихся 64 клонов панели антител к FOLR1, потребовалось второе антитело для анализа, которое обладало теми же критериями, что были необходимы для muFR1-13. Кроме того, второе антитело не могло одновременно конкурировать или препятствовать связыванию muFR1-13 с тем же антигеном (то есть Mov19, muFR1-13 и конечный клон должен иметь все эпитопы четко отдельными). Чтобы удовлетворять этим условиям, были проведены серии экспериментов конкурентного анализа ELISA на оставшейся панели из 65 антифолатных клонов (Фигура 3А). Если антитело разделяет аналогичный или стерически схожий эпитоп с детектируемым антителом, наблюдается уменьшение сигнала (Фигура 3В). С помощью этого способа, 5 из 64 протестированных антител были идентифицированны как имеющие эпитопы, которые конкурируют с Mov19 и, следовательно, были удалены из дальнейшего рассмотрения.

[0183] Тот же способ повторяли, заменяя конъюгированный с биотином Mov19 на конъюгированный с биотином muFR1-13 (Фигура 4). С помощью этого способа 6 дополнительных клонов были идентифицированы как имеющие эпитопы, которые конкурируют с muFR1-13 и, следовательно, были удалены из дальнейшего рассмотрения. Из оставшихся 53 клонов, еще 13 клонов продемонстрировали низкую аффинность и были удалены из рассмотрения.

[0184] Остальные 40 клонов были подвергнуты скринингу с помощью формата ELISA, схожего с тем, что показан на Фигуре 1. 40 клонов, которые были альтернативно нанесены на планшет для анализа в качестве покрытия вместо muFR1-9, показаны на диаграмме, и был проведен анализ полученных в результате кривых связывания, показанных на Фигуре 5. Антитела, которые имели самый низкий полумаксимальный ответ (ЕС50), рассматривались как имеющие наивысшую специфичность связывания с FOLR1 и, таким образом, были выбраны в качестве лучших кандидатов для анализа. Аффинность связывания 4 лучших клонов, которые анализировали в этом способе, варьировались от ~1-5×10-9 M до тех пор, как только новые, более качественные материалы стали доступны для тестирования.

Пример 3

Очистка мышиных моноклональных антител

[0185] Антитела очищали из супернатантов субклонов гибридомы с использованием стандартных способов, таких как, например, хроматография на основе белка А или G (HiTrap белок А или G HP, 1 мл, Amersham Biosciences). Коротко, супернатант был подготовлен к хроматографии посредством добавления 1/10 объема 1 M буфера Трис/HCl, рН 8,0. Супернатант со скорректированным уровнем рН профильтровали через мембранный фильтр 0,22 мкм и нанесли на колонку, уравновешенную буфером для связывания (ФСБ, рН 7,3). Колонку промывали буфером для связывания до достижения стабильной базовой линии с отсутствием поглощения при 280 нм. Антитело элюировали буферным раствором 0,1 M уксусной кислоты, содержащим 0,15 M NaCl, рН 2,8, при скорости потока 0,5 мл/мин. Фракции приблизительно 0,25 мл собирали и нейтрализовали добавлением 1/10 объема 1 M Трис/HCl, рН 8,0. Пиковую фракцию(-ии) дважды подвергали диализу в течение ночи против 1х ФСБ и стерилизовали фильтрацией через мембранный фильтр 0,2 мкм. Очищенное антитело подвергали количественному анализу посредством поглощения при Α280.

Пример 4

Характеристика связывания с помощью проточной цитометрии

[0186] Специфичность связывания исследовали с помощью проточной цитометрии с использованием очищенных антител. Каждое антитело инкубировали в течение 3 часов либо с клетками 300-19, экспрессирующими FOLR1, или с нетрансфицированными клетками 300-19 (1×105 клеток на образец) в 0,1 мл буфера ФАКС (среда RPMI-1640 с добавлением 2% нормальной козьей сыворотки). Затем клетки осаждали, промывали и инкубировали в течение 1 часа с 0,1 мл ФИТЦ-конъюгированного козьего антитела к IgG мыши (например, может быть получено от компании Jackson Laboratory, 6 мкг/мл в буфере ФАКС). Клетки снова осаждали, промывали буферным раствором ФАКС и ресуспендировали в 200 мкл ФСБ, содержащего 1% формальдегида. Образцы получали с использованием проточного цитометра FACSCalibur с многолуночным пробоотборником HTS или с помощью проточного цитометра FACS array и анализировали с использованием программного обеспечения CellQuest Pro (все от компании BD Biosciences, San Diego, US). Гистограммы ФАКС антител к FOLR1 продемонстрировали сдвиг флуоресценции, в то время как родительские клетки 300-19 не показали сдвига флуоресценции. Кроме того, не было обнаружено никакого значительного сдвига флуоресценции, когда какую-либо из клеточных линий инкубировали только с ФИТЦ-конъюгированным козьим антителом к IgG человека.

Пример 5

Клонирование и секвенирование областей VL и VH muFR1-9 и FR1-53

[0187] Общую клеточную РНК получали из 5×106 клеток гибридомы с использованием набора RNeasy (QIAgen) в соответствии с протоколом производителя. Затем синтезировали кДНК из общей РНК с использованием набора для синтеза кДНК Superscript II (Invitrogen). Процедура первого тура вырожденной ПЦР реакции на кДНК, полученной из клеток гибридомы, была основана на способах, описанных в публикациях Wang et al. (2000) J Immunol Methods. Jan 13; 233(1-2): 167-77) и Co et al. (1992) J Immunol. Feb 15; 148(4): 1149-54)). Последовательности VH амплифицировали с помощью ПЦР с использованием следующих вырожденных праймеров: EcoMH1 CTTCCGGAATTCSARGTNMAGCTGSAGSAGTC (SEQ ID NO: 45), EcoMH2 CTTCCGGAATTCSARGTNMAGCTGSAGSAGTCWGG (SEQ ID NO: 41) и BamIgG1 GGAGGATCCATAGACAGATGGGGGTGTCGTTTTGGC (SEQ ID NO: 42). Последовательности VL амплифицировали с помощью ПЦР с использованием следующих вырожденных праймеров: SacIMK GGAGЦOKGAYATTGTGMTSACMCARWCTMCA (SEQ ID NO: 43) и HindKL TATAGAGЦOKAAGCTTGGATGGTGGGAAGATGGATACAGTTGGTGC (SEQ ID NO: 44). (Смешанные основания определяются следующим образом: N=G+A+T+C, S=G+C, Y-C+T, M=A+C, R=A+G, W=A+T).

[0188] Затем реакционные смеси ПЦР разгоняли в геле из 1% легкоплавкой агарозы, полосы от 300 до 400 п.о. вырезали, очищали с помощью мини-колонок Zymo DNA и посылали в фирму Agencourt biosciences для секвенирования. Соответствующие 5' и 3' ПЦР-праймеры использовали в качестве праймеров секвенирования для создания кДНК вариабельной области с двух направлений. Аминокислотные последовательности VH и VL областей, были получены путем трансляции результатов секвенирования ДНК с помощью программного обеспечения VectorNTI.

[0189] Предварительные последовательности кДНК вариабельной области включали 5'-концевые последовательности, полученные из вырожденных ПЦР праймеров скорее чем мРНК мышиного антитела, так что сравнение последовательностей с последовательностями зародышевой линии мышиного антитела способствовало выявлению и устранению этих артефактов секвенирования. Сайт NCBI IgBlast (www.ncbi.nlm.nih.gov/igblast/) использовали для поиска мышиных последовательностей зародышевой линии, от которых произошла предварительная последовательность кДНК антитела и праймер, полученный от 5'-концевых последовательностей замещали соответствующими последовательностями зародышевой линии. Очищенные последовательности вариабельных областей затем были объединены с эталонными последовательностями NCBI для мышиной и IgG1 константных областей (номера доступ AJ294736.1 и D78344.1, соответственно), чтобы собрать последовательности ожидаемые мышиного антитела полной длины. Затем рассчитывали молекулярные массы тяжелой и легкой цепи ожидаемого мышиного FR1-9 и FR1-53 и сравнивали с молекулярными массами, полученными с помощью анализа жидкостной хроматографии/масс-спектрофотометрии (ЖХ/МС).

[0190] Исходные попытки секвенировать мышиную легкую цепь FR1-9 в соответствии со способами, описанными выше, оказались неудачными, поэтому были использованы альтернативные способы. Последовательности легкой цепи гибридом, связанные с FR1-9, были использованы для разработки ПЦР-праймера KS77LClead (ttttgagctctggattccagcctccagaggt) для отжига с предполагаемой лидерной последовательностью FR1-9 каркасной области легкой цепи. ПЦР реакцию с этим лидерным праймером и секвенирование проводили, как описано выше, и получали полную последовательность кДНК, кодирующую легкую цепь, которая соответствует массе легкой цепи FR1-9, измеренной посредством ЖХ/МС

Пример 6

Контрольный образец слияния FOLR1 Fc

[0191] В качестве альтернативного источника растворимого антигена для белка, связывающего фолатный рецептор человека, как правило, получаемого из человеческого молока была сконструирована слитая молекула фолатного рецептора человека 1 - Fc. Амино-конец кДНК человеческого FolRl, описанной в примере иммунизации выше, вырезали из полноразмерной последовательности с помощью расщепления эндонуклеазами рестрикции EcoRI и Pstl. Этот фрагмент содержал кДНК, кодирующую 233 аминокислоты от N-конца сигнального пептида до остатков выше от сайта связывания ГФИ антитела huFolR1 (NCBI номер доступа NM_016731.2). Олигонуклеотидный линкер Pstl с BamHI способствует клонированию фрагмента FolR1 внутри рамки считывания с последовательностями шарнирной области мышиного IgG2A, константной области СН2 и СН3 антител (NCBI номер доступа Р01863) в плазмиде экспрессии млекопитающего pmuFc2ANL-ЕК. Слитый белок FolR1-Fc человека затем экспрессируется посредством временной или стабильной трансфекции в клеточные линии млекопитающих-хозяев, такие как клетки HEK-293Т или СНО. Поскольку слитый белок из 475 аминокислот содержит константную область мышиного IgG2A, молекулу очищали в соответствии со стандартными процедурами очистки мышиного антитела, описанными выше.

Пример 7

Анализ ELISA слущивающегося антигена

[0192] Для гарантии того, что материалы постоянно функционируют так, как ожидалось, все антитела подвергали скринингу связывания как посредством анализа ELISA, так и посредством способа проточной цитометрии, известных в данной области техники. Проточную цитометрию проводили с использованием клеток T47D человека, экспрессирующих FOLR1, которые культивировали с использованием способов культивирования клеток in-vitro, известных в данной области техники. Антитела были связаны с этими клетками и их детектировали косвенным образом с помощью козьего антимышиного антитела детектирования с меткой Alexa-fluor 488 на оборудовании FACScalibur (Фигуры 6А-Б). Те же способы применяли к другим антителам и было установлено, что окончательные выбранные антитела FR1-13 и FR1-9 продемонстрировали аффинность связывания 1-3×10-9 M и 2-4×10-9, соответственно, согласно обоим способам.

[0193] Важно, что в этом анализе детектируются только FOLR1 и не детектируются FOLR2 или особенно FOLR3 (обычно встречаются в плазме крови человека как слущивающийся белок), поскольку антитело Mov19 является специфичным только для FOLR1. Чтобы определить это, проводили скрининг четырех топовых клонов с помощью коммерчески доступных наборов ELISA (Фигуры 7А-В). Антитело детектирования, которое служит положительным контролем, демонстрирует положительный сигнал выше фонового, указывая на детекцию FOLR2 или FOLR3. Остальные антитела (FR1-9, FR1-53, FR1-62, FR1-64 и Mov19) не образуют сигнал в анализе и, следовательно, не связываются с FOLR2 или FOLR3.

[0194] Кроме того, присутствие фолиевой кислоты, связанной с FOLR1 может потенциально скрыть эпитоп выбранных антител. Для гарантии того, что анализ будет детектировать FOLR1 при физиологических количествах фолиевой кислоты в крови человека, фолиевую кислоту предварительно инкубировали с очищенным обычным образом белком FOLR1 и добавляли в аналитический планшет. Как показано на Фигуре 8, присутствие фолиевой кислоты оказывало незначительное воздействие на аффинность детекции этого анализа в сравнении с положительными контролями, не содержащими фолиевую кислоту. Таким образом, был сделан вывод, что анализ может детектировать FOLR1 даже в присутствии связанной фолиевой кислоты.

[0195] Поскольку ни один из четырех топовых клонов антител (FR1-9, 53, 62 или 64) не продемонстрировали помех связывания Mov19 или FR1-13 и потому, что не наблюдалось никаких негативных характеристик связывания в присутствии FOLR2, FOLR3 или фолиевой кислоты, эти четыре кандидата из исходных 64 клонов оказались эффективными для использования в анализе. Из этих четырех клонов, было установлено, что клон FR1-9 и FR1-53 имели более высокую аффинность связывания по сравнению с FR1-62 и FR1-64. Получение FR1-53 антитела из родительской гибридомы постоянно давало худший выход, следовательно, клон FR1-9 был выбран за простоту производства антитела, более высокую чистоту антитела и процент мономера.

[0196] В стремлении оптимизмровать анализ был использован системный подходов котором концентрации FR1-9, биотинилированного FR1-13, Strp-ΠΧ и соответствующие периоды инкубации были оптимизированы с помощью слитого белка FOLR1-FC в качестве стандарта антигена. Гибрид FOLR1-Fc представляет собой слитый пептид huFOLR1 и шарнирной области мышиного IgG2A, СН2, СН3. Критериями для установления оптимальных условий были воспроизводимые сигналы с высоким соотношением сигнала к шуму, минимальные матричные эффекты в образцах плазмы крови человека, высокая повторяемость и точность и низкий предел детекции.

[0197] Более конкретно, анализ проводили путем нанесения на аналитический планшет в качестве покрытия 2 мкг/мл muFR1-9 и инкубации. После блокирования неспецифическим белком, в планшеты добавляли образцы для анализа (в том числе стандарты антигена и образцы плазмы человека) и инкубировали. Затем планшеты промывали и в каждую лунку добавляли антитело детектирования muFR1-13b (2 мкг/мл). Перед добавлением молярного избытка стрептавидина, конъюгированного с пероксидазой хрена (1:5000), планшеты снова промывали. Затем планшеты снова промывали перед добавлением 3,3',5,5'-тетраметилбензидина (ТМБ). ТМБ вступал в реакцию с пероксидазой с образованием синего окрашивания с интенсивностью, соизмеримой с количеством FOLR1, присутствующим в образце. Реакцию останавливали раствором, содержащим кислоту, который превращался в раствор желтого цвета. Затем анализ читали на планшетном ридере spectramax для определения интенсивности цвета реакции в каждом образце (поглощение). При необходимости создавали сигмоидальную кривую, отражающую зависимость ответа от дозы (вариабельный наклон) с помощью программного обеспечения Graphpad Prism v5.04 используя четырехпараметрическое логистическое (4ПЛ) уравнение: Y = Нижнее + (Верхнее - Нижнее)/1+10^((LogEC50-Х)*Наклон) для всех серий разведения.

[0198] Для определения адекватности окончательного формата ELISA, были протестированы образцы плазмы пациента - человека с раком яичников и образцы асцитной жидкости человека от источника без опухоли. У пациентов с асцитной жидкостью не имеющих опухоль, 15 образцов были проанализированы на наличие FOLR1. Во всех 15 образцах в этом анализе FOLR1 не был обнаружен и ложноположительные результаты из-за матричных эффектов не наблюдались (Фигура 9). В качестве альтернативы в эти образцы асцитной жидкости добавляли очищенный белок FOLR1 человека и выполняли последующую детекцию. Восстановление белка FOLR1, определенное с помощью анализа, составило больше 85% от известного добавленного количества (не показано). Таким образом, считалось, что в асцитной жидкости человека, не связанной с опухолями, не было интерферирующих белков даже при отсутствии разбавления образца.

[0199] Тот же анализ проводили в объединенной нормальной человеческой плазме (пул составил n=10 пациентов на серию). С помощью анализа не был детектирован эндогенный FOLR1 и не были обнаружены интерферирующие белки в неразбавленных образцах плазмы человека при добавлении очищенного белка huFOLR1-Fc (Фигура 10). Образцы плазмы от человека с раком яичников были предоставлены институтом рака Dana Farber Cancer Institute или госпиталем Mass General Hospital. Из 72 проанализированных на сегодняшний день образцов, 7 образцов были идентифицированы как имеющие детектируемые уровни FOLR1 в диапазоне от 0,7 до 30,6 нМ. Репрезентативный анализ этих данных показан на Фигуре 11. Здесь три из восьми образцов содержали детектируемые уровни FOLR1, демонстрируя показатели 0,74, 0,91 и 30,6 нМ для образцов РВ105, РВ106 и РВ109, соответственно. Способ интерполяции этих данных из соответствующей стандартной кривой, полученной с помощью huFOLR1-Fc, показан на Фигуре 12.

Пример 8

Анализ циркулирующих опухолевых клеток

[0200] Три клеточные линии с различными уровнями экспрессии FOLR1 были выбраны в качестве представителей высокой экспрессии (KB), низкой экспрессии (OVCAR3) и отсутствия экспрессии (А549). Немеченные FR1-9 и FR1-13, а также коммерческое антитело к FOLR1 ("коммерческое FRA") титровали, и определяли оптимальные титры для каждого из антител с использованием детекции посредством лазерной сканирующей цитометрии (ЛСЦ) на выбранных клеточных линиях. Флуоресценцию измеряли как среднюю интенсивность флуоресценции (СИФ) и результаты показаны на Фигуре 13. Все три антитела продемонстрировали экспрессию фолатного рецептора в KB клетках. Были определены оптимальные разведения для каждого антитела, являющиеся следующими: 1: для коммерческого FRA, 1:100 для muFR1-9 и 1:200 для muFR1-13. Из протестированных антител коммерческое антитело дало лучшее соотношение сигнала к фону (8,0 по сравнению с 4,07 (muFR1-9) и 4,19 (muFR1-13)), но только антитело muFR1-9 продемонстрировало сигнал в клетках OVCAR3 (сигнал приблизительно на 30% больше чем в клетках А549). См. Фигуру 14.

[0201] Для применений, которые включают мониторинг лечения или эффективности с IMGN853, антитело, выбранное для использования в анализе ЦОК не должно конкурировать с компонентом антитела IMGN853 (т.е. huMov19 (М9346А)) за связывание с FOLR1. Конкурентные анализы проводились с целью определения, конкурирует ли любое из антител с антителом IMGN853 за связывание с FOLR1. Для этих анализов, клетки А549 (отрицательная экспрессия) и KB (высокая экспрессия) обрабатывали антитело М9346А или только носителем. Затем клетки промывали и окрашивали с каждым из трех антител и анализировали экспрессию с использованием ЛСЦ. Результаты представлены на Фигуре 15. Светлые столбцы (слева) представляют только носитель, а темные столбцы (справа) представляют клетки, обработанные IMGN853. Если существует конкуренция с терапевтическим IMGN853, то темный столбец (справа) будет меньше, чем светлый столбец (слева) в клетках КВ. Результаты на Фигуре 15, показывают, что коммерческое антитело FRA конкурирует за связывание с IMGN853 (~ 66% падения сигнала FRA), в то время как обработка IMGN853 не оказала влияния на антитела muFR1-9 и muFR1-13.

[0202] Вместе взятые, эти результаты показывают, что muFR1-9 и muFR1-13 не конкурируют с IMGN853, тем самым делая их более желательными кандидатами для использования в анализе, который контролирует уровни FOLR1 в биологической жидкости (например, крови или плазме), циркулирующих опухолевых клетках или образце ткани после обработки IMGN853. Кроме того, антитело muFRl-9 оказалось более чувствительным и продемонстрировало уникальную способность детектировать экспрессию в клетках OVCAR3, которые имели низкие уровни экспрессии, и является предпочтительным кандидатом антитела для этих типов анализов.

Пример 9

Детекция FOLR1 в циркулирующих опухолевых клетках (ЦОК), выделенных от пациентов с НМКРЛ и раком яичников

[0203] Образцы крови отбирают у пациентов с раком яичников или НМКРЛ в следующих временных точках: скрининг (до 28 дней до исходного уровня); исходный уровень; перед циклом 3; и в конце цикла 4. ЦОК обогащают из образцов и окрашивают в отношении CK, CD45, ядра и FOLR1 с использованием антител и разведений, описанных в примере 8, выше. Количество ЦОК (т.е. CK+/CD45- ядросодержащих клеток), количество CK-/CD45- ядросодержащих клеток, экспрессию FOLR1 в ЦОК, количество CK-/CD45- ядро содержащих клеток и процент FOLR1-положительных ЦОК и CK-/CD45- ядросодержащих клеток определяли в каждом образце с помощью ЛСЦ. Эти данные используются для определения уровней экспрессии FOLR1 в ЦОК в различные моменты времени в ходе первой фазы клинического исследования IMGN853.

[0204] Все публикации, патенты, патентные заявки, интернет-сайты и номера доступа / базы данных последовательностей (включая как полинуклеотидные, так и полипептидные последовательности) приведенные здесь, включены в настоящий документ посредством ссылки во всей их полноте для всех целей в такой же степени, как если бы каждая отдельная публикация, патент, патентная заявка, интернет-сайт, или номер доступа / базы данных последовательностей были конкретно и индивидуально указаны как включенные посредством ссылки.

1. Антитело или его антиген-связывающий фрагмент, который специфически связывается с FOLR1, причем указанное антитело или его антиген-связывающий фрагмент содержит вариабельный домен тяжелой цепи и вариабельный домен легкой цепи, где:

(a) указанный вариабельный домен тяжелой цепи содержит аминокислотные последовательности CDR1, CDR2 и CDR3 SEQ ID NO: 1, 2 и 3, соответственно, и указанный вариабельный домен легкой цепи содержит аминокислотные последовательности CDR1, CDR2 и CDR3 SEQ ID NO: 13, 14 и 15, соответственно;

(b) указанный вариабельный домен тяжелой цепи содержит аминокислотные последовательности CDR1, CDR2 и CDR3 SEQ ID NO: 4, 5 и 6, соответственно, и указанный вариабельный домен легкой цепи содержит аминокислотные последовательности CDR1, CDR2 и CDR3 SEQ ID NO: 16, 17 и 18, соответственно;

(c) указанный вариабельный домен тяжелой цепи содержит аминокислотные последовательности CDR1, CDR2 и CDR3 SEQ ID NO: 7, 8 и 9, соответственно, и указанный вариабельный домен легкой цепи содержит аминокислотные последовательности CDR1, CDR2 и CDR3 SEQ ID NO: 19, 20 и 21, соответственно; или

(d) указанный вариабельный домен тяжелой цепи содержит аминокислотные последовательности CDR1, CDR2 и CDR3 SEQ ID NO: 10, 11 и 12, соответственно, и указанный вариабельный домен легкой цепи содержит аминокислотные последовательности CDR1, CDR2 и CDR3 SEQ ID NO: 22, 23 и 24, соответственно.

2. Антитело или его антиген-связывающий фрагмент по п. 1, отличающиеся тем, что указанное антитело или его антиген-связывающий фрагмент содержит вариабельный домен тяжелой цепи и вариабельный домен легкой цепи, причем указанные вариабельный домен тяжелой цепи и вариабельный домен легкой цепи содержат последовательности, выбранные из группы, состоящей из:

(a) SEQ ID NO: 25 и SEQ ID NO: 29, соответственно;

(b) SEQ ID NO: 26 и SEQ ID NO: 30, соответственно;

(c) SEQ ID NO: 27 и SEQ ID NO: 31, соответственно; и

(d) SEQ ID NO: 28 и SEQ ID NO: 32, соответственно.

3. Антитело или его антиген-связывающий фрагмент по п. 1 или 2, причем указанное антитело или его антиген-связывающий фрагмент содержит аминокислотные последовательности полноразмерной тяжелой цепи и полноразмерной легкой цепи, выбранные из группы, состоящей из:

(a) SEQ ID NO: 33 и SEQ ID NO: 37, соответственно;

(b) SEQ ID NO: 34 и SEQ ID NO: 38, соответственно;

(c) SEQ ID NO: 35 и SEQ ID NO: 39, соответственно; и

(d) SEQ ID NO: 36 и SEQ ID NO: 40, соответственно.

4. Антитело или его антиген-связывающий фрагмент по любому из пп. 1-3, отличающиеся тем, что указанное антитело или его антиген-связывающий фрагмент является мышиным, не относящимся к человеку, гуманизированным, химерным или с измененной поверхностью.

5. Молекула нуклеиновой кислоты, кодирующая антитело или его антиген-связывающий фрагмент по любому из пп. 1-4.

6. Способ детекции белка FOLR1 в образце, включающий контактирование указанного образца с антителом или его антиген-связывающим фрагментом по любому из пп. 1-4.

7. Способ по п. 6, отличающийся тем, что белок FOLR1 детектируют с помощью радиоиммуноанализа, вестерн-блоттинга, иммунофлуоресцентного анализа, иммуноферментного анализа, анализа иммунопреципитации, хемилюминесцентного анализа или иммуногистохимического анализа.

8. Способ по п. 7, отличающийся тем, что цитометрия представляет собой проточную цитометрию.

9. Способ по п. 6 или 7, отличающийся тем, что указанный белок FOLR1 представляет собой слущивающийся белок FOLR1.

10. Способ по п. 7, отличающийся тем, что иммуноферментный анализ представляет собой твердофазный иммуноферментный анализ (ELISA).

11. Способ по п. 7, отличающийся тем, что белок FOLR1 детектируют с помощью иммуногистохимического анализа.

12. Клетка для получения антитела или его антиген-связывающего фрагмента по любому из пп. 1-4, содержащая вектор экспрессии, причем указанный вектор содержит молекулу нуклеиновой кислоты по п. 5.

13. Способ получения антитела или его антиген-связывающего фрагмента по любому из пп. 1-4, включающий (а) культивирование клетки по п. 12; и (b) выделение указанного антитела, его антиген-связывающего фрагмента из указанной культивированной клетки.

14. Набор для иммуноанализа для детекции белка FOLR1 в образце, причем указанный набор включает: (а) первый реагент, при этом первый реагент представляет собой антитело или его антиген-связывающий фрагмент по любому из пп. 1-4, и (b) второй реагент, при этом второй реагент представляет собой реагент для детекции.



 

Похожие патенты:

Изобретение относится к биотехнологии. Изобретение касается способа диагностики миелоидных новообразований.
Изобретение относится к области медицины и представляет собой способ диагностики липодистрофии, заключающийся в том, что производят фотографирование липоаспирата, расположенного на предметном стекле, с помощью микроскопа, измеряют диаметры адипоцитов на фотографиях и при различии минимального и максимального диаметров адипоцитов более чем в 2 раза определяют липодистрофию.

Изобретение относится к областям животноводства, в частности к способу отбора бычков с высоким потенциалом роста по элементному составу шерсти. Способ включает определение концентрации химических элементов: кальция, цинка, меди и марганца.

Настоящее изобретение относится к иммунологии. Предложены варианты антитела, содержащие две различные пары тяжелых/легких цепей, одна из которых распознает и связывает β-амилоидный белок.

Предложенная группа изобретений относится к области медицины. Предложены способы иммобилизации активного агента на поверхности субстрата.

Изобретение относится к области медицинской биотехнологии, а именно способу получения и аттестации стандартного образца гликопротеина Е вируса клещевого энцефалита.

Изобретение относится к области молекулярной биологии, медицины и онкологии. Предложена аналитическая тест-система для определения чувствительности злокачественной опухоли конкретного пациента к онколитической биотерапии на основе мультиплексной ПЦР в режиме реального времени, включающая в себя список генов-маркеров CD74, CFI, CSF3, DNAJC24, FGF5, HCFC2, ИСК, IL15, IL1RAPL2, IL8, ITGA7, LEPR, MAP3K13, MAPKAPK3, MDK, PDGFRA, PDIK1L, PIK3CA, S100PBP, SCARB2, STK4, ТМЕМ54, TNFAIP6, TNFRSF1B, TRAF4 и тканеспецифичных референсных генов-хаускиперов GAPDH, АСТВ, RPN1, GUSB, инструкцию, планшеты для проведения ПЦР и смесь для амплификации.

Изобретение относится к ветеринарии и может быть использовано для диагностики хронического дегенеративного заболевания клапанов сердца у животного семейства псовых.

Изобретение относится к области биохимии, в частности к детектирующему агенту для обнаружения антитела, специфического к HCV-ядерному белку, причем указанный детектирующий агент может специфически связываться с указанным антителом, специфическим к HCV-ядерному белку.

Изобретение относится к области медицины, в частности к трансплантологии, и предназначено для анализа гемопоэтического химеризма при исследовании однонуклеотидных полиморфизмов генов фолатного цикла.

Изобретение относится к области биохимии, в частности к выделенному моноклональному антителу против ТАУ. Изобретение позволяет эффективно лечить заболевания, ассоциированные с ТАУ.

Изобретения относятся к клеткам и тестам, которые могут использоваться для идентификации модуляторов рецепторов сладкого вкуса. Предложены способ идентификации модулятора ощущения сладкого вкуса и выделенная клетка U2-OS.

Группа изобретений относится к области биотехнологии. Предложен полипептид, обладающий цитотоксической активностью, содержащий Fc-область IgG, которая состоит из гетеродимера, содержащего первый полипептид и второй полипептид, в аминокислотных последовательностях которых произведены серии мутаций.

Настоящее изобретение относится к области биотехнологии, конкретно к внеклеточному связывающему домену для аллостерического ингибитора, и может быть использовано для идентификации таких ингибиторов.

Изобретение относится к области биотехнологии, конкретно к применению пептида, состоящего из по меньшей мере 8 последовательных аминокислотных остатков последовательности, представленной в SEQ ID NO:3, для диагностики рассеянного склероза, что может быть использовано в медицине.

Изобретения относятся к области молекулярной биологии и касаются рекомбинантной ДНК pA4, рекомбинантной плазмидной ДНК pQE 30-А4, штамма Esherichia coli M15-A4, рекомбинантного полипептида А4, обладающего способностью селективно связывать человеческий сывороточный альбумин (ЧСА), аффинного сорбента, содержащего такой полипептид, аффинного комбинированного сорбента и способов последовательного удаления ЧСА и IgG из сыворотки крови.

Изобретение относится к области биохимии, в частности к способу получения мутеинов липокалина 2 (Lcn2, hNGAL) человека. Способ основан на мутагенезе молекулы нуклеиновой кислоты, кодирующей белок Lcn2 человека.

Изобретение относится к способу скрининга нетератогенного вещества, который включает приведение испытуемого вещества в контакт с цереблоном или фрагментом цереблона, оценку способности испытуемого вещества связываться с цереблоном или фрагментом цереблона и отбор испытуемого вещества, не связывающегося с цереблоном или фрагментом цереблона, или испытуемого вещества, характеризующегося более низкой способностью связываться с цереблоном или фрагментом цереблона по сравнению с талидомидом.

Настоящее изобретение относится к иммунологии. Предложены варианты антитела, содержащие две различные пары тяжелых/легких цепей, одна из которых распознает и связывает β-амилоидный белок.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, способные к специфическому связыванию с фолатным рецептором человека 1. Также рассмотрена молекула нуклеиновой кислоты, способ детекции белка FOLR1 в образце, клетка и способ получения антитела или его антигенсвязывающего фрагмента. Кроме того, описан набор для иммуноанализа для детекции белка FOLR1 в образце. Данное изобретение может найти дальнейшее применение в диагностике и лечении рака. 6 н. и 8 з.п. ф-лы, 15 ил., 6 табл., 9 пр.

Наверх