Молекулярные маркеры низкого содержания пальмитиновой кислоты в подсолнечнике (helianthus annus) и способы их применения

Изобретение относится к области биохимии, в частности к способу получения генетического материала подсолнечника. Изобретение позволяет получать генетический материал подсолнечника, который имеет содержание пальмитиновой кислоты менее чем 3,0% от общего содержания масла. 11 з.п. ф-лы, 5 ил., 12 табл., 8 пр.

 

ПРИТЯЗАНИЕ НА ПРИОРИТЕТ

По настоящей заявке испрашивается приоритет по временной патентной заявке США с серийным номером № 61/613383, поданной 20 марта 2012 года.

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение относится к композициям и способам для идентификации растений подсолнечника, которые имеют низкое содержание пальмитиновой кислоты, где в способах используются молекулярные генетические маркеры для идентификации, селекции и/или конструирования растений с низким содержанием пальмитиновой кислоты. Также изобретение относится к растениям подсолнечника, имеющим низкое содержание пальмитиновой кислоты, которые получены способами по изобретению.

УРОВЕНЬ ТЕХНИКИ

Культурный подсолнечник (Helianthus annuus L.) представляет собой основной источник растительного масла в мире. В США ежегодно высевают приблизительно 4 миллиона акров подсолнечника, в основном в Дакотах и Миннесоте.

Очень быстрое расширение в течение последнего десятилетия количества акров, засаженных подсолнечником в США, частично является следствием нескольких важных разработок в области разведения подсолнечника и улучшения сортов, включая открытие цитоплазматической мужской стерильности и генов для восстановления фертильности. Это открытие позволило получение гибридного подсолнечника. Полученные таким образом гибриды были внедрены в ранних 1970-х годах. Описание цитоплазматической мужской стерильности (CMS) и генетического восстановления фертильности у подсолнечника представлено в Fick, "Breeding and Genetics", Sunflower Science and Technology 279-338 (J.F. Carter ed. 1978).

Подсолнечное масло в основном состоит из пальмитиновой (16:0), стеариновой (18:0), олеиновой (18:1), линолевой (18:2) и линоленовой (18:3) жирных кислот. Хотя в растениях существуют другие необычные жирные кислоты, пальмитиновая, стеариновая, олеиновая, линолевая и линоленовая кислоты составляют приблизительно 88% жирных кислот, присутствующих в растительных маслах, продуцируемых в мире. J.L. Harwood, "Plant Acyl Lipids: Structure, Distribution and Analysis", 4 Lipids: Structure and Function, P.K. Stumpf and E.E. Conn ed. (1988). Пальмитиновая и стеариновая кислоты представляют собой насыщенные жирные кислоты, для которых в определенных исследованиях было продемонстрировано, что они вносят вклад в увеличение уровня холестерина в плазме - фактора, участвующего в развитии коронарной болезни сердца. В соответствии с последними исследованиями, растительные масла с высоким содержанием ненасыщенных жирных кислот (таких как олеиновая и линолеиновая кислота) могут иметь способность снижать уровень холестерина в плазме.

Насыщенные жирные кислоты, как правило, также имеют более высокие температуры плавления, чем ненасыщенные жирные кислоты с тем же количеством атомов углерода, что приводит к проблемам устойчивости к низким температурам продуктов питания, и, кроме того, они могут дополнительно обеспечивать ощущение воска или жира во рту во время употребления продукта питания. Также известно, что продукты питания, изготовленные из жиров и масел, имеющие менее чем приблизительно 3% насыщенных жирных кислот, как правило, содержат менее 0,5 граммов насыщенных жиров на одну порцию, и в результате они могут быть маркированы как содержащие "ноль насыщенных жиров" согласно современным правилам маркировки.

Существует множество стадий получения нового желаемого генетического материала растений. Программы разведения растений объединяют желаемые признаки двух или более сортов или различных универсальных источников в набор признаков для разведения, из которых выводят сорта посредством самоопыления и селекции желаемых фенотипов. Новые сорта оценивают для определения того, какой из них обладает коммерческим потенциалом. Разведение растений начинается с анализа и определения проблем и недостатков существующего генетического материала, установления целей программы и определения конкретных задач разведения. Следующей стадией является селекция генетического материала, который обладает признаками, удовлетворяющими цели программы. Целью является объединение в одном сорте улучшенной комбинации желаемых признаков из родительского генетического материала. Эти важные признаки могут включать более высокий выход семян, устойчивость к заболеваниям и насекомым, улучшенные стебли и корни, устойчивость к засухе и жаре и улучшенные агрономические качества.

Выбор способов разведения или селекции зависит от способа размножения растений, наследуемости признака(ов), подлежащего усовершенствованию, и типа сорта, используемого коммерчески (например, гибридный сорт F1, чистолинейный сорт и т.д.). Для признаков с высокой наследуемостью выбор улучшенных индивидуальных растений, оцениваемых на одной местности, может быть эффективным, в то время как для признаков с низкой наследуемостью селекция должна быть основана на средних значениях, полученных при повторяющейся оценке семейств родственных растений. Популярные способы селекции обычно включают селекцию потомков, модифицированную селекцию потомков, массовую селекцию и рекуррентную селекцию.

Сложность наследования влияет на выбор способа разведения. Разведение посредством обратного скрещивания используют для передачи одного или нескольких благоприятных генов для признака с высокой наследуемостью в желаемый сорт. Этот подход широко используют для выведения устойчивых к заболеваниям сортов. Для улучшения количественно наследуемых признаков, контролируемых многочисленными генами, используют различные способы рекуррентной селекции. Использование рекуррентной селекции в самоопыляющихся культурах зависит от простоты опыления, частоты успешных гибридов после каждого опыления и количества гибридных потомков от каждого успешного скрещивания.

Каждая программа разведения должна включать периодическую объективную оценку эффективности методики разведения. Критерии оценки варьируют в зависимости от цели и задач, однако они должны включать прибыль от селекции в год (на основе сравнений с соответствующим стандартом), общую стоимость усовершенствованных выведенных линий и количество успешных сортов, полученных на единицу вложения (например, в год, на потраченный доллар (фунт) и т.д.). Затем перспективные усовершенствованные выведенные линии тщательно исследуют и сравнивают с соответствующими стандартами в условиях окружающей среды, типичных для коммерческой целевой площади(ей), в течение трех или лет. Кандидатов для новых коммерческих сортов выбирают из наилучших линий; линии, все еще являющиеся дефицитными по нескольким признакам, можно использовать в качестве родительских линий для получения новых популяций для дальнейшей селекции. Эти процессы, которые приводят к конечной стадии маркетинга и распространения, обычно отнимают от 8 до 12 лет от времени проведения первого скрещивания. Таким образом, выведение новых сортов является длительным процессом, который требует точного перспективного планирования, эффективного использования ресурсов и минимальных изменений направления.

Наиболее трудной задачей при разведении растений является идентификация особей, которые являются генетически лучшими. Одним из способов идентификации улучшенного растения является наблюдение его характеристик относительно других экспериментальных растений широко выращиваемого стандартного сорта. Если однократное наблюдение является неубедительным, повторные наблюдения обеспечивают лучшую оценку его генетической ценности. Эта задача является настолько трудной, поскольку (для большинства признаков) истинная генетическая ценность маскируется другими искажающими признаками растений или факторами окружающей среды.

Целью выведения растений подсолнечника является выведение новых уникальных и усовершенствованных сортов и гибридов. Растениевод-селекционер первоначально выбирает и скрещивает две или более родительских линии, а затем проводит повторяющееся самоопыление и селекцию, получая множество новых генетических комбинаций. Растениевод-селекционер теоретически может получить миллиарды различных генетических комбинаций посредством скрещивания, самоопыления и мутагенеза. Такой специалист по разведению не имеет прямого контроля процессов на клеточном уровне. Таким образом, два специалиста по разведению никогда не выведут одинаковые линии или даже сходные линии, имеющие одинаковые признаки подсолнечника.

Каждый год растениевод-селекционер проводит селекцию генетического материала для перехода к следующему поколению. Этот генетический материал выращивают в уникальных и различных географических, климатических и почвенных условиях. Затем проводят последующую селекцию во время и в конце сезона выращивания. Выведенные сорта непредсказуемы. Эта непредсказуемость является следствием того, что селекция растениеводом-селекционером осуществляется в уникальных окружающих условиях и не позволяет осуществлять контроль на уровне ДНК (при использовании общепринятых методик выведения), причем получают миллионы различных возможных генетических комбинаций. Растениевод-селекционер, являющийся средним специалистом в данной области, не может предсказать конечные линии, которые он выводит, за исключением, возможно, очень грубой и общей оценки. Аналогично, один и тот же растениевод-селекционер не может получить тот же самый сорт дважды с использованием тех же самых исходных родительских растений и тех же самых способов селекции. Это непредсказуемым образом приводит к расходу больших количеств ресурсов, денежным и прочим расходам, чтобы вывести улучшенные новые сорта подсолнечника.

Выведение новых сортов подсолнечника требует выведения и селекции сортов подсолнечника, скрещивания этих сортов и селекции улучшенных гибридных потомков скрещивания. Гибридные семена получают посредством скрещиваний вручную между выбранными мужскими фертильными растениями или с использованием систем мужской стерильности. Эти гибриды выбирают для определенных признаков единичных генов (например, цвет стручка, цвет цветка, цвет пушка и устойчивость к гербицидам), которые указывают на то, что семена действительно являются гибридными. Данные о родительских линиях, а также о фенотипе гибрида, влияют на решение растениевода-селекционера в отношении того, продолжать ли разведение с конкретным гибридным потомком скрещивания.

Чистопородное разведение широко используют для улучшения самоопыляющихся культур. При чистопородном разведении два родительских растения, которые обладают ценными взаимодополняющими признаками скрещивают с получением потомства F1. Популяцию F2 получают посредством самоопыления одного или нескольких растений из поколения потомства F1. Селекция наилучших особей может начинаться в популяции F2; затем, начиная с F3, отбирают наилучших особей в наилучших семействах. Для повышения эффективности селекции признаков с низкой наследуемостью, повторяющееся исследование семейств можно начинать в поколении F4. На поздней стадии инбридинга (например, F6 или F7), наилучшие линии или смеси линий со сходными фенотипами исследуют в отношении потенциального выпуска в продажу в качестве новых сортов. Массовую и рекуррентную селекцию можно использовать для улучшения популяций либо самоопыляющихся, либо перекрестноопыляющихся культур. Генетически изменчивую популяцию гетерозиготных особей можно либо идентифицировать, либо создавать посредством скрещивания нескольких различных родительских растений. Наилучшие растения можно выбирать на основе индивидуального превосходства, выдающегося потомства или превосходной комбинационной способности. Отобранные растения скрещивают для получения новой популяции, в которой могут быть продолжены дальнейшие циклы селекции.

Разведение способом обратного скрещивания используют для переноса генов признака с простым и высоким наследованием в желаемый гомозиготный сорт или инбредную линию, которая является рекуррентным родителем. Источником признака, подлежащего переносу, является "донорный родитель". Ожидается, что полученное растение будет иметь признаки рекуррентного родителя (например, сорта) и желаемый признак, перенесенный из донорного родителя. После первоначального скрещивания особи, обладающие фенотипом донорного родительского растения, выбирают и многократно скрещивают (подвергают обратному скрещиванию) с рекуррентным родителем. Ожидается, что полученное растение будет иметь признаки рекуррентного растения и желаемый признак, перенесенный из донорного родителя.

При разведении подсолнечника "методика поколения одного семени" относится к посеву сегрегирующей популяции с последующим сбором образца из одного семени на полученное растение и использованием собранного образца из одного семени для выращивания следующего поколения. После перехода популяции от поколения F2 до желаемого уровня инбридинга, каждое из растений, из которых происходят линии, приведет к различным особям F2. Количество растений в популяции уменьшается в каждом поколении, поскольку некоторые семена не прорастают или некоторые растения не продуцируют по меньшей мере одного семени. В результате не все из растений F2, первоначально взятые в качестве образцов, будут представлены потомками после завершения перехода из поколения в поколение.

В методике с множеством семян растениеводы, осуществляющие селекцию подсолнечников, обычно собирают семена от каждого растений в популяции и смешивают их с образованием общей массы. Часть этой общей массы используют для посева следующего поколения, а часть из них сохраняют. Эту методику называют модифицированным потомством одного семени. Методику с множеством семян используют для экономии трудовых ресурсов, вовлеченных в сбор урожая. Значительно быстрее извлечь семена с помощью техники, чем извлечь одно семя из каждого из растений вручную, как в методике с одним семенем. Методика множества семян также делает возможным посев одного и того же количества семян популяции для каждого поколения инбридинга. Для компенсации количества растений, которые не проросли или не продуцировали семя, собирают достаточное количество семян.

Надлежащее исследование должно обнаруживать любые основные ошибки и устанавливать уровень превосходства или улучшения нового сорта относительно текущих сортов. В дополнение к демонстрации улучшенных характеристик, должна существовать потребность в новом сорте, который является совместимым с промышленными стандартами или который создает новый рынок сбыта. В испытаниях, предшествующих выпуску на рынок нового сорта, должны учитываться затраты на исследование и выведение, а также техническое превосходство конечного сорта. Внедрение нового сорта может вовлечь дополнительные затраты производителя семян, растениевода-селекционера, обработчика и потребителя, вследствие специальных требуемых рекламы и маркетинга, действий по производству измененных семян и коммерческому производству, и освоения нового продукта. Для сортов, размножающихся семенами, должно быть возможным простое и экономичное получение семян.

Целью растениевода-селекционера является селекция растений и обогащения популяции растений особями, которые имеют желаемые признаки, например, сниженное содержание пальмитиновой кислоты, в конечном итоге ведущее к увеличенному сельскохозяйственному производству. В соответствии с вышеуказанным, постоянной целью растениеводов-селекционеров является выведение стабильных сортов с высоким выходом, которые являются агрономически целесообразными. Текущие цели включают максимизацию количества зерен, продуцированных на используемой земле и продовольственное снабжение как животных, так и человека. Для осуществления этих целей растениевод-селекционер подсолнечника должен выбирать и разрабатывать растения подсолнечника, которые имеют признаки, которые приводят к улучшенным сортам наиболее экономичным образом. Чтобы способствовать идентификации и селекции особей или семейств особей, которые обладают наследуемыми признаками, которые связаны с маркерами, молекулярные маркеры можно использовать в процессе селекции с помощью маркера (MAS).

ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Молекулярные маркеры, которые связаны с низким содержанием пальмитиновой кислоты, можно использовать для упрощения селекции с помощью маркера признака низкого содержания пальмитиновой кислоты в подсолнечнике. Селекция с помощью маркера обеспечивает значительные преимущества в отношении времени, затрат и трудовых ресурсов по сравнению с фенотипированием содержания пальмитиновой кислоты. В настоящем описании описаны конкретные маркеры, идентифицированные как находящиеся в пределах или вблизи областей QTL низкого содержания пальмитиновой кислоты в геноме подсолнечника, которые являются полиморфными в родительских генотипах и связанными (например, прочно связанными) с фенотипом низкого содержания пальмитиновой кислоты. Эти маркеры обеспечивают увеличенную применимость в селекции с помощью маркера растений и сортов подсолнечника, имеющих низкое содержание пальмитиновой кислоты.

В настоящем описании описаны способы идентификации первого растения подсолнечника, которое проявляет низкое содержание пальмитиновой кислоты, или генетического материала, содержащегося в таком растении подсолнечника. Первое растение подсолнечника или генетический материал, которые проявляют низкое содержание пальмитиновой кислоты, в некоторых примерах могут представлять собой растение или генетический материал, имеющие более низкое содержание (т.е. сниженное) пальмитиновой кислоты, чем в родительской клетке или генетическом материале первого растения или генетического материала. Первое растение подсолнечника или генетический материал, которые проявляют низкое содержание пальмитиновой кислоты, в некоторых примерах могут представлять собой растение или генетический материал, имеющие более низкое содержание пальмитиновой кислоты, чем в конкретном общепринятом растении или генетическом материале того же вида (например, подсолнечник), что и первое растение или генетический материал. Некоторые варианты осуществления таких способов могут включать обнаружение в первом растении подсолнечника или генетическом материале по меньшей мере одного маркера, связанного с низким содержанием пальмитиновой кислоты, где по меньшей мере один маркер выбран из группы, состоящей из: HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907; HA0612A и маркеров, сцепленных (например, прочно связанных) с любым из HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907 и HA0612A.

Также описаны способы получения растения подсолнечника или генетического материала с низким содержанием пальмитиновой кислоты. Некоторые варианты осуществления таких способов могут включать интрогрессию по меньшей мере одного маркера, связанного с низким содержанием пальмитиновой кислоты из первого растения подсолнечника или генетического материала, во второе растение подсолнечника или генетический материал с получением растения подсолнечника или генетического материала, которые, вероятно, имеют низкое содержание пальмитиновой кислоты. В таких примерах по меньшей мере один маркер может быть выбран из группы, состоящей из: HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907; HA0612A; и маркеров, сцепленных с любым из HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907 и HA0612A. Растение подсолнечника или генетический материал, полученные указанными выше способами, также включены в конкретные варианты осуществления.

Некоторые варианты осуществления включают способы получения трансгенного растения подсолнечника. Примеры таких способов могут включать введение одной или нескольких экзогенной молекулы(молекул) нуклеиновой кислоты в заданное растение подсолнечника или его потомство, где по меньшей мере одна или несколько экзогенная молекула(молекул) нуклеиновой кислоты содержит геномную нуклеотидную последовательность подсолнечника, которая сцеплена по меньшей мере c одним маркером, связанным с низким содержанием пальмитиновой кислоты, или где по меньшей мере одна из одной или нескольких молекулы(молекул) нуклеиновой кислоты содержит нуклеотидную последовательность, которая специфически гибридизуется с нуклеотидной последовательностью, которая сцеплена по меньшей мере с одним маркером, который сцеплен с низким содержанием пальмитиновой кислоты. Маркер, сцепленный с низким содержанием пальмитиновой кислоты, может быть выбран из группы, состоящей из: HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907; HA0612A и маркеров, сцепленных с любым из HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907 и HA0612A. В определенных примерах указанных выше способов получения трансгенного растения подсолнечника полученное трансгенное растение подсолнечника может иметь низкое содержание пальмитиновой кислоты.

Некоторые варианты осуществления включают системы и наборы для идентификации растения подсолнечника, которое, вероятно, имеет низкое содержание пальмитиновой кислоты. Конкретные примеры таких систем и наборов могут включать набор зондов нуклеиновой кислоты, каждый из которых содержит нуклеотидную последовательность, которая специфически гибридизуется с нуклеотидной последовательностью, которая сцеплена в подсолнечнике по меньшей мере с одним маркером, который сцеплен с низким содержанием пальмитиновой кислоты. Маркер, который сцеплен в подсолнечнике с низким содержанием пальмитиновой кислоты, может быть выбран из группы, состоящей из: HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907; HA0612A, и маркеров, сцепленных с любым из HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907 и HA0612A. Конкретные примеры систем и наборов для идентификации растения подсолнечника, которые, вероятно, имеют низкое содержание пальмитиновой кислоты, также могут включать детектор, который имеет такую конфигурацию, чтобы обнаруживать один или несколько выходных сигналов из набора зондов нуклеиновой кислоты или их ампликона, тем самым, идентифицируя присутствие или отсутствие по меньшей мере одного маркера, который сцеплен с низким содержанием пальмитиновой кислоты. Конкретные примеры включают инструкции, которые коррелируют с присутствием или отсутствием по меньшей мере одного маркера с вероятным уменьшением содержания пальмитиновой кислоты.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг.1 представлена хроматограмма GC-FID FAME, демонстрирующая идентификацию пиков метилового сложного эфира посредством сравнения с временем удержания метилового сложного эфира эталонных стандартов. Индивидуальные процентные площади вычисляли для всех анализируемых соединений в эталонном стандарте на основе общих интегрированных пиковых площадей. Также инжектировали пустой раствор гептана для идентификации какого-либо загрязнения на GC.

На фиг.2 представлено графическое изображение, демонстрирующее распределение содержания пальмитиновой кислоты в 23040 образцах. Величины, описывающие это распределение, указаны в таблицах 1-2, ниже.

На фиг.3 представлена гистограмма содержания пальмитиновой кислоты в популяции F2 для 384 особей, полученных посредством скрещивания элитной линии подсолнечника с линией, имеющей низкое содержание пальмитиновой кислоты.

На фиг.4 представлено схематическое представление основного локуса группы сцепления 5 (LG5) для низкого содержания пальмитиновой кислоты в подсолнечнике. Было выявлено, что несколько маркеров SSR прочно сцеплены или фланкируют локус, как изображено.

На фиг.5 представлена схема сцепления между локусом низкого содержания пальмитиновой кислоты и несколькими маркерами SSR, демонстрирующая расположение основного QTL низкого содержания пальмитиновой кислоты для LG5. Показатель LOD показан на оси y, и на оси x представлено расстояние маркера от локуса в cM. Показатель LOD определен с использованием протокола множественных интервалов с помощью программного обеспечения Map QTL (J.W. Van Ooijen, M.P. Boer, R.C. Jansen, C. Maliepaard (2002) Map QTL 4.0: программное обеспечение для вычисления положений QTL на генетических картах, Plant Research International, Wageningen, Нидерланды).

СПОСОБ(Ы) ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

I. Обзор нескольких вариантов осуществления

По ряду причин является желательным производство подсолнечного масла, имеющего низкие уровни пальмитиновой и стеариновой кислот и высокие уровни олеиновой или линолеиновой кислот. Варианты осуществления изобретения включают, например, композиции и способы для идентификации растений подсолнечника, имеющих низкое содержание пальмитиновой кислоты, и/или генетического материала, имеющей генотип, который предсказывает и определяет фенотип низкого содержания пальмитиновой кислоты. Способы получения таких растений подсолнечника и генетического материала включены в некоторые варианты осуществления. Такие способы могут включать, например, но не ограничиваясь ими, интрогрессию желаемых маркерных аллелей низкого содержания пальмитиновой кислоты и/или способы генетической трансформации. Растения подсолнечника и/или генетический материал, полученные способами, такими как указанные выше способы, включены в конкретные варианты осуществления. Системы и наборы для селекции растений подсолнечника, имеющих низкое содержание пальмитиновой кислоты, и/или генетического материала, имеющего генотип, который предсказывает или определяет фенотип низкого содержания пальмитиновой кислоты, также являются признаком определенных вариантов осуществления.

Идентификация и селекция растений подсолнечника, имеющих низкое содержание пальмитиновой кислоты, с использованием MAS, могут обеспечить эффективный и экологически безвредный подход получения растений с желаемым содержанием масла. Варианты осуществления настоящего изобретения обеспечивают ряд маркерных локусов подсолнечника и хромосомных интервалов QTL, которые демонстрируют статистически значимую косегрегацию с (и, таким образом, предсказывают и определяют) низким содержанием пальмитиновой кислоты. Обнаружение этих маркеров или дополнительных локусов, сцепленных с этими маркерами, которые, таким образом эквивалентны им, можно использовать в программах селекции с помощью маркеров для получения растений и генетического материала с низким содержанием пальмитиновой кислоты.

Некоторые варианты осуществления относятся к способам идентификации первого растения подсолнечника или генетического материала (например, линия или сорт), которые имеют низкое содержание пальмитиновой кислоты. В некоторых примерах по меньшей мере один аллель одного или нескольких маркерных локусов (например, множество маркерных локусов), которые сцеплены (например, прочно сцеплены) с признаком низкого содержания пальмитиновой кислоты, выявляется/выявляются в первом растении или генетическом материале подсолнечника. Маркерные локусы могут быть выбраны из локусов, представленных на фиг.4, включая: HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, HA0612A и другие маркеры, сцепленные по меньшей мере с одним из вышеуказанных маркеров QTL.

В некоторых примерах множество маркерных локусов может быть выбрано или идентифицировано в том же растении или генетическом материале. Все комбинации, например, HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, HA0612A и прочих маркеров, которые сцеплены по меньшей мере с одним из указанных выше маркеров QTL, могут быть включены в множество маркерных локусов, выбираемых или идентифицируемых в растении или генетическом метериале.

В аспектах некоторых вариантов осуществления содержание пальмитиновой кислоты в растении подсолнечника можно количественно определять с использованием любого пригодного средства или способа, известных в данной области.

Сокращения

AFLP - полиморфизм длин фрагментов амплификации

ASH - аллелеспецифическая гибридизация

CCD - устройство, сопряженное с зарядом

EST - метка экспрессируемой последовательности

FAME - метиловый сложный эфир жирной кислоты

FID - пламенно-ионизационный детектор

GC - газовая хроматография

LCR - лигазная цепная реакция

LG - группа сцепления

LNA - замкнутая нуклеиновая кислота

LOD - логарифм (основание 10) вероятностей

MAS - селекция с помощью маркера

NASBA - амплификация на основе последовательности нуклеиновой кислоты

NIR - ближняя инфракрасная (спектроскопия)

NMR - ядерный магнитный резонанс (спектроскопия)

ORF - открытая рамка считывания

ПЦР - полимеразная цепная реакция

PNA - пептид нуклеиновая кислота

QTL - локус количественных признаков

RAPD - случайным образом амплифицированная полиморфная ДНК

RFLP - полиморфизм длин фрагментов рестрикции

RT-ПЦР - ПЦР c обратной транскриптазой

SNP - однонуклеотидный полиморфизм

SSCP - одноцепочный конформационный полиморфизм

SSR - простой повтор последовательности

III. Термины

Как используют в настоящей заявке, включая формулу изобретения, термины в единственном числе и формы единственного числа включают множественное число упоминаемых объектов, если контекст явно не указывает на иное. Таким образом, например, указание на "растение" также относится к множеству растений. Более того, в зависимости от контекста, использование термина "растение" также может относиться к генетически сходному или идентичному потомству этого растения. Аналогично, термин, "нуклеиновая кислота" может относиться к множеству копий молекулы нуклеиновой кислоты. Аналогично, термин "зонд" может относиться к множеству сходных или идентичных молекул зондов.

Числовые диапазоны включают числа, определяющие диапазон, и включают каждую целочисленную и нецелочисленную долю в определенном диапазоне. Если нет иных указаний, все технические и научные термины, используемые в настоящем описании, обладают тем же значением, которое обычно подразумевает специалист в данной области.

Чтобы упросить обзор различных вариантов осуществления, описанных в настоящем описании, предоставляется следующее пояснение конкретных терминов:

Выделенный: "выделенный" биологический компонент (такой как нуклеиновая кислота или белок) по существу отделен, получен отдельно или очищен от других биологических компонентов в клетке организма, в котором компонент встречается в природе (т.е. другие хромосомные и внехромосомные ДНК и РНК и белки), при обеспечении химического или функционального изменения компонента (например, нуклеиновая кислота может быть выделена из хромосомы посредством разрушения химических связей, соединяющих нуклеиновую кислоту с остальной ДНК в хромосоме). Молекулы нуклеиновой кислоты и белки, которые являются "выделенными", включают молекулы нуклеиновой кислоты и белки, очищенные стандартными способами очистки. Также термин охватывает нуклеиновые кислоты и белки, полученные посредством рекомбинантной экспрессии в клетке-хозяине, а также химически синтезированные молекулы нуклеиновой кислоты, белки и пептиды.

Популяция для картирования: как используют в рамках изобретения, термин "популяция для картирования" может относиться к популяции растений (например, популяция растения подсолнечника), используемой для картирования генов. Популяции для картирования, как правило, получают посредством контролируемого скрещивания родительских генотипов, предоставляемых двумя инбредными линиями. Принятие решения о выборе родительских организмов, моделирование скрещивания для получения популяции для картирования и тип используемых маркеров зависят от гена, подлежащего картированию, доступности маркеров и молекулярной карты. Родительские особи для растений в популяции для картирования должны обладать достаточным варьированием признака по представляющему интерес признаку(ам) как на уровне последовательности нуклеиновой кислоты, так и на уровне фенотипа. Варьирование родительской последовательности нуклеиновой кислоты используют для отслеживания событий рекомбинации в растениях популяции для картирования. Доступность информативных полиморфных маркеров зависит от уровня варьирования последовательности нуклеиновой кислоты. Таким образом, информативные маркеры могут не быть идентифицированы при конкретных скрещиваниях родительских генотипов, хотя такие маркеры могут существовать.

"Генетическая карта" представляет собой описание взаимосвязей генетического сцепления среди локусов на одной или нескольких хромосомах (или группах сцепления) в данном виде, что может быть определено с помощью анализа популяции для картирования. В некоторых примерах генетическая карта может быть изображена в форме диаграммы или таблицы. Термин "генетическое картирование" может относиться к процессу определения взаимосвязей сцепления с использованием генетических маркеров, картированию популяций, сегрегирующих по маркерам, и стандартным генетическим принципам частоты рекомбинации. "Положение на генетической карте" относится к положению на генетической карте (относительно окружающих генетических маркеров в той же группе сцепления или хромосоме), где конкретный маркер может встречаться у данного вида. Напротив, "физическая карта генома" относится к абсолютным расстояниям (например, измеряемым в парах оснований или изолированных и перекрывающихся смежных генетических фрагментах) между маркерами в данном виде. Физическая карта генов не обязательно отражает истинную частоту рекомбинации, наблюдаемую при тестовом скрещивании видов, между различными точками на физической карте.

Скрещивание: как используют в рамках изобретения, термин "скрещивание" или "скрещенный" относится к слиянию гамет посредством опыления с образованием потомства (например, клеток, семян и растений). Этот термин охватывают как половое скрещивание (т.е. опыление одного растения другим), так и селфинг (т.е. самоопыление, например, с использованием пыльцы и яйцеклетки одного и того же растения).

Обратное скрещивание: для введения последовательности нуклеиновой кислоты в растения можно использовать способы обратного скрещивания. Способ обратного скрещивания широко используется в течение десятилетий для введения новых признаков в растения. N. Jensen, Ed. Plant Breeding Methodology, John Wiley & Sons, Inc., 1988. В типичном протоколе обратного скрещивания исходный представляющий интерес сорт (рекуррентный родитель) скрещивают со вторым сортом (нерекуррентный родитель), который содержит представляющий интерес ген, подлежащий переносу. Затем потомство, полученное с помощью этого скрещивания, вновь скрещивают с рекуррентным родителем, и процесс повторяют до тех пор, пока не получат растение, где по существу все из желаемых морфологических и физиологических характеристик рекуррентного родительского растения воспроизведены в преобразованном растении, в дополнение к перенесенному гену из нерекуррентного родителя.

Интрогрессия: Как используют в рамках изобретения, термин "интрогрессия" относится к переносу аллеля на генетическом локусе в генетический фон. В некоторых вариантах осуществления интрогрессия конкретной формы аллеля в локусе может происходить путем передачи аллеля по меньшей мере одному потомку посредством полового скрещивания между двумя родителями одного и того же вида, где по меньшей мере один из родителей имеет конкретную форму аллеля в его геноме. Потомство, содержащее конкретную форму аллеля, можно повторно скрещивать с линией, имеющей желаемый генетический фон. Потомство обратного скрещивания можно выбирать для конкретной формы аллеля, чтобы получить новый сорт, где конкретная форма аллеля является фиксированной в генетическом фоне. В некоторых вариантах осуществления интрогрессия конкретной формы аллеля может происходить посредством рекомбинации двух донорных геномов (например, в слитом протопласте), где по меньшей мере один из донорных геномов имеет конкретную форму аллеля в его геноме. Интрогрессия может вовлекать передачу конкретной формы аллеля, которая может представлять собой, например, но не ограничиваясь этим, выбранную форму маркерного аллеля; QTL и/или трансген.

Генетический материал: как используют в рамках изобретения, термин "генетический материал" относится к генетическому материалу отдельного растения, группы растений (например, линия, сорт и семейство растений), и клону, происходящему из растения или группы растений. Генетический материал может быть частью организма или клетки, или она может быть отдельной (например, выделенной) от организма или клетки. Как правило, генетический материал обеспечивает генетический материал с конкретным молекулярным составом, который является основной наследуемых качеств растения. Как используют в рамках изобретения, "генетический материал" относится к клеткам конкретного растения; семени; ткани конкретного растения (например, ткань, из которой можно выращивать новые растения); и происходящим не из семян частям конкретного растения (например, листья, стебель, пыльца и клетки).

Как используют в рамках изобретения, термин "генетический материал" является синонимом "генетического материала", который можно использовать для обозначения семени (или другого растительного материала), посредством которого растение может быть размножено. "Банк генетического материала" может относиться к организованной коллекции различных семян или другого генетического материала (где каждый генотип является уникально идентифицированным), из которого можно культивировать известный сорт, и из которого можно получать новый сорт. В вариантах осуществления генетический материал, используемый в способе или растении, как описано в настоящем описании, происходит из линии или сорта подсолнечника. В конкретных примерах генетический материал представляет собой семена линии или сорта подсолнечника. В конкретных примерах генетический материал представляет собой образец нуклеиновой кислоты из линии или сорта подсолнечника.

Ген: как используют в рамках изобретения, термин "ген" (или "генетический элемент") может относиться к наследуемой геномной последовательности ДНК, имеющей функциональную значимость. Термин "ген" также можно использовать для обозначения, например, но не ограничиваясь этим, кДНК и/или мРНК, кодируемой наследуемой последовательностью геномной ДНК.

Генотип: как используют в рамках изобретения, термин "генотип" относится к генетическому набору особи (или группы особей) в одном или нескольких конкретных локусах. Генотип особи или группы особей определяется и описывается аллельными формами в одном или нескольких локусах, которые особь унаследовала от ее родителей. Термин "генотип" также можно использовать для обозначения генетического набора особи в одном локусе, в нескольких локусах или во всех локусах его генома. "Гаплотип" представляет собой генотип особи в нескольких генетических локусах. В некоторых примерах генетические локусы, описываемые гаплотипом, могут быть физически и генетически сцепленными; т.е. локусы могут быть расположены на одном и том же сегменте хромосомы.

Локус количественных признаков: в геноме организма могут быть картированы конкретные хромосомные локусы (или интервалы), которые коррелируют с конкретным количественными фенотипами. Такие локусы называют локусами количественных признаков или QTL. Как используют в рамках изобретения термин "локус количественных признаков" (QTL) может относиться к участкам ДНК, которые идентифицированы как вероятные последовательности ДНК (например, гены, некодирующие последовательности и/или межгенные последовательности), которые лежат в основе количественного признака или фенотипа, степень которого варьирует, и он может обозначать взаимодействия между двумя или более последовательностями ДНК (например, гены, некодирующие последовательности и/или межгенные последовательности) или их продуктами экспрессии и их окружением. Таким образом, термин "локус количественных признаков" включает полиморфные генетические локусы по меньшей мере с двумя аллелями, которые по-разному обеспечивают экспрессию фенотипического признака по меньшей мере в одном генетическом фоне (например, по меньшей мере в одной популяции для разведения или потомке). На практике, QTL можно молекулярно идентифицировать, чтобы облегчить картирование областей генома, которые содержат последовательности, вовлеченные в обеспечение количественного признака, такого как уменьшенное содержание пальмитиновой кислоты.

Как используют в рамках изобретения, термин "интервал QTL" может относиться к участкам ДНК, которые сцеплены с генами, которые лежат в основе признака QTL. Интервал QTL обычно, но не обязательно, имеет больший размер, чем сам QTL. Интервал QTL может содержать участки ДНК, которые находятся с 5'-стороны и/или 3'-стороны от QTL.

Было разработано множество экспериментальных моделей для идентификации и анализа QTL. См., например, Jansen (1996) Trends Plant Sci. 1:89. Большинство из опубликованных сообщений о картировании QTL в сельскохозяйственных культурах было основано на использовании скрещивания двух родителей (Lynch and Walsh (1997) Genetics and Analysis of Quantitative Traits, Sinauer Associates, Sunderland). Как правило, эти модели вовлекают скрещивание одной или нескольких родительских пар, которые могут представлять собой, например, одну пару, происходящую из двух инбредных линий или множество родственных или неродственных родителей различных инбредных штаммов или линий, каждый из которых обладает отличающимися характеристиками относительно представляющего интерес фенотипического признака. Как правило, этот экспериментальный протокол вовлекает получение от 100 до 300 сегрегирующих потомков от одного скрещивания двух дивергентных инбредных линий, которые, например, выбраны так, чтобы максимизировать фенотипические и молекулярные отличия маркеров между линиями. Родительские растения и сегрегирующие потомки генотипируют по множеству маркерных локусов и оценивают в отношении от одного до нескольких количественных признаков (например, устойчивость к заболеванию). Затем QTL идентифицируют как значимые статистические ассоциации между генотипическими величинами и фенотипической вариабельностью среди сегрегирующего потомства. Эффективность этого экспериментального протокола является результатом использования инбредного скрещивания, поскольку все полученные родительские организмы F1 имеют одну и ту же фазу сцепления (то, как аллели объединены в родительском поколении). Таким образом, после самоопыления растений F1 все сегрегирующие потомки F2 являются информативными, и неравновесие по сцеплению является максимизированным, фаза сцепления известна, существует только два аллеля QTL и (за исключением потомков обратного скрещивания) частота каждого аллеля QTL составляет 0,5.

Многочисленные статистические методы для определения того, являются ли маркеры генетически сцепленными с QTL (или с другим маркером), известны специалистам в данной области и включают, например, но не ограничиваясь ими, стандартные линейные модели, такие как ANOVA или регрессионное картирование (Haley and Knott (1992) Heredity 69:315); и способы максимальной вероятности, такие как алгоритмы ожидания-максимизации (например, Lander and Botstein (1989) Genetics 121: 185-99; Jansen (1992) Theor. Appl. Genet. 85:252-60; Jansen (1993) Biometrics 49:227-31; Jansen (1994) "Mapping of quantitative trait loci by using genetic markers: an overview of biometrical models," J.W. van Ooijen and J. Jansen (eds.), Biometrics in Plant breeding: applications of molecular markers, pp. 116-24, CPRO-DLO Netherlands; Jansen (1996) Genetics 142:305-11; и Jansen and Stam (1994) Genetics 136:1447-55).

Иллюстративные статистические методы включают одноточечный анализ маркеров; картирование интервалов (Lander and Botstein (1989) Genetics 121: 185); комбинированное картирование интервалов; регрессионный анализ со штрафами; комплексный анализ потомков; анализ MCMC; анализ MQM (Jansen (1994) Genetics 138:871); анализ HAPLO-IM+, анализ HAPLO-MQM и анализ HAPLO-MQM+; байесовский MCMC; гребневую регрессию; анализ идентичности по наследованию; и регрессию Haseman-Elston, любые из которых являются пригодными в контексте конкретных вариантов осуществления изобретения. Альтернативные статистические методы, применимые для комплексных популяций для разведения, которые можно использовать для идентификации и локализации QTL, в конкретных примерах описаны в патенте США 6399855 и международной публикации патента PCT № WO0149104 A2. Все из этих подходов требуют большого объема вычислений, и их обычно выполняют с помощью компьютерной системы и специализированного программного обеспечения. Подходящие статистические пакеты являются доступными от различных общественных и коммерческих источников и известны специалистам в данной области.

Маркер: хотя конкретные последовательности ДНК, которые кодируют белки, как правило, являются высококонсервативными у вида, другие области ДНК (например, некодирующая ДНК и интроны) имеют тенденцию к развитию и накоплению полиморфизма, и, таким образом, могут варьировать между особями одного и того же вида. Геномная вариабельность может иметь любое происхождение, например, вариабельность может быть следствием инсерций, делеций, дупликаций ДНК, повторяющихся элементов ДНК, точковых мутаций, событий рекомбинации и присутствия и последовательности транспозируемых элементов. Такие области могут содержать пригодные молекулярные генетические маркеры. Как правило, любой дифференциально наследуемый полиморфный признак (включая полиморфизмы нуклеиновых кислот), который сегрегирует у потомков, является потенциальным маркером.

Как используют в рамках изобретения, термины "маркер" и "молекулярный маркер" относятся к нуклеотидной последовательности или кодируемому ей продукту (например, белку), используемому в качестве исходной точки при идентификации сцепленного локуса. Таким образом, маркер может относиться к гену или нуклеотидной последовательности, которые можно использовать для идентификации растений, имеющих конкретный аллель. Маркер может быть описан как изменение в данном геномном локусе. Генетический маркер может представлять собой короткую последовательность ДНК, такую как последовательность, окружающую изменение одной пары оснований (однонуклеотидный полиморфизм или "SNP"), или длинную последовательность, например, микросателлитный/простой повтор последовательности ("SSR"). "Маркерный аллель" или "форма маркерного аллеля" относятся к версии маркера, которая присутствует у конкретной особи. Термин "маркер", как используют в рамках изобретения, может относиться к клонированному сегменту хромосомной ДНК, и он также или альтернативно может относиться к молекуле ДНК, которая комплементарна клонированному сегменту хромосомной ДНК. Также термин относится к последовательностям нуклеиновой кислоты, комплементарным геномным маркерным последовательностям, таким как праймеры и зонды нуклеиновой кислоты.

Маркер может быть описан, например, как конкретный полиморфный генетический элемент в конкретном положении в генетической карте организма. Генетическая карта может представлять собой графическое представление генома (или части генома, такой как одна хромосома) где расстояния между опознавательными ориентирами на хромосоме измеряют по частоте рекомбинаций между опознавательными ориентирами. Генетический опознавательный ориентир может представлять собой любой тип известных полиморфных маркеров, например, но не ограничиваясь ими: маркеры в форме простого повтора последовательности (SSR); маркеры в форме полиморфизма длин фрагментов рестрикции (RFLP) и маркеры в форме однонуклеотидного полиморфизма (SNP). В качестве одного примера, маркеры SSR могут происходить из геномных или экспрессированных нуклеиновых кислот (например, экспрессированные метки последовательности (EST)).

Дополнительные маркеры включают, например, но не ограничиваясь ими, EST; полиморфизмы длин амплифицированных фрагментов (AFLP) (Vos et al. (1995) Nucl. Acids Res. 23:4407; Becker et al. (1995) Mol. Gen. Genet. 249:65; Meksem et al. (1995) Mol. Gen. Genet. 249:74); случайным образом амплифицированную полиморфную ДНК (RAPD) и изоферментные маркеры. Изоферментные маркеры можно использовать в качестве генетических маркеров, например, для отслеживания изоферментных маркеров или других типов маркеров, которые сцеплены с конкретным первым маркером. Изоферменты представляют собой множественные формы ферментов, которые отличаются друг от друга аминокислотной последовательностью (и, таким образом, их кодирующими последовательностями нуклеиновой кислоты). Некоторые изоферменты представляют собой мультимерные ферменты, содержащие немного отличающиеся субъединицы. Другие изоферменты являются либо мультимерными, либо мономерными, но отщеплены от профермента в различных участках аминокислотной последовательности профермента. Изоферменты могут быть охарактеризованы и проанализированы на белковом уровне или на уровне нуклеиновой кислоты. Таким образом, в конкретных примерах любой из способов на основе нуклеиновых кислот, описанных в настоящем описании, можно использовать для анализа изоферментных маркеров.

"Генетические маркеры" включают аллели, которые являются полиморфными в популяции, где аллели могут быть выявлены и охарактеризованы одним или несколькими аналитическими способами (например, анализ RFLP, анализ AFLP, анализ изоферментных маркеров, анализ SNP и анализ SSR). Термин "генетический маркер" также может относиться к генетическому локусу ("маркерный локус"), который можно использовать в качестве исходной точки при идентификации генетически сцепленного локуса (например, QTL). Такой маркер также может быть обозначен как "маркер QTL".

Природа указанных выше физических опознавательных ориентиров (и способы, используемые для их выявления) варьирует, однако все из этих маркеров физически различимы друг от друга (а также от множества аллелей любого конкретного маркера), исходя из длины и/или последовательности полинуклеотида. Многочисленные способы выявления молекулярных маркеров и идентификации маркерных аллелей являются общеизвестными. Специалисту в данной области известен широкий диапазон протоколов для выявления этой вариабельности, и эти протоколы часто являются специфичными к типу полиморфизма, для выявления которого они разработаны. Такие протоколы включают, например, но не ограничиваясь ими, амплификацию способом ПЦР; выявление одноцепочечного конформационного полиморфизма (SSCP), например, посредством электрофореза; и самоподдерживающуюся репликацию последовательностей (3SR) (см. Chan and Fox (1999) Reviews in Medical Microbiology 10: 185-96).

Главной мотивацией для разработки технологий молекулярных маркеров с точки зрения растениеводов-селекционеров является увеличение эффективности разведения с помощью MAS. Молекулярный маркер, который демонстрирует неравновесие по сцеплению с желаемым фенотипическим признаком (например, QTL), обеспечивает пригодный инструмент для селекции желаемого признака в популяции растений. Ключевыми компонентами для осуществления подхода MAS являются создание плотной (информационно-обогащенной) генетической карты молекулярных маркеров в генетическом материале растений; выявление по меньшей мере одного QTL на основе статистических ассоциаций между маркерной и фенотипической вариабельностью; определение набора конкретных пригодных маркерных аллелей на основе результатов анализа QTL; и использование и/или экстраполяция этой информации к текущему набору генетического материала для разведения, чтобы стало возможным принятие решений о селекции, исходя из маркера.

Генетическую вариабельность, например, при определении в популяции для картирования, можно наблюдать между различными популяциями одного и того же вида (например, подсолнечник). Несмотря на вариабельность генетической карты, которая может существовать между популяциями одного и того же вида, генетическая карта и информация о маркере, полученные для одной популяции, как правило, остаются пригодными для множества популяций для целей идентификации и/или селекции растений и/или генетического материала, содержащих признаки, которые сцеплены с маркерами, и негативной селекции растений и/или генетического материала, содержащих нежелательные признаки.

Два типа маркеров, используемых в конкретных протоколах MAS, описанных в настоящем описании, представляют собой маркеры SSR и маркеры SNP. Маркеры SSR включают любой тип молекулярной гетерогенности, который приводит к вариабельности длины последовательности нуклеиновой кислоты. Иллюстративные маркеры SSR представляют собой короткие (вплоть до нескольких сотен пар оснований) сегменты ДНК, которые состоят из множества тандемных повторов двух или трех последовательностей пар оснований. Эти повторяющиеся последовательности приводят к высокополиморфным областям ДНК вариабельной длины вследствие низкой точности репликации (например, вследствие проскальзывания полимеразы). SSR, по-видимому, случайным образом распределены по геному и генетически фланкируются консервативными областями. Маркеры SSR также могут происходить из последовательностей РНК (в форме кДНК, частичной кДНК или EST), а также геномного материала.

Гетерогенность маркеров SSR делает их высокопригодными для применения в качестве молекулярных генетических маркеров. Например, геномная вариабельность SSR наследуется, и она является мультиаллельной, кодоминантной и воспроизводимо обнаруживаемой. Распространение все в большей степени сложных способов выявления на основе амплификации (например, способы на основе ПЦР) обеспечивает множество чувствительных способов для выявления гетерогенности нуклеотидной последовательности между образцами. Зонды (например, праймеры нуклеиновой кислоты) можно конструировать так, чтобы они гибридизовались с консервативными областями, которые фланкируют SSR, и зонды можно использовать для амплификации вариабельной области SSR. Ампликоны различных размеров, полученные из области SSR, имеют характерные и воспроизводимые размеры. Ампликоны SSR различных размеров, наблюдаемые на двух гомологичных хромосомах особи или различных особей в популяции растений, определяют маркерные аллели SSR. Поскольку существует по меньшей мере два маркерных аллеля SSR, которые продуцируют продукты ПЦР различных размеров, SSR можно использовать в качестве маркера.

(Не)равновесие по сцеплению: как используют в рамках изобретения, термин "равновесие по сцеплению" относится к ситуации, где два маркера независимо сегрегируют; т.е. маркеры не распределяются случайным образом среди потомков. Маркеры, которые демонстрируют неравновесие по сцеплению, считают несцепленными (независимо от того, лежат ли они на одной и той же хромосоме). Как используют в рамках изобретения, термин "неравновесие по сцеплению" относится к ситуации, где два маркера сегрегируют неслучайным образом; т.е. маркеры имеют частоту рекомбинации менее 50% (и, таким образом, по определению разделены менее чем на 50 cM на одной и той же группе сцепления). В некоторых примерах маркеры, которые демонстрируют неравновесие по сцеплению, считают сцепленными.

Сцепленный, прочно сцепленный и очень прочно сцепленный: как используют в рамках изобретения, сцепление между генами и маркерами может относиться к явлению, когда гены или маркеры на хромосоме демонстрируют поддающуюся измерению вероятность передачи вместе в следующее поколение. Таким образом, сцепление одного маркера с другим маркером или геном можно измерять и/или выражать в качестве частоты рекомбинаций. Чем ближе два гена или маркера находятся друг к другу, тем ближе эта вероятность к "1". Таким образом, термин "сцепленный" может относиться к одному или нескольким генам или маркерам, которые передаются вместе с геном с вероятностью более 0,5 (которая ожидается вследствие независимого расхождения, где маркеры/гены расположены на различных хромосомах). Когда присутствие гена приводит к фенотипу у особи, маркеры, которые сцеплены с геном, можно называть сцепленными с фенотипом. Таким образом, термин "сцепленный" может относиться к взаимосвязи между маркером и геном, или между маркером и фенотипом.

Относительное генетическое расстояние (определяемое по частотам кроссинговера и измеряемое в сантиморганах (cM)), как правило, пропорционально физическому расстоянию (измеряемому в парах оснований), на которое два сцепленных маркера или гены отделены друг от друга на хромосоме. Один сантиморган определяют как расстояние между двумя генетическими маркерами, которое демонстрирует частоту рекомбинации 1% (т.е. событие кроссинговера происходит между двумя маркерами один раз каждые 100 делений клеток). Как правило, чем ближе один маркер к другому маркеру или гену (независимо от того, измеряют ли расстояние между ними в значениях генетического расстояния или физического расстояния), тем более прочно они сцеплены. Поскольку хромосомное расстояние приблизительно пропорционально частоте событий рекомбинации между признаками, существует приблизительное физическое расстояние, которое коррелирует с частотой рекомбинации. Например, в подсолнечнике 1 cM коррелирует, в среднем, приблизительно с 400 т.п.н.

Таким образом, термин "сцепленный" в рамках настоящего изобретения может относиться к одному или нескольким генам или маркерам, которые физически расположены в пределах приблизительно 4,0 Мб друг от друга на одной и той же хромосоме подсолнечника (т.е. приблизительно 10 cM). Таким образом, два "сцепленных" гена или маркера могут быть разделены на 4,1 Мб; приблизительно на 4,0 Мб; приблизительно на 3,0 Мб; приблизительно на 2,5 Мб; 2,1 Мб; 2,00 Мб; приблизительно на 1,95 Мб; приблизительно на 1,90 Мб; приблизительно на 1,85 Мб; приблизительно на 1,80 Мб; приблизительно на 1,75 Мб; приблизительно на 1,70 Мб; приблизительно на 1,65 Мб; приблизительно на 1,60 Мб; приблизительно на 1,55 Мб; приблизительно на 1,50 Мб; приблизительно на 1,45 Мб; приблизительно на 1,40 Мб; приблизительно на 1,35 Мб; приблизительно на 1,30 Мб; приблизительно на 1,25 Мб; приблизительно на 1,20 Мб; приблизительно на 1,15 Мб; приблизительно на 1,10 Мб; приблизительно на 1,05 Мб; приблизительно на 1,00 Мб; приблизительно на 0,95 Мб; приблизительно на 0,90 Мб; приблизительно на 0,85 Мб; приблизительно на 0,80 Мб; приблизительно на 0,75 Мб; приблизительно на 0,70 Мб; приблизительно на 0,65 Мб; приблизительно на 0,60 Мб; приблизительно на 0,55 Мб; приблизительно на 0,50 Мб; приблизительно на 0,45 Мб; приблизительно на 0,40 Мб; приблизительно на 0,35 Мб; приблизительно на 0,30 Мб; приблизительно на 0,25 Мб; приблизительно на 0,20 Мб; приблизительно на 0,15 Мб; приблизительно на 0,10 Мб; приблизительно на 0,05 Мб; приблизительно на 0,025 Мб и приблизительно на 0,01 Мб.

Как используют в рамках изобретения, термин "прочно сцепленный" может относиться к одному или нескольким генам или маркерам, которые расположены в пределах приблизительно 2,0 Мб друг от друга на одной и той же хромосоме. Таким образом, два "прочно сцепленных" гена или маркера могут быть разделены на 2,1 Мб; приблизительно 1,75 Мб; приблизительно 1,5 Мб; приблизительно 1,0 Мб; приблизительно 0,9 Мб; приблизительно 0,8 Мб; приблизительно 0,7 Мб; приблизительно 0,6 Мб; приблизительно 0,55 Мб; 0,5 Мб; приблизительно 0,45 Мб; приблизительно 0,4 Мб; приблизительно 0,35 Мб; приблизительно 0,3 Мб; приблизительно 0,25 Мб; приблизительно 0,2 Мб; приблизительно 0,15 Мб; приблизительно 0,1 Мб; и приблизительно 0,05 Мб.

Как используют в рамках изобретения, термин "очень прочно сцепленный" может относиться к одному или нескольким генам или маркерам, которые расположены в пределах приблизительно 500 т.п.н. друг от друга на одной и той же хромосоме. Таким образом, два "очень прочно сцепленных" гена или маркера могут быть разделены приблизительно на 600 т.п.н.; приблизительно на 450 т.п.н.; приблизительно на 400 т.п.н.; приблизительно на 350 т.п.н.; приблизительно на 300 т.п.н.; приблизительно на 250 т.п.н.; приблизительно на 200 т.п.н.; приблизительно на 175 т.п.н.; приблизительно на 150 т.п.н.; приблизительно на 125 т.п.н.; приблизительно на 120 т.п.н.; приблизительно на 115 т.п.н.; приблизительно на 110 т.п.н.; приблизительно на 105 т.п.н.; 100 т.п.н.; приблизительно на 95 т.п.н.; приблизительно на 90 т.п.н.; приблизительно на 85 т.п.н.; приблизительно на 80 т.п.н.; приблизительно на 75 т.п.н.; приблизительно на 70 т.п.н.; приблизительно на 65 т.п.н.; приблизительно на 60 т.п.н.; приблизительно на 55 т.п.н.; приблизительно на 50 т.п.н.; приблизительно на 45 т.п.н.; приблизительно на 40 т.п.н.; приблизительно на 35 т.п.н.; приблизительно на 30 т.п.н.; приблизительно на 25 т.п.н.; приблизительно на 20 т.п.н.; приблизительно на 15 т.п.н.; приблизительно на 10 т.п.н.; приблизительно на 5 т.п.н. и приблизительно на 1 т.п.н.

Чем ближе конкретный маркер находится к гену, который кодирует полипептид, который вносит вклад в конкретный фенотип (независимо от того, измеряется ли расстояние в значениях генетического или физического расстояния), тем более прочно сцеплен конкретный маркер с фенотипом. Ввиду вышесказанного, будет понятно, что маркеры, сцепленные с конкретным геном или фенотипом, включают маркеры, которые прочно сцеплены, и маркеры, которые очень прочно сцеплены, с геном или фенотипом. В некоторых вариантах осуществления чем ближе конкретный маркер находится гену, который кодирует полипептид, который обеспечивает фенотип низкого содержания пальмитиновой кислоты (независимо от того, измеряется ли расстояние в значениях генетического или физического расстояния), тем более прочно сцеплен конкретный маркер с фенотипом низкого содержания пальмитиновой кислоты. Таким образом, сцепленные, прочно сцепленные и очень прочно сцепленные генетические маркеры фенотипа низкого содержания пальмитиновой кислоты в подсолнечнике, могут быть пригодными в программах MAS для идентификации сортов подсолнечника, имеющих сниженное содержание пальмитиновой кислоты (по сравнению с родительскими сортами и/или по меньшей мере одним конкретным общепринятым сортом), для идентификации растений подсолнечника, имеющих сниженное содержание пальмитиновой кислоты и для выведения этого признака в других сортах подсолнечника для снижения содержания пальмитиновой кислоты.

В некоторых вариантах осуществления взаимосвязь сцепления между конкретным маркером и фенотипом можно выражать в качестве "вероятности" или "вероятности с поправкой". В данном контексте, величина вероятности представляет собой статистическую вероятность того, что конкретная комбинация фенотипа и присутствия или отсутствия конкретной формы маркерного аллеля являются случайными. Таким образом, чем ниже показатель вероятности, тем большей является вероятность того, что фенотип и конкретная форма маркерного аллеля будут косегрегировать. В некоторых примерах показатель вероятности может быть описан как "значимый" или "незначимый". В конкретных примерах показатель вероятности 0,05 (p=0,05 (вероятность 5%)) случайного расхождения считается "значимым" показателем косегрегации. Однако в других примерах значимая вероятность может представлять собой любую вероятность менее 50% (p=0,5). Например, значимая вероятность может быть менее 0,25; менее 0,20; менее 0,15 или менее 0,1.

В некоторых вариантах осуществления маркер, который сцеплен с фенотипом низкого содержания пальмитиновой кислоты, может быть выбран из маркеров QTL группы сцепления 5 подсолнечника, которые проиллюстрированы на фиг.4. В некоторых вариантах осуществления маркер, который сцеплен с фенотипом низкого содержания пальмитиновой кислоты, выбран из маркеров, которые расположены в пределах приблизительно 10 cM от маркера QTL, проиллюстрированного на фиг.4. Таким образом, маркер, который сцеплен с фенотипом низкого содержания пальмитиновой кислоты, может находиться, например, в пределах 10 cM; 9 cM; 8 cM; 7 cM; 6 cM; 5 cM; 4 cM; 3 cM; 2 cM; 1 cM; 0,75 cM; 0,5 cM; 0,25 cM или менее, от маркера QTL, проиллюстрированного на фиг.4.

Растениевод-селекционер может преимущественно использовать молекулярные маркеры для идентификации желаемых особей посредством идентификации маркерных аллелей, которые демонстрируют статистически значимую вероятность косегрегации с желаемым фенотипом (например, низкое содержание пальмитиновой кислоты), проявляющуюся как неравновесие по сцеплению. Посредством идентификации молекулярного маркера или кластеров молекулярных маркеров, которые косегрегируют с количественным признаком, растениевод-селекционер, таким образом, идентифицирует QTL. Посредством идентификации и селекции маркерного аллеля (или желаемых аллелей из множества маркеров), который ассоциирует с желаемым фенотипом, растениевод-селекционер способен быстро выбирать фенотип путем выбора надлежащего молекулярного маркерного аллеля (т.е. MAS). Чем больше молекулярных маркеров, которые помещены на генетическую карту, тем более потенциально пригодной эта карта становится для проведения MAS.

Набор маркеров: как используют в рамках изобретения, "набор" маркеров или зондов относится к конкретной коллекции маркеров или зондов (или данным, полученным на ее основе), которую можно использовать для идентификации особей, имеющих представляющий интерес признак. В некоторых вариантах осуществления набор маркеров, сцепленных с фенотипом низкого содержания пальмитиновой кислоты, можно использовать для идентификации растений подсолнечника, имеющих низкое содержание пальмитиновой кислоты. Данные, соответствующие набору маркеров или набору зондов (или, данные, полученные посредством использования таких маркеров или зондов) можно сохранять на электронном носителе. В то время как каждый маркер в наборе маркеров может быть применимым в отношении идентификации признака, индивидуальные маркеры, выбранные из набора и поднаборов, включающих некоторые, но не все, маркеры также могут быть эффективными для идентификации особей, содержащих представляющий интерес признак.

Аллель: Как используют в рамках изобретения, термин "аллель" относится к одной из двух или более различных нуклеотидных последовательностей, которые встречаются в конкретном локусе. Например, первый аллель может находиться на одной хромосоме, в то время как второй аллель может находиться на второй гомологичной хромосоме; например, как происходит для различных хромосом гетерозиготной особи, или между различными гомозиготными или гетерозиготными особями в популяции. В некоторых вариантах осуществления конкретный аллель в конкретном локусе может быть сцеплен с агрономически желательным фенотипом (например, низкое содержание пальмитиновой кислоты). В некоторых вариантах осуществления конкретный аллель в локусе может обеспечить идентификацию растений, которые не содержат агрономически желаемый фенотип (например, растения с высоким содержанием пальмитиновой кислоты), так что эти растения можно устранять из программы разведения или посева. Маркерный аллель может сегрегировать с благоприятным фенотипом, таким образом, обеспечивая пользу идентификации растений, содержащих фенотип. "Аллельная форма сегмента хромосомы" может относиться к сегменту хромосомы, который содержит нуклеотидную последовательность маркерного аллеля, которая вносит вклад или сцеплена с конкретным фенотипом в одном или нескольких генетических локусах, физически расположенных на сегменте хромосомы.

"Аллельная частота" может относиться к частоте (выражаемой в качестве доли или процента) в которой каждый аллель присутствует в локусе в растении, в линии или в популяции линий. Таким образом, для аллеля "A" диплоидная особь с генотипом "AA", "Aa" или "aa" имеет аллельную частоту 1,0, 0,5 или 0,0, соответственно. Аллельную частоту в линии можно оценивать посредством усреднения аллельных частот образца особей этой линии. Аналогично, аллельную частоту в популяции линий можно вычислять посредством усреднения аллельных частот линий, которые составляют популяцию. Для популяции с конечным числом особей или линий аллельную частоту можно выражать в качестве количества особей или линий (или любой другой определенной группы), содержащей аллель.

Маркерный аллель "положительно" коррелирует с признаком, когда маркер сцеплен с признаком и когда присутствие маркерного аллеля является показателем того, что желаемый признак или форма признака появятся в растении, содержащем аллель. Маркерный аллель "отрицательно" коррелирует с признаком, когда маркер сцеплен с признаком и когда присутствие маркерного аллеля является показателем того, что желаемый признак или форма признака не встретятся в растении, содержащем аллель.

"Гомозиготная" особь имеет только одну форму аллеля в данном локусе (например, диплоидное растение имеет копию одной и той же формы аллеля в конкретном локусе для каждой из двух гомологичных хромосом). Особь является "гетерозиготной", если более одной аллельной формы присутствует в данном локусе (например, диплоидная особь имеет одну копию первой формы аллеля и одну копию второй формы аллеля в данном локусе). Термин "гомогенность" относится к представителям группы, которые имеют один и тот же генотип (т.е. одну и ту же аллельную частоту) в одном или нескольких конкретных представляющих интерес локусах. Напротив, термин "гетерогенность" относится к особям в группе, которые отличаются по генотипу в одном или нескольких представляющих интерес локусах.

Для идентификации маркерного аллеля можно использовать любой способ, который можно использовать для охарактеризации нуклеотидной последовательности в данном локусе. Способы выявления маркерного аллеля включают, например, но не ограничиваются ими, способы молекулярной идентификации (например, амплификация и выявление ампликона маркера). Например, аллельную форму маркера SSR или маркера SNP можно выявлять с помощью технологии на основе амплификации. В типичном способе выявления на основе амплификации маркерный локус или часть маркерного локуса амплифицируют (с использованием, например, ПЦР, LCR и транскрипции с использованием нуклеиновой кислоты, выделенной из представляющего интерес растения подсолнечника в качестве матрицы для амплификации) и полученный амплифицированный ампликон маркера выявляют. В некоторых вариантах осуществления РНК растений можно использовать в качестве матрицы для реакции амплификации. В некоторых вариантах осуществления геномную ДНК растений можно использовать в качестве матрицы для реакции амплификации. В некоторых примерах маркер QTL представляет собой маркер SNP, и выявленный аллель представляет собой маркерный аллель SNP, и способ выявления представляет собой аллелеспецифическую гибридизацию (ASH). В некоторых примерах маркер QTL представляет собой маркер SSR, и выявленный аллель представляет собой маркерный аллель SSR.

Технология ASH основана на стабильном отжиге короткого одноцепочечного олигонуклеотидного зонда с полностью комплементарной одноцепочечной нуклеиновой кислотой-мишенью. Выявление можно проводить посредством выявления изотопной или неизотопной метки, связанной с зондом. Для каждого полиморфизма можно конструировать два или более различных зондов ASH, чтобы они имели идентичные последовательности ДНК, за исключением участка полиморфизма. Каждый зонд может быть абсолютно гомологичен последовательности одного аллеля, так что набор зондов может различать все известные альтернативные аллельные последовательности. Когда каждый зонд гибридизуется с ДНК-мишенью в соответствующих условиях конструирования и гибридизации зонда, несоответствие в одно основание между зондом и ДНК-мишенью препятствует гибридизации. Таким образом, с заданным образцом, который гомозиготен по аллелю, гибридизуется только одни из альтернативных зондов. Образцы, которые являются гетерозиготными или гетерогенными по двум аллелям, гибридизуются с обоими из альтернативных зондов.

Маркеры ASH можно использовать в качестве доминантных маркеров, где присутствие или отсутствие только одного аллеля определяют по гибридизации или отсутствию гибридизации только одного зонда. Альтернативный аллель можно устанавливать по отсутствию гибридизации. В примерах зонд ASH и молекулы-мишени могут представлять собой молекулы РНК или ДНК; молекула-мишень может иметь последовательность нуклеотидов любой длины, помимо последовательности, которая комплементарна зонду; зонд может быть сконструирован так, чтобы он гибридизовался с любой цепью ДНК-мишени; и размер зонда можно варьировать, чтобы он удовлетворял требованиям различных условиях гибридизации.

Амплифицированные вариабельные последовательности относятся к амплифицированным последовательностям генома растений, которые проявляют высокую вариабельность остатков нуклеиновой кислоты между представителями одного и того же вида. Все организмы имеют вариабельные геномные последовательности и каждый организм (за исключением клона) имеет отличающийся набор вариабельных последовательностей. После идентификации присутствие конкретной вариабельной последовательности можно использовать для прогнозирования фенотипических признаков. В некоторых примерах ДНК из растения можно использовать в качестве матрицы для амплификации с праймерами, которые фланкируют вариабельную последовательность ДНК. Вариабельную последовательность можно амплифицировать, а затем секвенировать.

Также и альтернативно для идентификации генетических маркеров можно использовать самоподдерживающуюся репликацию последовательностей. Самоподдерживающаяся репликация последовательностей относится к способу амплификации нуклеиновых кислот с использованием последовательностей нуклеиновых кислот-мишеней, которые реплицируются экспоненциально in vitro по существу в изотермических условиях, с использованием трех ферментативных активных агентов, вовлеченных в репликацию ретровирусов: обратная транскриптаза; РНК-аза H; и ДНК-зависимая РНК-полимераза. Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874. Посредством имитации ретровирусной стратегии репликации РНК с помощью промежуточных кДНК, эта реакция обеспечивает накопление копий кДНК и РНК исходной мишени.

Данные, соответствующие выявленному маркерному аллелю(ям) могут передаваться (например, электронным путем; и посредством инфракрасной, беспроводной и оптической передачи) на компьютер или считываемый компьютером носитель для анализа или хранения.

Например, праймер для амплификации или пару праймеров для амплификации можно смешивать с геномной нуклеиновой кислотой, выделенной из первого растения или генетического материала подсолнечника, где праймер или пара праймеров комплементарны или частично комплементарны по меньшей мере части маркерного локуса, и праймер или пара праймеров способны инициировать полимеризацию ДНК ДНК-полимеразой с использованием геномной нуклеиновой кислоты подсолнечника в качестве матрицы. Праймер или пара праймеров (например, пара праймеров, представленная в таблице 6) удлиняются в реакции полимеризации ДНК с использованием ДНК-полимеразы и матричной геномной нуклеиновой кислоты с образованием по меньшей мере одного ампликона.

"Позиционное клонирование" относится к конкретной методике клонирования, в которой нуклеиновую кислоту-мишень идентифицируют и выделяют по ее геномной близости к маркеру. Например, клон геномной нуклеиновой кислоты может включать всю или часть двух или более хромосомных областей, которые расположены вблизи друг от друга. Если маркер можно использовать для идентификации клона геномной нуклеиновой кислоты из геномной библиотеки, стандартные способы, такие как субклонирование и/или секвенирование, можно использовать для идентификации и/или выделения подпоследовательностей клона, которые расположены вблизи маркера.

Локус: как используют в рамках изобретения, термин "локус" относится к положению в геноме, которое соответствует поддающейся измерению характеристике (например, признаку) или полиморфизму. Локус SNP определяют с помощью зонда, который гибридизуется с ДНК, содержащейся в локусе.

Разведение с помощью маркера: как используют в рамках изобретения, термин "разведение с помощью маркера" может относиться к подходу для разведения, прямо использующему MAS для одного или нескольких признаков (например, сниженное содержание пальмитиновой кислоты). В современной практике растениеводы-селекционеры предпринимают попытки идентифицировать легко выявляемые признаки, такие как цвет цветков, внешний вид оболочки семян и варианты изоферментов, которые сцеплены с агрономически желаемым признаком. Затем растениеводы-селекционеры наблюдают за агрономическим признаком в сегрегирующих популяциях для разведения путем наблюдения за сегрегацией легко выявляемого признака. Однако для применения в выведении растений доступно очень мало этих взаимосвязей сцепления.

Разведение с помощью маркера обеспечивает эффективный с точки зрения времени и расходов процесс для усовершенствования сортов растений. Несколько примеров применения разведения с помощью маркеров вовлекают использование изоферментных маркеров. См., например, Tanksley and Orton, eds. (1983) Isozymes in Plant Breeding and Genetics, Amsterdam: Elsevier. Одним примером является изоферментный маркер, ассоциированный с геном устойчивости к паразитическим круглым червям в томате. Ген, контролирующий устойчивость, обозначаемый как Mi, локализован на хромосоме 6 томата и очень прочно сцеплен с ApsI, изоферментов кислой фосфатазой. Применение изоферментного маркера ApsI для непрямой селекции гена Mi обеспечивает преимущества, состоящие в том, что сегрегацию в популяции можно определять однозначно с помощью стандартных электрофоретических способов; изоферментный маркер можно оценивать в ткани проростков, что устраняет необходимость в поддержании растений до созревания; и кодоминантность изоферментных маркерных аллелей позволяет различить гомозиготы и гетерозиготы. См. Rick (1983), Tanksley and Orton, выше.

Зонд: в некоторых вариантах осуществления присутствие маркера в растении можно выявлять с использованием зонда нуклеиновой кислоты. Зонд может представлять собой молекулу ДНК или молекулу РНК. РНК-зонды можно синтезировать способами, известными в данной области, например, с использованием молекулы ДНК-матрицы. Зонд может содержать всю или часть нуклеотидной последовательности маркера и дополнительную смежную нуклеотидную последовательность из генома растений. Это обозначается в настоящем описании как "смежный зонд". Дополнительная смежная нуклеотидная последовательность обозначается как "вышерасположенная" или "нижерасположенная" относительно исходного маркера, в зависимости от смежной нуклеотидной последовательности из хромосомы растений, и находится с 5'-стороны или с 3'-стороны исходного маркера, как хорошо понятно. Как понятно специалисту в данной области, процесс получения дополнительной смежной нуклеотидной последовательности для включения в маркер можно повторять практически до бесконечности (ограничиваясь только длиной хромосомы), тем самым, идентифицируя дополнительные маркеры вдоль хромосомы.

Последовательность олигонуклеотидного зонда можно получать способами синтеза или посредством клонирования. Пригодные векторы для клонирования хорошо известны специалистам в данной области. Олигонуклеотидный зонд может быть меченым или немеченым. Существует широкое множество способов мечения молекул нуклеиновой кислоты, включая, например, но не ограничиваясь ими: радиоактивное мечение посредством ник-трансляции; использование случайных праймеров; достраивание терминальной дезокситрансферазы и т.п., где используемые нуклеотиды являются мечеными, например, радиоактивным 32P. Другие метки, которые можно использовать, включают, например, но не ограничиваясь ими: флуорофоры (например, FAM и VIC); ферменты; субстраты ферментов; кофакторы ферментов; ингибиторы ферментов; и т.п. Альтернативно использование метки, которая обеспечивает поддающийся выявлению сигнал, сама по себе или вместе с другими реакционноспособными агентами, можно заменять лигандами, с которыми связываются рецепторы, где рецепторы являются мечеными (например, указанными выше метками), чтобы обеспечить поддающиеся обнаружению сигналы, либо самостоятельно, либо вместе с другими реагентами. См., например, Leary et al. (1983) Proc. Natl. Acad. Sci. USA 80:4045-9.

Зонд может содержать нуклеотидную последовательность, которая не является смежной с последовательностью исходного маркера; этот зонд обозначают в настоящем описании как "несмежный зонд". Последовательность несмежного зонда расположена достаточно близко к последовательности исходного маркера на геноме так, что несмежный зонд генетически сцеплен с тем же геном или признаком (например, низкое содержание пальмитиновой кислоты). Например, в некоторых вариантах осуществления, несмежный зонд расположен в пределах приблизительно 10 cM; 9 cM; 8 cM; 7 cM; 6 cM; 5 cM; 4 cM; 3 cM; 2 cM; 1 cM; 0,75 cM; 0,5 cM; 0,25 cM или менее от маркера QTL, проиллюстрированного на фиг.4.

Зонд может представлять собой точную копию маркера, подлежащего обнаружению. Зонд также может представлять собой молекулу нуклеиновой кислоты, содержащую или состоящую из, нуклеотидной последовательности, которая по существу идентична клонированному сегменту хромосомной ДНК рассматриваемого организма (например, подсолнечника). Как используют в рамках изобретения, термин "по существу идентичный" может относиться к нуклеотидным последовательностям, которые являются более чем на 85% идентичными. Например, по существу идентичная нуклеотидная последовательность может быть на 85,5%; 86%; 87%; 88%; 89%; 90%; 91%; 92%; 93%; 94%; 95%; 96%; 97%; 98%; 99% или 99,5% идентичной эталонной последовательности.

Зонд также может представлять собой молекулу нуклеиновой кислоты, которая "специфически гибридизуется" или "специфически комплементарна" точной копии маркера, подлежащего обнаружению ("ДНК-мишень"). "Специфично гибридизующийся" и "специфически комплементарный" представляют собой термины, которые указывают на достаточную степень комплементарности, чтобы между молекулой нуклеиновой кислоты и ДНК-мишенью происходило стабильное и специфическое связывание. Молекула нуклеиновой кислоты не должна быть на 100% комплементарной ее последовательности-мишени, чтобы быть специфически гибридизующейся. Молекула нуклеиновой кислоты является специфически гибридизующейся, когда существует достаточная степень комплементарности, чтобы избежать неспецифического связывания нуклеиновой кислоты с не являющимися мишенью последовательностями в условиях, когда является желательным специфическое связывание, например, в жестких условиях гибридизации.

Условия гибридизации, обеспечивающие конкретные степени жесткости, варьируют, в зависимости от типа выбранного способа гибридизации и композиции и длины гибридизующихся последовательностей нуклеиновых кислот. Как правило, жесткость гибридизации определяется температурой гибридизации и ионной силой (особенно концентрацией Na+ и/или Mg++) буфера для гибридизации, хотя также на жесткость влияет количество раз промывания. Вычисления, касающиеся условий гибридизации, требуемых для достижения конкретных степеней жесткости, известны средним специалистам в данной области, и рассмотрены, например, в Sambrook et al. (ed.) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11; и Hames and Higgins (eds.) Nucleic Acid Hybridization, IRL Press, Oxford, 1985. Дальнейшая детальная инструкция и руководство в отношении гибридизации нуклеиновых кислот могут быть найдены, например, в Tijssen, "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2, Elsevier, NY, 1993; и Ausubel et al., Eds., Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, NY, 1995.

Как используют в рамках изобретения, "жесткие условия" охватывают условия, при которых гибридизация происходит, только если существует менее 50% несоответствий гибридизующейся молекулой и ДНК-мишенью. "Жесткие условия" включают другие конкретные уровни жесткости. Таким образом, как используют в рамках изобретения, условия "умеренной жесткости" представляют собой условия, в которых молекулы с более чем 50% несоответствием последовательностей не гибридизуются; условия "высокой жесткости" представляют собой условия, в которых последовательности с более чем 20% несоответствий не гибридизуются; и условия "очень высокой жесткости" представляют собой условия, при которых последовательности с более чем 10% несоответствий не гибридизуются.

Ниже представлены типичные неограничивающие условия гибридизации.

Условия очень высокой жесткости (выявляют последовательности, которые обладают по меньшей мере 90% идентичностью последовательностей): гибридизация в 5x буфере SSC при 65°C в течение 16 часов; промывание два раза в 2x буфере SSC при комнатной температуре в течение 15 минут каждый раз; и промывание два раза в 0,5x буфере SSC при 65°C в течение 20 минут каждый раз.

Условия высокой жесткости (выявляют последовательности, которые обладают по меньшей мере 80% идентичностью последовательностей): гибридизация в 5x-6x буфере SSC при 65-70°C в течение 16-20 часов; промывание два раза в 2x буфере SSC при комнатной температуре в течение 5-20 минут каждый раз; и промывание два раза в 1x буфере SSC при 55-70°C в течение 30 минут каждый раз.

Условия умеренной жесткости (выявляют последовательности, которые обладают по меньшей мере 50% идентичностью последовательностей): гибридизация в 6x буфере SSC при температуре от комнатной температуры до 55°C в течение 16-20 часов; промывание по меньшей мере два раза в 2x-3x буфере SSC при температуре от комнатной температуры до 55°C в течение 20-30 минут каждый раз.

Что касается всех рассмотренных выше зондов, зонд может содержать дополнительные последовательности нуклеиновой кислоты, например, промоторы; сигналы транскрипции и/или векторные последовательности. Любой из зондов, рассмотренных выше, можно использовать для определения дополнительных маркеров, которые сцеплены с геном, вовлеченным в сниженное содержание пальмитиновой кислоты в подсолнечнике, и маркеры, идентифицированные таким образом, могут быть эквивалентны иллюстративным маркерам, названным в настоящем описании, и таким образом, они входят в объем изобретения.

Идентичность последовательностей: термин "идентичность последовательностей" или "идентичность", как используют в рамках изобретения в контексте двух последовательностей нуклеиновых кислот или полипептидов, может относиться к остаткам в двух последовательностях, которые являются одинаковыми при выравнивании на максимальное соответствие на протяжении указанного окна сравнения.

Как используют в рамках изобретения, термин "процент идентичности последовательностей" может относиться к величине, определяемой путем сравнения двух оптимально выровненных последовательностей (например, последовательностей нуклеиновых кислот) на протяжении окна сравнения, где часть последовательности в окне сравнения может содержать вставки или делеции (т.е. пропуски) по сравнению с эталонной последовательностью (которая не содержит вставок или делеций) для оптимального выравнивания двух последовательностей. Процент вычисляют путем определения количества положений, в которых идентичный нуклеотидный или аминокислотный остаток встречается в обеих последовательностях с получением количества совпавших положений, деления количества совпавших положений на общее количество положений в окне сравнения, и умножения результата на 100 с получением процента идентичности последовательностей.

Способы выравнивания последовательностей для сравнения хорошо известны в данной области. Различные программы и алгоритмы выравнивания описаны, например, в: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et al. (1994) Methods Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50. Подробное описание способов выравнивания последовательностей и вычисления гомологии может быть найдено, например, в Altschul et al. (1990) J. Mol. Biol. 215:403-10.

Basic Local Alignment Search Tool (BLASTTM; Altschul et al. (1990)) от National Center for Biotechnology Information (NCBI) доступен из нескольких источников, в том числе National Center for Biotechnology Information (Bethesda, MD), и через интернет, для применения совместно с несколькими программами анализа последовательностей. Описание того, как определять идентичность последовательностей с использованием этой программы, доступно через интернет в разделе "help" для BLASTTM. Для сравнений последовательностей нуклеиновых кислот можно использовать функцию "Blast 2 sequences" программы BLASTTM (Blastn) с использованием матрицы BLOSUM62 по умолчанию с параметрами по умолчанию. Последовательности нуклеиновых кислот с более высоким сходством с эталонными последовательностями будут демонстрировать увеличение процентной идентичности при оценке этим способом.

Молекула нуклеиновой кислоты: как используют в рамках изобретения, термин "молекула нуклеиновой кислоты" может относиться к полимерной форме нуклеотидов, которая может включать как смысловую, так и антисмысловую цепи РНК, кДНК, геномной ДНК, и их синтетические формы и смешанные полимеры. Нуклеотид может относиться к рибонуклеотиду, дезоксирибонуклеотиду или модифицированной форме любого типа нуклеотида. "Молекула нуклеиновой кислоты", как используют в рамках изобретения, является синонимом "нуклеиновой кислоты" и "полинуклеотида". Термин включает одноцепочечные и двухцепочечные формы ДНК. Молекула нуклеиновой кислоты может включать либо встречающиеся в природе, либо модифицированные нуклеотиды, или и те, и другие, связанные вместе встречающимся в природе и/или не встречающимися в природе нуклеотидными связями.

"Экзогенная" молекула представляет собой молекулу, которая не является нативной для определенной системы (например, генетический материал, сорт, элитный сорт и/или растение) в отношении нуклеотидной последовательности и/или положения полинуклеотида в геноме, и в отношении аминокислотной последовательности и/или клеточной локализации полипептида. В вариантах осуществления экзогенные или гетерологичные полинуклеотиды или полипептиды могут представлять собой молекулы, которые искусственным образом предоставлены биологической системе (например, клетка растения, ген растения, конкретный вид или сорт растений, и/или хромосома растения) и они не являются нативными для конкретной биологической системы. Таким образом, обозначение нуклеиновой кислоты как "экзогенная" может указывать на то, что нуклеиновая кислота произошла из источника, отличного от природного источника, или оно может указывать на то, что нуклеиновая кислота имеет неприродную конфигурацию, генетическое положение или расположение элементов.

Напротив, например, "нативная" или "эндогенная" нуклеиновая кислота представляет собой нуклеиновую кислоту (например, ген), которая не содержит элемент нуклеиновой кислоты, отличный от элементов, в норме присутствующих в хромосоме или другом генетическом материале, в котором нуклеиновая кислота в норме встречается в природе. Транскрипт эндогенного гена кодируется нуклеотидной последовательностью в ее природном хромосомном локусе и не предоставляется искусственным образом клетке.

Термин "рекомбинантный" относится к материалу (например, рекомбинантная нуклеиновая кислота, рекомбинантный ген, рекомбинантный полинуклеотид и/или рекомбинантный полипептид), который изменен посредством вмешательства человека. Например, расположение частей или элементов рекомбинантной молекулы может не быть нативным расположением и/или первичная последовательность рекомбинантной молекулы может быть измененной относительно ее нативной последовательности каким-либо образом. Материал может быть изменен так, чтобы получить рекомбинантный материал, находящийся в его природном окружении или состоянии, или извлеченный из его природного окружения или состояния. Открытая рамка считывания нуклеиновой кислоты является рекомбинантной, если нуклеотидная последовательность открытой рамки считывания удалена из ее природного контекста и клонирована в любой тип искусственной нуклеиновой кислоты (например, вектор). Протоколы и реагенты для получения рекомбинантных молекул, особенно рекомбинантных нуклеиновых кислот, распространены и являются стандартными в данной области. Термин "рекомбинантный" также в настоящем описании может относиться к клетке или организму, которые содержат рекомбинантный материал (например, растение и/или клетка растения, которые содержат рекомбинантную нуклеиновую кислоту). В некоторых примерах рекомбинантный организм представляет собой трансгенный организм.

Как используют в рамках изобретения, термин "введенный" при указании на перемещение гетерологичной или экзогенной нуклеиновой кислоты в клетку, относится к включению нуклеиновой кислоты в клетку с использованием любой методологии, доступной в данной области. Этот термин охватывает способы введения нуклеиновой кислоты, включающие, например, но не ограничивающиеся ими, трансфекцию; трансформацию и трансдукцию.

Вектор: как используют в рамках изобретения, термин "вектор" относится к полинуклеотиду или другим молекулам, которые способны переносить по меньшей мере один сегмент(ы) нуклеиновой кислоты в клетку. Вектор необязательно может содержать компоненты/элементы, которые опосредуют поддержание вектора и обеспечивают его предполагаемое применение (например, последовательности, необходимые для репликации, гены, сообщающие устойчивость к лекарственному средству или антибиотику, участок множественного клонирования и/или функционально связанные промоторные/энхансерные элементы, которые обеспечивают экспрессию клонированного гена). Векторы могут происходить, например, из плазмид, бактериофагов или вирусов растений или животных. "Клонирующий вектор", "челночный вектор" или "субклонирующий вектор", как правило, включает функционально связанные элементы, облегчающие стадии клонирования или субклонирования (например, участок множественного клонирования, содержащий множество участок эндонуклеазы рестрикции).

Термин "экспрессирующий вектор", как используют в рамках изобретения, относится к вектору, содержащему функционально связанные полинуклеотидные последовательности, которые могут способствовать экспрессии кодирующей последовательности в конкретном организме-хозяине. Например, бактериальный экспрессирующий вектор может способствовать экспрессии кодирующей последовательности в бактерии. Экспрессирующий вектор растений может способствовать экспрессии кодирующей последовательности в клетке растения. Полинуклеотидные последовательности, которые способствуют экспрессии в прокариотах, могут включать, например, но не ограничиваясь ими, промотор; оператор и участок связывания рибосом. Эукариотические экспрессирующие векторы (например, экспрессирующий вектор растений) содержат промоторы, энхансеры, сигналы терминации и полиаденилирования (и другие последовательности), которые, как правило, отличаются от последовательностей, используемых в прокариотических экспрессирующих векторах.

Однонуклеотидный полиморфизм: как используют в рамках изобретения, термин "однонуклеотидный полиморфизм" (SNP) может относиться к варьированию последовательности ДНК, когда один нуклеотид в геноме (или другой общей последовательности) отличается между представителями вида или парными хромосомами у особи. В популяции SNP может быть присвоена частота минорного аллеля, которая представляет собой наиболее низкую аллельную частоту в локусе, которая наблюдается в конкретной популяции. Она просто является меньшей из двух аллельных частот для однонуклеотидных полиморфизмов. Ожидается, что различные популяции будут проявлять по меньшей мере немного отличающиеся аллельные частоты. Конкретные популяции могут проявлять значительно отличающиеся аллельные частоты. В некоторых примерах, маркерами SNP являются маркеры, сцепленные с устойчивостью к SCN.

SNP могут находиться в кодирующих последовательностях генов, некодирующих областях генов или в межгенных областях между генами. SNP в кодирующей последовательности не обязательно будут изменять аминокислотную последовательность полученного белка вследствие вырожденности генетического кода. SNP, обе формы которого приводят к одной и той же полипептидной последовательности, называют "синонимичным" (иногда его называют молчащей мутацией). Если продуцируется отличающаяся полипептидная последовательность, его называют "несинонимичным". Несинонимичное изменение может представлять собой миссенс-изменение или нонсенс-изменение, миссенс-изменение приводит к отличающейся аминокислоте, и нонсенс-изменение приводит к преждевременному стоп-кодону. SNP, которые не являются кодирующими белок областями, все еще могут оказывать влияние на сплайсинг генов, связывание факторов транскрипции или последовательность некодирующей РНК. SNP обычно являются биаллельными и, таким образом, легко анализируемыми в растениях и животных. Sachidanandam (2001) Nature 409:928-33.

Растение: как используют в рамках изобретения, термин "растение" может относиться к целому растению, культуре клеток или тканей, полученной из растений, и/или любой части любого из вышеуказанных. Таким образом, термин "растение" охватывает, например, но не ограничиваясь ими, целые растения; компоненты и/или органы растений (например, листья, стебли и корни); ткань растений; семена и клетку растений. Клетка растений может представлять собой, например, но не ограничиваясь ими, клетку в растении и/или клетку растения, клетку, выделенную из растения и клетку, полученную посредством культивирования клетки, выделенной из растения. Таким образом, термин "растение подсолнечника" может относиться, например, но не ограничиваясь ими, к целому растению подсолнечника; нескольким растениям подсолнечника; клетке(ам) растения подсолнечника; протопласту растения подсолнечника; культуре тканей подсолнечника (например, из которой можно регенерировать растение подсолнечника); каллюсу растения подсолнечника; части растения подсолнечника (например, семена подсолнечника, цветки подсолнечника, семядоля подсолнечника, листья подсолнечника, стебли подсолнечника, почки подсолнечника, корни подсолнечника и кончики корней подсолнечника); и клеткам растений подсолнечника, которые являются неизмененными в растениях подсолнечника или в частях растений подсолнечника.

"Трансгенное растение" представляет собой растение, содержащее по меньшей мере в одной из его клеток экзогенный полинуклеотид. Например, экзогенный полинуклеотид стабильно встраивается в геном клетки, так что полинуклеотид может наследоваться в последующих поколениях. В некоторых примерах гетерологичный полинуклеотид может встраиваться в геном в качестве части рекомбинантной экспрессирующей кассеты. Термин "трансгенный" используют в настоящем описании для обозначения любой клетки, клеточной линии, каллюса, ткани, части растения или растения, генотип которых изменен присутствием экзогенной нуклеиновой кислоты. Таким образом, этот термин охватывает трансгенные организмы и клетки, которые исходно изменены так, чтобы они содержали экзогенный полинуклеотид, и организмы и клетки, полученные посредством скрещиваний и бесполого размножения исходного трансгенного организма или клетки. Термин "трансгенный", как используют в рамках изобретения, не охватывает геномные (хромосомные или внехромосомные) изменения, внесенные общепринятыми способами разведения растений (например, скрещивания только нетрансгенных организмов) или посредством встречающихся в природе событий (например, случайное перекрестное оплодотворение, нерекомбинантная вирусная инфекция, нерекомбинантная бактериальная трансформация, нерекомбинантная транспозиция и спонтанная мутация).

"Линия", "сорт" или "штамм" растений представляет собой группу отдельных растений, имеющих одно и то же происхождение. Растения линии, как правило, являются инбредными до некоторой степени и, как правило, являются гомозиготными и гомогенными в большинстве генетических локусов. "Подлиния" может относиться к инбредной подгруппе потомков общего предшественника, которые генетически отличаются от других аналогично инбредных подгрупп, происходящих от того же предшественника. В некоторых вариантах осуществления, "подлинию" можно получать посредством инбридинга семян из отдельного растения подсолнечника, выбранных из поколения F3-F5 до тех пор, пока остаточные сегрегирующие локусы не будут гомозиготными среди большинства или всех локусов.

Коммерческие сорта подсолнечника, как правило, получают посредством накопления самоопыляющихся потомков ("объединение") одного растения F3-F5 после контролируемого скрещивания между двумя генетически отличающимися родителями. Хотя такой сорт, как правило, оказывается единообразным, самоопыляющийся сорт, происходящий из выбранного растения, в конечном итоге (например, к поколению F8) становится смесью гомозиготных растений, которые могут варьировать по генотипу в любом локусе, который был гетерозиготным в первоначально выбранном растении F3-F5. В вариантах осуществления, описанных в настоящем описании, подлинии на основе маркеров, которые отличаются друг от друга полиморфизмом качественного маркера на уровне ДНК в одном или нескольких конкретных локусах, получают посредством генотипирования образца семян, полученных от индивидуального самоопыляющегося потомка, происходящего из выбранного растения F3-F5. Такой образец семян можно генотипировать прямо в качестве семени или ткани семян, выращенной из семени. В некоторых примерах семена, имеющие общий генотип в одном или нескольких конкретных маркерных локусах, объединяют с получением подлинии, которая является генетически гомогенной в одном или нескольких локусах, которые сцеплены с представляющим интерес признаком (например, низкое содержание пальмитиновой кислоты).

"Анцестральная линия" относится к родительской линии, которую используют или использовали в качестве источника генетического материала, например, для выведения элитных линий. "Анцестральная популяция" относится к группе предков, которые обеспечили совокупность генетической изменчивости, которую использовали для выведения элитной линии. "Потомство" представляет собой потомков предков, и потомство может быть отделено от их предков многими поколениями разведения. Например, элитные линии являются потомками их предков. Родословную можно использовать для описания взаимосвязи между потомством и каждым из его предков. Родословная может охватывать одно или несколько поколений и, таким образом, может описывать взаимосвязи между потомком и его предками, отдаленными на 1, 2, 3, 4 и т.д. поколений.

"Элитная линия" или "элитный штамм" относится к агрономически улучшенной линии, которая была выведена и отобрана (часто посредством множества циклов селекции) для улучшения агрономических характеристик. Многочисленные элитные линии подсолнечника доступны и известны специалистам в данной области. Элитная популяция представляет собой набор элитных линий или особей из элитных линий, которые можно использовать для отображения уровня техники с точки зрения доступных агрономически улучшенных генотипов данного вида культуры (например, подсолнечника). Аналогично, элитный генетический материал или элитный образец генетического материала представляет собой агрономически улучшенный генетический материал. Элитный генетический материал можно получать из растения с улучшенной агрономической эффективностью, и ее можно использовать для получения растения с улучшенными агрономическими характеристиками, такого как подсолнечник существующей или вновь выведенной элитной линии.

В противоположность элитным линиям, "экзотическая линия" или "экзотический штамм" (или "экзотический генетический материал") относятся к линии или генетическому материалу, полученному из подсолнечника, не принадлежащего элитной линии или образцу генетического материала. В контексте скрещивания между двумя растениями подсолнечника или генетических материалов, экзотический генетический материал не является близкородственным по происхождению элитным генетическим материалом, с которым его скрещивают. Наиболее часто экзотический генетический материал выбран для включения нового генетического элемента (например, представляющая интерес аллельная форма) в программу разведения.

Признак или фенотип: термины "признак" и "фенотип" используют в настоящем описании взаимозаменяемо для обозначения поддающейся измерению или наблюдению наследуемой характеристики. В некоторых примерах фенотип может прямо контролироваться единичным геном или генетическим локусом (т.е. признак одного гена). В других примерах фенотип может быть результатом взаимодействия между несколькими генами (комплексный признак). Таким образом, QTL может действовать посредством механизма одного гена или посредством полигенного механизма. В некоторых примерах признаку или фенотипу можно присваивать "фенотипическую величину", которая соответствует качественной величине, измеренной для фенотипического признака.

Термин "молекулярный фенотип" может относиться к фенотипу, который поддается обнаружению на уровне популяции (одной или нескольких) молекул. В некоторых примерах молекулярный фенотип может обнаруживаться на молекулярном уровне. Поддающиеся обнаружению молекулы фенотипа могут представлять собой нуклеиновые кислоты (например, геномная ДНК или РНК); белки и/или метаболиты. Например, молекулярный фенотип может представлять собой профиль экспрессии одного или нескольких продуктов генов (например, на конкретной стадии развития растения или в ответ на условия или стрессовые воздействия окружающей среды).

Низкое содержание пальмитиновой кислоты: для целей настоящего описания представляющим особый интерес признаком является "низкое содержание пальмитиновой кислоты". Хотя на состав жирных кислот в растениях подсолнечника могут в некоторой степени влиять факторы окружающей среды, специалистам в данной области будет понятно, что содержание пальмитиновой кислоты (а также другие признаки масла) в основном определяются наследуемыми генетическими факторами. Таким образом, например, выбор конкретного сорта подсолнечника для культивирования может быть основан по меньшей мере частично на характерном содержании пальмитиновой кислоты в этом конкретном сорте в нормальных полевых условиях выращивания (например, условия без засухи, заболеваний и с достаточными питательными веществами в почве). Например, растение подсолнечника, имеющее низкое содержание пальмитиновой кислоты, может иметь содержание пальмитиновой кислоты (16:0), которое составляет приблизительно 3% или менее от общего содержания масла в семенах растения. В некоторых примерах такое растение подсолнечника, имеющее низкое содержание пальмитиновой кислоты, имеет содержание пальмитиновой кислоты, которое составляет приблизительно 2,5% или менее от общего содержания масла в семенах растения, например, но не ограничиваясь ими, содержание пальмитиновой кислоты может составлять 2,6%; 2,5%; 2,4%; 2,3%; 2,2%; 2,1%; 2,0%; 1,9%; 1,8%; приблизительно 1,7% и ниже.

В некоторых вариантах осуществления "низкое содержание пальмитиновой кислоты" определяют посредством сравнения с характерным содержанием пальмитиновой кислоты сорта дикого типа или родительского сорта. Таким образом, первый подсолнечник, имеющий фенотип низкого содержания пальмитиновой кислоты, может иметь "уменьшенные" или "сниженные" уровни пальмитиновой кислоты относительно подсолнечника дикого типа или относительно родительского сорта подсолнечника, из которого происходил первый подсолнечник. "Уменьшенный" и "сниженный" являются относительными терминами, указывающими на то, что растение продуцирует или содержит меньше пальмитиновой кислоты, чем сходное растение дикого типа.

Содержание пальмитиновой кислоты в растении подсолнечника широко варьирует, и характерное содержание пальмитиновой кислоты, измеренное в конкретных сортах, отражает спектр фенотипов более высокого и более низкого содержания пальмитиновой кислоты. Однако относительное содержание пальмитиновой кислоты в различных растениях, линиях растений или семействах растений, можно определять путем простого наблюдения. Более того, сорта подсолнечника представляют собой генетически определимые фенотипические степени "содержания пальмитиновой кислоты". Специалисту в данной области известны анализы для количественного определения и оценки содержания пальмитиновой кислоты в подсолнечнике. Содержание пальмитиновой кислоты в растении можно количественно определять с использованием различных аналитических способов, стандартных в данной области, включая, например, но не ограничиваясь ими, ЯМР; NIR и экстракцию Soxhlet.

Подтверждение низкого содержания пальмитиновой кислоты можно проводить, используя или модифицируя доступные протоколы определения содержания пальмитиновой кислоты. Например, ЯМР, NIR и/или экстракцию Soxhlet можно использовать для подтверждения того, что признак низкого содержания пальмитиновой кислоты все еще сегрегирует в отношении конкретного маркера в любом конкретном растении или популяции. Эти и другие протоколы также можно использовать в некоторых вариантах осуществления для измерения степени снижения содержания пальмитиновой кислоты, достигаемого посредством интрогрессии или рекомбинантного внесения маркера, сцепленного с низким содержанием пальмитиновой кислоты, в желаемый генетический фон.

IV. Маркеры для низкого содержания пальмитиновой кислоты в подсолнечнике

Варианты осуществления изобретения включают маркеры, которые сцеплены с низким содержанием пальмитиновой кислоты в подсолнечнике. Такие маркеры можно использовать, например, но не ограничиваясь ими, для идентификации растений подсолнечника и генетического материала, имеющих увеличенную вероятность наличия фенотипа низкого содержания пальмитиновой кислоты; для селекции таких растений подсолнечника и генетического материала (например, в программе селекции с помощью маркера); и для идентификации и селекции растений и генетического материала подсолнечника, которые не имеют увеличенной вероятности наличия фенотипа низкого содержания пальмитиновой кислоты. Использование одного или нескольких маркеров, описанных в настоящем описании, может обеспечить преимущества для растениеводов-селекционеров в отношении времени, расходов и труда, вовлеченных в разведение подсолнечника, по сравнению с доступными в настоящее время композициями и способами уровня техники.

В настоящем описании описаны конкретные маркеры, идентифицированные как находящиеся в или вблизи области QTL низкого содержания пальмитиновой кислоты в группе сцепления 5 (LG5) в геноме подсолнечника, которые являются полиморфными в родительских генотипах. Среди таких маркеров QTL находятся конкретные маркерные аллели, которые сцеплены с фенотипом низкого содержания пальмитиновой кислоты в подсолнечнике. В некоторых вариантах осуществления маркер QTL, который сцеплен с фенотипом низкого содержания пальмитиновой кислоты в подсолнечнике, выбран из подгруппы маркеров, представленной на фиг.1. Например, но не ограничиваясь ими, маркер QTL, который сцеплен с фенотипом низкого содержания пальмитиновой кислоты в подсолнечнике, может быть выбран из HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907 и HA0612A.

Для определения маркера, который сцеплен с низким содержанием пальмитиновой кислоты, можно использовать популяции для картирования. В некоторых вариантах осуществления такая популяция для картирования может быть получена посредством скрещивания H757B/H280R, хотя также и альтернативно можно использовать другие популяции. Для определения сцепленного маркерного локуса можно использовать любую из множества пригодных программных платформ. Например, но не ограничиваясь ими, в конкретных примерах можно использовать TASSEL®; GeneFlow® и MapManager-QTX®. В некоторых вариантах осуществления, например, когда в анализе сцепления используют программное обеспечение, данные, отражающие информацию об обнаруженном аллелей, можно передавать электронным путем или хранить электронным образом во время применения или перед применением, например, на считываемом компьютером носителей.

В некоторых вариантах осуществления первое растение или генетический материал подсолнечника, которые, вероятно, имеют фенотип низкого содержания пальмитиновой кислоты, идентифицируют посредством выявления множества маркерных аллелей в первом растении или генетическом материале подсолнечника. Например, но не ограничиваясь ими, конкретные варианты осуществления включают способы идентификации растений или генетического материала, которые, вероятно, имеют фенотип низкого содержания пальмитиновой кислоты, где маркерный аллель, сцепленный с низким содержанием пальмитиновой кислоты, выявлен среди молекулярных маркеров HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907 и HA0612A. Способы идентификации растений или генетического материала, которые, вероятно, имеют фенотип низкого содержания пальмитиновой кислоты в соответствии с некоторыми вариантами осуществления, включают обнаружение более чем одного маркерного аллеля, сцепленного с низким содержанием пальмитиновой кислоты, из молекулярных маркеров HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907 и HA0612A. Конкретные варианты осуществления включают способы идентификации растений или генетического материала, которые, вероятно, имеют фенотип низкого содержания пальмитиновой кислоты, где маркерный аллель выявлен из молекулярных маркеров, которые сцеплены по меньшей мере с одним маркером, сцепленным с низким содержанием пальмитиновой кислоты, выбранным из HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907 и HA0612A.

В некоторых вариантах осуществления выявленный аллель представляет собой форму аллеля, которая положительно коррелирует с низким содержанием пальмитиновой кислоты. Альтернативно аллель, который выявлен, может представлять собой форму аллеля, которая отрицательно коррелирует с низким содержанием пальмитиновой кислоты, и в этом случае можно осуществлять негативную селекцию аллеля. В случае, когда более одного маркерного аллеля выбирают для выявления, аллель выбирают для каждого из маркеров; таким образом, выявляют два или более аллелей. В некоторых примерах маркер может содержать более одной преимущественной (например, положительно коррелирующей) формы аллеля; в таком примере можно выявлять любую из таких преимущественных форм аллеля.

Таким образом, в одном растении, генетическом материале или популяции растений можно одновременно выявлять множество маркерных аллелей. В примерах таких способов можно выбирать растение или генетический материал, которые содержат положительно коррелирующие аллели более чем одного маркера, сцепленного с низким содержанием пальмитиновой кислоты. В конкретных примерах положительно коррелирующие аллели из более чем одного маркера, сцепленного с низким содержанием пальмитиновой кислоты, можно вносить посредством интрогрессии в целевый (например, реципиентную) генетический материал подсолнечника. Специалистам в данной области будет понятно, что одновременная селекция (и/или интргрессия) положительно коррелирующих аллелей из более чем одного маркера низкого содержания пальмитиновой кислоты в одном и том же растении или генетическом материале могут приводить к аддитивному (например, синергичному) фенотипу в растении или генетическом материале.

Хотя конкретные маркерные аллели могут косегрегировать с фенотипом низкого содержания пальмитиновой кислоты, такие маркерные локусы не обязательно являются частью локуса QTL, обеспечивающего (например, ответственного за) низкое содержание пальмитиновой кислоты. Например, не требуется, чтобы косегрегирующий маркер содержался в гене (например, в качестве части открытой рамки считывания гена), который обеспечивает или сообщает низкое содержание пальмитиновой кислоты. Ассоциация между конкретным маркерным аллелем с фенотипом низкого содержания пальмитиновой кислоты может быть следствием первоначальной "сопрягающей" фазы сцепления между косегрегирующим маркерным аллелем и аллелем QTL низкого содержания пальмитиновой кислоты в анцестральной линии подсолнечника, из которой происходит аллель низкого содержания пальмитиновой кислоты. В конечном итоге, при повторяющейся рекомбинации события кроссинговера между косегрегирующим маркером и локусом QTL могут изменять эту ориентацию. Таким образом, положительно коррелирующий маркерный аллель может изменяться в последовательных поколениях в зависимости от фазы сцепления, которая существует в родителе с низким содержанием пальмитиновой кислоты, использованном для получения сегрегирующих популяций. Этот факт не уменьшает пригодности маркера для мониторинга сегрегации фенотипа; он только изменяет то, какая форма маркерного аллеля положительно (в противоположность отрицательной корреляции) коррелирует в данной сегрегирующей популяции.

При указании на взаимосвязь между двумя генетическими элементами (например, генетический элемент, обеспечивающий низкое содержание пальмитиновой кислоты и близкорасположенный маркер), "сопрягающая" фаза сцепления относится к обстоятельствам, когда положительно коррелирующий аллель в QTL низкого содержания пальмитиновой кислоты физически связан с той же хромосомой, что и положительно коррелирующий аллель соответствующего сцепленного маркерного локуса. В "сопрягающей фазе" оба аллеля наследуются вместе потомками, которые наследуют эту хромосомную нить. В "отталкивающей" фазе сцепления, положительно коррелирующий аллель в представляющем интерес локусе (например, QTL низкого содержания пальмитиновой кислоты) физически сцеплен с нормальным отрицательно коррелирующим аллелем в проксимальном маркерном локусе и, таким образом, два аллеля, которые обычно положительно коррелируют, не наследуются вместе (т.е. два локуса находятся "не в фазе" друг относительно друга).

Как используют в рамках изобретения, "положительно коррелирующий" аллель маркера, представляет собой аллель маркера, который косегрегирует с желаемым фенотипом (например, низкое содержание пальмитиновой кислоты) в популяциях для картирования, описанных в настоящем описании. Однако ввиду вышесказанного, будет понятно, что вследствие возможности отталкивающей фазы сцепления, в других вариантах осуществления, вовлекающих другие популяции можно эквивалентно использовать другие аллельные формы маркера.

Аналогично, сцепленную форму маркерного аллеля, которая не косегрегирует с низким содержанием пальмитиновой кислоты, также и альтернативно можно использовать в некоторых вариантах осуществления, поскольку такую аллельную форму можно использовать для идентификации растения, которое, вероятно, не имеет фенотипа низкого содержания пальмитиновой кислоты. Например, такой аллель можно использовать для целей исключения (например, негативная селекция) во время разведения для идентификации аллелей, которые отрицательно коррелируют с низким содержанием пальмитиновой кислоты и/или для устранения растений или генетического материала с увеличенным содержанием пальмитиновой кислоты из последующих раундов разведения.

Маркер QTL имеет минимум один положительно коррелирующий аллель, хотя в некоторых примерах маркер QTL может иметь два или более положительно коррелирующих аллелей, встречающихся в популяции. Можно использовать любой положительно коррелирующий аллель такого маркера, например, для идентификации и создания линий подсолнечника с низким (например, сниженным) содержанием пальмитиновой кислоты. В некоторых примерах один, два, три или более положительно коррелирующий аллель(ей) различных маркеров, сцепленных с низким содержанием пальмитиновой кислоты, идентифицируют в (или подвергают инирогрессии в) растении, и все или подгруппу положительно коррелирующих маркеров можно выбирать или исключать во время MAS. В некоторых вариантах осуществления идентифицируют по меньшей мере одно растение или генетический материал, которые имеют по меньшей мере один такой аллель, который положительно коррелирует с фенотипом низкого содержания пальмитиновой кислоты.

Маркерные локусы сами по себе являются признаками и, таким образом, их можно анализировать стандартным анализом сцепления, например, посредством отслеживания маркерных локусов в ходе сегрегации. Таким образом, в некоторых вариантах осуществления определяют сцепление между маркерами, например, где один cM равен вероятности 1% того, что первый маркерный локус отделится посредством кроссинговера в одном поколении от второго локуса (который может представлять собой любой другой признак (например, второй маркерный локус) или другой локус признака, который содержит или содержится в QTL).

Генетические маркеры, сцепленные с маркерами QTL (например, маркеры QTL, представленные на фиг.1 и их эквиваленты) являются особенно пригодными, когда они находятся достаточно близко (т.е. достаточно прочно сцеплены) с данным маркером QTL, так что генетический маркер и маркер QTL проявляют низкую частоту рекомбинации. В некоторых вариантах осуществления сцепленный маркер и маркер QTL проявляют частоту рекомбинации приблизительно 10% или менее (т.е. данный маркер находится в пределах приблизительно 10 cM от QTL). По определению эти сцепленные локусы косегрегируют в течение по меньшей мере 90% времени. Действительно, чем ближе маркер находится к маркеру QTL, тем более эффективным и преимущественным становится этот маркер в качестве индикатора желаемого признака. Тем не менее, могут быть пригодными маркеры, которые находятся на расстоянии, например, более чем приблизительно 10 cM от QTL, в частности в комбинации с другими сцепленными маркерами.

Таким образом, в некоторых вариантах осуществления сцепленные локусы, такие как маркерный локус QTL и второй маркерный локус, проявляют частоту рекомбинаций в локусе приблизительно 10% или менее; например, но не ограничиваясь ими, приблизительно 9% или менее, приблизительно 8% или менее, приблизительно 7% или менее, приблизительно 6% или менее, приблизительно 5% или менее, приблизительно 4% или менее, приблизительно 3% или менее, и приблизительно 2% или менее. В некоторых примерах соответствующие локусы (например, маркерный локус и локус-мишень, такой как QTL) проявляют частоту рекомбинации приблизительно 1% или менее; например, но не ограничиваясь ими, приблизительно 0,75% или менее, приблизительно 0,5% или менее, и приблизительно 0,25% или менее. Таким образом, в конкретных вариантах осуществления локусы могут быть разделены приблизительно на 10 cM; приблизительно 9 cM; приблизительно 8 cM; приблизительно 7 cM; приблизительно 6 cM; приблизительно 5 cM; приблизительно 4 cM; приблизительно 3 cM; приблизительно 2 cM; приблизительно 1 cM; приблизительно 0,75 cM; приблизительно 0,5 cM; приблизительно 0,25 cM или менее. В некоторых примерах конкретные сцепленные маркеры можно определять путем изучения генетической карты генома подсолнечника, включая, например, LG5.

В некоторых аспектах сцепление можно выражать в качестве предела частоты рекомбинации, или в качестве генетического или физического диапазона. Например, в некоторых вариантах осуществления два сцепленных локуса представляют собой два локуса, которые разделены на количество единиц карты, составляющее менее 50 cM. В некоторых примерах сцепленные локусы представляют собой два локуса, которые разделены менее чем на 40 cM. В некоторых примерах два сцепленных локуса представляют собой два локуса, которые разделены менее чем на 30 cM. В некоторых примерах два сцепленных локуса представляют собой два локуса, которые разделены менее чем на 25 cM. В некоторых примерах два сцепленных локуса представляют собой два локуса, которые разделены менее чем на 20 cM. В некоторых примерах два сцепленных локуса представляют собой два локуса, которые разделены менее чем на 15 cM. В некоторых примерах сцепление может быть выражено в качестве диапазона с верхним и нижним пределом; например, но не ограничиваясь ими, приблизительно от 10 до 20 cM; приблизительно от 10 до 30 cM; приблизительно от 10 до 40 cM; от приблизительно 0,5 до приблизительно 10 cM; от приблизительно 0,1 до приблизительно 9 cM; от приблизительно 0,1 до приблизительно 8 cM; от приблизительно 0,1 до приблизительно 7 cM; от приблизительно 0,1 до приблизительно 6 cM; от приблизительно 0,1 до приблизительно 5 cM; от приблизительно 0,1 до приблизительно 4 cM; от приблизительно 0,1 до приблизительно 3 cM; от приблизительно 0,1 до приблизительно 2 cM; от приблизительно 0,1 до приблизительно 1 cM; и от приблизительно 0,1 до приблизительно 0,5 cM.

Маркеры, описанные в настоящем описании (например, маркеры, представленные на фиг.1: HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, HA0612A, и маркеры, сцепленные по меньшей мере с одним из указанных выше маркеров) в некоторых вариантах осуществления положительно коррелируют с низким содержанием пальмитиновой кислоты в подсолнечнике. Таким образом, эти маркеры могут находиться достаточно близко к QTL и/или признаку низкого содержания пальмитиновой кислоты, так что один или несколько маркеров можно использовать в качестве прогностического фактора для признака низкого содержания пальмитиновой кислоты. Эта прогностическая способность чрезвычайно полезна в контексте MAS, как более подробно рассмотрено в настоящем описании.

Использование конкретных маркеров, описанных в настоящем описании, которые сцеплены с фенотипом низкого содержания пальмитиновой кислоты и/или маркером QTL, не ограничивается какой-либо конкретной генетической картой подсолнечника или методологией. Следует отметить, что перечень сцепленных маркеров может варьировать между картами и методологиями вследствие различных факторов. Например, маркеры, которые находятся на любых двух картах, могут не быть идентичными, и первая карта может иметь более высокую плотность маркеров, чем другая, вторая карта. Также популяции для картирования, методологии и алгоритмы, используемые для конструирования генетических карт, могут отличаться. Специалисту в данной области будет понятно, что одна генетическая карта не обязательно более или менее точна, чем другая, и, более того, квалифицированному специалисту будет понятно, что любую генетическую карту подсолнечника можно использовать для определения маркеров, которые сцеплены с конкретным маркером. Например, конкретные сцепленные маркеры можно определять из любой генетической карты, известной в данной области (например, экспериментальная карта или интегрированная карта), и их можно определять из любого нового набора данных о картировании.

Варианты осуществления настоящего изобретения не ограничиваются какой-либо конкретной популяцией подсолнечника или применением какой-либо конкретной методологии (например, каким-либо конкретным программным обеспечением или каким-либо конкретным набором параметров программного обеспечения) для идентификации или определения сцепления конкретного маркера с фенотипом низкого содержания пальмитиновой кислоты. Ввиду настоящего изобретения специалист в данной области способен экстраполировать признаки маркеров, описанных в настоящем описании, на любую совокупность генов подсолнечника или представляющую интерес популяцию, и применять какое-либо конкретное программное обеспечение и параметры программного обеспечения для этого.

V. Обнаружение маркеров низкого содержания пальмитиновой кислоты в подсолнечнике

Способы выявления (идентификации) растений или генетического материала подсолнечника, которые содержат конкретные аллели маркерных локусов низкого содержания пальмитиновой кислоты, являются признаком некоторых вариантов осуществления. В некоторых вариантах осуществления для обнаружения маркерного аллеля можно использовать любой из различных протоколов обнаружения маркеров, доступных в данной области, в зависимости от типа выявляемого маркера. Например, пригодные способы обнаружения маркеров могут включать амплификацию и идентификацию полученного амплифицированного маркера посредством, например, но не ограничиваясь ими, ПЦР; LCR и способа амплификации на основе транскрипции (например, ASH, обнаружение с помощью SSR, анализа RFLP и многие другие).

Как правило, обнаружение генетического маркера основано на одном или нескольких свойствах нуклеиновых кислот. Например, в некоторых способах обнаружения генетических маркеров используется гибридизация нуклеиновой кислоты зонда с нуклеиновой кислотой, соответствующей генетическому маркеру (например, амплифицированная нуклеиновая кислота, полученная с использованием молекулы геномной ДНК подсолнечника в качестве матрицы). В конкретных вариантах осуществления для обнаружения аллеля могут быть пригодными форматы гибридизации, включающие, например, но не ограничивающиеся ими, анализы гибридизации в жидкой фазе; твердой фазе; смешанной фазе и анализы гибридизации in situ. Обширное руководство по гибридизации нуклеиновых кислот может быть найдено, например, в Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Elsevier, NY.

Маркеры, соответствующие генетическим полиморфизмам между представителями популяции, можно выявлять с помощью многочисленных способов, включая, например, но не ограничиваясь ими, способы на основе амплификации нуклеиновых кислот и секвенирования нуклеотидов полиморфной маркерной области. В некоторых примерах множество способов обнаружения (включая способы на основе амплификации и способы на основе секвенирования) можно без труда адаптировать к высокопроизводительному анализу, например, с использованием доступных высокопроизводительных способов секвенирования, таких как секвенирование гибридизацией.

В конкретных примеры некоторых вариантов осуществления включены праймеры для амплификации маркерных локусов SSR-типа. В таблице 6 представлены конкретные праймеры для амплификации конкретных маркеров, описанных в настоящем описании. Однако специалисту в данной области будет хорошо понятно, что вместо данных праймеров можно использовать другие последовательности с любой стороны от данных праймеров, при условии, что праймеры способны амплифицировать нуклеотидную последовательность, содержащую аллель, подлежащий обнаружению. Кроме того, конкретный зонд, используемый для обнаружения аллеля, может варьировать. Например, любой зонд, способный идентифицировать область ампликона маркера, подлежащего обнаружению, можно заменять иллюстративными зондами, приведенными в настоящем описании. Кроме того, также может варьировать конфигурация праймеров для амплификации и зондов для обнаружения. Таким образом, варианты осуществления не ограничиваются праймерами и зондами, конкретно указанными в настоящем описании. Хотя в настоящем описании описано множество конкретных праймеров (см. таблицу 6), пригодные праймеры, подлежащие применению в рамках изобретения, можно конструировать с использованием любого подходящего способа. Например, эквивалентные праймеры можно конструировать с использованием любого подходящего программного обеспечения, такого как, например, но не ограничиваясь ими, LASERGENE®.

Молекулярные маркеры можно выявлять стандартными способами, доступными в данной области, например, но не ограничиваясь ими: ASH или другие способы обнаружения SNP; обнаружение AFLP; обнаружение амплифицированной вариабельной последовательности; обнаружение RAPD; обнаружение RFLP; обнаружение посредством самоподдерживающейся репликации последовательностей; обнаружение SSR; обнаружение SSCP и обнаружение изоферментных маркеров. Хотя иллюстративные маркеры, представленные на фиг.1 и в таблице 6, представляют собой маркеры SSR, любой из упомянутых выше типов маркеров можно использовать в конкретных вариантах осуществления для идентификации сегментов хромосомы, охватывающих генетический элемент, который обеспечивает фенотип низкого содержания пальмитиновой кислоты в подсолнечнике.

Например, маркеры, которые включают RFLP, можно выявлять, например, посредством гибридизации зонда (который, как правило, представляет собой подфрагмент или синтетический олигонуклеотид, соответствующий подфрагмент) нуклеиновой кислоты, подлежащей обнаружению, с рестрикционно расщепленной геномной ДНК. Фермент рестрикции выбирают так, чтобы получить фрагменты рестрикции по меньшей мере двух альтернативных (или полиморфных) длин у различных особей или популяций. Определение одного или нескольких фермента(ов) рестрикции, которые продуцируют информативные фрагменты для каждого скрещивания, является простой методикой, которую легко выполняют специалисты в данной области после установления последовательности ДНК-мишени. После разделения по длине в подходящем матриксе (например, агароза или полиакриламид) и переноса на мембрану (например, нитроцеллюлоза или нейлон), меченый зонд может гибридизоваться в условиях, которые приводят к равновесному связыванию зонда с мишенью, с последующим удалением избытка зонда посредством промывания, и обнаружения меченого зонда.

В некоторых вариантах осуществления стадию амплификации используют в качестве части способа обнаружения/генотипирования маркерного локуса. Однако стадия амплификация не во всех случаях требуется для обнаружения маркера. Например, неамплифицированную геномную ДНК можно выявлять просто посредством проведения саузерн-блоттинга на образце геномной ДНК. Обособленные зонды для обнаружения также могут отсутствовать в способах амплификации/обнаружения, например, но не ограничиваясь этим, вследствие проведения реакции амплификации в реальном времени, которая выявляет образование продукта по модификации праймера для амплификации при включении в продукт; включения меченых нуклеотидов в ампликон; и мониторинга изменений свойств вращения молекул ампликонов по сравнению с неамплифицированными предшественниками (например, посредством флуоресцентной поляризации).

ПЦР, ОТ-ПЦР, ПЦР в реальном времени и LCR имеют особенно широкое применение в качестве способов амплификации и амплификации-обнаружения для амплификации и обнаружения нуклеиновых кислот (например, нуклеиновых кислот, содержащих маркерные локусы). Детали, касающиеся применения этих и других способов амплификации могут быть найдены в любом из различных стандартных справочников, включающих, например, Sambrook et al., Molecular Cloning: A Laboratory Manual (2000) 3rd Ed., Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; Current Protocols in Molecular Biology (дополненный по 2002 год) F.M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. и John Wiley & Sons, Inc.; и ПЦР Protocols A Guide to Methods and Applications (1990) Innis et al. eds) Academic Press Inc., San Diego, CA. Дополнительные детали, касающиеся обнаружения нуклеиновых кислот в растениях, также могут быть найдены, например, d Plant Molecular Biology (1993) Cray (ed.) BIOS Scientific Publishers, Inc.

Дополнительные детали, касающиеся способов, достаточных для указания специалистам в данной области на конкретные способы амплификации и обнаружения in vitro, включая способы полимеразной цепной реакции (ПЦР), лигазной цепной реакции (LCR), амплификации с QP-репликазой и другие опосредуемые РНК-полимеразой способы (например, NASBA) и их примеры, также могут быть найдены, например: в патенте США 4683202; Arnheim and Levinson (1991) J NIH Res. 3:81-94; Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173; Guatelli et al. (1990), выше; Lomell et al. (1989) J. Clin. Chem. 35:1826; Landegren et al. (1988) Science 241:1077-80; Van Brunt (1990) Biotechnology 8:291-4; Wu and Wallace (1989) Gene 4:560; Barringer et al. (1990) Gene 89:117; и Sooknanan and Malek (1995) Biotechnology 13:563-4. Усовершенствованные способы амплификации крупных нуклеиновых кислот способом ПЦР, которые могут быть пригодными в некоторых применениях позиционного клонирования, дополнительно описаны в Cheng et al. (1994) Nature 369:684, и в ссылках, цитированных в ней, согласно которым получали ампликоны ПЦР размером вплоть до 40 т.п.н.

Множество доступных биологических справочников также расширили обсуждение ПЦР и родственных способов амплификации. Специалисту в данной области будет понятно, что по существу любую РНК можно конвертировать в двухцепочечную ДНК, которая пригодна для рестрикционного расщепления, амплификации способом ПЦР и секвенирования с использованием обратной транскриптазы и полимеразы (например, способом ОТ-ПЦР).

В некоторых вариантах осуществления зонд нуклеиновой кислоты можно использовать для обнаружения нуклеиновой кислоты, которая содержит нуклеотидную последовательность маркерного аллеля. Такие зонды можно использовать, например, для позиционного клонирования для выделения нуклеотидных последовательностей, которые сцеплены с последовательностью маркерного аллеля. Зонды нуклеиновой кислоты, которые пригодны в конкретных вариантах осуществления, не ограничиваются никаким конкретным размером. В некоторых вариантах осуществления зонд нуклеиновой кислоты может иметь длину, например, но не ограничиваясь этим, по меньшей мере 20 нуклеотидов; по меньшей мере 50 нуклеотидов; по меньшей мере 100 нуклеотидов и по меньшей мере 200 нуклеотидов. Зонды нуклеиновой кислоты для маркерного локуса могут быть клонированными и/или синтезированными.

В конкретных примерах с зондом можно использовать любую метку. Поддающиеся обнаружению метки, пригодные для применения с зондами нуклеиновой кислоты, включают любую композицию, обнаруживаемую с помощью спектроскопических, радиоизотопных, фотохимических, биохимических, иммунохимических, электрических, оптических или химических средств. Таким образом, гибридизованный зонд можно выявлять с использованием, например, радиоавтографии, флуорографии и других сходных способов обнаружения в зависимости от конкретной метки, подлежащей обнаружению. Пригодные метки включают биотин (для окрашивания меченого стрептавидином конъюгата), магнитные гранулы, флуоресцентные красители, радиоактивные метки, ферменты и колориметрические метки. Другие метки включают лиганды, которые связываются с антителами или определенными связывающимися мишенями, меченными флуорофорами, хемилюминесцентными агентами и ферментами. Зонд также может содержать радиоактивно меченые праймеры для ПЦР, которые используют для получения радиоактивно меченого ампликона. Дополнительная информация, касающаяся стратегий мечения нуклеиновых кислот и соответствующих стратегий обнаружения, может быть найдена, например, в Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals, Sixth Edition, Molecular Probes, Inc., Eugene OR; и Haugland (2001) Handbook of Fluorescent Probes and Research Chemicals, Eighth Edition, Molecular Probes, Inc., Eugene OR (Available on CD ROM). В конкретных примерах обнаружение и количественное определение с помощью ПЦР проводят с использованием флуорогенных олигонуклеотидных зондов с двойным мечением, например, зондов TaqMan® (Applied Biosystems).

В некоторых вариантах осуществления праймеры не являются мечеными и маркерные ампликоны ПЦР можно визуализировать, например, после их разделения по размеру (например, после агарозного гель-электрофореза). В конкретных примерах окрашивание бромидом этидия ампликонов ПЦР после разделения по размеру позволяет визуализацию ампликонов с различным размером, соответствующих различным маркерным аллелям.

Праймеры для применения в вариантах осуществления не ограничиваются праймерами, способными образовывать ампликон любого конкретного размера. Например, праймеры, используемые для амплификации конкретных маркерных локусов и аллелей, не ограничиваются праймерами, амплифицирующими всю область соответствующего локуса. Праймеры могут образовывать ампликон любой подходящей длины, которая является большей или меньшей, чем длина, приведенная в характеристиках аллеля. Например, амплификация маркера может продуцировать ампликон, который имеет длину, например, но не ограничиваясь этим, по меньшей мере 20 нуклеотидов; по меньшей мере 50 нуклеотидов; по меньшей мере 100 нуклеотидов и по меньшей мере 200 нуклеотидов.

Синтетические способы получения олигонуклеотидов и пригодных композиций, содержащих олигонуклеотиды (например, зондов, праймеров, молекулярных маяков, PNA и LNA), как правило, хорошо известны специалистам в данной области. Например, олигонуклеотиды можно синтезировать химически в соответствии с твердофазным способом со сложными триэфирами фосфорамидитов, описанным, например, в Beaucage and Caruthers (1981) Tetrahedron Letts. 22(20): 1859-62. В таких способах может использоваться автоматическое устройство для синтеза, например, но не ограничиваясь этим, как описано в Needham-VanDevanter et al. (1984) Nucleic Acids Res. 12:6159-68. Олигонуклеотиды (включая модифицированные олигонуклеотиды) также можно заказывать из различных коммерческих источников, включая, но не ограничиваясь этим, The Midland Certified Reagent Company; The Great American Gene Company; ExpressGen Inc.; и Operon Technologies Inc. Аналогично, PNA могут изготавливаться на заказ различными источниками, включая, например, но не ограничиваясь этим, PeptidoGenic; HTI Bio-Products, Inc.; BMA Biomedicals Ltd (U.K.) и Bio.Synthesis, Inc.

В некоторых вариантах осуществления для обнаружения маркерного аллеля можно использовать способ in silico. Например, последовательность нуклеиновой кислоты, содержащую маркерную последовательность, можно сохранять в компьютере. Желаемую последовательность маркерного локуса (или ее гомолог) можно идентифицировать с использованием подходящего алгоритма для поиска нуклеиновых кислот, предоставленного, например, но не ограничиваясь этим в BLASTTM или даже в простых текстовых редакторах.

В некоторых вариантах осуществления маркерный аллель обнаруживают с использованием способа обнаружения на основе ПЦР, где размер или последовательность ампликона ПЦР, содержащего маркер, указывают на отсутствие или присутствие конкретного маркерного аллеля. В некоторых примерах, праймеры для ПЦР гибридизуются с консервативными областями, фланкирующими полиморфную маркерную область. Праймеры для ПЦР, используемые таким образом для амплификации молекулярного маркера, иногда называют в данной области "маркерами для ПЦР" или просто "маркерами".

Главным стимулом для обнаружения молекулярных маркеров в сельскохозяйственных культурах является возможность увеличения эффективности разведения растений посредством селекции с помощью маркеров (MAS). Генетические маркеры, которые сцеплены с представляющим интерес признаком или геном, можно использовать для идентификации растений, которые содержат желаемый маркерный аллель в одном или нескольких локусах, и, таким образом, ожидается, что эти растения перенесут желаемый маркерный аллель вместе с представляющим интерес признаком или геном их потомству. Генетические маркеры можно использовать для идентификации растений, которые имеют конкретный генотип в одном локусе или в нескольких несцепленных или сцепленных локусах (например, гаплотип). Аналогично, маркерные аллели, описанные в настоящем описании, можно вносить посредством интрогрессии в любой желаемый генетический фон, зародышевую линию, растению, линию, сорт и т.д. подсолнечника, в качестве части общей программы разведения MAS, предназначенной для повышения выхода подсолнечника.

В соответствии с некоторыми вариантами осуществления маркеры, описанные в настоящем описании, обеспечивают средство для идентификации растений и генетического материала подсолнечника, которые имеют низкое или сниженное содержание пальмитиновой кислоты (или высокое или увеличенное содержание пальмитиновой кислоты) посредством идентификации растений и генетического материала, содержащих конкретный аллель в локусе, таком как HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, HA0612A и маркерный локус, сцепленный по меньшей мере с одним из вышеуказанных локусов. Посредством идентификации растений, не имеющих маркерного аллеля, который косегрегирует с низким содержанием пальмитиновой кислоты, можно идентифицировать растения и генетический материал с высоким содержанием пальмитиновой кислоты (или растения с меньшим снижением содержания пальмитиновой кислоты), например, для устранения из последующего скрещивания и разведения.

В соответствии с вышеуказанным, варианты осуществления изобретения включают молекулярные маркеры, которые имеют значительную вероятность косегрегации с QTL, который обеспечивает или сообщает фенотип с низким (например, сниженным) содержанием пальмитиновой кислоты. Эти QTL применимы в селекции с помощью маркера желаемых признаков (сниженное содержание пальмитиновой кислоты) и также имеют другие применения. Варианты осуществления изобретения не ограничиваются каким-либо конкретным способом обнаружения или анализа этих маркеров.

VI. Интрогрессия маркеров низкого содержания пальмитиновой кислоты в линии подсолнечника

Как указано выше, идентификация растений или генетического материала подсолнечника, которая включает маркерный аллель или аллели, которые сцеплены с фенотипом низкого (например, сниженного) содержания пальмитиновой кислоты, обеспечивает основу для проведения селекции подсолнечника с помощью маркеров. В некоторых вариантах осуществления выбирают по меньшей мере одно растение подсолнечника, которое содержит по меньшей мере один маркерный аллель, который положительно коррелирует с низким содержанием пальмитиновой кислоты, в то время как растения подсолнечника, которые содержат маркерные аллели, которые отрицательно коррелируют с низким содержанием пальмитиновой кислоты можно подвергать негативной селекции.

Желаемые маркерные аллели, которые положительно коррелируют с низким содержанием пальмитиновой кислоты, можно подвергать интрогрессии в подсолнечник, имеющий конкретный (например, элитный или экзотический) генетический фон, так чтобы получить растение или генетический материал подсолнечника с интрогрессией низкого содержания пальмитиновой кислоты. В некоторых вариантах осуществления множество маркеров низкого содержания пальмитиновой кислоты можно последовательно или одновременно отбирать и/или вводить путем интрогрессии в подсолнечник. Конкретные комбинации маркеров низкого содержания пальмитиновой кислоты, по которым можно проводить селекцию в единичном растении или генетическом материале, не ограничены, и они включают комбинацию маркеров, таких как маркеры, указанные на фиг.1, любые маркеры, сцепленные с маркерами, приведенными на фиг.1, или любые маркеры, расположенные в интервалах QTL, определенных в настоящем описании.

В некоторых вариантах осуществления способность идентифицировать маркерные аллели QTL, которые положительно коррелируют с низким содержанием пальмитиновой кислоты в растении подсолнечника, обеспечивает способ селекции растений, которые также имеют благоприятные маркерные локусы. Например, можно проводить селекцию любого растения, которое идентифицируют как содержащее маркерный аллель (например, маркерный аллель, который положительно коррелирует с низким содержанием пальмитиновой кислоты), в то время как растения, которые лишены аллеля (или которые содержат аллель, который отрицательно коррелирует с низким содержанием пальмитиновой кислоты) можно подвергать негативной селекции. Таким образом, в конкретных вариантах осуществления после идентификации маркерного аллеля в первом растении или генетическом материале, способ интрогрессии включает селекцию первого растения или генетического материала подсолнечника или селекцию потомства первого растения или генетического материала. В некоторых примерах полученные путем селекции растение или генетического материала подсолнечника можно скрещивать со вторым растением или генетическом материалом подсолнечника (например, элитный подсолнечник или экзотический подсолнечник), чтобы получить потомство, содержащее маркерный аллель и имеющее желаемые характеристики и/или аллели второго растения или генетического материала.

В некоторых вариантах осуществления способ интрогрессии QTL низкого содержания пальмитиновой кислоты может включать, например, предоставление по меньшей мере одного маркера, сцепленного с низким содержанием пальмитиновой кислоты (например, маркер, который косегрегирует с низким содержанием пальмитиновой кислоты); определение маркерного аллеля в первом растении или генетическом материале, содержащих QTL низкого содержания пальмитиновой кислоты; и интрогрессию маркерного аллеля во второе растение или генетический материал подсолнечника, чтобы получить растение или генетический материал подсолнечника с интрогрессией. В конкретных вариантах осуществления второе растение или генетический материал подсолнечника могут иметь увеличенное содержание пальмитиновой кислоты по сравнению с первым растением подсолнечника или генетическим материалом, в то время как растение или генетический материал подсолнечника с интрогрессией имеют сниженное содержание пальмитиновой кислоты по сравнению со вторым растением или генетическим материалом. Как более подробно рассмотрено ниже, растение или генетический материал подсолнечника с интрогрессией, полученные с помощью этих и других вариантов осуществления, также включены в варианты осуществления изобретения.

В некоторых вариантах осуществления, когда растение или генетический материал с интрогрессией получают любым из способов, представленных в настоящем описании, растение или генетический материал подсолнечника с интрогрессией могут быть охарактеризованы составом жирных кислот в масле семян растения. Растение или генетический материал с интрогрессией могут содержать, например, но не ограничиваясь ими, приблизительно 3% или менее пальмитиновой кислоты в масле семян из растения. В некоторых примерах, такое растение или генетический материал подсолнечника с интрогрессией содержат приблизительно 2,5% или менее пальмитиновой кислоты в масле семян растения, например, но не ограничиваясь этим, 2,6%; 2,5%; 2,4%; 2,3%; 2,2%; 2,1%; 2,0%; 1,9%; 1,8%; приблизительно 1,7% и ниже.

В дополнение к интрогрессии выбранных маркерных аллелей (например, посредством стандартных способом разведения) в желаемый генетический фон, чтобы осуществить интрогрессию QTL низкого содержания пальмитиновой кислоты в генетический фон, в некоторых вариантах осуществления можно использовать трансгенные подходы для получения растений и/или генетического материала подсолнечника с низким содержанием пальмитиновой кислоты. В некоторых вариантах осуществления экзогенную нуклеиновую кислоту (например, ген или открытую рамку считывания), которая сцеплена по меньшей мере c одним маркером в подсолнечнике, описанным в настоящем описании, можно вводить в целевое растение или генетический материал. Например, нуклеиновую кислоту, кодирующую последовательность, сцепленную по меньшей мере с одним маркером, описанным в настоящем описании, можно клонировать из геномной ДНК подсолнечника (например, посредством позиционного клонирования) и вводить в целевое растение или генетический материал.

Таким образом, конкретные варианты осуществления включают способы получения растения или генетического материала подсолнечника, имеющих фенотип низкого содержания пальмитиновой кислоты, где способ включает введение экзогенной нуклеиновой кислоты в целевое растение подсолнечника или его потомство, где экзогенная нуклеиновая кислота по существу идентична нуклеотидной последовательности, которая сцеплена по меньшей мере с одним положительно коррелирующим маркерным аллелем в одном или нескольких маркерных локусах, которые сцеплены с низким содержанием пальмитиновой кислоты. В некоторых примерах маркерный локус может быть выбран из: HA0031B; HA0908; HA1665; HA0304A; HA0850; HA0743; HA0870; HA0907; HA0612A и маркера, который сцеплен (например, демонстрирует частоту рекомбинации не более 10%) по меньшей мере с одним из вышеуказанных. В некоторых вариантах осуществления множество сцепленных маркеров можно использовать для конструирования трансгенного растения. То, какой из маркеров, описанных в настоящем описании, из такого множества использовать, определяет практикующий специалист.

Для введения экзогенной нуклеиновой кислоты в растение или генетический материал подсолнечника можно использовать любой из множества способов. В некоторых вариантах осуществления нуклеотидную последовательность выделяют посредством позиционного клонирования и идентифицируют по сцеплению с маркерным аллелем, который положительно коррелирует с низким содержанием пальмитиновой кислоты. Например, нуклеотидная последовательность может соответствовать открытой рамке считывания (ORF), которая кодирует полипептид, который при экспрессии в растении подсолнечника приводит к или обеспечивает растение подсолнечника, имеющее низкое содержание пальмитиновой кислоты. Затем нуклеотидную последовательность можно встраивать в экзогенную молекулу нуклеиновой кислоты. Точный состав экзогенной нуклеиновой кислоты может варьировать. Например, экзогенная нуклеиновая кислота может содержать экспрессирующий вектор для обеспечения экспрессии нуклеотидной последовательности в растении, в которое вводят экзогенную нуклеиновую кислоту.

Маркеры, сцепленные с низким содержанием пальмитиновой кислоты, можно вводить путем интрогрессии (например, тем самым, осуществляя интрогрессию фенотипа низкого содержания пальмитиновой кислоты) в растение или генетический материал подсолнечника с использованием способа, включающего селекцию с помощью маркера. В вариантах осуществления MAS проводят с использованием полиморфных маркеров, которые идентифицированы как имеющие значительную вероятность косегрегации с признаком низкого содержания пальмитиновой кислоты. Такие маркеры (например, маркеры, указанные на фиг.1) предположительно картируются в гене или генах или вблизи них, которые обеспечивают сниженное содержание пальмитиновой кислоты в растении (по сравнению с растением, содержащим ген или гены дикого типа). Такие маркеры можно считать индикаторами признака, и они могут быть обозначены как маркеры QTL. В некоторых вариантах осуществления растение или генетический материал исследуют в отношении присутствия положительно коррелирующего аллеля по меньшей мере в одном маркере QTL.

В некоторых вариантах осуществления анализ сцепления используют для определения того, какой полиморфный аллель демонстрирует статистическую вероятность косегрегации с фенотипом низкого содержания пальмитиновой кислоты. После идентификации такого положительно коррелирующего маркерного аллеля для фенотипа низкого содержания пальмитиновой кислоты, маркер можно использовать для быстрого точного скрининга линий растений в отношении аллеля низкого содержания пальмитиновой кислоты без необходимости в выращивании растений в течение их жизненного цикла и ожидании фенотипической оценки. Более того, идентификация маркера позволяет генетическую селекцию конкретного аллеля с низким содержанием пальмитиновой кислоты, даже когда молекулярная структура истинного QTL низкого содержания пальмитиновой кислоты неизвестна. Небольшой образец ткани (например, из первого листа растений) можно брать от растения подсолнечника, являющегося потомком, полученного скрещиванием и подвергнутого скринингу с помощью соответствующего молекулярного маркера. Таким образом, можно быстро определить, следует ли использовать потомство для дальнейшего разведения. Сцепленные маркеры также устраняют влияние факторов окружающей среды, которые могут влиять на проявление фенотипа, тем самым позволяя селекцию подсолнечника с низким содержанием пальмитиновой кислоты независимо от условий окружающей среды. Таким образом, в то время как вклад различных факторов внешней среды в признаки масла растений может, на первый взгляд, мешать использованию маркеров, описанных в настоящем описании, в действительности конкретное преимущество этих маркеров состоит в том, что их применимость не зависит от окружающей среды.

В некоторых вариантах осуществления, включающих MAS, локус полиморфного маркера QTL можно использовать для селекции растения, которое содержит маркерный аллель (или аллели), которые положительно коррелируют с фенотипом низкого содержания пальмитиновой кислоты. Например, нуклеиновую кислоту, соответствующую маркерному аллелю нуклеиновой кислоты, можно выявлять в биологическом образце из растения, подлежащего селекции. Это обнаружение может принимать форму гибридизации зонда нуклеиновой кислоты с маркерным аллелем или его ампликоном (например, с использованием аллелеспецифической гибридизации, саузерн-анализа, нозерн-анализа, гибридизации in situ и гибридизации праймеров с последующей амплификацией способом ПЦР области маркера). После подтверждения присутствия (или отсутствия) конкретного маркерного аллеля в биологическом образце, растение отбирают, и в некоторых случаях его можно использовать для получения растений-потомков посредством селекционного разведения.

Для растениеводов-селекционеров подсолнечника являются желательными комбинации маркерных локусов низкого содержания пальмитиновой кислоты с маркерами/генами других желаемых признаков (например, высокий выход), чтобы вывести улучшенные сорта подсолнечника. Скрининг больших количеств образцов немолекулярными способами (например, оценка признака в растениях подсолнечника) обычно является дорогостоящим, требующим много времени и ненадежным. Использование полиморфных маркеров, описанных в настоящем описании, которые сцеплены с QTL низкого содержания пальмитиновой кислоты, обеспечивает эффективный способ селекции желаемых сортов в программах разведения. Преимущества селекции с помощью маркеров над оценкой в полевых условиях низкого содержания пальмитиновой кислоты включают, например, то, что MAS можно проводить в любое время года, независимо от сезона выращивания. Более того, как указано выше, эффекты факторов окружающей среды по большей части не имеют значения для селекции с помощью маркеров.

Когда популяция является сегрегирующей по множеству маркерных локусов, сцепленных с одним или несколькими признаками (например, множество маркеров, сцепленных с низким содержанием пальмитиновой кислоты), эффективность MAS по сравнению с фенотипическим скринингом становится еще более высокой, поскольку все маркерные локусы можно оценивать в лаборатории вместе в одном образце ДНК. В конкретных вариантах осуществления изобретения маркеры HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907 и HA0612A, а также маркеры, сцепленные по меньшей мере с одним из указанных выше маркеров, можно анализировать одновременно или последовательно в одном образце или в нескольких параллельных образцах.

Другим применением MAS в разведении растения является способствование восстановлению генотипа рекуррентного родителя посредством разведения способом обратного скрещивания. Обратное скрещивание обычно проводят для интрогрессии одного или нескольких маркеров или локусов QTL из донорного родителя (например, родитель, имеющий желаемые маркерные локусы низкого содержания пальмитиновой кислоты) в остальном желательный генетический фон из рекуррентного родителя (например, линия подсолнечника с высоким выходом). Чем больше циклов обратного скрещивания проводят, тем более высоким является генетический вклад рекуррентного родителя в конечный сорт с интрогрессией. В некоторых примерах можно проводить множество циклов обратного скрещивания, например, поскольку растения с низким содержанием пальмитиновой кислоты могут быть в остальном нежелательными, например, вследствие низкого выхода, низкой плодородности и т.д. Напротив, штаммы, которые являются результатом интенсивных программ разведения, могут иметь превосходный выход, плодородность и т.д., являясь дефицитными только в одном желаемом аспекте, таком как содержание пальмитиновой кислоты. В скрещивании с помощью маркеров конкретных маркеров из донорного источника, который может составлять или может не составлять элитный генетический фон для элитного сорта, который будет служить в качестве рекуррентной линии, практикующий специалист может проводить селекцию среди потомков обратного скрещивания по донорному маркеру, а затем использовать повторяющееся обратное скрещивание с рекуррентной линией для максимального восстановления генома рекуррентной линии.

В соответствии с вышеуказанным, маркеры и способы, описанные в настоящем описании, можно использовать для осуществления селекции с помощью маркеров или разведения сортов подсолнечника с желаемым комплектом (набором) аллельных форм сегментов хромосомы, ассоциированных с улучшенными агрономическими характеристиками (например, низкое содержание пальмитиновой кислоты вместе с любыми другими доступными маркерами выхода, устойчивости к заболеваниям и т.д.). Любой из описанных маркерных аллелей можно вводить в линию подсолнечника посредством интрогрессии (например, путем традиционного разведения, посредством трансформации, или обоих из них) с получением растения подсолнечника с улучшенными агрономическими характеристиками. Если нуклеиновые кислоты из растения являются положительными по желаемому генетическому маркерному аллелю, в некоторых вариантах осуществления растение можно подвергать самоопылению с получением чистой линии с одним и тем же генотипом, или его можно скрещивать с растением, содержащим тот же маркерный аллель или другие желаемые маркеры и/или характеристики, с получением гибридного поколения, являющегося результатом полового скрещивания.

Часто способ по настоящему изобретению используют по меньшей мере для одного родственного растения подсолнечника, такого как из линий потомков или нисходящих родственников в рассматриваемой родословной растений подсолнечника, так чтобы можно было отследить наследование желаемого аллеля сниженного содержания пальмитиновой кислоты. Количество поколений растений, используемых в способах по настоящему изобретению, как правило, составляет от 1 до 20, обычно от 1 до 5, и, как правило, 1, 2 или 3 поколения, и особенно часто способ осуществляют на прямых потомках или родителях растения подсолнечника (т.е. разделение в одно поколение).

Генетическое разнообразие является важным для программ разведения. При ограниченном разнообразии генетическая выгода, достигаемая в программе по разведению, в конечном итоге достигнет плато, когда все из благоприятных аллелей будут фиксированы в элитной популяции. Таким образом, одной задачей разведения растений является включение разнообразия в элитный набор без утраты генетической выгоды, которая уже достигнута, и с минимальными возможными инвестициями. MAS обеспечивает указание на то, какие геномные области и какие благоприятные аллели из первоначальных предков, были отобраны и сохранены с течением времени, облегчая попытки включения благоприятного варьирования из экзотических источников генетического материала (родительские растения, которые являются неродственными с набором элитных генов) в надеждах найти благоприятные аллели, которые в настоящее время отсутствуют в элитном наборе генов. Таким образом, в некоторых вариантах осуществления маркеры, описанные в настоящем описании, можно использовать для MAS при скрещиваниях, вовлекающих (элитные x экзотические) линии подсолнечника, осуществляя MAS для сегрегирующего потомства в целях сохранения основных аллелей, обеспечивающих выход, вместе с маркерными аллелями сниженного содержания пальмитиновой кислоты, описанных в настоящем описании.

Локусы молекулярных маркеров и аллели, описанные в настоящем описании (например, HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, HA0612A и маркеры, сцепленные по меньшей мере с одним из вышеуказанных маркеров) в некоторых вариантах осуществления можно использовать, как и указано ранее, для идентификации QTL низкого содержания пальмитиновой кислоты, который затем можно клонировать с помощью известных методик. Такие клоны со сниженным содержанием пальмитиновой кислоты можно сначала идентифицировать по их генетическому сцеплению с маркерами, описанными в настоящем описании. Например, в "позиционном клонировании генов" используется физическая близость маркера низкого содержания пальмитиновой кислоты для определения выделенного хромосомного фрагмента, содержащего ген QTL низкого содержания пальмитиновой кислоты. Выделенный хромосомный фрагмент можно получать такими хорошо известными способами, как, например, но не ограничиваясь ими, расщепление хромосомной ДНК одним или несколькими ферментами рестрикции, амплификацию хромосомной области с использованием ПЦР, и любая пригодная альтернативная реакция амплификации. Затем расщепленный и амплифицированный фрагмент можно лигировать в вектор, пригодный для репликации и/или экспрессии встроенного фрагмента. Маркеры, которые являются соседними с ORF, ассоциированной с фенотипическим признаком, можно специфически гибридизовать с клоном ДНК (например, клон из библиотеки геномной ДНК), тем самым, идентифицируя клон, на котором расположена ORF (или фрагмент ORF). Если маркер расположен дальше от гена QTL низкого содержания пальмитиновой кислоты, фрагмент, содержащий ORF, можно идентифицировать посредством последовательных раундов скрининга и выделения клонов, которые также содержат смежную последовательность ДНК. Этот процессы обычно называют "прогулкой по хромосоме", и его можно использовать для получения "контига" или "карты контигов".

Протоколы, достаточные для информации для специалиста в данной области о выделении клонов, ассоциированных со сцепленными маркерами, могут быть найдены, например, в Sambrook et al. (ed.) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; и Ausubel et al., Eds., Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, NY, 1995.

VII. Растения, содержащие маркеры низкого содержания пальмитиновой кислоты

Некоторые варианты осуществления включают способы получения растения подсолнечника и, кроме того, включают сами эти растения подсолнечника. В конкретных вариантах осуществления такой способ может включать скрещивание первого родительского растения подсолнечника, содержащего по меньшей мере один маркерный аллель, который положительно коррелирует с низким содержанием пальмитиновой кислоты, со вторым растением подсолнечника с маркером, сцепленным с низким содержанием пальмитиновой кислоты, описанным в настоящем описании, и выращивание женского растения подсолнечника в условиях выращивания растений, обеспечивающих потомство растений подсолнечника. Такое потомство растений подсолнечника можно анализировать в отношении маркерных аллелей, сцепленных с низким содержанием пальмитиновой кислоты, и можно выбирать желательных потомков. Такие растения-потомки или их семена можно использовать различным образом, включая, например, но не ограничиваясь этим, то, что их можно продавать коммерчески для производства подсолнечника; использовать для продуктов питания; обрабатывать для получения жалеемого продукта подсолнечника (например, подсолнечное масло) и/или далее использовать в последующих раундах разведения. Растения подсолнечника в соответствии с некоторыми вариантами осуществления включают растения-потомки, которые содержат по меньшей мере одну из аллельных форм маркеров, описанных в настоящем описании, так чтобы последующее потомство было способно наследовать маркерный аллель.

Некоторые варианты осуществления включают способы получения растения подсолнечника, имеющего низкое содержание пальмитиновой кислоты (например, сниженное содержание пальмитиновой кислоты). В конкретных вариантах осуществления такие способы могут включать получение такого растения общепринятым разведением растений или введением экзогенной ДНК (например, трансгена) в сорт или растение подсолнечника.

Таким образом, некоторые варианты осуществления включают клетки-хозяева и организмы-хозяева, которые трансформированы нуклеиновыми кислотами, соответствующими QTL низкого содержания пальмитиновой кислоты, идентифицированными с использованием по меньшей мере одного маркера, сцепленного с низким содержанием пальмитиновой кислоты, описанного в настоящем описании. В некоторых примерах, такие нуклеиновые кислоты могут включать хромосомные интервалы (например, геномные фрагменты), ORF и/или кДНК, которые кодируют продукты экспрессии, которые вносят вклад в фенотип низкого содержания пальмитиновой кислоты.

Клетки-хозяева можно получать способами генной инженерии (например, трансдуцировать, трансфицировать, трансформировать и т.д.) вектором (например, клонирующий вектор, челночный вектор или экспрессирующий вектор), который содержит ORF, сцепленную с маркером низкого содержания пальмитиновой кислоты. Векторы включают, например, но не ограничиваясь ими, плазмиды; фагмиды; агробактерии; вирусы; "голые" полинуклеотиды (линейные или замкнутые) и конъюгированные полинуклеотиды. Множество векторов можно вводить в бактерии, особенно для увеличения в количестве и распространения.

Векторы можно вводить в ткани растений, культивируемые клетки растений и протопласты растений любым из множества стандартных способов, известных в данной области, включая, например, но не ограничиваясь ими: электропорацию (From et al. (1985) Proc. Natl. Acad. Sci. USA 82:5824); инфицирование вирусными векторами, такими как вирус мозаики цветной капусты (CaMV) (см., например, патент США 4407956); баллистическое проникновение мелких частиц, содержащих нуклеиновую кислоту (Klein et al. (1987) Nature 327:70); использование пыльцы в качестве вектора (международная публикация патента PCT № WO 85/01856); и использование Agrobacterium tumefaciens или A. rhizogenes, содержащих T-ДНК-плазмиду, в которой клонированы фрагменты ДНК (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803). В определенных вариантах осуществления изобретения можно использовать любой подходящий способ, включая, но не ограничиваясь ими, конкретные способы, прямо указанные в настоящем описании, которые обеспечивают эффективное введение нуклеиновой кислоты в клетку или протопласт.

Модифицированные способами инженерии клетки-хозяева можно культивировать в обычных питательных средах или средах, модифицированных, например, для активации промоторов или селекции трансформантов. В некоторых вариантах осуществления хозяйские клетки-растений можно культивировать в трансгенные растения. Регенерация растений из культивированных протопластов описана, например, в Evans et al. (1983) "Protoplast Isolation and Culture", Handbook of Plant Cell Cultures 1, MacMillan Publishing Co., NY, pp. 124-176; Davey (1983) "Recent Developments in the Culture and Regeneration of Plant Protoplasts", Protoplasts, Birkhauser, Basel, pp. 12-29; Dale (1983) "Protoplast Culture and Plant Regeneration of Cereals and Other Recalcitrant Crops", Protoplasts, выше, pp. 31-41; и Binding (1985) "Regeneration of Plants", Plant Protoplasts, CRC Press, Boca Raton, FL, pp. 21-73. Дополнительные ресурсы, обеспечивающие пригодные детали, касающиеся культивирования и регенерации клеток растений включают Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems, John Wiley & Sons, Inc., NY; Gamborg and Phillips (eds.) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods, Springer Lab Manual, Springer-Verlag (Berlin Heidelberg NY); и R. R. D. Croy (Ed.) Plant Molecular Biology (1993) Bios Scientific Publishers, Oxford, UK (ISBN 0 12 198370 6).

Трансформированные клетки растений, полученные с использованием любого из описанных выше способов трансформации, можно культивировать для регенерации целого растения, которое обладает трансформированным генотипом и, таким образом, желаемым фенотипом. Такие способы регенерации, как правило, основаны на манипулировании определенными фитогормонами в среде для выращивания культуры ткани, как правило, основанном на биоцидном и/или гербицидном маркере, введенном в клетку вместе с желаемыми нуклеотидным последовательностями. Процессы регенерации и выращивания, используемые для получения целого растения, как правило, включают стадии селекции трансформированных клеток и побегов; укоренения трансформированных побегов и выращивания ростков в почве.

Трансформацию растений нуклеиновыми кислотами, которые снижают содержание пальмитиновой кислоты (например, которые содержат маркеры, описанные в настоящем описании) можно использовать для трансформации вида, отличного от подсолнечника. Например, предусматривается, что продукты экспрессии из QTL, которые вносят вклад в или обеспечивают фенотип низкого содержания пальмитиновой кислоты в подсолнечнике, также могут снижать содержание пальмитиновой кислоты при трансформации и экспрессии в других важных с агрономической точки зрения и с точки зрения садоводства видах растений. Такие виды включают двудольные растения, например, но не ограничиваясь ими, семейств: Leguminosae (включая горох, бобы, фасоль, арахис, пахиризус, коровий горох, бобы бархатные, сою, клевер, люцерну, люпин, вику, лотос, донник белый, глицинию и душистый горошек) и Compositae (наиболее крупное семейство сосудистых растений, включающее по меньшей мере 1000 родов, включающих важные коммерческие культуры, такие как подсолнечник). Дополнительные растения, содержащие нуклеиновые кислоты, которые снижают содержание пальмитиновой кислоты (например, которые содержат маркеры, описанные в настоящем описании) могут представлять собой растения родов: Allium, Apium, Arachis, Brassica, Capsicum, Cicer, Cucumis, Curcubita, Daucus, Fagopyrum, Glycine, Helianthus, Lactuca, Lens, Lycopersicon, Medicago, Pisum, Phaseolus, Solarium, Trifolium, Vigna и многие другие. Распространенные селькохозяйственные культуры, которые можно использовать в конкретных примерах, включают, например, но не ограничиваясь ими: сою, подсолнечник, канолу, горох, бобы, фасоль, арахис, пахиризус, коровий горох, бобы бархатные, клевер, люцерну, люпин, вику, донник белый, душистый горошек, горох полевой, стручковую фасоль, брокколи, брюссельскую капусту, кочанную капусту, цветную капусту, капусту кормовую, кольраби, сельдерей, салат-латук, морковь, лук, перец, картофель, баклажан и томат.

VIII. Системы для обнаружения и/или установления соотношения маркеров низкого содержания пальмитиновой кислоты

Системы, включая автоматические системы, для идентификации растений, которые содержат по меньшей мере один маркер, сцепленный с фенотипом низкого содержания пальмитиновой кислоты в подсолнечнике и/или установления соотношения присутствия конкретного сцепленного маркера с низким содержанием пальмитиновой кислоты, также включены в некоторые варианты осуществления. Иллюстративные системы могут включать зонды, пригодные для обнаружения аллелей в маркерном локусе, описанном в настоящем описании; детектор для обнаружения меток на зондах; соответствующие элементы для обработки жидкостей и контроллеры температуры, например, которые смешивают зонды и матрицы и/или амплифицируют матрицы; и/или системные инструкции, которые устанавливают соотношение между обнаружением метки и присутствием конкретного маркерного локуса или аллеля.

В конкретных вариантах осуществления предусматривается система для идентификации растения подсолнечника, предположительно имеющего низкое содержание пальмитиновой кислоты. Такая система может включать, например, но не ограничиваясь ими: набор маркерных праймеров и/или зондов, сконструированных так, чтобы они выявляли по меньшей мере один аллель по меньшей мере одного маркера, сцепленного с низким содержанием пальмитиновой кислоты (например, HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, HA0612A и маркер, сцепленный с по меньшей мере одним из указанных выше маркеров); детектор, который настроен так, чтобы обнаруживать один или несколько выходных сигналов от набора маркерных зондов или праймеров, или их ампликона, тем самым идентифицируя присутствие или отсутствие аллеля; и системные инструкции, которые устанавливают соотношение между присутствием или отсутствием аллеля и низким (например, сниженным) или повышенным содержанием пальмитиновой кислоты.

Система, которая проводит обнаружение маркера и/или установление соотношения, может включать детектор, который настроен так, чтобы обнаруживать один или несколько выходных сигналов из набора маркерных зондов или праймеров, или их ампликона. Точная конфигурация детектора может зависеть от типа метки, используемой для выявления маркерного аллеля. Конкретные примеры могут включать детекторы света и/или детекторы радиоактивности. Например, обнаружение эмиссии света или другого свойства меченого зонда может указывать на присутствие или отсутствие маркерного аллеля, взаимодействующего с зондом (например, посредством специфической гибридизации). Детектор(ы) необязательно осуществляет мониторинг одного или нескольких сигналов реакции амплификации. Например, детектор может осуществлять мониторинг оптических сигналов, которые соответствуют результатам анализа амплификации в "реальном времени".

Является доступным широкое множество устройств для обнаружения сигнала, например, но не ограничиваясь ими, трубки фотоумножителей; спектрофотометры; чипы CCD; чипы и сканеры чипов; сканирующие детекторы; фотоэлементы и фотодиоды; микроскопы; гальванометрические сканеры и микрожидкостные устройства для обнаружения амплификации нуклеиновых кислот. В дополнение к типу метки, используемой для обнаружения маркерного аллеля, точная конфигурация детектора может зависеть, частично, от оборудования, наиболее удобного для пользователя. В некоторых примерах можно использовать детекторы, которые выявляют флуоресценцию, фосфоресценцию, радиоактивность, pH, заряд, поглощение, люминесценцию, температуру или магнетизм.

Точная форма инструкций, предоставленных системе в соответствии с некоторыми вариантами осуществления, может варьировать сходным образом, в зависимости от компонентов системы. Например, инструкции могут присутствовать в качестве программного обеспечения системы в одном или нескольких встроенном элементе(ах) системы, или они могут присутствовать в одном или нескольких компьютерах или считываемых компьютером носителях, функционально сопряженных с детектором. В некоторых примерах системные инструкции включают по меньшей мере одну эталонную таблицу, которая включает корреляцию между присутствием или отсутствием конкретного маркерного аллеля в растении или генетическом материале и предсказанным содержанием пальмитиновой кислоты. Инструкции также могут включать указания по созданию пользовательского интерфейса системой; например, чтобы позволить пользователю видеть результаты анализа образца и вводить параметры в систему.

В конкретных вариантах осуществления система может включать компоненты для хранения или передачи считываемых компьютером данных, соответствующих или обозначающих выявленные маркерные аллели, например, в автоматизированной (например, полностью автоматизированной) системе. Например, может быть предоставлен считываемый компьютером носитель, который включает кэш-память, оперативную память и запоминающее устройство, и/или другие компоненты для электронного хранения данных (например, дисковод жестких дисков, дисковод мягких дисков и запоминающее устройство) для хранения компьютерного кода. Данные, соответствующие аллелям, обнаруженным способом по настоящему изобретению, также могут переводиться электронным, оптическим или магнитным путем в сигнал данных компьютера, передаваемый по сети, такой как внутренняя сеть, или интернет, или их комбинации. Также или альтернативно система может передавать данные с помощью беспроводного, инфракрасного или другого доступного альтернативного способа передачи.

Во время работы система, как правило, содержит образец, который подлежит анализу, такой как ткань растения или материал, выделенный из ткани, такой как геномная ДНК, амплифицированная геномная ДНК, кДНК, амплифицированная кДНК, РНК, амплифицированная РНК или сходные с ними.

В некоторых вариантах осуществления система может состоять из отдельных элементов, или альтернативно она может быть интегрирована в одну установку для удобного обнаружения маркерных аллелей, и необязательно для дополнительного проведения установления соотношений маркер-фенотип. В конкретных вариантах осуществления система также включает образец, например, но не ограничиваясь ими, геномную ДНК; амплифицированную геномную ДНК; кДНК; амплифицированную кДНК; РНК; и амплифицированную РНК, из подсолнечника или из выбранной ткани растения подсолнечника.

Автоматизированные системы, предусматриваемые в некоторых вариантах осуществления, необязательно включают компоненты для манипулирования образцом; например, роботизированные устройства. Например, автоматизированная система может включать роботизированный манипулятор для управления жидкостями для переноса растворов (например, экстрактов клеток растений) от источника в место назначения (например, из микропланшета для титрования на подложку чипа), который может быть функционально соединен с цифровым вычислительным устройством (например, в интегрированной компьютерной системе). Устройство для ввода данных в цифровое вычислительное устройство для контроля высокопроизводительного переноса жидкостей роботизированным манипулятором для управления жидкостями (и, необязательно, для контроля переноса манипулятором на твердую подложку) также может быть признаком автоматизированной системы. Множество автоматизированных роботизированных систем для обработки жидкостей являются коммерчески доступными. Например, различные автоматизированные системы, в которых используются различные системы ZymateTM, и которые, как правило, включают робототехнический модуль и модуль обработки жидкостей, доступны от Caliper Technologies Corp. (Hopkinton, MA). Аналогично, распространенный робот ORCA®, который используют в различных лабораторных системах (например, для манипулирования лотком для микротитрования) также является коммерчески доступным, например, от Beckman Coulter, Inc. (Fullerton, CA). В качестве альтернативы общепринятой робототехнике, в настоящее время широко доступны микрожидкостные системы для проведения обработки жидкостей и детекции от Caliper Technologies and Agilent technologies (Palo Alto, CA).

В конкретных вариантах осуществления система для молекулярного анализа маркеров может включать, например, но не ограничиваясь ими, цифровое вычислительное устройство, содержащее программное обеспечения для высокопроизводительного контроля жидкостей; цифровое вычислительное устройство, содержащее программное обеспечение для анализа изображений для анализа данных от меток маркеров; цифровое вычислительное устройство, содержащее программное обеспечение для интерпретации данных; роботизированный манипулятор для управления жидкостями для переноса растворов из источника в место назначения; устройство ввода (например, клавиатура компьютера) для ввода данных в систему (например, для контроля высокопроизводительного переноса жидкостей с помощью роботизированного стержня контроля жидкостей); и сканер изображений для оцифровки сигналов метки от меченых зондов.

Оптические изображения (например, профили гибридизации), визуализированные и/или записанные с помощью камеры или другого устройства (например, фотодиодное устройство и устройство для хранения данных) можно далее обрабатывать в любом из вариантов осуществления, описанных в настоящем описании. Например, но не ограничиваясь этим, такие изображения можно обрабатывать путем оцифровки изображения и/или сохранения и анализа изображения на компьютере. Для оцифровки, хранения или анализа оцифрованной видеозаписи или оцифрованного оптического изображения доступно различное коммерчески доступное периферийное оборудование и программное обеспечение, например, с использованием различных компьютерных и программных платформ.

Некоторые варианты осуществления также включают наборы, пригодные для идентификации растений, которые содержат по меньшей мере один маркер, сцепленный с фенотипом низкого содержания пальмитиновой кислоты в подсолнечнике, и/или для установления соотношения между присутствием конкретного сцепленного маркерного аллеля с низким содержанием пальмитиновой кислоты. В некоторых примерах такой набор может включать соответствующие праймеры или зонды для обнаружения по меньшей мере одного маркера, сцепленного с низким содержанием пальмитиновой кислоты, и конкретных маркерных аллелей; и инструкции по применению праймеров или зондов для обнаружения по меньшей мере одного маркера и установления соотношения маркерного аллеля с прогнозируемым содержанием пальмитиновой кислоты. В некоторых примерах набор может включать материалы для упаковывания зондов, праймеров и/или инструкций; и контроли (например, контрольные реакционные смеси для амплификации, которые включают зонды, праймеры или матричные нуклеиновые кислоты для амплификаций и маркеры размера молекул).

В некоторых вариантах осуществления набор или система для идентификации растений, которые содержат по меньшей мере один маркер, сцепленный с фенотипом низкого содержания пальмитиновой кислоты в подсолнечнике, и/или для установления соотношения между присутствием конкретного сцепленного маркерного аллеля и низким содержанием пальмитиновой кислоты, могут включать нуклеиновые кислоты, которые выявляют конкретные маркеры SSR QTL, описанные в настоящем описании. Например, система или набор могут содержать пару праймеров для амплификации, способных инициировать полимеризацию ДНК ДНК-полимеразой на матричной нуклеиновой кислоте подсолнечника, для получения ампликона маркера подсолнечника, где ампликон маркера соответствует маркеру подсолнечника, выбранному из HA0031B, HA0908, HA1665, HA0304A, HA0850, HA0743, HA0870, HA0907, HA0612A и маркера, сцепленного по меньшей мере c одним из указанных выше маркеров. Например, пара праймеров, которая является специфичной к маркеру, может быть выбрана из пар праймеров, указанных в таблице 6, или их эквивалентов.

ПРИМЕРЫ

Представленные ниже примеры предоставлены для иллюстрации, но не для ограничения, определенных вариантов осуществления изобретения. Понятно, что примеры и варианты осуществления, описанные в настоящем описании, предназначены только для целей иллюстрации, и специалистам в данной области известны различные реагенты, технологии, системы и параметры, которые можно изменять без отклонения от сущности или объема изобретения.

Пример 1: Естественное варьирование содержания пальмитиновой кислоты в подсолнечнике

Естественное варьирование содержания пальмитиновой кислоты в подсолнечнике измеряли, исходя из способа AOCSTM Ce 2-66(97) (код продукта AOCSTM MC-CE266).

Пять семян подсолнечника из каждого образца, подлежащего исследованию, помещали в обозначенный 96-луночный планшет для экстракции (Corning Inc., каталожный номер № 4411), содержащий один стальной шар размером 1/8 дюйма (0,2825-см) (Small Parts Inc. каталожный номер № BS-0125-C). В каждую лунку добавляли 200 мкл гептана, а затем их накрывали. Накрытые образцы помещали в GenoGrinderTM на 2,0 минуты при 1300 ударов/минута. Образцы извлекали и любые неразмолотые образцы дробили вручную с помощью шпателя и повторно перемалывали.

После первого измельчения в каждую лунку добавляли 400 мкл гептана, и материал повторно измельчали при 1300 ударов/минута. Затем образцы центрифугировали в течение 10 минут при 3700 об./мин. при 6°C. Затем, с использованием робота Beckman Coulter MC, супернатант переносили в 96-луночный планшет со стеклянными вставками (Microliter Analytical Supplies Inc., каталожный номер № 07-8045MB-1200), содержавший 400 мкл гептана. Затем в каждую лунку добавляли 40 мкл 1% метоксида натрия. Метоксид натрия разбавляли их исходного 30% раствора с метанолом (Sigma-Aldrich Fluka, каталожный номер № 71748). Планшеты накрывали тефлоновой плоской крышкой и инкубировали при комнатной температуре в течение 60 минут перед анализом.

Образцы анализировали для определения их состава жирных кислот на Agilent 6890 GC-FID (Agilent Technologies), оборудованном колонкой ID J&W Scientific DB-23, 15 м x 0,25 мм, и пленкой толщиной 0,25 мкм (Agilent Technologies, каталожный номер № 122-2312). Первоначальная температура печи составляла 200°C, эту температуру поддерживали на протяжении всего анализа. Входное отверстие было установлено на отношение деления потока 1:50 и температуру 280°C. В течение первых двух минут поддерживали скорость наклонного потока гелия 0,8 мл/минута. Затем поток увеличивали до скорости от 1,0 мл/минута до 2,5 мл/минута, и на этой скорости держали в течение 1,5 минут. Детектор был установлен на 300°C с постоянным составом газа-носителя и скоростью колонки 30 мл/минута, скоростью потока топливного водорода 30 мл/минута, и скоростью потока окислителя 400 мл/минута. Для всех образцов использовали объем инъекции 2 мкл.

Пики метилового сложного эфира пальмитиновой кислоты идентифицировали посредством сравнения с временем удержания эталонных стандартов метилового сложного эфира (Nu-Chek-Prep, Inc., GLC#428). Фиг.1 и таблица 1. Индивидуальные процентные площади вычисляли для всех анализируемых соединений в эталонном стандарте на основе общих интегрированных площадей хроматографических пиков. Также инжектировали пустой образец гептана для идентификации каких-либо примесей на GC.

Таблица 1
Статистика распределения содержания пальмитиновой кислоты
Распределение Квантиль % пальмитиновой кислоты
100,0 % максимальный 15,05
99,5 5,87
97,5 5,23
90,0 4,63
75,0 квартиль 4,20
50,0 средний 3,72
25,0 квартиль 3,21
10,0 2,92
2,5 2,66
0,5 2,41
0,0 минимальный 0,00

С использованием этого способа содержание пальмитиновой кислоты в выращенных на поле образцах оценивали на сортах подсолнечника, которые были выведены в качестве части программы разведения подсолнечника в течение семи лет. Измеренное распределение содержания пальмитиновой кислоты представлено на фиг.2 и в таблице 2. Как правило, наблюдаемые величины для пальмитиновой кислоты в обычном генетическом материале подсолнечника находились и диапазоне приблизительно от 2,5% до 6% от общего содержания жирных кислот со средним значением 3,75%.

Таблица 2
Статистика распределения содержания пальмитиновой кислоты
Среднее значение 3,74945
Стандартное отклонение 0,70766
Средняя стандартная ошибка 0,00466
Среднее значение для верхних 95% 3,75858
Среднее значение для нижних 95% 3,74031

Пример 2: Идентификация генетического материала с низким содержанием пальмитиновой кислоты

Профиль низкого содержания пальмитиновой кислоты был обнаружен во время программы, предназначенной для усовершенствования элитной линии подсолнечника с черной оболочкой и высоким содержанием линолеиновой кислоты (687R) посредством скрещивания ее с линией, имеющей профиль увеличенного содержания олеиновой кислоты. Это осуществляли путем разведения способом обратного скрещивания с использованием в качестве донора с высоким содержанием олеиновой кислоты кондитерского родительского растения с полосатой оболочкой и высоким содержанием олеиновой кислоты (H280R). H280R, как правило, имеет более низкое содержание пальмитиновой кислоты, однако наблюдаемый уровень обычно составляет не ниже чем приблизительно 2,5%. Для достижения заданных уровней олеиновой кислоты проводили анализ FAME, как описано в примере 1, в каждом поколении во время программы по разведению способом обратного скрещивания. Во время стандартного скрининга уровней жирных кислот наблюдали сегрегирующую особь, которая имела существенно сниженные уровни пальмитиновой кислоты. В таблице 3 представлены величины содержания пальмитиновой кислоты для четырех особей из первого поколения обратного скрещивания программы разведения способом обратного скрещивания 687R с H280R.

Таблица 3
Уровни пальмитиновой кислоты, определенные с использованием протокола, описанного в примере 1, для объединенного образца из 8-10 семян из четырех головок, выбранных из первого поколения разведения путем обратного скрещивания 687R/H280R
Головка Содержание пальмитиновой кислоты
1 2,18
2 2,13
3 2,06
4 2,04
H280R 3,18

Пример 3: Варьирование содержания пальмитиновой кислоты в популяции подсолнечника, полученной из родительского растения с низким содержанием пальмитиновой кислоты и обычного элитного родительского растения подсолнечника

Варьирование содержания пальмитиновой кислоты, когда элитное инбредное растение подсолнечника скрещивают с источником сниженного содержания пальмитиновой кислоты, было продемонстрировано посредством скрещивания растения, восстанавливающего высокое содержание олеиновой кислоты (линия R), с источником низкого содержания пальмитиновой кислоты, полученным в результате открытия, описанного в примере 2. Источник с низким содержанием пальмитиновой кислоты конвертировали в генетический фон с цитоплазматической мужской стерильностью (линия A). Получали популяцию F2 от скрещивания линии A с линией R и собирали 384 семян. Семена разрезали пополам, причем половину семени анализировали в соответствии с протоколом, описанным в примере 1. Другую половину семени сеяли для последующего анализа. Суммарная статистика для содержания пальмитиновой кислоты в популяции F2 линия A/линия R (N=384) представлены в таблицах 4-5.

Таблица 4
Статистика распределения содержания пальмитиновой кислоты в поколении F2 между элитным инбредным растением, имеющим типичное содержание пальмитиновой кислоты, и линией, имеющей низкое содержание пальмитиновой кислоты
Распределение Квантиль % пальмитиновой кислоты
100,0 % максимальный 4,216
99,5 4,216
97,5 3,612
90,0 3,342
75,0 квартиль 3,1995
50,0 средний 2,989
25,0 квартиль 2,5995
10,0 1,976
2,5 1,734
0,5 1,648
0,0 минимальный 1,648

Таблица 5
Статистика распределения содержания пальмитиновой кислоты в популяции F2 между элитным инбредным растением, имеющим типичное содержание пальмитиновой кислоты и линией, имеющей низкое содержание пальмитиновой кислоты
Среднее значение 2,83964
Стандартное отклонение 0,51878
Средняя стандартная ошибка 0,02647
Среднее значение для верхних 95% 2,89169
Среднее значение для нижних 95% 2,78759

Пример 4: Демонстрация бимодального распределения содержания пальмитиновой кислоты

Распределение содержания пальмитиновой кислоты в популяции, описанной в примере 3, представлено на фиг.3. Распределение является бимодальным: часть популяции имеет центр на уровне приблизительно 3,15% пальмитиновой кислоты, причем нижняя концевая часть оканчивается на уровне приблизительно 2,5% и верхняя концевая часть продолжается до приблизительно 4%; и вторая часть популяции имеет центр на уровне приблизительно 2,1% пальмитиновой кислоты, причем нижняя концевая часть достигает приблизительно 1,75% и верхняя концевая часть продолжается до приблизительно 2,5%. Из квантилей, представленных в примере 3, было выявлено, что 25% популяции имеет содержание пальмитиновой кислоты ниже 2,6%, причем остальная часть популяции имеет более высокое содержание пальмитиновой кислоты. Величина первого квартиля (2,6%) располагается близко к точке перегиба, где бимодальное распределение переходит из нижнего кластера в верхний кластер. Отметив, что существует соотношение 3:1 между особями с высоким содержанием пальмитиновой кислоты и особами с более низкой величиной, было сделано заключение, что существует один главным генетический элемент, который ответственен за низкое содержание пальмитиновой кислоты в этой популяции, причем рецессивный аллель сообщает фенотип низкого содержания пальмитиновой кислоты.

Пример 5: Картирование QTL генетической детерминанты содержания пальмитиновой кислоты

Главный локус для содержания пальмитиновой кислоты был картирован на группе сцепления подсолнечника 5 (LG5) с использованием микросателлитных маркеров или маркеров SSR и данные о содержании пальмитиновой кислоты представлены в примерах 3 и 4.

Карты подсолнечника обычно предоставляют по группам сцепления. Доступны карты группы сцепления 5. См. Yu et al. (2003) Crop Sci. 43:367-87; также см. Tang et al. (2002) Theor. Appl. Genet. 105:1124-36. Следует отметить, что номера групп сцепления подсолнечника на картах, разработанных европейскими учеными, отличаются, например, от номеров, указанных в цитированных выше источниках. Номера хромосом, соответствующие группам сцепления в подсолнечнике, еще не были определены.

Таблица 6
Последовательности праймеры и положения на картах маркеров SSR, картированных на LG5, для идентификации локуса пальмитиновой кислоты
Маркер Положение на карте (см) Последовательность прямого праймера Последовательность обратного праймера
HA0357_H757B 0,0 GTTCCTGTCGGGTAACTGTAGC (SEQ ID NO:1) CATTGATGGAGATGGCTGG (SEQ ID NO:2)
HA0694B_H280R 17,8 GCCGTGAATAATGGGATTGA (SEQ ID NO:3) GATTGGGTCAGCTTGTGTGA (SEQ ID NO:4)
HA1485 19,7 GGGAAGTGGGCTTGTCTATGTAT (SEQ ID NO:5) AACACACCGAAATCACCTATGAA (SEQ ID NO:6)
HA1838 20,1 AGAGGAATGAGATCGGGTTGAT (SEQ ID NO:7) GTGGGACAACTCAGCAACGTC (SEQ ID NO:8)
HA1489_H280R 20,5 CTTATTCCAAGGACGCATAGTCG (SEQ ID NO:9) CGATGGTATGATTCTCGACGTTA (SEQ ID NO:10)
HA1146B 21,6 ACACCAACCAGACGCAGAAT (SEQ ID NO:11) GTGCAAGAACGAGGAAGAGG (SEQ ID NO:12)
HA0037 21,8 GAACATGGCCATAACTCATAGACG (SEQ ID NO:13) CCTTCGACCCAACATC
(SEQ ID NO:14)
HA0654 21,8 ACGCACATGAGAGAGAAAGAG (SEQ ID NO:15) ACCTTCGACCCAACATCAAG (SEQ ID NO:16)
HA1620_H280R 22,6 TTTCGTGATGGTGATTGATGATT (SEQ ID NO:17) CAGCAACTCTGACCGTTTCATTA (SEQ ID NO:18)
HA0031B 23,0 CTCACGAAACTCTTCATGCTG (SEQ ID NO:19) CTCTCACACTTACTGAAC
(SEQ ID NO:20)
HA0908 23,1 TTGTCTTCATCTGCGTGTGA (SEQ ID NO:21) TTGCTGTTGTTGATCGGTGT (SEQ ID NO:22)
HA1665 23,2 CCTAAGGGGATGAATTCTCTTTC (SEQ ID NO:23) AACTTCCAATGTTCTCCAACCAT (SEQ ID NO:24)
HA0304A_H757B 23,6 GTGCCCTAACACTGTTCCGT (SEQ ID NO:25) AGCGAAAGGATCGAGAATC (SEQ ID NO:26)
HA0850_H757B 23,8 CCCTGGAGTGTATGTCCGTTA (SEQ ID NO:27) ATCCGTCTGCTGCCTAATCC (SEQ ID NO:28)
HA0743_H757B 24,2 ACGGAAAGCTCTTGAAAGCA (SEQ ID NO:29) GCGGGCATTCCAACTAGTAA (SEQ ID NO:30)
HA0870 24,3 GTGCGTTGGCTCTTATGGAT (SEQ ID NO:31) AGTGATGGCATTCCCAATTT (SEQ ID NO:32)
HA0907 24,6 CATGAACATCGCCAATTCAG (SEQ ID NO:33) TGCAAGGAACCATCAGAATC (SEQ ID NO:34)
HA0612A_H757B 25,8 CTTGGGTTCTTCATAACTC (SEQ ID NO:35) CATGTAATCACCTTTCAAG (SEQ ID NO:36)
HA1923 27,1 AACCAAAGATTCAAGGCAATCA (SEQ ID NO:37) CAGACATTAGACGCGAAGCAG (SEQ ID NO:38)
HA1357A 28,2 CACAAAACAATCGCTAAAAGAACA (SEQ ID NO:39) AATGATGATGGTCACGAAGAAGA (SEQ ID NO:40)
HA1357B_H757B 29,5 CACAAAACAATCGCTAAAAGAACA (SEQ ID NO:39) AATGATGATGGTCACGAAGAAGA (SEQ ID NO:40)
HA1819_H280R 30,9 GTTTCGGGTGGGGGATTACGG (SEQ ID NO:41) ATGGTCGACAACAAGCGCAAAC (SEQ ID NO:42)
HA0894 33,2 TGGTGGAGGTCACTATTGGA (SEQ ID NO:43) AGGAAAGAAGGAAGCCGAGA (SEQ ID NO:44)
HA1790 37,6 TCCCCAAACTTGCGTGTAGGT (SEQ ID NO:45) CATTACAAACCACAGCTCCTTCC (SEQ ID NO:46)
HA0041 47,1 CTAGCAACCAACCTCATTG (SEQ ID NO:47) GTCTCCTTCTCTTTCTCGGC (SEQ ID NO:48)
HA1313 52,3 CGACCCACCTAGTAAAAGCAAAC (SEQ ID NO:49) TGCCATAAAAAGATTTGGTCTCC (SEQ ID NO:50)
HA1776_H757B 59,6 TCACAGGAGAATGCAAAGAGTG (SEQ ID NO:51) GCATAATAGGAGTAACTGCCAAAAC (SEQ ID NO:52)

Методики ПЦР для маркеров SSR. Реакции ПЦР проводили на системе GeneAmpTM PCR System 9700 (Applied Biosystems) с двумя 384-луночными блоками. Каждую реакцию ПЦР проводили в объеме 8 мкл, содержащем 10 нг геномной ДНК с 1x конечной концентрацией буфера для ПЦР QiagenTM (Qiagen, Valencia, California), 0,25 мкМ каждого праймера (прямой и обратный), 1 мМ MgCl2, 0,1 мМ каждого dNTP, 0,4% PVP и 0,04 единицы ДНК-полимеразы Taq HotStartTM (Qiagen, Valencia, California).

Условия ПЦР были следующими: 12 минут при 95°C для денатурации матричной ДНК; 40 циклов для амплификации ДНК (каждый цикл: 5 секунд при 94°C для денатурации, 15 секунд при 55°C для отжига и 30 секунд при 72°C для удлинения); и 30 минут при 72°C для конечного удлинения.

Анализ фрагментов. Продукты ПЦР различных пар праймеров подвергали мультиплексному анализу в конечном объеме 100 мкл (с использованием автоклавированной воды для доведения объема до 100 мкл). 0,5 мкл продуктов мультиплексной ПЦР смешивали 5 мкл буфера для нанесения. Гели разделяли на AB3730XL DNA Analyzer (Applied Biosystems) со спектральной матрицей G5-RCT с использованием стандартных условий. Затем данные импортировали в GeneMapper® версии 4.0 (Applied Biosystems). Импортировали все цвета красителей и 2 наиболее высоких пика с минимальной интенсивностью 100 относительных единиц флуоресценции (rfu) обозначали. Аллелям присваивали числовую величину в соответствии с размером фрагмента ПЦР. Числовые показатели аллелей импортировали в ExcelTM (Microsoft), где их конвертировали в форматы, подходящие для JoinMapTM 3.0 и MapQTLTM 4.0.

Статистический анализ

Картирование сцепления. JoinMapTM 3.0 использовали для создания карты генетического сцепления для популяции F2 линия A/линия R. Для JoinMapTM 3.0 требуется один входной файл, обозначаемый как файл генотипа локуса. В файле генотипа локуса аллели элитного родительского растения обозначали как "A", аллели донорного растения обозначали как "B", в то время как гетерозиготные аллели обозначали как "H". Отсутствующие данные отображали тире в файле генотипа локуса. Результаты вычисляли в сантиморганах Kosambi. Карту, полученную в этом анализе, сравнивали с общедоступной картой (см. S. Tang, J.K. Yu, M.B. Slabaugh, D.K. Shintani, S.J. Knapp (2002) Simple sequence repeat map of the sunflower genome. Theor. Appl. Genet. 105:1124-1136) для конечной интерпретации данных.

Анализ QTL. Картирование интервалов для содержания пальмитиновой кислоты проводили с использованием MapQTLTM 4.0 для определения положения потенциального QTL. Для MapQTLTM 4.0 требуется три входных файла, включая файл генотипа локуса, файл карты и файл количественных данных. Файл генотипа локуса содержал коды генотипа для всех локусов сегрегирующей популяции, как описано выше. Файл карты, полученный с помощью JoinMapTM 3.0, содержал оцененные положения на карте LG5 для 27 локусов, приведенных в примере 5. Файл количественных данных включал содержание пальмитиновой кислоты, определенное с использованием способов аналитической химии, описанных в примере 1.

Анализ для картирования интервалов оценивает вероятность расположения QTL в интервале между двумя маркерами. Jansen (1993) Genetics 135:205-11. Проводили анализ для картирования интервалов и вычисляли вероятность того, что QTL находится в пределах интервала. Когда показатель LOD превышал заранее заданный порог значимости P<0,05 или P<0,01, вычисленный из испытания с перестановкой с 1000 повторений эксперимента (Churchill and Doerge (1994) Genetics 138(3):963-71) проводили определение QTL. Положение с наибольшим LOD на группе сцепления использовали в качестве оцененного положения QTL на карте. Поскольку эта популяция представляла собой популяцию F2 было возможным проведение картирования интервалов с использованием статистической модели для обнаружения QTL, ассоциированного с аддитивной генетической изменчивостью, отдельно, и с использованием статистической модели, которая учитывала (и, таким образом, обнаруживала) QTL, ассоциированный как с аддитивной, так и с доминантной генетической изменчивостью. Ранее определенные данные анализировали с использованием обеих моделей.

Пример 6: Селекция потомства обратного скрещивания по содержанию пальмитиновой кислоты

Маркеры, описанные в настоящем описании, использовали для селекции потомства, полученного путем разведения способом обратного скрещивания с использованием донорной линии, имеющей аллель, ассоциированный с фенотипом низкого содержания пальмитиновой кислоты. Элитную линию с низким содержанием пальмитиновой кислоты, составляющим приблизительно 3,5%, скрещивали с донорной линией, имеющей аллели, ассоциированные с фенотипом низкого содержания пальмитиновой кислоты в локусах HA0907, HA0041, HA1790, HA1665, HA0908 и HA1620. Отобранных полученных потомков скрещивали с элитной линией с получением первого поколения обратного скрещивания. Отобранных потомков первого поколения обратного скрещивания вновь подвергали обратному скрещиванию с элитной линией с получением второго поколения обратного скрещивания. Генотип особей второго поколения обратного скрещивания представлен в таблице 7.

Таблица 7
Генотипы элитной линии, имеющей фенотип увеличенного содержания пальмитиновой кислоты, и донора с аллелями, ассоциированными с фенотипом сниженного содержания пальмитиновой кислоты, и селекция во втором поколении обратного скрещивания этих двух линий в качестве рекуррентного родительского растения и донора, соответственно
Хромосома 5
HA0907 HA0041 HA1790 HA1665 HA0908 HA1620 Конец
18 20 25 31 35 39 59
Образец
ON6725R A,A A,A A,A A,A A,A A,A
NS1982,8 B,B B,B B,B B,B B,B B,B
ON6725R[2]/
NS1982,8#1=1=3
Растение #19 A,A A,B A,B A,B A,B A,B

Поскольку фенотип низкого содержания пальмитиновой кислоты является рецессивным, особь из второго поколения обратного скрещивания, представленная в таблице 7, сама по себе не обладает фенотипом низкого содержания пальмитиновой кислоты. Для подтверждения того, что аллели, ассоциированные со сниженным содержанием пальмитиновой кислоты, сообщают фенотип низкого содержания пальмитиновой кислоты в элитном генетическом фоне, проводили испытание по качеству потомства. Особь, представленную в таблице 7, подвергали самоопылению и восемь семян, соответствующих потомству самоопыления, подвергали анализу FAME для определения содержания пальмитиновой кислоты. Результаты, представленные в таблице 8, демонстрируют, что три из восьми потомков имеют фенотип низкого содержания пальмитиновой кислоты, что согласуется с ожидаемым соотношением один к трем для рецессивного признака, контролируемого одним локусом. Этот результат демонстрирует, что фенотип низкого содержания пальмитиновой кислоты наследуется потомством.

Таблица 8
Фенотипы пальмитиновой кислоты для восьми особей, полученных в результате самоопыления растения номер 19 из второго поколения обратного скрещивания ON6725R[2]/NS1982.8#1=1=3
Особь Содержание пальмитиновой кислоты (%)
1 2,68
2 2,73
3 1,71
4 2,23
5 1,98
6 2,85
7 3,31
8 1,92

Пример 7: Селекция линии потомков, сохраняющей цитоплазматическую мужскую стерильность, с повышенным содержанием пальмитиновой кислоты

При коммерческом производстве гибридных семян подсолнечника используют систему с цитоплазматической мужской стерильностью для получения требуемых количеств семян. Линия подсолнечника в примере 6 представляла собой линию-восстановителя, которая восстанавливает нормальную фертильность при использовании в качестве опылителя с женским растением, имеющим цитоплазму с мужской стерильностью. Гибриды, имеющие фенотип низкого содержания пальмитиновой кислоты, можно получать из мужских и женских инбредных растений, содержащих аллель(и) QTL низкого содержания пальмитиновой кислоты, сцепленный с маркерами, описанными в настоящем описании, поскольку фенотип низкого содержания пальмитиновой кислоты является рецессивным. В системе получения гибрида с цитоплазматической мужской стерильностью инбредные женские растения состоят из двух практически изогенных линий: линия A, которая содержит цитоплазму, сообщающую мужскую стерильность; и линия B, которая имеет нормальную цитоплазму, но не содержит ген-восстановитель. Линия B обладает мужской фертильностью и ее можно использовать для опыления линии A, причем полученное потомство обладает мужской стерильностью, поскольку они наследуют цитоплазму из женской линии A. Эти потомки также по существу идентичны родительской линии A, поскольку линии A и B являются практически изогенными. Таким образом, линия B известна в качестве поддерживающей линии. Линия A происходит из линии B вследствие использования линии с цитоплазматической мужской стерильностью в качестве донора и линии B в качестве рекуррентного родителя. После повторяющегося обратного скрещивания с линией B в качестве рекуррентного (мужского) родителя, генотип линии B можно восстанавливать при сохранении мужской стерильной цитоплазмы донора. Полученная линия известна как линия A. Первой стадией для создания новой пары линия A-линия B является создание новой линии B. Затем линию A получают из линии B.

Чтобы продемонстрировать применимость маркеров, описанных в настоящем описании, для создания поддерживающих линий с цитоплазматической мужской стерильностью, имеющих фенотип низкого содержания пальмитиновой кислоты, элитную линию B с содержанием пальмитиновой кислоты приблизительно 3,5% скрещивали с донорной линией, имеющей аллели, ассоциированные с фенотипом низкого содержания пальмитиновой кислоты в локусах HA0850, HA0907 и HA0908. Остальные локусы были мономорфными между донорным и рекуррентным родительским растением. Отобранных полученных потомков подвергали обратному скрещиванию с элитной линией с получением первого поколения обратного скрещивания. Генотип особи из первого поколения обратного скрещивания представлен в таблице 9.

Таблица 9
Генотипы элитной линии B, имеющей фенотип увеличенного содержания пальмитиновой кислоты, донора с аллелями, ассоциированными с фенотипом сниженного содержания пальмитиновой кислоты, и отобранных особей первого поколения обратного скрещивания с этими двумя линиями в качестве рекуррентного родителя и донора, соответственно
Хромосома 5
HA0850 HA0907 HA0908 Конец
Образец 13 18 35 59
ON1919B A,A A,A A,A
NS1982,8 B,B B,B B,B
ON1919B[1]//CN1919B/
NS1982,8#3=1-17=5
Растение # 11 A,A A,B A,B

Для подтверждения того, что аллели низкого содержания пальмитиновой кислоты, имеющиеся у особи, представленные в таблице 9, сообщают фенотип низкого содержания пальмитиновой кислоты в гомозиготном состоянии, проводили испытание по качеству потомства. Особь в таблице 9 подвергали самоопылению и восемь семян, соответствующих потомству самоопыления, подвергали анализу FAME для определения фенотипа содержания пальмитиновой кислоты. Результаты, представленные в таблице 10, демонстрируют, что два из восьми потомков имели фенотип низкого содержания пальмитиновой кислоты, который согласуется с ожидаемым соотношением один к трем для рецессивного признака, контролируемого одним локусом. Этот результат демонстрирует, что фенотип с низким содержанием пальмитиновой кислоты можно подвергать интрогрессии в линию B с использованием разведения способом обратного скрещивания.

Таблица 10
Фенотипы содержания пальмитиновой кислоты в восьми особях, полученных путем самоопыления растения номер 11 из первого поколения обратного скрещивания ON1919B[1]//CN1919B/NS1982,8#3=1-17=5
Особь Содержание пальмитиновой кислоты (%)
1 2,74
2 3,16
3 3,01
4 1,77
5 2,97
6 3,47
7 2,73
8 1,87

Пример 8: Выведение окончательных элитной поддерживающей линии с цитоплазматической мужской стерильностью и линии-восстановителя с повышенным содержанием пальмитиновой кислоты

После двух поколений обратного скрещивания отобранных особей подвергали самоопылению в течение 3 поколений и отобранные особи с желаемыми агрономическими признаками подвергали анализу FAME. Результаты, представленные в таблице 11, демонстрируют, что окончательные элитные линии B с фенотипом низкого содержания пальмитиновой кислоты могут быть выведены с использованием способа обратного скрещивания.

Таблица 11
Содержание пальмитиновой кислоты в элитных линиях B, выведенных с использованием способа разведения посредством обратного скрещивания
Название Содержание пальмитиновой кислоты (%)
H251B[3]/NS1982,12-20=1=4-1-20-07 1,93
ON7479B[2]/NS1982-8#2=1=5-12-10-01 1,96

После двух поколений обратного скрещивания отобранные особи подвергали самоопылению в течение трех поколений, и отобранные желаемые агрономические признаки подвергали анализу FAME. Результаты, представленные в таблице 12, демонстрируют, что окончательные элитные линии-восстановители с фенотипом низкого содержания пальмитиновой кислоты могут быть выведены с использованием способа выведения с обратным скрещиванием.

Таблица 12
Содержание пальмитиновой кислоты в элитных линиях-восстановителях, выведенных с использованием способа выведения с обратным скрещиванием
Название Содержание пальмитиновой кислоты (%)
OND163R[4]/NS1982-16=20=2=3=13-7-2-2 1,79
ON7385R[3]/NS1982,8=7=2=5-4-2-01 1,79

Хотя представленные выше варианты осуществления подробно описаны для ясности и понимания, специалисту в данной области из настоящего описания будет понятно, что можно вносить различные изменения в форме и деталях без отклонения от истинного объема изобретения. Например, все технологии и устройства, описанные выше, можно использовать в различных комбинациях.

1. Способ получения генетического материала подсолнечника, который имеет содержание пальмитиновой кислоты менее чем 3,0% от общего содержания масла, причем способ включает:

амплификацию из геномной ДНК генетического материала подсолнечника по меньшей мере одного маркера, сцепленного с низким содержанием пальмитиновой кислоты, где по меньшей мере один маркер выбран из группы, состоящей из HA0304A(SEQ ID NO:25), HA0743(SEQ ID NO:29), и HA0612A(SEQ ID NO:35), для получения ампликона маркера, где амплификация включает:

смешение праймера для амплификации или пары праймеров для амплификации с нуклеиновой кислотой, выделенной из растения или генетического материала подсолнечника, где праймер или пара праймеров комплементарны или частично комплементарны по меньшей мере части маркера и способны инициировать полимеризацию ДНК ДНК-полимеразой с использованием нуклеиновой кислоты подсолнечника в качестве матрицы;

удлинение праймера или пары праймеров в реакционной смеси для полимеризации ДНК, содержащей ДНК-полимеразу и матричную нуклеиновую кислоту, с получением по меньшей мере одного ампликона;

выявление по меньшей мере одного ампликона маркера; и

скрещивание генетического материала подсолнечника с другим генетическим материалом подсолнечника с получением генетического материала подсолнечника, который имеет содержание пальмитиновой кислоты менее чем 3,0% от общего содержания масла.

2. Способ по п.1, где выявленный маркер имеет частоту генетической рекомбинации менее чем приблизительно 10% по меньшей мере с одним маркером из HA0304A(SEQ ID NO:25), HA0743(SEQ ID NO:29) и HA0612A(SEQ ID NO:35).

3. Способ по п.1, где выявление включает выявление по меньшей мере одной аллельной формы полиморфного простого повтора последовательности (SSR).

4. Способ по п.1, где амплификация включает использование полимеразной цепной реакции (ПЦР) или лигазной цепной реакции (LCR) с использованием нуклеиновой кислоты, выделенной из генетического материала подсолнечника, в качестве матрицы в ПЦР или LCR.

5. Способ по п.1, где выявленный маркер определяют с использованием популяции для картирования H757B/H280R.

6. Способ по п.5, где выявленный маркер определяют с использованием программного обеспечения, выбранного из TASSELTM, GeneFlowTM и MapManager-QTXTM.

7. Способ по п.1, где способ включает электронную передачу или электронное хранение данных, соответствующих выявленному маркеру, на считываемом компьютером носителе.

8. Способ по п.1, где способ включает отбор генетического материала подсолнечника.

9. Способ по п.1, где способ включает отбор потомства генетического материала подсолнечника.

10. Способ по п.1, где другой генетический материал подсолнечника представляет собой генетический материал подсолнечника из элитного сорта подсолнечника или экзотического сорта подсолнечника.

11. Способ по п.1, где нуклеотидная последовательность является выделенной посредством позиционного клонирования и идентифицированной по сцеплению по меньшей мере с одним маркером.

12. Способ по п.1, где нуклеиновая кислота соответствует открытой рамке считывания (ORF), которая кодирует полипептид, который при экспрессии в растении подсолнечника приводит к растению подсолнечника, имеющему сниженное содержание пальмитиновой кислоты.



 

Похожие патенты:
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагинита Lactobacillus spp.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагинита Lactobacillus spp.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для количественного определения ДНК энтеробактерий семейства Enterobacteriaceae, включая Е.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для количественного определения ДНК энтеробактерий семейства Enterobacteriaceae, включая Е.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Gardnerella vaginalis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Gardnerella vaginalis в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Atopobium vaginae в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагиноза Atopobium vaginae в слизистой оболочке влагалища методом полимеразной цепной реакции, включающий праймеры и зонды с флуоресцентной меткой.

Изобретение относится к биотехнологии. Предложены биомаркеры, способы и тест-системы для определения неблагоприятного прогноза при интерстициальной пневмонии (фиброзе легких) у индивидуума, у которого предполагают наличие интерстициальной пневмонии.

Изобретение относится к биотехнологии. Предложены биомаркеры, способы и тест-системы для определения неблагоприятного прогноза при интерстициальной пневмонии (фиброзе легких) у индивидуума, у которого предполагают наличие интерстициальной пневмонии.

Настоящее изобретение относится к предоставлению вакцин, которые специфичны к опухолям пациентов и потенциально применимы для иммунотерапии первичной опухоли, а также метастазов опухоли. В одном аспекте настоящее изобретение относится к способу получения индивидуальной противоопухолевой вакцины, включающему стадии: (а) идентификации опухолеспецифичных соматических мутаций в образце опухоли онкопациента с получением сигнатуры опухолевых мутаций пациента; и (b) получения РНК вакцины, характерной чертой которой является сигнатура опухолевых мутаций, полученная на стадии (а). В следующем аспекте настоящее изобретение относится к вакцине, которую можно получить указанным способом. 4 н. и 15 з.п. ф-лы, 21 ил., 8 табл., 9 пр.

Настоящее изобретение относится к предоставлению вакцин, которые специфичны к опухолям пациентов и потенциально применимы для иммунотерапии первичной опухоли, а также метастазов опухоли. В одном аспекте настоящее изобретение относится к способу получения индивидуальной противоопухолевой вакцины, включающему стадии: (а) идентификации опухолеспецифичных соматических мутаций в образце опухоли онкопациента с получением сигнатуры опухолевых мутаций пациента; и (b) получения РНК вакцины, характерной чертой которой является сигнатура опухолевых мутаций, полученная на стадии (а). В следующем аспекте настоящее изобретение относится к вакцине, которую можно получить указанным способом. 4 н. и 15 з.п. ф-лы, 21 ил., 8 табл., 9 пр.

Изобретение относится к области биохимии, в частности к способу получения генетического материала подсолнечника. Изобретение позволяет получать генетический материал подсолнечника, который имеет содержание пальмитиновой кислоты менее чем 3,0 от общего содержания масла. 11 з.п. ф-лы, 5 ил., 12 табл., 8 пр.

Наверх