Набор синтетических олигонуклеотидов для количественного определения днк энтеробактерий, стафилококков и стрептококков в слизистой оболочке влагалища



Владельцы патента RU 2670278:

ООО "НекстБио" (RU)

Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для количественного определения ДНК энтеробактерий семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp., стафилококков Staphylococcus spp. и стрептококков Streptococcus spp. в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой. Изобретение обеспечивает расширение арсенала средств количественного определения ДНК возбудителей аэробного вагинита в слизистой оболочке влагалища. 3 пр.

 

Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии, и касается синтетических олигонуклеотидов для выявления ДНК энтеробактерий семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp., стафилококков (Staphylococcus spp.) и стрептококков (Streptococcus spp.). Изобретение предназначено для исследования биологического материала человека, полученного от лиц с подозрением на наличие аэробный вагинит вне зависимости от формы и наличия манифестации заболевания с целью выявления ДНК энтеробактерий семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp., стафилококков (Staphylococcus spp.) и стрептококков (Streptococcus spp.). Олигонуклеотиды могут быть использованы для создания набора реагентов для выявления ДНК возбудителей анаэробного вагинита методом полимеразной цепной реакции. Изобретение позволяет проводить обнаружение указанных микроорганизмов в биологическом материале с высокой точностью.

Из уровня техники известен способ проведения количественной ПЦР в режиме реального времени. Также описаны наборы специфических праймеров для ПЦР. При описании способа заявитель приводит наиболее оптимальные параметры для ПЦР [Заявка WO 02/070751 А1, (University Of Pittsburg Of The Commonwealth System Of Higher Education, US), опубл. 12.09.2002 г.].

Также из уровня техники известны критерии оценки состояния вагинального микробиоценоза и факторы, способствующие его нарушению. Оценены преимущества и недостатки рутинных методов лабораторной диагностики неспецифических вульвовагинитов [М.Р. Рахматулина и соавт., 2009, Вестник дерматологии и венерологии, 2009; 3: 38-42 «Современные представления о микробиоценозе вагинального биотопа и его нарушениях у женщин репродуктивного возраста»]. Освещены современные проблемы терапии неспецифических вульвовагинитов, в частности, рост резистентности условно-патогенных микроорганизмов к применяемым препаратам.

Также известны данные о нарушения микроценоза влагалища с преобладанием аэробного компонента [Ю.В. Ширева, Е.А. Сандакова, Т.И. Карпунина, 2010, Медицинский альманах, ноябрь 2010; №4(13): 164-168 «Неспецифический аэробный вагинит - «новое» или «старое» заболевание? (обзор)»]. Особое внимание обращается на роль условно-патогенных аэробных бактерий в развитии перинатальных инфекционных осложнений.

Техническим результатом, на достижение которого направлено предлагаемое изобретение, является расширение арсенала средств выявления ДНК возбудителей аэробного вагинита (энтеробактерий семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp.; стафилококков Staphylococcus spp. и стрептококков Streptococcus spp.) в биологическом материале (отделяемое слизистой оболочки влагалища).

Указанный результат достигается путем использования при постановке ПЦР набора синтетических олигонуклеотидов для количественного определения ДНК в слизистой оболочке влагалища возбудителей аэробного вагинита (энтеробактерий (семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp.), стафилококков (Staphylococcus spp.) и стрептококков (Streptococcus spp.)) в области амплификации - gene 16S rRNA, включающие в себя праймеры следующих последовательностей Seq. N1 - Seq. N8, также используются зонды с флуоресцентной меткой, интенсивность флуоресценции которых свидетельствует о количестве образующегося продукта, Seq. N9 - Seq. N12:

CTGGACGAAGACTGACGCTC Seq. N1

GTTTACGGCGTGGACTACCA Seq. N2

GGACAATACAAAGGGCAGCG Seq. N3

CCGGGAACGTATTCACCGTA Seq. N4

CCCCTTATGACCTGGGCTAC Seq. N5

GAGATTTGCTTGCCGTCACC Seq. N6

CGTCTGCGGATGGAGAGTGCAA Seq. N7

GAAGTCCGTCAATAGGCCCACAC Seq. N8

GTGCGAAAGCGTGGGGAGCA Seq. N9

CCGCGAGGTCAAGCAAATCCCA Seq. N10

TGGTTGGTACAACGAGTCGCAAGT Seq. N11

CTAGCTGGGCGTCAGGAATCCCAGG Seq. N12

Существенным отличием работы с данными праймерами является:

1) Высокая специфичность и чувствительность праймеров в области gene 16S рибосомальной РНК позволяет выявить ДНК (энтеробактерий (семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp.), стафилококков (Staphylococcus spp.) и стрептококков (Streptococcus spp.)), в биологическом материале при низкой концентрации возбудителя.

2) Для снижения вероятности образования неспецифических продуктов реакции использовали праймеры с высокой температурой отжига.

3) Использование данных праймеров для ПЦР совместимо с образцами ДНК, выделенных с применением коммерческих наборов, таких как «АмплиПрайм® ДНК-сорб-АМ», «МагноПрайм Юни» и «МагноПрайм Фаст» (ООО «НекстБио» Россия).

Указанный набор синтетических олигонуклеотидов может являться составной частью многосоставных реакционных смесей, реакционных смесей раскапаных под прослойку парафина и лиофильновысушенных реакционных смесей.

Указанный набор синтетических олигонуклеотидов является составной частью набора следующих веществ:

1. ПЦР-смесь, включающая в состав указанные праймеры и зонды, специфические к участку ДНК энтеробактерий (семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp.), стафилококков (Staphylococcus spp.) и стрептококков (Streptococcus spp.), смесь дезоксинуклеозидтрифосфатов (дНТФ).

2. ПЦР-буфер.

3. Набор контрольных образцов (положительный кнтрольный образец и отрицательный контрольный образец):

3.1. Положительный контрольный образец (ПК) - смесь бактериофагов λ и плазмид со вставками специфических последовательностей. Положительный контрольный образец вносится в отдельную пробирку с реакционной смесью. Результат амплификации ПК демонстрирует эталонное положительное прохождение реакции, с которым сравниваются результаты амплификации исследуемых образцов.

3.2. Отрицательный контрольный образец - образец, который вводится в эксперимент для контроля возможного загрязнения реактивов продуктами ранее проведенных реакций. Отрицательный контрольный образец вносится в отдельную пробирку с реакционной смесью. Положительный результат в этом образце свидетельствует о необходимости заменить реагенты и переставить эксперимент.

Пример 1. Определение наличия ДНК энтеробактерий семейства Enterobacteriaceae, стафилококков (Staphylococcus spp.) и стрептококков (Streptococcus spp.) в биологическом образце с помощью набора синтетических олигонуклеотидов в составе многосоставной реакционной смеси.

Биологический материал (отделяемое слизистой оболочки влагалища) перед проведением ПЦР с помощью предлагаемого набора реагентов проводится через процедуру пробоподготовки с использованием набора реагентов для пробоподготовки, который не является предметом данного патента. В ходе этой процедуры из биологического материала выделяется ДНК, которые, в свою очередь, используют для проведения ПЦР. Вместе с образцами биологического материала процедуру экстракции проходят контрольные образцы - отрицательный контроль и положительный контроль.

Предварительно готовиться реакционная смесь путем смешивания ПЦР-смеси, содержащей специфические синтетические олигонуклеотидные праймеры и зонды, и ПЦР-буфера в объемах, необходимых для исследования образцов биологического материала и контрольных образцов (отрицательный и положительный контроли).

В предварительно подготовленные маркированные пробирки вносится приготовленная реакционная смесь.

В пробирки с реакционной смесью, промаркированные для образцов биологического материала, вносятся пробы ДНК, полученные на этапе экстракции.

В специально промаркированную пробирку вносятся пробы ДНК, полученные на этапе экстракции из отрицательного контроля.

В специально промаркированную пробирку вносятся пробы ДНК, полученные на этапе экстракции из положительного контроля.

Установить пробирки в ячейки реакционного модуля прибора, провести амплификацию и выполнить анализ результатов.

Предложенный набор синтетических олигонуклеотидов позволяет определять наличие возбудителей аэробного вагинита с высокой точностью.

Пример 2. Определение наличия ДНК энтеробактерий семейства Enterobacteriaceae, стафилококков (Staphylococcus spp.) и стрептококков (Streptococcus spp.) в биологическом образце с помощью набора синтетических олигонуклеотидов в составе реакционной смеси раскапаной под прослойку парафина.

Биологический материал (отделяемое слизистой оболочки влагалища) перед проведением ПЦР проводится через процедуру пробоподготовки с использованием набора реагентов для пробоподготовки. В ходе этой процедуры из биологического материала выделяется ДНК, которую, в свою очередь, используют для проведения ПЦР. Вместе с образцами биологического материала процедуру экстракции проходят контрольные образцы - отрицательный контроль и положительный контроль.

Отобрать необходимое количество пробирок с ПЦР-смесью для амплификации ДНК исследуемых и контрольных образцов. Убедиться, что парафин полностью покрывает раствор на дне пробирок.

На поверхность парафина внести буферный раствор с полимеразой, при этом он не должен проваливаться под парафин и смешиваться с ПЦР-смесью.

Внести в подготовленные маркированные пробирки пробы ДНК, полученные в результате экстракции из исследуемых образцов. В специально промаркированную пробирку вносится проба ДНК, полученная на этапе экстракции из отрицательного контроля.

В специально промаркированную пробирку вносится проба ДНК, полученная на этапе экстракции из положительного контроля.

Установить пробирки в ячейки реакционного модуля прибора, провести амплификацию и выполнить анализ результатов.

Предложенный набор синтетических олигонуклеотидов позволяет определять наличие возбудителей аэробного вагинита с высокой точностью.

Пример 3. Определение наличия ДНК энтеробактерий семейства Enterobacteriaceae, стафилококков (Staphylococcus spp.) и стрептококков (Streptococcus spp.) в биологическом образце с помощью набора синтетических олигонуклеотидов в составе лиофильновысушенной реакционной смеси.

Биологический материал (отделяемое слизистой оболочки влагалища) перед проведением ПЦР проводится через процедуру пробоподготовки с использованием набора реагентов для пробоподготовки. В ходе этой процедуры из биологического материала выделяется ДНК, которую, в свою очередь, используют для проведения ПЦР. Вместе с образцами биологического материала процедуру экстракции проходят контрольные образцы - отрицательный контроль и положительный контроль.

Отобрать необходимое количество пробирок или достать 96-луночный планшет для амплификации с готовой лиофилизированной реакционной смесью для амплификации ДНК исследуемых и контрольных образцов.

В подготовленные пробирки или лунки планшета внести по пробу ДНК, полученную в результате экстракции из исследуемых образцов.

Поставить контрольные реакции:

а) в пробирку или лунку планшета с реакционной смесью внести контрольный образец.

б) в пробирку или лунку планшета с реакционной смесью внести контрольный образец.

в) отрицательный контроль экстракции (ОК) - в пробирку или лунку планшета с реакционной смесью внести пробы, экстрагированные из ОКО.

Установить пробирки или планшет в ячейки реакционного модуля прибора, провести амплификацию и выполнить анализ результатов.

Предложенный набор синтетических олигонуклеотидов позволяет определять наличие возбудителей аэробного вагинита с высокой точностью.

Набор синтетических олигонуклеотидов для количественного определения ДНК возбудителей аэробного вагинита: энтеробактерий семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp., стафилококков Staphylococcus spp. и стрептококков Streptococcus spp. в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий в себя праймеры следующих последовательностей Seq. N1 - Seq. N8, также зонды с флуоресцентной меткой, интенсивность флуоресценции которых свидетельствует о количестве образующегося продукта, Seq. N9 - Seq. N12:

CTGGACGAAGACTGACGCTC Seq. N1

GTTTACGGCGTGGACTACCA Seq. N2

GGACAATACAAAGGGCAGCG Seq. N3

CCGGGAACGTATTCACCGTA Seq. N4

CCCCTTATGACCTGGGCTAC Seq. N5

GAGATTTGCTTGCCGTCACC Seq. N6

CGTCTGCGGATGGAGAGTGCAA Seq. N7

GAAGTCCGTCAATAGGCCCACAC Seq. N8

GTGCGAAAGCGTGGGGAGCA Seq. N9

CCGCGAGGTCAAGCAAATCCCA Seq. N10

TGGTTGGTACAACGAGTCGCAAGT Seq. N11

CTAGCTGGGCGTCAGGAATCCCAGG Seq. N12.



 

Похожие патенты:
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Gardnerella vaginalis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Atopobium vaginae в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.

Изобретение относится к области молекулярной биологии, медицины и онкологии. Предложена аналитическая тест-система для определения чувствительности злокачественной опухоли конкретного пациента к онколитической биотерапии на основе мультиплексной ПЦР в режиме реального времени, включающая в себя список генов-маркеров CD74, CFI, CSF3, DNAJC24, FGF5, HCFC2, ИСК, IL15, IL1RAPL2, IL8, ITGA7, LEPR, MAP3K13, MAPKAPK3, MDK, PDGFRA, PDIK1L, PIK3CA, S100PBP, SCARB2, STK4, ТМЕМ54, TNFAIP6, TNFRSF1B, TRAF4 и тканеспецифичных референсных генов-хаускиперов GAPDH, АСТВ, RPN1, GUSB, инструкцию, планшеты для проведения ПЦР и смесь для амплификации.

Изобретение относится к области молекулярной биологии, медицины и онкологии. Предложена аналитическая тест-система для определения чувствительности злокачественной опухоли конкретного пациента к онколитической биотерапии на основе мультиплексной ПЦР в режиме реального времени, включающая в себя список генов-маркеров CD74, CFI, CSF3, DNAJC24, FGF5, HCFC2, ИСК, IL15, IL1RAPL2, IL8, ITGA7, LEPR, MAP3K13, MAPKAPK3, MDK, PDGFRA, PDIK1L, PIK3CA, S100PBP, SCARB2, STK4, ТМЕМ54, TNFAIP6, TNFRSF1B, TRAF4 и тканеспецифичных референсных генов-хаускиперов GAPDH, АСТВ, RPN1, GUSB, инструкцию, планшеты для проведения ПЦР и смесь для амплификации.

Изобретение относится к области медицины, в частности к трансплантологии, и предназначено для анализа гемопоэтического химеризма при исследовании однонуклеотидных полиморфизмов генов фолатного цикла.

Изобретение относится к новым соединениям, которые могут найти применение в медицине, характеризующимся структурной формулой или ,где R1 представляет собой -Н, -СН3; R2 представляет собой –Н, -СН2ОН, -(CH2)2S(O)CH3; R3 представляет собой -Н, pNP, NHS; n=0-5, m=1-3, М+ представляет собой Na+, Li+, K+, (C2H5)(4-y)NHy+ (где у=1,4).

Изобретение относится к области медицины, в частности к гематологии, и предназначено для определения посттрансплантационного донорского химеризма при анализе точечных мутаций замены оснований в генах тромбофилии.

Предложенная группа изобретений относится к области медицины. Предложены способы определения и выбора терапии для пациента и набор для определения, может ли пациент получать пользу от лечения с помощью антагониста VEGF.

Предложенная группа изобретений относится к области молекулярной биологии и медицины. Предложены способ и набор для специфической идентификации по меньшей мере одной последовательности ДНК в образце путем проведения полимеразной цепной реакции (ПЦР), включающие одну пару праймеров, специфичных для этой последовательности ДНК, и пару зондов, в которой один представляет собой олигонуклеотидный мишень-специфичный зонд, имеющий 3'-сегмент, комплементарный идентифицируемому участку последовательности ДНК и содержащий метку, и 5'-сегмент, некомплементарный идентифицируемой последовательности ДНК и содержащий метку, а другой - олигонуклеотидный сигнальный зонд, комплементарный 5'-сегменту мишень-специфичного зонда и содержащий метку.

Предложенная группа изобретений относится к области молекулярной биологии и медицины. Предложены способ и набор для специфической идентификации по меньшей мере одной последовательности ДНК в образце путем проведения полимеразной цепной реакции (ПЦР), включающие одну пару праймеров, специфичных для этой последовательности ДНК, и пару зондов, в которой один представляет собой олигонуклеотидный мишень-специфичный зонд, имеющий 3'-сегмент, комплементарный идентифицируемому участку последовательности ДНК и содержащий метку, и 5'-сегмент, некомплементарный идентифицируемой последовательности ДНК и содержащий метку, а другой - олигонуклеотидный сигнальный зонд, комплементарный 5'-сегменту мишень-специфичного зонда и содержащий метку.

Изобретение относится к экологии, а именно к способу оценки состояния экосистем морских акваторий в зонах влияния источников загрязнения с использованием в качестве тест-объектов морских гидробионтов, культивируемых на плантации акватории, и/или гидробионтов, обитающих на естественных поселениях акватории бухты Козьмина с различной периодичностью.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Gardnerella vaginalis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Atopobium vaginae в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.

Изобретение относится к биотехнологии. Предложены биомаркеры, способы и тест-системы для определения неблагоприятного прогноза при интерстициальной пневмонии (фиброзе легких) у индивидуума, у которого предполагают наличие интерстициальной пневмонии.

Изобретение относится к области биохимии, в частности к генетически модифицированному животному-грызуну, экспрессирующему гуманизированный белок Baff, а также к способу его получения.

Изобретение относится к ветеринарии, а именно к лабораторной диагностике, и может применяться для определения белковых фракций сыворотки крови. Способ определения белковых фракций сыворотки крови, включающий осаждение белковых фракций сыворотки крови фосфатными растворами в 6-ти пробирках, определение оптической плотности по степени мутности растворов и вычисление содержания белковых фракций сыворотки крови, отличается тем, что в пробирку №0 вносят 1,0 мл дистиллированной воды, по 1,0 мл соответствующих рабочих фосфатных растворов в пробирки №№1, 2, 3, 4 и 0,1 мл сыворотки крови, 0,15 мл дистиллированной воды, 0,75 мл основного фосфатного раствора в пробирку №5 с последующим перемешиванием путем перевертывания пробирки №5 и перенесением смеси по 0,1 мл в пробирки №№0, 1, 2, 3, 4, при этом измерение оптической плотности проводят на биохимическом анализаторе.

Изобретение относится к области биологии и может быть использовано при подготовке образцов костной ткани для исследования их пространственной микроструктуры с использованием сканирующего электронного микроскопа.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, способные к специфическому связыванию с фолатным рецептором человека 1 (FOLR1).

Изобретение относится к биотехнологии. Изобретение касается способа диагностики миелоидных новообразований.
Изобретение относится к области медицины и представляет собой способ диагностики липодистрофии, заключающийся в том, что производят фотографирование липоаспирата, расположенного на предметном стекле, с помощью микроскопа, измеряют диаметры адипоцитов на фотографиях и при различии минимального и максимального диаметров адипоцитов более чем в 2 раза определяют липодистрофию.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Gardnerella vaginalis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.

Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для количественного определения ДНК энтеробактерий семейства Enterobacteriaceae, включая Е. coli, Klebsiella spp., Proteus spp., стафилококков Staphylococcus spp. и стрептококков Streptococcus spp. в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой. Изобретение обеспечивает расширение арсенала средств количественного определения ДНК возбудителей аэробного вагинита в слизистой оболочке влагалища. 3 пр.

Наверх