Рекомбинантная плазмида, экспрессирующая клонированные гены биосинтеза сидерофора иерсиниахелина возбудителя чумы, способ её получения и штамм yersinia pestis - суперпродуцент иерсиниахелина



C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2670949:

Федеральное казенное учреждение здравоохранения "Ростовский-на-Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмиде pSC-A-5EV. Плазмида pSC-A-5EV предназначена для экспрессии клонированных генов биосинтеза сидерофора иерсиниахелина Y. pestis. Указанная плазмида содержит ПЦР-копию четырех генов (уро1529-1532) биосинтеза сидерофора иерсиниахелина Y. pestis длиной 5,6 т.п.н. Указанная ПЦР-копия получена на матрице хромосомной ДНК Y. pestis EV76 с помощью праймеров p1529 (CCAAGTTCCTGCATTAGACAGA) и p1532r (CGTTGCCGGATCATTACTGACCCTGAAT). Настоящее изобретение также относится к способу конструирования плазмиды pSC-A-5EV и к рекомбинантному штамму Y. pestis КМ1986. Указанный штамм является суперпродуцентом сидерофора иерсиниахелина возбудителя чумы и представляет собой продукт трансформации плазмидой pSC-A5EV штамма Y. pestis, не синтезирующего собственный сидерофор иерсиниахелина. Изобретение позволяет получать сидерофор иерсиниахелина Y. pestis с высоким выходом. 3 н.п. ф-лы, 3 ил., 1 табл., 3 пр.

 

Изобретение относится к биотехнологии, генной инженерии, медицинской микробиологии и может быть использовано для изучения свойств и биологической активности сидерофора иерсиниахелина (Ych) возбудителя чумы (Yersinia pestis).

Известно, что в геноме Y. pestis имеются кластеры генов, способные кодировать синтез гидроксаматного сидерофора Ych, роль которого в физиологии и патогенности возбудителя чумы неизвестна [1]. Данные транскриптомных и протеомных исследований различных штаммов Y. pestis свидетельствуют об активации экспрессии этого сидерофора в организме млекопитающих, что может указывать на его возможную роль в вирулентности возбудителя чумы. Для изучения Ych необходимы его препаративные количества, наличие которых будет способствовать расшифровке структуры, функции и роли этого сидерофора в патогенезе чумы.

Наиболее перспективным способом получения больших количеств биологически активных веществ является создание их суперпродуцентов на основе рекомбинантных штаммов, содержащих клонированные гены биосинтеза изучаемого вещества в составе высококопийных плазмидных векторов. Такой подход был успешно использован для получения продуцента иммуногенного белка LcrV чумного микроба [2]. Биосинтез низкомолекулярных метаболитов бактериями проходит с помощью последовательных ферментативных реакций, осуществляемых несколькими белками. При относительно небольших размерах этих белков возможно провести клонирование их генов в составе плазмидных векторов для получения суперпродуцентов метаболитов. Клонирование генов биосинтеза сидерофоров является гораздо более сложной задачей, поскольку в синтезе сидерофоров, как правило, принимают участие несколько, в том числе и высокомолекулярных белков, гены которых находятся в сложных для клонирования больших кластерах ДНК. Преодолеть эти трудности удалось в результате клонирования разных генов, участвующих в биосинтезе сидерофора иерсиниабактина Y. pestis, в составе разных плазмид, которые возможно совместить в одной бактериальной клетке. В результате был получен штамм Е. coli, способный синтезировать иерсиниабактин [3].

В настоящее время известно, что Ych является гидроксаматным сидерофором, который кодируется хромосомным ysu локусом Y. pestis и регистрируется на поверхности бактерий в составе фактора аутоагглютинации [4]. Синтез Ych обеспечивается относительно небольшим по размерам кластером, состоящим из четырех хромосомных генов Y.pestis, поэтому клонирование этих генов в составе одной плазмиды является вполне осуществимой задачей. Однако до настоящего времени продуцент Ych не был получен, поэтому предполагаемое изобретение не имеет аналогов.

За прототип выбран способ [5], заключающийся в использовании вакцинного штамма Y.pestis EV76 для демонстрации продукции чумным микробом гидроксаматного сидерофора, который авторы назвали иерсиниахелином.

Недостатком прототипа является то, что штаммы Y. pestis в условиях in vitro синтезируют лишь небольшие количества Ych, которые слабо выделяются в культуральную среду, что не позволяет получить препаративные количества Ych и провести его структурно-функциональную характеристику.

Технической задачей предполагаемого изобретения является получение штамма Y. pestis-суперпродуцента Ych путем конструирования рекомбинантной плазмиды, которая способна обеспечить конститутивный синтез белков, необходимых для суперподукции этого сидерофора.

Поставленная задача достигается путем конструирования рекомбинантной плазмиды pSC-A-5EV, экспрессирующей клонированные гены биосинтеза Ych Y.pestis, имеющей длину 9,9 т.п.н. и состоящую из следующих элементов: ДНК вектора pSC-A-amp-kan (4,3 т.п.н.), содержащего гены устойчивости к ампициллину и канамицину, N-концевой фрагмент гена β-галактозидазы (lacZ), в который встроена ПЦР-копия четырех генов (уро1529-1532) биосинтеза Ych длиной 5,6 т.п.н., полученная на матрице хромосомной ДНК Y. pestis EV76 с помощью праймеров p1529ƒ и p1532r .

При этом способ конструирования рекомбинантной плазмиды pSC-A-5EV заключается в том, что ПЦР-копию четырех генов биосинтеза сидерофора иерсиниахелина (уро1529-1532) получают на матрице хромосомной ДНК штамма Y. pestis EV76 при использовании праймеров p1529ƒ и p1532r , ПЦР-копию клонируют в составе плазмидного вектора pSC-A-amp-kan в штамме E.coli Strata; отбирают

ампициллин-резистентные клоны, не синтезирующие β-галактозидазу, которые анализируют посредством ПЦР с праймерами pM13r комплементарен векторной ДНК) и p1532r , комплементарен клонированному фрагменту) для отбора клонов с рекомбинантной плазмидой pSC-A-5EV, содержащей гены биосинтеза иерсиниахелина под контролем векторного Plac-промотора, после этого из отобранных клонов выделяют плазмиду pSC-A-5EV, которая является рекомбинантной плазмидой pSC-A-5EV по п. 1.

Кроме того рекомбинантный штамм Y. pestis, депонированный в Государственной коллекции патогенных бактерий «Микроб» под номером КМ1986, является суперпродуцентом сидерофора иерсиниахелина возбудителя чумы и представляет собой продукт трансформации плазмидой pSC-A5EV, указанной в п. 1, штамма Y. pestis, не синтезирующего собственный сиднрофор иерсиниахелин и депонированного в Государственной коллекции патогенных бактерий «Микроб» под номером КМ 1933.

Рекомбинантный штамм Y. pestis КМ 1986 имеет характерные признаки Y. pestis, описанные в «Практическом руководстве по лабораторной диагностике опасных инфекционных болезней» [6].

Культурально-морфологичсские свойства штамма типичны для Y.pestis EV76: в мазках он представлен грамотрицательными полиморфными биполярными палочками, в 0,7%-ном агаре бактерии неподвижны, в жидких питательных средах штамм растет придонно без помутнения среды, а в более поздние сроки (3-5 суток) на поверхности среды образует пленку, на плотных средах образует бугристые зернистые колонии со слабо выраженной кружевной зоной.

Биохимические свойства штамма: штамм ферментирует глюкозу, мальтозу, маннит, арабинозу, но не сахарозу, лактозу, рамнозу, сорбит, мочевину, глицерин. Штамм не сорбирует пигменты, обладает нитрифицирующей и денитрифицирующей активностью, не продуцирует щелочную фосфатазу, синтезирует капсульный антиген Cafl и пестицин, обладает фибринолитической и плазмокоагулазной активностью, растет на среде без кальция при 37°C, резистентен к канамицину (50 мкг/мл) и ампициллину (50-100 мкг/мл).

Предполагаемое изобретение иллюстрируется следующими графическими материалами: Фиг. 1. Схема конструирования рекомбинантной плазмиды pSC-A-5EV.

Фиг. 2. Генетический анализ рекомбинантного штамма Y.pestis КМ 1986.

Фиг. 3. Продукция иерсиниахелина штаммом Y.pestis КМ 1986.

Для понимания сущности предполагаемого изобретения ниже следуют примеры его конкретного выполнения.

Пример 1, иллюстрирующий процесс конструирования плазмиды pSC-A-5EV

Плазмида pSC-A-5EV представляет собой генно-инженерный вариант, который получают путем встраивания в вектор pSC-A-amp/kan рекомбинантного фрагмента ДНК, содержащего четыре гена биосинтеза Ych Y.pestis (ypo1529-1532). ПЦР-копию этих генов получают на матрице хромосомной ДНК штамма Y. pestis EV76 при использовании сконструированных с помощью программы Vector NTI праймеров. Праймер p1529ƒ (структура ) комплементарен области ДНК перед геном уро1529, а праймер p1532r комплементарен области ДНК после гена уро1532. На фиг.1-А приведена генетическая карта кластера генов, ответственных за биосинтез и транспорт Ych. Темным цветом обозначены гены, ответственные за биосинтез Ych, светлым цветом - за транспорт нагруженного железом Ych в бактерии. Показаны праймеры (р1529ƒ и p1532r), использованные для получения ПЦР-копии генов биосинтеза Ych. Полученный ПЦР-фрагмент длиной 5,6 т.п.н. не содержал промоторной области (Р), ответственной за регуляцию биосинтеза Ych концентрацией железа в среде, а также генов транспортных белков, необходимых для поглощения бактериями связанного с железом сидерофора и гена ферри-редуктазы (ypol528), обеспечивающей освобождение железа из его комплексов с Ych внутри бактерий.

Затем полученный ПЦР-фрагмент встраивают в плазмидный вектор pSC-A-amp/kan (4,3 т.п.н.), который содержит следующие элементы: ориджин репликации высококопийных плазмид серии pUC, гены устойчивости к ампициллину и канамицину, N-концевой фрагмент гена β-галактозидазы (lacZ), Plac-промотор, лишенный регуляторных сигналов и способный обеспечивать конститутивную экспрессию клонированных генов [7]. Полйлинкер для клонирования фрагментов ДНК встроен в плазмиду таким образом, что экспрессия клонированных генов осуществляется под контролем векторного Plac-промотора. Клонирование ПЦР-копии генов биосинтеза Ych в составе вектора pSC-A-amp/kan проводят в штамме E.coli Strata с помощью набора для клонирования ПЦР-продуктов (Strata, США). После лигирования вектора с ПЦР-фрагментом и трансформации продуктом лигирования клеток E.coli Strata на среде с ампициллином и хромогенным субстратом β-галактозидазы X-gal отбирают клоны, не синтезирующие β-галактозидазу.

Полученные клоны анализируют с помощью ПЦР с праймерами pM13r комплементарен векторной ДНК) и p1532r, комплементарен клонированному фрагменту) и отбирают клон, содержащий рекомбинантную плазмиду pSC-A-5EV, генетическая карта которой приведена на фиг. 1-Б. Темным цветом обозначен рекомбинантный фрагмент, полученный с помощью ПЦР из штамма Y. pestis EV76 и клонированный в составе плазмидного вектора pSC-A-amp-kan. Показаны праймеры (pM13r и p1532r), использованные для подтверждения встраивания в векторную плазмиду генов уро1529-1532 в ориентации, обеспечивающей их экспрессию под контролем векторного Plac-промотора.

Таким образом получают рекомбинантную плазмиду pSC-A-5EV, способную обеспечивать конститутивный синтез белков, необходимых для суперпродукции Ych.

Пример 2, подтверждающий присутствие рекомбинантной плазмиды pSC-A-5EV в штамме Y. pestis КМ1986

В качестве хозяина для рекомбинантной плазмиды pSC-A-5EV используют ранее полученный на основе вакцинного штамма Y. pestis EV76 штамм Y. pestis КМ1933 (депонирован в Государственной коллекции патогенных бактерий «Микроб»), в котором, в отличие от родительского штамма EV76, делетированы хромосомные гены биосинтеза Ych и отсутствует плазмида кальций-зависимости pCD1. В результате введения путем электропорации в штамм Y. pestis КМ1933 рекомбинантной плазмиды pSC-A-5EV получен штамм Y. pestis КМ1986, который сравнивают по свойствам с контрольными штаммами. В качестве контролей во всех экспериментах используют два штамма, не содержащие плазмиду pCD1: родительский штамм EV76 и КМ1933. В оба контрольных штамма путем электропорации вводят векторную плазмиду pSC-A-amp/kan. Векторная плазмида в контрольных штаммах и рекомбинантная плазмида в штамме КМ1986 стабильно сохраняются в присутствии в среде выращивания бактерий ампициллина (50-100 мкг/мл).

Генетическую характеристику штамма Y. pestis КМ1986 проводят в сравнении с двумя контрольными штаммами: Y. pestis EV76 (pCD1-, pSC-A-amp/kan+) и KM 1933 (pCD1-, pSC-A-amp/kan+). Исследование плазмидного состава трех штаммов осуществляют методом анализа тотальной клеточной ДНК [8]. На фиг. 2-А приведена электрофореграмма ДНК контрольных и рекомбинантного штаммов в 0,8% агарозном геле, где: 1 - ДНК штамма EV76 (pCD1-, pSC-A-amp/kan+); 2 - ДНК штамма КМ1933 (pCD1-, pSC-A-amp/kan+); 3 - ДНК штамма КМ1986 (pCD1-, pSC-A-5EV+). В качестве дополнительных контролей используются препараты векторной плазмиды pSC-A-amp/kan, (0,1 мкг) и рекомбинантной плазмиды pSC-A-5EV (0,1 мкг). На фиг. 2-А видно, что в контрольных штаммах, помимо двух характерных для Y. pestis плазмид (рМТ1 и pPCP1), выявляется векторная плазмида, а в штамме КМ1986 - рекомбинантная плазмида pSC-A-5EV с меньшей подвижностью в геле, а, следовательно, с большей молекулярной массой за счет встроенного фрагмента ДНК.

Наличие в штамме КМ1986 генов биосинтеза Ych подтверждается при анализе лизатов контрольных и рекомбинантного штаммов методом ПЦР с помощью праймеров pM13r (комплементарен векторной ДНК) и p1532r (комплементарен рекомбинантному фрагменту ДНК). Результаты амплификации представлены на фиг. 2-Б, где 1 - лизат штамма EV76 (pCD1-, pSC-A-amp/kan+); 2 - лизат штамма КМ1933 (pCD1-, pSC-A-amp/kan+); 3 - лизат штамма КМ1986 (pCD1-, pSC-A-5EV+); М - маркеры фрагментов ДНК длиной 10-8-6-5-4-3,5-3-2,5-2-1,5-1-0,75 т.п.н. Как видно на фиг. 2-Б, в контрольных штаммах, содержащих векторную плазмиду, отсутствует продукт амплификации с этими праймерами. В то же время штамм Y.pestis КМ1986 дает ПЦР-фрагмент длиной около 6 т.п.н., соответствующий по длине теоретически рассчитанному фрагменту ДНК (5,63 т.п.н от рекомбинантного фрагмента + 0,15 т.п.н. от векторной ДНК).

Следовательно, генетические эксперименты подтверждают наличие в штамме Y. pestis КМ1986 рекомбинантной плазмиды, содержащей гены биосинтеза Ych.

Пример 3, демонстрирующий продукцию Ych штаммом Y. pestis КМ1986

Способность штамма Y.pestis КМ1986 продуцировать Ych определяют на универсальной индикаторной среде для выявления сидерофоров [9]. Среда содержит хромогенный хелатор железа хромазурол S (CAS), который при 30%-ном насыщении железом имеет сине-зеленую окраску, изменяющуюся на желтую после удаления из него ионов железа сидерофорами, выделяющимися бактериями в среду. Суспензии, содержащие 109 м.кл./мл двух контрольных и рекомбинантного штаммов, высевают каплями на эту среду, содержащую ампициллин (50 мкг/мл), и посевы инкубируют при 26°С 48 час. Результаты визуального сравнения сидерофорной активности трех штаммов на CAS-агаре приведены на фиг. 3-А, где: 1 - EV76 (pCD1-, pSC-A-amp/kan+); 2 - КМ1933 (pCD1-, pSC-A-amp/kan+); 3 - KM1986 (pCD1-, pSC-A-5EV+). Контрольные штаммы Y. pestis EV76 и KM1933, содержащие векторную плазмиду, не проявляли выраженной сидерофорной активности на этой среде, хотя вокруг посева штамма EV76, в хромосоме которого имеются гены биосинтеза Ych, наблюдается узкая зона просветления CAS-реактива, которая отсутствовует у штамма КМ1933. В отличие от контрольных штаммов, штамм КМ1986, который содержит высококопийную рекомбинантную плазмиду, содержащую гены биосинтеза Ych под контролем не регулируемого железом промотора, при росте на CAS-arape выделяет в среду большие количества Ych, который выявляется в виде большой зоны просветления CAS-реактива вокруг посева.

Секреция больших количеств Ych в среду штаммом Y. pestis КМ1986, но не контрольными штаммами, подтверждается и при анализе культуральной среды трех штаммов. Штаммы выращивают с аэрацией 72 час при 26°С в 50 мл минимальной среды М9[10], в которую добавляют необходимые для роста этих штаммов 4 аминокислоты (L-метионин, L-цистеин, L-треонин, L-фенилаланин) в конечной концентрации 20 мкг/мл. Оптическую плотность культур выравнивают средой М9, и бактерии осаждают центрифугированием при 8000 об/мин 10 мин. Супернатант отбирают, фильтруют через нитроцеллюлозный фильтр с диаметром пор 0,22 мкм для удаления оставшихся бактерий, и фильтраты концентрируют в 10 раз в вакуумном роторном испарителе. Полученные концентраты культуральной среды трех штаммов анализируют с помощью восходящей тонкослойной хроматографии на пластинах силикагеля, используя в качестве мобильной фазы 70% этанол и пары йода для окрашивания хроматограмм. Результаты анализа трех концентратов приведены на фиг. 3-Б, где: 1 - EV76 (pCD1-, pSC-A-amp/kan+); 2 - КМ1933 (pCD1-, pSC-A-amp/kan+); 3 - KM1986 (pCD1-, pSC-A-5EV+). В отличие от концентратов среды контрольных штаммов, концентрат среды штамма КМ1986 содержит окрашивающийся йодом компонент с Rf 0,7.

Сидерофорную активность концентратов культуральной среды трех штаммов тестируют на пластинах CAS-агара, на который наносят по 2 мкл исследуемых растворов. Результат учитывают после 5 часов инкубации при 26°С. О наличии сидерофорной активности у концентрата среды Y. pestis КМ1986, но не контрольных штаммов, судят по появлению желтого пятна на месте нанесения анализируемых растворов на сине-зеленую индикаторную среду. Результаты представлены на фиг. 3-В, где: 1 - концентрат культуральной среды штамма EV76 (pCD1-, pSC-A-amp/kan+); 2 - концентрат культуральной среды штамма КМ1933 (pCD1-, pSC-A-amp/kan+); 3 - концентрат культуральной среды штамма КМ1986 (pCD1-, pSC-A-5EV+).

Таким образом, анализ продукции Ych штаммом Y. pestis КМ1986 показал, что он выделяет в среду значительно больше сидерофора, чем родительский штамм EV76.

В предполагаемом изобретении предложен рекомбинантный штамм Y. pestis КМ1986, который может служить штаммом-суперпродуцентом Ych для выделения и анализа этого сидерофора. Штамм обладает биохимическими и культурально-морфологическими свойствами штамма EV76, имеет те же питательные потребности и не диссоциирует. В присутствии ампициллина штамм стабильно сохраняет рекомбинантную плазмиду pSC-A-5EV, выделяет Ych в культуральную среду и сохраняет свои свойства при многократных пересевах на питательных средах. Штамм КМ 1986, как и штамм EV76, принадлежит к III группе патогенности на основании СП 1.2.036-95 «Порядок учета, хранения, передачи и транспортирования микроорганизмов I-IV групп патогенности». В штамме КМ 1986 отсутствует плазмида pCD1, что приводит к утрате штаммом остаточной вирулентности, характерной для Y.pestis EV76, и делает его абсолютно безопасным при биохимических манипуляциях в процессе выделения сидерофора.

Использование предполагаемого изобретения позволит получить препаративные количества Ych, необходимые для изучения структуры и функции этого сидерофора, а также для выяснения его роли в физиологии Y. pestis и патогенности возбудителя чумы.

Источники информации.

1. Forman S., Paulley J.T., Fetherston J.D., Cheng Y.Q., Perry R.D. Yersinia ironomics: comparison of iron transporters among Yersinia pestis biotypes and its nearest neighbor, Yersinia pseudotuberculosis. // Biometals. - 2010. - V. 23, №2. - P. 275-294.

2. Копылов П.Х., Бахтеева И.В., Анисимов А.П., Дентовская СВ., Иванов С.А., Киселева Н.В., Левчук В.П., Панферцев Е.А., Платонов М.Е., Светоч Т.Э., Титарева Г.М. Нуклеотидная последовательность, кодирующая иммуногенный полипептид LcrV(G113), вызывающий защитный иммунный ответ против Yersinia pestis; рекомбинантная плазмидная ДНК pETV-I-3455, кодирующая иммуногенный полипептид LcrV(G113); рекомбинантный штамм Escherichia coli BL21(DE3)/pETV-I--3455 - продуцент иммуногенного полипептида LcrV(G113); полипептид LcrV(G113) и способ его получения. Патент RU №2439155. // Бюлл. изобрет. - 2012. - №1.

3. Ahmadi М.К., Fawaz S., Jones C.H., Zhang G., Pfeife B.A. Total biosynthesis and diverse applications of the nonribosomal peptide-polyketide siderophore yersiniabactin. // App. Environ. Microbiol. - 2015. - V. 81, N. 16. - P. 5290-5298.

4. Rakin A., Schneider L., Podladchikova O. Hunger for iron: the alternative siderophore iron scavenging systems in highly virulent Yersinia. // Front. Cell. Inf. Microbiol. - 2012. -№4.

5. Podladchikova O., Rykova V., Antonenka U., Rakin A. Yersinia pestis autoagglutination is mediated by Hep-like protein and siderophore yersiniachelin. // Adv. Exp.Med. Biol. - 2012. - V. 954. - P. 289-292.

6. Лабораторная диагностика опасных инфекционных болезней. Практическое руководство. / Под ред. Г.Г. Онищенко, В.В. Кутырева. - М.: ОАО «Медицина», «Шико», 2009. - 472 с.

7. StrataClone PCR Cloning Kit. Instruction manual. Agilent Technologies. http://www. stratagene.com.

8. Kado C.I., Liu S.T. Rapid procedure for detection and isolation of large and small plasmids. // J. Bacteriol. - 1981 - V. 145 - P. 1365-1373.

9. Schwyn В., Neilands J.B. Universal chemical assay for the detection and determination of siderophores. // Anal. Biochem. - 1987. - V. 160, N 1. - P. 47-56.

10. Миллер Дж. Эксперименты в молекулярной генетике. - Москва, 1976. - 436 С.

Таблица 1. Структура использованных в работе праймеров

Название Структура Происхождение
1 M13 rev 5` CAGGAAACAGCTATGACC 3` StrataClone
2 p1529fov 5` CCAAGTTCCTGCATTAGACAGA 3` Настоящее исследование
3 p1532rev 5` CGTTGCCGGATCATTACTGACCCTGAAT 3` Настоящее исследование

1. Рекомбинантная плазмида pSC-A-5EV, экспрессирующая клонированные гены биосинтеза сидерофора иерсиниахелина Y. pestis, имеющая длину 9,9 т.п.н. и состоящая из следующих элементов: ДНК вектора pSC-A-amp-kan (4,3 т.п.н.), содержащего гены устойчивости к ампициллину и канамицину; N-концевой фрагмент гена β-галактозидазы (lacZ), в который встроена ПЦР-копия четырех генов (уро1529-1532) биосинтеза сидерофора иерсиниахелина Y. pestis длиной 5,6 т.п.н., полученная на матрице хромосомной ДНК Y. pestis EV76 с помощью праймеров p1529ƒ (5'CCAAGTTCCTGCATTAGACAGA3') и p1532r (5'CGTTGCCGGATCATTACTGACCCTGAAT3').

2. Способ конструирования рекомбинантной плазмиды pSC-A-5EV, заключающийся в том, что ПЦР-копию четырех генов биосинтеза сидерофора иерсиниахелина (уро1529-1532) получают на матрице хромосомной ДНК штамма Y. pestis EV76 при использовании праймеров p1529ƒ (5'CCAAGTTCCTGCATTAGACAGA3') и p1532r (5'CGTTGCCGGATCATTACTGACCCTGAAT3'), ПЦР-копию клонируют в составе плазмидного вектора pSC-A-amp-kan в штамме E.coli Strata; отбирают ампициллин-резистентные клоны, не синтезирующие β-галактозидазу, которые анализируют посредством ПЦР с праймерами pM13r (5'CAGGAAACAGCTATGACC3', комплементарен векторной ДНК) и p1532r (5'CGTTGCCGGATCATTACTGACCCTGAAT3', комплементарен клонированному фрагменту) для отбора клонов с рекомбинантной плазмидой pSC-A-5EV, содержащей гены биосинтеза иерсиниахелина под контролем векторного Plac-промотора, после этого из отобранных клонов выделяют плазмиду pSC-A-5EV, которая является рекомбинантной плазмидой pSC-A-5EV по п. 1.

3. Рекомбинантный штамм Y. pestis, депонированный в Государственной коллекции патогенных бактерий «Микроб» под номером КМ1986, является суперпродуцентом сидерофора иерсиниахелина возбудителя чумы и представляет собой продукт трансформации плазмидой pSC-A5EV, указанной в п. 1, штамма Y. pestis, не синтезирующего собственный сидерофор иерсиниахелина и депонированного в Государственной коллекции патогенных бактерий «Микроб» под номером КМ1933.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к молекуле нуклеиновой кислоты, кодирующей первый полипептид, второй полипептид, сигнальную последовательность mBIP и либо белок оболочки, либо адаптерный белок.

Изобретение относится к биохимии и вирусологии и касается способов и системы для упаковки репортерных молекул нуклеиновых кислот в нерепликативные трансдукторные частицы для использования в качестве репортерных молекул.

Настоящие изобретения относятся к полицистронной экспрессии у грамположительной бактерии и касаются молочнокислой бактерии для экспрессии одного или нескольких экзогенных генов, фармацевтической композиции, содержащей такую молочнокислую бактерию, нуклеиновой кислоты и вектора.

Настоящие изобретения относятся к полицистронной экспрессии у грамположительной бактерии и касаются молочнокислой бактерии для экспрессии одного или нескольких экзогенных генов, фармацевтической композиции, содержащей такую молочнокислую бактерию, нуклеиновой кислоты и вектора.

Группа изобретений относится к биотехнологии. Предложены рекомбинантный модифицированный глюкагоноподобный пептид-1 человека (рмГПП-1), способ его получения и штамм-продуцент E.coli ВКПМ В-12555.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к способу создания живой вакцины на основе биологически активного штамма Еnterococcus faecium L3 за счет включения в структуру его пилей антигена клинически актуального патогенного микроорганизма.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к способу создания живой вакцины на основе биологически активного штамма Еnterococcus faecium L3 за счет включения в структуру его пилей антигена клинически актуального патогенного микроорганизма.

Изобретение относится к области биохимии, в частности к гуманизированному антителу, которое связывается с эпитопом С3 компонента комплемента человека. Также раскрыты ДНК, кодирующая указанное антитело, экспрессионный вектор, для экспрессии указанного антитела, а также штамм клеток яичников китайского хомячка, который продуцирует указанное антитело.

Изобретение относится к биотехнологии и представляет собой модифицированный микроорганизм рода Corynebacterium, обладающий повышенной способностью продуцировать путресцин, где активность белка, имеющего аминокислотную последовательность, представленную в SEQ ID NO: 18 или SEQ ID NO: 20, в микроорганизме рода Corynebacterium, способном продуцировать путресцин, ослаблена или устранена по сравнению с его эндогенной активностью.

Группа изобретений относится к биотехнологии. Предложен белок-предшественник для рекомбинантного получения пептидов с длиной последовательности от 5 до 70 аминокислотных остатков.
Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК для инициации транскрипции гетерологической транскрибируемой молекулы ДНК, а также к генетической конструкции для инициации транскрипции гетерологической транскрибируемой молекулы ДНК, ее содержащей.

Настоящее изобретение относится к предоставлению вакцин, которые специфичны к опухолям пациентов и потенциально применимы для иммунотерапии первичной опухоли, а также метастазов опухоли.

Изобретение относится к биотехнологии и медицине, в частности к рекомбинантной плазмидной ДНК pAL2-T-ExP. Плазмидная ДНК pAL2-T-ExP предназначена для создания ДНК-калибраторов при оценке эффективности терапии у пациентов с острым миелоидным лейкозом.

Изобретение относится к области биохимии, в частности к молекуле нуклеиновой кислоты, кодирующей первый полипептид, второй полипептид, сигнальную последовательность mBIP и либо белок оболочки, либо адаптерный белок.

Изобретение относится к области биотехнологии, конкретно к модифицированному олигонуклеотиду, направленно воздействующему на рецептор андрогенов (AR) человека для ингибирования уровней рецептора андрогенов в клетке, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к самособирающейся в наночастицу олигонуклеотидной конструкции, и может быть использовано в медицине. Олигонуклеотидная конструкция согласно настоящему изобретению может быть полезной в качестве системы доставки на основе олигонуклеотида нового типа, а также инструмента для лечения злокачественных заболеваний, инфекционных заболеваний и т.п.

Изобретение относится к биотехнологии. Описан вектор экспрессии CAR, содержащий нуклеиновую кислоту, кодирующую химерный антигенный рецептор (CAR), и нуклеиновую кислоту, кодирующую иммуномодулирующий фактор Т-клетки, при этом нуклеиновая кислота, кодирующая иммуномодулирующий фактор Т-клетки, представляет собой нуклеиновую кислоту, кодирующую интерлейкин-7, и нуклеиновую кислоту, кодирующую CCL19.

Группа изобретений относится к рекомбинантной плазмиде, обеспечивающей синтез химерного белка прохимозина В Bos Taurus, и рекомбинантному штамму Е. coli - продуценту химерного белка прохимозина В Bos taurus в клетках E.

Изобретение относится к биотехнологии. Изобретение касается способа диагностики миелоидных новообразований.

Изобретение относится к области биотехнологии, конкретно к композиции, содержащей эффективное количество по меньшей мере одного ингибитора микроРНК, вовлеченной в ангиогенез и проявляющей антиангиогенную активность, или ее предшественника, где ингибитор микроинкапсулирован в полимерных биоразлагаемых и биосовместимых микросферах, и может быть использовано в медицине.

Настоящее изобретение относится к биохимии, генной инженерии и биотехнологии, в частности к новым полипептидам с антимикробной активностью в отношении энтерогеморрагических бактерий вида Escherichia coli.

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмиде pSC-A-5EV. Плазмида pSC-A-5EV предназначена для экспрессии клонированных генов биосинтеза сидерофора иерсиниахелина Y. pestis. Указанная плазмида содержит ПЦР-копию четырех генов биосинтеза сидерофора иерсиниахелина Y. pestis длиной 5,6 т.п.н. Указанная ПЦР-копия получена на матрице хромосомной ДНК Y. pestis EV76 с помощью праймеров p1529 и p1532r. Настоящее изобретение также относится к способу конструирования плазмиды pSC-A-5EV и к рекомбинантному штамму Y. pestis КМ1986. Указанный штамм является суперпродуцентом сидерофора иерсиниахелина возбудителя чумы и представляет собой продукт трансформации плазмидой pSC-A5EV штамма Y. pestis, не синтезирующего собственный сидерофор иерсиниахелина. Изобретение позволяет получать сидерофор иерсиниахелина Y. pestis с высоким выходом. 3 н.п. ф-лы, 3 ил., 1 табл., 3 пр.

Наверх