Растения, устойчивые к насекомым-вредителям

Изобретение относится к области биохимии, в частности к трансгенному растению, к заражению насекомыми-вредителями Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum. Также раскрыты трансгенное семя для получения указанного растения, ДНК-конструкция, которую содержит указанное трансгенное растение, клетка-хозяин для получения указанной ДНК-конструкции. Раскрыты способ получения трансгенного растения, способ идентификации трансгенного растения, способ профилактики или борьбы с Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum. Изобретение позволяет эффективно защищать растение от насекомых-вредителей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum. 9 н. и 6 з.п. ф-лы, 23 ил., 23 табл., 7 пр.

 

Область изобретения

Настоящее изобретение относится в целом к генетическому контролю нападения видов насекомых-вредителей, в частности, предотвращению и/или борьбе с нападением вредителей на растения. Более конкретно, настоящее изобретение относится к подавлению экспрессии генов-мишеней у видов насекомых-вредителей с помощью интерферирующих молекул рибонуклеиновой кислоты (РНК). Также предусматриваются трансгенные растения, которые (i) экспрессируют или способны экспрессировать интерферирующие РНК по настоящему изобретению и (ii) устойчивы к нападению видов насекомых-вредителей.

Предпосылки изобретения

Существует множество видов насекомых-вредителей, которые могут поражать или нападать на большое множество местообитаний и организмов-хозяев. Насекомые-вредители включают разнообразные виды из отрядов насекомых Hemiptera (клопы), Coleoptera (жуки), Siphonaptera (блохи), Dichyoptera (тараканы и богомолы), Lepidoptera (моли и бабочки), Orthoptera (например, кузнечики) и Diptera (настоящие мухи). Нападение вредителей может приводить к значительному ущербу. Насекомые-вредители, которые нападают на виды растений, вызывают особые проблемы в сельском хозяйстве, поскольку они могут приводить к серьезному повреждению сельскохозяйственных культур и значительно снижать урожайность растений. Большое разнообразие различных типов растений, включая товарные культуры, такие как рис, хлопок, соя, картофель и кукуруза, чувствительны к нападению вредителей.

Традиционно, нападение насекомых-вредителей предотвращают или контролируют посредством применения химических пестицидов. Однако данные химические вещества не всегда пригодны для применения в обработке сельскохозяйственных культур, так как они могут являться токсичными для других видов и могут наносить значительный ущерб окружающей среде. За последние десятилетия исследователи разработали более экологически безопасные способы контроля нападения вредителей. Например, применялись микроорганизмы, такие как бактерии Bacillus thuringiensis, которые в естественных условиях экспрессируют белки, токсичные для насекомых-вредителей. Ученые также выделили гены, кодирующие эти инсектицидные белки, и использовали их для создания трансгенных культур, устойчивых к насекомым-вредителям, например, растения кукурузы и хлопчатника, генетически сконструированные для продуцирования белков семейства Cry.

Хотя бактериальные токсины являлись весьма успешными в борьбе с определенными типами вредителей, они не эффективны против всех видов вредителей. Исследователи, следовательно, искали другие, более целенаправленные подходы к борьбе с вредителями и, в частности, к РНК-интерференции или 'сайленсингу генов' в качестве средств для борьбы с вредителями на генетическом уровне.

РНК-интерференция или 'RNAi' является процессом, посредством которого экспрессия генов в отношении клетки или всего организма подавляется последовательность-специфическим образом. RNAi является в настоящее время общепризнанным методом в данной области для ингибирования или подавления экспрессии генов у самых разнообразных организмов, включая организмы-вредители, такие как грибы, нематоды и насекомые. Кроме того, предыдущие исследования показали, что подавление экспрессии генов-мишеней у видов насекомых-вредителей можно использовать в качестве средств для борьбы с нападением вредителей.

WO2007/074405 описывает способы ингибирования экспрессии генов-мишеней у беспозвоночных вредителей, включая колорадского жука. Кроме того, WO2009/091864 описывает композиции и способы подавления генов-мишеней у видов насекомых-вредителей, включая вредителей из рода Lygus.

Хотя применение RNAi для подавления экспрессии генов у видов вредителей в данной области известно, успех данного метода в применении в качестве меры борьбы с вредителями зависит от выбора наиболее подходящих генов-мишеней, а именно тех, у которых потеря функции приводит к значительному нарушению жизненно важного биологического процесса и/или гибели организма. Настоящее изобретение, таким образом, направлено на подавление конкретных генов-мишеней у насекомых-вредителей в качестве средства достижения более эффективного предотвращения и/или борьбы с нападением насекомых-вредителей, в частности на растения.

Краткое описание изобретения

Авторы настоящего изобретения пытались идентифицировать улучшенные средства для предотвращения и/или борьбы с нападением насекомых-вредителей с применением генетических подходов. В частности, они исследовали применение RNAi для подавления генов таким образом, чтобы снизить способность насекомых-вредителей выживать, расти, проходить через различные стадии жизненного цикла насекомых (например, через метаморфоз из куколки в имаго), колонизировать специфические местообитания и/или нападать на организмы-хозяева, и таким образом ограничить ущерб, наносимый вредителем.

Следовательно, в соответствии с одним аспектом настоящего изобретения предоставлено трансгенное растение, или репродуктивный материал, или материал для размножения трансгенного растения, или культивируемая клетка трансгенного растения, которая экспрессирует или способна экспрессировать по меньшей мере одну интерферирующую рибонуклеиновую кислоту (РНК или двухцепочечную РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39 до 42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, состоящую из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(iv) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(v) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или ее комплементарную последовательность, при этом два ортологических гена являются подобными в последовательности до такой степени, что, при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или

(vi) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70% предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389.

В конкретном аспекте настоящего изобретения молекулы интерферирующей РНК, экспрессируемые растениями по настоящему изобретению, содержат по меньшей мере одну двухцепочечную область, как правило, сайленсирующий элемент интерферирующей РНК, содержащий смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, где смысловая цепь молекулы dsRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени.

В одном варианте осуществления настоящее изобретение относится к трансгенному растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которая экспрессирует или способна экспрессировать молекулу интерферирующей РНК, которая содержит по меньшей мере одну двухцепочечную область, как правило, сайленсирующий элемент молекулы интерферирующей РНК, содержащий смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, где смысловая цепь молекулы dsRNA содержит последовательность по меньшей мере из 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98%, 99% или 100% комплементарной последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени из комплекса тропонин/миофиламент.

В одном варианте осуществления ген-мишень кодирует белок wings up A (тропонин I) насекомых (например, у насекомых ортолог белка CG7178 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 1 и 2. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 79. В одном варианте осуществления ген-мишень кодирует белок upheld (например, у насекомых ортолог белка CG7107 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 121 и 130. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 330. В одном варианте осуществления ген-мишень кодирует белок тропомиозин 1 (например, у насекомых ортолог белка CG4898 Dm), или белок тропомиозин 2 (например, у насекомых ортолог белка CG4843 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 123 и 132. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 332. В одном варианте осуществления ген-мишень кодирует тяжелую цепь миозина (например, у насекомых ортолог белка CG17927 Dm), указанный ген-мишень представлен с помощью SEQ ID NO: 122 и 131. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 331. В одном варианте осуществления ген-мишень кодирует цитоплазматический белок на основе легкой цепи миозина (например, у насекомых ортолог белка CG3201 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 124 и 133. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 333. В одном варианте осуществления ген-мишень кодирует белок spaghetti squash (например, у насекомых ортолог белка CG3595 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 125 и 134. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере, 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 334. В одном варианте осуществления ген-мишень кодирует белок zipper (например, у насекомых ортолог белка CG15792 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 126 и 135. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 335. В одном варианте осуществления ген-мишень кодирует тропонин C (например, у насекомых ортолог белка CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 или CG6514 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 127 и 136. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 336 и 337.

В соответствии с другим вариантом осуществления настоящее изобретение относится к трансгенному растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которая экспрессирует или способна экспрессировать молекулу интерферирующей РНК, которая содержит по меньшей мере одну двухцепочечную область, как правило, сайленсирующий элемент молекулы интерферирующей РНК, содержащий смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, при этом смысловая цепь молекулы dsRNA содержит последовательность из по меньшей мере 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98%, 99% или 100% комплементарной последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени, который кодирует рибосомный белок насекомых. В одном варианте осуществления ген-мишень кодирует рибосомный белок S3A (например, у насекомых ортолог белка CG2168 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 11 и 12. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 84. В одном варианте осуществления ген-мишень кодирует рибосомный белок LP1 (например, у насекомых ортолог белка CG4087 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 3 и 4. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO:80. В одном варианте осуществления ген-мишень кодирует рибосомный белок S3 (например, у насекомых ортолог белка CG6779 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 7 и 8. В одном варианте осуществления ген-мишень кодирует рибосомный белок L10Ab (например, у насекомых ортолог белка CG7283 Dm), представленный с помощью SEQ ID NO: 9 и 10. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 83. В одном варианте осуществления ген-мишень кодирует рибосомный белок S18 (например, у насекомых ортолог белка CG8900 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 13 и 14. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO:85. В одном варианте осуществления ген-мишень кодирует рибосомный белок L4 (например, у насекомых ортолог белка CG5502 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 5 и 6. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO:81. В одном варианте осуществления ген-мишень кодирует рибосомный белок S27 (например, у насекомых ортолог белка CG10423 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 15 и 16. В одном варианте осуществления ген-мишень кодирует рибосомный белок L6 (например, у насекомых ортолог белка CG11522 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 17 и 18. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 87. В одном варианте осуществления ген-мишень кодирует рибосомный белок S13 (например, у насекомых ортолог белка CG13389 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 19 и 20. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 88. В одном варианте осуществления ген-мишень кодирует рибосомный белок L12 (например, у насекомых ортолог белка CG3195 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 21 и 22. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO:89. В одном варианте осуществления ген-мишень кодирует рибосомный белок L26 (например, у насекомых ортолог белка CG6846 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 158 и 159. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 343. В одном варианте осуществления ген-мишень кодирует рибосомный белок L21 (например, у насекомых ортолог белка CG12775 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 165, 166 и 167. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 347 и 348. В одном варианте осуществления ген-мишень кодирует рибосомный белок S12 (например, у насекомых ортолог белка CG11271 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 156 и 157. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 342. В одном варианте осуществления ген-мишень кодирует рибосомный белок S28b (например, у насекомых ортолог белка CG2998 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 160 и 161. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 344. В одном варианте осуществления ген-мишень кодирует рибосомный белок L13 (например, у насекомых ортолог белка CG4651 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 154 и 155. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 341. В одном варианте осуществления ген-мишень кодирует рибосомный белок L10 (например, у насекомых ортолог белка CG17521 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 163 и 164. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 345. В одном варианте осуществления ген-мишень кодирует рибосомный белок L5 (например, у насекомых ортолог белка CG17489 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 152 и 153. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 340. В одном варианте осуществления ген-мишень кодирует рибосомный белок S15Aa (например, у насекомых ортолог белка CG2033 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 150 и 151. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 339. В одном варианте осуществления ген-мишень кодирует рибосомный белок L19 (например, у насекомых ортолог белка CG2746 Dm) или рибосомный белок L27 (например, у насекомых ортолог белка CG4759 Dm). В одном варианте осуществления ген-мишень кодирует белок субъединицы II митохондриальной цитохром с-оксидазы (например, у насекомых ортолог белка CG34069 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 25 и 26. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 91. В одном варианте осуществления ген-мишень кодирует γ-цепь АТФ-синтазы (например, у насекомых ортолог белка CG7610 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 129 и 138. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 338. В одном варианте осуществления ген-мишень кодирует убиквитин-5E (например, у насекомых ортолог белка CG32744 Dm). В одном варианте осуществления ген-мишень кодирует протеасомную субъединицу бета-типа (например, у насекомых ортолог белка CG17331 Dm), белок, который является у насекомых ортологом белка CG13704 Dm; и белок Rpn12 (например, у насекомых ортолог белка CG4157 Dm).

В соответствии с дополнительным аспектом настоящего изобретения предусматривается выделенный полинуклеотид, выбранный из группы, состоящей из:

(i) полинуклеотида, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, которая представлена любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или ее комплементарной последовательностью, или

(ii) полинуклеотида, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, которая представлена любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательностью, или

(iii) полинуклеотида, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, которая представлена в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении двух последовательностей указанный полинуклеотид являлся по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичным любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(iv) полинуклеотида, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, который представлен в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, и при этом указанный фрагмент или указанная комплементарная последовательность обладают нуклеотидной последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(v) полинуклеотида, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, который представлен в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, и при этом указанный фрагмент или указанная комплементарная последовательность обладают нуклеотидной последовательностью, которая при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(vi) полинуклеотида, кодирующего аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 и

при этом указанный полинуклеотид составляет не более, чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов.

Аминокислотные последовательности, кодируемые генами-мишенями по настоящему изобретению, представлены SEQ ID NO: 79, 349, 352, 356, 80, 326, 81, 327, 82, 83, 328, 84, 329, 85, 86, 359, 87-91, 330, 350, 353, 331, 351, 332 до 336, 337, 354, 338 до 344, 346, 345, 347, 348, 357, 355, 358, 390-393.

В конкретном аспекте по настоящему изобретению выделенный полинуклеотид является частью молекулы интерферирующей РНК, как правило, частью сайленсирующего элемента, содержащего по меньшей мере одну двухцепочечную область, содержащую смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, где смысловая цепь молекулы dsRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени. Более конкретно, выделенный полинуклеотид клонирован в конструкцию ДНК в смысловой и антисмысловой ориентации так, что при транскрипции смыслового и антисмыслового полинуклеотида формируется молекула dsRNA, которая функционирует при поглощении вредителем с ингибированием или подавлением экспрессии гена-мишени в указанном вредителе.

В одном варианте осуществления настоящее изобретение относится к выделенному полинуклеотиду, который клонирован в конструкцию ДНК в смысловой и антисмысловой ориентации так, что при транскрипции смыслового и антисмыслового полинуклеотида формируется молекула dsRNA, которая функционирует при поглощении насекомым с ингибированием или подавлением экспрессии гена-мишени в пределах комплекса тропонин/миофиламент.

В одном варианте осуществления ген-мишень кодирует белок wings up A (тропонин I) насекомых (например, у насекомых ортолог белка CG7178 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 1 и 2. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 79. В одном варианте осуществления ген-мишень кодирует белок upheld (например, у насекомых ортолог белка CG7107 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 121 и 130. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 330. В одном варианте осуществления ген-мишень кодирует белок тропомиозин 1 (например, у насекомых ортолог белка CG4898 Dm), или белок тропомиозин 2 (например, у насекомых ортолог белка CG4843 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 123 и 132. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 332. В одном варианте осуществления ген-мишень кодирует тяжелую цепь миозина (например, у насекомых ортолог белка CG17927 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 122 и 131. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 331. В одном варианте осуществления ген-мишень кодирует цитоплазматический белок на основе легкой цепи миозина (например, у насекомых ортолог белка CG3201 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 124 и 133. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 333. В одном варианте осуществления ген-мишень кодирует белок spaghetti squash (например, у насекомых ортолог белка CG3595 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 125 и 134. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 334. В одном варианте осуществления ген-мишень кодирует белок zipper (например, у насекомых ортолог белка CG15792 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 126 и 135. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 335. В одном варианте осуществления ген-мишень кодирует тропонин C (например, у насекомых ортолог белка CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 или CG6514 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 127 и 136. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 336 и 337.

В соответствии с другими вариантами осуществления настоящее изобретение относится к выделенному полинуклеотиду, который клонирован в конструкцию ДНК в смысловой и антисмысловой ориентации так, что при транскрипции смыслового и антисмыслового полинуклеотида формируется молекула dsRNA, которая функционирует при поглощении насекомым с ингибированием или подавлением экспрессии гена-мишени, который кодирует рибосомный белок насекомых.

В одном варианте осуществления ген-мишень кодирует рибосомный белок S3A (например, у насекомых ортолог белка CG2168 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 11 и 12. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 84. В одном варианте осуществления ген-мишень кодирует рибосомный белок LP1 (например, у насекомых ортолог белка CG4087 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 3 и 4. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO:80. В одном варианте осуществления ген-мишень кодирует рибосомный белок S3 (например, у насекомых ортолог белка CG6779 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 7 и 8. В одном варианте осуществления ген-мишень кодирует рибосомный белок L10Ab (например, у насекомых ортолог белка CG7283 Dm), представленный с помощью SEQ ID NO: 9 и 10. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 83. В одном варианте осуществления ген-мишень кодирует рибосомный белок S18 (например, у насекомых ортолог белка CG8900 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 13 и 14. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO:85. В одном варианте осуществления ген-мишень кодирует рибосомный белок L4 (например, у насекомых ортолог белка CG5502 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 5 и 6. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO:81. В одном варианте осуществления ген-мишень кодирует рибосомный белок S27 (например, у насекомых ортолог белка CG10423 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 15 и 16. В одном варианте осуществления ген-мишень кодирует рибосомный белок L6 (например, у насекомых ортолог белка CG11522 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 17 и 18. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 87. В одном варианте осуществления ген-мишень кодирует рибосомный белок S13 (например, у насекомых ортолог белка CG13389 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 19 и 20. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 88. В одном варианте осуществления ген-мишень кодирует рибосомный белок L12 (например, у насекомых ортолог белка CG3195 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 21 и 22. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO:89. В одном варианте осуществления ген-мишень кодирует рибосомный белок L26 (например, у насекомых ортолог белка CG6846 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 158 и 159. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 343. В одном варианте осуществления ген-мишень кодирует рибосомный белок L21 (например, у насекомых ортолог белка CG12775 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 165, 166 и 167. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 347 и 348. В одном варианте осуществления ген-мишень кодирует рибосомный белок S12 (например, у насекомых ортолог белка CG11271 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 156 и 157. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 342. В одном варианте осуществления ген-мишень кодирует рибосомный белок S28b (например, у насекомых ортолог белка CG2998 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 160 и 161. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 344. В одном варианте осуществления ген-мишень кодирует рибосомный белок L13 (например, у насекомых ортолог белка CG4651 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 154 и 155. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 341. В одном варианте осуществления ген-мишень кодирует рибосомный белок L10 (например, у насекомых ортолог белка CG17521 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 163 и 164. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 345. В одном варианте осуществления ген-мишень кодирует рибосомный белок L5 (например, у насекомых ортолог белка CG17489 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 152 и 153. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 340. В одном варианте осуществления ген-мишень кодирует рибосомный белок S15Aa (например, у насекомых ортолог белка CG2033 Dm), при этом указанный ген-мишень представлен с помощью SEQ ID NO: 150 и 151. В предпочтительном варианте осуществления ортолог у насекомого обладает по меньшей мере 85%, 90%, 92%, 94%, 96%, 98%, 99%, 100% идентичности с SEQ ID NO: 339. В одном варианте осуществления ген-мишень кодирует рибосомный белок L19 (например, у насекомых ортолог белка CG2746 Dm) или рибосомный белок L27 (например, у насекомых ортолог белка CG4759 Dm).

Предпочтительно, способы по настоящему изобретению находят практическое применение в предотвращении и/или борьбе с нападением насекомых-вредителей, в частности, борьбе с нападением вредителей сельскохозяйственных культур, таких как, но без ограничений, хлопчатник, картофель, рис, клубника, люцерна, соя, помидор, канола, подсолнечник, сорго, просо, кукуруза, баклажан, перец и табак. В дополнение, интерферирующую РНК по настоящему изобретению можно вводить в растения, подлежащие защите, с помощью обычных методов генной инженерии.

Следовательно, в соответствии с другим аспектом настоящего изобретения предусматривается способ создания трансгенного растения, устойчивого к нападению любого вида вредителя, включающий:

(a) трансформацию растительной клетки с помощью конструкции ДНК, содержащей полинуклеотидную последовательность, кодирующую интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного вида насекомого-вредителя, где ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере, на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(iv) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности, или

(v) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что, при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентична любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или

(vi) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая, при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389;

(b) регенерацию растения из трансформированной растительной клетки; и

(c) выращивание трансформированного растения в условиях, пригодных для экспрессии интерферирующей РНК из рекомбинантной конструкции ДНК, при этом указанное растение, таким образом, является устойчивым к указанному вредителю по сравнению с нетрансформированным растением.

В дополнительном аспекте в данном документе предусматривается способ предотвращения и/или борьбы с нападением насекомых-вредителей в поле культурных растений, при этом указанный способ включает экспрессию в указанных растениях эффективного количества интерферирующей рибонуклеиновой кислоты (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного вида насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является, по меньшей мере на 75% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательных нуклеотида любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389.

Во всех аспектах настоящего изобретения, в предпочтительных вариантах осуществления ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательных нуклеотида любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательных нуклеотида любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233.

В предпочтительном варианте осуществления ген-мишень кодирует белок насекомых, выбранный из комплекса тропонин/миофиламент, выбранный из группы, содержащей тропонин I (например, у насекомых ортолог белка CG7178 Dm), белок upheld (например, у насекомых ортолог белка CG7107 Dm), белок тропомиозин 1 (например, у насекомых ортолог белка CG4898 Dm), белок тропомиозин 2 (например, у насекомых ортолог белка CG4843 Dm), тяжелую цепь миозина (например, у насекомых ортолог белка CG17927 Dm), цитоплазматический белок на основе легкой цепи миозина (например, у насекомых ортолог белка CG3201 Dm), белок spaghetti squash (например, у насекомых ортолог белка CG3595 Dm), белок zipper (например, у насекомых ортолог белка CG15792 Dm), тропонин C (например, у насекомых ортолог белка CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 или CG6514 Dm).

Во всех аспектах настоящего изобретения в предпочтительных вариантах осуществления ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность такой, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательных нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент из, по меньшей мере, 21 последовательных нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273.

В предпочтительном варианте осуществления ген-мишень кодирует рибосомный белок насекомых, выбранный из группы, содержащей рибосомный белок S3A (например, у насекомых ортолог белка CG2168 Dm), рибосомный белок LP1 (например, у насекомых ортолог белка CG4087 Dm), рибосомный белок S3 (например, у насекомых ортолог белка CG6779 Dm), рибосомный белок L10Ab (например, у насекомых ортолог белка CG7283 Dm), рибосомный белок S18 (например, у насекомых ортолог белка CG8900 Dm), рибосомный белок L4 (например, у насекомых ортолог белка CG5502 Dm), рибосомный белок S27 (например, у насекомых ортолог белка CG10423 Dm), рибосомный белок L6 (например, у насекомых ортолог белка CG11522 Dm), рибосомный белок S13 (например, у насекомых ортолог белка CG13389 Dm), и рибосомный белок L12 (например, у насекомых ортолог белка CG3195 Dm), рибосомный белок L26 (например, у насекомых ортолог белка CG6846 Dm), рибосомный белок L21 (например, у насекомых ортолог белка CG12775 Dm), рибосомный белок S12 (например, у насекомых ортолог белка CG11271 Dm), рибосомный белок S28b (например, у насекомых ортолог белка CG2998 Dm), рибосомный белок L13 (например, у насекомых ортолог белка CG4651 Dm), рибосомный белок L10 (например, у насекомых ортолог белка CG17521 Dm), рибосомный белок L5 (например, у насекомых ортолог белка CG17489 Dm), рибосомный белок S15Aa (например, у насекомых ортолог белка CG2033 Dm), рибосомный белок L19 (например, у насекомых ортолог белка CG2746 Dm), рибосомный белок L27 (например, у насекомых ортолог белка CG4759 Dm).

Во всех аспектах настоящего изобретения в предпочтительных вариантах осуществления ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность такой, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательных нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательных нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401.

Краткое описание таблиц и фигур

Таблица 1: Lygus hesperus новые мишени, идентифицированные из первого анализа.

Таблица 1B: Lygus hesperus новые мишени в пути Lh594.

Таблица 1C: Lygus hesperus новые мишени, идентифицированные из второго цикла анализа.

Таблица 2: Полинуклеотидные последовательности генов-мишеней, идентифицированные у Lygus hesperus.

Таблица 3: Аминокислотные последовательности генов-мишеней, идентифицированные у Lygus hesperus.

Таблица 4: dsRNA (смысловая цепь, представленная эквивалентной последовательностью ДНК), соответствующие Lygus hesperus генам-мишеням и праймерам для продуцирования dsRNA.

Таблица 5: Ранжирование мишеней Lygus hesperus в соответствии с кривыми дозовой зависимости (DRC) и по сравнению с исходными мишенями Lh423 и Lh105.

Таблица 6: Lygus hesperus мишени из второго цикла анализа-ранжирования в соответствии с DRC и по сравнению с исходными мишенями Lh423 и Lh594.

Таблица 7: Обзор тестирования трансгенного картофеля, несущего Lygus hesperus шпильки.

Таблица 8: Последовательность ампликонов для гена-мишени и два конститутивных гена для qRT-ПЦР.

Таблица 9: Полинуклеотидные последовательности генов-мишеней, идентифицированные у колорадского жука (CPB).

Таблица 10: Аминокислотные последовательности генов-мишеней, идентифицированные у CPB.

Таблица 11: dsRNA (смысловая цепь, представленная эквивалентной последовательностью ДНК), соответствующие CPB генам-мишеням и праймерам для продуцирования dsRNA.

Таблица 12: Полинуклеотидные последовательности генов-мишеней, идентифицированные у коричневого дельфацида (BPH).

Таблица 13: Аминокислотные последовательности генов-мишеней, идентифицированные у BPH.

Таблица 14: dsRNA (смысловая цепь, представленная эквивалентной последовательностью ДНК), соответствующие BPH генам-мишеням и праймерам для продуцирования dsRNA.

Таблица 15: Праймеры, используемые для амплификации cDNA тлей, на основе геномной последовательности гороховой тли.

Таблица 16: Полинуклеотидные последовательности генов-мишеней, идентифицированные у тлей.

Таблица 17: Аминокислотные последовательности генов-мишеней, идентифицированные у тлей.

Таблица 18: dsRNA (смысловая цепь, представленная эквивалентной последовательностью ДНК), соответствующие генам-мишеням тлей и праймерам для продуцирования dsRNA.

Таблица 19: Вырожденные праймеры, используемые для амплификации CPB Ld594 cDNA.

Таблица 20: Вырожденные праймеры, используемые для амплификации BPH cDNAs.

Таблица 21: Leptinotarsa decemlineata новые мишени из данного теста.

Таблица 22: Nilaparvata lugens новые идентифицированные мишени.

Таблица 23: Acyrthosiphon pisum новые идентифицированные мишени.

Фигура 1: Полоски Lh001_009 второго подтверждающего анализа. Темные полосы: смертность в день 3-6, светлые полосы: смертность в день 6-8. Кандидатные клоны названы с применением “Lygxxx” скрининговых кодов и “Lhxxx” номенклатурных кодов мишеней.

Фигура 2: Полоски Lh010_020 второго подтверждающего анализа. Темные полосы: смертность в день 3-6, светлые полосы: смертность в день 6-8. Кандидатные клоны названы с применением “Lygxxx” скрининговых кодов и “Lhxxx” номенклатурных кодов мишеней.

Фигура 3: Анализ смертности Lygus новых мишеней из полосок Lh001-Lh009, выраженный в % смертности за 10-дневный период. Контроли обозначены пунктирными линиями. Положительный контроль: Lh423 dsRNA (RpL19). Отрицательные контроли: GFP dsRNA и только корм (контроль).

Фигура 4: Анализ смертности Lygus новых мишеней из полосок Lh010-Lh020, выраженный в % смертности за 10-дневный период. Контроли обозначены пунктирными линиями. Положительный контроль: Lh423 (RpL19). Отрицательные контроли: GFP и только корм (контроль).

Фигура 5: Схематическое изображение растительного вектора экспрессии, несущего Lygus hesperus hpRNA кассету. RB: правая граница; LB: левая граница; P35S: Промотор 35S вируса мозаики цветной капусты; T35S: Терминатор 35S вируса мозаики цветной капусты; TNOS: терминатор нопалинсинтазы; GFP: репортерный ген зеленого флуоресцентного белка; NPT II: кодирующая последовательность гена неомицинфосфотрансферазы II; KmR: ген устойчивости к канамицину; pBR322 ori: pBR322 точка начала репликации; pBR322 bom: pBR322 мобилизация; pVS1 rep: pVS1 репликон; pVS1 sta: pVS1 элемент стабильности.

Фигура 6: Картофель-Lygus in planta постановка анализа. Белые стрелки указывают повреждения насекомыми.

Фигуры 7-11: Lygus hesperus новые мишени - кривые дозовой зависимости при концентрациях очищенной синтетической dsRNA в диапазоне от 0,4 до 0,025 мкг/мкл (на фигуре единица “мкг/мкл” не отображена). GFP dsRNA и воду milliQ применяли как отрицательные контроли. dsRNA мишеней получали с использованием праймеров, как описано в разделе примера 1.1.

Фигура 12: Lh594 кривая дозовой зависимости, при концентрациях dsRNA в диапазоне от 0,05 до 0,001 мкг/мкл. GFP dsRNA и воду milliQ применяли как отрицательные контроли.

Фигура 13 A: dsRNA активность в Lygus hesperus биопробе в отсутствие tRNA. Lh594 (5 мкг/мкл); положительный контроль: Lh423 (5 мкг/мкл); отрицательные контроли: GFP dsRNA (5 мкг/мкл) и вода milliQ; B: Идентификация Lh594 предела активности с использованием уменьшающейся концентрации dsRNA (от 5 мкг до 0,25 мкг). Отрицательные контроли: GFP dsRNA (5 мкг/мкл) и вода milliQ.

Подробное описание настоящего изобретения

Авторы настоящего изобретения обнаружили, что подавление экспрессии конкретных генов-мишеней у видов насекомых-вредителей с помощью RNAi можно применять для эффективного предотвращения и/или борьбы с нападением указанного насекомого-вредителя. Использование RNAi для подавления экспрессии генов-мишеней у видов насекомых-вредителей применяется в данном документе для создания растений, устойчивых к нападению насекомых-вредителей.

Следовательно, в первом аспекте, настоящее изобретение предоставляет трансгенные растения, устойчивые к нападению видов насекомых-вредителей. В частности, в данном документе предоставлены трансгенные растения, которые экспрессируют или способны экспрессировать по меньшей мере одну интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видами насекомых-вредителей с подавлением экспрессии гена-мишени, как описано в других местах в данном документе, у указанного вредителя. Интерферирующей РНК может являться любая из тех, которые раскрыты в данном документе ниже. Предпочтительно, интерферирующая РНК содержит или состоит по меньшей мере из одного сайленсирующего элемента, при этом указанный сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых (смысловая цепь) содержит последовательность нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени. Подавление гена-мишени вредителя можно применять для нарушения жизненно важного биологического процесса или функции у вредителя, где 'жизненно важный' относится к тому факту, что процесс или функция являются необходимыми для инициирования или поддержания нападения вредителя.

Применяемый в данном документе термин 'растение' может содержать любой репродуктивный материал или материал для размножения растения. Ссылка на растение также может включать клетки растений, протопласты растений, культуры тканей растений, растительные каллусы, маточные корневища растений и растительные клетки, которые являются интактными в растениях или частях растений, такие как зародыши, пыльца, семяпочки, семена, листья, цветы, ветки, фрукты, ядра, колосья, початки, шелуха, стебли, корни, кончики корней и тому подобное. Потомство, варианты и мутанты любого из трансгенных растений, описанных в данном документе, находятся в рамках настоящего изобретения. Также включены семена, полученные от любого из указанных трансгенных растений.

Применяемый в данном документе термин “борьба” с нападением вредителей относится к любому воздействию на вредителя, которое служит для ограничения и/или уменьшения количества организмов вредителей и/или повреждения, вызываемого вредителем. Предпочтительные гены-мишени являются, следовательно, жизненно важными генами, которые контролируют или регулируют одну или более жизненно важные биологические функции у насекомых-вредителей, например, деление клеток, размножение, энергетический обмен, пищеварение, неврологическая функция и тому подобное. Подавление данных жизненно важных генов с помощью RNAi методов может вести к гибели насекомого или иным образом значительно замедлять рост и развитие, или нарушать способность вредителей колонизировать местообитание или нападать на организмы-хозяева.

Авторы настоящего изобретения в настоящее время идентифицировали лучшие гены-мишени видов насекомых-вредителей, принадлежащих к Lygus, Leptinotarsa, Nilaparvata и Acyrthosiphum родам, чьи мишени предусматриваются для применения в отдельности или в комбинации в качестве эффективных средств для RNAi-опосредованной борьбы с нападением насекомых на агрономически важные культуры. Ортологи этих недавно идентифицированных генов-мишеней можно использовать у других видов насекомых для борьбы с нападением насекомых на соответствующие значимые культуры.

Более конкретно, авторы настоящего изобретения описывают в данном документе, что гены, кодирующие белки комплекса тропонин/миофиламент, образуют отличные гены-мишени для подавления с помощью методики РНК-ингибирования. Один из данных генов-мишеней кодировал белок тропонин I (wings up A) насекомых, который является ортологом белка CG7178 дрозофилы. Данный белок участвует в мышечных сокращениях и принадлежит к физиологическому пути, который еще не полностью исследован для борьбы с (насекомыми) вредителями посредством РНК-ингибирования. Кроме того, поскольку данный белковый комплекс является специфичным для животных, не известен ни один гомолог или ортолог генов растений, что снижает риск нетипичных фенотипов растений при экспрессии dsRNA-мишени в растениях. В дополнение, у дрозофилы тропонин I описывается как гаплонедостаточный ген, проявляющий мутантный фенотип в гетерозиготном состоянии. Такие гены особенно восприимчивы к снижению уровней экспрессии mRNA, и как таковые могут считаться идеальными мишенями RNAi.

Дополнительные вызывающие интерес гены-мишени в данном комплексе тропонин/миофиламент перечислены ниже, и дополнительно исследуются для борьбы с помощью RNAi с Lygus hesperus и другими видами насекомых-вредителей:

ID аннотации Цитология Dm идентификатор
up upheld CG7107
Tm1 тропомиозин 1 CG4898
Tm2 тропомиозин 2 CG4843
Mhc тяжелая цепь миозина CG17927
Mlc-c цитоплазматическая легкая цепь миозина CG3201
sqh spaghetti squash CG3595
Zip zipper CG15792

В одном аспекте настоящее изобретение предусматривает трансгенное растение, репродуктивный материал или материал для размножения, полученный из него, или культивируемую клетку растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени в указанном насекомом-вредителе.

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и где ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136 или ее комплементарную последовательность, или имеющих нуклеотидную последовательность такой, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, или ее комплементарной последовательности, или имеющих нуклеотидную последовательность, таким образом, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, или ее комплементарную последовательность, где два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136.

В предпочтительном варианте осуществления ген-мишень кодирует белок насекомых, выбранный из комплекса тропонин/миофиламент, выбранный из группы, включающей тропонин I (например, у насекомых ортолог белка CG7178 Dm), белок upheld (например, у насекомых ортолог белка CG7107 Dm), белок тропомиозин 1 (например, у насекомых ортолог белка CG4898 Dm), белок тропомиозин 2 (например, у насекомых ортолог белка CG4843 Dm), тяжелая цепь миозина (например, у насекомых ортолог белка CG17927 Dm), цитоплазматический белок на основе легкой цепи миозина (например, у насекомых ортолог белка CG3201 Dm), белок spaghetti squash (например, у насекомых ортолог белка CG3595 Dm), белок zipper (например, у насекомых ортолог белка CG15792 Dm), тропонин C (например, у насекомых ортолог белка CG2981, CG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 или CG6514 Dm).

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 11, 12, 3, 4, 7, 8, 9, 10, 13, 14, 5, 6, 15, 16, 17, 18, 19, 20, 21, 22, 158, 159, 165, 166, 167, 156, 157, 160, 161, 154, 155, 163, 164, 152, 153, 150, 151.

В предпочтительном варианте осуществления ген-мишень кодирует рибосомный белок насекомых, выбранный из группы, содержащей рибосомный белок S3A (например, у насекомых ортолог белка CG2168 Dm), рибосомный белок LP1 (например, у насекомых ортолог белка CG4087 Dm), рибосомный белок S3 (например, у насекомых ортолог белка CG6779 Dm), рибосомный белок L10Ab (например, у насекомых ортолог белка CG7283 Dm), рибосомный белок S18 (например, у насекомых ортолог белка CG8900 Dm), рибосомный белок L4 (например, у насекомых ортолог белка CG5502 Dm), рибосомный белок S27 (например, у насекомых ортолог белка CG10423 Dm), рибосомный белок L6 (например, у насекомых ортолог белка CG11522 Dm), рибосомный белок S13 (например, у насекомых ортолог белка CG13389 Dm), и рибосомный белок L12 (например, у насекомых ортолог белка CG3195 Dm), рибосомный белок L26 (например, у насекомых ортолог белка CG6846 Dm), рибосомный белок L21 (например, у насекомых ортолог белка CG12775 Dm), рибосомный белок S12 (например, у насекомых ортолог белка CG11271 Dm), рибосомный белок S28b (например, у насекомых ортолог белка CG2998 Dm), рибосомный белок L13 (например, у насекомых ортолог белка CG4651 Dm), рибосомный белок L10 (например, у насекомых ортолог белка CG17521 Dm), рибосомный белок L5 (например, у насекомых ортолог белка CG17489 Dm), рибосомный белок S15Aa (например, у насекомых ортолог белка CG2033 Dm), рибосомный белок L19 (например, у насекомых ортолог белка CG2746 Dm), рибосомный белок L27 (например, у насекомых ортолог белка CG4759 Dm).

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и где ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность такой, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, указанная нуклеотидная последовательность является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, указанная нуклеотидная последовательность указанного фрагмента является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189.

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 141, 11 12, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность такой, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 141, 11 12, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 141, 11 12, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 141, 11 12, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 141, 11 12, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 141, 11 12, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 141, 11 12, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 141, 11 12, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 141, 11 12, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 141, 11 12, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 141, 11 12.

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 17, 18, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность такой, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 17, 18, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 17, 18, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 17, 18, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 17, 18, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 17, 18, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 17, 18, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 17, 18, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 17, 18, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 17, 18, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 17, 18.

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 19, 20, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 19, 20, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 19, 20 или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 19, 20, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 19, 20, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 19, 20 или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 19, 20 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 19, 20 или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 19, 20 или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 19, 20, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 19, 20.

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу, или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 165, 166, 167 или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 165, 166, 167 или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 165, 166, 167 или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 165, 166, 167 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 165, 166, 167 или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент из, по меньшей мере 21 последовательного нуклеотида из любой из SEQ ID NO: 165, 166, 167 или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 17, 18 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 165, 166, 167 или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 165, 166, 167 или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 165, 166, 167, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 165, 166, 167.

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183 или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183.

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 145, 122, 144, 178, 131, 179 или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 145, 122, 144, 178, 131, 179 или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 145, 122, 144, 178, 131, 179 или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 145, 122, 144, 178, 131, 179, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 145, 122, 144, 178, 131, 179.

В одном варианте осуществления настоящее изобретение относится к растению или репродуктивному материалу или материалу для размножения трансгенного растения, или культивируемой клетке трансгенного растения, которые экспрессируют или способны экспрессировать интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, причем сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 128, 149, 184, 137 или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 128, 149, 184, 137 или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 128, 149, 184, 137 или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 128, 149, 184, 137 указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 128, 149, 184, 137 или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 128, 149, 184, 137 или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 128, 149, 184, 137 указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 128, 149, 184, 137 или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 128, 149, 184, 137 или ее комплементарную последовательность, где два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 128, 149, 184, 137 или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 128, 149, 184, 137.

Применяемый в данном документе термин «ген-мишень» включает любой ген у насекомого-вредителя, который предполагается подавить. В предпочтительном варианте осуществления ген-мишень подавляется так, чтобы бороться с нападением вредителя, например, путем нарушения жизненно важного биологического процесса, происходящего у вредителя, или путем уменьшения патогенности вредителя. Предпочтительные гены-мишени, следовательно, включают, но без ограничений, те, которые играют ключевую роль в регуляции питания, выживания, роста, развития, размножения, нападения и способности вызывать поражение. В соответствии с одним вариантом осуществления ген-мишень является таковым, что при подавлении или ингибировании его экспрессии насекомое-вредитель погибает. В соответствии с другим вариантом осуществления ген-мишень является таковым, что при подавлении или ингибировании его экспрессии рост вредителя предотвращается или замедляется, или останавливается, или задерживается, или затрудняется, размножение вредителя предотвращается, или предотвращается переход через жизненные циклы вредителя. В соответствии еще с другим вариантом осуществления настоящего изобретения ген-мишень является таковым, что при подавлении или ингибировании его экспрессии повреждение, вызванное вредителем и/или способностью вредителя поражать или нападать на место обитания, поверхности и/или растение, или сельскохозяйственную культуру уменьшается; или вредитель прекращает питаться из своих природных пищевых ресурсов, таких как растения и растительные продукты. Термины “нападать” и “поражать” или “нападение” и “поражение”, как правило, используются взаимозаменяемо повсеместно.

Гены-мишени могут экспрессироваться во всех или некоторых клетках насекомых-вредителей. Кроме того, гены-мишени могут экспрессироваться насекомым-вредителем только на определенной стадии его жизненного цикла, например, зрелой стадии имаго, незрелой нимфы или личиночной стадии, или стадии яйца.

Применяемое в данном документе виды “вредителей” предпочтительно являются видами насекомых, которые вызывают поражение или нападают, предпочтительно на растения.

Предпочтительными насекомыми, патогенными для растений, в соответствии с настоящим изобретением, являются вредители растений, выбранные из группы, включающей Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук), или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Laodelphax spp. (например, L. striatellus (малый коричневый дельфацид)); Nephotettix spp. (например, N. virescens или N. cincticeps (зеленая рисовая цикадка), или N.nigropictus (рисовая цикадка)); Sogatella spp. (или S. furcifera (белоспинный рисовый дельфацид)); Chilo spp. (например, C. suppressalis (огневка азиатская стеблевая), C. auricilius (огневка Chilo auricilius), или C. polychrysus (темноголовая рисовая огневка)); Sesamia spp. (например, S. inferens (розовый сверлильщик)); Tryporyza spp. (например, T. innotata (огневка Tryporyza innotata), или T. incertulas (желтый рисовый сверлильщик)); Anthonomus spp. (например, A. grandis (долгоносик хлопковый)); Phaedon spp. (например, P. cochleariae (хреновый листоед)); Epilachna spp. (например, E. varivetis (зерновка бобовая мексиканская)); Tribolium spp. (например, T. castaneum (хрущак каштановый)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук), D. virgifera zeae (мексиканский кукурузный корнегрыз); Ostrinia spp. (например, O. nubilalis (огневка кукурузная)); Anaphothrips spp. (например, A. obscrurus (трипс злаковый)); Pectinophora spp. (например, P. gossypiella (розовый коробочный червь хлопчатника)); Heliothis spp. (например, H. virescens (табачная листовертка)); Trialeurodes spp. (например, T. abutiloneus (белокрылка Trialeurodes abutiloneus) T. vaporariorum (белокрылка тепличная)); Bemisia spp. (например, B. argentifolii (белокрылка магнолиевая)); Aphis spp. (например, A. gossypii (тля хлопковая)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Euschistus spp. (например, E. conspersus (клоп Euschistus conspersus)); Chlorochroa spp. (например, C. sayi (клоп Сэя)); Nezara spp. (например, N. viridula (зеленый овощной клоп)); Thrips spp. (например, T. tabaci (трипс луковый)); Frankliniella spp. (например, F. fusca (трипс табачный), или F. occidentalis (западный цветочный трипс)); Acheta spp. (например, A. domesticus (сверчок домовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Macrosiphum spp. (например, M. euphorbiae (тля картофельная большая)); Blissus spp. (например, B. leucopterus leucopterus (клоп-черепашка пшеничный североамериканский)); Acrosternum spp. (например, A. hilare (клоп-щитник Acrosternum hilare)); Chilotraea spp. (например, C. polychrysa (огневка Chilotraea polychrysa)); Lissorhoptrus spp. (например, L. oryzophilus (долгоносик рисовый водяной)); Rhopalosiphum spp. (например, R. maidis (тля кукурузная)); и Anuraphis spp. (например, A. maidiradicis (тля кукурузная корневая)).

В соответствии с более конкретными вариантами осуществления настоящее изобретение применимо к видам, принадлежащим к семейству Chrysomelidae или листоеды. Жуки листоеды, такие как колорадские жуки, блошки, кукурузные корневые жуки, и долгоносики, такие как долгоносик люцерновый, являются особенно важными вредителями. Конкретные виды рода Leptinotarsa, контролируемые в соответствии с настоящим изобретением, включают колорадского жука (Leptinotarsa decemlineata (Say)) и ложного картофельного жука (Leptinotarsa juncta (Say)). CPB является (серьезным) вредителем нашего домашнего картофеля, других культурных и диких клубненосных и неклубненосных видов картофеля и других видов растений семейства Solanaceous (пасленовых), включая сельскохозяйственные культуры помидоров, баклажанов, перцев, табака (виды рода Nicotiana, включая декоративные), физалиса, риса, кукурузы или хлопка; и виды сорняков/травянистых растений, паслен каролинский, черный паслен, дурман обыкновенный, белену и паслен клювообразный. Кукурузные корневые жуки включают виды, основывающие род Diabrotica (например, D. undecimpunctata undecimpunctata, D. undecimpunctata howardii, D. longicornis, D. virgifera и D. balteata). Кукурузные корневые жуки причиняют существенный вред кукурузе и тыквенным.

В соответствии с более конкретным вариантом осуществления настоящее изобретение применимо к видам, принадлежащим к отряду полужесткокрылые (Hemipterans) (семейство Aphidoidea), таким как Myzus persicae (тля персиковая зеленая), Aphis fabae (тля свекловичная), Acyrthosiphum pisum (тля гороховая), Brevicoryne brassicae (тля капустная), Sitobion avenae (тля большая злаковая), Cavariella aegopodii (тля зонтичная), Aphis craccivora (тля арахисовая), Aphis gossypii (тля хлопковая), Toxoptera aurantii (тля померанцевая), Cavariella spp (тля тминная), Chaitophorus spp (тли рода Chaitophorus), Cinara spp. (тли рода Cinara), Drepanosiphum platanoides (тля яворовая), Elatobium spp (тли рода Elatobium), которые вызывают повреждение растений, таких как деревья рода слива, в частности, персик, абрикос и слива; деревьев, которые в основном культивируются для производства древесины, таких как ивы и тополя, пропашных культур, таких как кукуруза, хлопок, соя, пшеница и рис, овощных культур из семейств Solanaceae, Chenopodiaceae, Compositae, Cruciferae и Cucurbitaceae, включая, но без ограничений, артишок, спаржу, фасоль, свеклу, брокколи, брюссельскую капусту, кочанную капусту, морковь, цветную капусту, мускусную дыню, сельдерей, кукурузу, огурцы, укроп, капусту кормовую, кольраби, репу, баклажан, салат, горчицу, бамию, петрушку, пастернак, горох, перец, картофель, редис, шпинат, тыкву, помидор, репу, кресс водяной и арбуз; или полевых культур, таких как, но без ограничений, табак, сахарная свекла и подсолнечник; цветочных культур или других декоративных растений, таких как сосны и хвойные деревья. Другие полужесткокрылые (Hemipterans) относятся к Nilaparvata ssp (например, N. lugens, Sogatella furcifera) и причиняют вред растениям риса. Другие полужесткокрылые (Hemipterans) относятся к Lygus ssp (например, Lygus hesperus, Lygus rugulipennis, Lygus lineolaris, Lygus sully) и другим видам растительноядных насекомых в семействе Miridae, и причиняют вред хлопку, растениям картофеля, клубнике, хлопку, люцерне, каноле, персику, сливам, винограду, латуку, баклажану, луку, зеленым бобам. А также некоторым средиземноморским деревьям и некоторым декоративным деревьям, таким как вяз (Ulmus spp.), кедровый орех (Pinus Pinea), платан кленолистный (Platanus Acerifolia), яблоня Malus alba (Malus alba). Другие полужесткокрылые (Hemipterans) относятся к семейству Pentatomoidea, их обычно называют щитники, лесные клопы и клопы-вонючки (например; коричневый мраморный щитник (Halyomorpha halys), клоп-щитник Euschistus conspersus (Euschistus conspersus), зеленый овощной клоп (Nezara viridula), щитник красноногий (Pentatoma rufipes), клоп капустный (Murgantia histrionica), клоп Oebalus pugnax (Oebalus pugnax)), и они наносят ущерб плодам, включая яблоки, персики, инжир, шелковицу, плодам цитрусовых и хурме, ежевике, и овощам, включая сахарную кукурузу, помидоры, соевые бобы, фасоль лимскую и паприку, капусту, цветную капусту, репу, хрен, капусту кормовую, горчицу, брюссельскую капусту, картофель, баклажаны, бамию, бобы, спаржу, свеклу, сорняки, фруктовые деревья и полевые культуры, такие как полевая кукуруза и соевые бобы. Щитники также являются вредителями трав, сорго и риса.

Растение для применения в способах по настоящему изобретению или трансгенное растение в соответствии с настоящим изобретением охватывает любое растение, но предпочтительно является растением, которое является восприимчивым к нападению насекомых, патогенных для растения.

Соответственно, настоящее изобретение распространяется на растения и на способы, описываемые в данном документе, где растение выбирают из следующей группы растений (или сельскохозяйственных культур): люцерна, яблоня, абрикос, артишок, спаржа, авокадо, банан, ячмень, бобы, свекла, ежевика, черника, брокколи, брюссельская капуста, капуста, канола, морковь, маниок, цветная капуста, зерновые, сельдерей, вишня, цитрусы, клементины, кофе, кукуруза, хлопок, огурцы, баклажаны, эндивий, эвкалипт, инжир, виноград, грейпфрут, арахис, физалис, киви, латук, лук-порей, лимон, лайм, сосна, кукуруза, манго, дыня, просо, грибы, орехи, овес, бамия, лук, апельсин, декоративное растение или цветок, или дерево, папайя, петрушка, горох, персики, арахис, торфяной мох, перец, хурма, ананас, подорожник, слива, гранат, картофель, тыква, красный эндивий, редис, рапсовое семя, малина, рис, рожь, сорго, соя, соевые бобы, шпинат, клубника, сахарная свекла, сахарный тростник, подсолнечник, сладкий картофель, мандарин, чай, табак, помидоры, виноград культурный, арбуз, пшеница, ямс и цукини.

В конкретных вариантах осуществления настоящее изобретение предусматривает гены-мишени, которые кодируют белки, участвующие в функции белка wings up A (тропонина I), субъединицы II митохондриальной цитохром с-оксидазы или одного из рибосомных белков, как указано в таблице 1.

В предпочтительных вариантах осуществления настоящее изобретение предусматривает гены-мишени, выбранные из группы генов (i) имеющих нуклеотидную последовательность, содержащей любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или (ii) имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, или (iii) имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000, или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или (iv) имеющих нуклеотидную последовательность, содержащую фрагмент из, по меньшей мере, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно по меньшей мере 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности, или (v) имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или (vi) ген которой у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389;

и где нуклеотидная последовательность указанного гена составляет не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов.

Аминокислотные последовательности, кодируемые генами-мишенями по настоящему изобретению представлены SEQ ID NO: 79, 349, 352, 356, 80, 326, 81, 327, 82, 83, 328, 84, 329, 85, 86, 359, 87-91, 330, 350, 353, 331, 351, 332-336, 337, 354, 338-344, 346, 345, 347, 348, 357, 355, 358, 390-393.

Применяемый в данном документе термин “обладающий” имеет такое же значение, как «содержащий».

Применяемый в данном документе термин “идентичность последовательностей” используется для описания сходства последовательностей между двумя или более нуклеотидными или аминокислотными последовательностями. Процент «идентичности последовательностей» между двумя последовательностями определяется путем сравнения двух оптимально выровненных последовательностей в окне сравнения (определенное число положений), при этом часть последовательности в окне сравнения может содержать присоединения или делеции (т.е. пробелы) по сравнению с контрольной последовательностью с целью достижения оптимального выравнивания. Процент идентичности последовательностей рассчитывается путем определения числа положений, в которых идентичное нуклеотидное основание или аминокислотный остаток встречается в обеих последовательностях, с получением числа 'совпадающих' положений, деления числа совпадающих положений на общее число положений в окне сравнения и умножения результата на 100. Способы и программное обеспечение для определения идентичности последовательностей доступны в данной области и включают программное обеспечение Blast и GAP-анализ. Для нуклеиновых кислот, процент идентичности рассчитывают предпочтительно с помощью инструмента выравнивания BlastN, посредством чего процент идентичности рассчитывают по всей длине запросной нуклеотидной последовательности.

Специалисту в данной области будет понятно, что гомологи или ортологи (гомологи, существующие у различных видов) генов-мишеней, представленные любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, можно идентифицировать. Данные гомологи и/или ортологи вредителей также находятся в рамках настоящего изобретения. Предпочтительные гомологи и/или ортологи являются генами, подобными в нуклеотидной последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов гомолог и/или ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80% или 85%, более предпочтительно, по меньшей мере на 90% или 95%, и наиболее предпочтительно, по меньшей мере приблизительно 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности. Аналогично, также предпочтительными гомологами и/или ортологами являются белки, которые подобны в аминокислотной последовательности до такой степени, что при оптимальном выравнивании и сравнении двух аминокислотных последовательностей гомолог и/или ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80% или 85%, более предпочтительно, по меньшей мере на 90% или 95%, и наиболее предпочтительно, по меньшей мере приблизительно 99% идентичной любой из SEQ ID NO: 79-91, 326-359, 390-395.

Другие гомологи являются генами, которые являются аллелями гена, содержащего последовательность, которая представлена любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389. Дополнительно предпочтительными гомологами являются гены, содержащие по меньшей мере один одиночный нуклеотидный полиморфизм (SNP) по сравнению с геном, содержащим последовательность, которая представлена любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389.

'Интерферирующая рибонуклеиновая кислота (РНК)' по настоящему изобретению охватывает любой тип молекулы РНК, способной подавлять или подвергать 'сайленсингу' экспрессию гена-мишени, включая, но без ограничений, смысловую РНК, антисмысловую РНК, короткую интерферирующую РНК (siRNA), микроРНК (miRNA), двухцепочечную РНК (dsRNA), шпилечную РНК (RNA) и тому подобное. Способы анализа на функциональные молекулы интерферирующих РНК хорошо известны в данной области и описаны в данном документе в других местах.

Молекулы интерферирующей РНК по настоящему изобретению обеспечивают последовательность-специфическое подавление экспрессии гена-мишени путем связывания с целевой нуклеотидной последовательностью в пределах гена-мишени. Связывание происходит в результате спаривания оснований между комплементарными областями интерферирующей РНК и целевой нуклеотидной последовательности. Применяемый в данном документе термин 'сайленсирующий элемент' относится к части или области интерферирующей РНК, содержащей или состоящей из последовательности нуклеотидов, которая комплементарна или по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и которая функционирует как активная часть интерферирующей РНК с непосредственным подавлением экспрессии указанного гена-мишени. В одном варианте осуществления настоящего изобретения сайленсирующий элемент содержит или состоит из последовательности по меньшей мере из 17 последовательных нуклеотидов, предпочтительно, по меньшей мере 18 или 19 последовательных нуклеотидов, более предпочтительно, по меньшей мере 21 последовательного нуклеотида, еще более предпочтительно, по меньшей мере 22, 23, 24 или 25 последовательных нуклеотидов, комплементарных целевой нуклеотидной последовательности в пределах гена-мишени.

Применяемое в данном документе выражение “экспрессия гена-мишени” относится к транскрипции и накоплению РНК-транскрипта, кодируемого геном-мишенью, и/или трансляции mRNA в белок. Термин 'подавлять' предназначен для обозначения любого из способов, известных в данной области, с помощью которого молекулы интерферирующей РНК снижают уровень первичных транскриптов РНК, mRNA или белка, полученного из гена-мишени. В определенных вариантах осуществления подавление относится к ситуации, когда уровень РНК или белка, полученного из гена, уменьшается по меньшей мере на 10%, предпочтительно, по меньшей мере на 33%, более предпочтительно, по меньшей мере на 50%, еще более предпочтительно, по меньшей мере на 80%. В особенно предпочтительных вариантах осуществления подавление относится к снижению уровня РНК или белка, полученного из гена по меньшей мере на 80%, предпочтительно, по меньшей мере на 90%, более предпочтительно, по меньшей мере на 95% и наиболее предпочтительно, по меньшей мере на 99% в клетках насекомого-вредителя по сравнению с соответствующим контрольным насекомым-вредителем, которое, например, не подвергалось воздействию интерферирующей РНК или подвергалось воздействию контрольной молекулы интерферирующей РНК. Способы выявления снижения уровней РНК или белка хорошо известны в данной области и включают гибридизацию РНК в растворе, нозерн гибридизацию, обратную транскрипцию (например, анализ количественной ОТ-ПЦР (RT-PCR)), микроматричный анализ, связывание антител, иммуноферментный твердофазный анализ (ELISA) и вестерн-блоттинг. В другом варианте осуществления настоящего изобретения подавление относится к снижению уровней РНК или белка, достаточному для получения выявляемого изменения фенотипа вредителя, по сравнению с соответствующей мерой борьбы с вредителями, например, гибелью клеток, прекращением роста или тому подобное. Подавление, таким образом, можно измерить с помощью фенотипического анализа насекомого-вредителя с использованием методов, обычных в данной области.

В предпочтительном варианте осуществления настоящего изобретения интерферирующая РНК подавляет экспрессию гена с помощью РНК-интерференции или RNAi. RNAi является процессом последовательность-специфической генной регуляции, как правило, опосредованной молекулами двухцепочечной РНК, такими как короткие интерферирующие РНК (siRNA). siRNA содержат смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК. Смысловая цепь или 'направляющая цепь' молекулы siRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенных в пределах РНК-транскрипта гена-мишени. Смысловая цепь siRNA, следовательно, способна соединяться с РНК-транскриптом посредством спаривания оснований по Уотсон-Крику, и направлять РНК на деградацию в пределах клеточного комплекса, известного как индуцируемый РНК сайленсирующий комплекс или RISC. Таким образом, в отношении предпочтительных молекул интерферирующей РНК по настоящему изобретению сайленсирующий элемент, как изложено в данном документе, может являться двухцепочечной областью, содержащей соединенные комплементарные цепи, из которых по меньшей мере одна цепь содержит или состоит из последовательности нуклеотидов, комплементарной или по меньшей мере частично комплементарную целевой нуклеотидной последовательности в пределах гена-мишени. В одном варианте осуществления двухцепочечная область составляет в длину по меньшей мере 21, 22, 23, 24, 25, 30, 35, 40, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 пар оснований.

Более длинные двухцепочечные молекулы РНК (dsRNA), содержащие один или более функциональных двухцепочечных сайленсирующих элементов, которые описаны в данном документе в других местах, и способные к сайленсингу генов посредством RNAi, также рассматриваются в рамках настоящего изобретения. Такие более длинные молекулы dsRNA содержат по меньшей мере 80, 200, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 пар оснований. Данные молекулы dsRNA могут служить в качестве предшественников активных молекул siRNA, которые направляют РНК-транскрипт к комплексу RISC для последующей деградации. Молекулы dsRNA, присутствующие в среде, окружающей организм или его клетки, могут поглощаться организмом и перерабатываться ферментом, называемым Dicer, с получением молекул siRNA. Альтернативно, dsRNA может быть получена in vivo, т.е. транскрибирована из полинуклеотида или полинуклеотидов, кодирующих dsRNA, присутствуюших в клетке, например, бактериальной клетке или растительной клетке, и впоследствии обработана с помощью Dicer, либо в пределах клетки-хозяина, либо, предпочтительно, в пределах клеток насекомого-вредителя после поглощения более длинной dsRNA-предшественника. dsRNA может образовываться из двух отдельных (смысловой и антисмысловой) цепей РНК, которые соединяются посредством комплементарного спаривания оснований. Альтернативно, dsRNA может являться одной цепью, способной складываться назад на себя с образованием шпилечной РНК (РНК) или структуры стебель-петля. В случае РНК, двухцепочечная область или 'стебель' образована из двух областей или сегментов РНК, которые являются существенно инвертированными повторами друг друга и обладают достаточной комплементарностью для обеспечения образования двухцепочечной области. Один или более функциональных двухцепочечных сайленсирующих элементов могут присутствовать в данной 'области стебля' молекулы. Области инвертированных повторов, как правило, разделены областью или сегментом РНК, известным как область «петли». Данная область может содержать любую нуклеотидную последовательность, придающую достаточную гибкость для обеспечения осуществления самоспаривания между фланкирующими комплементарными областями РНК. В общем, область петли является по существу одноцепочечной и действует как разделительный элемент между инвертированными повторами.

Все молекулы интерферирующей РНК по настоящему изобретению обеспечивают последовательность-специфическое подавление экспрессии гена-мишени путем связывания с целевой нуклеотидной последовательностью в пределах гена-мишени. Связывание происходит в результате комплементарного спаривания оснований между сайленсирующим элементом интерферирующей РНК и целевой нуклеотидной последовательностью. Молекулы интерферирующей РНК по настоящему изобретению содержат по меньшей мере один или по меньшей мере два сайленсирующих элемента. В одном варианте осуществления настоящего изобретения целевая нуклеотидная последовательность содержит последовательность нуклеотидов, которая представлена РНК-транскриптом гена-мишени или его фрагментом, при этом фрагмент составляет предпочтительно по меньшей мере 17 нуклеотидов, более предпочтительно, по меньшей мере 18, 19 или 20 нуклеотидов или наиболее предпочтительно, по меньшей мере 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 нуклеотидов. В предпочтительном варианте осуществления настоящего изобретения целевая нуклеотидная последовательность содержит последовательность нуклеотидов, эквивалентную РНК-транскрипту, кодируемому любым из полинуклеотидов, который выбирают из группы, включающей (i) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100 или 1115 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательностью, или (ii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательностью,

или (iii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении двух последовательностей указанный полинуклеотид являлся по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичным любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или (iv) полинуклеотид, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27 до 30, 282 до 285, 294 до 297, 310 до 313, 401, 3, 4, 31 до 34, 139, 5, 6, 35 до 38, 140, 7, 8, 39 до 42, 9, 10, 43 до 46, 141, 11, 12, 47 до 50, 13, 14, 51 до 54, 15, 204, 16, 205, 55 до 58, 322 до 325, 17, 18, 59 до 62, 19, 20, 63 до 66, 21, 22, 67 до 70, 23, 24, 71 до 74, 25, 26, 75 до 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 до 209, 286 до 289, 298 до 301, 145, 122, 144, 178, 131, 179, 210 до 213, 290 до 293, 123, 132, 214 до 217, 124, 133, 218 до 221, 146, 125, 134, 222 до 225, 147, 126, 135, 226 до 229, 127, 148, 136, 230 до 233, 128, 149, 184, 137, 185, 234 до 237, 302 до 305, 129, 138, 238 до 241, 150, 151, 242 до 245, 152, 153, 246 до 249, 154, 155, 250 до 253, 156, 157, 254 до 257, 158, 159, 258 до 261, 160, 161, 262 до 265, 163, 162, 164, 266 до 269, 165, 167, 166, 270 до 273, 168, 170, 169, 274 до 277, 172, 173, 278 до 281, 200, 201, 314 до 317, 402, 186, 202, 187, 203, 306 до 309, 318 до 321, 386, 387, 388, 389, или ее комплементарной последовательностью, и при этом указанный фрагмент или указанная комплементарная последовательность обладает нуклеотидной последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или ее комплементарной последовательности,

или (v) полинуклеотид, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательностью, и при этом указанный фрагмент или указанная комплементарная последовательность обладает нуклеотидной последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фырагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или ее комплементарной последовательности, или (vi) полинуклеотид, кодирующий аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389. В более предпочтительном варианте осуществления вышеупомянутого указанный полинуклеотид составляет в длину не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов.

Предпочтительно, молекулы интерферирующей РНК по настоящему изобретению содержат по меньшей мере одну двухцепочечную область, как правило, сайленсирующий элемент интерферирующей РНК, содержащий смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, при этом смысловая цепь молекулы dsRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени.

Сайленсирующий элемент или по меньшей мере одна его цепь, при этом сайленсирующий элемент является двухцепочечным, может являться полностью комплементарным или частично комплементарным целевой нуклеотидной последовательности гена-мишени. Применяемый в данном документе термин “полностью комплементарный” означает, что все основания нуклеотидной последовательности сайленсирующего элемента являются комплементарными или 'соответствуют' основаниям целевой нуклеотидной последовательности. Термин “по меньшей мере частично комплементарный” означает, что существует менее чем 100% совпадения между основаниями сайленсирующего элемента и основаниями целевой нуклеотидной последовательности. Специалисту в данной области будет понятно, что сайленсирующий элемент должен являться лишь по меньшей мере частично комплементарным целевой нуклеотидной последовательности для опосредования подавления экспрессии гена-мишени. Как известно в данной области, последовательности РНК со вставками, делециями и нарушениями комплементарности относительно целевой последовательности все же могут являться эффективными при RNAi. В соответствии с настоящим изобретением предпочтительно, чтобы сайленсирующий элемент и целевая нуклеотидная последовательность гена-мишени обладали по меньшей мере 80% или 85% идентичности последовательности, предпочтительно, по меньшей мере 90% или 95% идентичности последовательности или более предпочтительно, по меньшей мере 97% или 98% идентичности последовательности, и еще более предпочтительно по меньшей мере 99% идентичности последовательности. Альтернативно, сайленсирующий элемент может содержать 1, 2 или 3 нарушения комплементарности по сравнению с целевой нуклеотидной последовательностью на каждом отрезке из 24 частично комплементарных нуклеотидова.

Специалисту в данной области будет очевидным, что степень комплементарности между сайленсирующим элементом и целевой нуклеотидной последовательностью может варьировать в зависимости от гена-мишени, подлежащего подавлению, или в зависимости от вида насекомого-вредителя, у которого экспрессия гена подлежит контролю.

В другом варианте осуществления настоящего изобретения сайленсирующий элемент содержит последовательность нуклеотидов, которая является эквивалентом РНК любого из полинуклеотидов, выбранных из группы, включающей полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100 или 1115 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательностью, или (ii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной в любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности так, что при оптимальном выравнивании и сравнении двух последовательностей указанный полинуклеотид является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичным любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности, или (iii) полинуклеотид, который содержит фрагмент по меньшей мере, из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного в любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности, и при этом указанный фрагмент или указанная комплементарная последовательность обладают нуклеотидной последовательностью так, что при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, указанная нуклеотидная последовательность является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400 или ее комплементарной последовательности, при этом указанный полинуклеотид составляет не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов. Следует понимать, что в таких вариантах осуществления сайленсирующий элемент может содержать или состоять из области двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых, смысловая цепь, содержит последовательность нуклеотидов по меньшей мере частично комплементарную целевой нуклеотидной последовательности в пределах гена-мишени.

Целевую нуклеотидную последовательность можно выбирать из любой подходящей области или нуклеотидной последовательности гена-мишени или его РНК-транскрипта. Например, целевая нуклеотидная последовательность может располагаться в пределах 5'UTR или 3'UTR гена-мишени или РНК транскрипта или в пределах экзонной или интронной областей гена.

Специалисту в данной области известны способы идентифицирования наиболее подходящих целевых нуклеотидных последовательностей в рамках полноразмерного гена-мишени. Например, множество сайленсирующих элементов, воздействующих на различные области гена-мишени, можно синтезировать и тестировать. Альтернативно, расщепление РНК-транскрипта с помощью ферментов, таких как РНКаза Н, можно использовать для определения сайтов в РНК, которые находятся в конформации, восприимчивой к сайленсингу гена. Сайты-мишени также можно идентифицировать с применением in silico подходов, например, использование компьютерных алгоритмов, предназначенных для прогнозирования эффективности сайленсинга генов на основе воздействия на различные сайты в пределах гена полной длины.

Интерферирующие РНК по настоящему изобретению могут содержать один сайленсирующий элемент или несколько сайленсирующих элементов, при этом каждый сайленсирующий элемент содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии указанного гена-мишени. Конкатемерные конструкции РНК данного типа описаны в WO2006/046148, который включен в данный документ в качестве ссылки. В контексте настоящего изобретения термин 'несколько' означает по меньшей мере два, по меньшей мере три, по меньшей мере четыре и т.д., и по меньшей мере до 10, 15, 20 или по меньшей мере 30. В одном варианте осуществления интерферирующая РНК содержит нескольких копий одного сайленсирующего элемента, т.е. повторов сайленсирующего элемента, который связывается с конкретной целевой нуклеотидной последовательностью в пределах определенного гена-мишени. В другом варианте осуществления сайленсирующие элементы в пределах интерферирующей РНК содержат или состоят из различных последовательностей нуклеотидов, комплементарных различным целевым нуклеотидным последовательностям. Должно быть ясно, что комбинации нескольких копий одного и того же сайленсирующего элемента, комбинированные с сайленсирующими элементами, связывающимися с различными целевыми нуклеотидными последовательностями, находятся в рамках настоящего изобретения.

Различные целевые нуклеотидные последовательности могут происходить из одного гена-мишени у вида насекомого-вредителя для достижения улучшения подавления конкретного гена-мишени у вида насекомого-вредителя. В этом случае сайленсирующие элементы можно комбинировать в интерферирующей РНК в исходном порядке, в котором целевые нуклеотидные последовательности встречаются в гене-мишени, или сайленсирующие элементы можно смешивать и комбинировать случайно в любом порядке ранжирования в рамках интерферирующей РНК по сравнению с порядком целевых нуклеотидных последовательностей в гене-мишени.

Альтернативно различные целевые нуклеотидные последовательности представляют один ген-мишень, но происходят из различных видов насекомых-вредителей.

Альтернативно различные целевые нуклеотидные последовательности могут происходить из различных генов-мишеней. Если интерферирующая РНК предназначена для использования для предупреждении и/или борьбы с нападением вредителей, предпочтительно выбирать различные гены-мишени из группы генов, регулирующих жизненно важные биологические функции вида насекомого-вредителя, включая, но без ограничений, выживание, рост, развитие, размножение и патогенность. Гены-мишени могут регулировать одинаковые или различные биологические пути или процессы. В одном варианте осуществления по меньшей мере один из сайленсирующих элементов содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, при этом ген-мишень выбран из группы генов, которая описана ранее.

В дополнительном варианте осуществления настоящего изобретения различные гены, на которые воздействуют различные сайленсирующие элементы, происходят из одного вида насекомого-вредителя. Данный подход предназначен для достижения усиленного воздействия на один вид насекомого-вредителя. В частности, различные гены-мишени могут экспрессироваться дифференциально на различных стадиях жизненного цикла насекомого, например, зрелого имаго, незрелой личиночной и стадии яйца. Интерферирующую РНК по настоящему изобретению можно использовать для предотвращения и/или борьбы с нападением насекомых-вредителей на более чем одной стадии жизненного цикла насекомого.

В альтернативном варианте осуществления настоящего изобретения различные гены, на которые воздействуют различные сайленсирующие элементы, происходят из различных видов насекомых-вредителей. Интерферирующую РНК по настоящему изобретению можно, таким образом, использовать для предотвращения и/или борьбы с нападением более чем одного вида насекомых-вредителей одновременно.

Сайленсирующие элементы могут располагаться в виде одной непрерывной области интерферирующей РНК или могут разделяться присутствием линкерной последовательности. Линкерная последовательность может содержать короткую случайную нуклеотидную последовательность, которая не комплементарна ни одной из целевых нуклеотидных последовательностей или генов-мишеней. В одном варианте осуществления линкер является при определенных условиях самостоятельно расщепляющейся последовательностью РНК, предпочтительно pH-чувствительным линкером или гидрофобно-чувствительным линкером. В одном варианте осуществления линкер содержит последовательность нуклеотидов, эквивалентную интронной последовательности. Линкерные последовательности по настоящему изобретению могут находиться в диапазоне длины от приблизительно 1 пары оснований до приблизительно 10000 пар оснований, при условии, что линкер не ухудшает способности интерферирующей РНК подавлять экспрессию гена (генов)-мишени.

В дополнение к сайленсирующему элементу (элементам) и любым линкерным последовательностям интерферирующая РНК по настоящему изобретению может содержать по меньшей мере одну дополнительную полинуклеотидную последовательность. В различных вариантах осуществления настоящего изобретения дополнительную последовательность выбирают из (i) последовательности, способной защитить интерферирующую РНК от РНК процессинга, (ii) последовательности, влияющей на стабильность интерферирующей РНК, (iii) последовательности, обеспечивающей связывание белков, например, для облегчения поглощения интерферирующей РНК клетками вида насекомого-вредителя, (iv) последовательности, облегчающей крупномасштабное производство интерферирующей РНК, (v) последовательности, которая является аптамером, который связывается с рецептором или молекулой на поверхности клеток насекомого-вредителя для облегчения поглощения, или (v) последовательности, которая катализирует процессинг интерферирующей РНК в клетках насекомого-вредителя и тем самым повышает эффективность интерферирующей РНК. Структуры для повышения стабильности молекулы РНК хорошо известны в данной области и описаны дополнительно в WO2006/046148, который включен в данный документ в качестве ссылки.

Длина интерферирующей РНК по настоящему изобретению должна являться достаточной для поглощения клетками вида насекомого-вредителя и подавления генов-мишеней у вредителя, как описано в данном документе в других местах. Однако верхний предел длины может зависеть от (i) требования к интерферирующей РНК поглощаться клетками вредителя, и (ii) требования к интерферирующей РНК подвергаться процессингу в клетках вредителя для опосредования сайленсинга генов путем RNAi. Длина также может зависеть от способа получения и состава для доставки интерферирующей РНК к клеткам. Предпочтительно, интерферирующая РНК по настоящему изобретению составляет от 21 до 10000 нуклеотидов в длину, предпочтительно от 50 до 5000 нуклеотидов или от 100 до 2500 нуклеотидов, более предпочтительно от 80 до 2000 нуклеотидов в длину.

Интерферирующая РНК может содержать основания ДНК, неприродные основания или неприродные связи остова, или модификации сахарофосфатного остова, например, для повышения стабильности во время хранения или повышения устойчивости к деградации нуклеазами. Дополнительно, интерферирующая РНК может быть получена химически или ферментативно специалистом в данной области с помощью управляемых вручную или автоматизированных реакций. Альтернативно, интерферирующая РНК может транскрибироваться из полинуклеотида, кодирующего таковую. Таким образом, в настоящем документе предусматривается выделенный полинуклеотид, кодирующий любую из интерферирующих РНК по настоящему изобретению.

Также в настоящем документе предусматривается выделенный полинуклеотид, выбранный из группы, включающей (i) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательностью, или (ii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100 или 1115 последовательных нуклеотидов нуклеотидной последовательности, представленной любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, ее комплементарной последовательностью, или (iii) полинуклеотид, который содержит по меньшей мере 21, предпочтительно, по меньшей мере 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной в любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности так, что при оптимальном выравнивании и сравнении двух последовательностей указанный полинуклеотид является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичным любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности, или (iv) полинуклеотид, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотидной последовательности, представленной в любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности, и при этом указанный фрагмент или указанная комплементарная последовательность обладают нуклеотидной последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400 или ее комплементарной последовательности, или (v) полинуклеотид, который содержит фрагмент по меньшей мере из 21, предпочтительно, по меньшей мере 22, 23 или 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов нуклеотида, представленного в любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности, и при этом указанный фрагмент или указанная комплементарная последовательность обладают нуклеотидной последовательностью, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400 или ее комплементарной последовательности, или (vi) полинуклеотид, кодирующий аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 70%, предпочтительно, по меньшей мере на 75%, 80%, 85%, 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, и при этом указанный полинуклеотид составляет не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов.

В предпочтительных вариантах осуществления выделенный полинуклеотид является частью молекулы интерферирующей РНК, как правило, частью сайленсирующего элемента, содержащего по меньшей мере одну двухцепочечную область, содержащую смысловую цепь РНК, соединенную путем комплементарного спаривания оснований с антисмысловой цепью РНК, при этом смысловая цепь молекулы dsRNA содержит последовательность нуклеотидов, комплементарную последовательности нуклеотидов, расположенной в пределах РНК-транскрипта гена-мишени. Смысловая цепь dsRNA, следовательно, способна соединяться с РНК-транскриптом и воздействовать на РНК для деградации в пределах RNAi-индуцируемого сайленсирующего комплекса или RISC.

Полинуклеотиды по настоящему изобретению можно вставлять с помощью рутинных методов молекулярного клонирования в конструкции ДНК или векторы, известные в данной области. Следовательно, в соответствии с одним вариантом осуществления предусматривается конструкция ДНК, содержащая любые из полинуклеотидов по настоящему изобретению. Предпочтительно, в данном документе предусматривается конструкция ДНК, содержащая полинуклеотид, кодирующий по меньшей мере одну из интерферирующих РНК по настоящему изобретению. Конструкция ДНК может являться рекомбинантным ДНК-вектором, например, бактериальным или дрожжевым вектором, или растительным вектором. В предпочтительном варианте осуществления настоящего изобретения конструкция ДНК является экспрессирующей конструкцией, и полинуклеотид функционально связан с по меньшей мере одной регуляторной последовательностью, способной управлять экспрессией полинуклеотидной последовательности. Термин 'регуляторная последовательность' следует рассматривать в широком контексте, и он предназначен для обозначения любой нуклеотидной последовательности, способной воздействовать на экспрессию полинуклеотидов, с которыми она функционально связана, включая, но без ограничений, промоторы, энхансеры и другие природные или синтетические элементы-активаторы транскрипции. Регуляторная последовательность может располагаться на 5'-или 3'-конце полинуклеотидной последовательности. Термин 'функционально связанный' относится к функциональной связи между регуляторной последовательностью и полинуклеотидной последовательностью, такой, что регуляторная последовательность управляет экспрессией полинуклеотида. Функционально связанные элементы могут являться смежными или несмежными.

Предпочтительно, регуляторная последовательность является промотором, выбранным из группы, включающей, но без ограничений, конститутивные промоторы, индуцируемые промоторы, тканеспецифические промоторы и промоторы, специфичные для стадии роста/развития. В одном варианте полинуклеотид находится под контролем сильного конститутивного промотора, такого как любой, выбранный из группы, включающей CaMV35S промотор, двойной CaMV35S промотор, убиквитиновый промотор, актиновый промотор, rubisco промотор, GOS2 промотор, промотор 34S вируса мозаики норичника. В другом варианте осуществления регуляторная последовательность является растительным промотором для использования в регуляции экспрессии полинуклеотида в растениях. Растительные промоторы, в частности, тканеспецифические растительные промоторы, охватываемые объемом настоящего изобретения, описаны более подробно в данном документе в других местах.

Необязательно одну или более последовательностей терминации транскрипции можно включать в экспрессирующую конструкцию по настоящему изобретению. Термин 'последовательность терминации транскрипции' охватывает управляющую последовательность в конце транскрипционной единицы, которая сигнализирует о терминации транскрипции, 3' процессинге и полиаденилировании первичного транскрипта. Дополнительные регуляторные последовательности, включая, но без ограничений, энхансеры транскрипции или трансляции, можно включать в экспрессионную конструкцию, например, как с усиленным двойным промотором CaMV35S.

Настоящее изобретение также охватывает способ создания любой из интерферирующих РНК по настоящему изобретению, включающий этапы: (i) контакта полинуклеотида, кодирующего указанную интерферирующую РНК, или ДНК-конструкции, содержащей полинуклеотид, с бесклеточными компонентами; или (ii) введения в клетку (например, путем трансформации, трансфекции или инъекции) полинуклеотида, кодирующего указанную интерферирующую РНК, или ДНК-конструкции, содержащей полинуклеотид.

Настоящее изобретение, таким образом, также относится к любому двухцепочечному рибонуклеотиду, полученному при экспрессии полинуклеотида, описанного в данном документе.

Соответственно, также в данном документе предусматривается клетка-хозяин, трансформированная любым из полинуклеотидов, описанных в данном документе. Дополнительно охватываются настоящим клетки-хозяева, содержащие любую из интерферирующих РНК по настоящему изобретению, любой из полинуклеотидов по настоящему изобретению или ДНК-конструкцию, содержащую любой из полинуклеотидов. Клетка-хозяин может являться прокариотической клеткой, включая, но без ограничений, грамположительные и грамотрицательные бактериальные клетки, или эукариотической клеткой, включая, но без ограничений, клетки дрожжей или клетки растений. Предпочтительно, указанная клетка-хозяин является бактериальной клеткой или растительной клеткой. Бактериальную клетку можно выбирать из группы, включающей, но без ограничений, грамположительные и грамотрицательные клетки, включающие Escherichia spp. (например, E. coli), Bacillus spp. (например, B. thuringiensis), Rhizobium spp., Lactobacillus spp., Lactococcus spp., Pseudomonas spp. и Agrobacterium spp. Полинуклеотид или ДНК-конструкция по настоящему изобретению может существовать или поддерживаться в клетке-хозяине как внехромосомный элемент, или может являться стабильно включенным в геном клетки-хозяина. Характеристики, представляющие особый интерес при выборе клетки-хозяина для целей настоящего изобретения, включают простоту, с которой полинуклеотид или ДНК-конструкцию, кодирующую интерферирующую РНК, можно ввести в хозяина, доступность совместимых экспрессионных систем, эффективность экспрессии и стабильность интерферирующей РНК в хозяине.

Предпочтительно, интерферирующие РНК по настоящему изобретению экспрессируются в растительных клетках-хозяевах. Предпочтительные растения, представляющие интерес, включают, но без ограничений, хлопок, картофель, рис, помидор, канолу, сою, подсолнечник, сорго, просо, кукурузу, люцерну, землянику, баклажаны, перец и табак.

В ситуациях, где интерферирующая РНК экспрессируется в клетке-хозяине и/или применяется для предотвращения и/или борьбы с нападением вредителя на организм-хозяин, предпочтительно, чтобы интерферирующая РНК не демонстрировала значительных 'нецелевых' эффектов, т.е. интерферирующая РНК не влияла на экспрессию генов в хозяине. Предпочтительно, сайленсирующий элемент не демонстрирует значительной комплементарности с нуклеотидными последовательностями, кроме заданной целевой нуклеотидной последовательности гена-мишени. В одном варианте осуществления настоящего изобретения сайленсирующий элемент демонстрирует менее 30%, более предпочтительно менее 20%, более предпочтительно менее 10% и еще более предпочтительно менее 5% идентичности последовательности с любым геном клетки-хозяина или организма. Если известны данные геномной последовательности для организма-хозяина, можно перепроверить идентичность с сайленсирующим элементом, применяя стандартные инструменты биоинформатики. В одном варианте осуществления отсутствует идентичность последовательности между сайленсирующим элементом и геном из клетки-хозяина или организма-хозяина в области из 17, более предпочтительно, в области из 18 или 19 и наиболее предпочтительно, в области из 20 или 21 последовательных нуклеотидов.

При практическом применении настоящего изобретения интерферирующие РНК по настоящему изобретению можно использовать для предотвращения и/или борьбы с любым насекомым вредителем, принадлежащим к отрядам Coleoptera, Lepidoptera, Diptera, Dichyoptera, Orthoptera, Hemiptera и Siphonaptera.

Также в данном документе предусматривается способ предотвращения и/или борьбы с нападением вредителей, при котором вид насекомого-вредителя контактирует с эффективным количеством по меньшей мере одной интерферирующей РНК, при этом РНК функционирует при поглощении указанным вредителем с подавлением экспрессии жизненно важного гена-мишени вредителя. Жизненно важным геном-мишенью может являться любой ген вредителя, участвующий в регуляции жизненно важного биологического процесса, необходимого вредителю для инициирования или поддержания нападения, включая, но без ограничений, выживание, рост, развитие, размножение и патогенность. В частности, ген-мишень может являться любым из генов вредителя, как описано в данном документе в других местах.

Кроме того, в данном документе предусматривается способ предотвращения и/или борьбы с нападением вредителей в поле культурных растений, при этом указанный способ включает экспрессию в указанных растениях эффективного количества интерферирующей РНК, описываемой в данном документе.

В способе, предназначенном для борьбы с нападением вредителя, фраза 'эффективное количество' распространяется на количество или концентрацию интерферирующей РНК, необходимые для получения фенотипического эффекта у вредителя таким образом, чтобы уменьшались количества организмов-вредителей, поражающих организм-хозяин, и/или уменьшалось количество повреждений, вызванных вредителем. В одном варианте осуществления фенотипическим эффектом является гибель вредителя, и интерферирующая РНК используется для достижения по меньшей мере 20%, 30%, 40%, предпочтительно, по меньшей мере 50%, 60%, 70%, более предпочтительно, по меньшей мере 80% или 90% смертности вредителей по сравнению с контрольными насекомыми-вредителями. В дополнительном варианте осуществления, фенотипические эффекты включают, но без ограничений, остановку роста вредителя, прекращение питания и уменьшение яйцекладки. Общее количество организмов-вредителей, поражающих организм-хозяин, можно таким образом уменьшить по меньшей мере на 20%, 30%, 40%, предпочтительно, по меньшей мере на 50%, 60%, 70%, более предпочтительно, по меньшей мере на 80% или 90% по сравнению с контрольными вредителями. Альтернативно, ущерб, наносимый насекомыми-вредителями, можно уменьшить по меньшей мере на 20%, 30%, 40%, предпочтительно, по меньшей мере на 50%, 60%, 70%, более предпочтительно, по меньшей мере на 80% или 90% по сравнению с контрольными насекомыми-вредителями. Таким образом, способ по настоящему изобретению можно применять для достижения по меньшей мере 20%, 30%, 40%, предпочтительно, по меньшей мере 50%, 60%, 70%, более предпочтительно, по меньшей мере 80% или 90% борьбы с вредителями.

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297 или 310-313, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297 или 310-313, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук),

где ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 79, 349, 352 или 356 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 141, 11, 12, 47-50, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 141, 11, 12, 47-50, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 328 или 84 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 17, 18, 59-62, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: SEQ ID NO: 17, 18, 59-62, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. Persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в SEQ ID NO: 87 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 19, 20, 63-66, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: SEQ ID NO: 19, 20, 63-66, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. Persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в SEQ ID NO: 88 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 165, 167, 166, 270-273, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. Persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук). В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: SEQ ID NO: 165, 167, 166, 270-273, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 347 или 348 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: SEQ ID NO: 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук),

при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 330, 350 или 353 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 145, 122, 144, 178, 131, 179, 210-213, 290-293, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: SEQ ID NO: 145, 122, 144, 178, 131, 179, 210-213, 290-293, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 331 или 351 (при оптимальном выравнивании указанных кодируемых белков).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: 128, 149, 184, 137, 185, 234-237, 302-305, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук).

В способах, описанных в данном документе, для подавления экспрессии гена-мишени у вида насекомого-вредителя, молекулы двухцепочечной РНК, содержащей по меньшей мере 21 пару оснований, одна цепь которой содержит или состоит из последовательности нуклеотидов, комплементарной по меньшей мере 21 последовательному нуклеотиду в любой из SEQ ID NO: SEQ ID NO: 128, 149, 184, 137, 185, 234-237, 302-305, или ее комплементарной последовательности, можно применять для подавления экспрессии ортологического гена-мишени у жесткокрылых, полужесткокрылых, чешуекрылых или двукрылых насекомых, выбранных из группы включающей, но без ограничений, Leptinotarsa spp. (например, L. decemlineata (колорадский жук), L. juncta (ложный картофельный жук) или L. texana (картофельный жук Leptinotarsa texana)); Nilaparvata spp. (например, N. lugens (коричневый дельфацид)); Lygus spp. (например, L. lineolaris (клоп-слепняк Lygus lineolaris) или L. hesperus (слепняк западный матовый)); Myzus spp. (например, M. persicae (тля персиковая зеленая)); Diabrotica spp. (например, D. virgifera virgifera (западный кукурузный жук), D. barberi (северный кукурузный жук), D. undecimpunctata howardi (южный кукурузный жук) или D. virgifera zeae (мексиканский кукурузный жук), при этом ортологические гены кодируют белок, обладающий аминокислотной последовательностью, которая является по меньшей мере на 85%, 90%, 92%, 94%, 96%, 98%, 99% идентичной аминокислотной последовательности, представленной в любой из SEQ ID NO: 337 или 354 (при оптимальном выравнивании указанных кодируемых белков).

В одном варианте осуществления растение, подлежащее обработке, сконструировано для экспрессии интерферирующей РНК внутриклеточно, посредством транскрипции с полинуклеотида, включенного в него. По мере того как вредитель питается тканями растения, клетки, содержащие интерферирующую РНК, расщепляются внутри пищеварительного тракта насекомого, и интерферирующая РНК, таким образом, распределится внутри тела насекомого, приводя к подавлению генов-мишеней.

Таким образом, в соответствии с другим аспектом настоящего изобретения предусматривается способ создания трансгенного растения, устойчивого к нападению вида насекомого-вредителя, включающий этапы: (a) трансформацию растительной клетки ДНК-конструкцией, содержащей полинуклеотидную последовательность, кодирующую интерферирующую рибонуклеиновую кислоту (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного вида насекомого-вредителя, (b) регенерацию растения из трансформированной растительной клетки, и (c) выращивание трансформированного растения в условиях, подходящих для экспрессии интерферирующей РНК из рекомбинантной ДНК-конструкции, при этом указанное растение, таким образом, является устойчивым к указанному вредителю по сравнению с нетрансформированным растением.

Интерферирующая РНК, экспрессируемая растением или его частью, может являться любой из тех, которые раскрыты в других местах в данном документе. Предпочтительно, интерферирующая РНК содержит или состоит по меньшей мере из одного сайленсирующего элемента, и указанный сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых (смысловая цепь) содержит последовательность нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах гена-мишени. Там, где часть интерферирующей РНК является двухцепочечной, две цепи молекулы могут экспрессироваться по меньшей мере из двух отдельных полинуклеотидов, или могут кодироваться одним полинуклеотидом, кодирующим интерферирующую РНК с помощью, например, структуры типа стебель-петля или так называемой шпилечной структуры, описываемой в других местах в данном документе.

Интерферирующая РНК, экспрессируемая растением или его частью, может воздействовать на любые из генов вредителя, описываемых в других местах в данном документе. В частности, ген-мишень можно выбирать из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, или выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1-26, 121-205, 386-389, 394, 400, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности, или выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 или 3000 последовательных нуклеотидов из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389 или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарной последовательности. Ген-мишень также может являться у насекомого-вредителя ортологом гена, который обладает нуклеотидной последовательностью, содержащей любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 23, 24, 71-74, 25, 26, 75-78, 143, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, 128, 149, 184, 137, 185, 234-237, 302-305, 129, 138, 238-241, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, 168, 170, 169, 274-277, 172, 173, 278-281, 200, 201, 314-317, 402, 186, 202, 187, 203, 306-309, 318-321, 386, 387, 388, 389.

В одном варианте осуществления ген-мишень:

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 2, 121, 130, 123, 132, 122, 131, 124, 133, 125, 134, 126, 135, 127, 136 или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, 121, 142, 176, 182, 130, 177, 183, 206-209, 286-289, 298-301, 145, 122, 144, 178, 131, 179, 210-213, 290-293, 123, 132, 214-217, 124, 133, 218-221, 146, 125, 134, 222-225, 147, 126, 135, 226-229, 127, 148, 136, 230-233.

В одном варианте осуществления ген-мишень:

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273 или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент, по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 3, 4, 31 до 34, 139, 5, 6, 35 до 38, 140, 7, 8, 39 до 42, 9, 10, 43 до 46, 141, 11, 12, 47 до 50, 13, 14, 51 до 54, 15, 204, 16, 205, 55 до 58, 322 до 325, 17, 18, 59 до 62, 19, 20, 63 до 66, 21, 22, 67 до 70, 150, 151, 242 до 245, 152, 153, 246 до 249, 154, 155, 250 до 253, 156, 157, 254 до 257, 158, 159, 258 до 261, 160, 161, 262 до 265, 163, 162, 164, 266 до 269, 165, 167, 166, 270 до 273, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, указанная нуклеотидная последовательность указанного фрагмента является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 3, 4, 31-34, 139, 5, 6, 35-38, 140, 7, 8, 39-42, 9, 10, 43-46, 141, 11, 12, 47-50, 13, 14, 51-54, 15, 204, 16, 205, 55-58, 322-325, 17, 18, 59-62, 19, 20, 63-66, 21, 22, 67-70, 150, 151, 242-245, 152, 153, 246-249, 154, 155, 250-253, 156, 157, 254-257, 158, 159, 258-261, 160, 161, 262-265, 163, 162, 164, 266-269, 165, 167, 166, 270-273.

В одном варианте осуществления ген-мишень:

(i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарную последовательность, или имеющих нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, или ее комплементарной последовательности, или

(ii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарной последовательности, или имеющих такую нуклеотидную последовательность, чтобы при оптимальном выравнивании и сравнении указанного гена, содержащего указанный фрагмент, с любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, указанная нуклеотидная последовательность являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294 до 297, 310-313, 401, или ее комплементарной последовательности, или

(iii) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую фрагмент по меньшей мере из 21 последовательного нуклеотида из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарной последовательности, таким образом, чтобы при оптимальном выравнивании и сравнении указанного фрагмента с соответствующим фрагментом в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, указанная нуклеотидная последовательность указанного фрагмента являлась по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной указанному соответствующему фрагменту из любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарной последовательности, или

(iv) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую любую из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401, или ее комплементарную последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая является по меньшей мере на 75%, предпочтительно, по меньшей мере на 80%, 85%, 90%, 95%, 98% или 99% идентичной любой из последовательностей, представленных в SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282 до 285, 294-297, 310-313, 401, или

(v) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85%, предпочтительно, по меньшей мере на 90%, 95%, 98% или 99% идентичной аминокислотной последовательности, кодируемой любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, 27-30, 282-285, 294-297, 310-313, 401.

Предпочтительнонуклеотидная последовательность указанного гена-мишени составляет не более чем 10000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 или 1500 нуклеотидов. Кроме того, важно, чтобы интерферирующая РНК не нарушала экспрессии какого-либо гена растения-хозяина.

Применяемый в данном документе термин 'трансгенное растение' или 'трансгенная растительная клетка' относится к любому растению или растительной клетке, которые созданы методами генетической инженерии, или происходят от растения, которое создано методами генетической инженерии таким образом, чтобы нести экзогенную полинуклеотидную последовательность. 'Экзогенный' относится к тому факту, что полинуклеотид происходит из-за пределов растительной клетки. Как правило, экзогенный полинуклеотид не является присущим для трансгенного растения, т.е. он не обнаруживается в природных условиях в пределах генома растения.

Применяемый в данном документе термин 'трансформация' относится к введению экзогенных полинуклеотидных молекул в растение или его клетку. Методы введения полинуклеотидов в растения известны в данной области. В одном варианте осуществления настоящего изобретения растения являются 'стабильно трансформированными', с помощью полинуклеотида или ДНК-конструкции, содержащей полинуклеотид, т.е. полинуклеотид или ДНК-конструкция, введенная в растительную клетку, интегрируется в геном растения и способна наследоваться его потомством. Протоколы трансформации для введения полинуклеотидов или ДНК-конструкций в клетки растений могут варьировать в зависимости от вовлеченного вида растения. Подходящие способы трансформация включают, но без ограничений, микроинъекцию, электропорацию, Agrobacterium-опосредованную трансформацию и баллистическое ускорение частиц. Способы также известны в данной области для целенаправленного встраивания полинуклеотида или ДНК-конструкции в специфическом положении в геном растения с использованием сайт-специфических систем рекомбинации.

ДНК-конструкция, содержащая полинуклеотид, кодирующий активную молекулу интерферирующей РНК, может являться любым вектором, подходящим для трансформации растительных клеток. Подходящие векторы включают, но без ограничений, бактериальные плазмиды, например, Ti-плазмиду Agrobacterium tumefaciens, и вирусные векторные системы. ДНК-конструкция, вводимая в клетки растения, не должна являться вредной или токсичной для растения, и/или не должна являться вредной или токсичной для любых организмов выше по цепи питания, которые питаются указанными растениями.

В одном варианте осуществления ДНК-конструкция является экспрессирующей конструкцией, содержащей полинуклеотид, кодирующий интерферирующую РНК, функционально связанную с регуляторной последовательностью, способной управлять экспрессией полинуклеотидной последовательности в растениях, такой как любая, выбранная из группы, содержащей CaMV35S промотор, двойной CaMV35S промотор, убиквитиновый промотор, актиновый промотор, rubisco промотор, GOS2 промотор, промотор 34S вируса мозаики норичника и усиленный двойной CaMV35S промотор. Предпочтительно, регуляторная последовательность является растительным промотором, выбранным из тех, которые известны в данной области. В некоторых вариантах осуществления может являться предпочтительным, чтобы растение продуцировало молекулы интерферирующей РНК только в тех частях растения, которые вступают в контакт с и/или повреждаются видом насекомого-вредителя, например, надземные части растения, корни и т.д. Данный эффект можно достичь посредством использования тканеспецифических растительных промоторов, включая, но без ограничений, промоторы, специфические для листьев, промоторы, специфические для корней, промоторы, специфические для стебля, промоторы, специфические для цветка и промоторы, специфические для плода, известны в данной области. Подходящими примерами промоторов, специфических для корней, являются PsMTA и промотор хитиназы класса III. Примерами специфических для листьев и специфических для стебля, или специфических для фотосинтетических тканей промоторов, которые также являются фотоактивируемыми, являются промоторы двух хлорофилл-связывающих белков (cab1 и cab2) из сахарной свеклы, рибулозобисфосфаткарбоксилазы (Rubisco), кодируемой rbcS, A (gapA) и B (gapB) субъединиц глицеральдегид-3-фосфатдегидрогеназы хлоропластов, промотор гена из Solanum tuberosum, кодирующего специфический для листьев и стебля (ST-LS1) белок, стебель-регулируемых (stem-regulated), индуцируемых защитой генов как, например, JAS промоторы, промоторы, специфические для цветка, такие как промотор халконсинтазы, и промоторы, специфические для плода, такие как RJ39 из земляники.

В других вариантах осуществления может являться предпочтительным, чтобы растение продуцировало молекулы интерферирующей РНК только на определенной стадии его роста. Данный эффект можно достичь посредством использования специфических для развития растительных промоторов, которые управляют экспрессией только в течение определенных периодов развития растения. В частности, является важным защищать растения от нападения вредителей на ранних стадиях роста растения или во время цветения (например, в случае риса), или во время плодоношения или созревания плодов, или налива зерна, так как это то время, когда растение может наиболее серьезно повреждаться.

ДНК-конструкция для использования в трансформации растения в соответствии с настоящим способом, может содержать более одного полинуклеотида, кодирующего молекулу интерферирующей РНК по настоящему изобретению. В одном варианте осуществления различные полинуклеотиды могут кодировать молекулы интерферирующих РНК, воздействующие на различные нуклеотидные последовательности в пределах одного гена-мишени. В дополнительном варианте осуществления различные полинуклеотиды могут кодировать молекулы интерферирующих РНК, воздействующие на различные нуклеотидные последовательности в пределах различных генов-мишеней, где различные гены-мишени происходят из одного или различных видов насекомых-вредителей. Там, где ДНК-конструкция кодирует более одной интерферирующей РНК, данные РНК могут экспрессироваться дифференциально в различных тканях растения в силу того, что находятся под контролем различных тканеспецифических промоторных последовательностей, описываемых в других местах в данном документе. В одном варианте осуществления растение сконструировано для экспрессии интерферирующей РНК в листьях, которая подавляет экспрессию гена-мишени у насекомого, которое питается листьями, и для дополнительной экспрессии интерферирующей РНК в корнях, которая подавляет экспрессию гена-мишени у насекомого, которое заселяет почву и питается корнями растений.

ДНК-конструкция может также содержать по меньшей мере один дополнительный полинуклеотид, представляющий интерес, например, полинуклеотид, кодирующий дополнительную регуляторную молекулу РНК, полинуклеотид, кодирующий белок, токсичный для вида насекомого-вредителя, и/или полинуклеотид, кодирующий белок, придающий устойчивость или толерантности к гербицидам.

В соответствии с настоящим способом растение регенерируют из трансформированной растительной клетки с использованием методов, известных в данной области. Один из таких методов включает ферментативное расщепление стенки растительной клетки с получением протопластов растения, которые впоследствии могут подвергаться нескольким циклам деления и дифференцировки клеток с получением взрослого растения. Взрослые растения, полученные таким образом, можно впоследствии тестировать на устойчивость к нападению вредителей. Термин 'устойчивый', применяемый в данном документе, следует толковать широко, он относится к способности растения защищаться от нападения вредителя, который, как правило, способен нанести повреждения или ущерб растению. Под устойчивым может подразумеваться, что растение более не является восприимчивым к нападению вредителя, или что любые симптомы заболевания, обусловленные нападением вредителя, снижаются по меньшей мере примерно на 20%, предпочтительно, по меньшей мере на 30%, 40% или 50%, более предпочтительно, по меньшей мере на 60%, 70% или 80% и наиболее предпочтительно, по меньшей мере на 90%. Методы измерения устойчивости растения к видам насекомых-вредителей общеизвестны в данной области и включают, но без ограничений, измерение с течением времени среднего диаметра поражения, биомассы или веса вредителей, выживаемость и/или смертность вредителей, и/или общий процент разрушенных тканей растения.

В одном варианте осуществления настоящий способ получения трансгенного растения также включает этап, на котором получают отпрысков или потомство трансгенного растения и тестируют потомство на устойчивость к насекомым-вредителям. Можно получить два или более поколений для подтверждения того, что экспрессия признака устойчивости стабильно поддерживается и наследуется. Семена также можно собирать от родительского трансгенного растения и/или его потомства для тестирования на устойчивость к насекомым-вредителям.

Также настоящим изобретением охватывается способ получения трансгенных растений, устойчивых к нападению вида насекомого-вредителя, включающий этапы скрещивания первого трансгенного растения, несущего ДНК-конструкцию, кодирующую интерферирующую РНК, которая функционирует с подавлением экспрессии гена-мишени вредителя, со вторым растением, у которого отсутствует указанная ДНК-конструкция, и отбора потомства, устойчивого к указанному вредителю. Скрещивание можно осуществлять любыми способами, обычно используемыми в сфере селекции растений. Потомство, отобранное по устойчивости к вредителям, можно дополнительно самоопылять или 'подвергать самоопылению' для получения последующего поколения, устойчивого к вредителю потомства. В одном варианте осуществления несколько циклов самоопыления или самоопыления можно осуществлять для получения 2, 3, 4, 5 или более поколений потомства. Полученное потомство можно теститровать на устойчивость к вредителям для подтверждения того, что экспрессия признака устойчивости стабильно поддерживается и наследуется.

В дополнительном варианте осуществления любое устойчивое к вредителю потомство растений, полученное от скрещивания первого трансгенного родительского растения, несущего ДНК-конструкцию, представляющую интерес, со вторым родительским растением, у которого отсутствует указанная ДНК-конструкция, можно подвергать возвратному скрещиванию со вторым родительским растением и тестировать последующее потомство на устойчивость к нападению вредителя. Растения или их потомство можно тестировать на устойчивость к нападению вредителя, либо с помощью фенотипического анализа, описываемого в других местах в данном документе, либо с помощью стандартных молекулярных методов. Например, устойчивые к вредителям растения можно идентифицировать путем обнаружения присутствия полинуклеотидной последовательности, кодирующей интерферирующую РНК, которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени. Методы обнаружения присутствия специфических полинуклеотидных последовательностей в клетках известны в данной области и включают ПЦР, ферментативное расщепление и SNP анализ.

Способы по настоящему изобретению можно применять для получения 'многоуровневых трансгенных' растений, которые устойчивы к виду насекомого-вредителя, и которые необязательно обладают по меньшей мере одним дополнительным желательным признаком. Применяемое в данном документе 'многоуровневое' трансгенное растение относится к растению, которое несет более одной экзогенной полинуклеотидной последовательности. Фраза 'более одного' относится к возможности растения нести по меньшей мере 2, по меньшей мере 3, по меньшей мере 4 экзогенных полинуклеотида. В одном варианте осуществления растительная клетка, трансформированная с помощью ДНК-конструкции, кодирующей интерферирующую РНК, воздействующую на ген вредителя, может являться предварительно сконструированной с содержанием отдельного экзогенного полинуклеотида. Альтернативно, способ получения трансгенного растения из растительной клетки, описываемый в данном документе, может включать протокол ко-трансформации, где ДНК-конструкция, кодирующая интерферирующую РНК по настоящему изобретению, доставляется в растительную клетку одновременно или последовательно с отдельным экзогенным полинуклеотидом.

Многоуровневые трансгенные растения, демонстрирующие устойчивость к вредителям, также можно получать с помощью стандартных методов селекции растений. В одном варианте осуществления первое устойчивое к вредителям трансгенное растение скрещивают со вторым растением, сконструированным для экспрессии экзогенного полинуклеотида или гетерологичного гена, придающего желаемый признак растения. Любое полученное потомство можно тестировать на устойчивость к вредителям и приобретение дополнительного желаемого признака. Альтернативно или в дополнение, любое устойчивое к вредителям потомство, полученное от скрещивания, можно подвергать возвратному скрещиванию со вторым родителем с целью получения дальнейшего потомства, которое можно отбирать по наследованию гетерологичного гена, переносимого вторым родителем, и тем самым, дополнительного желаемого признака растения. Экзогенные полинуклеотиды, которые несет многоуровневое трансгенное растение по настоящему изобретению, могут экспрессироваться в тех же частях растения или могут экспрессироваться дифференциально в силу того, что экспрессия каждого контролируется с помощью отличного тканеспецифического промотора.

В одном варианте осуществления экзогенный полинуклеотид или гетерологичный ген, придающий дополнительный желаемый признак, кодирует другую интерферирующую РНК, воздействующую на тот же самый или другой вид насекомого-вредителя. В дополнительном варианте осуществления гетерологичный ген кодирует белок, вредный или токсичный для вида насекомого-вредителя растения, например, инсектицидный белок, выбранный из группы, включающей, но без ограничений, инсектицидные белки Bacillus thuringiensis, инсектицидные белки Xenorhabdus, инсектицидные белки Photorhabdus, инсектицидные белки Bacillus laterosporous, инсектицидные белки Bacillus sphaericus иинсектицидные белки VIP, такие как белок, выбранный из группы, включающей, но без ограничений Cry1Ab, Cry1C, Cry2Aa, Cry3, CryET70, Cry22, CryET33, CryET34, CryET80, CryET76, TIC100, TIC101, TIC851, TIC900, TIC901, TIC1201, TIC407, TIC417 и инсектицидные белки PS149B1. В еще одном дополнительном варианте осуществления гетерологичный ген кодирует белок, придающий устойчивость или толерантность к гербицидам. Примеры генов, придающих устойчивость или толерантность к гербицидам включают Bar, EPSPS, который придает устойчивость к глифосату, ALS, который придает устойчивость к имидазолинону и сульфонилмочевине, и bxn, который придает устойчивость к бромоксинилу.

Также в данном документе предусматривается способ получения гибридных семян от любого из трансгенных растений, полученных с помощью способов по настоящему изобретению, при этом указанный способ включает этапы: (i) посадки семян, полученных от первого инбредного растения, и семян, полученных от второго инбредного растения, где по меньшей мере, одно из инбредных растений является трансгенным растением, устойчивым к нападению вредителя, (ii) выращивания семян в растения, которые имеют цветы, (iii) предотвращения самоопыления по меньшей мере одного из первого или второго взрослых растений, (iv) предоставления возможности перекрестного опыления между первым и вторым растениями; и (v) сбор семян, полученных в результате перекрестного опыления. Гибридное семя, полученное данным способом, и гибридные растения, полученные путем культивирования указанных семян, находятся в пределах объема настоящего изобретения. Гибридные растения, полученные данным способом, как правило, являются генетически однородными, и вероятно продемонстрируют гетерозис или гибридную силу. Таким образом, сельскохозяйственные культуры с потенциалом к повышению урожайности можно получить с помощью такого способа.

В группу трансгенных растений по настоящему изобретению включены трансгенные растения, полученные с помощью любого из способов, описываемых в данном документе. Таким образом, в одном варианте осуществления настоящего изобретения трансгенные растения включают многоуровневые трансгенные признаки, несущие первый экзогенный полинуклеотид, придающий устойчивость к вредителям, и по меньшей мере один дополнительный экзогенный полинуклеотид или гетерологичный ген, придающий дополнительный желаемый признак растения. Дополнительные гетерологичные гены могут содержать гены, кодирующие дополнительные пестицидные средства, гены, кодирующие белки, токсичные или вредные для видов насекомых-вредителей, и/или гены, кодирующие белки, придающие устойчивость к гербицидам, как описано в других местах в данном документе.

Предпочтительные трансгенные растения в соответствии с настоящим изобретением, включают, но без ограничений, хлопок, картофель, рис, помидор, канолу, сою, подсолнечник, сорго, просо, кукурузу, люцерну, землянику, баклажан, перец и табак.

Также в данном документе предусматривается применение интерферирующей рибонуклеиновой кислоты (РНК), описываемой в данном документе, или ДНК-конструкции, описываемой в данном документе, для предотвращения и/или борьбы с нападением насекомых-вредителей, предпочтительно нападением насекомых-вредителей на растения.

Настоящее изобретение будет дополнительно понятно со ссылкой на следующие неограничивающие примеры.

Примеры

Пример 1: Идентификация генов-мишеней у видов насекомых вредителей

1.1. Lygus hesperus нормализованная библиотека cDNA и получение dsRNA в многолуночных планшетах для скрининговых исследований

Нуклеиновые кислоты выделили из нимф Lygus hesperus различных стадий жизни, включая только что вылупившихся нимф 2, 4, 6 и 9 дневных нимф и взрослых. Библиотеку cDNA получали с использованием ПЦР-набора для синтеза cDNA SMARTer™, следуя инструкциям производителя (Clontech Cat. No 634925). Библиотеку cDNA нормализовали с использованием набора Trimmer (Evrogen Cat No NK001) и клонировали в PCR4-TOPO вектор (Invitrogen). Нормализация введенных в клоны M2 адаптеров (Trimmer Kit, Evrogen, SEQ ID NO: 92: AAGCAGTGGTATCAACGCAG), противоположно ориентированных на каждом конце клонов. Рекомбинантные конструкции векторов трансформировали в клетки Escherichia coli штамма TOP10 (Invitrogen). Трансформированные клетки затем разбавляли и высевали с целью получения отдельных колоний или клонов. Клоны проверяли для подтверждения того, что избыточность клонов для библиотеки не превышает 5%. Отдельные клоны отбирали в жидкую LB (бульон Лурия) среду, в 96-луночные планшеты с глубокими лунками, и выращивали в течение ночи при 37°C. Планшеты также включали положительные (Lh423) и отрицательные (FP) контрольные клоны.

Для создания dsRNA, смысловой и антисмысловой фрагменты ДНК, содержащие последовательность промотора T7, создали с помощью ПЦР. Вкратце, на клон 1 мкл бактериальной суспензии помещали в многолуночные ПЦР-планшеты, содержащие REDTaq® (Sigma Cat No D4309) и праймеры oGCC2738 (SEQ ID NO: 93: AAGCAGTGGTATCAACGCAG) и oGCC2739 (SEQ ID NO: 94: GCGTAATACGACTCACTATAGGAAGCAGTGG TATCAACGCAG) на основе M2 и T7-M2 последовательностей, соответственно. За ПЦР-реакцией следовала in vitro транскрипция, где на клон 6 мкл продукта ПЦР добавляли к 9 мкл RiboMAX™ Large Scale RNA Production System-T7 (Promega Cat No P1300) и инкубировали в течение ночи при 37°C. Конечный раствор dsRNA разбавляли в 2 раза в L. hesperus сахарозной пище, содержащей 15% сахарозы и 5 мкг/мкл дрожжевой tRNA (Invitrogen Cat No 15401-029) и использовали для скрининга. dsRNA, соответствующей положительному Lh423 контрольному клону, является SEQ ID NO: 101, и отрицательному FP контрольному клону, является SEQ ID NO: 104 (см. таблицу 4).

1.2. Скрининг на новые и эффективные Lygus hesperus гены-мишени с использованием cDNA-библиотеки экспрессируемых dsRNA

Разработали новое скрининговое исследование на эффективные Lygus hesperus мишени. Постановка анализа являлась следующей: каждая лунка 96-луночного планшета содержит однодневную L. hesperus нимфу под действием саше из парафильма, содержащего сахарозную пищу, которая включает либо тестируемую dsRNA, либо контрольную dsRNA в присутствии tRNA. Каждый планшет содержал dsRNA из 90 различных клонов, 3×Lh423 (положительный контроль) и 3×FP (флуоресцентный белок; отрицательный контроль). Каждый клон (тестируемая dsRNA) реплицировали на трех планшетах. После трех дней воздействия зарегистрировали число выживших нимф и заменили пищу на свежую пищу (комплексной) для выращивания, не содержащую dsRNA. Смертность оценивали в дни 4, 6 и 8. Идентичную постановку использовали для подтверждающих анализов первого и второго цикла, с 8 и 20 насекомыми соответственно, с одной нимфой на лунку.

Систему анализа проверяли с использованием dsRNA, соответствующей Lh423 мишени, в качестве положительного контроля и dsRNA флуоресцентного белка в качестве отрицательного контроля: более 90% являлись истинно положительными и менее 5% являлись ложноположительными, соответственно.

Протестировали двадцать 96-луночных планшетов, поименованных Lh001-Lh020 (см. нижнюю линию на фигурах 1 и 2), содержащих 1800 отдельных клонов. 205 кандидатов идентифицировали и протестировали в первом подтверждающем анализе. Устанавливая пороговую величину на показателе ≥50% смертности, 41 отдельный клон идентифицировали и продвинули во второй цикл подтверждения. В анализе клоны сравнивали с положительными контролями Lh423 (RpL19) и Lh105.2 (Sec23) и отрицательным контролем Pt (кодирующим флуоресцентный белок коралла). dsRNA, соответствующей положительному (Lh423) контрольному клону, является SEQ ID NO: 101, соответствующей положительному Lh105.2 контрольному клону, является SEQ ID NO: 102 и отрицательному (Pt) контрольному клону является SEQ ID NO: 104 (см. таблицу 4).

Подтверждающие анализы второго цикла, тестирующие 20 насекомых/тестируемых dsRNA, начали для всех тестируемых dsRNA, показывающих ≥50% смертности в первом подтверждении (фигуры 1 и 2). Мишени-кандидаты, соответствующие подтвержденным тестируемым dsRNA, обозначили с помощью “Lhxxx число” (см. таблицу 1). Применяя то же пороговое значение при ≥50% смертности, 15 мишеней подтвердили в первом скрининге.

Выполнили второй скрининг для идентификации новых Lygus hesperus мишеней. Результаты подтверждающих анализов второго цикла представлены на фигуре 14. Применяя то же пороговое значение при ≥50% смертности, несколько мишеней подтвердили во втором скрининге (см. таблицу 1 C).

1.3. Идентификация Lygus мишеней

Одновременно с подтверждающими анализами на насекомых, вставки, соответствующие положительным клонам, секвенировали, и BlastX поиск по сравнению с базами данных белков Drosophila и Tribolium использовали для подтверждения идентичности мишеней. В таблице 1 приводится краткое изложение биоинформационного анализа и текущая аннотация новых идентифицированных L. hesperus целевых последовательностей.

Пятнадцать новых L. hesperus мишеней идентифицировали в первом скрининге и 11 новых L. Hesperus мишеней идентифицировали во втором скрининге. Все мишени проявляют высокую эффективность против нимф L. hesperus, указывая на то, что cDNA, кодирующие двухцепочечные РНК, содержащиеся в них, являются существенно важными для выживания вредителя, и таким образом представляют гены-мишени, представляющие интерес в целях борьбы с вредителями. Последовательности ДНК и предсказанные аминокислотные последовательности данных генов-мишеней, следовательно, определили и представили в таблицах 2 и 3, соответственно.

Lh594, Lygus hesperus ортолог Drosophila тропонина I, участвующего в сокращении мышц - и, следовательно, отсутствующего у растений, - представляет новый класс мишеней, относящихся к специфическому для животных физиологическому пути, еще не изученному на GM-RNAi. У плодовой мушки тропонин I описан как гаплонедостаточный ген, проявляющий мутантный фенотип в гетерозиготном состоянии. Такие гены могут являться особенно восприимчивыми к снижению уровней экспрессии mRNA и таким образом могут рассматриваться как идеальные мишени для RNAi.

В данном Lh594 пути, отобрали восемь мишеней (см. таблицу 1B). Для каждой мишени до 4 пар вырожденных ПЦР праймеров сконструировали на основе выравнивания последовательностей различных насекомых, включая пчелу, Tribolium и тлю. Данные праймеры применяют для амплификации фрагментов из Lygus hesperus мишеней. Последовательности ДНК и предсказанные аминокислотные последовательности данных генов-мишеней определили и представили в таблицах 2 и 3, соответственно.

Таблица 1
Lygus hesperus новые мишени, ранжированные по % смертности в соответстви с результатами второго подтверждающего анализа (первый скрининг)
ID мишени Позиция во 2-м
подтверждении
Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕ-НИЕ
Lh594 1 CG7178 wings up A (тропонин I) WupA
Lh618 2 CG2168 рибосомный белок S3A RpS3A

Lh609 3 CG4087 рибосомный белок LP1 RpLP1
Lh595 4 - не обнаружено попаданий для Drosophila, Lygus специфическая мишень/последовательность
Lh611 5 CG6779 рибосомный белок S3 RpS3
Lh560 6 CG10423 рибосомный белок S27 RpS27
Lh596 7 - не обнаружено попаданий для Drosophila, Lygus специфическая мишень/последовательность RpL34b
Lh615 8 CG11522 рибосомный белок L6 RpL6
Lh617 9 CG7283 рибосомный белок L10Ab RpL10Ab
Lh612 10 CG13389 рибосомный белок S13 RpS13
Lh246 11 CG3195 рибосомный белок L12 RpL12
Lh429 12 CG8900 рибосомный белок S18 RpS18
Lh610 13 CG5502 рибосомный белок L4 RpL4
Lh597 14 не обнаружено попаданий
Lh598 15 CG34069 субъединица II митохондриальной цитохром с-оксидазы mt:CoII
Lh614 - CG7610 γ-цепь ATP синтазы ATPsyn-γ

Таблица 1B
Lygus hesperus новые мишени в Lh594 пути
ID мишени Лучшее попадание (попадания) НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Lh619 CG7107 тропонин T (upheld) up
Lh620 CG17927 тяжелая цепь миозина Mhc
Lh621 CG4843 Тропомиозин2 (Tm2) Tm2
Lh622 CG3201 цитоплазматическая легкая цепь миозина Mlc-c
Lh623 CG3595 spaghetti squash sqh
Lh624 CG15792 zipper zip
Lh625 *CG2981,CG7930,CG9073,
CG6514,CG12408
тропонин C

Lh626 *CG9073,CG7930,CG2981,
CG12408,CG6514
тропонин C
*неясно: несколько попаданий в семействе ранжированы в соответствии с собственным значением (e-value)

Таблица 1C
Lygus hesperus новые мишени, ранжированные по % смертности в соответствии срезультатами второго подтверждающего анализа (второй скрининг)
ID мишени позиция
во 2-м подтверждении
Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Lh631 1 CG6846 Рибосомный белок L26 RpL26
Lh634.2 2 CG12775 Рибосомный белок L21 RpL21
Lh634.1 3 CG12775 Рибосомный белок L21 RpL21
Lh630 4 CG11271 Рибосомный белок S12 RpS12
Lh632 5 CG2998 Рибосомный белок S28b RpS28b
Lh618.2 6 CG2168 Рибосомный белок S3A RpS3A
Lh629 7 CG4651 Рибосомный белок L13 RpL13
Lh633.2 8 CG17521 Рибосомный белок L10 RpL10
Lh628 9 CG17489 Рибосомный белок L5 RpL5
Lh633 10 CG17521 Рибосомный белок L10 RpL10
Lh627 11 CG2033 Рибосомный белок S15Aa RpS15A

1.4. Клонирование полноразмерной cDNA с помощью RACE (быстрая амплификация концов cDNA)

Для клонирования полноразмерной cDNA, начиная от известного клона внутреннего фрагмента из самых эффективных мишеней, использовали набор 5'/3' RACE (Roche, Cat. No. 1 734 792; на основе Sambrook, J. & Russell, D.M). Следовали стандартному протоколу, описанному в руководстве по эксплуатации. Вкратце, для 5' RACE сконструировали антисмысловой праймер, специфический для целевой последовательности, на известной последовательности, и применяли для синтеза первой цепи cDNA, применяя Lygus РНК в качестве матрицы. К первой цепи cDNA добавили хвост и использовали в качестве якоря для синтеза второй цепи и амплификации неизвестной концевой части транскрипта. Для 3' RACE применяли якорный праймер олиго dT для синтеза первой цепи cDNA. Для 5' и 3' RACE применяли вложенные праймеры, специфические для целевой последовательности, во второй реакции ПЦР. Фрагменты ПЦР анализировали на агарозном геле, очищали, клонировали и секвенировали для подтверждения.

Последовательности полноразмерной cDNA, соответствующие мишеням, собрали в VectorNTi, полностью интегрированном пакете программного обеспечения для анализа последовательности, с целью анализа последовательности ДНК (Invitrogen).

Пример 2: In vitro получение двухцепочечных РНК для сайленсинг генов

2.1. Получение dsRNA, соответствующих частичным последовательностям Lygus hesperus генов-мишеней

Двухцепочечную РНК синтезировали в миллиграммовых количествах. Сначала, две отдельные матрицы 5' T7 РНК-полимеразного промотора (смысловая матрица и антисмысловая матрица) создали с помощью ПЦР. ПЦР разрабатывали и проводили таким образом, чтобы получить смысловой и антисмысловой матричные полинуклеотиды, каждый из которых обладает T7 промотором в различной ориентации по отношению к целевой последовательности, подлежащей транскрибированию.

Для каждого из генов-мишеней создали смысловую матрицу, применяя мишень-специфический T7 прямой праймер и мишень-специфический обратный праймер. Антисмысловые матрицы создали, применяя мишень-специфический прямой праймер и мишень-специфический T7 обратный праймер. Последовательности соответствующих праймеров для амплификации смысловой и антисмысловой матриц посредством ПЦР для каждого из генов-мишеней приведены в таблице 4. ПЦР-продукты анализировали с помощью электрофореза в агарозном геле и очистили. Полученные T7 смысловую и антисмысловую матрицы смешали и транскрибировали путем добавления T7 РНК-полимеразы. Одноцепочечным РНК, полученным путем транскрипции с матриц, предоставили возможность соединиться, обработали с помощью ДНКазы и РНКазы и очистили осаждением. Смысловая цепь образующейся в результате dsRNA, полученная от каждого из генов-мишеней, приведена в таблице 4.

2.2. Испытания анализа выживаемости для новых Lygus hesperus мишеней

Для создания возможности ранжирования в соответствии с эффективностью, in vitro dsRNA, соответствующие новым мишеням, синтезировали и применили к L. hesperus в 10-дневных биопробах анализа выживаемости. Вкратце, однодневных нимф L. hesperus поместили в 96-луночные планшеты с сахарозными пленками, содержащими 0,5 мкг/мкл dsRNA-мишени, с добавлением 5 мкг/мкл дрожжевой tRNA. Планшеты инкубировали в течение 3 дней в стандартных Lygus условиях выращивания. В дни 3, 6 и 8, пищевые пленки обновляли пленками, содержащими Lygus только пищу. Lh423 (RpL19) использовали в качестве положительного контроля, а GFP dsRNA и сахарозную пищу использованы в качестве отрицательного контроля.

Результаты анализа выживаемости подтвердили данные первого и второго подтверждающих анализов. Lh594 установили в качестве высокоэффективной мишени с активностью и скоростью поражения, более сильной, чем сильный контроль Lh423.

До сих пор Lygus скрининг на новые мишени идентифицировал новые мишени с активностями более высокими или находящимися в диапазоне положительного контроля Lh423, которые включают Lh429, Lh594, Lh609, Lh610, Lh611, Lh617 и Lh618. Смертность, вызванная данными мишенями, показана на фигурах 3 и 4.

Для обеспечения более точного ранжирования мишеней в соответствии с их активностью выполнили анализы концентрации в зависимости от дозы. Новые мишени тестировали в in vitro анализах при концентрации в диапазоне от 0,4 до 0,025 мкг/мкл. Согласно условию, 24-дневных нимф тестировали в постановке с 96-луночным планшетом, в сахарозной пище с добавлением dsRNA и носителя tRNA. Результаты представлены в виде % выживаемости в течение 10-дневного эксперимента (фигуры 7-11) и суммированы в таблице 5.

На основе анализа кривой концентрации мишени ранжировали путем сравнения с исходными контролями Lh423 и Lh105 (таблица 5).

Таблица 5
Ранжирование новых мишеней Lygus в соответствии с DRC и по сравнению с исходными мишенями Lh423 и Lh105
ID мишени Эффективность, выраженная как мкг/мкл dsRNA, необходимая для достижения 90% уничтожения в день 7
Lh594 0,025 (в день 6)
Lh618 0,05-0,1
Lh612 0,05
Lh615 0,05
Lh423 0,1
Lh595 0,1
Lh560 0,1
Lh610 0,1
Lh617 0,1
Lh105 0,2
Lh614 0,2 (в день 6)
Lh611 0,2
Lh596 0,3
Lh609 Не определено
Lh429 Не определено

Эффективность Lh594 дополнительно подтвердили. Эффект данной мишени отчетливо наблюдается по меньшей мере за один день до эффекта других мишеней и исходного положительного контроля Lh105 и Lh423. Так как Lh594 являлась высокоэффективной, LD50 не достигли в стандартном DRC эксперименте с концентрацией в диапазоне от 0,4 до 0,025 мкг/мкл dsRNA (фигура 8), Lh594 эксперимент, следовательно, повторили, включая более низкие концентрации в диапазоне от 0,05 до 0,001 мкг/мкл dsRNA (фигура 12). В заключение, активность Lh594 наблюдали при такой низкой концентрации, как 0,0025 мкг/мкл, и примерно 90% уничтожение (что соответствует примерно 10% выживаемости) получили в день 6 при 0,025 мкг dsRNA.

Для дополнительного изучения эффективности Lh594 и роли tRNA носителя в ответе на RNAi у Lygus hesperus, дополнительные in vitro анализы питания подготовили в отсутствие носителя tRNA. Lh594, Lh423 (исходный контроль) и GFP (отрицательный контроль) dsRNA получили in vitro, применяя стандартный способ. dsRNA очистили и тестировали при 5 мкг/мкл в отсутствие tRNA (фигура 13 A).

В отсутствие tRNA, мишени Lh594 и Lh423 индуцировали высокую летальность у Lygus нимф. Результаты данного эксперимента были воспроизведены позднее. dsRNA-мишень обладала способностью индуцировать эффекты RNAi-путем-кормления у Lygus нимф в отсутствие tRNA.

Для исследования активности dsRNA при более низких концентрациях в отсутствие носителя tRNA, поставили дополнительные эксперименты, применяя уменьшение количеств dsRNA (фигура 13 B).

Аналогичный подход применялся для lygus мишеней, которые идентифицировали во втором скрининге. Для обеспечения ранжирования мишеней в соответствии с их активностью выполнили анализы концентрации в зависимости от дозы. Новые мишени тестировали в in vitro анализах при концентрациях в диапазоне от 0,5 до 0,05 мкг/мкл. Согласно условию, 24-дневных нимф тестировали в постановке с 96-луночным планшетом, в сахарозной пище с добавлением dsRNA и носителя tRNA. Результаты представлены в виде % выживаемости в течение 9-дневного эксперимента. Lh594 и Lh423 включили в анализ в качестве эталонных мишеней. Результаты суммированы в таблице 6. На основе анализов кривой концентрации мишени ранжировали путем сравнения с исходным контролем Lh423.

Таблица 6
Lygus новые мишени из второго скрининга - ранжирование в соответствии с DRC и по сравнению с исходными мишенями Lh423 и Lh594
ID мишени Эффективность, выраженная как мкг/мкл dsRNA, необходимая для достижения 90% уничтожения в день 7
Lh594 0,025 (в день 6)
Lh634 0,1
Lh423 0,1
Lh631 0,4
Lh633 0,4
Lh627 0,5
Lh628 0,5
Lh630 0,5
Lh632 0,5
Lh629 Не определено

Пример 3: Скрининг пути тропонина

Для создания возможности тестирования мишеней пути тропонина, in vitro полученные dsRNA, соответствующие Lh619, Lh620, Lh621, Lh622, Lh622, Lh623, Lh624, Lh625 и Lh626, синтезировали и применили к L. hesperus в 10-дневных биопробах анализа выживаемости. Вкратце, однодневных нимф L. hesperus поместили в 96-луночные планшеты с сахарозными пленками, содержащими 0,5 мкг/мкл dsRNA-мишени, с добавлением 5 мкг/мкл дрожжевой tRNA. Планшеты инкубировали в течение 3 дней в стандартных Lygus условиях выращивания. В дни 3, 6 и 8 пищевые пленки обновляли пленками, содержащими Lygus только пищу. Lh594 (тропонин I) использовали в качестве положительного контроля и GFP dsRNA и сахарозную пищу использовали в качестве отрицательных контролей 1. Четыре мишени затем включили в анализы кривой дозовой зависимости в in vitro анализе, с концентрациями в диапазоне от 0,4 до 0,025 мкг/мкл. Согласно условию, 24-дневных нимф тестировали в постановке с 96-луночным планшетом, в сахарозной пище с добавлением dsRNA и носителя tRNA. Результаты представлены в виде % выживаемости в течение 10-дневного эксперимента.

Пример 4: Создание растений, устойчивых к видам насекомых-вредителей

4.1. Сборка растительных экспрессирующих векторов, содержащих Lygus hesperus шпилечную последовательность для трансформации картофеля или хлопка

Поскольку механизм РНК-интерференции работает посредством фрагментов dsRNA, целевые полинуклеотидные последовательности клонировали в антисмысловой и смысловой ориентации, разделенной спейсером (SEQ ID NO: 98:

с формированием шпилечной конструкции dsRNA. Шпилечные конструкции dsRNA, кодирующие молекулы L. hesperus dsRNA, полученные из генов-мишеней, которые упоминаются в данном документе, субклонировали в растительный экспрессирующий вектор. Аналогично GUS dsRNA контрольную шпилечную конструкцию, где смысловую полинуклеотидную последовательность, кодирующую GUS (SEQ ID NO: 97:

клонировали в антисмысловой и смысловой ориентации, разделенной тем же интроном (SEQ ID NO: 98 или SEQ ID NO: 385), субклонировали в растительный экспрессирующий вектор.

Растительный экспрессирующий вектор содержит также элементы, необходимые для поддержания плазмиды в бактериальной клетке. Шпилечная конструкция dsRNA расположена между левой границей (LB) и правой границей (RB), 3' по ходу транскрипции от 35S промотора вируса мозаики цветной капусты (P35S) и 5' против хода транскрипции от TNOS терминатора. GFP репортерную экспрессионную кассету, содержащую GFP последовательность в окружении P35S промотора и терминатора, субклонировали в растительный вектор трансформации, несущий L. hesperus шпилечную кассету. NPT II экспрессионную кассету, содержащую NPT II последовательность в окружении P35S промотора и терминатора, использовали для отбора растений, которые эффективно трансформировали. Правильность сборки генетических фрагментов в растительном векторе экспрессии подтвердили путем секвенирования (фигура 5).

Растительные векторы экспрессии, содержащие отдельные L. hesperus шпильки-мишени впоследствии трансформировали в Agrobacterium tumefaciens. Для всех L. hesperus генов-мишеней, упомянутых в данном документе, фрагменты можно отобрать и клонировать в виде шпилек аналогичным образом.

4.2. Трансформация картофеля с помощью растительного вектора экспрессии, содержащего Lygus hesperus шпилечную последовательность, и тестирование трансформированных растений картофеля на устойчивость к L. hesperus

Пример, приведенный ниже, является иллюстрацией к выводу, что трансгенные растения картофеля, экспрессирующие шпилечные РНК, специфические для гена-мишени, неблагоприятно влияют на выживаемость и/или развитие видов насекомых-вредителей.

Lygus hesperus RNAi- путем кормления in planta

После положительных результатов, полученных в dsRNA экспериментах с питанием у L. hesperus, провели контрольно-проверочные эксперименты in planta.

Анализ in planta разработали с in vitro проростками картофеля, которые могут поддерживать выживание насекомых по меньшей мере 8 дней, сохраняя исходную смертность низкой. L. hesperus нимфы выживают и питаются проростками картофеля дикого типа. Это подтверждается видимым повреждением, вызванным насекомыми, которое можно наблюдать на листьях и почках (фигура 6).

В анализе, L. hesperus кормят трансгенным картофелем, экспрессирующим шпилечную dsRNA, воздействующую на L. hesperus мишени, идентифицированные в данном документе. Создали плазмиды, несущие шпилечные конструкции и GUS контроль.

Проростки анализировали с помощью ПЦР для подтверждения интеграции T-DNA и наличия шпильки перед размножением. Получили избыточные экспланты с целью получения по меньшей мере 30 независимых событий для каждой конструкции.

Трансформации картофеля

Стабильно трансформированные растения картофеля получили, применяя адаптированные протоколы, полученные Julie Gilbert в NSF Potato Genome Project (http://www.potatogenome.org/nsf5). Экспланты стеблевых междоузлий картофеля 'Line V' (первоначально полученные из лаборатории селекции растений Laboratory of Plant Breeding при PRI Вагенинген, Нидерланды), который получен от восприимчивого диплоидного Solanum tuberosum 6487-9, использовали в качестве исходного материала для трансформации. В in vitro-полученные экспланты инокулировали Agrobacterium tumefaciens C58C1RifR, содержащими шпилечные конструкции. После трех дней совместного культивирования экспланты поместили на селективную среду, содержащую 100 мг/л канамицина и 300 мг/л тиментина. Через 6 недель после трансформации первые предполагаемые побеги удалили и укоренили на селективной среде. Побеги, происходящие из различных эксплантов, рассматривались как независимые события, побеги происходящие из одного и того же каллуса, называют 'сиблинги' до тех пор, пока их клональный статус можно проверить с помощью саузерн-блоттинга, и узловые черенки побегов называют 'клоны '.

Трансгенный статус укореняющихся побегов проверяли либо с помощью GFP флуоресценции, либо с помощью плюс/минус ПЦР для вставленной целевой последовательности. Положительные побеги затем клонально размножали в культуре ткани для того, чтобы обеспечить достаточно копий, доступных для Lygus hesperus анализов. Данные побеги либо содержали в среде тканевой культуры, либо переносили в почву, предоставляя возможность большей гибкости для тестирования на устойчивость к L. hesperus нимфам/имаго. Первые растения являлись доступными для тестирования через четырнадцать недель после трансформации.

Биопроба

Молодые трансгенные растения картофеля, либо содержали в среде тканевой культуры, либо выращивали в почве в помещении камеры для выращивания растений со следующими условиями: 25±1ºC, 50±5% относительной влажности, 16:8 часов светлый:темный фотопериод. В конструкции ряд событий (например, двадцать) создавали с помощью подходящего количества клонов (например, десять) на событие. Ряд молодых Lygus нимф/имаго помещали на содержащиеся в отдельных клетках молодые (например, на стадии 4-5 развернутых листьев) растения картофеля и оставляли по меньшей мере на семь дней перед оценкой устойчивости к Lygus hesperus с точки зрения снижения выживаемости нимф/личинок/имаго, задержки развития и остановки роста, и/или уменьшения повреждения растений при питании.

Применимость in planta RNAi для защиты сельскохозяйственных культур от Lygus тестировали в анализе с использованием трансгенного картофеля, экспрессирующего шпильки, соответствующие Lygus генам-мишеням. В таблице 7 суммированы количества полученного и протестированного трансгенного картофеля. Трансгенные события создавали с помощью шпилек, соответствующих Lygus мишеням Lh423 (шпилечная последовательность для Lh423 представлена в SEQ ID NO: 402; смысловая последовательность Lh423-мишени представлена в SEQ ID NO: 101) и Lh594 (шпилечная последовательность для Lh594 представлена в SEQ ID NO: 401; смысловая последовательность Lh594-мишени представлена в SEQ ID NO: 2), и GUS в качестве контроля (шпилечная последовательность для GUS представлена в SEQ ID NO: 403; смысловая последовательность GUS представлена в SEQ ID NO: 97). В данном анализе SEQ ID NO: 385 использовали в качестве интрона.

Таблица 7
Ген Конструкт Количество событий Количество проростков Линия трансформации
GUS pGCC121 46 20×2 P001
Lh423 pGCC133 28 20×30 P006
Lh594 pGCC135 25 20×30 P007
Дикий тип - 20

Проростки размножали сначала в ящиках, затем в отдельных вегетационных сосудах, содержащих MS среду для укоренения (4,4 г/л MS солей и витаминов, 30 г/л сахарозы, 10 г/л Gelrite, pH 5,7), при подготовке Lygus анализов с питанием. Два независимых GUS события отобрали из 8 независимых событий, протестированных в 2 независимых экспериментах. В анализе 20-30 трансгенных растений одного и того же события, каждое посаженное в отдельный вегетационный сосуд, тестировали и сравнивали с WT проростками. Для трансгенных линий, несущих Lh423 и Lh594 шпильки, 28 и 25 независимых событий протестировали соответственно, и для каждого независимого трансгенного события протестировали 20-30 проростков, каждый из которых был посажен в отдельный вегетационный сосуд (фигура 6).

Как и ожидалось, в первичных трансформантах диапазон активности наблюдали для 28 независимых Lh423 трансгенных событий; 6 независимых P006 событий индуцировали свыше 60% летальности в день 9, и в одном событии летальность достигла 80% в день 9.

Как и ожидалось в первичных трансформантах, и как наблюдалось для Lh423 первичных трансформантов, диапазон активности также наблюдали для 25 независимых Lh594 трансгенных событий; 6 независимых P007 событий индуцировали свыше 60% летальности в день 9, и в одном событии летальность достигла 80% в день 9. В дополнение, задержку роста и остановку роста отчетливо наблюдали у выживших насекомых.

Результаты qRT-ПЦР питавшегося растениями Lygus

Для подтверждения того, что наблюдаемое снижение выживаемости Lygus, питавшегося трансгенными проростками картофеля, экспрессирующими шпильки, направленные против эндогенных генов, являлось истинным ответом на RNAi, измеряли уровень подавления mRNA-мишени (Lh423) с помощью количественной ПЦР в реальном времени (qRT-ПЦР). Насекомым предоставили возможность питаться 3-мя событиями, несущими Lh423 шпильку (P006/59, /22 и /29), и одним событием, несущим контрольную GUS шпильку (P001/28), в качестве контроля. Насекомых собирали через 5 дней и немедленно замораживали в жидком азоте. Суммарную РНК экстрагировали из 5 пулов 5 насекомых, применяя реагент TRI и в соответствии с инструкциями производителя (SIGMA). После обработки ДНКазой I (Promega) для удаления геномной ДНК с последующей экстракцией фенолом и хлороформом и осаждением этанолом, осажденные РНК растворяли в воде. Для каждого образца 1 мкг РНК подвергали обратной транскрипции с помощью смеси случайных гексамеров и якорных олиго dT праймеров. qRT-ПЦР ПЦР проводили на BioRad I-циклере, применяя iQ SYBR Green Supermix (Biorad), и с использованием рекомендованных производителем условий. qRT-ПЦР праймеры (таблица 8) разработали, применяя BeaconDesign; во избежание ПЦР-артефактов, предполагаемых в наличии экспрессируемой растением dsRNA, поглощаемой насекомыми, последовательности праймеров расположили на 3' dsRNA последовательности. GeNorm алгоритм использовали для нормализации уровня mRNA-мишени, применяя 2 конститутивных гена, Lh425 (SDHAand) и Lh427 (rpl 11).

В GUS трансгенном контроле не наблюдали подавления Lh423 эндогенной mRNA-мишени насекомого. Но результаты ясно показали подавление эндогенной Lygus Lh423 mRNA, соответствующей dsRNA, поглощаемой животными, питающимися 3-мя различными событиями Lh423 трансгенных растений.

4.3. Трансформация хлопка с помощью растительного вектора экспрессии, содержащего Lygus hesperus шпилечную последовательность, и тестирование трансформированного каллусного материала или растений хлопка на устойчивость к L. hesperus

Пример, приведенный ниже, является иллюстрацией к выводу, что трансгенные растения или каллус хлопка, экспрессирующие шпилечные РНК, специфические для генов-мишеней, неблагоприятно влияют на выживаемость и/или развитие видов насекомых-вредителей.

Трансформация хлопка

Поверхность семени Coker 312 стерилизовали с применением сначала промывания в течение 5 минут в 70% этаноле, а затем встряхивания в 20% отбеливающего (Clorox Co. США, 1% активного хлора) раствора плюс 10 капель неионного детергента, Tween® 20, на литр. Семя затем промывали 3 раза в стерильной дистиллированной воде, затем досуха промакивали стерильной фильтровальной бумагой. Стерильное семя проращивают на среде для прорастания (SG) в течение 4-6 дней, и в этот момент гипокотили собирают и нарезают по 0,5 см длиной, подготавливая для инокулирования Agrobacterium. Срезы помещают на стерильную фильтровальную бумагу, покрывая средой на основе среды Мурасиге-Скуга (Murashige and Skoog), не содержащей фитогормоны. Эксплантаты инкубировали при 16:8 часовом цикле дня:ночи при 28oC ±2°C в течение 3 дней перед инокулированием.

Для инокуляции, Agrobacterium tumefaciens культуру (10 мл) в жидкой LB среде, штамм GV3101 (pMP90) GentR или штамм LBA4404, содержащие предпочтительную шпильку РНК-мишени и растительную селекционную кассету, кодирующую устойчивость к гигромицину, выращивают в течение ночи, и 5 мл применяют для инокуляции 100 мл культуры вечером накануне инокуляции. Культуру центрифугируют, ресуспендируют и разбавляют до OD 600 в 0,15 в бактериальной среде для разбавления.

В сегменты гипокотилей инокулируют Agrobacterium суспензию в течение 5 минут. После этого эксплантаты промокали стерильной фильтровальной бумагой для удаления избытка бактериальной суспензии. Эксплантаты инкубировали в темноте на среде для совместного культивирования хлопка (CCM) в течение 48 часов. Эксплантаты затем помещают на селективную среду для индукции каллусов (SCIM), содержащую 10 мг/л гигромицина и 500 мг/л цефотаксима и включающую фитогормоны 2,4-дихлорфеноксиуксусную кислоту (0,1 мкг/мл) и кинетин (0,1 мкг/мл). Через 4-6 недель наблюдают первые устойчивые каллусы, и их можно переместить на свежую SCIM и дополнительно амплифицировать для молекулярной оценки и биопробы на насекомых. Планшеты обновляются каждые 4-6 недель для поддержания выбора питательных веществ и антибиотиков.

Каллусы, которые, как показано, дают положительный результат в биопробе с питанием насекомых, выбирают для регенерации, и каллус переносят на неселективную среду для созревания соматических зародышей, рецептура основана на публикации Trolinder и Goodin, 1986 г. Как только эмбрионы достигают 4 мм в длину и обладают дифференцированными семядолями и корешками (через 2-3 месяца после переноса на среду для созревания), их можно переносить на среду для роста корней в длину. Она включает стерилизованный вермикулит в больших пробирках, пропитанный жидкой средой на основе среды Стюарта и Хсу (Stewart & Hsu) (1977) с добавлением кинетина, гиберелловой кислоты, при этом и то, и другое добавляют в конечной концентрации 0,1 мг/л. Эмбрионы инкубируют при 28°C при 16:8 цикле дня/ночи, и как только они достигают стадии 2-3 листьев, проростки можно закаливать в вегетационных сосудах вермикулита, заключенных в пропагаторе для поддержания влажности. Как только растения полностью закалены (стадия 4-6 истинных листочков), их можно высаживать в 50:50 смесь торфа:суглинка и выращивать при 14:10 световом цикле при 30/20°C день/ночь.

Биопроба

L. hesperus нимф помещают в чашку Петри, содержащую недифференцированную каллусную ткань хлопка, экспрессирующую шпилечную РНК-мишень. В конструкции ряд трансформированных каллусов хлопка получают и тестируют в биопробе с питанием на снижение выживаемости нимф/имаго и/или задержку развития и остановку роста. Трансгенные каллусы, не экспрессирующие L. hesperus фрагмент гена шпилечной РНК-мишени, служат в качестве отрицательного контроля. Кроме того, молодые регенерированные растения хлопка из трансгенных каллусов выращивают в почве в помещении камеры для выращивания растений со следующими условиями: 30/20ºC день/ночь, 50±5% относительной влажности, 14:10 часов светлого:темного фотопериода. В конструкции создают ряд событий (например, двадцать). Ряд молодых L. hesperus нимф/имаго помещают на содержащиеся в отдельных клетках молодые (например, на стадии 4-5 развернутых листков) растения и оставляют по меньшей мере на семь дней перед оценкой устойчивости к L. hesperus с точки зрения снижения выживаемости нимф/имаго, задержки развития и остановки роста, и/или уменьшения повреждения растений при питании. Растения хлопка, не трансформированные L. hesperus фрагментом гена шпилечной РНК-мишени, служат в качестве отрицательного контроля.

Пример 5: Идентификация генов-мишеней у Leptinotarsa decemlineata

5.1. Leptinotarsa decemlineata нормализованная cDNA библиотека и получение dsRNA в многолуночных планшетах для скрининговых исследований

Нуклеиновые кислоты выделили из Leptinotarsa decemlineata личинок различных стадий. Библиотеку cDNA получали, с использованием ПЦР-набора для синтеза cDNA SMARTer™, следуя инструкциям производителя (Clontech Cat. No 634925). Библиотеку cDNA нормализовали, применяя набор Trimmer (Evrogen Cat No NK001), и клонировали в PCR®-BLUNTII-TOPO® вектор (Invitrogen). Нормализация введенных в клоны M2 адаптеров (Trimmer Kit, Evrogen, SEQ ID NO: 92: AAGCAGTGGTATCAACGCAG), противоположно ориентированных на каждом конце клонов. Рекомбинантные конструкции векторов трансформировали в клетки Escherichia coli strain TOP10 (Invitrogen). Трансформированные клетки затем разбавляли и высевали с целью получения отдельных колоний или клонов. Клоны проверяли для подтверждения того, что избыточность клонов для библиотеки не превышает 5%. Отдельные клоны инокулировали в жидкую LB (бульон Лурия) среду, в 96-луночные планшеты, и выращивали в течение ночи при 37°C. Планшеты также включали положительный (Ld513) и отрицательный (FP) контрольные клоны.

Для создания dsRNA с помощью ПЦР создали смысловой и антисмысловой фрагменты ДНК, содержащие последовательность промотора T7. Вкратце, на клон 1 мкл бактериальной суспензии помещали в многолуночные ПЦР-планшеты, содержащие REDTaq® (Sigma Cat No D4309) и праймеры oGCC2738 (SEQ ID NO: 93: AAGCAGTGGTATCAACGCAG) и oGCC2739 (SEQ ID NO: 94: GCGTAATACGACTCACTATAGGAAGCAGTGGTATCAACGCAG) на основе последовательностей M2 и T7-M2, соответственно. За ПЦР реакцией следовала in vitro транскрипция, при этом на клон использовали 6 мкл ПЦР-продукта в 20 мкл реакционного объема, содержащего реагенты для транскрипции, обеспеченные набором RiboMAX™ Large Scale RNA Production System-T7 (Promega Cat No P1300), и инкубировали в течение ночи при 37°C. Конечный раствор dsRNA разбавляли стерильной водой Milli-Q и использовали для скрининга. dsRNA, соответствующей положительному Ld513 контрольному клону, является SEQ ID NO: 400 (см. таблицу 11), и отрицательному FP контрольному клону является SEQ ID NO: 104 (см. таблицу 4).

5.2. Скрининг на новые и эффективные Leptinotarsa decemlineata гены-мишени с использованием cDNA-библиотеки экспрессируемых dsRNA

Каждая лунка 48-луночного планшета содержала 0,5 мл искусственной пищи, предварительно обработанной с помощью наружного покрытия 25 мкл (или 1 мкг) тестируемой или контрольной dsRNA. Одну L2 личинку помещали в каждую лунку, и на клон тестировали 3 личинки. Количества выживших CPB оценивали в дни 4, 7 и 10.

Во второй биопробе личинок CPB кормили пищей, обработанной наружно наносимой тестируемой dsRNA, полученной из клонов, полученных из нормализованной библиотеки cDNA. Одну личинку помещали в лунку 48-луночного мультипланшета, содержащего 0,5 мл пищи, предварительно обработанной с помощью наружного покрытия 25 мкл 40 нг/мкл dsRNA раствора. Всего на обработку (клон) тестировали двадцать четыре личинки. Количество выживших насекомых оценивали в дни 4, 5, 6, 7, 8 и 11. Процент смертности личинок рассчитывали относительно дня 0 (начало исследования).

5.3. Идентификация мишеней у L. decemlineata жуков

Новые целевые последовательности из скрининга в 5.2. и целевые последовательности, соответствующие мишеням пути тропонина, ортологическим Lygus Lh594, Lh619 и Lh620 последовательностям, идентифицировали у L. decemlineata. Праймеры, которые обеспечили соответствующие фрагменты cDNA для Ld594, перечислены в таблице 19. Последовательности cDNA и предсказанные аминокислотные последовательности данных генов-мишеней определили и представили в таблицах 9 и 10, соответственно.

5.4. Получение dsRNA, соответствующих частичным последовательностям L. decemlineata генов-мишеней

dsRNA синтезировали, применяя праймеры, приведенные в таблице 11. Смысловая цепь полученной в результате dsRNA, полученная из генов-мишеней, приведена в таблице 11.

5.5. Испытания анализа выживаемости для новых L. decemlineata мишеней

Ранний личиночный анализ

Синтетические dsRNA получили для 3 мишеней, Ld594, Ld619 и Ld620, и тестировали в анализе с питанием на личинках CPB. 10-дневный анализ проводили в 48-луночных планшетах, на искусственной пище (на основе Gelman et al, J Ins Sc,1:7, 1-10: Artificial diets for rearing the Colorado Potato Beetle), с добавлением 1 мкг dsRNA/лунку с 12 личинками согласно условиям.

Наблюдали четкий эффект на развитие личинок. Второй анализ поставили для изучения эффекта данных dsRNA в течение окукливания и метаморфоза (см. анализ окукливания ниже).

Анализ окукливания

Анализ окукливания CPB поставили для изучения эффекта RNAi нокдауна Ld594, Ld619 и Ld620 в течение окукливания и метаморфоза. Личинок четвертой возрастной стадии кормили 1 мкг in vitro синтезированной dsRNA, распределенной на листовой дисках картофеля, и затем переносили в коробку с необработанными свежими листьями картофеля. Через четыре дня выживших насекомых помещали на вермикулит для обеспечения окукливания. Обработанные с помощью Lh594 насекомые были медленными, более мелкими и в основном не способными пройти окукливание. Вылупление куколки оценивали в конце эксперимента. Для необработанного контроля 24 личинки окуклились, и все вылупились в здоровых имаго. Для Ld620 наблюдали снижение численности личинок, прогрессирующих в окукливание. Для трех протестированных мишеней отсутствовали личинки, развившиеся в здоровые куколки, и ни одна не вылупилась в имаго. Мертвые насекомые, извлеченные из вермикулита, демонстрировали различную степень пороков развития.

Ld594, Ld619 и Ld620 вначале предстали в качестве несмертельных мишеней в анализе личинок CPB, хотя снижение жизнеспособности отчетливо наблюдалась у насекомых, обработанных dsRNA. С другой стороны, в анализе окукливания все 3 мишени индуцировали сильные эффекты и ингибировали вхождение в окукливание и/или метаморфоз.

Анализ имаго

Для оценки активности Ld594, Ld619 и Ld620 у имаго CPB поставили анализ листовых дисков. Листовые диски картофеля (1,7 см в диаметре) покрыли dsRNA или контролями и поместили в 3,5 см чашки Петри с одним взрослым жуком. На следующий день насекомым предоставили свежий обработанный листовой диск. На третий день имаго перенесли в коробку, содержащую достаточно свежих, необработанных листьев картофеля для поддержания выживания необработанных контролей. На обработку тестировали 6 имаго и подсчитывали количества выживших и умирающих насекомых с регулярными интервалами от дня 6 до дня 13. Насекомые считались умирающими, если они не могли перевернуться после укладывания на спину.

Несмотря на относительно высокий уровень фона в отрицательном контроле в данном конкретном анализе, наблюдали четкие эффекты на насекомых, которых подвергли воздействию Ld594 или Ld619 dsRNA.

Пример 6: Идентификация генов-мишеней у Nilaparvata lugens

6.1. Идентификация Nilaparvata lugens мишеней

Новые целевые последовательности, соответствующие мишеням пути тропонина и названные Nl594 (тропонин I), Nl619 (тропонин T) и Nl626 (тропонин C), идентифицировали у коричневого дельфацида, Nilaparvata lugens. Ортологические последовательности Lygus генов, названные Nl594 (тропонин I), Nl619 (тропонин T) и Nl625/626 (тропонин C), клонировали посредством ПЦР с вырожденными праймерами с использованием BPH cDNA в качестве матрицы. В дополнение, полноразмерную cDNA идентифицировали для Nl594, применяя RACE (см. способ выше). ПЦР-систему AmpliTaq Gold (Applied Biosystems) применяли, следуя инструкциям производителя и в стандартных условиях для реакции ПЦР с вырожденными праймерами, как правило, следующим образом: 1 цикл в 10 минут при 95°C, с последующими 40 циклами по 30 секунд при 95°C, 1 минуту при 50°C и 1 минуту при 72°C, с последующими 10 минутами при 72°C. Для увеличения степени успеха до 10 различных вырожденных праймеров, прямых и обратных, разработали на основе выравниваний ортологических последовательностей у других видов и использовали в различных комбинациях. Полученные ПЦР-фрагменты очищали из геля с помощью набора для экстракции геля (Qiagen Cat. No 28706) и клонировали в TOPO TA вектор (Invitrogen). Клоны секвенировали и консенсусные последовательности использовали в Blast поисках в отношении различных доступных баз данных последовательностей насекомых для подтверждения значимости вставки. Вырожденные праймеры, которые привели к успешной амплификации, перечислены в таблице 20.

Последовательности ДНК и предсказанные аминокислотные последовательности данных генов-мишеней и еще одного гена-мишени (Nl537) определили и представили в таблицах 12 и 13, соответственно.

6.2. Получение dsRNA, соответствующих частичным последовательностям Nilaparvata lugens генов-мишеней

dsRNA синтезировали с использованием праймеров, которые указаны в таблице 14. Смысловая цепь полученной в результате dsRNA, полученная из каждого из генов-мишеней, приведена в таблице 14.

6.3. Испытания анализа выживаемости для новых Nilaparvata lugens мишеней

dsRNA синтезировали и тестировали в предварительно оптимизированных анализах RNAi-путем-кормления у BPH, в присутствии цвиттерионного детергента, CHAPSO, при 0,1% конечной концентрации. dsRNA тестировали при 0,5 мкг/мкл конечной концентрации. Nl537, эффективную мишень в анализах BPH, использовали в качестве исходной мишени в данном анализе. Выживаемость насекомых оценивали на протяжении 9 дней.

Результаты биопробы показали, что у BPH Nl594, Nl619 и Nl626 также являлись эффективными мишенями RNAi у BPH.

Пример 7: Идентификация генов-мишеней у Acyrthosiphon pisum

7.1. Идентификация Acyrthosiphon pisum мишеней

Новые целевые последовательности идентифицировали у тлей и назвали Ap423, Ap537, Ap560 и Ap594, следуя той же номенклатуре: “Apxxx”, где “Ap” соответствует Acyrthosiphon pisum и “xxx” соответствует ID мишени. Праймеры разрабатывали на основе открытого источника предсказания генов в AphidBase (ref: http://www.aphidbase.com/).

Последовательности ДНК и предсказанные аминокислотные последовательности данных генов-мишеней определили и представили в таблицах 16 и 17, соответственно.

7.2. Получение dsRNA, соответствующих частичным последовательностям генов-мишеней тли

dsRNA синтезировали с использованием праймеров, которые указаны в таблице 18. Смысловая цепь полученной в результате dsRNA, полученная из каждого из генов-мишеней, приведена в таблице 18.

7.3. Испытания анализа выживаемости для новых мишеней у тлей

RNAi-путем-кормления тестировали у Acyrthosiphon pisum (гороховая тля) с 4 мишенями Ap594, Ap423, Ap560, Ap537. Последовательности амплифицировали с помощью ПЦР с использованием праймеров, разработанных на основе открытого источника информации о последовательностях (http://www.aphidbase.com), и cDNA, полученной из тлей. Синтетические dsRNA получали и тестировали в конечной концентрации 0,5 мкг/мкл в присутствии 5 мкг/мкл дрожжевой tRNA в сахарозной пище. Десять новорожденных нимф гороховой тли поместили в маленькую чашку Петри (32 мм). Пятьдесят мкл пищи (с tRNA и dsRNA) наносили пипеткой на верхнюю часть первого слоя парафильма. Второй слой парафильма покрывал пищу и создавал пакетик для кормления, где тли могли питаться. На каждую мишень подготовили пять повторов 10 новорожденных нимф. GFP dsRNA использовали в качестве отрицательного контроля. Пищу обновляли в дни 4 и 7 анализов и оценивали выживаемость.

Таблица 2
ID мишени cDNA последовательность (смысловая цепь) 5'→3'
Lh594 SEQ ID NO: 1
Lh609 SEQ ID NO: 3
Lh610 SEQ ID NO: 5
Lh610 (b) SEQ ID NO: 139
Lh611 SEQ ID NO: 7
Lh611 (b) SEQ ID NO: 140
Lh617 SEQ ID NO: 9
Lh618 SEQ ID NO: 11
Lh618 (b) SEQ ID NO: 141
Lh429 SEQ ID NO: 13
Lh423 SEQ ID NO: 95
Lh105.2 SEQ ID NO: 96
Lh560 SEQ ID NO: 15
Lh615 SEQ ID NO: 17
Lh612 SEQ ID NO: 19
Lh246 SEQ ID NO: 21
Lh597 SEQ ID NO: 23
Lh598 SEQ ID NO: 25
Lh619 SEQ ID NO: 121
Lh619 (b) SEQ ID NO: 142
Lh619 (c) SEQ ID NO: 143
Lh620 SEQ ID NO: 122
Lh620 (b) SEQ ID NO: 144
Lh620 (c) SEQ ID NO: 145
Lh621 SEQ ID NO: 123
Lh622 SEQ ID NO: 124
Lh623 SEQ ID NO: 125
Lh623 (b) SEQ ID NO: 146
Lh624 SEQ ID NO: 126

Lh624 (b) SEQ ID NO: 147
Lh625 SEQ ID NO: 127
Lh625 (b) SEQ ID NO: 148
Lh626 SEQ ID NO: 128
Lh626 (b) SEQ ID NO: 149
Lh614 SEQ ID NO: 129
Lh627 SEQ ID NO: 150
Lh628 SEQ ID NO: 152
Lh629 SEQ ID NO: 154
Lh630 SEQ ID NO: 156
Lh631 SEQ ID NO: 158
Lh632 SEQ ID NO: 160
Lh633.1 SEQ ID NO: 162
Lh633.2 SEQ ID NO: 163
Lh634.1 SEQ ID NO: 165
Lh634.2 SEQ ID NO: 167
Lh595.1 SEQ ID NO: 168
Lh595.2 SEQ ID NO: 170
Lh596 SEQ ID NO: 172

Таблица 3
ID мишени Соответствующая аминокислотная последовательность cDNA клона, представленного в таблице 2
Lh594 SEQ ID NO: 79
Lh609 SEQ ID NO: 80
Lh610 SEQ ID NO: 81
Lh610 (b) SEQ ID NO: 326
Lh611 SEQ ID NO: 82
Lh611 (b) SEQ ID NO: 327
Lh617 SEQ ID NO: 83
Lh618 SEQ ID NO: 84
Lh618 (b) SEQ ID NO: 328
Lh429 SEQ ID NO: 85
Lh429 (b) SEQ ID NO: 329

Lh423 SEQ ID NO: 99
Lh105.2 SEQ ID NO: 100
Lh560 SEQ ID NO: 86
Lh615 SEQ ID NO: 87
Lh612 SEQ ID NO: 88
Lh246 SEQ ID NO: 89
Lh597 SEQ ID NO: 90
Lh598 SEQ ID NO: 91
Lh619 SEQ ID NO: 330
Lh620 SEQ ID NO: 331
Lh621 SEQ ID NO: 332
Lh622 SEQ ID NO: 333
Lh623 SEQ ID NO: 334
Lh624 SEQ ID NO: 335
Lh625 SEQ ID NO: 336
Lh626 SEQ ID NO: 337
Lh614 SEQ ID NO: 338
Lh627 SEQ ID NO: 339
Lh628 SEQ ID NO: 340
Lh629 SEQ ID NO: 341
Lh630 SEQ ID NO: 342
Lh631 SEQ ID NO: 343
Lh632 SEQ ID NO: 344
Lh633.1 SEQ ID NO: 345
Lh633.2 SEQ ID NO: 346
Lh634.1 SEQ ID NO: 347
Lh634.2 SEQ ID NO: 348

Таблица 4
ID мишени Прямые праймеры
5'→3'
Обратные праймеры
5'→3'
dsRNA: смысловая цепь, представленная эквивалентной последовательностью ДНК 5'→3'
Lh594 SEQ ID NO: 27
SEQ ID NO: 29
SEQ ID NO: 28
SEQ ID NO: 30
SEQ ID NO: 2
Lh609 SEQ ID NO: 31
SEQ ID NO: 33
SEQ ID NO: 32
SEQ ID NO: 34
SEQ ID NO: 4
Lh610 SEQ ID NO: 35
SEQ ID NO: 37
SEQ ID NO: 36
SEQ ID NO: 38
SEQ ID NO: 6
Lh611 SEQ ID NO: 39
SEQ ID NO: 41
SEQ ID NO: 40
SEQ ID NO: 42
SEQ ID NO: 8
Lh617 SEQ ID NO: 43
SEQ ID NO: 45
SEQ ID NO: 44
SEQ ID NO: 46
SEQ ID NO: 10
Lh618 SEQ ID NO: 47
SEQ ID NO: 49
SEQ ID NO: 48
SEQ ID NO: 50
SEQ ID NO: 12
Lh429 SEQ ID NO: 51
SEQ ID NO: 53
SEQ ID NO: 52
SEQ ID NO: 54
SEQ ID NO: 14
Lh423 SEQ ID NO: 105
SEQ ID NO: 107
SEQ ID NO: 106
SEQ ID NO: 108
SEQ ID NO: 101
Lh105.2 SEQ ID NO: 109
SEQ ID NO: 111
SEQ ID NO: 110
SEQ ID NO: 112
SEQ ID NO: 102
GFP SEQ ID NO: 113
SEQ ID NO: 115
SEQ ID NO: 114
SEQ ID NO: 116
SEQ ID NO: 103
Pt SEQ ID NO: 117
SEQ ID NO: 119
SEQ ID NO: 118
SEQ ID NO: 120
SEQ ID NO: 104
Lh560 SEQ ID NO: 55
SEQ ID NO: 57
SEQ ID NO: 56
SEQ ID NO: 58
SEQ ID NO: 16
Lh615 SEQ ID NO: 59
SEQ ID NO: 61
SEQ ID NO: 60
SEQ ID NO: 62
SEQ ID NO: 18
Lh612 SEQ ID NO: 63
SEQ ID NO: 65
SEQ ID NO: 64
SEQ ID NO: 66
SEQ ID NO: 20

Lh246 SEQ ID NO: 67
SEQ ID NO: 69
SEQ ID NO: 68
SEQ ID NO: 70
SEQ ID NO: 22
Lh597 SEQ ID NO: 71
SEQ ID NO: 73
SEQ ID NO: 72
SEQ ID NO: 74
SEQ ID NO: 24
Lh598 SEQ ID NO: 75
SEQ ID NO: 77
SEQ ID NO: 76
SEQ ID NO: 78
SEQ ID NO: 26
Lh619 SEQ ID NO: 206
SEQ ID NO: 208
SEQ ID NO: 207
SEQ ID NO: 209
SEQ ID NO: 130
Lh620 SEQ ID NO: 210
SEQ ID NO: 212
SEQ ID NO: 211
SEQ ID NO: 213
SEQ ID NO: 131
Lh621 SEQ ID NO: 214
SEQ ID NO: 216
SEQ ID NO: 215
SEQ ID NO: 217
SEQ ID NO: 132
Lh622 SEQ ID NO: 218
SEQ ID NO: 220
SEQ ID NO: 219
SEQ ID NO: 221
SEQ ID NO: 133
Lh623 SEQ ID NO: 222
SEQ ID NO: 224
SEQ ID NO: 223
SEQ ID NO: 225
SEQ ID NO: 134
Lh624 SEQ ID NO: 226
SEQ ID NO: 228
SEQ ID NO: 227
SEQ ID NO: 229
SEQ ID NO: 135
Lh625 SEQ ID NO: 230
SEQ ID NO: 232
SEQ ID NO: 231
SEQ ID NO: 233
SEQ ID NO: 136
Lh626 SEQ ID NO: 234
SEQ ID NO: 236
SEQ ID NO: 235
SEQ ID NO: 237
SEQ ID NO: 137
Lh614 SEQ ID NO: 238
SEQ ID NO: 240
SEQ ID NO: 239
SEQ ID NO: 241
SEQ ID NO: 138
Lh627 SEQ ID NO: 242
SEQ ID NO: 244
SEQ ID NO: 243
SEQ ID NO: 245
SEQ ID NO: 151
Lh628 SEQ ID NO: 246
SEQ ID NO: 248
SEQ ID NO: 247
SEQ ID NO: 249
SEQ ID NO: 153
Lh629 SEQ ID NO: 250
SEQ ID NO: 25
SEQ ID NO: 251
SEQ ID NO: 253
SEQ ID NO: 155
Lh630 SEQ ID NO: 254
SEQ ID NO: 256
SEQ ID NO: 255
SEQ ID NO: 257
SEQ ID NO: 157
Lh631 SEQ ID NO: 258
SEQ ID NO: 260
SEQ ID NO: 259
SEQ ID NO: 261
SEQ ID NO: 159

Lh632 SEQ ID NO: 262 SEQ ID NO: 264 SEQ ID NO: 263
SEQ ID NO: 265
SEQ ID NO: 161
Lh633.2 SEQ ID NO: 266 SEQ ID NO: 268 SEQ ID NO: 267
SEQ ID NO: 269
SEQ ID NO: 164
Lh634.1 SEQ ID NO: 270
SEQ ID NO: 272
SEQ ID NO: 271
SEQ ID NO: 273
SEQ ID NO: 166
Lh595 SEQ ID NO: 274
SEQ ID NO: 276
SEQ ID NO: 275
SEQ ID NO: 277
SEQ ID NO: 169
Lh596 SEQ ID NO: 278
SEQ ID NO: 280
SEQ ID NO: 279
SEQ ID NO: 281
SEQ ID NO: 173

Таблица 8
ID мишени Прямые праймеры
5'→3'
Обратные праймеры 5'→3' qRT-ПЦР ампликон
5'→3'
Lh423 SEQ ID NO: 360 SEQ ID NO: 361 SEQ ID 362
Lh425 SEQ ID 363 SEQ ID 364 SEQ ID 365
Lh427 SEQ ID 366 SEQ ID 367 SEQ ID 368

Таблица 9
ID мишени Последовательность cDNA (смысловая цепь) 5'→3'
Ld594 SEQ ID NO: 174
Ld619 SEQ ID NO: 176
Ld620 SEQ ID NO: 178
Ld583 SEQ ID NO: 386
Ld584 SEQ ID NO: 387
Ld586 SEQ ID NO: 388
Ld588 SEQ ID NO: 389
Ld513 SEQ ID NO: 394

Таблица 10
ID мишени Соответствующая аминокислотная последовательность cDNA клона, представленного в таблице 9
Ld594 SEQ ID NO: 349
Ld619 SEQ ID NO: 350
Ld620 SEQ ID NO: 351
Ld583 SEQ ID NO: 390
Ld584 SEQ ID NO: 391
Ld586 SEQ ID NO: 392
Ld588 SEQ ID NO: 393
Ld513 SEQ ID NO: 395

Таблица 11
ID мишени Прямые праймеры
5'→3'
Обратные праймеры
5'→3'
dsRNA: смысловая цепь, представленная эквивалентной последовательностью ДНК
5'→3'
Ld594 SEQ ID NO: 282
SEQ ID NO: 284
SEQ ID NO: 283
SEQ ID NO: 285
SEQ ID NO: 175
Ld619 SEQ ID NO: 286
SEQ ID NO: 288
SEQ ID NO: 287
SEQ ID NO: 289
SEQ ID NO: 177
Ld620 SEQ ID NO: 290
SEQ ID NO: 292
SEQ ID NO: 291
SEQ ID NO: 293
SEQ ID NO: 179
Ld513 SEQ ID NO: 396
SEQ ID NO: 398
SEQ ID NO: 397
SEQ ID NO: 399
SEQ ID NO: 400

Таблица 12
ID мишени Последовательность cDNA (смысловая цепь) 5' → 3'
Nl594 SEQ ID NO: 180
Nl619 SEQ ID NO: 182
Nl626 SEQ ID NO: 184
Nl537 SEQ ID NO: 186

Таблица 13
ID мишени Соответствующая аминокислотная последовательность cDNA клона, представленного в таблице 12
Nl594 SEQ ID NO: 352
Nl619 SEQ ID NO: 353
Nl626 SEQ ID NO: 354
Nl537 SEQ ID NO: 355

Таблица 14
ID мишени Прямые праймеры 5'→3' Обратные праймеры 5'→3' dsRNA: смысловая цепь, представленная эквивалентной последовательностью ДНК 5'→3'
Nl594 SEQ ID NO: 294
SEQ ID NO: 296
SEQ ID NO: 295
SEQ ID NO: 297
SEQ ID NO: 181
Nl619 SEQ ID NO: 298
SEQ ID NO: 300
SEQ ID NO: 299
SEQ ID NO: 301
SEQ ID NO: 183
Nl626 SEQ ID NO: 302
SEQ ID NO: 304
SEQ ID NO: 303
SEQ ID NO: 305
SEQ ID NO: 185
Nl537 SEQ ID NO: 306
SEQ ID NO: 308
SEQ ID NO: 307
SEQ ID NO: 309
SEQ ID NO: 187

Таблица 15
Мишень Последовательность прямого праймера Последовательность обратного праймера
Ap594 SEQ ID NO: 369 SEQ ID NO: 370
Ap423 SEQ ID NO: 371 SEQ ID NO: 372
Ap537 SEQ ID NO: 373 SEQ ID NO: 374
Ap560 SEQ ID NO: 375 SEQ ID NO: 376

Таблица 16
ID мишени Последовательность cDNA (смысловая цепь) 5'→3'
Ap594 SEQ ID NO: 188
Ap423 SEQ ID NO: 200
Ap537 SEQ ID NO: 202
Ap560 SEQ ID NO: 204

Таблица 17
ID мишени Соответствующая аминокислотная последовательность cDNA клона, представленного в таблице 16
Ap594 SEQ ID NO: 356
Ap423 SEQ ID NO: 357
Ap537 SEQ ID NO: 358
Ap560 SEQ ID NO: 359

Таблица 18
ID мишени Прямые праймеры
5'→3'
Обратные праймеры
5'→3'
dsRNA: смысловая цепь, представленная эквивалентной последовательностью ДНК 5'→3'
Ap594 SEQ ID NO: 310
SEQ ID NO: 312
SEQ ID NO: 311
SEQ ID NO: 313
SEQ ID NO: 189
Ap423 SEQ ID NO: 314
SEQ ID NO: 316
SEQ ID NO: 315
SEQ ID NO: 317
SEQ ID NO: 201
Ap537 SEQ ID NO: 318
SEQ ID NO: 320
SEQ ID NO: 319
SEQ ID NO: 321
SEQ ID NO: 203
Ap560 SEQ ID NO: 322
SEQ ID NO: 324
SEQ ID NO: 323
SEQ ID NO: 325
SEQ ID NO: 205

Таблица 19
Мишень Прямой праймер Обратный праймер
Ld594 SEQ ID NO: 377 SEQ ID NO: 378

Таблица 20
Мишень Прямой праймер Обратный праймер
Nl594 SEQ ID NO: 379 SEQ ID NO: 380
Nl619 SEQ ID NO: 381 SEQ ID NO: 382
Nl626 SEQ ID NO: 383 SEQ ID NO: 384

Таблица 21
ID мишени Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Ld583 CG4759 Рибосомный белок L27 RpL27
Ld584 CG 17331 Протеасома, субъединица бета-типа
Ld586 CG13704 неизвестный
Ld588 CG4157 Rpn12

Таблица 22
ID мишени Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Nl594 CG7178 wings up A (тропонин I) wupA
Nl619 CG7107 тропонин T (upheld) up
Nl626 *CG9073, CG7930, CG2981, CG12408, CG6514, CG2981, CG7930, CG9073, CG6514, CG12408 тропонин C
Nl537 CG32744 Убиквитин -5E; способ модификации белка
* неясно: несколько попаданий в семействе

Таблица 23
ID мишени Лучшие попадания Drosophila НАЗВАНИЕ ОБОЗНАЧЕНИЕ
Ap594 CG7178 wings up A
(тропонин I)
wupA
Ap423 CG2746 рибосомный белок L19 RpL19
Ap537 CG32744 Убиквитин-5E; способ модификации белка
Ap560 CG10423 рибосомный белок S27 RpS27

Специалистам в данной области будет очевидно, что многочисленные изменения и/или модификации можно внести в вышеупомянутые анализы без отступления от сущности или объема данного анализа, который описан в общем. Специалисты в данной области обнаружат или смогут установить, применяя не более чем обычное экспериментирование, многие эквиваленты конкретных примеров, и такие эквиваленты охватываются настоящим изобретением. Настоящий пример, таким образом, следует рассматривать во всех отношениях как иллюстративный, а не ограничительный.

1. Трансгенное растение, устойчивое к заражению насекомыми-вредителями, которое экспрессирует или способно экспрессировать одну рибонуклеиновую кислоту (РНК) для подавления экспрессии гена-мишени у Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum, при этом РНК включает по меньшей мере один сайленсирующий элемент, где сайленсирующий элемент является областью двухцепочечной РНК, включающей соединенные комплементарные цепи, одна цепь из которых включает или состоит из последовательности по меньшей мере из 59 последовательных нуклеотидов, которая идентична любой из последовательностей SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189.

2. Трансгенное растение по п. 1, где указанный ген-мишень кодирует белок насекомого тропонин I.

3. Трансгенное семя для получения трансгенного растения, устойчивого к заражению насекомыми-вредителями, где указанное семя экспрессирует или способно экспрессировать одну рибонуклеиновую кислоту (РНК) для подавления экспрессии гена-мишени у Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum, где РНК содержит по меньшей мере один сайленсирующий элемент, где указанный сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности по меньшей мере из 59 последовательных нуклеотидов, которая идентична любой из последовательностей SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189.

4. Способ получения трансгенного растения, устойчивого к заражению Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum, включающий:

(а) трансформацию растительной клетки с помощью ДНК-конструкции, включающей полинуклеотидную последовательность, кодирующую рибонуклеиновую кислоту (РНК) для подавления экспрессии гена-мишени у указанного вида насекомого-вредителя, при этом РНК включает по меньшей мере один сайленсирующий элемент,

где сайленсирующий элемент является областью двухцепочечной РНК, включающей соединенные комплементарные цепи, одна цепь из которых включает или состоит из последовательности по меньшей мере из 59 последовательных нуклеотидов, которая идентична любой из последовательностей SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189;

(b) регенерацию растения из трансформированной растительной клетки и

(c) выращивание трансформированного растения в условиях, подходящих для экспрессии РНК из ДНК-конструкции, при этом указанное растение является устойчивым к указанному вредителю по сравнению с нетрансформированным растением.

5. Способ по п. 4, в котором трансгенное растение является таким, как определено в п. 1 или 2.

6. Способ по п. 4 или 5, где способ дополнительно включает этапы получения одного или нескольких потомков от трансформированного растения и тестирования потомства на устойчивость к насекомому-вредителю.

7. Способ идентификации трансгенного растения по п. 1 или 2, в котором потомство, устойчивое к насекомым, идентифицируют с помощью определения наличия полинуклеотидной последовательности, кодирующей рибонуклеиновую кислоту (РНК), при этом РНК функционирует для подавления экспрессии гена-мишени у Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum, где ген-мишень идентичен любой из последовательностей SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189.

8. Способ по любому из пп. 4-7, в котором растение, устойчивое к нападению насекомого-вредителя, выбрано из хлопка, картофеля, риса, канолы, подсолнечника, сорго, проса, кукурузы, земляники, сои, люцерны, помидора, баклажана, перца и табака.

9. Трансгенное растение, устойчивое к заражению Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum, полученное способом по любому из пп. 4-8, где указанное растение экспрессирует или способно экспрессировать одну рибонуклеиновую кислоту (РНК) для подавления экспрессии гена-мишени у указанного насекомого-вредителя, где РНК содержит по меньшей мере один сайленсирующий элемент, где указанный сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности по меньшей мере из 59 последовательных нуклеотидов, которая идентична любой из последовательностей SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189.

10. Трансгенное семя для получения растения по п. 9, где указанное семя экспрессирует или способно экспрессировать одну рибонуклеиновую кислоту (РНК) для подавления экспрессии гена-мишени у Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum, где РНК содержит по меньшей мере один сайленсирующий элемент, где указанный сайленсирующий элемент является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности по меньшей мере из 59 последовательных нуклеотидов, которая идентична любой из последовательностей SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189.

11. Способ профилактики или борьбы с Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum на поле с культурными растениями, где указанный способ включает экспрессию в указанных растениях эффективного количества рибонуклеиновой кислоты (РНК) для подавления экспрессии гена-мишени у указанного вида насекомого-вредителя, при этом РНК включает по меньшей мере один сайленсирующий элемент, где сайленсирующий элемент является областью двухцепочечной РНК, включающей соединенные комплементарные цепи, одна цепь из которых включает или состоит по меньшей мере из 59 последовательных нуклеотидов, которая идентична любой из последовательностей SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189.

12. ДНК-конструкция, включающая полинуклеотид для подавления экспрессии гена-мишени у Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum, где указанный полинуклеотид включает по меньшей мере 59 последовательных нуклеотидов нуклеотидной последовательности, представленной в любой из SEQ ID NO: 1, 174, 180, 188, 2, 175, 181, 189, где указанная ДНК-конструкция является экспрессирующей конструкцией, в которой полинуклеотидная последовательность функционально связана по меньшей мере с одной регуляторной последовательностью, экспрессирующей полинуклеотидную последовательность.

13. Клетка-хозяин для получения ДНК, которая включает ДНК-конструкцию по п. 12.

14. Клетка-хозяин по п. 13, где клетка-хозяин является прокариотической или эукариотической клеткой.

15. Клетка-хозяин по п. 13, где клетка-хозяин является бактериальной клеткой или растительной клеткой.



 

Похожие патенты:
Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК для инициации транскрипции гетерологической транскрибируемой молекулы ДНК, а также к генетической конструкции для инициации транскрипции гетерологической транскрибируемой молекулы ДНК, ее содержащей.
Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК для инициации транскрипции гетерологической транскрибируемой молекулы ДНК, а также к генетической конструкции для инициации транскрипции гетерологической транскрибируемой молекулы ДНК, ее содержащей.

Изобретение относится к области биохимии, в частности к конструкции рекомбинантной ДНК для супрессии экспрессии кодирующей белок последовательности. Также раскрыты трансгенное растение, содержащие указанную конструкцию, семя указанного трансгенного растения, часть указанного трансгенного растения.

Изобретение относится к области биохимии, в частности к способу получения трансгенной клетки растения. При этом способ включает трансформацию клетки растения донорной молекулой нуклеиновой кислоты, которая встраивается в геномный локус, выбранный из группы, состоящей из FAD2, FAD3 и IPK1, с использованием сайт-специфической нуклеазы.

Изобретение относится к области биохимии, в частности к способу получения трансгенной клетки растения. При этом способ включает трансформацию клетки растения донорной молекулой нуклеиновой кислоты, которая встраивается в геномный локус, выбранный из группы, состоящей из FAD2, FAD3 и IPK1, с использованием сайт-специфической нуклеазы.

Изобретение относится к области биохимии, в частности к выделенному полипептиду, обладающему фунгицидной активностью против грибковых патогенов Fusarium virguliforme, Fusarium oxysporum, Fusarium graminearum, Colletotrichum graminicola и Exserohilum turcicum и инсектицидной активностью против насекомого, выбранного из западного кукурузного жука, соевой совки и бобовой гусеницы, композиции, его содержащей, а также к выделенной молекуле нуклеиновой кислоты, его кодирующей.

Изобретение относится к области биохимии, в частности к выделенному полипептиду, обладающему фунгицидной активностью против грибковых патогенов Fusarium virguliforme, Fusarium oxysporum, Fusarium graminearum, Colletotrichum graminicola и Exserohilum turcicum и инсектицидной активностью против насекомого, выбранного из западного кукурузного жука, соевой совки и бобовой гусеницы, композиции, его содержащей, а также к выделенной молекуле нуклеиновой кислоты, его кодирующей.

Изобретение относится к области биохимии, в частности к способу интегрирования представляющей интерес последовательности нуклеиновой кислоты в ген FAD3 в клетке. Кроме того, раскрыта сайт-специфическая нуклеаза на основе цинковых пальцев для применения в модификации гена FAD3.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле полинуклеотида, предназначенной для снижения уровня гена фитохрома PHYA1. Также раскрыты шпилечный конструкт нуклеиновой кислоты, рекомбинантный бинарный вектор, клетка-хозяин, включающая указанный конструкт, трансгенный хлопчатник, трансгенная клетка хлопчатника, трансгенное семя трансгенного растения, часть растения.

Изобретение относится к биотехнологии. Описана интерферирующая рибонуклеиновая кислота (РНК), которая функционирует при поглощении видом насекомого-вредителя с подавлением экспрессии гена-мишени у указанного насекомого-вредителя, при этом РНК содержит по меньшей мере один сайленсирующий элемент, который является областью двухцепочечной РНК, содержащей соединенные комплементарные цепи, одна цепь из которых содержит или состоит из последовательности нуклеотидов, которая комплементарна целевой нуклеотидной последовательности в пределах гена-мишени, и при этом ген-мишень (i) выбран из группы генов, имеющих нуклеотидную последовательность, содержащую SEQ ID NO 122, 131, 144, 145, 178, 179 или комплементарную ей последовательность, или имеющих такую нуклеотидную последовательность, которая при оптимальном выравнивании и сравнении двух последовательностей по меньшей мере на 85% идентична SEQ ID NO 122, 131, 144, 145, 178, 179 или комплементарной ей последовательности, или (ii) у насекомого-вредителя является ортологом гена, имеющего нуклеотидную последовательность, содержащую SEQ ID NО 122, 131, 144, 145, 178, 179 или комплементарную ей последовательность, при этом два ортологических гена сходны по последовательности до такой степени, что при оптимальном выравнивании и сравнении двух генов ортолог имеет последовательность, которая по меньшей мере на 85% идентична последовательности, представленной в SEQ ID NО 122, 131, 144, 145, 178, 179, или (iii) выбран из группы генов, имеющих нуклеотидную последовательность, кодирующую аминокислотную последовательность, которая при оптимальном выравнивании и сравнении двух аминокислотных последовательностей является по меньшей мере на 85% идентичной аминокислотной последовательности, кодируемой SEQ ID NО 122, 131, 144, 145, 178, 179.

Изобретение относится к области биохимии, в частности к способу получения трансгенной клетки растения. При этом способ включает трансформацию клетки растения донорной молекулой нуклеиновой кислоты, которая встраивается в геномный локус, выбранный из группы, состоящей из FAD2, FAD3 и IPK1, с использованием сайт-специфической нуклеазы.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле полинуклеотида, предназначенной для снижения уровня гена фитохрома PHYA1. Также раскрыты шпилечный конструкт нуклеиновой кислоты, рекомбинантный бинарный вектор, клетка-хозяин, включающая указанный конструкт, трансгенный хлопчатник, трансгенная клетка хлопчатника, трансгенное семя трансгенного растения, часть растения.

Изобретение относится к области биохимии, в частности к корму для животных, содержащему трансгенное растение или его часть для получения усвояемых сахаров с помощью фермента, деградирующего клеточную стенку, присутствующего в нем.

Изобретение относится к области биотехнологии, конкретно к гипоаллергенным полипептидам аллергена злаковых Phl p 5, и может быть использовано в медицине для терапии аллергии типа 1, в инициирование которой вовлечены аллергены пятой группы семейства злаковых (Poaceae).

Изобретение относится к области биохимии, в частности к трансгенному растению, для получения неполярного липида. Также раскрыты часть трансгенного растения для получения неполярного липида, рекомбинантная клетка для получения неполярного липида.

Изобретение относится к области биохимии, а именно представлен полинуклеотид, который кодирует белок, обладающий активностью переноса сахара на гидроксильную группу в 4ʹ-положении флавона.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков в Escherichia coli, и может быть использовано для получения рекомбинантного пищевого аллергена гороха посевного Pisum sativum.

Изобретение относится к области биохимии, в частности к биологическому ДНК-маркеру для определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки, а также к способу определения наличия примеси муки мягкой пшеницы в муке твердой пшеницы и продуктах ее переработки в исследуемых образцах с его использованием.

Настоящее изобретение относится к биотехнологии, конкретно к рекомбинантным модификациям аллергенов группы 6 Poaceae (мятликовых), и может быть использовано в медицине для предупреждения или терапевтического лечения аллергий типа 1, в инициирование которых вовлечены аллергены группы 6 мятликовых.

Изобретение относится к области биохимии, в частности к векторам для экспрессии белков в растениях. Представлены варианты трансгенного растения, предназначенного для экспрессии фермента, деградирующего клеточную стенку.

Изобретение относится к области генной инженерии, конкретно к рекомбинантному получению антиангиогенных белков, и может быть использовано в медицине. Сконструирована рекомбинантная плазмидная ДНК pERIG-PGS, обеспечивающая синтез в клетках Escherichia coli гибридного белка GyrA-PGS, содержащего модифицированный мини-интеин Мхе GyrA и антиангиогенный пептид Пигастин - производное фрагмента [44-77] фактора роста пигментного эпителия человека с присоединенной к С-концу последовательностью Pro-Gly-Pro.

Изобретение относится к области биохимии, в частности к трансгенному растению, к заражению насекомыми-вредителями Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum. Также раскрыты трансгенное семя для получения указанного растения, ДНК-конструкция, которую содержит указанное трансгенное растение, клетка-хозяин для получения указанной ДНК-конструкции. Раскрыты способ получения трансгенного растения, способ идентификации трансгенного растения, способ профилактики или борьбы с Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum. Изобретение позволяет эффективно защищать растение от насекомых-вредителей Lygus hesperus, Leptinotarsa decemlineata, Nilaparvata lugens или Acyrthosiphon pisum. 9 н. и 6 з.п. ф-лы, 23 ил., 23 табл., 7 пр.

Наверх