Олигонуклеотид для лечения пациентов с мышечной дистрофией



Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
Олигонуклеотид для лечения пациентов с мышечной дистрофией
C12N2320/33 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2674600:

ПРОСЕНСА ТЕКНОЛОДЖИЗ Б.В. (NL)

Данное изобретение относится к биотехнологии. Предложен олигонуклеотид для обеспечения пропуска двух или более экзонов пре-мРНК дистрофина. Также рассмотрена композиция для обеспечения пропуска двух или более экзонов пре-мРНК дистрофина, способ и применение олигонуклеотида и композиции для предупреждения, замедления, смягчения и/или лечения мышечной дистрофии Дюшенна (DMD) и мышечной дистрофии Беккера (BMD). Настоящее изобретение может найти дальнейшее применение в терапии различных заболеваний, вызванных мутациями в гене дистрофина. 4 н. и 1 з.п. ф-лы, 5 ил., 6 табл., 5 пр.

 

Область изобретения

Изобретение относится к области генетики человека, более конкретно, к способу конструирования единичного олигонуклеотида, который предпочтительно способен индуцировать пропускание двух или более экзонов пре-мРНК. Кроме того, изобретение относится к указанному олигонуклеотиду, к фармацевтической композиции, содержащей указанный олигонуклеотид, и к применению указанного олигонуклеотида, как указано в настоящем описании.

Уровень техники, к которому относится изобретение

Олигонуклеотиды являются перспективными в медицине для лечения генетических нарушений, таких как мышечная дистрофия. Мышечная дистрофия (MD) относится к генетическим заболеваниям, которые характеризуются прогрессирующей слабостью и дегенерацией скелетных мышц. Мышечная дистрофия Дюшенна (DMD) и мышечная дистрофия Беккера (BMD) являются наиболее распространенными детскими формами мышечной дистрофии, и они используются в настоящем описании для иллюстрации изобретения. DMD представляет собой тяжелое летальное нервно-мышечное нарушение, приводящее к потребности в инвалидной коляске в возрасте до 12 лет и пациенты DMD часто погибают в возрасте до тридцати лет вследствие дыхательной или сердечной недостаточности.

DMD вызывается мутациями в гене DMD; в основном делециями или дупликациями со сдвигом рамки считывания одного или нескольких экзонов, небольшими нуклеотидными вставками или делециями, или точечными нонсенс-мутациями, которые, как правило, приводят к отсутствию функционального дистрофина. В ходе последнего десятилетия появилась специально индуцируемая модификация сплайсинга для восстановления нарушенной рамки считывания транскрипта DMD в качестве перспективной терапии мышечной дистрофии Дюшенна (DMD) (van Ommen G.J. et al., Yokota T., et al., van Deutekom et al., Goemans N.M., et al.). С использованием специфичных к последовательности антисмысловых олигонуклеотидов (AON), которые нацелены на конкретный экзон, фланкирующий или содержащий мутацию, и препятствуют его сигналам сплайсинга, может быть индуцировано пропускание этого экзона во время процессинга пре-мРНК DMD. Несмотря на получаемый в результате укороченный транскрипт, открытая рамка считывания восстанавливается, и образуется белок, который сходен с белками, встречающимися у пациентов с обычно более мягкой мышечной дистрофией Беккера. Индуцируемое AON пропускание экзонов обеспечивает специфический для мутации и, таким образом, потенциально персонализированный терапевтический подход для пациентов с DMD и определенных пациентов с тяжелой BMD. Поскольку большинство мутаций кластеризуются в области экзонов 45-55 в гене DMD, пропускание одного конкретного экзона в этой области может быть терапевтическим для субпопуляции пациентов с различными мутациями. Пропускание экзона 51 имеют наибольшие субпопуляции пациентов (приблизительно 13%), включая пациентов с делециями экзонов 45-50, 48-50, 50 или 52. В случае некоторых мутаций для восстановления открытой рамки считывания требуется пропускание более одного экзона. Например, для пациентов DMD с делецией с экзона 46 по экзон 50 в гене DMD, только пропускание обоих из экзонов 45 и 51 является корректирующим. Для лечения этих пациентов требуется введение двух олигонуклеотидов, один из которых нацелен на экзон 45, а другой из которых нацелен на экзон 51. Осуществимость пропускания двух или более последовательных экзонов с использованием комбинации AON, либо в коктейле, либо в доставляемых с помощью вирусов генных конструкциях, широко исследована (Aartsma-Rus A. et al., 2004; Béroud C., et al.; Van Vliet L., et al.; Yokota T., et al.; Goyenvalle A., et al.). Пропускание множества экзонов было бы применимым для совокупных субпопуляций пациентов, позволило бы имитировать делеции, о которых известно, что они ассоциированы с относительно мягкими фенотипами, и обеспечило бы инструмент для нацеливания на редкие мутации вне области горячей точки делеций в гене DMD. Однако недостатком разработки лекарственных средств, содержащих множество олигонуклеотидов, является то, что учреждение по контролю за оборотом лекарственных средств может рассматривать олигонуклеотиды с различными последовательностями как различные лекарственные средства, для каждого из которых требуются доказательства стабильной продукции, испытания токсичности и клинические испытания. Таким образом, существует потребность в одном молекулярном соединении, способном индуцировать пропускание по меньшей мере двух экзонов, чтобы упростить лечение совокупных подгрупп пациентов с DMD.

Описание изобретения

Изобретение относится к способу конструирования олигонуклеотида, где указанный олигонуклеотид способен связываться с областью первого экзона и с областью второго экзона в одной и той же пре-мРНК, где указанная область указанного второго экзона обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона. Олигонуклеотиды, получаемые указанным способом, предпочтительно способны индуцировать пропускание указанного первого экзона и указанного второго экзона в указанной пре-мРНК. Предпочтительно, также индуцируется пропускание дополнительного экзона(ов), где указанный дополнительный экзон(ы) предпочтительно расположен между указанным первым и указанным вторым экзонами. Полученный транскрипт указанной пре-мРНК, где пропускаются указанные экзоны, находится в рамке считывания.

Олигонуклеотид

В первом аспекте изобретение относится к олигонуклеотиду, который способен связываться с областью первого экзона и с областью второго экзона в одной и той же пре-мРНК, где указанная область второго экзона обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона.

Олигонуклеотид предпочтительно способен индуцировать пропускание первого и второго экзонов указанной пре-мРНК; более предпочтительно, индуцируется пропускание дополнительного экзона(ов), где указанный дополнительный экзон(ы) предпочтительно расположен между указанным первым и указанным вторым экзонами, и где полученный транскрипт находится в рамке считывания.

Пропускание экзона препятствует природным процессам сплайсинга, происходящим в эукариотической клетке. У высших эукариот генетическая информация для белков в ДНК клетки кодируется в экзонах, которые отделены друг от друга последовательностями интронов. Эти интроны в некоторых случаях являются очень длинными. Аппарат транскрипции эукариот образует пре-мРНК, которая содержит как экзоны, так и интроны, в то время как аппарат сплайсинга, часто уже во время происходящей продукции пре-мРНК, образует истинную кодирующую мРНК для белка путем удаления интронов и связывания экзонов, присутствующих в пре-мРНК, в ходе процесса, называемого сплайсингом.

Олигонуклеотид по изобретению, который способен связываться с областью первого экзона в пре-мРНК и с областью второго экзона в той же пре-мРНК, следует рассматривать как олигонуклеотид, пригодный для связывания с областью первого экзона в пре-мРНК и пригодный для связывания с областью второго экзона в той же пре-мРНК. Такой олигонуклеотид по изобретению характеризуется его признаком связывания (т.е. способен связываться), когда его используют с или в комбинации с пре-мРНК, предпочтительно в клетке. В этом контексте выражение "способен к" может быть заменено на "может". Таким образом, специалисту в данной области будет понятно, что олигонуклеотид, способный связываться с областью первого экзона и способный связываться с областью второго экзона в одной и той же пре-мРНК, определяемый нуклеотидной последовательностью, определяет указанный олигонуклеотид структурно, т.е. указанный олигонуклеотид обладает такой последовательностью, которая обратно комплементарна последовательности указанной области указанного первого экзона и также обратно комплементарна последовательности указанной области указанного второго экзона в одной и той же пре-мРНК. Степень обратной комплементарности с указанными областями указанного первого и/или указанного второго экзона, которая необходима для олигонуклеотида по изобретению, может составлять менее 100%. Может быть допустимым определенное количество несоответствий нуклеотидов или один или два пропуска, как дополнительно описано в настоящем описании. Нуклеотидную последовательность области первого экзона, которая обладает по меньшей мере 50% идентичностью с указанной областью указанного второго экзона (или нуклеотидная последовательность области второго экзона, которая обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона), с которой способен связываться олигонуклеотид по изобретению, можно конструировать с использованием способа по изобретению, как пояснено ниже в настоящем описании. Предпочтительная пре-мРНК представляет собой пре-мРНК дистрофина. Предпочтительные комбинации первого и второго экзонов пре-мРНК дистрофина и предпочтительные области указанных первого и второго экзонов дистрофина определены в таблице 2. Олигонуклеотид по изобретению предпочтительно способен индуцировать пропускание указанных первого и второго экзонов в указанной пре-мРНК дистрофина; более предпочтительно, индуцируется пропускание дополнительного экзона(ов), где указанный дополнительный экзон(ы) предпочтительно расположен между указанным первым и указанным вторым экзонами, и где полученный транскрипт дистрофина находится в рамке считывания, предпочтительно, как указано в таблице 1.

Транскрипт находится в рамке считывания, когда он имеет открытую рамку считывания, которая обеспечивает продукцию белка. Состояние нахождения мРНК в рамке считывания можно оценивать с помощью анализа последовательности и/или анализа ОТ-ПЦР, как известно специалисту в данной области. Полученный белок, который образуется в результате трансляции транскрипта в рамке считывания, можно анализировать с помощью иммунофлуоресценции и/или анализа с использованием вестерн-блоттинга с использованием антител, которые перекрестно реагируют с указанным белком, как известно специалисту в данной области. В рамках настоящего изобретения олигонуклеотид, описанный в настоящем описании, может быть назван функциональным, если полученный транскрипт в рамке считывания идентифицируется с помощью ОТ-ПЦР и/или анализа последовательности, или если белок, образовавшийся с указанного транскрипта, идентифицируется с помощью иммунофлуоресценции и/или анализа с использованием вестерн-блоттинга, в соответствующей системе in vitro или in vivo в зависимости от типа транскрипта. Если транскрипт представляет собой транскрипт дистрофина, соответствующая система может представлять собой мышечную клетку или мышечную трубочку здорового донора или пациента с DMD, как пояснено в настоящем описании ниже.

В одном варианте осуществления область второго экзона (присутствующая в той же пре-мРНК в качестве области первого экзона) обладает по меньшей мере 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100% идентичностью с областью первого экзона, как определено выше (предпочтительные области первого и второго экзонов дистрофина указаны в таблице 2). Процент идентичности можно оценивать по всей длине указанных первого и/или второго экзонов или на протяжении области из 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 или более нуклеотидов, как проиллюстрировано в настоящем описании для экзонов дистрофина. Для квалифицированного специалиста очевидно, что первый и второй экзоны, как описано в настоящем описании, представляют собой два различных экзона одной единственной мРНК или два различных экзона одной и той же пре-мРНК. Первый экзон, как указано в настоящем описании, может быть расположен выше (т.е. с 5'-стороны) второго экзона в одной и той же пре-мРНК, как указано в настоящем описании, или второй экзон может быть расположен выше указанного первого экзона. Предпочтительно, указанный первый экзон расположен выше указанного второго экзона. Специалисту в данной области очевидно, что олигонуклеотид по изобретению может быть исходно сконструирован так, чтобы он был способен связываться с областью первого экзона; ввиду идентичности области указанного первого и указанного второй экзонов, указанный олигонуклеотид также вторично может быть способен связываться с указанной областью указанного второго экзона. Возможно обратное конструирование: олигонуклеотид по изобретению может быть первично сконструирован так, чтобы он был способен связываться с областью второго экзона; ввиду идентичности области указанного первого и указанного второго экзонов, указанный олигонуклеотид также может быть вторично способен связываться с указанной областью указанного первого экзона.

Процент идентичности между областью первого и областью второго экзонов можно оценивать по всей области указанного первого экзона, где область может быть более короткой, более длинной или в равной степени длинной относительно части этой области, с которой олигонуклеотид по изобретению способен связываться. Область первого экзона и область второго экзона, как используют в рамках изобретения, также могут быть идентифицированы как область(и) идентичности. Предпочтительно область первого экзона, которая определяет идентичность с областью второго экзона, является в равной степени длинной или более длинной, чем часть этой области, с которой способен связываться олигонуклеотид по изобретению. Должно быть понятно, что олигонуклеотид по изобретению может быть способен связываться с меньшей частью или частично перекрывающейся частью указанных областей, использованных для оценки идентичности последовательностей указанных первого и/или второго экзонов. Таким образом, должно быть понятно, что олигонуклеотид, который способен связываться с областью первого и второго экзонов, может связываться с частью указанной области указанного первого экзона и указанного второго экзона. Указанная часть может иметь такую же длину, как и указанная область указанного первого и/или указанного второго экзонов. Указанная часть может быть более короткой или более длинной относительно указанной области указанного первого и/или указанного второго экзонов. Указанная часть может находиться в указанной области указанного первого и/или указанного второго экзонов. Указанная часть может перекрываться с указанной областью указанного первого и/или указанного второго экзонов. Это перекрывание может составлять 1, 2, 3, 4, 5 или более нуклеотидов на 5'- и/или на 3'-стороне области указанного первого и/или второго экзона. Олигонуклеотид может быть по меньшей мере на 1, 2, 3, 4, 5 или более нуклеотидов длиннее или короче области указанного первого и/или указанного второго экзона и может находиться на 5'- или 3'-стороне указанной области первой и/или второй области.

Область, составляющая 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 или вплоть до 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 или более нуклеотидов, используемая для вычисления процента идентичности между первым экзоном и вторым экзоном, может представлять собой непрерывный участок, или она может прерываться одним, двумя, тремя, четырьмя или более пропусками при условии, что процент идентичности на протяжении всей области составляет по меньшей мере 50%.

Процент идентичности между областью первого экзона и областью второго экзона можно оценивать с использованием любой программы, известной специалисту в данной области. Предпочтительно, указанную идентичность оценивают следующим образом: наилучшее попарное выравнивание между первым и вторым экзонами с использованием сетевого инструмента EMBOSS Matcher с использованием параметров по умолчанию (матрица: EDNAFULL, штраф за внесение пропуска: 16, штраф за продолжение пропуска: 4).

Олигонуклеотид, как используют в рамках изобретения, предпочтительно относится к олигомеру, который способен связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарным области или части области первого и второго экзонов в одной и той же пре-мРНК.

Олигонуклеотид, как определено в настоящем описании (т.е. который способен связываться с областью первого экзона и с областью другого экзона (т.е. второго экзона) в одной и той же пре-мРНК, где указанная область указанного второго экзона обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона), также предпочтительно по меньшей мере на 80% обратно комплементарен указанной области указанного первого экзона и по меньшей мере на 45% обратно комплементарен указанной области указанного второго экзона. Более предпочтительно, указанный олигонуклеотид по меньшей мере на 85%, 90%, 95% или 100% обратно комплементарен указанной области указанного первого экзона и по меньшей мере на 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100% обратно комплементарен указанной области указанного второго экзона. Обратную комплементарность предпочтительно, но не обязательно, оценивают на протяжении всей длины олигонуклеотида.

Олигонуклеотид, охватываемый изобретением, может содержать по меньшей мере 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 или 40 нуклеотидов. Олигонуклеотид, охватываемый изобретением, может содержать не более 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 нуклеотидов. Длина олигонуклеотида по изобретению определяется общим количеством нуклеотидов, охватываемых указанным олигонуклеотидом, независимо от модификаций, присутствующих в указанном олигонуклеотиде. Как дополнительно рассмотрено ниже, нуклеотиды могут содержать определенные химические модификации, однако такие модифицированные нуклеотиды, тем не менее, считаются нуклеотидами в контексте настоящего изобретения. В зависимости от химии олигонуклеотида, оптимальная длина олигонуклеотида может отличаться. Например, длина 2'-O-метилфосфоротиоатного олигонуклеотида может составлять от 15 до 30. Если этот олигонуклеотид далее модифицировать, как проиллюстрировано в настоящем описании, оптимальная длина может быть укорочена до 14, 13 или даже менее.

В предпочтительном варианте осуществления олигонуклеотид по изобретению имеет не более 30 нуклеотидов для ограничения вероятности снижения эффективности синтеза, выхода, частоты или масштабируемости, снижения биодоступности и/или клеточного захвата и транспорта, снижения безопасности и для ограничения расходов. В более предпочтительном варианте осуществления олигонуклеотид состоит из 15-25 нуклеотидов. Наиболее предпочтительно, олигонуклеотид, охватываемый изобретением, состоит из 20, 21, 22, 23, 24 или 25 нуклеотидов. Длина олигонуклеотида по изобретению предпочтительно является такой, что функциональность или активность олигонуклеотида определяется индукцией по меньшей мере 5% пропускания первого и второго экзонов (и любого экзона(ов) между ними), или способствованием тому, что образуется по меньшей мере 5% транскрипта в рамке считывания, когда по меньшей мере 100 нМ указанного олигонуклеотида используют для трансфицирования соответствующей клеточной культуры in vitro. Оценка присутствия указанного транскрипта уже описана в настоящем описании. Соответствующая клеточная культура представляет собой клеточную культуру, где пре-мРНК, содержащая указанный первый и указанный второй экзоны, транскрибируется и сплайсируется в мРНК-транскрипт. Если пре-мРНК представляет собой пре-мРНК дистрофина, соответствующая клеточная культура содержит (дифференцированные) мышечные клетки. В этом случае образуется по меньшей мере 20% транскрипта в рамке считывания, когда используют по меньшей мере 250 нМ указанного олигонуклеотида.

Область первого экзона может иметь длину по меньшей мере 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 или вплоть до 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 или более нуклеотидов. Область первого экзона также может быть определена как составляющая по меньшей мере 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или 100% длины указанного экзона. Область первого экзона может быть названа областью идентичности.

Область второго экзона может составлять по меньшей мере 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 или вплоть до 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 или более нуклеотидов. Область второго экзона может быть определена как составляющая по меньшей мере 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или 100% от длины указанного экзона. Область второго экзона может быть названа областью идентичности.

В одном варианте осуществления олигонуклеотид по изобретению способен связываться с областью экзона U+1 (первый экзон) из пре-мРНК, где область другого экзона D-1 (второй экзон) в той же пре-мРНК обладает по меньшей мере 50% идентичностью с указанной областью указанного (U+1) экзона, где указанный олигонуклеотид предназначен для пропускания указанного U+1 и указанного D-1 экзонов (и дополнительного экзона(ов), предпочтительно расположенного между указанным первым и указанным вторым экзонами) указанной пре-мРНК, с образованием транскрипта в рамке считывания, в котором экзоны U и D сплайсированы вместе (например, для DMD, предпочтительно, как в таблице 1). Олигонуклеотид по изобретению также обозначается в настоящем описании как соединение. Олигонуклеотид по изобретению предпочтительно представляет собой антисмысловой олигонуклеотид (т.е. AON). Олигонуклеотид предпочтительно предназначен для пропускания указанных двух экзонов (т.е. указанного первого (U+1) и указанного второго (D-1) экзонов) указанной пре-мРНК, и где образовавшийся транскрипт (в котором U прямо сплайсирован с D) находится в рамке считывания (например, для DMD, предпочтительно, как в таблице 1). Можно сказать, что указанный олигонуклеотид индуцирует пропускание указанных двух экзонов в одной единственной пре-мРНК. Необязательно, индуцируется пропускание дополнительного экзона(ов), где указанный дополнительный экзон(ы) предпочтительно расположен между указанным первым и указанным вторым экзонами, и образующийся транскрипт находится в рамке считывания.

Более предпочтительно, олигонуклеотид предназначен для пропускания указанных двух экзонов (т.е. указанного первого и указанного второго экзонов), и полного участка экзонов между указанным первым и указанным вторым экзонами в указанной пре-мРНК для удаления какой-либо мутации в указанном участке и для получения транскрипта, который является более коротким, но который обладает восстановленной открытой рамкой считывания, что обеспечивает продуцирование белка.

Без связи с какой-либо теорией, полагают, что вследствие по меньшей мере 50% идентичности или сходства последовательностей между указанными двумя экзонами, единственный олигонуклеотид по изобретению способен связываться и индуцировать пропускание обоих экзонов и предпочтительно всего участка экзонов между ними, чтобы получить более короткий транскрипт, который находится в рамке считывания. Таким образом, указанные два экзона могут быть соседними в пре-мРНК, или они могут быть разделены по меньшей мере 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 экзонами. Область, охватывающая один или несколько экзонов, присутствующих между указанным первым и указанным вторым экзонами, также может быть названа участком (множества) экзонов или мультиэкзонным участком. Предпочтительно, первый экзон этого мультиэкзонного участка представляет собой первый экзон, определенный в настоящем описании выше, а последний экзон этого мультиэкзонного участка представляет собой второй экзон, определенный в настоящем описании ранее. Олигонуклеотид по изобретению также может быть определен как олигонуклеотид, который способен индуцировать пропускание указанных двух экзонов, или пропускание участка (множества) экзонов или пропускание указанного мультиэкзонного участка. В предпочтительном варианте осуществления пропускание как первого экзона, так и второго экзона индуцируют с использованием одного единственного олигонуклеотида по изобретению. В предпочтительном варианте осуществления осуществляют пропускание более одного, более 2, более 3, более 4, более 5, более 6, более 7, более 8, более 9, более 10, более 11, более 12, более 13, более 14, более 15, более 16, более 17 экзонов, более 18, более 19, более 20, более 21, более 22, более 23, более 24, более 25, более 26, более 27, более 28, более 29, более 30, более 31, более 32, более 33, более 34, более 35, более 36, более 37, более 38, более 39, более 40, более 41, более 42, более 43, более 44, более 45, более 46, более 47, более 48, более 49, более 50 экзонов с использованием одного единственного олигонуклеотида, и, таким образом, это пропускание более 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 экзонов проводят, не используя смесь или коктейль двух или более различных олигонуклеотидов, или не используя два или более различных олигонуклеотидов, которые могут быть связаны с помощью одного или нескольких линкера(ов), или не используя генную конструкцию, транскрибирующую два или более различных олигонуклеотидов. В одном варианте осуществления, таким образом, предусматривается, что изобретение охватывает один единственный олигонуклеотид и не содержит двух или более различных олигонуклеотидов, причем указанный единственный олигонуклеотид способен связываться с указанным первым и указанным вторым экзонами и способен индуцировать пропускание по меньшей мере указанного первого и указанного второго экзонов в одной пре-мРНК, как проиллюстрировано в настоящем описании. В этом контексте квалифицированному специалисту будет понятно, что слово "единственный" не относится к количеству молекул, требуемому для индукции пропускания экзонов. "Единственный" относится к последовательности олигонуклеотида: изобретение охватывает одну единственную олигонуклеотидную последовательность и ее применение, и не включает две или более различных олигонуклеотидных последовательностей, причем указанная единственная олигонуклеотидная последовательность способна связываться с указанным первым и указанным вторым экзонами и способна индуцировать пропускание по меньшей мере указанного первого и указанного второго экзонов в одной пре-мРНК, как объяснено в настоящем описании. Это изобретение представляет собой первое изобретение, позволяющее пропускание более чем одного экзона с помощью только одного единственного олигонуклеотида для лечения заболевания, вызываемого (редкой) мутацией в гене, при условии, что различные экзоны в указанном гене включают области, которые обладают по меньшей мере 50% идентичностью последовательностей.

Олигонуклеотид по изобретению предпочтительно используют в качестве части терапии на основе активности модулирования РНК, как определено в настоящем описании ниже. В зависимости от типа транскрипта, где присутствуют первый и второй экзоны, можно сконструировать олигонуклеотид для предупреждения, лечения или замедления данного заболевания.

Было показано, что нацеливание на два экзона в одной пре-мРНК с помощью одного олигонуклеотида, способного связываться с обоими экзонами, приводит к мРНК, лишенной экзонов-мишеней, и, кроме того, всего участка экзонов между ними. Преимуществом такого единственного олигонуклеотида, как определено в настоящем описании, является то, что можно лечить дефекты, вызванные различными мутациями в этом мультиэкзонном участке. Если выбрать два или более различных олигонуклеотидов для индукции пропускания двух или более экзонов, следует, например, учитывать, что каждый олигонуклеотид может обладать его собственным профилем PK, и что, таким образом, необходимо будет найти условия, где каждый из них будет сходным образом присутствовать в одной и той же клетке. Таким образом, другим преимуществом использования только одного единственного олигонуклеотида, способного связываться с двумя различными экзонами, как определено выше, является то, что значительно упрощается изготовление, исследование токсичности, поиск дозы и клиническое испытание, поскольку это может быть сведено к простому изготовлению и исследованию одного единственного соединения.

Ниже определены дополнительные признаки олигонуклеотида по изобретению.

В контексте изобретения, в предпочтительном варианте осуществления олигонуклеотид способен связываться с, нацеливаться на, гибридизоваться с, является обратно комплементарным и/или способен ингибировать функцию по меньшей мере одной регулирующей сплайсинг последовательности в по меньшей мере указанном первом экзоне и/или указанном втором экзоне и/или влияет на структуру по меньшей мере указанного первого экзона и/или указанного второго экзона:

где указанный олигонуклеотид содержит последовательность, которая способна связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарной участку связывания серин-аргининового (SR) белка в указанном первом и/или втором экзоне,

и/или

где указанный олигонуклеотид способен связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарным энхансеру сплайсинга экзонов (ESE), последовательности распознавания экзонов (ERS) и/или сайленсеру сплайсинга экзонов (ESS) в указанном первом и/или втором экзоне.

Более предпочтительно, указанный олигонуклеотид, который способен связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарным области первого экзона пре-мРНК и/или области второго экзона пре-мРНК, способен специфически ингибировать по меньшей мере одну регулирующую сплайсинг последовательность и/или влиять на структуру по меньшей мере указанного первого и/или второго экзона в указанной пре-мРНК. Препятствование регулирующим сплайсинг последовательностям и/или структурам имеет преимущество, состоящее в том, что такие элементы располагаются в экзоне. Путем предоставления такого олигонуклеотида, как определено в настоящем описании, можно эффективно замаскировать по меньшей мере указанный первый и второй экзоны, и предпочтительно полный участок экзонов между ними, от аппарата сплайсинга. Отсутствие распознавания аппаратом сплайсинга этих экзонов, таким образом, приводит к пропусканию или исключению этих экзонов из конечной мРНК. Этот вариант осуществления сфокусирован только на кодирующих последовательностях. Полагают, что это позволяет способу быть более специфическим и, таким образом, надежным. Обратная комплементарность указанного олигонуклеотида с указанной областью указанного первого и/или второго экзона в пре-мРНК предпочтительно составляет по меньшей мере 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100%.

Таким образом, настоящее изобретение относится к антисмысловому олигонуклеотиду для применения в качестве лекарственного средства для предупреждения, замедления, смягчения и/или лечения заболевания у индивидуума,

где указанный олигонуклеотид способен связываться с областью первого экзона и областью второго экзона, где указанная область указанного второго экзона обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона,

где указанный первый и указанный второй экзоны находятся в одной и той же пре-мРНК у указанного индивидуума,

где указанное связывание приводит к пропусканию указанного первого экзона и указанного второго экзона и предпочтительно к пропусканию мультиэкзонного участка, начинающегося с указанного первого экзона и охватывающего один или несколько экзонов, находящихся между указанным первым и указанным вторым экзонами, и в лучшем случае к пропусканию всего участка экзонов между указанным первым и указанным вторым экзонами, и

где получают транскрипт в рамке считывания, позволяющий продуцирование функционального или полуфункционального белка.

Предпочтительно, как проиллюстрировано в настоящем описании, указанный олигонуклеотид способен индуцировать пропускание всего участка экзонов между указанным первым экзоном и указанным вторым экзоном.

Более предпочтительно, как объяснено в настоящем описании, указанное связывание указанного олигонуклеотида способно препятствовать по меньшей мере одной регулирующей сплайсинг последовательности в указанных областях указанных первого и второго экзонов, и/или вторичной структуре указанного первого и/или указанного второго экзонов, и/или вторичной структуре, охватывающей по меньшей мере указанный первый и/или указанный второй экзоны в указанной пре-мРНК. Предпочтительные регулирующие сплайсинг последовательности представлены в настоящем описании ниже.

Таким образом, один предпочтительный вариант осуществления относится к олигонуклеотиду по изобретению, который способен связываться с областью первого экзона в пре-мРНК и/или с областью второго экзона в той же пре-мРНК, где указанная область указанного второго экзона в той же пре-мРНК обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона (например, для DMD, предпочтительно, как в таблице 2), где указанный олигонуклеотид способен индуцировать пропускание указанного первого и указанного второго экзонов в указанной пре-мРНК; что приводит к транскрипту, который находится в рамке считывания (например, для DMD, предпочтительно, как в таблице в таблице 1 или 6). Указанный олигонуклеотид обеспечивает у указанного индивидуума функциональный или полуфункциональный белок, и указанный олигонуклеотид дополнительно содержит:

- последовательность, которая способна связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарной области первого и/или второго экзона пре-мРНК, которая гибридизуется с другой частью первого и/или второго экзона пре-мРНК (закрытая структура), и/или

- последовательность, которая способна связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарной области указанного первого и/или второго экзона пре-мРНК, которая не гибридизуется с указанной пре-мРНК (открытая структура).

Для этого варианта осуществления приводится ссылка на патентную заявку WO 2004/083446. Молекулы РНК обладают прочными вторичными структурами, по большей части вследствие спаривания оснований обратно комплементарных или частично обратно комплементарных участков в одной и той же РНК. Уже давно полагают, что структуры в РНК играют роль в функции РНК. Без связи с теорией, полагают, что вторичная структура РНК экзона играет роль в структурировании процесса сплайсинга. В ее структуре экзон распознается в качестве части, которая должна быть включена в мРНК. В одном варианте осуществления олигонуклеотид способен препятствовать структуре по меньшей мере указанного первого экзона и, возможно, также указанного второго экзона и, возможно, также участка экзонов между ними, и, таким образом, способен препятствовать сплайсингу указанного первого, и, возможно, также указанного второго экзона, и, возможно, также участка экзонов между ними, путем маскирования указанных экзонов от аппарата сплайсинга и тем самым обеспечения пропускания указанных экзонов. Без связи с теорией, полагают, что перекрывание с открытой структурой повышает эффективность инвазии олигонуклеотида (т.е. повышает эффективность, с которой олигонуклеотид может проникать в структуру), в то время как перекрывание с закрытой структурой повышает эффективность препятствования вторичной структуре РНК экзона. Было обнаружено, что длина частичной обратной комплементарности как с закрытой, так и с открытой структурой в значительной степени не ограничена. Авторы настоящего изобретения наблюдали высокую эффективность в случае олигонуклеотида с различной длиной обратной комплементарности в любой структуре. Термин "обратная комплементарность" используют в настоящем описании для обозначения участка нуклеиновых кислот, которые могут гибридизоваться с другим участком нуклеиновых кислот в физиологических условиях. Условия гибридизации определены в настоящем описании ниже. Таким образом, не является абсолютным требованием, чтобы все основания в области обратной комплементарности были способны спариваться с основаниями на противоположной цепи. Например, при конструировании олигонуклеотида может быть желательным включение, например, одного или нескольких остатков, которые не образуют пары оснований с основаниями на обратной комплементарной цепи. Несоответствия оснований могут быть до некоторой степени допустимыми, если в условиях в клетке участок нуклеотидов все еще способен гибридизоваться с обратно комплементарной частью. В контексте настоящего изобретения присутствие несоответствия в олигонуклеотиде по изобретению является предпочтительным, поскольку в одном варианте осуществления указанный олигонуклеотид является по меньшей мере на 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% обратно комплементарным области первого экзона и/или области второго экзона. Присутствие несоответствия в указанном олигонуклеотиде является предпочтительной характеристикой изобретения, поскольку указанный олигонуклеотид способен связываться с областью указанного первого и с областью указанного второго экзона, как определено в настоящем описании выше.

Другие преимущества обеспечения присутствия несоответствия оснований в антисмысловом олигонуклеотиде по изобретению определены в настоящем описании, и они сходны с преимуществами, обеспечиваемыми присутствием инозина (гипоксантина), и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований: избегание присутствия CpG, избегание или снижение потенциальной мультимеризации или агрегации, избегание квадруплексных структур, возможность конструирования олигонуклеотида с улучшенной кинетикой связывания РНК и/или термодинамическими свойствами.

Предпочтительно, обратная комплементарность олигонуклеотида области идентичности между указанными первым и/или вторым экзонами составляет от 45% до 65%, от 50% до 75%, но более предпочтительно от 65% до 100% или от 70% до 90%, или от 75% до 85%, или от 80% до 95%. Как правило, это обеспечивает 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или 11 несоответствий в олигонуклеотиде из 20 нуклеотидов. Таким образом, в олигонуклеотиде из 40 нуклеотидов может быть 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 20, 21 или 22 несоответствия оснований. Предпочтительно, в олигонуклеотиде из 40 нуклеотидов присутствует менее 14 несоответствий оснований. Количество несоответствий оснований является таким, что олигонуклеотид по изобретению все еще способен связываться с, гибридизоваться с, нацеливаться на область указанного первого экзона и на область указанного второго экзона, тем самым индуцируя пропускание по меньшей мере указанного первого и указанного второго экзонов и индуцируя продукцию транскрипта в рамке считывания, как объяснено в настоящем описании. Предпочтительно, продукции транскрипта в рамке считывания достигают по меньшей мере с 5% эффективностью при использовании по меньшей мере 100 нМ указанного олигонуклеотида для трансфекции соответствующей клеточной культуры in vitro, как объяснено в настоящем описании выше.

Следует отметить, что изобретение охватывает олигонуклеотид, который не обладает никаким несоответствием оснований с областью первого экзона и который может иметь 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 20, 21 или 22 несоответствия оснований с соответствующей областью второго экзона, как определено в настоящем описании. Однако изобретение также охватывает олигонуклеотид, который не имеет никакого несоответствия оснований с областью второго экзона и который может иметь 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 20, 21 или 22 несоответствия оснований с соответствующей областью первого экзона, как определено в настоящем описании. Наконец, изобретение охватывает олигонуклеотид, который может иметь 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 20, 21 или 22 несоответствия оснований с областью первого экзона и который может иметь 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 несоответствие оснований с соответствующей областью второго экзона, как определено в настоящем описании. Вновь, в рамках настоящего изобретения следует понимать, что количество несоответствий оснований в олигонуклеотиде по изобретению является таким, чтобы этот указанный олигонуклеотид все еще был способен связываться с, гибридизоваться с, нацеливаться на область указанного первого экзона и область указанного второго экзона, как пояснено в настоящем описании.

Олигонуклеотид по изобретению предпочтительно не пересекает пропуск в выравнивании области первого экзона и области второго экзона, как определено в настоящем описании. Выравнивание предпочтительно проводят с использованием сетевого инструмента EMBOSS Matcher, как пояснено в настоящем описании выше. Однако в конкретных случаях возможно, что олигонуклеотид по изобретению должен пересекать пропуск, как упомянуто в настоящем описании выше. Предпочтительно, указанный пропуск представляет собой только один пропуск. Указанный пропуск предпочтительно охватывает менее 3 нуклеотидов, наиболее предпочтительно только один нуклеотид. Количество и длина пропусков являются такими, что олигонуклеотид по изобретению все еще способен связываться с, гибридизоваться с, нацеливаться на область указанного первого экзона и область указанного второго экзона, тем самым индуцируя пропускание по меньшей мере указанного первого и указанного второго экзонов и индуцируя продукцию транскрипта в рамке считывания, как пояснено в настоящем описании.

Структуру (т.е. открытые и закрытые структуры) наилучшим образом анализируют в контексте пре-мРНК, где находится экзон. Такую структуру можно анализировать в истинной РНК. Однако в настоящее время возможно спрогнозировать вторичную структуру молекулы РНК (с наибольшими затратами энергии) достаточно тщательно с использованием моделирующих структуру программ. Неограничивающим примером подходящей программы является интернет-сервер Mfold (Zuker, M.).

Специалист в данной области способен спрогнозировать с приемлемой воспроизводимостью вероятную структуру экзона, учитывая нуклеотидную последовательность. Наилучшее прогнозирование осуществляют, когда программе предоставляют как последовательность указанного экзона, так и последовательности фланкирующих интронов. Как правило, не является необходимым моделирование структуры всей пре-мРНК.

Отжиг олигонуклеотида по изобретению может влиять на локальное сворачивание или 3D-структуру или конформацию РНК-мишени (т.е. область, охватывающую по меньшей мере первый и/или второй экзоны). Отличающаяся конформация может приводить к нарушению структуры, распознаваемой аппаратом сплайсинга. Однако, когда в первом и/или втором экзоне-мишени присутствуют потенциальные (скрытые) акцепторные и/или донорные последовательности сплайсинга, иногда образуется новая структура, определяющая отличающийся (нео-) экзон, т.е. с отличающимся 5'-концом, отличающимся 3'-концом или обоими из них. Этот тип активности находится в объеме настоящего изобретения, поскольку экзон-мишень исключается из мРНК. Присутствие нового экзона, содержащего часть указанного первого и/или второго экзона-мишени в мРНК, не изменяет тот факт, что экзон-мишень, как таковой, исключается. Включение нового экзона можно наблюдать в качестве побочного эффекта, который происходит только изредка. Существует две возможности, когда пропускание экзона используется для восстановления (части) открытой рамки считывания транскрипта, которая разрушается в результате мутации. Одной из них является то, что новый экзон является функциональным в отношении восстановления рамки считывания, в то время как в другом случае рамка считывания не восстанавливается. При выборе олигонуклеотида для восстановления открытой рамки считывания с помощью пропускания множества экзонов, безусловно, очевидно, что в этих условиях выбирают только те олигонуклеотиды, которые действительно приводят к пропусканию экзона, которое восстанавливает открытую рамку считывания данного транскрипта, с новым экзоном или без него.

Кроме того, в другом предпочтительном варианте осуществления предусматривается олигонуклеотид по изобретению, который способен связываться с областью первого экзона в пре-мРНК и с областью второго экзона в той же пре-мРНК, где указанная область указанного второго экзона обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона (предпочтительные области для экзонов дистрофина указаны в таблице 2 или таблице 6), где указанный олигонуклеотид способен индуцировать пропускание указанных первого и второго экзонов указанной пре-мРНК; что приводит к транскрипту, который находится в рамке считывания (для DMD, предпочтительно, как в таблице 1 или таблице 6). Указанный олигонуклеотид обеспечивает у указанного индивидуума функциональный или полуфункциональный белок, и указанный олигонуклеотид дополнительно содержит: последовательность, которая способна связываться с, нацеливаться на, гибридизоваться с, является обратно комплементарной для и/или способна ингибировать функцию одного или нескольких участков связывания серин-аргининового (SR) белка в РНК экзона из пре-мРНК.

В патентной заявке WO 2006/112705 авторы настоящего изобретения описали наличие корреляции между эффективностью внутреннего антисмыслового олигонуклеотида (AON) экзона в отношении индукции пропускания экзонов и присутствием предполагаемого участка связывания SR в заданном участке пре-мРНК указанного AON. Таким образом, в одном варианте осуществления получают указанный олигонуклеотид, как определено в настоящем описании, включая определение одного или нескольких (предполагаемых) участков связывания для белка SR в РНК указанного первого и/или указанного второго экзона и получение соответствующего олигонуклеотида, который способен связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарным указанной РНК и который по меньшей мере частично перекрывает указанный (предполагаемый) участок связывания. Термин "по меньшей мере частично перекрывает" определяют в настоящем описании как включающий перекрывание только одного нуклеотида участка связывания SR, а также множества нуклеотидов одного или нескольких указанных участков связывания, а также полное перекрывание одного или нескольких указанных участков связывания. Этот вариант осуществления, предпочтительно, дополнительно включает определение во вторичной структуре первого и/или второго экзона области, которая гибридизуется с другой частью указанного первого и/или второго экзона (закрытая структура), и области, которая не гибридизуется в указанной структуре (открытая структура), а затем получение олигонуклеотида, который по меньшей мере частично перекрывает один или несколько указанных (предполагаемых) участков связывания, и который перекрывает по меньшей мере часть указанной закрытой структуры и перекрывает по меньшей мере часть указанной открытой структуры, и который связывается с, нацеливается на, гибридизуется с и/или является обратно комплементарным первому и второму экзонам. Таким образом, авторы настоящего изобретения увеличивают вероятность получения олигонуклеотида, который способен препятствовать включению указанного первого и второго экзонов, и, если это применимо, полного участка экзонов между ними, из пре-мРНК в мРНК. Без связи с какой-либо теорией, в настоящее время полагают, что применение олигонуклеотида, направленного на участок связывания белка SR, приводит (по меньшей мере частично) к нарушению связывания белка SR с указанным участком связывания, что приводит к нарушенному или ухудшенному сплайсингу.

Предпочтительно, область первого экзона и/или область второго экзона в одной и той же пре-мРНК, с которой способен связываться олигонуклеотид по изобретению, содержит открытую/закрытую структуру и/или участок связывания белка SR, более предпочтительно указанная открытая/закрытая структура и указанный участок связывания белка SR частично перекрываются, и еще более предпочтительно указанная открытая/закрытая структура полностью перекрывает участок связывания белка SR, или участок связывания белка SR полностью перекрывает открытую/закрытую структуру. Это обеспечивает дальнейшее нарушение включения экзона.

Помимо консенсусных последовательностей участков связывания, множество (или даже все) экзонов содержат регулирующие сплайсинг последовательности, такие как последовательности энхансера сплайсинга экзонов (ESE), чтобы облегчить распознавание истинных участков сплайсинга сплайсингосомой (Cartegni L, et al. 2002; и Cartegni L, et al., 2003). Подгруппа факторов связывания, называемых белками SR, может связываться с этими ESE и привлекать другие факторы сплайсинга, такие как U1 и U2AF, в (слабо определенные) участки сплайсинга. Участки сплайсинга четырех из наиболее распространенных белков SR (SF2/ASF, SC35, SRp40 и SRp55) проанализированы детально (Cartegni L, et al. 2002 и Cartegni L, et al., 2003). Существует корреляция между эффективностью олигонуклеотида и наличием/отсутствием участка связывания SF2/ASF, SC35, SRp40 и SRp55 в части первого экзона, с которой связывается, гибридизуется и/или на которую нацеливается указанный олигонуклеотид. В предпочтительном варианте осуществления изобретение, таким образом, относится к олигонуклеотиду, который связывается с, гибридизуется с, нацеливается на и/или обратно комплементарен участку связывания для белка SR. Предпочтительно, указанный SR белок представляет собой SF2/ASF или SC35, SRp40 или SRp55. В одном варианте осуществления олигонуклеотид связывается с, гибридизуется с, нацеливается на и/или является обратно комплементарным участку связывания белка SF2/ASF, SC35, SRp40 или SRp55 в первом экзоне и участку связывания другого белка SF2/ASF, SC35, SRp40 или SRp55 во втором экзоне. В более предпочтительном варианте осуществления олигонуклеотид связывается с, гибридизуется с, нацеливается на и/или является обратно комплементарным участку связывания белка SF2/ASF, SC35, SRp40 или SRp55 в первом экзоне и участку связывания сходного белка SF2/ASF, SC35, SRp40 или SRp55 во втором экзоне.

В одном варианте осуществления у пациента обеспечивают функциональный или полуфункциональный белок с использованием олигонуклеотида, который способен связываться с, нацеливаться на регуляторную последовательность РНК, присутствующую в первом и/или втором экзоне, которая требуется для правильного сплайсинга указанного экзона(ов) в транскрипте. Для правильного сплайсинга экзонов в транскрипте требуется несколько цис-действующих последовательностей РНК. В частности, идентифицированы дополнительные элементы, такие как энхансеры сплайсинга экзонов (ESE), для регуляции специфического и эффективного сплайсинга конститутивных и альтернативных экзонов. С использованием соединения, содержащего олигонуклеотид, который связывается или способен связываться с одним из дополнительных элементов в указанном первом и/или втором экзоне(ах), их регуляторная функция нарушается так, что экзоны пропускаются. Таким образом, в одном предпочтительном варианте осуществления олигонуклеотид по изобретению способен связываться с областью первого экзона в пре-мРНК и областью второго экзона в той же пре-мРНК, где указанная область указанного второго экзона обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона, где указанный олигонуклеотид способен индуцировать пропускание указанных первого и второго экзона в указанной пре-мРНК; где указанная область указанного первого экзона и/или указанная область указанного второго экзона содержит энхансер сплайсинга экзонов (ESE), последовательность распознавания экзонов (ERS) и/или последовательность энхансера сплайсинга (SES), и/или где указанный олигонуклеотид способен связываться с, нацеливаться на, способен ингибировать и/или является обратно комплементарным указанному энхансеру сплайсинга экзонов (ESE), последовательности распознавания экзонов (ERS) и/или последовательности энхансера сплайсинга (SES).

Ниже описаны предпочтительные химические структуры олигонуклеотида по изобретению.

Олигонуклеотид широко известен как олигомер, который имеет базовые характеристики гибридизации, сходные с природными нуклеиновыми кислотами. Гибридизация определена в разделе, посвященном определениям, в конце описания изобретения. В настоящей заявке термины "олигонуклеотид" и "олигомер" используют взаимозаменяемо. Для получения указанного олигонуклеотида по изобретению можно использовать различные типы нуклеозидов. Олигонуклеотид может содержать по меньшей мере одну модифицированную межнуклеозидную связь и/или по меньшей мере одну модификацию сахара и/или по меньшей мере одну модификацию основания по сравнению с встречающимся в природе олигонуклеотидом на основе рибонуклеотида или дезоксирибонуклеотида.

"Модифицированная межнуклеозидная связь" указывает на присутствие модифицированной версии фосфодиэфира относительно встречающейся в природе РНК и ДНК. Примерами модификаций межнуклеозидной связи, которые совместимы с настоящим изобретением, являются фосфоротиоат (PS), хирально чистый фосфоротиоат, фосфородитиоат (PS2), фосфоноацетат (PACE), фосфоноацетамид (PACA), тиофосфоноацетат, тиофосфоноацетамид, фосфоротиоатное пролекарство, H-фосфонат, метилфосфонат, метилфосфонотиоат, метилфосфат, метилфосфоротиоат, этилфосфат, этилфосфоротиоат, боранофосфат, боранофосфоротиоат, метилборанофосфат, метилборанофосфоротиоат, метилборанофосфонат, метилборанофосфонотиоат и их производные. Другая модификация включает фосфорамидит, фосфорамидат, N3'→P5' фосфорамидат, фосфородиамидат, фосфортиоамидат, фосфоротиодиамидат, сульфамат, диметиленсульфоксид, сульфонат, метиленимино (MMI), оксалил- и тиоацетамидонуклеиновую кислоту (TANA); и их производные. В зависимости от длины, олигонуклеотид по изобретению может содержать 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 или 39 модификаций основной цепи. Также изобретение охватывает внесение в указанный олигонуклеотид более одной отличающейся модификации основной цепи.

Также изобретение охватывает олигонуклеотид, который содержит межнуклеозидную связь, которая может отличаться с точки зрения атомов нуклеозидов, которые связаны друг с другом, по сравнению со встречающейся в природе межнуклеозидной связью. В этом отношении, олигонуклеотид по изобретению может содержать по меньшей мере одну межнуклеозидную связь, сконструированную как мономеры, связанные 3'-3', 5'-5', 2'-3', 2'-5', 2'-2'. Нумерация положений может отличаться для других химических структур, однако идея сохраняется в объеме изобретения.

В одном варианте осуществления олигонуклеотид по изобретению содержит по меньшей мере одну фосфоротиоатную модификацию. В более предпочтительном варианте осуществления олигонуклеотид по изобретению является полностью модифицированным посредством фосфоротиоата.

"Модификация сахара" указывает на присутствие модифицированной версии рибозильной части относительно рибозильной части во встречающихся в природе РНК и ДНК (т.е. фуранозильная часть), такой как бициклические сахара, тетрагидропираны, структуры морфолино, 2'-модифицированные сахара, 3'-модифицированные сахара, 4'-модифицированные сахара, 5'-модифицированные сахара и 4'-замещенные сахара. Примеры подходящих модификаций сахаров включают, но не ограничиваются ими, 2'-O-модифицированные нуклеотидные остатки РНК, такие как 2'-O-алкил или 2'-O-(замещенный)алкил, например 2'-O-метил, 2'-O-(2-цианоэтил), 2'-O-(2-метокси)этил (2'-MOE), 2'-O-(2-тиометил)этил, 2'-O-бутирил, 2'-O-пропаргил, 2'-O-аллил, 2'-O-(2-амино)пропил, 2'-O-(2-(диметиламино)пропил), 2'-O-(3-амино)пропил, 2'-O-(3-(диметиламино)пропил), 2'-O-(2-амино)этил, 2'-O-(3-гуанидино)пропил (как описано в патентной заявке WO 2013/061295, University of the Witwatersrand, включенной в настоящее описание в качестве ссылки), 2'-O-(2-(диметиламино)этил); 2'-O-(галогеналкокси)метил (Arai K. et al.), например, 2'-O-(2-хлорэтокси)метил (MCEM), 2'-O-(2,2-дихлорэтокси)метил (DCEM); 2'-O-алкоксикарбонил, например, 2'-O-[2-(метоксикарбонил)этил] (MOCE), 2'-O-[2-(N-метилкарбамоил)этил] (MCE), 2'-O-[2-(N,N-диметилкарбамоил)этил] (DMCE); 2'-O-[метиламинокарбонил]метил; 2'-азидо; 2'-амино и 2'-замещенный амино; 2'-галоген, например, 2'-F, FANA (2'-F арабинозилнуклеиновая кислота); карбо- и аза- модификации сахаров; 3'-O-алкил, например, 3'-O-метил, 3'-O-бутирил, 3'-O-пропаргил; 2',3'-дидезокси; и их производные.

Другая модификация сахара включает "мостиковые" или "бициклические" (BNA) модифицированные части сахаров нуклеиновой кислоты, такие, как встречаются, например, в закрытой нуклеиновой кислоте (LNA), ксило-LNA, α-L-LNA, β-D-LNA, cEt (2'-O,4'-C связанный этил) LNA, cMOEt (2'-O,4'-C связанный метоксиэтил) LNA, связанной этиленовым мостиком нуклеиновой кислоте (ENA), BNANC[N-Me] (как описано в Chem. Commun. 2007, 3765-3767 Kazuyuki Miyashita et al., которая включена в настоящее описание в качестве ссылки в полном объеме), CRN, как описано в патентной заявке WO 2013/036868 (Marina Biotech, включенной в настоящее описание в качестве ссылки в полном объеме); разомкнутой нуклеиновой кислоте (UNA) или других ациклических нуклеозидах, таких как описаны в патентной заявке США US 2013/0130378 (Alnylam Pharmaceuticals), включенной в настоящее описание в качестве ссылки в полном объеме; 5'-метил-замещенных BNA (как описано в патентной заявке США 13/530218, которая включена в качестве ссылки в полном объеме); циклогексенилнуклеиновой кислоте (CeNA), алтриолнуклеиновой кислоте (ANA), гекситолнуклеиновой кислоте (HNA), фторированной HNA (F-HNA), пиранозил-РНК (p-РНК), 3'-дезоксипиранозил-ДНК (p-ДНК); или других модифицированных частях сахаров, таких как морфолино (PMO), катионный морфолино (PMOPlus), PMO-X; трициклоДНК; трицикло-PS-ДНК; и их производные. Производные BNA описаны, например, в WO 2011/097641, которая включена в настоящее описание в качестве ссылки в полном объеме. Примеры PMO-X описаны в WO 2011150408, которая включена в настоящее описание в качестве ссылки в полном объеме. В зависимости от длины, олигонуклеотид по изобретению может содержать 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 или 40 модификаций сахаров. Также изобретение охватывает внесение более одной отличающейся модификации сахаров в указанный олигонуклеотид.

В одном варианте осуществления олигонуклеотид по изобретению содержит по меньшей мере одну модификацию сахара, выбранную из 2'-O-метила, 2'-O-(2-метокси)этила, 2'-F, морфолино, мостикового нуклеотида или BNA, или олигонуклеотид содержит как мостиковые нуклеотиды, так и 2'-дезоксинуклеотиды (смешанные BNA/ДНК-меры). Было показано, что олигонуклеотиды, содержащие 2'-фтор (2-'F) нуклеотид, способны привлекать связывающий энхансер интерлейкина фактор 2 и 3 (ILF2/3) и тем самым способны индуцировать пропускание экзонов в пре-мРНК-мишени (Rigo F, et al., WO 2011/097614).

В другом варианте осуществления олигонуклеотид, как определено в настоящем описании, содержит или состоит из LNA или ее производного. Более предпочтительно, олигонуклеотид по изобретению модифицирован по его всей длине модификацией сахара, выбранной из 2'-O-метила, 2'-O-(2-метокси)этила, морфолино, мостиковой нуклеиновой кислоты (BNA) или смешанного BNA/ДНК-мера. В более предпочтительном варианте осуществления олигонуклеотид по изобретению является полностью 2'-O-метил-модифицированным.

В предпочтительном варианте осуществления олигонуклеотид по изобретению содержит по меньшей мере одну модификацию сахара и по меньшей мере одну модифицированную межнуклеозидную связь. Такие модификации включают пептидно-нуклеиновую кислоту (PNA), модифицированную борным кластером PNA, окси-пептидно-нуклеиновую кислоту на основе пирролидина (POPNA), нуклеиновую кислоту на основе гликоля или глицерина (GNA), нуклеиновую кислоту на основе треозы (TNA), ациклическую нуклеиновую кислоту на основе треонинола (aTNA), олигонуклеотиды на основе морфолино (PMO, PPMO, PMO-X), катионные олигомеры на основе морфолино (PMOPlus, PMO-X), олигонуклеотиды с объединенными основаниями и остовами (ONIB), пирролидин-амидные олигонуклеотиды (POM); и их производные. В предпочтительном варианте осуществления олигонуклеотид по изобретению содержит остов пептидно-нуклеиновой кислоты и/или остов морфолинофосфородиамидата или их производное. В более предпочтительном варианте осуществления олигонуклеотид по изобретению является 2'-O-метилфосфоротиоат-модифицированным, т.е. содержит по меньшей мере одну 2'-O-метилфосфоротиоатную модификацию, предпочтительно олигонуклеотид по изобретению является полностью 2'-O-метилфосфоротиоат-модифицированным. Предпочтительно, 2'-O-метилфосфоротиоат-модифицированный олигонуклеотид или полностью 2'-O-метилфосфоротиоат-модифицированный олигонуклеотид представляет собой РНК-олигонуклеотид.

Термин "модификация основания" или "модифицированное основание", как определено в настоящем описании, относится к модификации встречающегося в природе основания в РНК и/или ДНК (т.е. пиримидинового или пуринового основания) или к синтезированным de novo основаниям. Такое синтезированное de novo основание может рассматриваться как "модифицированное" по сравнению с существующим основанием.

В дополнение к модификациям, описанным выше, олигонуклеотид по изобретению может содержать дополнительные модификации, такие как различные типы нуклеотидных остатков нуклеиновой кислоты или нуклеотидов, как описано ниже. Для получения олигонуклеотида по изобретению можно использовать различные типы нуклеотидных остатков нуклеиновой кислоты. Указанный олигонуклеотид может иметь по меньшей мере одну модификацию основной цепи и/или сахара и/или по меньшей мере одну модификацию основания по сравнению с олигонуклеотидом на основе РНК или ДНК.

Олигонуклеотид может содержать природные основания пурины (аденин, гуанин) или пиримидины (цитозин, тимин, урацил) и/или модифицированные основания, как определено ниже. В контексте изобретения урацил может быть заменен тимином.

Модификация оснований включает модифицированную версию природных пуриновых и пиримидиновых оснований (например, аденин, урацил, гуанин, цитозин и тимин), таких как гипоксантин, оротовая кислота, агматидин, лизидин, псевдоурацил, псевдотимин, N1-метилпсевдоурацил, 2-тиопиримидин (например, 2-тиоурацил, 2-тиотимин), 2,6-диаминопурин, G-зажим и его производные, 5-замещенный пиримидин (например, 5-галогенурацил, 5-метилурацил, 5-метилцитозин, 5-пропинилурацил, 5-пропинилцитозин, 5-аминометилурацил, 5-гидроксиметилурацил, 5-аминометилцитозин, 5-гидроксиметилцитозин, Super T), 5-октилпиримидин, 5-тиофенпиримидин, 5-октин-1-илпиримидин, 5-этинилпиримидин, 5-(пиридиламид), 5-изобутил, 5-фенил, как описано в патентной заявке US 2013/0131141 (RXi), включенной в настоящее описание в качестве ссылки в полном объеме; 7-деазагуанин, 7-деазааденин, 7-аза-2,6-диаминопурин, 8-аза-7-деазагуанин, 8-аза-7-деазааденин, 8-аза-7-деаза-2,6-диаминопурин, Super G, Super A и N4-этилцитозин, или их производные; N2-циклопентилгуанин (cPent-G), N2-циклопентил-2-аминопурин (cPent-AP) и N2-пропил-2-аминопурин (Pr-AP), или их производные; и вырожденные или универсальные основания, такие как 2,6-дифтортолуол, или отсутствующие основания, такие как абазические участки (например, 1-дезоксирибоза, 1,2-дидезоксирибоза, 1-дезокси-2-O-метилрибоза; или производные пирролидина, в которых кислород кольца заменен азотом (азарибоза)). Примеры производных Super A, Super G и Super T могут быть найдены в патенте США 6683173 (Epoch Biosciences), который включен в настоящее описание в качестве ссылки. Было показано, что cPent-G, cPent-AP и Pr-AP снижает иммуностимулирующие эффекты при включении в миРНК (siRNA) (Peacock H. et al.), и сходные признаки были показаны для псевдоурацила и N1-метилпсевдоурацила (патентная заявка США 2013/0123481, modeRNA Therapeutics, включенная в настоящее описание качестве ссылки в полном объеме).

"Тимин" и "5-метилурацил" могут использоваться в настоящем документе взаимозаменяемо. Аналогично, "2,6-диаминопурин" идентичен "2-аминоаденину", и эти термины могут использоваться в настоящем документе взаимозаменяемо.

В предпочтительном варианте осуществления олигонуклеотид по изобретению содержит по меньшей мере один 5-метилцитозин и/или по меньшей мере один 5-метилурацил и/или по меньшей мере одно 2,6-диаминопуриновое основание, что следует понимать как то, что по меньшей мере одно из цитозиновых нуклеиновых оснований указанного олигонуклеотида модифицировано путем замены протона в положении 5 кольца пиримидина метильной группой (т.е. 5-метилцитозином), и/или что по меньшей мере одно из урацильных нуклеиновых оснований указанного олигонуклеотида модифицировано путем замены протона в положении 5 кольца пиримидина метильной группой (т.е. 5-метилурацил), и/или что по меньшей мере одно из адениновых нуклеиновых оснований указанного олигонуклеотида модифицировано путем замены протона в положении 2 аминогруппой (т.е. 2,6-диаминопурин), соответственно. В контексте изобретения выражение "замена протона метильной группой в положении 5 кольца пиримидина" может быть заменено выражением "замена пиримидина 5-метилпиримидином", причем пиримидин обозначает только урацил, только цитозин или оба из них. Аналогично, в контексте изобретения выражение "замена протона аминогруппой в положении 2 аденина" может быть заменено выражением "замена аденина 2,6-диаминопурином". Если указанный олигонуклеотид содержит 1, 2, 3, 4, 5, 6, 7, 8, 9 или более остатков цитозина, урацила и/или аденина, по меньшей мере 1, 2, 3, 4, 5, 6, 7, 8, 9 или более остатков цитозина, урацила и/или аденина, соответственно, могут быть модифицированы таким путем. В предпочтительном варианте осуществления все остатки цитозина, все остатки урацила и/или все остатки аденина модифицированы таким путем или заменены 5-метилцитозином, 5-метилурацилом и/или 2,6-диаминопурином, соответственно.

Было обнаружено, что присутствие 5-метилцитозина, 5-метилурацила и/или 2,6-диаминопурина в олигонуклеотиде по изобретению имеет положительный эффект по меньшей мере на один из параметров или улучшение по меньшей мере одного из параметров указанного олигонуклеотида. В этом контексте параметры могут включать: аффинность и/или кинетику связывания, активность сайленсинга, биостабильность, (внутритканевое) распределение, клеточный захват и/или транспорт, и/или иммуногенность указанного олигонуклеотида, как объяснено ниже.

Поскольку известно, что несколько модификаций, упомянутых выше, увеличивает величину Tm и, таким образом, усиливает связывание определенного нуклеотида с его аналогом на его мРНК-мишени, эти модификации могут быть исследованы в отношении усиления связывания олигонуклеотида по изобретению как с областью первого экзона, так и с областью второго экзона, в контексте изобретения. Поскольку последовательности олигонуклеотида по изобретению могут не быть на 100% обратно комплементарными данной области первого экзона и/или второго экзона, увеличивающие Tm модификации, такие как мостиковый нуклеотид или BNA (такой как LNA) или модификация основания, выбранная из 5-метилпиримидинов и/или 2,6-диаминопурина, предпочтительно могут быть осуществлены в нуклеотидном положении, которое обратно комплементарно указанной первой и/или указанной второй области указанных экзонов.

Аффинность связывания и/или кинетика связывания или гибридизации зависят от термодинамических свойств AON. Они по меньшей мере частично определяются температурой плавления указанного олигонуклеотида (Tm; вычисляемая, например, с помощью калькулятора свойств олигонуклеотидов (http://www.unc.edu/~cail/biotool/oligo/index.html или http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/) для одноцепочечной РНК с использованием базовой Tm и модели ближайшего соседа) и/или свободной энергией комплекса олигонуклеотида и экзона-мишени (с использованием RNA structure версии 4.5 или РНК mfold версии 3.5). Если Tm увеличивается, активность пропускания экзона, как правило, возрастает, однако ожидается, что, когда Tm является слишком высокой, AON станет менее специфичным к последовательности. Приемлемая Tm и свободная энергия зависят от последовательности олигонуклеотида. Таким образом, трудно привести предпочтительные диапазоны для каждого из этих параметров.

Активность олигонуклеотида по изобретению предпочтительно определяют следующим образом:

- смягчение одного или нескольких симптома(ов) заболевания, ассоциированного с мутацией, присутствующей в первом и/или во втором экзоне, и/или с мутацией, присутствующей в участке, начинающемся в указанном первом экзоне и оканчивающемся в указанном втором экзоне, предпочтительно смягчение одного или нескольких симптома(ов) DMD или BMD; и/или

- смягчение одной или нескольких характеристик клетки от пациента, предпочтительно мышечной клетки от пациента; и/или

- обеспечение у указанного индивидуума функционального или полуфункционального белка, предпочтительно функционального или полуфункционального белка дистрофина; и/или

- по меньшей мере частичное снижение продукции аберрантного белка у указанного индивидуума, предпочтительно по меньшей мере частичное снижение продукции аберрантного белка дистрофина у указанного индивидуума. Каждый из этих признаков и анализов для их оценки определен в настоящем описании ниже.

Ожидается, что предпочтительный олигонуклеотид по изобретению, содержащий 5-метилцитозин и/или 5-метилурацил и/или 2,6-диаминопуриновое основание, будет проявлять увеличенную активность по сравнению с соответствующей активностью олигонуклеотида без какого-либо 5-метилцитозина, без какого-либо 5-метилурацила и без какого-либо 2,6-диаминопуринового основания. Это различие в активности может составлять по меньшей мере 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100%. Биораспределение и биостабильность предпочтительно по меньшей мере частично определяются валидированным анализом лигирования при гибридизации, взятого из Yu et al., 2002. В одном варианте осуществления образцы плазмы или образцы гомогенизированной ткани инкубируют с конкретным улавливающим олигонуклеотидным зондом. После разделения, DIG-меченный олигонуклеотид лигируют с комплексом и проводят детекцию с использованием связанной с антителом против DIG пероксидазой. Некомпартментный анализ фармакокинетики проводят с использованием пакета программ WINNONLIN (модель 200, версия 5.2, Pharsight, Mountainview, CA). Проводят мониторинг уровней AON (мкг) на мл плазмы или мг ткани с течением времени для оценки площади под кривой (AUC), максимальной концентрации (Cmax), времени до достижения максимальной концентрации (Tmax), терминального времени полужизни и латентного периода всасывания (tlag). Такой предпочтительный анализ описан в экспериментальной части.

Олигонуклеотид может стимулировать врожденный иммунный ответ путем активации Toll-подобных рецепторов (TLR), включая TLR9 и TLR7 (Krieg A.M., et al., 1995). Активация TLR9, как правило, происходит вследствие присутствия неметилированных последовательностей CG, присутствующих в олигодезоксинуклеотидах (ODN), посредством имитации бактериальной ДНК, которая активирует врожденную иммунную систему посредством опосредуемого TLR9 высвобождения цитокинов. Однако 2'-O-метил-модификация может значительно снижать такой возможный эффект. Описано, что TLR7 распознает урациловые повторы в РНК (Diebold S.S., et al., 2006).

Активация TLR9 и TLR7 приводит к набору скоординированных иммунных ответов, которые включают врожденный иммунитет (макрофаги, дендритные клетки (DC) и NK-клетки) (Krieg A.M., et al., 1995; Krieg A.M., et al. 2000). В этот процесс вовлечено несколько хемокинов и цитокинов, таких как IP-10, TNFα, IL-6, MCP-1 и IFNα (Wagner H., et al., 1999; Popovic P.J., et al., 2006). Воспалительные цитокины привлекают дополнительные защитные клетки из крови, такие как T- и B-клетки. Уровни этих цитокинов можно исследовать с помощью исследования in vitro. В кратком изложении, цельную кровь человека инкубируют с возрастающими концентрациями олигонуклеотидов, после чего уровни цитокинов определяют с помощью стандартных коммерчески доступных наборов для ELISA. Снижение иммуногенности предпочтительно соответствует поддающемуся обнаружению снижению концентрации по меньшей мере одного из цитокинов, упомянутых выше, при сравнении с концентрацией соответствующего цитокина в анализе в клетке, обработанной олигонуклеотидом, содержащим по меньшей мере один 5-метилцитозин и/или 5-метилурацил и/или 2,6-диаминопурин, по сравнению с клеткой, обработанной соответствующим олигонуклеотидом, не имеющим 5-метилцитозинов, 5-метилурацилов или 2,6-диаминопуринов.

Таким образом, предпочтительный олигонуклеотид по изобретению имеет улучшенный параметр, такой как приемлемая или сниженная иммуногенность и/или лучшее биораспределение и/или приемлемая или улучшенная кинетика связывания РНК и/или термодинамические свойства по сравнению с соответствующим олигонуклеотидом без 5-метилцитозина, без 5-метилурацила и без 2,6-диаминопурина. Каждый из этих параметров можно оценивать с использованием анализов, известных специалисту в данной области.

Предпочтительный олигонуклеотид по изобретению содержит или состоит из молекулы РНК или модифицированной молекулы РНК. В предпочтительном варианте осуществления олигонуклеотид является одноцепочечным. Однако квалифицированному специалисту будет понятно, что одноцепочечный олигонуклеотид может образовывать внутреннюю двухцепочечную структуру. Однако этот олигонуклеотид, тем не менее, называют одноцепочечным олигонуклеотидом в контексте настоящего изобретения. Одноцепочечный олигонуклеотид имеет несколько преимуществ по сравнению с двухцепочечным олигонуклеотидом миРНК: (i) ожидается, что его синтез будет более простым, чем синтез двух комплементарных цепей миРНК; (ii) существует более широкий диапазон химических модификаций, возможных для повышения захвата в клетки, более высокой (физиологической) стабильности и снижения потенциальных общих неблагоприятных эффектов; (iii) миРНК имеют более высокий потенциал для неспецифических эффектов (включая гены вне мишени) и улучшенную фармакологию (например, возможен меньший контроль эффективности и селективности схемы лечения или дозы); и (iv) миРНК с меньшей вероятностью будут действовать в ядре и не могут быть направлены против интронов.

В другом варианте осуществления олигонуклеотид по изобретению содержит абазический участок или абазический мономер. В контексте изобретения такой мономер может называться абазическим участком или абазическим мономером. Абазический мономер представляет собой нуклеотидный остаток или структурный элемент, который лишен нуклеинового основания, по сравнению с соответствующим нуклеотидным остатком, содержащим нуклеиновое основание. В рамках изобретения абазический мономер, таким образом, представляет собой часть структурного элемента олигонуклеотида, но лишенную нуклеинового основания. Такой абазический мономер может присутствовать, или может быть связан, или может быть присоединен, или может быть конъюгирован со свободным концом олигонуклеотида.

В более предпочтительном варианте осуществления олигонуклеотид по изобретению содержит 1-10 или более абазических мономеров. Таким образом, в олигонуклеотиде по изобретению может находиться 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или более абазических мономеров.

Абазический мономер может представлять собой любой тип, известный и понятный квалифицированному специалисту, неограничивающие примеры которых представлены ниже:

В рамках настоящего изобретения, R1 и R2 независимо представляют собой H, олигонуклеотид или другой абазический участок(ки) при условии, что не оба из R1 и R2 представляют собой H и R1 и R2 не оба являются олигонуклеотидами. Абазический мономер(ы) может быть связан с любым или с обоими концами олигонуклеотида, как указано выше. Следует отметить, что олигонуклеотид, связанный с одним или двумя абазическим участком(ами) или абазическим мономером(ами), может содержать менее 10 нуклеотидов. В этом отношении олигонуклеотид по изобретению может содержать по меньшей мере 10 нуклеотидов, необязательно включающих один или несколько абазических участков или абазических мономеров на одном или обоих концах. Другие примеры абазических участков, которые охватываются изобретением, описаны в патентной заявке США 2013/013378 (Alnylam Pharmaceuticals), включенной в настоящее описание в качестве ссылки в полном объеме.

В зависимости от длины олигонуклеотид по изобретению может содержать 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 или 40 модификаций оснований. Также изобретение охватывает внесение более одной определенной модификации оснований в указанный олигонуклеотид.

Таким образом, в одном варианте осуществления олигонуклеотид по изобретению содержит:

(a) по меньшей мере одну модификацию основания, выбранную из 2-тиоурацила, 2-тиотимина, 5-метилцитозина, 5-метилурацила, тимина, 2,6-диаминопурина; и/или

(b) по меньшей мере одну модификацию сахара, выбранную из 2'-O-метила, 2'-O-(2-метокси)этила, 2'-O-дезокси (ДНК), 2'-F, морфолино, мостикового нуклеотида или BNA, или олигонуклеотид содержит как мостиковые нуклеотиды, так и 2'-дезокси-модифицированные нуклеотиды (смешанные BNA/ДНК-меры); и/или

(c) по меньшей мере одну модификацию основной цепи, выбранную из фосфоротиоата или фосфородиамидата.

В другом варианте осуществления олигонуклеотид по изобретению содержит:

(a) по меньшей мере одну модификацию оснований, выбранную из 5-метилпиримидина и 2,6-диаминопурина; и/или

(b) по меньшей мере одну модификацию сахара, которая представляет собой 2'-O-метил; и/или

(c) по меньшей мере одну модификацию основной цепи, которая представляет собой фосфоротиоат.

В одном варианте осуществления олигонуклеотид по изобретению содержит по меньшей мере одну модификацию по сравнению со встречающимся в природе олигонуклеотидом на основе рибонуклеотида или дезоксирибонуклеотида, более предпочтительно

(a) по меньшей мере одну модификацию основания, предпочтительно выбранную из 2-тиоурацила, 2-тиотимина, 5-метилцитозина, 5-метилурацила, тимина, 2,6-диаминопурина, более предпочтительно, выбранную из 5-метилпиримидина и 2,6-диаминопурина; и/или

(b) по меньшей мере одну модификацию сахара, предпочтительно выбранную из 2'-O-метила, 2'-O-(2-метокси)этила, 2'-O-дезокси (ДНК), 2'-F, морфолино, мостикового нуклеотида или BNA, или олигонуклеотид содержит как мостиковые нуклеотиды, так и 2'-дезокси-модифицированные нуклеотиды (смешанные BNA/ДНК-меры), более предпочтительно модификация сахара представляет собой 2'-O-метил; и/или

(c) по меньшей мере одну модификацию основной цепи, предпочтительно выбранную из фосфоротиоата или фосфородиамидата, более предпочтительно модификация основной цепи представляет собой фосфоротиоат.

Таким образом, олигонуклеотид согласно этому варианту осуществления изобретения содержит модификацию основания (a) и отсутствие модификации сахара (b) и отсутствие модификации основной цепи (c). Другой предпочтительный олигонуклеотид согласно этому аспекту изобретения включает модификацию сахара (b) и отсутствие модификации основания (a) и отсутствие модификации основной цепи (c). Другой предпочтительный олигонуклеотид согласно этому аспекту изобретения содержит модификацию основной цепи (c) и отсутствие модификации основания (a) и отсутствие модификации сахара (b). Также предполагается, что настоящее изобретение охватывает олигонуклеотиды, не имеющие ни одной из упомянутых выше модификаций, а также олигонуклеотиды, содержащие две, т.е. (a) и (b), (a) и (c) и/или (b) и (c), или все три из модификаций (a), (b) и (c), как определено выше.

В предпочтительном варианте осуществления олигонуклеотид по изобретению модифицирован по всей его длине одной или несколькими одинаковыми модификациями, выбранными из (a) одной из модификаций оснований; и/или (b) одной из модификаций сахара; и/или (c) одной из модификаций основной цепи.

С появлением технологии имитации нуклеиновых кислот стало возможным получать молекулы, которые обладают сходными, предпочтительно одинаковыми по типу характеристиками гибридизации, но не обязательно сходными количественными характеристиками, с самой нуклеиновой кислотой. Такие функциональные эквиваленты, безусловно, также являются пригодными для применения в рамках изобретения.

В другом предпочтительном варианте осуществления олигонуклеотид содержит инозин, гипоксантин, универсальное основание, вырожденное основание и/или нуклеозид или нуклеотид, содержащие основание, способное образовывать качающуюся пару оснований или ее функциональный эквивалент. Применение инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований, в олигонуклеотиде по изобретению, является высоко перспективным, как пояснено ниже. Инозин, например, является известным модифицированным основанием, которое может образовывать пару с тремя основаниями: урацил, аденин и цитозин. Инозин представляет собой нуклеозид, который образуется, когда гипоксантин связан с кольцом рибозы (также известным как рибофураноза) через β [бета]-N9-гликозидную связь. Инозин (I) обычно встречается в тРНК, и он необходим для надлежащей трансляции генетического кода в качающихся парах оснований. Качающаяся пара оснований может существовать между G и U, или между I с одной стороны и U, A или C с другой стороны. Это является фундаментальным при образовании вторичной структуры РНК. Ее термодинамическая стабильность сравнима с термодинамической стабильностью пары оснований Уотсона-Крика. Генетический код исправляет несоответствия в количестве аминокислот (20) для триплетных кодонов (64), с использованием модифицированных пар оснований в первом основании антикодона.

Первое преимущество использования инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований, в олигонуклеотиде по изобретению, позволяет конструировать олигонуклеотид, который способен связываться с областью первого экзона из пре-мРНК и способен связываться с областью второго экзона в той же пре-мРНК, где указанная область из указанного второго экзона обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона. Иными словами, присутствие инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований, в олигонуклеотиде по изобретению, позволяет связывание указанного олигонуклеотида с областью первого экзона и с областью второго экзона указанной пре-мРНК.

Второе преимущество использования инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований, в олигонуклеотиде по изобретению, позволяет конструировать олигонуклеотид, который охватывает однонуклеотидный полиморфизм (SNP), без опасения, что полиморфизм нарушит эффективность отжига олигонуклеотида. Таким образом, в рамках изобретения использование такого основания позволяет конструирование олигонуклеотида, который можно использовать для индивидуума, имеющего SNP в участке пре-мРНК, на который нацелен олигонуклеотид по изобретению.

Третье преимущество использования инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований, в олигонуклеотиде по изобретению, представляет собой случай, когда указанный олигонуклеотид в норме содержит CpG, если он сконструирован как являющийся комплементарным части первого экзона пре-мРНК, как определено в настоящем описании. Присутствие CpG в олигонуклеотиде обычно ассоциировано с увеличенной иммуногенностью указанного олигонуклеотида (Dorn A. and Kippenberger S.). Эта увеличенная иммуногенность является нежелательной, поскольку она может индуцировать разрушение мышечных волокон. Ожидается, что замена гуанина инозином в одном, двух или более CpG в указанном олигонуклеотиде обеспечит олигонуклеотид со сниженным и/или приемлемым уровнем иммуногенности. Иммуногенность можно оценивать в модели на животных путем оценки присутствия клеток CD4+ и/или CD8+ и/или инфильтрации воспалительных мононуклеоцитов в биоптате мышц указанного животного. Иммуногенность также можно оценивать в крови животного или человека, подвергаемого лечению олигонуклеотидом по изобретению, путем обнаружения присутствия нейтрализующего антитела и/или антитела, распознающего указанный олигонуклеотид, с использованием стандартного иммуноанализа, известного квалифицированному специалисту. Увеличение иммуногенности предпочтительно соответствует поддающемуся обнаружению увеличению по меньшей мере одного из этих типов клеток по сравнению с количеством каждого типа клеток в соответствующем биоптате мышц животного до обработки или лечения соответствующим олигонуклеотидом, имеющим по меньшей мере один инозин (гипоксантин) и/или универсальное основание и/или вырожденное основание и/или нуклеотид, содержащий основание, способное образовывать качающуюся пару оснований. Альтернативно, увеличение иммуногенности можно оценивать путем обнаружения присутствия или увеличения количества нейтрализующего антитела или антитела, распознающего указанный олигонуклеотид, с использованием стандартного иммуноанализа. Снижение иммуногенности предпочтительно соответствует поддающемуся обнаружению снижению по меньшей мере одного из этих типов клеток по сравнению с количеством соответствующего типа клеток в соответствующем биоптате мышц животного до лечения или после лечения соответствующим олигонуклеотидом, не имеющим инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований. Альтернативно, снижение иммуногенности можно оценивать по отсутствию или снижению количества указанного соединения и/или нейтрализующих антител с использованием стандартного иммуноанализа.

Четвертым преимуществом использования инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований, в олигонуклеотиде по изобретению, является избегание или снижение потенциальной мультимеризации или агрегации олигонуклеотидов. Например, известно, что олигонуклеотид, содержащий мотив G-квартет, имеет тенденцию к образованию квадруплекса, мультимера или агрегата, образованного хугстиновским спариванием оснований четырех одноцепочечных олигонуклеотидов (Cheng A.J. и Van Dyke M.W.), что, безусловно, нежелательно: ожидается, что в результате этого эффективность олигонуклеотида снизится. Мультимеризацию или агрегацию предпочтительно оценивают стандартными способами полиакриламидного неденатурирующего гель-электрофореза, известными квалифицированному специалисту. В предпочтительном варианте осуществления менее 20% или 15%, 10%, 7%, 5% или менее от общего количества олигонуклеотида по изобретению обладает способностью к мультимеризации или агрегации, оцениваемой с использованием анализа, упомянутого выше.

Пятым преимуществом использования инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований, в олигонуклеотиде по изобретению, таким образом, также является избегание квадруплексных структур, которая ассоциирована с антитромботической активностью (Macaya R.F., et al.), а также со связыванием с и ингибированием фагоцитарного рецептора макрофагов (Suzuki K., et al.).

Шестым преимуществом использования инозина (гипоксантина) и/или универсального основания и/или вырожденного основания и/или нуклеотида, содержащего основание, способное образовывать качающуюся пару оснований, в олигонуклеотиде по изобретению, является возможность конструирования олигонуклеотида с улучшенной кинетикой связывания РНК и/или термодинамическими свойствами. Кинетика связывания РНК и/или термодинамические свойства по меньшей мере частично определяются температурой плавления олигонуклеотида (Tm; вычисляемая с помощью калькулятора свойств олигонуклеотидов (http://www.unc.edu/~cail/biotool/oligo/index.html) для одноцепочечной РНК с использованием базовой Tm и модели ближайшего соседа) и/или свободной энергией комплекса AON и экзона-мишени (с использованием RNA structure версии 4.5). Если Tm является чрезмерно высокой, ожидается, что олигонуклеотид будет менее специфичным. Приемлемая Tm и свободная энергия зависят от последовательности олигонуклеотида. Таким образом, трудно привести предпочтительные диапазоны для каждого из этих параметров. Приемлемая Tm может находиться в диапазоне от 35 до 85°C, и приемлемая свободная энергия может находиться в диапазоне от 15 до 45 ккал/моль.

В зависимости от длины, олигонуклеотид по настоящему изобретению может содержать по меньшей мере 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 остатков инозина (гипоксантина) и/или универсальных оснований и/или вырожденных оснований и/или нуклеотидов, содержащих основание, способное образовывать качающуюся пару оснований, или их функциональные эквиваленты.

Предпочтительно, указанный олигонуклеотид по изобретению содержит РНК, поскольку дуплексы РНК/РНК являются высокостабильными. Является предпочтительным, чтобы РНК-олигонуклеотид содержал модификацию, обеспечивающую РНК с дополнительным свойством, например, устойчивостью к эндонуклеазам, экзонуклеазам и РНК-азе H, дополнительной прочностью гибридизации, увеличенной стабильностью (например, в жидкостях организма), увеличенной или сниженной пластичностью, сниженной токсичностью, увеличенным внутриклеточным транспортом, тканевой специфичностью и т.д. Предпочтительные модификации описаны выше.

Таким образом, один вариант осуществления относится к олигонуклеотиду, который содержит по меньшей мере одну модификацию. Предпочтительный модифицированный олигонуклеотид является полностью 2'-O-метил-модифицированным. В одном варианте осуществления изобретения олигонуклеотид содержит или состоит из гибридного олигонуклеотида, содержащего модификацию 2'-O-метил-фосфоротиоатным олигорибонуклеотидом и модификацию мостиковой нуклеиновой кислотой (BNA, как проиллюстрировано выше). В другом варианте осуществления изобретения олигонуклеотид содержит или состоит из гибридного олигонуклеотида, содержащего модификацию 2'-O-метоксиэтилфосфоротиоатом и мостиковую нуклеиновую кислоту (BNA, как проиллюстрировано выше). В другом варианте осуществления изобретения олигонуклеотид содержит или состоит из гибридного олигонуклеотида, содержащего модификацию мостиковой нуклеиновой кислотой (BNA, как проиллюстрировано выше) и модификацию олигодезоксирибонуклеотидом. Эта конкретная комбинация обладает лучшей специфичностью последовательности по сравнению с эквивалентом, состоящим только из мостиковой нуклеиновой кислоты, и обладает увеличенной эффективностью по сравнению с олигонуклеотидом, состоящим из модификации 2'-O-метилфосфоротиоатным олиго(дезокси)рибонуклеотидом.

Соединение, как описано в рамках изобретения, предпочтительно может обладать ионогенными группами. Ионогенные группы могут представлять собой основания или кислоты, и они могут быть заряженными или нейтральными. Ионогенные группы могут присутствовать в качестве пары ионов с соответствующим противоионом, который имеет противоположный заряд(ы). Примерами катионных противоионов являются натрий, калий, цезий, Tris, литий, кальций, магний, триалкиламмоний, триэтиламмоний и тетраалкиламмоний. Примерами анионных противоионов являются хлорид, бромид, йодид, лактат, мезилат, ацетат, трифторацетат, дихлорацетат и цитрат. Примеры противоионов описаны [например, Kumar L, которая включена в настоящее описание в качестве ссылки в полном объеме]. Примеры применения двух- или трехвалентных противоионов, особенно Ca2+, описаны в качестве дополнительных положительных характеристик к определенным олигонуклеотидам в патентной заявке США 2012046348 (Replicor), которая включена в качестве ссылки в полном объеме. Предпочтительные двухвалентные или трехвалентные противоионы выбирают из следующего перечня или группы: кальций, магний, кобальт, железо, марганец, барий, никель, медь и цинк. Предпочтительным двухвалентным противоионом является кальций. Таким образом, настоящее изобретение охватывает приготовление, получение и применение композиции, содержащей олигонуклеотид по изобретению и любой другой противоион, определенный выше, предпочтительно кальций.

Такой способ получения указанной композиции, содержащей указанный олигонуклеотид и указанный противоион, предпочтительно кальций, может быть следующим: олигонуклеотид по изобретению можно растворять в фармацевтически приемлемом водном эксципиенте, и постепенно к растворенному олигонуклеотиду можно добавлять раствор, содержащий указанный противоион, чтобы хелатный комплекс олигонуклеотида оставался растворимым.

Таким образом, в предпочтительном варианте осуществления олигонуклеотид по изобретению приводят в контакт с композицией, содержащей такой противоион, предпочтительно Ca2+, для формирования хелатного комплекса олигонуклеотида, содержащего два или более идентичных олигонуклеотидов, связанных таким противоионом, как определено в настоящем описании. Композиция, содержащая хелатный комплекс олигонуклеотида, содержащий два или более идентичных олигонуклеотида, связанных противоионом, предпочтительно кальцием, таким образом, охватывается настоящим изобретением.

Способ конструирования олигонуклеотида

Таким образом, в следующем аспекте изобретения предусматривается способ конструирования олигонуклеотида, где указанный способ приводит к олигонуклеотиду, как определено выше.

Этот способ включает следующие стадии:

(a) идентификация комбинации в рамке считывания первого и второго экзона в одной и той же пре-мРНК, где область указанного второго экзона обладает по меньшей мере 50% идентичностью с областью указанного первого экзона;

(b) конструирование олигонуклеотида, который способен связываться с указанной областью указанного первого экзона и указанной областью указанного второго экзона; и

(c) где указанное связывание приводит к пропусканию указанного первого экзона и указанного второго экзона, предпочтительно к пропусканию мультиэкзонного участка, начинающегося указанным первым экзоном и охватывающего один или несколько экзонов, присутствующих между указанным первым и указанным вторым экзонами, и, в лучшем случае, к пропусканию всего участка экзонов между указанным первым и указанным вторым экзонами.

На стадии b) такого способа указанный олигонуклеотид предпочтительно конструируют так, чтобы его связывание препятствовало по меньшей мере одной регулирующей сплайсинг последовательности в указанных областях указанного первого и/или второго экзонов в указанной пре-мРНК.

Альтернативно или в комбинации с препятствованием регулирующей сплайсинг последовательности, связывание указанного олигонуклеотида предпочтительно препятствует вторичной структуре, охватывающей по меньшей мере указанный первый и/или указанный второй экзоны в указанной пре-мРНК.

Олигонуклеотид, получаемый этим способом, способен индуцировать пропускание указанных первого и второго экзонов в указанной пре-мРНК. Предпочтительно индуцируется пропускание дополнительного экзона(ов), где указанный дополнительный экзон(ы) предпочтительно располагается между указанным первым и указанным вторым экзонами, и где полученный мРНК-транскрипт находится в рамке считывания. Олигонуклеотид предпочтительно способен индуцировать пропускание всего участка экзонов между указанным первым экзоном и указанным вторым экзоном. В одном варианте осуществления указанные области указанного первого экзона и указанного второго экзона содержат регулирующий сплайсинг элемент, так что связывание указанного олигонуклеотида способно препятствовать по меньшей мере одной регулирующей сплайсинг последовательности в указанных областях указанных первого и второго экзонов. Также предусматривается, что связывание указанного олигонуклеотида препятствует вторичной структуре, охватывающей по меньшей мере указанный первый и/или указанный второй экзоны в указанной пре-мРНК. Предпочтительная регулирующая сплайсинг последовательность содержит участок связывания серин-аргининового (SR) белка, энхансер сплайсинга экзонов (ESE), последовательность распознавания экзонов (ERS) и/или сайленсер сплайсинга экзонов (ESS).

Каждый признак этого способа уже определен в настоящем описании или известен квалифицированному специалисту.

Предпочтительные олигонуклеотиды

Предпочтительно, олигонуклеотид по изобретению предназначен для применения в качестве лекарственного средства, более предпочтительно, указанное соединение предназначено для применения в модулирующих РНК терапевтических средствах. Более предпочтительно, указанное модулирование РНК приводит к коррекции нарушенной транскрипционной рамки считывания и/или к восстановлению экспрессии желаемого или ожидаемого белка. Таким образом, способ по изобретению и олигонуклеотид по изобретению можно в принципе применять к любому заболеванию, связанному с присутствием нарушающей рамку считывания мутации, что приводит к аберрантному транскрипту и/или к отсутствию кодируемого белка и/или к присутствию аберрантного белка. В предпочтительном варианте осуществления способ по изобретению и олигонуклеотид по изобретению применяют к ассоциированным с заболеванием генам, содержащим повторяющиеся последовательности и, таким образом, области с относительно высокой идентичностью последовательности (т.е. по меньшей мере 50%, 60%, 70%, 80% идентичностью последовательности между областью второго экзона и областью первого экзона, как определено в настоящем описании). Неограничивающими примерами являются гены со спектрин-подобными повторами (поскольку ген DMD вовлечен в мышечную дистрофию Дюшенна, как описано в настоящем описании), Kelch-подобными повторами (как например, ген KLHL3, вовлеченный в семейную гиперкалиемическую гипертензию (Louis-Dit-Picard H et al.), ген KLHL6, вовлеченный в хронический лимфоцитарный лейкоз (Puente XS et al.), ген KLHL7, вовлеченный в пигментный ретинит (Friedman JS et al.), гены KLHL7/12, вовлеченные в синдром Шегрена (Uchida K et al.), ген KLHL9, вовлеченный в дистальную миопатию (Cirak S et al.), ген KLHL16 или GAN, вовлеченный в гигантскую аксональную невропатию (Bomont P et al.) , гены KLHL19 или KEAP1, вовлеченные в несколько злокачественных опухолей (Dhanoa BS et al.), ген KLHL20, вовлеченный в промиелоцитарный лейкоз (Dhanoa BS et al.) , или гены KLHL37 или ENC1, вовлеченные в опухоли головного мозга (Dhanoa BS et al.), FGF-подобными повторами, EGF-подобными повторами (как, например, ген NOTCH3, вовлеченный в CADASIL (Chabriat H et al.), гены SCUBE, вовлеченные в злокачественную опухоль или метаболическое заболевание костей, ген нейрексина-1 (NRXN1), вовлеченный в нейропсихиатрические нарушения и идиопатическую генерализованную эпилепсию (Moller RS et al.), ген Del-1, ген тенасцин-C (TNC), вовлеченный в атеросклероз и болезнь коронарных артерий (Mollie A et al.), ген THBS3 или ген фибриллина (FBN1), вовлеченный в синдром Марфана (Rantamaki T et al.), анкирин-подобными повторами (как, например, ген ANKRD1, вовлеченный в кардиомиопатию с дилятацией (Dubosq-Bidot L et al.), ген ANKRD2, ген ANKRD11, вовлеченные в синдром KBG (Sirmaci A et al.), ген ANKRD26, вовлеченный в тромбоцитопению (Noris P et al.) или диабет (Raciti GA et al.), ген ANKRD55, вовлеченный в рассеянный склероз (Alloza I et al.), или ген TRPV4, вовлеченный в дистальную спинальную мышечную атрофию (Fiorillo C et al.), HEAT-подобными повторами (как, например, ген, вовлеченный в болезнь Хантингтона), аннексин-подобными повторами, лейцин-богатыми повторами (как, например, гены NLRP2 и NLRP7, вовлеченные в идиопатическое привычное невынашивание беременности (Huang JY et al.)), ген LRRK2, вовлеченный в болезнь Паркинсона (Abeliovich A et al.), ген NLRP3, вовлеченный в болезнь Альцгеймера или менингит (Heneka MT et al.), ген NALP3, вовлеченный в почечную недостаточность (Knauf F et al.), или ген LRIG2, вовлеченный в урофациальный синдром (Stuart HM et al.), или доменами ингибитора сериновой протеазы (как, например, ген SPINK5, вовлеченный в синдром Незертона (Hovnanian A et al.), как описано в Andrade M.A. et al.

В контексте изобретения предпочтительной пре-мРНК или транскриптом является пре-мРНК или транскрипт дистрофина. Эта предпочтительная пре-мРНК или транскрипт предпочтительно являются человеческими. Заболевание, связанное с присутствием мутации, присутствующей в пре-мРНК дистрофина, представляет собой DMD или BMD, в зависимости от мутации. Предпочтительные комбинации и области первого и второго экзонов из пре-мРНК дистрофина, подлежащие применению в контексте изобретения, представлены в таблице 2.

В предпочтительном варианте осуществления соединение по изобретению используют для индукции пропускания экзона в клетке, в органе, в ткани и/или у пациента, предпочтительно у пациента с BMD или DMD или в клетке, органе, ткани, происходящих из указанного пациента. Пропускание экзона приводит к зрелой мРНК, которая не содержит пропущенного экзона, и, таким образом, когда указанный экзон кодирует аминокислоты, оно может приводить к экспрессии измененного, внутренне укороченного, но от частично до в большой степени функционального продукта дистрофина. Технология пропускания экзонов в настоящее время направлена на применение AON или транскрибирующих AON генных конструкций. Способы пропускания экзонов в настоящее время используют для борьбы с генетическими мышечными дистрофиями. Недавно авторами настоящего изобретения и другими исследователями были сообщены перспективные результаты в отношении терапии на основе индуцируемого AON пропускания экзонов, нацеленной на восстановление рамки считывания пре-мРНК дистрофина из мыши mdx и от пациентов с DMD (Heemskerk H., et al., Cirak S., et al., Goemans et al.). Путем направленного пропускания конкретного экзона тяжелый фенотип DMD (отсутствие функционального дистрофина) преобразуется в более мягкий фенотип BMD (экспрессия функционального или полуфункционального дистрофина). Пропускание экзона предпочтительно индуцируется связыванием AON, нацеленных на внутреннюю последовательность экзона.

Ниже изобретение иллюстрируется при помощи мутантной пре-мРНК дистрофина, где присутствуют первый и второй экзоны. Как определено в настоящем описании, пре-мРНК дистрофина предпочтительно означает пре-мРНК гена DMD, кодирующего белок дистрофина. Мутантная пре-мРНК дистрофина соответствует пре-мРНК пациента с BMD или DMD с мутацией по сравнению с пре-мРНК DMD дикого типа у здорового индивидуума, что приводит к (сниженным уровням) аберрантному белку (BMD), или к отсутствию функционального дистрофина (DMD). Пре-мРНК дистрофина также называют пре-мРНК DMD. Ген дистрофина также может быть называться геном DMD. Дистрофин и DMD могут использоваться в настоящем описании взаимозаменяемо.

Пациент предпочтительно означает пациента, имеющего DMD или BMD, как определено в настоящем описании ниже, или пациента, предрасположенного к развитию DMD или BMD вследствие его (или ее) генетического фона. В случае пациента с DMD, используемое соединение предпочтительно корректирует мутацию, присутствующую в гене DMD указанного пациента и, таким образом, предпочтительно образует белок дистрофина, сходный с белком дистрофина пациента с BMD: указанный белок предпочтительно представляет собой функциональный или полуфункциональный дистрофин, как определено в настоящем описании ниже. В случае пациента с BMD, антисмысловой олигонуклеотид по изобретению предпочтительно модифицирует мутацию, присутствующую в гене BMD указанного пациента и предпочтительно образует дистрофин, который является более функциональным, чем дистрофин, который исходно присутствует у указанного пациента с BMD.

Как определено в настоящем описании, функциональный дистрофин предпочтительно представляет собой дистрофин дикого типа, соответствующий белку, имеющему аминокислотную последовательность, как указано в SEQ ID NO: 1. Функциональный дистрофин предпочтительно представляет собой дистрофин, который имеет действующий связывающий домен в его N-концевой части (первые 240 аминокислот на N-конце), цистеин-богатый домен (аминокислоты с 3361 по 3685) и C-концевой домен (последние 325 аминокислот на C-конца), причем каждый из этих доменов присутствует в дистрофине дикого типа, как известно квалифицированному специалисту. Аминокислоты, указанные в настоящем описании, соответствуют аминокислотам дистрофина дикого типа, указанным в SEQ ID NO: 1. Иными словами, функциональный или полуфункциональный дистрофин представляет собой дистрофин, который проявляет по меньшей мере в некоторой степени активность дистрофина дикого типа. "По меньшей мере в некоторой степени" предпочтительно означает по меньшей мере 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100% соответствующей активности функционального дистрофина дикого типа. В этом контексте активность функционального дистрофина предпочтительно представляет собой связывание с актином и взаимодействие с ассоциированным с дистрофином гликопротеиновым комплексом (DGC) или (DAGC) (Ehmsen J et al.). Связывание дистрофина с актином и с комплексом DGC можно визуализировать либо посредством ко-иммунопреципитации с использованием экстрактов тотального белка, либо посредством иммунофлуоресцентного анализа поперечных срезов из биоптата мышцы, предположительно являющейся дистрофичной, как известно квалифицированному специалисту.

Индивидуумы, страдающие DMD, как правило, имеют мутацию в гене, кодирующем дистрофин, которая препятствует синтезу полного белка, например, преждевременный стоп-кодон препятствует синтезу C-конца. При BMD ген дистрофина также содержит мутацию, однако эта мутация не нарушает открытую рамку считывания и синтезируется C-конец. В результате образуется (полу)функциональный или функциональный белок дистрофин, который обладает сходным типом активности с белком дикого типа, хотя и не обязательно сходным уровнем активности. Геном индивидуума с BMD, как правило, кодирует белок дистрофин, содержащий N-концевую часть (первые 240 аминокислот на N-конце), цистеин-богатый домен (аминокислоты с 3361 по 3685) и C-концевой домен (последние 325 аминокислот на C-конце), однако в большинстве случаев его центральный домен в форме стержня может быть короче, чем у дистрофина дикого типа (Monaco A.P., et al.).

Пропускание экзонов для лечения DMD, как правило, относится к обходу преждевременного стоп-кодона в пре-мРНК путем пропускания экзона, фланкирующего или содержащего мутацию. Это позволяет коррекцию открытой рамки считывания и синтез внутренне укороченного белка дистрофина, но включающего C-конец. В предпочтительном варианте осуществления у индивидуума, имеющего DMD и подвергаемого лечению олигонуклеотидом по изобретению, синтезируется дистрофин, который проявляет, по меньшей мере в некоторой степени, сходную активность с дистрофином дикого типа. Более предпочтительно, если указанный индивидуум является пациентом с DMD или предположительно является пациентом с DMD, (полу)функциональный дистрофин представляет собой дистрофин индивидуума, имеющего BMD: как правило, указанный дистрофин способен взаимодействовать как с актином, так и с DGC или DAGC (Ehmsen J., et al., Monaco A.P., et al.).

Центральный стержневой домен дистрофина дикого типа содержит 24 спектрин-подобных повтора (Ehmsen J., et al.). Во многих случаях центральный стержневой домен в BMD-подобных белках является более коротким, чем в дистрофине дикого типа (Monaco A.P., et al.). Например, центральный стержневой домен дистрофина, как предусматривается в настоящем описании, может содержать от 5 до 23, от 10 до 22 или от 12 до 18 спектрин-подобных повторов при условии, что он может связываться с актином и с DGC.

Смягчение одного или нескольких симптомов DMD или BMD у индивидуума с использованием соединения по изобретению можно оценивать с помощью любого из следующих анализов: продление времени до прекращения хождения, увеличение мышечной силы, повышение способности поднимать тяжести, улучшение времени вставания с пола, улучшение времени ходьбы на девять метров, улучшение времени подъема на четыре ступеньки, улучшение степени функции ног, улучшение легочной функции, улучшение сердечной функции, улучшение качества жизни. Каждый из этих анализов известен квалифицированному специалисту. В качестве примера, в публикации Manzur et al. (Manzur A.Y. et al.) приводится обширное пояснение каждого из этих анализов. Для каждого из этих анализов, когда выявляют поддающееся обнаружению улучшение или продление параметра, измеряемого в анализе, это предпочтительно означает, что один или несколько симптомов DMD или BMD смягчились у индивидуума с использованием соединения по изобретению. Поддающееся обнаружению улучшение или продление предпочтительно представляет собой статистически значимое улучшение или продление, как описано в Hodgetts et al. (Hodgetts S., et al.). Альтернативно, смягчение одного или нескольких симптомов DMD или BMD можно оценивать посредством измерения улучшения функции, целостности и/или выживаемости мышечных волокон. В предпочтительном способе один или несколько симптомов пациента с DMD или BMD смягчается и/или одна или несколько характеристик одной или нескольких мышечных клеток от пациента с DMD или BMD улучшается. Такие симптомы или характеристики можно оценивать на клеточном, тканевом уровне или у самого пациента.

Смягчение одной или нескольких характеристик мышечной клетки от пациента с DMD или BMD можно оценивать с помощью любого из следующих анализов на миогенной клетке или мышечной клетке от этого пациента: сниженный захват кальция мышечными клетками, сниженный синтез коллагена, измененная морфология, измененный биосинтез липидов, сниженный окислительный стресс и/или улучшенная функция, целостность и/или выживаемость мышечных волокон. Эти параметры обычно оценивают с использованием иммунофлуоресцентных и/или гистохимических анализов поперечных срезов биоптатов мышц.

Улучшение функции, целостности и/или выживаемости мышечных волокон можно оценивать с использованием по меньшей мере одного из следующих анализов: поддающееся обнаружению снижение уровня креатинкиназы в крови, поддающееся обнаружению снижение некроза мышечных волокон в поперечном срезе биоптата мышцы, предположительно являющейся дистрофической, и/или поддающееся обнаружению повышение гомогенности диаметра мышечных волокон в поперечном срезе биоптата мышцы, предположительно являющейся дистрофической. Каждый из этих анализов известен квалифицированному специалисту.

Креатинкиназу можно выявлять в крови, как описано в Hodgetts et al. (Hodgetts S., et al.). Поддающееся обнаружению снижение креатинкиназы может означать снижение на 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или более по сравнению с концентрацией креатинкиназы у того же пациента с DMD или BMD до лечения.

Поддающееся обнаружению снижение некроза мышечных волокон предпочтительно оценивают в биоптате мышц, более предпочтительно, как описано в Hodgetts et al. (Hodgetts S., et al.), с использованием поперечных срезов биоптатов. Поддающееся обнаружению снижение некроза может представлять собой снижение, составляющее 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или более от площади, где идентифицирован некроз с использованием поперечных срезов биоптатов. Снижение измеряют путем сравнения с некрозом, как оценивают у того же пациента с DMD или BMD до лечения.

Поддающееся обнаружению повышение гомогенности диаметра мышечных волокон предпочтительно оценивают в поперечном срезе биоптата, более предпочтительно, как описано в Hodgetts et al. (Hodgetts S., et al.). Увеличение измеряют путем сравнения с гомогенностью диаметра мышечного волокна у того же пациента с DMD или BMD до лечения.

Предпочтительно, олигонуклеотид по изобретению обеспечивает у указанного индивидуума (более высокие уровни) функциональный и/или (полу)функциональный белок дистрофин (как для DMD, так и для BMD) и/или способен, по меньшей мере частично, снижать продукцию аберрантного белка дистрофина у указанного индивидуума. В этом контексте, функциональный и/или полуфункциональный дистрофин может означать, что может образовываться несколько форм функционального и/или полуфункционального дистрофина. Этого можно ожидать, когда область с по меньшей мере 50% идентичностью между первым и вторым экзонами перекрывается с одной или несколькими другими областями с по меньшей мере 50% идентичностью между другими первым и вторым экзонами, и где указанный олигонуклеотид способен связываться с указанной перекрывающейся частью, так что несколько различных участков экзонов пропускается и продуцируется несколько различных транскриптов в рамке считывания. Эта ситуация иллюстрируется в примере 4, где один единственный олигонуклеотид по изобретению (PS816; SEQ ID NO: 1679) способен индуцировать продукцию нескольких транскриптов в рамке считывания, все из которых имеют общий экзон 10 в качестве первого экзона, и где второй экзон может представлять собой экзон 13, 14, 15, 18, 20, 27, 30, 31, 32, 35, 42, 44, 47, 48 или 55.

Более высокие уровни относятся к увеличению уровня функционального и/или (полу)функционального белка дистрофина по сравнению с соответствующим уровнем функционального и/или (полу)функционального белка дистрофина у пациента до начала лечения олигонуклеотидом по изобретению. Уровень указанного функционального и/или (полу)функционального белка дистрофина предпочтительно оценивают с использованием иммунофлуоресцентного анализа или анализа с использованием вестерн-блоттинга (белок).

Снижение продукции аберрантной мРНК дистрофина или аберрантного белка дистрофина предпочтительно означает, что 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% или менее от первоначального количества аберрантной мРНК дистрофина или аберрантного белка дистрофина все еще поддается обнаружению с помощью ОТ-ПЦР (мРНК) или иммунофлуоресцентного анализа или анализа с использованием вестерн-блоттинга (белок). Аберрантную мРНК или белок дистрофина также обозначают в настоящем описании как менее функциональную (по сравнению с функциональным белком дистрофина дикого типа, как определено в настоящем описании ранее) или нефункциональную мРНК или белок дистрофина. Нефункциональный белок дистрофина предпочтительно представляет собой белок дистрофина, который не способен связывать актин и/или представителей белкового комплекса DGC. Нефункциональный белок дистрофина или мРНК дистрофина, как правило, не обладает или не кодирует белок дистрофина с интактным C-концом белка. В предпочтительном варианте осуществления используют способ пропускания экзонов (также называемый модулированием РНК или переключением сплайсинга).

Увеличение продукции функциональной и/или полуфункциональной мРНК и/или белка дистрофина предпочтительно означает, что такая функциональная и/или полуфункциональная мРНК и/или белок дистрофина поддаются обнаружению или увеличены по меньшей мере на 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или более по сравнению с выявляемым количеством указанной мРНК и/или белка в начале лечения. Указанное выявление можно осуществлять с использованием ОТ-ПЦР (мРНК) или иммунофлуоресцентного анализа или анализа с использованием вестерн-блоттинга (белок).

В другом варианте осуществления соединение по изобретению обеспечивает у указанного индивидуума функциональный или полуфункциональный белок дистрофина. Этот функциональный или полуфункциональный белок или мРНК дистрофина можно выявлять в качестве аберрантного белка или мРНК дистрофина, как пояснено в настоящем описании выше.

Посредством направленного совместного пропускания указанных двух экзонов (указанный первый и указанный второй экзоны) можно индуцировать пропускание дополнительного экзона(ов), где указанный дополнительный экзон(ы) предпочтительно расположен между указанным первым и указанным вторым экзонами, и где полученный транскрипт дистрофина находится в рамке считывания (предпочтительно, как в таблице 1 или 6), фенотип DMD или тяжелой BMD преобразуется в более мягкий фенотип BMD или даже бессимптомный фенотип. Совместное пропускание указанных двух экзонов предпочтительно индуцируется связыванием олигонуклеотида с областью первого экзона в пре-мРНК дистрофина и связыванием олигонуклеотида с областью второго экзона в пре-мРНК дистрофина, где указанная область указанного второго экзона обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона. Предпочтительно, указанный первый и указанный второй экзоны дистрофина и области идентичности в них представлены в таблице 2 или 6. Указанный олигонуклеотид предпочтительно не обладает перекрыванием с последовательностями не экзонов. Указанный олигонуклеотид предпочтительно не перекрывается с участками сплайсинга, по меньшей мере не в той степени, в какой они присутствуют в интроне. Указанный олигонуклеотид, направленный на внутреннюю последовательность экзона, предпочтительно не содержит последовательность, обратно комплементарную соседнему интрону. Способ пропускания экзонов предпочтительно используют так, что отсутствие указанных двух экзонов, предпочтительно дополнительного экзона(ов), более предпочтительно расположенного между указанным первым и указанным вторым экзонами, из мРНК, продуцированной с пре-мРНК DMD, образует кодирующую область для (более высокой) экспрессии более (полу)функционального - хотя и более короткого - белка дистрофина. В этом контексте (как правило, у пациента с BMD), ингибирование включения указанных двух экзонов, предпочтительно дополнительного экзона(ов), расположенных между указанным первым и указанным вторым экзонами, предпочтительно означает, что:

- уровень исходной аберрантной (менее функциональной) мРНК дистрофина снижен по меньшей мере на 5% при оценке способом ОТ-ПЦР, или уровень соответствующего аберрантного белка дистрофина снижается по меньшей мере на 2% при оценке с помощью иммунофлуоресцентного анализа или анализа с использованием вестерн-блоттинга с использованием антител против дистрофина; и/или

- транскрипт в рамке считывания, кодирующий полуфункциональный или функциональный белок дистрофин, поддается обнаружению или его уровень возрастает по меньшей мере на 5% при оценке способом ОТ-ПЦР (уровень мРНК) или по меньшей мере на 2% при оценке с помощью иммунофлуоресцентного анализа или вестерн-блоттинга с использованием антител против дистрофина (белковый уровень).

Снижение аберрантного менее функционального или нефункционального белка дистрофина предпочтительно составляет по меньшей мере 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или 100%, и предпочтительно оно происходит одновременно или параллельно выявлению или увеличенной продукции более функционального или полуфункционального транскрипта или белка дистрофина. В этом контексте (как правило, у пациента с DMD), ингибирование включения указанных двух экзонов, предпочтительно дополнительного экзона(ов), расположенного между указанным первым и указанным вторым экзонами, предпочтительно означает, что у указанного индивидуума обеспечивается (более высокий уровень) более функциональный или (полу)функциональный белок или мРНК дистрофина.

После того, как у пациента с DMD обеспечивают (более высокие уровни) (более) функциональный или полуфункциональный белок дистрофина, причина DMD, по меньшей мере частично, смягчается. Таким образом, можно ожидать, что симптомы DMD в достаточной степени снижаются. Кроме того, настоящее изобретение относится к пониманию того, что пропускание всего участка из по меньшей мере двух экзонов дистрофина в пре-мРНК, содержащей указанные экзоны, индуцируется или усиливается при использовании единственного олигонуклеотида, направленного на (или способного связываться с, или гибридизоваться с, или являющегося обратно комплементарным или способного нацеливаться на) оба из внешних экзона указанного участка. В настоящей заявке, в предпочтительном варианте осуществления олигонуклеотид по изобретению, таким образом, по меньшей мере на 80% обратно комплементарен указанной области указанного первого экзона и по меньшей мере на 45% обратно комплементарен указанной области указанного второго экзона, как определено в настоящем описании, где указанные первый и второй экзоны соответствуют наружным экзонам участка экзонов, подлежащего пропусканию. Более предпочтительно, указанный олигонуклеотид по меньшей мере на 85%, 90% 95% или 100% обратно комплементарен указанной области указанного первого экзона и по меньшей мере на 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100% обратно комплементарен указанной области указанного второго экзона. Увеличенная частота пропускания также увеличивает уровень более (полу)функционального белка дистрофина, продуцированного в мышечной клетки индивидуума с DMD или BMD.

Олигонуклеотид в соответствии с настоящим изобретением, который предпочтительно используют, предпочтительно является обратно комплементарным или способен связываться, или гибридизоваться, или нацеливаться на область первого экзона дистрофина, причем указанная область имеет по меньшей мере 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 или более нуклеотидов, предпочтительно является обратно комплементарной или способна связываться, или гибридизоваться, или нацеливаться на область второго экзона дистрофина, причем указанная область имеет по меньшей мере 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 или более нуклеотидов, где указанная область указанного второго экзона в той же пре-мРНК обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона.

В контексте изобретения олигонуклеотид может содержать или состоять из функционального эквивалента олигонуклеотида. Функциональный эквивалент олигонуклеотида предпочтительно означает олигонуклеотид, как определено в настоящем описании, где один или несколько нуклеотидов заменены, и где активность указанного функционального эквивалента сохраняется по меньшей мере в некоторой степени. Предпочтительно, активность указанного соединения, содержащего функциональный эквивалент олигонуклеотида, представляет собой обеспечение функционального или полуфункционального белка дистрофина. Указанную активность указанного соединения, содержащего функциональный эквивалент олигонуклеотида, таким образом, предпочтительно оценивают путем количественного определения функционального или полуфункционального белка дистрофина. Функциональный или полуфункциональный дистрофин предпочтительно определяют в рамках настоящего изобретения как представляющий собой дистрофин, способный связываться с актином и представителями комплекса белков DGC и поддерживать структуру и гибкость мембран мышечных волокон. Оценка указанной активности соединения, содержащего функциональный олигонуклеотид или эквивалент, предпочтительно включает ОТ-ПЦР (для обнаружения пропускания экзона на уровне РНК) и/или иммунофлуоресценцию или анализ с использованием вестерн-блоттинга (для обнаружения экспрессии и локализации белка). Указанная активность предпочтительно сохраняется, по меньшей мере в некоторой степени, когда она соответствует по меньшей мере 50%, или по меньшей мере 60%, или по меньшей мере 70%, или по меньшей мере 80%, или по меньшей мере 90%, или по меньшей мере 95% или более соответствующей активности указанного соединения, содержащего олигонуклеотид, из которого происходит функциональный эквивалент. На протяжении настоящей заявки, когда используют слово "олигонуклеотид", оно может быть заменено его функциональным эквивалентом, как определено в настоящем описании.

Таким образом, применение олигонуклеотида или его функционального эквивалента, содержащего или состоящего из последовательности:

которая способна связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарной области первого экзона дистрофина,

которая способна связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарной области второго экзона дистрофина,

и

где указанная область второго экзона в пре-мРНК дистрофина обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона, проявляет терапевтические результаты в отношении DMD посредством:

- смягчения одного или нескольких симптомов DMD или BMD; и/или

- смягчения одной или нескольких характеристик мышечной клетки от пациента; и/или

- обеспечения у указанного индивидуума функционального или полуфункционального белка дистрофина; и/или

- по меньшей мере частичного снижения продукции аберрантного белка дистрофина у указанного индивидуума.

Каждый из этих признаков уже определен в настоящем описании.

Предпочтительно, олигонуклеотид содержит или состоит из последовательности, которая способна связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарной области первого экзона DMD или дистрофина, где область второго экзона DMD или дистрофина в той же пре-мРНК обладает по меньшей мере 50% идентичностью с указанной областью указанного первого экзона. Указанные первый и второй экзоны предпочтительно выбирают из группы экзонов, включающей экзоны с 8 по 60, где участок экзонов, начинающийся с первого экзона и содержащий второй экзон в качестве последнего экзона, участок экзонов, начинающийся первым экзоном и содержащий второй экзон в качестве последнего экзона, когда он пропускается, обеспечивает транскрипт в рамке считывания. Предпочтительные комбинации экзонов в рамке считывания в мРНК дистрофина приведены в таблице 1, 2 или 6.

Без связи с какой-либо теорией, идентичность первого и второго экзонов дистрофина можно определять с помощью одного или нескольких из следующих аспектов. В одном варианте осуществления один или несколько интронов, присутствующих между первым экзоном и вторым экзоном, не являются чрезмерно большими. В этом контексте, чрезмерно большой интрон в гене дистрофина может составлять 70, 80, 90, 100, 200 т.п.н. или более; например, интрон 1 (~83 т.п.н.), интрон 2 (~170 т.п.н.), интрон 7 (~110 т.п.н.), интрон 43 (~70 т.п.н.), интрон 44 (~248 т.п.н.), интрон 55 (~119 т.п.н.) или интрон 60 (~96 т.п.н.). Кроме того, в следующем варианте осуществления может предусматриваться пример уже пациента с BMD, у которого экспрессируется укороченный белок дистрофин, где этот первый, этот второй экзон и участок экзонов от указанного первого экзона до указанного второго экзона удалены. Другим критерием может быть относительно большая применимость пропущенных экзонов для объединенных субпопуляций пациентов с DMD (и/или BMD) с конкретными соответствующими мутациями.

В предпочтительном варианте осуществления пропускается участок экзонов DMD в рамке считывания (более предпочтительно, полностью пропускается в одном транскрипте), где наружные экзоны определяются первым и вторым экзонами следующим образом:

- первый экзон представляет собой экзон 8, и второй экзон представляет собой экзон 19 (применимо для ~7% пациентов с DMD),

- первый экзон представляет собой экзон 9, и второй экзон представляет собой экзон 22 (применимо для ~11% пациентов с DMD),

- первый экзон представляет собой экзон 9, и второй экзон представляет собой экзон 30 (применимо для ~14% пациентов с DMD),

- первый экзон представляет собой экзон 10, и второй экзон представляет собой экзон 18 (применимо для ~5% пациентов с DMD),

- первый экзон представляет собой экзон 10 и второй экзон представляет собой экзон 30 (применимо для ~13% пациентов с DMD),

- первый экзон представляет собой экзон 10, и второй экзон представляет собой экзон 42 (применимо для ~16% пациентов с DMD),

- первый экзон представляет собой экзон 10, и второй экзон представляет собой экзон 47 (применимо для ~29% пациентов с DMD),

- первый экзон представляет собой экзон 10, и второй экзон представляет собой экзон 57 (применимо для ~72% пациентов с DMD),

- первый экзон представляет собой экзон 10, и второй экзон представляет собой экзон 60 (применимо для ~72% пациентов с DMD),

- первый экзон представляет собой экзон 11, и второй экзон представляет собой экзон 23 (применимо для ~8% пациентов с DMD),

- первый экзон представляет собой экзон 13 и второй экзон представляет собой экзон 30 (применимо для ~10% пациентов с DMD),

- первый экзон представляет собой экзон 23, и второй экзон представляет собой экзон 42 (применимо для ~7% пациентов с DMD),

- первый экзон представляет собой экзон 34 и второй экзон представляет собой экзон 53 (применимо для ~42% пациентов с DMD),

- первый экзон представляет собой экзон 40, и второй экзон представляет собой экзон 53 (применимо для ~38% пациентов с DMD),

- первый экзон представляет собой экзон 44, и второй экзон представляет собой экзон 56 (применимо для ~40% пациентов с DMD),

- первый экзон представляет собой экзон 45, и второй экзон представляет собой экзон 51 (применимо для ~17% пациентов с DMD)

- первый экзон представляет собой экзон 45 и второй экзон представляет собой экзон 53 (применимо для ~28% пациентов с DMD),

- первый экзон представляет собой экзон 45, и второй экзон представляет собой экзон 55 (применимо для ~33% пациентов с DMD),

- первый экзон представляет собой экзон 45, и второй экзон представляет собой экзон 60 (применимо для ~37% пациентов с DMD), или

- первый экзон представляет собой экзон 56, и второй экзон представляет собой экзон 60 (применимо для ~2% пациентов с DMD).

Таким образом, в одном варианте осуществления олигонуклеотид по изобретению индуцирует пропускание следующих экзонов дистрофина: экзоны с 8 по 19, экзоны с 9 по 22, экзоны с 9 по 30, экзоны с 10 по 18, экзоны с 10 по 30, экзоны с 10 по 42, экзоны с 10 по 47, экзоны с 10 по 57, экзоны с 10 по 60, экзоны с 11 по 23, экзоны с 13 по 30, экзоны с 23 по 42, экзоны с 34 по 53, экзоны с 40 по 53, экзоны с 44 по 56, экзоны с 45 по 51, экзоны с 45 по 53, экзоны с 45 по 55, экзоны с 45 по 60 или экзоны с 56 по 60.

Предпочтительно, олигонуклеотид по изобретению содержит или состоит из последовательности, которая способна связываться с, нацеливаться на, гибридизоваться с и/или является обратно комплементарной области первого экзона пре-мРНК дистрофина, так что обратно комплементарная часть составляет по меньшей мере 30% длины указанного олигонуклеотида по изобретению, более предпочтительно по меньшей мере 40%, еще более предпочтительно по меньшей мере 50%, еще более предпочтительно по меньшей мере 60%, еще более предпочтительно по меньшей мере 70%, еще более предпочтительно по меньшей мере 80%, еще более предпочтительно по меньшей мере 90% или еще более предпочтительно по меньшей мере 95%, или еще более предпочтительно 98% и наиболее предпочтительно вплоть до 100%. В этом контексте первый экзон предпочтительно представляет собой экзон 8, 9, 10, 11, 13, 23, 34, 40, 44, 45 или 56 пре-мРНК дистрофина, как определено в настоящем описании. Указанный олигонуклеотид может содержать дополнительные фланкирующие последовательности. В более предпочтительном варианте осуществления длина указанной обратно комплементарной части указанного олигонуклеотида составляет по меньшей мере 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 или 40 нуклеотидов. Можно использовать несколько типов фланкирующих последовательностей. Предпочтительно, фланкирующие последовательности используют для модификации связывания белка с указанным олигонуклеотидом или для модификации термодинамического свойства указанного олигонуклеотида, более предпочтительно для модификации аффинности связывания РНК-мишени. В другом предпочтительном варианте осуществления дополнительные фланкирующие последовательности являются обратно комплементарными последовательностям пре-мРНК дистрофина, которые не присутствуют в указанном экзоне.

В предпочтительном варианте осуществления олигонуклеотид содержит или состоит из последовательности, которая способна связываться с, нацеливаться на, гибридизоваться с и является обратно комплементарной по меньшей мере области первого и области второго экзона дистрофина, присутствующей в пре-мРНК дистрофина, где указанные первый и второй экзоны выбраны из группы экзонов 8 (SEQ ID NO: 2), 9 (SEQ ID NO: 3), 10 (SEQ ID NO: 4), 11 (SEQ ID NO: 1761), 13 (SEQ ID NO: 1762),18 (SEQ ID NO: 5), 19 (SEQ ID NO: 6), 22 (SEQ ID NO: 7), 23 (SEQ ID NO: 8), 30 (SEQ ID NO: 9), 34 (SEQ ID NO: 1763), 40 (SEQ ID NO: 1764), 42 (SEQ ID NO: 11), 44 (SEQ ID NO: 1765), 45 (SEQ ID NO: 12), 47 (SEQ ID NO: 10), 51 (SEQ ID NO: 1760), 53 (SEQ ID NO: 13), 55 (SEQ ID NO: 14), 56 (SEQ ID NO: 15), 57 (SEQ ID NO: 1744) или 60 (SEQ ID NO: 16) и указанные области имеют по меньшей мере 10 нуклеотидов. Однако указанные области также могут иметь по меньшей мере 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 или более нуклеотидов. Для предпочтительных экзонов, указанных выше, квалифицированный специалист способен идентифицировать область первого экзона и область второго экзона с использованием способов, известных в данной области. Более предпочтительно используют сетевой инструмент EMBOSS Matcher, как пояснено выше. Еще более предпочтительно, предпочтительные области идентичности первого и второго экзонов дистрофина, с которыми олигонуклеотид по изобретению предпочтительно связывается и/или для которых он является, по меньшей мере частично, обратно комплементарным, представлены в таблице 2. Обратная комплементарность в этом контексте предпочтительно составляет по меньшей мере 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100%. Предпочтительная олигонуклеотидная последовательность, подлежащая применению в рамках изобретения, способна связываться с, гибридизоваться с, нацеливаться на и/или является обратно комплементарной области идентичности между указанными первым и вторым экзонами, предпочтительно из таблицы 2, и имеет длину по меньшей мере 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 или 40 нуклеотидов, более предпочтительно менее 40 нуклеотидов или более предпочтительно менее 30 нуклеотидов, еще более предпочтительно менее 25 нуклеотидов и наиболее предпочтительно от 20 до 25 нуклеотидов. Обратная комплементарность в этом контексте предпочтительно составляет по меньшей мере 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 100%.

В одном варианте осуществления предпочтительный олигонуклеотид является таким, что первый и второй экзоны дистрофина являются такими, как указано в таблице 1, 2 или 6, и указанный олигонуклеотид способен связываться с соответствующими областями первого и второго экзонов, как указано в таблице 2 или 6 и как определяется SEQ ID NO: 17-1670, 1742, 1743 или 1766-1777.

Предпочтительные олигонуклеотиды описаны в таблице 3 и содержат или состоят из SEQ ID NO: 1671-1741. Другие предпочтительные олигонуклеотиды содержат или состоят из SEQ ID NO: 1778-1891, как описано в таблице 6. Предпочтительные олигонуклеотиды содержат SEQ ID NO: 1671-1741 или 1778-1891 и имеют на 1, 2, 3, 4 или 5 нуклеотидов больше или на 1, 2, 3, 4 или 5 нуклеотидов меньше, чем их точный SEQ ID NO, как указано в таблице 3 или 6. Эти дополнительные нуклеотиды могут присутствовать на 5'- или 3'-стороне данного SEQ ID NO. Эти отсутствующие нуклеотиды могут представлять собой нуклеотиды, присутствующие на 5'- или 3'-стороне данного SEQ ID NO. Каждый из этих олигонуклеотидов может иметь любую химическую структуру, как определено в настоящем описании ранее или их комбинации. В каждом из олигонуклеотидов, указанных в настоящем описании с помощью SEQ ID NO, U может быть заменен на T.

Более предпочтительные олигонуклеотиды приведены ниже.

Если первый экзон дистрофина представляет собой экзон 8 и второй экзон дистрофина представляет собой экзон 19, предпочтительная область экзона 8 содержит или состоит из SEQ ID NO: 17, и предпочтительная область экзона 19 содержит или состоит из SEQ ID NO: 18. Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1722 или 1723 или содержит SEQ ID NO: 1722 или 1723, и имеет длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 13, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 101, и предпочтительная область экзона 13 содержит или состоит из SEQ ID NO: 102.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 14, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 103, и предпочтительная область экзона 14 содержит или состоит из SEQ ID NO: 104.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 15, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 105, и предпочтительная область экзона 15 содержит или состоит из SEQ ID NO: 106.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 18, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 109, и предпочтительная область экзона 18 содержит или состоит из SEQ ID NO: 110. Предпочтительные олигонуклеотиды содержат:

- последовательность оснований, определяемую любой из SEQ ID NO: 1679-1681, 1778, 1812, 1813, 1884-1886, 1890 или 1891 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую SEQ ID NO: 1814 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1815-1819 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1820, 1824 и имеющую длину 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1826, 1782, 1832 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1821, 1825, 1780 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1822 и имеющую длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1823, 1781, 1829, 1830, 1831 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов,

- последовательность оснований, определяемую любой из SEQ ID NO: 1887 и имеющую длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1888 или 1889 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую SEQ ID NO: 1827 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую SEQ ID NO: 1828 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 18, другая предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 1766, и другая предпочтительная область экзона 18 содержит или состоит из SEQ ID NO: 1767. Предпочтительные олигонуклеотиды содержат последовательность оснований, определяемую любой из SEQ ID NO: 1783, 1833, 1834, 1835 и имеющую длину 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 18, другая предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 1768, и другая предпочтительная область экзона 18 содержит или состоит из SEQ ID NO: 1769. Предпочтительные олигонуклеотиды содержат последовательность оснований, определяемую любой из SEQ ID NO: 1673 или 1674 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 20, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 111, и предпочтительная область экзона 20 содержит или состоит из SEQ ID NO: 112.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 27, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 121, и предпочтительная область экзона 27 содержит или состоит из SEQ ID NO: 122.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 30, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 127, и предпочтительная область экзона 30 содержит или состоит из SEQ ID NO: 128. Предпочтительные олигонуклеотиды содержат:

- последовательность оснований, определяемую любой из SEQ ID NO: 1679-1681, 1812, 1813, 1884-1886, 1890 или 1891 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую SEQ ID NO: 1814 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую SEQ ID NO: 1675 или 1676 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую SEQ ID NO: 1677 или 1678 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1784, 1836 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1786, 1838 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1780 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1785, 1837 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 30, другая предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 1772, и другая предпочтительная область экзона 30 содержит или состоит из SEQ ID NO: 1773. Предпочтительные олигонуклеотиды содержат:

- последовательность оснований, определяемую любой из SEQ ID NO: 1688, 1689, 1839, 1840, 1841, 1842, 1843 или 1844 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1845, 1846, 1847, 1848 и имеющую длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1849, 1850 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1787, 1851 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 31, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 129, и предпочтительная область экзона 31 содержит или состоит из SEQ ID NO: 130.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 32, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 131, и предпочтительная область экзона 32 содержит или состоит из SEQ ID NO: 132.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 35, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 137, и предпочтительная область экзона 35 содержит или состоит из SEQ ID NO: 138.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 42, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 151, и предпочтительная область экзона 42 содержит или состоит из SEQ ID NO: 152.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 44, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 153, и предпочтительная область экзона 44 содержит или состоит из SEQ ID NO: 154.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 47, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 157, и предпочтительная область экзона 47 содержит или состоит из SEQ ID NO: 158.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 48, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 159, и предпочтительная область экзона 48 содержит или состоит из SEQ ID NO: 160.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 55, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 167, и предпочтительная область экзона 55 содержит или состоит из SEQ ID NO: 168.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 57, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 169, и предпочтительная область экзона 57 содержит или состоит из SEQ ID NO: 170.

Если первый экзон дистрофина представляет собой экзон 10 и второй экзон дистрофина представляет собой экзон 60, предпочтительная область экзона 10 содержит или состоит из SEQ ID NO: 173, и предпочтительная область экзона 60 содержит или состоит из SEQ ID NO: 174.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1673 или содержит SEQ ID NO: 1673 и имеет длину 25, 26, 27, 28, 29 или 30 нуклеотидов.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1675 или содержит SEQ ID NO: 1675 и имеет длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1677 или содержит SEQ ID NO: 1677 и имеет длину 25, 26, 27, 28, 29 или 30 нуклеотидов.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1679 или содержит SEQ ID NO: 1679 и имеет длину 25, 26, 27, 28, 29 или 30 нуклеотидов. Предпочтительный олигонуклеотид содержит последовательность оснований SEQ ID NO: 1679 и имеет длину 25, 26, 27, 28, 29 или 30 нуклеотидов. Необязательно, 1, 2, 3, 4, 5, 6, 7 из U в SEQ ID NO: 1679 заменены на T. В предпочтительном варианте осуществления все U в SEQ ID NO: 1679 заменен/заменены на T. Предпочтительный олигонуклеотид, содержащий SEQ ID NO: 1679, содержит любую из химических структур, определенных в настоящем описании выше: модификацию основания и/или модификацию сахара и/или модификацию основной цепи.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1681 или содержит SEQ ID NO: 1681 и имеет длину 25, 26, 27, 28, 29 или 30 нуклеотидов.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1684 или содержит SEQ ID NO: 1684 и имеет длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1685 или содержит SEQ ID NO: 1685 и имеет длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1686 или содержит SEQ ID NO: 1686 и имеет длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1688 или содержит SEQ ID NO: 1688 и имеет длину 26, 27, 28, 29 или 30 нуклеотидов. Предпочтительный олигонуклеотид содержит последовательность оснований SEQ ID NO: 1688 и имеет длину 26, 27, 28, 29 или 30 нуклеотидов. Необязательно, 1, 2, 3, 4, 5, 6 из U в SEQ ID NO: 1688 заменен/заменены на T. В предпочтительном варианте осуществления все U в SEQ ID NO: 1688 заменены на T. Предпочтительный олигонуклеотид, содержащий SEQ ID NO: 1688, содержит любую из химических структур, определенных в настоящем описании выше: модификацию основания и/или модификацию сахара и/или модификацию основной цепи.

Для каждого из олигонуклеотидов, соответствующих SEQ ID NO: 1673, 1675, 1677, 1679, 1681, 1684, 1685, 1686 и 1688, первый экзон дистрофина представляет собой экзон 10. Однако второй экзон дистрофина представляет собой экзон 13, 14, 15, 18, 20, 27, 30, 31, 32, 35, 42, 44, 47, 48, 55, 57 или 60. Это означает, что при использовании любого из этих олигонуклеотидов может произойти образование нескольких транскриптов в рамке считывания, каждый из которых приводит к продукции укороченного, но (полу)функционального белка дистрофина.

Если первый экзон дистрофина представляет собой экзон 11 и второй экзон дистрофина представляет собой экзон 23, предпочтительная область экзона 23 содержит или состоит из SEQ ID NO: 191, и предпочтительная область экзона 23 содержит или состоит из SEQ ID NO: 192. Предпочтительные олигонуклеотиды содержат:

- последовательность оснований, определяемую любой из SEQ ID NO: 1794, 1861, 1795, 1862 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1796, 1863, 1797, 1864 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1798, 1865, 1799, 1866 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 13 и второй экзон дистрофина представляет собой экзон 30, предпочтительная область экзона 13 содержит или состоит из SEQ ID NO: 285, и предпочтительная область экзона 30 содержит или состоит из SEQ ID NO: 286. Предпочтительные олигонуклеотиды содержат:

- последовательность оснований, определяемую любой из SEQ ID NO: 1808, 1867, 1809, 1868, 1810, 1869, 1858, 1873 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов,

- последовательность оснований, определяемую любой из SEQ ID NO: 1811, 1870, 1859, 1874 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1856, 1871, 1860, 1875 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1857, 1872 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 23 и второй экзон дистрофина представляет собой экзон 42, предпочтительная область экзона 23 содержит или состоит из SEQ ID NO: 776, и предпочтительная область экзона 42 содержит или состоит из SEQ ID NO: 777. Предпочтительные олигонуклеотиды содержат или состоят из SEQ ID NO: 1698-1703.

Если первый экзон дистрофина представляет собой экзон 34 и второй экзон дистрофина представляет собой экзон 53, предпочтительная область экзона 34 содержит или состоит из SEQ ID NO: 1294, и предпочтительная область экзона 53 содержит или состоит из SEQ ID NO: 1295. Предпочтительные олигонуклеотиды содержат:

- последовательность оснований, определяемую любой из SEQ ID NO: 1800, 1876, 1801, 1877 и имеющую длину 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1802, 1878, 1803, 1879 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 40 и второй экзон дистрофина представляет собой экзон 53, предпочтительная область экзона 40 содержит или состоит из SEQ ID NO: 1477, и предпочтительная область экзона 53 содержит или состоит из SEQ ID NO: 1478. Предпочтительные олигонуклеотиды содержат:

- последовательность оснований, определяемую любой из SEQ ID NO: 1804, 1880 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

- последовательность оснований, определяемую любой из SEQ ID NO: 1805, 1881 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 44 и второй экзон дистрофина представляет собой экзон 56, предпочтительная область экзона 44 содержит или состоит из SEQ ID NO: 1577, и предпочтительная область экзона 56 содержит или состоит из SEQ ID NO: 1558. Предпочтительные олигонуклеотиды содержат последовательность оснований, определяемую любой из SEQ ID NO: 1806, 1882, 1807, 1883 и имеющую длину 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 45 и второй экзон дистрофина представляет собой экзон 51, предпочтительная область экзона 45 содержит или состоит из SEQ ID NO: 1567, и предпочтительная область экзона 51 содержит или состоит из SEQ ID NO: 1568. Предпочтительные олигонуклеотиды содержат или состоят из SEQ ID NO: 1730-1731.

Если первый экзон дистрофина представляет собой экзон 45 и второй экзон дистрофина представляет собой экзон 53, предпочтительная область экзона 45 содержит или состоит из SEQ ID NO: 1569, и предпочтительная область экзона 53 содержит или состоит из SEQ ID NO: 1570. Предпочтительные олигонуклеотиды содержат или состоят из SEQ ID NO: 1732-1737.

Если первый экзон дистрофина представляет собой экзон 45 и второй экзон дистрофина представляет собой экзон 55, предпочтительная область экзона 45 содержит или состоит из SEQ ID NO: 1571, и предпочтительная область экзона 55 содержит или состоит из SEQ ID NO: 1572. Предпочтительные олигонуклеотиды содержат или состоят из SEQ ID NO: 1704-1719, 1788, 1852, 1789, 1853.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1706 или содержит SEQ ID NO: 1706 и имеет длину 25, 26, 27, 28, 29 или 30 нуклеотидов. Предпочтительный олигонуклеотид, содержащий SEQ ID NO: 1706 и имеющий длину 25 нуклеотидов, состоит из SEQ ID NO: 1706.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1707 или содержит SEQ ID NO: 1707 и имеет длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов. Предпочтительный олигонуклеотид, содержащий SEQ ID NO: 1707 и имеющий длину 25 нуклеотидов, состоит из SEQ ID NO: 1706.

Предпочтительный олигонуклеотид состоит из SEQ ID NO: 1713 или содержит SEQ ID NO: 1713 и имеет длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов. Предпочтительный олигонуклеотид, содержащий SEQ ID NO: 1713 и имеющий длину 25 нуклеотидов, состоит из SEQ ID NO: 1710.

Предпочтительные олигонуклеотиды содержат последовательность оснований, определяемую любой из SEQ ID NO: 1788, 1852, 1789, 1853 и имеющую длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 45 и второй экзон дистрофина представляет собой экзон 55, другая предпочтительная область экзона 45 содержит или состоит из SEQ ID NO: 1774, и другая предпочтительная область экзона 55 содержит или состоит из SEQ ID NO: 1775. Предпочтительные олигонуклеотиды содержат последовательность оснований, определяемую любой из SEQ ID NO: 1790, 1854, 1792, 1855 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов.

Если первый экзон дистрофина представляет собой экзон 45 и второй экзон дистрофина представляет собой экзон 60, предпочтительная область экзона 45 содержит или состоит из SEQ ID NO: 1577, и предпочтительная область экзона 60 содержит или состоит из SEQ ID NO: 1578. Предпочтительные олигонуклеотиды содержат или состоят из SEQ ID NO: 1738-1741.

Если первый экзон дистрофина представляет собой экзон 56 и второй экзон дистрофина представляет собой экзон 60, предпочтительная область экзона 56 содержит или состоит из SEQ ID NO: 1742, и предпочтительная область экзона 60 содержит или состоит из SEQ ID NO: 1743. Предпочтительные олигонуклеотиды содержат или состоят из SEQ ID NO: 1720-1721.

Более предпочтительный олигонуклеотид содержит:

(a) последовательность оснований, определяемую SEQ ID NO: 1673 или 1674 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов; или

(b) последовательность оснований, определяемую SEQ ID NO: 1675 или 1676 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов; или

(c) последовательность оснований, определяемую SEQ ID NO: 1677 или 1678 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов; или

(d) последовательность оснований, определяемую любой из SEQ ID NO: 1679-1681 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов; или

(e) последовательность оснований, определяемую любой из SEQ ID NO: 1684-1686 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов; или

(f) последовательность оснований, определяемую SEQ ID NO: 1688 или 1689 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов; или

(g) последовательность оснований, определяемую любой из SEQ ID NO: 1704-1706 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов,

(h) последовательность оснований, определяемую любой из SEQ ID NO: 1707-1709 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов; или

(i) последовательность оснований, определяемую любой из SEQ ID NO: 1710, 1713-1717 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Еще более предпочтительные олигонуклеотиды содержат:

(a) последовательность оснований, определяемую любой из SEQ ID NO: 1679-1681, 1778, 1812, 1813, 1884-1886, 1890 или 1891 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или SEQ ID NO: 1814 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

(b) последовательность оснований, определяемую SEQ ID NO: 1688, 1689 или 1839-1844 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

(c) последовательность оснований, определяемую SEQ ID NO: 1673 или 1674 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(d) последовательность оснований, определяемую SEQ ID NO: 1675 или 1676 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(e) последовательность оснований, определяемую SEQ ID NO: 1677 или 1678 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(f) последовательность оснований, определяемую любой из SEQ ID NO: 1684-1686 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(g) последовательность оснований, определяемую любой из SEQ ID NO: 1704-1706 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(h) последовательность оснований, определяемую любой из SEQ ID NO: 1707-1709 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(i) последовательность оснований, определяемую любой из SEQ ID NO: 1710, 1713-1717 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(j) последовательность оснований, определяемую любой из SEQ ID NO: 1815-1819 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(k) последовательность оснований, определяемую любой из SEQ ID NO: 1820, 1824, и имеющую длину 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(l) последовательность оснований, определяемую любой из SEQ ID NO: 1826, 1782, 1832 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(m) последовательность оснований, определяемую любой из SEQ ID NO: 1821, 1825, 1780 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(n) последовательность оснований, определяемую любой из SEQ ID NO: 1822 и имеющую длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(o) последовательность оснований, определяемую любой из SEQ ID NO: 1823, 1781, 1829, 1830, 1831 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(p) последовательность оснований, определяемую любой из SEQ ID NO: 1783, 1833, 1834, 1835 и имеющую длину 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(q) последовательность оснований, определяемую любой из SEQ ID NO: 1887 и имеющую длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(r) последовательность оснований, определяемую любой из SEQ ID NO: 1888 или 1889 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

(s) последовательность оснований, определяемую SEQ ID NO: 1827 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(t) последовательность оснований, определяемую SEQ ID NO: 1828 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(u) последовательность оснований, определяемую любой из SEQ ID NO: 1784, 1836 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(v) или последовательность оснований, определяемую любой из SEQ ID NO: 1786, 1838 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(w) последовательность оснований, определяемую любой из SEQ ID NO: 1780 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(x) последовательность оснований, определяемую любой из SEQ ID NO: 1785, 1837 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(y) последовательность оснований, определяемую любой из SEQ ID NO: 1845, 1846, 1847, 1848 и имеющую длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(z) последовательность оснований, определяемую любой из SEQ ID NO: 1849, 1850 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(a1) последовательность оснований, определяемую любой из SEQ ID NO: 1787, 1851 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

(b1) последовательность оснований, определяемую любой из SEQ ID NO: 1788, 1852, 1789, 1853 и имеющую длину 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(c1) последовательность оснований, определяемую любой из SEQ ID NO: 1790, 1854, 1792, 1855 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(d1) последовательность оснований, определяемую любой из SEQ ID NO: 1794, 1861, 1795, 1862 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(e1) последовательность оснований, определяемую любой из SEQ ID NO: 1796, 1863, 1797, 1864 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(f1) последовательность оснований, определяемую любой из SEQ ID NO: 1798, 1865, 1799, 1866 и имеющую длину 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(g1) последовательность оснований, определяемую любой из SEQ ID NO: 1808, 1867, 1809, 1868, 1810, 1869, 1858, 1873 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(h1) последовательность оснований, определяемую любой из SEQ ID NO: 1811, 1870, 1859, 1874 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(i1) последовательность оснований, определяемую любой из SEQ ID NO: 1856, 1871, 1860, 1875 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(j1) последовательность оснований, определяемую любой из SEQ ID NO: 1857, 1872 и имеющую длину 26, 27, 28, 29 или 30 нуклеотидов, или

(k1) последовательность оснований, определяемую любой из SEQ ID NO: 1800, 1876, 1801, 1877 и имеющую длину 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(l1) последовательность оснований, определяемую любой из SEQ ID NO: 1802, 1878, 1803, 1879 и имеющую длину 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(m1) последовательность оснований, определяемую любой из SEQ ID NO: 1804, 1880 и имеющую длину 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(n1) последовательность оснований, определяемую любой из SEQ ID NO: 1805, 1881 и имеющую длину 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или

(o1) последовательность оснований, определяемую любой из SEQ ID NO: 1806, 1882, 1807, 1883 и имеющую длину 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

Олигонуклеотид по изобретению, который содержит или состоит из последовательности, определяемой номером SEQ ID, также охватывает олигонуклеотид, содержащий последовательность оснований, определяемую этим SEQ ID. Олигонуклеотиды, имеющие модифицированную основную цепь (т.е. модифицированные части сахаров и/или модифицированные межнуклеозидные связи), относительно олигонуклеотидов, определяемых SEQ ID, также охватываются изобретением. Каждое основание U в SEQ ID NO олигонуклеотида, как определено в настоящем описании, может быть модифицировано или заменено на T.

Композиция

В следующем аспекте предусматривается композиция, содержащая олигонуклеотид, как описано в предыдущем разделе под названием "Олигонуклеотид". Эта композиция предпочтительно содержит или состоит из олигонуклеотида, как описано выше. Предпочтительная композиция содержит один единственный олигонуклеотид, как определено выше. Таким образом, понятно, что пропускания по меньшей мере указанного первого и указанного второго экзона достигают с использованием одного единственного олигонуклеотида, а не с использованием коктейля различных олигонуклеотидов.

В предпочтительном варианте осуществления указанная композиция предназначена для применения в качестве лекарственного средства. Таким образом, указанная композиция представляет собой фармацевтическую композицию. Фармацевтическая композиция обычно содержит фармацевтически приемлемый носитель, разбавитель и/или эксципиент. В предпочтительном варианте осуществления композиция по настоящему изобретению содержит соединение, как определено в настоящем описании, и необязательно дополнительно содержит фармацевтически приемлемый состав, наполнитель, консервант, солюбилизатор, носитель, разбавитель, эксципиент, соль, адъювант и/или растворитель. Такой фармацевтически приемлемый носитель, наполнитель, консервант, солюбилизатор, разбавитель, соль, адъювант, растворитель и/или эксципиент может быть найден, например, в Remington. Соединение, как описано в рамках изобретения, обладает по меньшей мере одной ионогенной группой. Ионогенная группа может представлять собой основание или кислоту, и она может быть заряженной или нейтральной. Ионогенная группа может присутствовать в качестве пары ионов с соответствующим противоионом, который имеет противоположный заряд(ы). Примерами катионных противоионов являются натрий, калий, цезий, Tris, литий, кальций, магний, триалкиламмоний, триэтиламмоний и тетраалкиламмоний. Примерами анионных противоионов являются хлорид, бромид, йодид, лактат, мезилат, ацетат, трифторацетат, дихлорацетат и цитрат. Примеры противоионов описаны (Kumar L., которая включена в настоящее описание в качестве ссылки в полном объеме). Таким образом, в предпочтительном варианте осуществления олигонуклеотид по изобретению приводят в контакт с композицией, содержащей такие ионогенные группы, предпочтительно Ca2+, с получением хелатного комплекса олигонуклеотида, содержащего два или более идентичных олигонуклеотидов, связанных таким мультивалентным катионом, как уже определено в настоящем описании.

Фармацевтическую композицию, кроме того, можно составлять, чтобы дополнительно способствовать повышению стабильности, растворимости, всасывания, биодоступности, фармакокинетики и клеточного захвата указанного соединения, в частности, составов, содержащих эксципиенты или конъюгаты, способные образовывать комплексы, наночастицы, микрочастицы, нанотрубки, наногели, гидрогели, полоксамеры или плюроники, полимерсомы, коллоиды, микропузырьки, везикулы, мицеллы, липоплексы и/или липосомы. Примеры наночастиц включают полимерные наночастицы, золотые наночастицы, магнитные наночастицы, частицы на основе диоксида кремния, липидные наночастицы, наночастицы на основе сахаров, белковые наночастицы и пептидные наночастицы.

Предпочтительная композиция содержит по меньшей мере один эксципиент, который может далее способствовать усилению нацеливания и/или доставки указанной композиции и/или указанного олигонуклеотида к и/или в мышцу и/или клетку. Клетка может представлять собой мышечную клетку.

Другая предпочтительная композиция может содержать по меньшей мере один эксципиент, классифицируемый как второй тип эксципиента. Второй тип эксципиента может включать или содержать конъюгатную группу, как описано в настоящем описании, для усиления нацеливания и/или доставки композиции и/или олигонуклеотида по изобретению к ткани и/или клетке и/или в ткань и/или клетку, например, такую как мышечная ткань или клетка. Оба типа эксципиентов можно комбинировать в одну единственную композицию, как определено в настоящем описании. Предпочтительные конъюгатные группы описаны в части, посвященной определениям.

Квалифицированный специалист может выбирать, комбинировать и/или адаптировать один или несколько из описанных выше или других альтернативных эксципиентов и систем для доставки для составления и доставки соединения для применения в рамках настоящего изобретения.

Такую фармацевтическую композицию по изобретению можно вводить в эффективной концентрации в установленные моменты времени животному, предпочтительно млекопитающему. Более предпочтительным млекопитающим является человек. Соединение или композиция, как определено в настоящем описании, могут быть пригодны для прямого введения в клетку, ткань и/или орган in vivo у индивидуумов, предпочтительно указанные индивидуумы страдают или имеют риск развития BMD или DMD, и их можно вводить прямо in vivo, ex vivo или in vitro. Введение можно осуществлять системным и/или парентеральным путями, например, внутривенным, подкожным, внутрижелудочковым, интратекальным, внутримышечным, интраназальным, энтеральным, интравитреальным, внутрицеребральным, эпидуральным или пероральным путем.

Предпочтительно, такая фармацевтическая композиция по изобретению может быть инкапсулирована в форме эмульсии, суспензии, пилюли, таблетки, капсулы или мягкой желатиновой капсулы для пероральной доставки, или она может быть в форме аэрозоля или сухого порошка для доставки в дыхательные пути и легкие.

В одном варианте осуществления соединение по изобретению можно использовать вместе с другим соединением, уже известным тем, что его используют для лечения указанного заболевания. Такие другие соединения можно использовать для замедления прогрессирования заболевания, для снижения аномального поведения или движений, для снижения воспаления мышечной ткани, для улучшения функции, целостности и/или выживаемости мышечных волокон и/или для улучшения, увеличения или восстановления сердечной функции. Примерами являются, но не ограничиваясь ими, стероид, предпочтительно (глюко)кортикостероид, ингибитор ACE (предпочтительно периндоприл), блокатор рецептора ангиотензина II типа 1 (предпочтительно лозартан), ингибитор фактора некроза опухоли-альфа (TNFα), ингибитор TGFβ (предпочтительно декорин), рекомбинантный бигликан человека, источник mIGF-1, ингибитор миостатина, манноза-6-фосфат, антиоксидант, ингибитор ионных каналов, ингибитор протеаз, ингибитор фосфодиэстеразы (предпочтительно ингибитор PDE5, такой как силденафил или тадалафил), L-аргинин, блокаторы дофамина, амантадин, тетрабеназин и/или кофермент Q10. Это комбинированное применение может представлять собой последовательное применение: каждый компонент вводят в отдельной композиции. Альтернативно, каждое соединение можно использовать вместе в одной композиции.

Применение

В следующем аспекте предусматривается применение композиции или соединения, как описано в настоящем описании, в качестве лекарственного средства или части терапии, или применения, в которых соединение проявляет его активность внутриклеточно.

В предпочтительном варианте осуществления соединение или композиция по изобретению предназначены для применения в качестве лекарственного средства, где лекарственное средство предназначено для профилактики, замедления, смягчения и/или лечения заболевания, как определено в настоящем описании, предпочтительно DMD или BMD.

Способ профилактики, замедления, смягчения и/или лечения заболевания

В следующем аспекте предусматривается способ профилактики, замедления, смягчения и/или лечения заболевания, как определено в настоящем описании, предпочтительно DMD или BMD. Указанное заболевание можно предупреждать, лечить, замедлять или смягчать у индивидуума, в клетке, ткани или органе указанного индивидуума. Способ включает введение олигонуклеотида или композиции по изобретению указанному индивидууму или субъекту, нуждающемуся в этом.

Способ по изобретению, где олигонуклеотид или композиция, как определено в настоящем описании, могут быть пригодными для введения в клетку, ткань и/или орган in vivo индивидуумам, предпочтительно индивидуумам, страдающим BMD или DMD или имеющим риск развития такого заболевания, можно проводить in vivo, ex vivo или in vitro. Индивидуум или субъект, нуждающиеся в этом, предпочтительно представляют собой млекопитающее, более предпочтительно человека.

В одном варианте осуществления в способе по изобретению концентрация олигонуклеотида или композиции находится в диапазоне от 0,01 нМ до 1 мкМ. Более предпочтительно, используемая концентрация составляет от 0,02 до 400 нМ, или от 0,05 до 400 нМ, или от 0,1 до 400 нМ, еще более предпочтительно от 0,1 до 200 нМ.

Диапазоны доз олигонуклеотида или композиции по изобретению предпочтительно выбирают, исходя из исследований с возрастающей дозой в клинических испытаниях (применение in vivo), для которых существуют строгие требования протокола. Олигонуклеотид, как определено в настоящем описании, можно использовать в дозе, которая находится в диапазоне от 0,01 до 200 мг/кг, или от 0,05 до 100 мг/кг, или от 0,1 до 50 мг/кг, или от 0,1 до 20 мг/кг, предпочтительно от 0,5 до 10 мг/кг.

Диапазоны концентрации или дозы олигонуклеотида или композиции, приведенные выше, являются предпочтительными концентрациями или дозами для применений in vitro или ex vivo. Квалифицированному специалисту будет понятно, что в зависимости от типа используемого олигонуклеотида, клетки-мишени, подлежащей лечению, гена-мишени и его уровней экспрессии, используемой среды и условий трансфекции и инкубации, концентрация или доза указанного используемого олигонуклеотида может далее варьировать и может требовать дальнейшей оптимизации.

Определения

"Идентичность последовательностей", как известно в данной области, представляет собой взаимосвязь между двумя или более последовательностями нуклеиновой кислоты (полинуклеотид или нуклеотид), как определяют путем сравнения последовательностей. В данной области процент "идентичности" или "сходства" указывает на степень родственности последовательностей нуклеиновой кислоты при определении по соответствию цепей таких последовательностей. "Идентичность" может быть заменена в настоящем описании "сходством". Предпочтительно, процент идентичности определяют путем сравнения всей SEQ ID NO, как определено в настоящем описании. Однако также можно использовать часть последовательности. Часть последовательности в этом контексте может означать по меньшей мере 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или 100% данной последовательности или SEQ ID NO.

"Идентичность" и "сходство" можно без труда вычислить известными способами, включая, но не ограничиваясь ими, способы, описанные в Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; и Sequence Analysis Primer Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; и Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988).

Предпочтительные способы определения идентичности разработаны так, чтобы обеспечить наибольшее соответствие между исследуемыми последовательностями. Способы определения идентичности и сходства закодированы в общедоступных компьютерных программах. Предпочтительные компьютерные программы для определения идентичности и сходства между двумя последовательностями включают, например, пакет программ GCG (Devereux, J., et al., Nucleic Acids Research 12 (1):387 (1984)), BestFit и FASTA (Altschul, S.F. et al., J. Mol. Biol. 215: 403-410 (1990)). Семейство программ BLAST 2.0, которое можно использовать для поиска сходства в базах данных, включает, например, BLASTN для нуклеотидных последовательностей запроса против нуклеотидных последовательностей из баз данных. Семейство программ BLAST 2.0 является общедоступным от NCBI и других источников (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, MD 20894; Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990)). Также для определения идентичности можно использовать хорошо известный алгоритм Смита-Ватермана.

Предпочтительные параметры для сравнения нуклеиновых кислот включают следующие параметры: алгоритм: Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970); матрица сравнений: совпадение = +10, несовпадение = 0; штраф за пропуск: 50; штраф за продолжение пропуска: 3. Доступен в качестве программы Gap от Genetics Computer Group, расположенной в Madison, Wis. Выше приведены параметры по умолчанию для сравнений нуклеиновых кислот.

Другим предпочтительным способом определения сходства и идентичности последовательностей является способ с использованием алгоритма Needleman-Wunsch (Needleman, S.B. and Wunsch, C.D. (1970) J. Mol. Biol. 48, 443-453, Kruskal, J.B. (1983), обзор сравнения последовательностей: D. Sankoff and J.B. Kruskal, (ed.), Time warps, string edits and macromolecules: the theory and practice of sequence comparison, pp. 1-44 Addison Wesley).

Другим предпочтительным способом определения сходства и идентичности последовательностей является способ с использованием EMBOSS Matcher и алгоритма Waterman-Eggert (локальное выравнивание двух последовательностей; [Schoniger и Waterman, Bulletin of Mathematical Biology 1992, Vol. 54 (4), pp. 521-536; Vingron and Waterman, J. Mol. Biol. 1994; 235(1), p1-12]). Можно использовать следующие web-сайты: http://www.ebi.ac.uk/Tools/emboss/align/index.html или http://emboss.bioinformatics.nl/cgi-bin/emboss/matcher. Определения параметров, используемых в этом алгоритме, находится на следующем web-сайте: http://emboss.sourceforge.net/docs/themes/AlignFormats.html#id. Предпочтительно используют параметры по умолчанию (матрица: EDNAFULL, штраф за пропуск: 16, штраф за продолжение пропуска: 4). Emboss Matcher обеспечивает наилучшее локальное выравнивание между двумя последовательностями, однако также предоставляются альтернативные выравнивания. В таблице 2 представлено наилучшее локальное выравнивание между двумя различными экзонами, предпочтительно экзонами дистрофина, которые предпочтительно используют для конструирования олигонуклеотидов. Однако также можно идентифицировать альтернативные выравнивания и, таким образом, альтернативные области идентичности между двумя экзонами, и их можно использовать для конструирования олигонуклеотидов, что также является частью настоящего изобретения.

На протяжении заявки слова "связывается", "нацеливается", "гибридизуется" могут использоваться взаимозаменяемо, когда их используют в контексте олигонуклеотида, который обратно комплементарен области пре-мРНК, как определено в настоящем описании. Аналогично, выражения "способен связываться", "способен нацеливаться" и "способен гибридизоваться" могут использоваться взаимозаменяемо для указания на то, что олигонуклеотид имеет определенную последовательность, которая позволяет связывание, нацеливание или гибридизацию с последовательностью-мишенью. Когда последовательность-мишень определена в настоящем описании или известна в данной области, квалифицированный специалист способен сконструировать все возможные структуры указанного олигонуклеотида с использованием принципа обратной комплементарности. В этом отношении будет понятно, что допустимо ограниченное количество несоответствий или пропусков в последовательности между олигонуклеотидом по изобретению и последовательностями-мишенями в первом и/или втором экзонах при условии, что связывание не изменяется, как рассмотрено выше. Таким образом, олигонуклеотид, который способен связываться с определенной последовательностью-мишенью, может считаться олигонуклеотидом, который обратно комплементарен последовательности-мишени. В контексте изобретения "гибридизуется" или "способен гибридизоваться" используют для физиологических условий в клетке, предпочтительно в клетке человека, если нет иных указаний.

Как используют в рамках изобретения, "гибридизация" относится к спариванию комплементарных олигомерных соединений (например, антисмысловое соединение и его нуклеиновая кислота-мишень). Не ограничиваясь конкретным механизмом, наиболее распространенный механизм образования пар вовлекает образование водородных связей, которое может представлять собой образование водородных связей по типу Уотсона-Крика, Хугстина или обратному хугстиновскому типу между комплементарными нуклеозидными или нуклеотидными основаниями (нуклеиновые основания). Например, природное основание аденин представляет собой нуклеиновое основание, комплементарное природному нуклеиновому основанию тимину, 5-метилурацилу и урацилу, которые образуют пару путем образования водородных связей. Природное основание гуанин представляет собой нуклеиновое основание, комплементарное природным основаниям цитозину и 5-метилцитозину. Гибридизация может происходить в различных условиях.

Аналогично, "обратную комплементарность" используют для указания на две нуклеотидных последовательности, которые способны гибридизоваться друг с другом, в то время как одна из последовательностей ориентирована от 3' к 5', а другая ориентирована в обратном направлении, т.е. от 5' к 3'. Таким образом, нуклеозид A на первой нуклеотидной последовательности способен образовывать пару с нуклеозидом A* на второй нуклеотидной последовательности через их соответствующие нуклеиновые основания, и нуклеозид B, расположенный в 5'-положении от упомянутого выше нуклеозида A в первой нуклеотидной последовательности, способен образовывать пару с нуклеозидом B*, который расположен в 3'-положении от упомянутого выше нуклеозида A* во второй нуклеотидной последовательности. В контексте настоящего изобретения первая нуклеотидная последовательность, как правило, представляет собой олигонуклеотид по изобретению, и вторая нуклеотидная последовательность представляет собой часть экзона из пре-мРНК, предпочтительно пре-мРНК дистрофина. Олигонуклеотид предпочтительно называют обратно комплементарным области экзона (первого и/или второго экзона), когда указанный олигонуклеотид по меньшей мере на 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100% обратно комплементарен указанной области указанного первого и/или второго экзона. Предпочтительно, обратная комплементарность составляет по меньшей мере 80%, 85%, 90%, 95% или 100%.

В контексте изобретения эксципиенты включают полимеры (например, полиэтиленимин (PEI), полипропиленимин (PPI), производные декстрана, бутилцианоакрилат (PBCA), гексилцианоакрилат (PHCA), сополимер молочной и гликолевой кислоты (PLGA), полиамины (например, спермин, спермидин, путресцин, кадаверин), хитозан, поли(амидоамины) (PAMAM), поли(сложный эфир-амин), поливиниловый эфир, поливинилпирролидон (PVP), полиэтиленгликоль (PEG) циклодекстрины, гиалуроновую кислоту, коломиновую кислоту и их производные), дендримеры (например, поли(амидоамин)), липиды {например, 1,2-диолеоил-3-диметиламмоний пропан (DODAP), диолеоилдиметиламмоний хлорид (DODAC), производные фосфатидилхолина [например, 1,2- дистеароил-sn-глицеро-3-фосфохолин (DSPC)], производные лизо-фосфатидилхолина [например, 1-стеароил-2-лизо-sn-глицеро-3-фосфохолин (S-LysoPC)], сфингомиелин, 2-{3-[бис-(3-аминопропил)амино]пропиламино}-N-дитетрацедилкарбамоилметилацетамид (RPR209120), производные фосфоглицерина [например, 1,2-дипальмитоил-sn-глицеро-3-фосфоглицерин, натриевая соль (DPPG-Na), производные фосфатицидной кислоты [1,2-дистеароил-sn-глицеро-3-фосфатицидная кислота, натриевая соль (DSPA), производные фосфатидилэтаноламина [например, диолеоил-фосфатидилэтаноламин (DOPE), 1,2-дистеароил-sn-глицеро-3-фосфоэтаноламин (DSPE), 2-дифитаноил-sn-глицеро-3-фосфоэтаноламин (DPhyPE)], N-[1-(2,3-диолеоилокси)пропил]-N,N,N-триметиламмоний (DOTAP), N-[1-(2,3-диолеоилокси)пропил]-N,N,N-триметиламмоний (DOTMA), 1,3-диолеоилокси-2-(6-карбоксиспермил)пропиламид (DOSPER), (1,2-димиристоилоксипропил-3-диметилгидроксиэтиламмоний (DMRIE), (N1-холестерилоксикарбонил-3,7-диазанонан-1,9-диамин (CDAN), диметилдиоктадециламмоний бромид (DDAB), 1-пальмитоил-2-олеоил-sn-глицерол-3-фосфохолин (POPC), (b-L-аргинил-2,3-L-диаминопропионовая кислота-N-пальмитил-N-олеиламид тригидрохлорид (AtuFECT01), производные N,N-диметил-3-аминопропана [например, 1,2-дистеароилокси-N,N-диметил-3-аминопропан (DSDMA), 1,2-диолеилокси-N,N-диметил-3-аминопропан (DoDMA), 1,2-дилинолеилокси-N,N-3-диметиламинопропан (DLinDMA), 2,2-дилинолеил-4-диметиламинометил-[1,3]-диоксолан (DLin-K-DMA), производные фосфатидилсерина [1,2-диолеил-sn-глицеро-3-фосфо-L-серин, натриевая соль (DOPS)], холестерин}, белки (например, альбумин, желатины, ателлоколлаген) и пептиды (например, протамин, PepFects, NickFects, полиаргинин, полилизин, CADY, MPG).

В контексте изобретения конъюгатные группы выбирают из группы, состоящей из нацеливающих частей, повышающих стабильность частей, усиливающих захват частей, усиливающих растворимость частей, улучшающих фармакокинетику частей, улучшающих фармакодинамику частей, повышающих активность частей, репортерных молекул и лекарственных средств, где эти части могут представлять собой пептиды, белки, углеводы, полимеры, производные этиленгликоля, витамины, липиды, полифторалкильные части, стероиды, холестерин, флуоресцентные части и радиоактивно меченые части. Конъюгатные группы необязательно могут быть защищенными и они могут быть связаны с олигонуклеотидом по изобретению прямо или через двухвалентный или поливалентных линкер.

Конъюгатные группы включают части, которые усиливают нацеливание, захват, растворимость, активность, фармакодинамику, фармакокинетику или которые снижают токсичность. Примеры таких групп включают пептиды (например, глутатион, полиаргинин, пептиды RXR (см., например, Antimicrob. Agents Chemother. 2009, 53, 525), полиорнитин, TAT, TP10, pAntp, полилизин, NLS, пенетратин, MSP, ASSLNIA, MPG, CADY, Pep-1, Pip, SAP, SAP(E), транспортан, буфорин II, полимиксин B, гистатин, CPP5, NickFects, PepFects), vivo-porter, белки (например, антитела, авидин, Ig, трансферрин, альбумин), углеводы (например, глюкоза, галактоза, манноза, мальтоза, мальтотриоза, рибоза, трегалоза, глюкозамин, N-ацетилглюкозамин, лактоза, сахароза, фукоза, арабиноза, талоза, сиаловая кислота, гиалуроновая кислота, нейрамидиновая кислота, рамноза, квиновоза, галактозамин, N-ацетилгалактозамин, ксилоза, ликсоза, фруктоза, манноза-6-фосфат, 2-дезоксирибоза, глюкал, целлулобиоза, хитобиоза, хитотриоза), полимеры (например, полиэтиленгликоль, полиэтиленимин, полимолочная кислота, поли(амидоамин)), производные этиленгликоля (например, триэтиленгликоль, тетраэтиленгликоль), водорастворимые витамины (например, витамин B, B1, B2, B3, B5, B6, B7, B9, B12, C), жирорастворимые витамины (например, витамин A, D, D2, D3, E, K1, K2, K3), липиды (например, пальмитил, миристил, олеил, стеарил, батил, глицерофосфолипид, глицеролипид, сфинголипид, церамид, цереброзид, сфингозин, стерин, пренол, эруцил, арахидонил, линолеил, линоленил, арахидил, бутирил, сапеинил, элаидил, лаурил, бегенил, нонил, децил, ундецил, октил, гептил, гексил, пентил, DOPE, DOTAP, терпенил, дитерпеноид, тритерпеноид), полифторалкильные части (например, перфтор[1H,1H,2H,2H]-алкил), одобренные лекарственные средства с ММ<1500 Да, которые обладают аффинностью к конкретным белкам (например, NSAID, такие как ибупрофен (больше описано в патенте США 6656730, включенном в настоящее описание в качестве ссылки), антидепрессанты, противовирусные средства, антибиотики, алкилирующие средства, амебицидные средства, аналгетики, андрогены, ингибиторы ACE, снижающие аппатит средства, антациды, противогельминтные средства, антиангиогенные средства, антиадренергетики, антиангинальные средства, антихолинергетики, антикоагулянты, противосудорожные препараты, противодиабетические средства, противодиарейные средства, антидиуретики, антидоты, противогрибковые средства, противорвотные средства, средства против головокружения, противоподагрические средства, антигонадотропные средства, антигистамины, антигиперлипидемические средства, антигипертензивные средства, противомалярийные средства, средства против мигрени, средства против злокачественной опухоли, антипсихотические средства, противоревматические средства, антитиреоидные средства, антитоксины, противокашлевые средства, анксиолитические средства, контрацептивы, стимуляторы ЦНС, хелаторы, сердечно-сосудистые средства, противозастойные средства, дерматологические средства, диуретики, отхаркивающие средства, диагностические средства, желудочно-кишечные средства, анестетики, глюкокортикоиды, антиаритмические средства, иммуностимулирующие средства, иммунодепрессивные средства, слабительные средства, лепростатические средства, метаболические средства, средства, действующие на органы дыхательной системы, муколитики, мышечные релаксанты, нутрицевтические средства, сосудорасширяющие средства, тромболитические средства, утеротонические средства, сосудосуживающие средства), природные соединения с ММ<2000 Да (например, антибиотики, эйкозаноиды, алкалоиды, флавоноиды, терпеноиды, кофакторы ферментов, поликетиды), стероиды (например, преднизон, преднизолон, дексаметазон, ланостерин, холевая кислота, эстран, андростан, прегнан, холан, холестан, эргостерин, холестерин, кортизол, кортизон, дефлазакорт), пентациклические тритерпеноиды (например, 18β-глицирретиновая кислота, урсоловая кислота, амирин, карбеноксолон, эноксолон, ацетоксолон, бетулиновая кислота, азиатиковая кислота, эритродиол, олеанолевая кислота), полиамины (например, спермин, спермидин, путресцин, кадаверин), флуоресцентные части (например, FAM, карбоксифлуоресцеин, FITC, TAMRA, JOE, HEX, TET, родамин, Cy3, Cy3,5, Cy5, Cy5,5, CW800, BODIPY, AlexaFluors, Dabcyl, DNP), репортерные молекулы (например, акридины, биотины, дигоксигенин, (радио)изотопно меченые части (например, с 2H, 13C, 14C, 15N, 18O, 18F, 32P, 35S, 57Co, 99mTc, 123I, 125I, 131I, 153Gd)) и их комбинации. Такие конъюгатные группы могут быть присоединены прямо к соединениям по изобретению или через линкер. Этот линкер может быть двухвалентным (обеспечивающим конъюгат 1:1) или поливалентным, обеспечивающим олигомер с более чем одной конъюгатной группой. Методики связывания такой конъюгатной группы, либо прямо, либо через линкер, с олигомером по изобретению известны в данной области. Также в контексте изобретения находится применение наночастиц, с которыми ковалентно связаны олигонуклеотиды по изобретению, таким образом, такие конструкции называют сферическими нуклеиновыми кислотами (SNA), например, как описано в J. Am. Chem. Soc. 2008, 130, 12192 (Hurst et al., включенная в настоящее описание в качестве ссылки).

В настоящем документе и в его формуле изобретения глагол "содержать" и его спряжения используют в неограничивающем значении для обозначения того, что объекты после этого слова включены, однако объекты, конкретно не упомянутые, не исключены. Кроме того, глагол "состоять из" может быть заменен на "по существу состоять из", что означает, что олигонуклеотид или композиция, как определено в настоящем описании, могут содержать дополнительный компонент(ы) помимо компонентов, конкретно указанных, причем указанный дополнительный компонент(ы) не изменяет уникальной характеристики изобретения. Кроме того, указание на элемент в единственном числе не исключает возможности того, что присутствует более одного элемента, если контекст явно не требует, чтобы существовал один и только один из элементов. Таким образом, форма единственного числа обычно означает "по меньшей мере один".

Слова "приблизительно" или "примерно", когда их используют применительно к числовой величине (приблизительно 10), предпочтительно означают, что величина может представлять собой данную величину, равную 10, или отличается менее чем на 1% от этой величины.

Каждый вариант осуществления, как указано в настоящем описании, может быть комбинирован с другим, если нет иных указаний. Все патентные и литературные ссылки в настоящем описании включены в настоящее описание в качестве ссылки в полном объеме.

Следующие примеры представлены только для иллюстративных целей, и они не предназначены для ограничения объема настоящего изобретения никоим образом.

Примеры

Таблицы 1-3

Таблица 1
Перечень возможных комбинаций экзонов в транскрипте гена DMD, для которых экзон U (вышележащий) имеет непрерывную открытую рамку считывания с экзоном D (нижележащий), если экзоны с U+1 (первый экзон) по D-1 (второй экзон), и любые экзоны между ними, удалены из транскрипта.
Первый экзон ("U") Второй экзон ("D")
1 8,20,22,51,53,59,62,64,65,67,76,79
2 5,6,9,10,11,13,14,15,16,17,19,21,23,24,25,26,27,28,
29,30,31,32,33,34,35,36,37,38,39,40,41,
42,43,45,47,49,50,52,54,56,58,60,61,68,70
3 6,9,10,11,13,14,15,16,17,19,21,23,24,25,26,27,28,29,
30,31,32,33,34,35,36,37,38,39,40,41,42,43,45,47,49,
50,52,54,56,58,60,61,68,70

4 9,10,11,13,14,15,16,17,19,21,23,24,25,26,27,28,29,
30,31,32,33,34,35,36,37,38,39,40,41,42,
43,45,47,49,50,52,54,56,58,60,61,68,70
5 9,10,11,13,14,15,16,17,19,21,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,
43,45,47,49,50,52,54,56,58,60,61,68,70
6 12,18,44,46,55,57,63,66,69,71,72,73,74,75,77,78
7 20,22,51,53,59,62,64,65,67,76,79
8 11,13,14,15,16,17,19,21,23,24,25,26,27,28,29,30,31,
32,33,34,35,36,37,38,39,40,41,42,43,45,
47,49,50,52,54,56,58,60,61,68,70
9 13,14,15,16,17,19,21,23,24,25,26,27,28,29,30,31,32,
33,34,35,36,37,38,39,40,41,42,43,45,47,
49,50,52,54,56,58,60,61,68,70
10 13,14,15,16,17,19,21,23,24,25,26,27,28,29,30,31,32,
33,34,35,36,37,38,39,40,41,42,43,45,47,
49,50,52,54,56,58,60,61,68,70
11 18,44,46,55,57,63,66,69,71,72,73,74,75,77,78
12 15,16,17,19,21,23,24,25,26,27,28,29,30,31,32,33,34,
35,36,37,38,39,40,41,42,43,45,47,49,50,
52,54,56,58,60,61,68,70
13 16,17,19,21,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,45,47,49,50,52,
54,56,58,60,61,68,70
14 17,19,21,23,24,25,26,27,28,29,30,31,32,33,34,35,36,
37,38,39,40,41,42,43,45,47,49,50,52,54,
56,58,60,61,68,70
15 19,21,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,
38,39,40,41,42,43,45,47,49,50,52,54,56,
58,60,61,68,70
16 19,21,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,
38,39,40,41,42,43,45,47,49,50,52,54,56,
58,60,61,68,70
17 44,46,55,57,63,66,69,71,72,73,74,75,77,78

18 21,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,
39,40,41,42,43,45,47,49,50,52,54,56,58,
60,61,68,70
19 22,51,53,59,62,64,65,67,76,79
20 23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,
40,41,42,43,45,47,49,50,52,54,56,58,60,
61,68,70
21 51,53,59,62,64,65,67,76,79
22 25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,
42,43,45,47,49,50,52,54,56,58,60,61,68,
70
23 26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,
43,45,47,49,50,52,54,56,58,60,61,68,70
24 27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,
45,47,49,50,52,54,56,58,60,61,68,70
25 28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,45,
47,49,50,52,54,56,58,60,61,68,70
26 29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,45,47,
49,50,52,54,56,58,60,61,68,70
27 30,31,32,33,34,35,36,37,38,39,40,41,42,43,45,47,49,
50,52,54,56,58,60,61,68,70
28 31,32,33,34,35,36,37,38,39,40,41,42,43,45,47,49,50,
52,54,56,58,60,61,68,70
29 32,33,34,35,36,37,38,39,40,41,42,43,45,47,49,50,52,
54,56,58,60,61,68,70
30 33,34,35,36,37,38,39,40,41,42,43,45,47,49,50,52,54,
56,58,60,61,68,70
31 34,35,36,37,38,39,40,41,42,43,45,47,49,50,52,54,56,
58,60,61,68,70
32 35,36,37,38,39,40,41,42,43,45,47,49,50,52,54,56,58,
60,61,68,70
33 36,37,38,39,40,41,42,43,45,47,49,50,52,54,56,58,60,
61,68,70
34 37,38,39,40,41,42,43,45,47,49,50,52,54,56,58,60,61,
68,70

35 38,39,40,41,42,43,45,47,49,50,52,54,56,58,60,61,68,70
36 39,40,41,42,43,45,47,49,50,52,54,56,58,60,61,68,70
37 40,41,42,43,45,47,49,50,52,54,56,58,60,61,68,70
38 41,42,43,45,47,49,50,52,54,56,58,60,61,68,70
39 42,43,45,47,49,50,52,54,56,58,60,61,68,70
40 43,45,47,49,50,52,54,56,58,60,61,68,70
41 45,47,49,50,52,54,56,58,60,61,68,70
42 45,47,49,50,52,54,56,58,60,61,68,70
43 46,55,57,63,66,69,71,72,73,74,75,77,78
44 47,49,50,52,54,56,58,60,61,68,70
45 55,57,63,66,69,71,72,73,74,75,77,78
46 49,50,52,54,56,58,60,61,68,70
47 50,52,54,56,58,60,61,68,70
48 52,54,56,58,60,61,68,70
49 52,54,56,58,60,61,68,70
50 53,59,62,64,65,67,76
51 54,56,58,60,61,68,70
52 59,62,64,65,67,76
53 56,58,60,61,68,70
54 57,63,66,69,71,72,73,74,75,77,78
55 58,60,61,68,70
56 63,66,69,71,72,73,74,75,77,78
57 60,61,68,70
58 62,64,65,67,76,79
59 68,70
60 68,70
61 64,65,67,76,79
62 66,69,71,72,73,74,75,77,78
63 67,76,79
64 67,76,79
65 69,71,72,73,74,75,77,78
66 76,79
67 70
68 71,72,73,74,75,77,78

70 73,74,75,77,78
71 74,75,77,78
72 75,77,78
73 77,78
74 77,78

Таблица 2
Перечень областей экзонов: участки последовательности с (частично) высокой идентичностью или сходством последовательности (по меньшей мере 50%) между двумя различными экзонами дистрофина, идентифицированные в качестве наилучшего попарного выравнивания с помощью EMBOSS Matcher с использованием параметров по умолчанию (матрица: EDNAFULL, штраф за пропуск: 16, штраф за продолжение пропуска: 4) (http://www.ebi.ac.uk/tools/psa/emboss_matcher/nucleotide.html). Пропускание этих экзонов, и предпочтительно любых экзонов между ними, может привести к транскрипту DMD в рамке считывания (как в таблице 1)
Экзоны-мишени Выравнивание EMBOSS SEQ ID NO
8
19
AGAUAAGAAGUCCA
||.|.||||||.||
AGCUGAGAAGUUCA
17
18
8
21
ACCUAUCCAGAUAAG-AAGUCCAUCUUAAUGUACA
||..|||....|||| |||||..|..|.||||.||
ACAAAUCAUUUUAAGCAAGUCUUUUCUGAUGUGCA
19
20
8
50
UUUGCCUCAACAAGUGAG--CAUUGAAGCC
|||.|.||||.|..|||| ||..|.||||
UUUACUUCAAGAGCUGAGGGCAAAGCAGCC
21
22
8
52
GAAGCCAUCCAGGAAGUGGAA
|.|.|.||.|||||..|||||
GCAACAAUGCAGGAUUUGGAA
23
24

8
58
CAAGUGAGCAUUGAA
||||.|.|.||||||
CAAGAGGGAAUUGAA
25
26
9
10
CUAGCACAGGGAUA
|.||||||.|||.|
CAAGCACAAGGAGA
27
28
9
12
GUCAGUCUAGCACAGGGAUAUGAGAGAAC
|.|.|.|||.||.|...|.|.||.|||||
GACUGGCUAACAAAAACAGAAGAAAGAAC
29
30
9
13
UCUAGCACAGGGAUAUGAGAG
|||||.|||.|.|.|.|..||
UCUAGAACAAGAACAAGUCAG
31
32
9
14
ACACAGGCUGCUUAUGUCACCACCUCUGAC
|.|||..||.||.|..|..|.||.|||.||
AGACAUCCUUCUCAAAUGGCAACGUCUUAC
33
34
9
15
UCUAGCACAGGGAUAUGAGAGAA
|.|||..||.||.|.|.|||.||
UUUAGUGCAUGGCUUUCAGAAAA
35
36
9
16
UAUGCCUACACACAGGCUGCUUAUGUCACCAC
|||.|...||.|||.|.| |||.|.|||.|||
UAUUCACUCAAACAAGAU-CUUCUUUCAACAC
37
38

9
18
GAUAUGAGAGAACUUC
|||||.|..|||||||
GAUAUAACUGAACUUC
39
40
9
20
CACCACCUCUGACCCUACA
||||.|.||.||.||.|||
CACCCCAUCAGAGCCAACA
41
42
9
22
CUUA-UGUCACCACCUCUGA
|||| |||||||..||.|||
CUUAGUGUCACCGACUAUGA
43
44
9
23
UAUGUCACCACCUCUG
|||.|||.||||.|||
UAUCUCAGCACCACUG
45
46
9
25
CAGGGAUAUG-AGAGAACUUCUUCCC
|||.|||||. |||.|| |||..|||
CAGUGAUAUUCAGACAA-UUCAGCCC
47
48
9
26
UAAGCCUCGAUUCAAGAGCUAU
||||||||.|.. ||||.||||
UAAGCCUCCAGA-AAGAUCUAU
49
50
9
27
ACCACCUCUGACCCUACAC
||.|||..||.|.||.|||
ACUACCAGUGGCUCUGCAC
51
52

9
28
GGAUAUGAGAGAACUUCU
|||..||||..||..|||
GGAGCUGAGGAAAUCUCU
53
54
9
29
AGGGAUAUGAGAGAACUUCUUCCCCU
|||.|..|||||.|..|..|||.|.|
AGGAACUUGAGACAUUUAAUUCUCGU
55
56
9
30
CAGUCUAGCACAGGGAUAUGAGAGAACUUCUUCCCCUAAGCCUCGAUUC
|||||| ||.||||....|||.|.|.|.| |.|.|.|||.||..||.||
CAGUCU-GCCCAGGAGACUGAAAAAUCCU-UACACUUAAUCCAGGAGUC
57
58
9
31
GGUCAGUCUAGCACAGGGAUAUGAGAGAACUUCUUC
|.|||||.|||.| ||.||||...|||.|..||
GAUCAGUUUAGAA----GAAAUGAAGAAACAUAAUC
59
60
9
32
UUCUUCCCCUAAGCCUCGAUUCAAGAGCUAUGCCUACA
||.||||...||.|..|.|.|...||||...|.|||||
UUAUUCCAGAAACCAGCCAAUUUUGAGCAGCGUCUACA
61
62
9
33
CCCUAAGC-CUCGAUUCAAGAG
|||.|||. ||.|||..|||||
CCCAAAGAACUUGAUGAAAGAG
63
64
9
34
GGGAUAUGAGAGAACUUCUUCCCCUAAGCCUCGAUUCAAGAGCUAUGCCUACACACA--GGCUG
|.||.|||...|||.||.| |||.||||...|||....|.|...|||.||..|||.| |||||
GAGAAAUGCUUGAAAUUGU-CCCGUAAGAUGCGAAAGGAAAUGAAUGUCUUGACAGAAUGGCUG
65
66

9
35
AGUCUAGCACAGGGAUAUGAGAGAACUU
||..||.|||||.|.||.|||||..|||
AGAGUAUCACAGAGGUAGGAGAGGCCUU
67
68
9
36
UCAGUCUAGCACAG----GGAU--AUGAGAGAA
||||.||..||||. |||| ||.||||||
UCAGGCUGACACACUUUUGGAUGAAUCAGAGAA
69
70
9
38
CAGUCUAGCACAGGGAUAUGAGAGAACUUCUU
||||.||.|.|| |||||...|.||.|.|||
CAGUUUAACUCA--GAUAUACAAAAAUUGCUU
71
72
9
40
CAGGCUGCUUAUGUC
|||||||.|.||.||
CAGGCUGAUGAUCUC
73
74
9
41
CCACCUCUGACCC
|||.|||.||.||
CCAACUCAGAUCC
75
76
9
42
GAUAUGAGAGAACUUCU
||..||..|.|||||||
GAAGUGGAACAACUUCU
77
78
9
44
GGGAUAUGAGAGAACU
|.|||.|||.|||.||
GCGAUUUGACAGAUCU
79
80

9
46
GUCAGUCUAGCACAGGGAUAUGAGAGAACUUCUU
|||||..|..||.||.|||.|.|..|||.||.||
GUCAGAAUUUCAAAGAGAUUUAAAUGAAUUUGUU
81
82
9
47
UCCCCUAAGCCUCGA
||||.||||||..||
UCCCAUAAGCCCAGA
83
84
9
48
GAUUCAAGAGCUAUGCCU-ACACACAGG
|.|||.||||||.|.||| |.|.|||.|
GUUUCCAGAGCUUUACCUGAGAAACAAG
85
86
9
49
GGUCAGUCUAG-CACAGGGAUAUGAGAGAACUUCU
|.|||..|||. ||...||||.||..|||..||.|
GUUCAAGCUAAACAACCGGAUGUGGAAGAGAUUUU
87
88
9
51
CACGGUCAGUCUAGCACAGGGAUAUGAGAGAACUU
|.|.|.|||..|...||.|||.|..||.|||||||
CUCUGGCAGAUUUCAACCGGGCUUGGACAGAACUU
89
90
9
53
CUACACACAGGCUG
|.|||||..|||||
CAACACAAUGGCUG
91
92
9
57
GUCUAGCACAGGGAUAUGAGAGAACUUCU
|||| ||||.....|.||...||||||||
GUCU-GCACCUUUCUCUGCAGGAACUUCU
93
94

9
59
CAGGCUGCUUAUGUCACCAC
|||||||...|.||||..||
CAGGCUGAGGAGGUCAAUAC
95
96
9
60
CACCUCUGACCCUACA
||.||||.|||.||.|
CAGCUCUCACCGUAUA
97
98
10
12
UGAUGUGGAAGUGGUGAAAGACCAGUUUCAUACUCAUGAG
||||.|.||||...|.|||..|||..|.||....|||.||
UGAUCUUGAAGACCUAAAACGCCAAGUACAACAACAUAAG
99
100
10
13
UCAAACAGCUUUAGAAGAAGUA
||||..||.|.|||||.|||.|
UCAAGAAGAUCUAGAACAAGAA
101
102
10
14
CAAACAGCUUUAGAAGAAGU-AUUAUCG-UGGCUUCUUU
||||||.||.||||.|.|.. |..|.|| |||.||||||
CAAACAUCUGUAGAUGGACAGAAGACCGCUGGGUUCUUU
103
104
10
15
ACAGCUUUAGAAGAAGUAUUAUCGUGGCUUC
|.||.|..|.|.|||.|.|||||..|.||||
AAAGAUCAAAAUGAAAUGUUAUCAAGUCUUC
105
106
10
16
AGUAAACCUGGACCGUUAUCAAACAGCUUUAGAAGAAGU
|.|.||.|..||.|.|..|..|||| ||..||||.||||
ACUCAAACAAGAUCUUCUUUCAACA-CUGAAGAAUAAGU
107
108

10
18
AUUUGGAAGCUC-CUGAAGACAAGUCAUUUGGCAG
|||||.||.||. |.||||..|.|..|.||..|||
AUUUGCAAUCUUUCGGAAGGAAGGCAACUUCUCAG
109
110
10
20
AUCAAACA-GCUUUAGAAGAAGU
|||||||| ||.|.||||.||.|
AUCAAACAAGCCUCAGAACAACU
111
112
10
22
GACACAUUGCAAGCA
|||||.||||.|.||
GACACUUUGCCACCA
113
114
10
23
UGAAGUAAACCUGGACCGUUAUCAAACAGCUUUAGAAGAAGU
||||.|.|.||.|.| .||||||.|||..||.||||||.|
UGAAAUUAGCCGGAA---AUAUCAAUCAGAAUUUGAAGAAAU
115
116
10
25
AAACCUG-GACCGUUAUCAAACAGCUUUAGAAGAAGUAUUAUC
|.||.|| |||.|...|||||.|.|||.|.|...|||...|||
AGACUUGAGACAGAACUCAAAGAACUUAACACUCAGUGGGAUC
117
118
10
26
CUGCUGAGGACACAUUGCAAGCACAAGGAGAGAU
||.|.||.||...|..|.|||||...|.||||||
CUCCAGAUGAAUUACAGAAAGCAGUUGAAGAGAU
119
120
10
27
ACAGCUUUAGAAGAAG
|.||||..||||||.|
AGAGCUAAAGAAGAGG
121
122

10
28
AAACCUGGACCGUUAUCAAACAGCUU--UAGAAGAAGUAUUAUCGUGGCUUCUUUCUGCUGAGGACACAUUGCAAGC
|.||.|||| |..|.||||||..|. ||.|.||||||..||.....|||....|..|||| |.|||||.|..||
AUACUUGGA--GAAAGCAAACAAGUGGCUAAAUGAAGUAGAAUUUAAACUUAAAACCACUGA--AAACAUUCCUGGC
123
124
10
29
CUAAUGA-UGUGGAAGUGGUGAAA
|||||.| ||.||||.|.|.||.|
CUAAUCAAUGAGGAACUUGAGACA
125
126
10
30
GACAAGUCAUUUGGCAGUUCAUUGAUGGAGAGUGAAGUAAACCUGGACCGUUAUCAAACAGCUUUAGAAG
|||||| ||.|||||||.|.|| |.||.||..||..|||||.....|||||...||...||||
GACAAG-CAGUUGGCAGCUUAU--------AUUGCAGACAAGGUGGACGCAGCUCAAAUGCCUCAGGAAG
127
128
10
31
GACAAGUCAUUUGGCAGUUCAUUGAUGGAGAG-UGAAGUAA
||||||||||. ||.|||.|...|.|||. |||||.||
GACAAGUCAUG----AGAUCAGUUUAGAAGAAAUGAAGAAA
129
130
10
32
ACAAGUCAUUUGGCAGUUCAUUGAUGGAGAGU-GAAGUAAA--CCUGGACCGUUAUCAAACAGCUUUAGAA---GAAGUAUUAUCGU
|||||..|.|..|..|.|..|.||||.||.|. ||.|.|.. ||||.|..|..|.||||.|| |.|.||| ||||||.||..||
ACAAGAAAGUAAGAUGAUUUUAGAUGAAGUGAAGAUGCACUUGCCUGCAUUGGAAACAAAGAG-UGUGGAACAGGAAGUAGUACAGU
131
132
10
33
UGAUGUGGAAGUGGUGA--AAGAC
|||.||||||.|||||| |||||
UGAAGUGGAAAUGGUGAUAAAGAC
133
134

10
34
CUAAUGAUGUGGAAGUGGUGAA-AGACCAG
|||..|||.|||||.||...|| |||.|||
CUACAGAUAUGGAAUUGACAAAGAGAUCAG
135
136
10
35
AAACAGCUUUAG--AAGAAGUA
||||||.|||.| ||||||.|
AAACAGUUUUGGGCAAGAAGGA
137
138
10
36
AAGCACAAGGAGAGAUUUCUAAUGA-UGUGGA
||.||||.|||.|..|||.....|| ||||||
AAACACAUGGAAACUUUUGACCAGAAUGUGGA
139
140
10
37
GAAGUAAACCUGGA
|||.|||..|||||
GAAUUAAGACUGGA
141
142
10
38
UGAAGUAAACCUGGACCGUUAUCAAACAGCUUUAGAAGAAGU
|||||.|| .||||.|..|.|.|..|||.|.||.||.||.|
UGAAGGAA--UUGGAGCAGUUUAACUCAGAUAUACAAAAAUU
143
144
10
39
AUUGAUGGAGAGUGAAGUAAACCU
||||.||.|.||.|.||..|||.|
AUUGUUGCAAAGAGGAGACAACUU
145
146
10
40
UGAGGACACAUUGCAAGCACAAGG----AGAGAUUUCUAAUGAUGUGGAAGUGGUGAAAGA
|||||.|.||..|.|...|.|||| |||.||||||.||.| ||||.|...||..||||
UGAGGUCUCAAAGAAGAAAAAAGGCUCUAGAAAUUUCUCAUCA-GUGGUAUCAGUACAAGA
147
148

10
41
GCUGAGGACACAUUGCAAGCACAAGGAGAGAUU-UCUAAUGAUGUGG
|||||...||....|.|.|||....|||.|.|| |||.|.||||.||
GCUGAAUGCAGUGCGUAGGCAAGCUGAGGGCUUGUCUGAGGAUGGGG
149
150
10
42
CUGAAGACAAGUCAUUUGGCAGUUCAUUGAUGGAGAGUGAAGUAAACCUGGACCGUUAUCAAACAGCUUU-AGAAGAAGUAUUAUC-GUGG-----CUUCUUUCUGCUGAGGACACAU-UGC-//
|||||||||.| |.|||||.|.||..|| |||.....|..|.|.| .|.|||.|..||||..||..|.| |.|||...|||||.| |||| |||||...||||...|||...| |||
CUGAAGACAUG-CCUUUGGAAAUUUCUU-AUGUGCCUUCUACUUA--UUUGACUGAAAUCACUCAUGUCUCACAAGCCCUAUUAGAAGUGGAACAACUUCUCAAUGCUCCUGACCUCUGUGCU//
//AAGCACAAGGAGAGAUUUCU
|||..|...|| ||||.|||
//AAGGACUUUGA-AGAUCUCU
151
152
10
44
CGUUAUCAAACAGCUUUAGAAGAAGUAUUAUC-GUGGCUUCUUUCUGCUGAGGACACAUUGCAAGCACAAGGAGAGAUUUCUAAUGAUGUGGAAGUGGUGAAAGACCAGU
||||.|||....|.|.|| ||||..|.|.||| ||||||.......||||| |||..||...|| |.|...|.|.|||.||.|..||..||||...|..|||.||.|..
CGUUUUCAUUAUGAUAUA-AAGAUAUUUAAUCAGUGGCUAACAGAAGCUGA--ACAGUUUCUCAG-AAAGACACAAAUUCCUGAGAAUUGGGAACAUGCUAAAUACAAAU
153
154
10
46
AAGUAAACCUGGACCGU-UAUCAAACAGCUUUAGAAGAA---GUAUUAUCGUGG
|||.|.|.||.|.|.|. |.|||||.||.||||.|.||| ||.||||.||.|
AAGAAUAUCUUGUCAGAAUUUCAAAGAGAUUUAAAUGAAUUUGUUUUAUGGUUG
155
156

10
47
AAGCUCCUGAAGACAAGUC
||||||..|.||||||.||
AAGCUCAAGCAGACAAAUC
157
158
10
48
UGGAAGCUCCUGAAGACAAGUCAUUUGGCAGUU
|.|||||||. ||.|.|||.|.||.|||||.|
UUGAAGCUCA--AAUAAAAGACCUUGGGCAGCU
159
160
10
49
GAGAGUGAAGUAAACCUGGACCGUUAUCAAACAGCUUUAGAAGAAGUAUUAUC
||.|.||||.||....|..|...|.|.|||.|.|.|.|.|||||..|.||.||
GAAACUGAAAUAGCAGUUCAAGCUAAACAACCGGAUGUGGAAGAGAUUUUGUC
161
162
10
51
UUCAUUGAUGGAGAGUGAAGUAAACCUGGACCGUUAUCAAACAGCUUUAGA-AGAAGUAUUAUCG--UGGCUUCUUUCUGCU-GAGGACACAUUGCAAGCACAAGGAGAGAU
|||.||||||..|.|.|.|......|||| |.|.|.||||.|.|..||.|| ||||.| ||.|| |||||| |.|||||| ||..|.....|..||.||||..|.|.|||
UUCCUUGAUGUUGGAGGUACCUGCUCUGG-CAGAUUUCAACCGGGCUUGGACAGAACU--UACCGACUGGCUU-UCUCUGCUUGAUCAAGUUAUAAAAUCACAGAGGGUGAU
163
164
10
53
GAGAGAUUUCU-AAUGAUGUGGAAGUGGUGAAAGACCAGUUUCAUA
||.|||.|||. |||.|...|||.|..||..||||.||..||||.|
GAAAGAAUUCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCAGA
165
166
10
55
CAGCUUUAGAAGAA
|.|||||.||||||
CUGCUUUGGAAGAA
167
168

10
57
CAUUUGGAAGCUCCUGAAGACAAGU
|||||||||||...|...|||.|||
CAUUUGGAAGCCAGUUCUGACCAGU
169
170
10
59
CUUUCUGCUGAGGACACA
||..||.|||||||.|.|
CUGCCUCCUGAGGAGAGA
171
172
10
60
CAUUUGGAAGCUCCUGAAG
||..||||||||.|||.||
CAGAUGGAAGCUUCUGCAG
173
174
11
12
AUCAGAAGAUGAA------GAA--ACUGAAGUACAAGAGCAGAUGAAUCUCCUAAAUUCAAGAUGGGAAUGCCUCAGGGUAGCUAGCAUGGAAAAACAAA
|||||||..|||| ||| ||||....||||.|.||||.|||....|.|.....|.|..||.|..|||||..|| |.||....|.|||.|.|.||
AUCAGAAACUGAAAGAGUUGAAUGACUGGCUAACAAAAACAGAAGAAAGAACAAGGAAAAUGGAGGAAGAGCCUCUUGG-ACCUGAUCUUGAAGACCUAA
175
176
11
13
AGAAGAUGAAGAAACUGAAGUACAAGAGCAGAUGAAUCUCCUAAAUU-CAAGAUGG
|||||||..|||| .|||.|||||....|.|.|||...||.|.|. ||.|.|||
AGAAGAUCUAGAA---CAAGAACAAGUCAGGGUCAAUUCUCUCACUCACAUGGUGG
177
178
11
14
GAUGAAGAAACUGAAGUACAAGAGCAGAUGA
||||...||||....|||.|.|..||||.||
GAUGGGCAAACAUCUGUAGAUGGACAGAAGA
179
180

11
15
UAUCAGAAGAUGAAGAAACUGAAGUACAAGAG-CAGAUGAAUCUCCUAAAUUCAAGAUGGGAAUGCCUCAGGGUAGCUAGCAUGGAAAAAC
|.||||||.|.|||||..|.|. |.||||||. ||.|..|.|..|.| |.|||||...||||. .|...||.|.||.|.|.||||||
UUUCAGAAAAAGAAGAUGCAGU-GAACAAGAUUCACACAACUGGCUU----UAAAGAUCAAAAUGA--AAUGUUAUCAAGUCUUCAAAAAC
181
182
11
16
AAGAAACUGAAGUACAAGAGCAGA-UGAAUCUCCUAAAUUCAAGAU
||||||..|.|.|.||.|.|||.| ||.||...||.||. ||||||
AAGAAAAAGCAAUCCAUGGGCAAACUGUAUUCACUCAAA-CAAGAU
183
184
11
18
AGGAAAAUUAUCAGAAGAUGAAGAAA
|||.||.||.|||||.....||||||
AGGCAACUUCUCAGACUUAAAAGAAA
185
186
11
20
CGGGUUGGUAAUAUUCUACAA-UUGGGAAGUAAGCUGAUUGGAACAGGAAA-AUUAUCAGAAGA
|.|||.|.|...|||||.|.| |||..||||.||....|| |||.||... |.||||||||.|
CCGGUGGAUCGAAUUCUGCCAGUUGCUAAGUGAGAGACUU--AACUGGCUGGAGUAUCAGAACA
187
188
11
22
CCAUCAGGGCCGGGUU
||||||||.|..||.|
CCAUCAGGACAUGGGU
189
190
11
23
CUGAUUGGAACAGGAAAAUU--AUCAGAAGAUGAAGAAACUGAAGUACAAGAGCAGAUGAAUCUCCU
||||....|.|.|||||..| |||||||..||||||||.|||.|.||....|.|||.|. ||||||
CUGAAAUUAGCCGGAAAUAUCAAUCAGAAUUUGAAGAAAUUGAGGGACGCUGGAAGAAGC-UCUCCU
191
192

11
24
GAUGAAGAAACUGAAGUACAAGAGCAGAUGAAUC
|||..|||||.|. ||.||.|||||.||||.|
GAUUCAGAAAUUC---UAAAAAAGCAGCUGAAAC
193
194
11
25
GUUGGUAAUAUUCU-ACAAUUGGGA--AGUAAGCUGAUUGGAACAGGAAAAUUAUCAGAAGAUGAAGAAACUGAAGUACA
||..||.||||||. ||||||..|. |||......|.||..| |.|||..|...||||||||.||||| |||||.|.|
GUCAGUGAUAUUCAGACAAUUCAGCCCAGUCUAAACAGUGUCA-AUGAAGGUGGGCAGAAGAUAAAGAA--UGAAGCAGA
195
196
11
26
CAGGAAAAU-UAUCAGAAGAUGAAGAAACUGAAGUACAAGAGCAGAUGAA
|||.||.|| ||||||| ||||.|..|| ||.|..|||..|||.||.|||
CAGAAAGAUCUAUCAGA-GAUGCACGAA-UGGAUGACACAAGCUGAAGAA
197
198
11
27
AAGAUGAAGAAACUGAAGUACAAGAGCAGAUGAAUCUCCUAAAU
||||.||.|......||..|.|||.|.|..||||.|||||.|.|
AAGAAGAGGCCCAACAAAAAGAAGCGAAAGUGAAACUCCUUACU
199
200
11
28
GAAGAUGAAGAAA---CUGAAGUACAAGA
|.||.|||.|||| ||||.||.|.|||
GGAGCUGAGGAAAUCUCUGAGGUGCUAGA
201
202
11
29
GCUGAUUGGAACAGGAAAAUUAUCAGAAGAUGAAGAAACUGAAGUACAAGAGCA--GAUGAAUCUCCUAAAUUCAA
||..|||||.|||| |...||.||||.|..|.||..|..||.|..|.| |.|| ||.|||..|...|.|||.||
GCAUAUUGGCACAG--ACCCUAACAGAUGGCGGAGUCAUGGAUGAGCUA-AUCAAUGAGGAACUUGAGACAUUUAA
203
204
11
31
AAGCUGAUUGGAACAGGAAAAUUAUCAGAAGAUGAAGAAACUGAAGUA-CAAGAGCAGAUGAA
||.||||||.||..||..|....|||||...| ||||||| |||||.| ||..|.|||..|||
AAUCUGAUUUGACAAGUCAUGAGAUCAGUUUA-GAAGAAA-UGAAGAAACAUAAUCAGGGGAA
205
206

11
32
AUUGGGAAGUAAGCUGAUUGGAACAGGAA
|||||.||..|||. |..|||||||||||
AUUGGAAACAAAGA-GUGUGGAACAGGAA
207
208
11
33
AAAAUUAUCAG--AAGAUGAAGAAACUGAAGUACAAGAGCAGAUGAA
||||.|.|.|| ||| ||||| .|||||||..||..|..|||.||
AAAAGUCUGAGUGAAG-UGAAG--UCUGAAGUGGAAAUGGUGAUAAA
209
210
11
34
UGGAACAGGAAAAUU-AUCAGAAGAUGAAGAAA
|||||..|..|||.. |||||.||.|||||.||
UGGAAUUGACAAAGAGAUCAGCAGUUGAAGGAA
211
212
11
35
AGAUGAAGAAACUGAAG
||||..||||||.||||
AGAUUGAGAAACAGAAG
213
214
11
36
AUCAGAAGAUGAAGAAACUGAAGUACAAGAGCAGAUG
|||||| ||..|||||||...||.| ||.||.|||.|
AUCAGA-GAAAAAGAAACCCCAGCA-AAAAGAAGACG
215
216
11
37
AUGGAUUUGACAGCC
||.|||||| |||||
AUCGAUUUG-CAGCC
217
218
11
38
AAAAUUAUCAGAAGAUGAAGAAACUGAAGUACAAGAGCAGAUGAAUCU
||||||....|||......||..|||||.|.||..||..|.|||||||
AAAAUUGCUUGAACCACUGGAGGCUGAAAUUCAGCAGGGGGUGAAUCU
219
220

11
39
AGAAGAUGA-AGAAACUGAAG-UACAAGAGCAGAUG
||||...|| ||.||.|.||| ||.||.|||||.||
AGAAAGCGAGAGGAAAUAAAGAUAAAACAGCAGCUG
221
222
11
40
AGUACAAGAG-CAGA-UGA--AUCUCCUAAAUU
|||||||||| |||. ||| |||||||.||.|
AGUACAAGAGGCAGGCUGAUGAUCUCCUGAAAU
223
224
11
41
GAAAAUUAUCAGAAGAUGAAGAAACUGAAGUACAAGAGCAGAUGAAU
||||.|.|||.|.|..||.|||| ||||.| ||||.||.|||||
GAAAUUGAUCGGGAAUUGCAGAA---GAAGAA--AGAGGAGCUGAAU
225
226
11
42
UAUCAGAAGAUGAAGAA
|||.|||||..|||.||
UAUUAGAAGUGGAACAA
227
228
11
44
ACAAGAGCAGAUGAAUCUCCUAAAUUCAAGAUGGGAAUGCCUCAGGGUAGCUAGCAUGGAAAA-ACAAA
|||..|||.||..|.|.||..|.| ||||....|||.|||.||..|.|..|.||||..||| |||||
ACAGAAGCUGAACAGUUUCUCAGA---AAGACACAAAUUCCUGAGAAUUGGGAACAUGCUAAAUACAAA
229
230
11
46
GAAGUACAAGAGCAGAUGAAUCUCCUAAAUUCAA
||||.||||.||.|.||.. |.||..||.|||||
GAAGAACAAAAGAAUAUCU-UGUCAGAAUUUCAA
231
232
11
47
CAGAAGAUGAAGA--AACUGAAGUACAAG----AGCAGAUGAAUCUCC
|||||||..|||| ||||..|..|.||| ||||||..|||||||
CAGAAGAGCAAGAUAAACUUGAAAAUAAGCUCAAGCAGACAAAUCUCC
233
234

11
48
AACUGAAGUACAAG-AGCAGAUGAAUCUCCUAAAUUCAAGA
|.||||...||||| ||.|..||||.||| ||||..||||
ACCUGAGAAACAAGGAGAAAUUGAAGCUC--AAAUAAAAGA
235
236
11
49
GGAACAGGAAAAUUAUCAGAAGAUGAAGAAACUGAAGUACAAGAG
|.|||.|.||.|..|....|||.|.||.||.|.||.||..|||||
GAAACUGAAAUAGCAGUUCAAGCUAAACAACCGGAUGUGGAAGAG
237
238
11
51
AUGAAUCUCCUAAAUUCAAGAUGGGAAUGCC
|.|||.||.|.|..|.|||..|.|.||||||
AGGAAACUGCCAUCUCCAAACUAGAAAUGCC
239
240
11
53
GAAAAUUAUCAGAAGAUGAAGAAACUGAAGUACAAGAGCA
||||....||||||...|..|.| ||||||||||||.||
GAAAGAAUUCAGAAUCAGUGGGA--UGAAGUACAAGAACA
241
242
11
55
AGAUGAAGAAACUGAAGUACAAGAGCAGAUGAAUC
|||.||....|..|.||||.||||||.||||||.|
AGAAGACUCCAAGGGAGUAAAAGAGCUGAUGAAAC
243
244
11
57
GGAAGUAAGCUGAUUGGAACAGGAAAAUUAUCAGAAGAU--GAAGAA-ACUGAAGUACA
||.||..|.|| |||||| ||..|.||..|||.||.| ||||.| |..||.|||||
GGCAGGCACCU-AUUGGA---GGCGACUUUCCAGCAGUUCAGAAGCAGAACGAUGUACA
245
246

11
59
UCAGGGCCGGGUUGGUAAUAUUCUACAAUUGGGAAGUAAGCUGAUUGGAACAGGAAAAUU- AUCAGAAGAUGAAGAAACU----GAAGUACAAGAGCAGAUGAAUCUCCUAAAU-//
|||...|.|.||.||.||.|||..||.. |.|.|..|||||.|||.|.||.|||||. ||.|||...|..|.|.||| |||.|.||||||...|.|.||...||..|.
UCAAUACUGAGUGGGAAAAAUUGAACCU----GCACUCCGCUGACUGGCAGAGAAAAAUAGAUGAGACCCUUGAAAGACUCCAGGAACUUCAAGAGGCCACGGAUGAGCUGG ACC//
//UCAAGAUGGGAAUGCCUCAGGGUAGCUAG
|||||.||.|.....||.|||..|.|.||
//UCAAGCUGCGCCAAGCUGAGGUGAUCAAG
247
248
11
60
CCUAAAUUCAAGAUGGGA
|||.||..|.||||||.|
CCUGAACACCAGAUGGAA
249
250
12
17
ACAUAGAGUUUUAAUGGA
|||.|.|..|.|||||||
ACAGACAACUGUAAUGGA
251
252
12
43
GCUAACAAAAAC-AGAAGAAAGAACAAGG
|.||||||||.. |.|||.|...||||||
GUUAACAAAAUGUACAAGGACCGACAAGG
253
254
12
45
CAAAAACAGAAGAAAGAA-----CAAGGAAAAUGGAGGAAG
||||||||||.|..||.| ||.|.|||||.| |||||
CAAAAACAGAUGCCAGUAUUCUACAGGAAAAAUUG-GGAAG
255
256

12
54
UUACAUAGAGUUUUAAUGGAUCUCC-AGAAUCA
|.|||.|||.|.|.||||..|||.. ||||.||
UAACAGAGAAUAUCAAUGCCUCUUGGAGAAGCA
257
258
12
56
GAUCUCCA----GAAUCAGAAACUGAAAGAGUUGA--AUGACUGGCUA-ACAAAAACAGAAGAAAGAAC
||.||||| |||...|||.||.|.|.||.||. ||.||...||. |..|||||||...|||.|.|
GACCUCCAAGGUGAAAUUGAAGCUCACACAGAUGUUUAUCACAACCUGGAUGAAAACAGCCAAAAAAUC
259
260
13
15
UCACGCAACUGCUGCUUUGGAAGAACAA
||||.|||||| |||||. ||||.|||
UCACACAACUG--GCUUUA-AAGAUCAA
261
262
13
16
AAGAAGAUCUAGAACAAGAACAAG
|||..||||||||| |||||.|||
AAGCGGAUCUAGAA-AAGAAAAAG
263
264
13
18
AAUCUAGUGGAGAUCACGCAACUGCU--GCUUUGGAAGAACAACUUAA
|||||...|||....|.||||||.|| |..||..|||||.||.|.||
AAUCUUUCGGAAGGAAGGCAACUUCUCAGACUUAAAAGAAAAAGUCAA
265
266
13
20
AUCUAGUGGAGAUCACG-CAACUGCUGCU
|.|.|.|||||...|.| |||||.|||||
AACAAUUGGAGCAGAUGACAACUACUGCU
267
268
13
22
AGUCAGGGUCAAUUCUCUC
||||||...|.|..|||||
AGUCAGAAACCAAACUCUC
269
270

13
23
GCUUCAAGAAGAUCUAGAACAAGAACAAGUCAG-GGUCAAUUCUCUCAC
||||.|..|||.|||... |||||.|||...|| ||.|.||.||.||.|
GCUUUACAAAGUUCUCUG-CAAGAGCAACAAAGUGGCCUAUACUAUCUC
271
272
13
24
ACAUGG-UGGUGGUAGUUGAUG
|.|||| |||..|.||||||||
AAAUGGAUGGCUGAAGUUGAUG
273
274
13
25
AGAAGAUCUAGAACAAGAACAAGUCAGGGU
|||||||..||||..|.....||.|||.||
AGAAGAUAAAGAAUGAAGCAGAGCCAGAGU
275
276
13
26
CUUCAAGAAGAUCUA
||.||..||||||||
CUCCAGAAAGAUCUA
277
278
13
27
UCAAGAAGAUCUAGAACAAGAACAAGUCAGGGUCAAUUCUCUCACUCA
|.|||||||.....|||||.||.|||..|..||.||....||.|||.|
UAAAGAAGAGGCCCAACAAAAAGAAGCGAAAGUGAAACUCCUUACUGA
279
280
13
28
CAUGGUGGUGGUAGUUGAUG--AAUCUAGUGGAGAUCACGCAACUGCUGCUUUG-GAAGAACAACUUAA
||||.|||....||||..|| |..||.|..||.|.||..|||.|| |||... ||||.|.||.||||
CAUGUUGGCAUGAGUUAUUGUCAUACUUGGAGAAAGCAAACAAGUG--GCUAAAUGAAGUAGAAUUUAA
281
282
13
29
CAUGGUGGUGGUAGUUGAUGA
|||||..|.|.||.|..||||
CAUGGAUGAGCUAAUCAAUGA
283
284

13
30
UCACUCACAUGGUGGUGGUAGUUGAUGAAUCUAGUGGAGAUC-ACGCAACU
|||.|.|||.|..|.|||.||.|.|| |.|..||...||.|. |||||.||
UCAUUGACAAGCAGUUGGCAGCUUAU-AUUGCAGACAAGGUGGACGCAGCU
285
286
13
31
AGAAGAUCUAGAACAAGAACAAGUCAGGG
||||||..| |||.||..|.|| ||||||
AGAAGAAAU-GAAGAAACAUAA-UCAGGG
287
288
13
32
GAUGAAUCUAGUGGA---GAUCACGCAACUGC-UGCUUUGGAA
|||||.|.|||..|| ||..|.|||..||| |||.||||||
GAUGAUUUUAGAUGAAGUGAAGAUGCACUUGCCUGCAUUGGAA
289
290
13
34
GCAACUGCUGCUUUGGAA
|||.||.|.|.|.|||||
GCAGCUACAGAUAUGGAA
291
292
13
35
UCAAGAAGAUCUAGAACAAGAACAAGUCAGGGUCAAUUCUCUCACUCACAUGGUGGUGGUAGUUGAUGAAUCUAGUGGAGAUCACGCAACUGCUGCUUUGGAAGAACAACUUA
||||.||||..|.||..||.|..|.||.....|.||...|.||||..|..|.|..|.||.. ||||..|...|..|||..|..|.|.|...|.||. |||||||..||||.|
UCAAAAAGAGAUUGAGAAACAGAAGGUGCACCUGAAGAGUAUCACAGAGGUAGGAGAGGCC-UUGAAAACAGUUUUGGGCAAGAAGGAGACGUUGG--UGGAAGAUAAACUCA
293
294
13
36
UUGAUGAAUCUAGUGGAGAUCACGCAACUGCUGCUUUG-GAAGAACAACUUAAG
|.||||||||. ||||..|.|.|||..|.||.... |||||....||||||
UGGAUGAAUCA----GAGAAAAAGAAACCCCAGCAAAAAGAAGACGUGCUUAAG
295
296

13
37
GAAUCUAGUGGAGAUCACGCAAC
||.||||...|.||.||.|||.|
GACUCUACACGUGACCAAGCAGC
297
298
13
38
AUCUAGAACAAGAACAAGUCA
||||..||.|.|||.|..|||
AUCUGAAAGAGGAAGACUUCA
299
300
13
39
GAUGAAUCUAGUGGAGAUCACGC---AACUGCUGCUUUGGAAGA-ACAACUUAA
||..||.|.||.|||.||.|.|. |||.||.|||.|...||| |.|||.|||
GAGAAAGCGAGAGGAAAUAAAGAUAAAACAGCAGCUGUUACAGACAAAACAUAA
301
302
13
40
AGAUCUAGAACAAGAACAAGUCAGGGUC---AAUUCUCUCACUCACAUGGUGGUGGUAGUUGAUGAAUCUAGUGGA-GAUCACGC-AACUGCU
||.|||..||.|||||.|| |||.|| ||.|.||||| ||| |||||...|||..|.||..|..|..|| ||||.|.. ||.||||
AGGUCUCAAAGAAGAAAAA---AGGCUCUAGAAAUUUCUCA-UCA----GUGGUAUCAGUACAAGAGGCAGGCUGAUGAUCUCCUGAAAUGCU
303
304
13
41
AGUGGAGAUCACGCAACUGCUGCUUUGGAAG
|||||||...||.||..|.|.|||..|.|||
AGUGGAGCCAACUCAGAUCCAGCUCAGCAAG
305
306
13
42
UGAUGAAUCUAG--UGGAGAUCACGCAACUGCUGC-UUUGGAA
|||.|||.|.|. |||.|||.||..||....||| |||||||
UGAAGAAACGAUGAUGGUGAUGACUGAAGACAUGCCUUUGGAA
307
308

13
44
AGUUGAUGAAUCUAGUGGAGAUCA----CGCAACUGCUGCUUUGGAAGA-ACAACUU
||.|..|.|||| |||||..|.|| |..|||.|.|.||..|.|||| ||||.||
AGAUAUUUAAUC-AGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAAGACACAAAUU
309
310
13
46
CUUCAAGAAGAUCUAGAACAAG
||..|||||.|.||.||.||||
CUAAAAGAAAAGCUUGAGCAAG
311
312
13
47
GUGCUUCAAGAAGAUCU--AGAACAAGAACAAGU
|||||.|.|.|||..|. |||.|||||..||.|
GUGCUCCCAUAAGCCCAGAAGAGCAAGAUAAACU
313
314
13
48
AGUGGAGAUCACGCAACUGCUGCUUUGG
||.|.||.|.|..||.||||||||.|||
AGAGCAGUUAAAUCAUCUGCUGCUGUGG
315
316
13
49
UAGAACAAGAACAAGUCAG
|.|.|||||.|.||..|||
UUGUACAAGGAAAAACCAG
317
318
13
51
GGUCAAUUCUCUCACUCACAUGGUGGUGGUAGUUGAUGAAUCUAGUGGAGAUCACGCAACUGCUGCUUUGGAAGAA
|.||||.|.....|.|||||..| ||||.|.||.|.|||. ||.|.|||.||||...|..||.|..|...|.||||
GAUCAAGUUAUAAAAUCACAGAG-GGUGAUGGUGGGUGAC-CUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAGAA
319
320
13
53
GAUCUAGAACAAGAACA
|||..||.|||||||||
GAUGAAGUACAAGAACA
321
322

13
55
GCUGCUUUGGAAGAA
|||||||||||||||
GCUGCUUUGGAAGAA
323
323
13
57
UUCAAGAAGAUCUAGAACAAGAACAA
|||.||.||.|| ||||..|||||.|
UUCCAGCAGUUC-AGAAGCAGAACGA
324
325
13
59
GGAGAUCACGCAACUGCUGCUUUGGAAGAACAACUUAAG
||.||||.|...|.||...||.|..||||.||.||..||
GGCGAUCUCCUCAUUGACUCUCUCCAAGAUCACCUCGAG
326
327
13
60
GCAACUGCUGCUUUGGAAGAACAACUUAAG
|.||.|||..||.||.||||. |||.|.||
GAAAUUGCGCCUCUGAAAGAG-AACGUGAG
328
329
14
15
ACGUCUUACUGAAGAACA
|.|.|||.|.|||.||.|
AUGGCUUUCAGAAAAAGA
330
331
14
16
AUCGAUGGGCAAAC
|||.||||||||||
AUCCAUGGGCAAAC
332
333
14
18
UUCUCAAAUGGCAACGUCUUACUGAAGAA
|.||.||.|.|||| ||||.|.||||.|
UCCUGAAUUUGCAA--UCUUUCGGAAGGA
334
335

14
20
CAAAUGGCAACGUCUUACUGAAGA
||.|||.|||| |..|.|||||.|
CAGAUGACAAC-UACUGCUGAAAA
336
337
14
22
UAUUGGGAGAUCGAUGGGCAAACAUCUGUAGAUGG
|||..|||||.| |||.|... ||||.|.|.||||
UAUCAGGAGACC-AUGAGUGC-CAUCAGGACAUGG
338
339
14
23
UUUACAAGACAUCCUUCUCAAAUGGCAAC
||||||| |..|| |||..||..|||||
UUUACAA-AGUUC--UCUGCAAGAGCAAC
340
341
14
24
AAGACAUCCUUCUCAAAUGGCAACGUCUUACUGAAGAA
||||.||...|..|..|.|...|.||.||.||||||.|
AAGAAAUGGAUGGCUGAAGUUGAUGUUUUUCUGAAGGA
342
343
14
25
UGUAGAUGGACAGAAGA
||.||.|||.|||||||
UGAAGGUGGGCAGAAGA
344
345
14
27
AAAUGGCAACGUCUUACUGA
|||..|.|||..||||||||
AAAGUGAAACUCCUUACUGA
346
347
14
28
GCAAACAUCUG--UAGAUGGA
|||||||..|| ||.|||.|
GCAAACAAGUGGCUAAAUGAA
348
349

14
29
AUCGAUGGGCAAA
||.||||.||.||
AUGGAUGAGCUAA
350
351
14
30
CAGAAGACCGCUGGGUUCUUUUACAAG
|||.||.||......|||.||.|||||
CAGGAGUCCCUCACAUUCAUUGACAAG
352
353
14
31
UUUUACAAGACAU
|||.|||||.|||
UUUGACAAGUCAU
354
355
14
32
UGUAGAUGGACAGAAGA
|.||||||.|..|||||
UUUAGAUGAAGUGAAGA
356
357
14
33
AACGUCUUACUGAAG
||.||||.|.|||||
AAAGUCUGAGUGAAG
358
359
14
34
AAAUGGCAACGUCUU-ACUGAA
||||| ||.||||| ||.|||
AAAUG--AAUGUCUUGACAGAA
360
361
14
35
CAGAAGACCGCUGGGUUCUUUU
|||||||..|.|....||||||
CAGAAGAGUGGUUAAAUCUUUU
362
363

14
36
CAAAUGGCAACGUCUUAC
||.||||.|||.|.|.||
CACAUGGAAACUUUUGAC
364
365
14
37
AUCGAUGGGCAAACAUCUGUAGAUGGACAGAAGACCG
||||||..|||..|||.|. |.|..||...|||||.|
AUCGAUUUGCAGCCAUUUC-ACACAGAAUUAAGACUG
366
367
14
38
UCUCAAAUGGCAACGUCUUACUGAAGA
|||.|||..|.||....|.|.|.||||
UCUGAAAGAGGAAGACUUCAAUAAAGA
368
369
14
39
GAAGACCGCUGGGUUCUUUUACAAGACAUCCUUCUCAAAUGGCAACGUCUUAC
||||||.....||.|..|.||.|||| ||..||...||..||..||..|||||
GAAGACAAUGAGGGUACUGUAAAAGA-AUUGUUGCAAAGAGGAGACAACUUAC
370
371
14
40
ACGUCUUACUGAAGAACA
|.||||.|..||||||.|
AGGUCUCAAAGAAGAAAA
372
373
14
41
GGGAGAUCGAUGGGCAAA
||||.||.|| |.|||||
GGGAAAUUGA-GAGCAAA
374
375
14
42
AAGACAU-CCUUCUCAAAU
||||||| ||||...||||
AAGACAUGCCUUUGGAAAU
376
377

14
44
AAAUGGCAACGUCUUACUGAAGA
|||||||..|||.||..|.|.||
AAAUGGCGGCGUUUUCAUUAUGA
378
379
14
46
UAGAUGGACAGAAGA
||||.|.|||.||||
UAGAAGAACAAAAGA
380
381
14
47
UUCUCAAAUGGCAACGUCUUACUGAAGAAC
||||||||.....|..|...||||.||.||
UUCUCAAACAAUUAAAUGAAACUGGAGGAC
382
383
14
48
AUUGGGAGAUCGAUGGGCAAACAUCUGUAGAUGGAC
|.|.|||.||..||...|||.||.....|||.||||
AGUUGGAAAUUUAUAACCAACCAAACCAAGAAGGAC
384
385
14
49
AUGGGCAAACAUCUGUAGAUGGACAGA
|.|||||. |||.||||.|.|||.|.|
AAGGGCAG-CAUUUGUACAAGGAAAAA
386
387
14
51
UGGACAGAAG--ACCG-CUGGGUUCUUUUACAAGACAUCCUUCUCAAAUGGCA
|||||||||. |||| ||||.||..|.|.|..||.....||.|.||||..||
UGGACAGAACUUACCGACUGGCUUUCUCUGCUUGAUCAAGUUAUAAAAUCACA
388
389
14
53
UGGGUUCUUUUACAAGACAUCCUUCUCAAAUGG---CAACGUCUUACUGAA
||||.|....|||||||...|||||..||..|| ||||...|.|.||||
UGGGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGAAUGAA
390
391

14
55
CAAAUGGCAACGUCUUACUGAA
|||.||.|||.|||.|||.|.|
CAACUGCCAAUGUCCUACAGGA
392
393
14
57
CUUUUACAAGACAUCCUUCUCAAAUGGCAACGUCU
|.|||..|||.||....|..|.|.|||.|.|||||
CAUUUGGAAGCCAGUUCUGACCAGUGGAAGCGUCU
394
395
14
59
GAUGGGCAAACAUCUGUAGAUG
||..||||.|.|....||||||
GACUGGCAGAGAAAAAUAGAUG
396
397
14
60
CUGUAGAUGGACAGAAGACC-GCUGGGUUCUUUUACA
||.|.||.|..|.|||.||| |.|||...|||.|.||
CUCUGGAAGACCUGAACACCAGAUGGAAGCUUCUGCA
398
399
15
16
AGAAAAAGAAGAUGCAGUG---AACAAGAUUCACACAA
||||||||.| ||.||..| |||...||||||.|||
AGAAAAAGCA-AUCCAUGGGCAAACUGUAUUCACUCAA
400
401
15
18
CACAACUGGCUUUAAAGAUCAAAAUGAAAUGUUAUCAAGUCUUCAA
||||.||||.||....|.|||.|| |...||||....||||.|.||
CACAGCUGGAUUACUCGCUCAGAA-GCUGUGUUGCAGAGUCCUGAA
402
403
15
20
AAAGAAGAU-GCAGUGAACAAGAUUCACA-CAACUG
||.|.|||| |||...||||||..|||.| ||||||
AAUGCAGAUAGCAUCAAACAAGCCUCAGAACAACUG
404
405

15
23
AACUGGCUUUAAAGAUCAAAAUGAAAU
||.|.||...|||.|||||...|||.|
AAUUAGCCGGAAAUAUCAAUCAGAAUU
406
407
15
24
UUCAGAAAAAGAAGAUG---CAGUGAACA
|||..||||||.||.|| |||||.|.|
UUCUAAAAAAGCAGCUGAAACAGUGCAGA
408
409
15
25
UUUUAGUGCAUGGCUUUCAGAAAAAGAAGAUGCAGUGAACA-AGAUUCACACAACUGGCUUUAAAGAUCAA-AAUGAA
|||||||...||...||||||.||...||.. ||||..|.| ||..|||...||...|.....|||||.|| ||||||
UUUUAGUCAGUGAUAUUCAGACAAUUCAGCC-CAGUCUAAACAGUGUCAAUGAAGGUGGGCAGAAGAUAAAGAAUGAA
410
411
15
26
AUGGCUUUCAGAAAAAGAAGAUGCAGUGAACAAG
|||..||.|||||| |.||.||.||.||..|||
AUGAAUUACAGAAA--GCAGUUGAAGAGAUGAAG
412
413
15
27
AGAAAAAGAAGAUGCAGUGAA
|.|||||||||....||||||
ACAAAAAGAAGCGAAAGUGAA
414
415
15
28
CACACAACUGGCUUUAAAGAUCAAAAUGAAAUGUUAUCAAGUCUUCAAAAACU
||.||||.|||||..|...|..|.|||..||..|||..|...||..|||.|.|
CAAACAAGUGGCUAAAUGAAGUAGAAUUUAAACUUAAAACCACUGAAAACAUU
416
417
15
29
AGAAGAUGCAGUGAACAAGAUUCACACA
|||.|||......||..||||||.||.|
AGAGGAUAACCCAAAUCAGAUUCGCAUA
418
419

15
30
UUUCAGAAAAAGAAGAUGCAGUGAACAAGAUUCA
||.||||.||.|..||.||||...|.|.|..|||
UUGCAGACAAGGUGGACGCAGCUCAAAUGCCUCA
420
421
15
31
AAAAUGAAAUGUUAU----CAAGUCUUCAAA
|||||..|||.|.|| ||||||.|.|.|
AAAAUCCAAUCUGAUUUGACAAGUCAUGAGA
422
423
15
32
GCCUUUUUAGUGCAUGGCUUUCAGAAAAAGAAGAUG
|||..|||.|.|||..|..|.||..|||..||||||
GCCAAUUUUGAGCAGCGUCUACAAGAAAGUAAGAUG
424
425
15
33
UUCAGAAAAAGAAGAUGCA
|.|||||||||.|||.|.|
UACAGAAAAAGCAGACGGA
426
427
15
34
CAGAAAAAGAAGAUGCAGUGAACAAGAUUCACACAACUGGCUUUAAAGAU-CAAAAUGAAAUGUUAUCAAGUCUUCAAAAACUGGC
||||||.| |||...||||.....|.||.|....||.||.|....||||| |.|||.||||||. |.|||||.|.|.|.||||
CAGAAAGA-AAGCAACAGUUGGAGAAAUGCUUGAAAUUGUCCCGUAAGAUGCGAAAGGAAAUGA----AUGUCUUGACAGAAUGGC
428
429
15
35
UUCAGAAAAAGAAGAUGCAGUGAACAAGAUUCACACA
||.|||||.|||||.||||....|..||..|||||.|
UUGAGAAACAGAAGGUGCACCUGAAGAGUAUCACAGA
430
431

15
36
UGCAUGGCUUUCAGAAAAAGAAGAUGCAGUGAACAAGA
||.|||..|...||||||||||....|||..|| ||||
UGGAUGAAUCAGAGAAAAAGAAACCCCAGCAAA-AAGA
432
433
15
37
UUUAAAGAUCAAAAUGAA
|||||||....||.||||
UUUAAAGGCAGAACUGAA
434
435
15
38
UGCAUGGCUUUCAGAAAAAGAAGAUGCAGUG-AACA-AGAUUCACACAACUGGCUUUAA
|.|||..|||| |||..|...|..|||||. |||. ||||..|||.||.|.||||.||
UCCAUUCCUUU--GAAGGAAUUGGAGCAGUUUAACUCAGAUAUACAAAAAUUGCUUGAA
436
437
15
39
UCAGAAAAAGA-AGAUGCAGUGAACAAGAUUCACACAACUGGCUUUAAAGAUCAAAAUGAAAUGUUAUCAAG
|.|||.||||. |||.|.|.|.||.| |.|.|||.|.|...|||.||| |||||...||||.|.|||||
UGAGAGAAAGCGAGAGGAAAUAAAGA----UAAAACAGCAGCUGUUACAGA-CAAAACAUAAUGCUCUCAAG
438
439
15
40
AAAGAAGAUGCAGUGAACAAGA---UUCACACAACUGGCUUUAAAGAUCAAAAUGAAAUGUUAUCAAGUCUUCAAAAACUGG
||||||||...|..|..|.||| |||.||..|.|||..|. ||..|||.|.|.|...|.||.|..||.|.|||..||.|
AAAGAAGAAAAAAGGCUCUAGAAAUUUCUCAUCAGUGGUAUC--AGUACAAGAGGCAGGCUGAUGAUCUCCUGAAAUGCUUG
440
441
15
41
UUUCAGAAAAAGAAGAUGCAG-UGAA
||.|||||.|||||...|.|| ||||
UUGCAGAAGAAGAAAGAGGAGCUGAA
442
443

15
42
GGCUUUAAAGAUC
|.||||.||||||
GACUUUGAAGAUC
444
445
15
44
UUUUUAGUGCAUGGCUUUCAGAAAAAGAAGAUGCAGUGAACAAGAUUCACACAACUG-GCUUUA--AAGAU-CAAAAUG-AAAUGUUAUC
|.||||.|...|||||..|||||...|||.|.....|.|..||||..||.|...||| |..||. ||.|| |.||||. |||||.||||
UAUUUAAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAAGACACAAAUUCCUGAGAAUUGGGAACAUGCUAAAUACAAAUGGUAUC
446
447
15
46
AAGAUCAAAAUGAAAUGUUAUCAAGUCUUCAAAAA
||||.|||||..|.||.||.|||....||||||.|
AAGAACAAAAGAAUAUCUUGUCAGAAUUUCAAAGA
448
449
15
47
AAGAUCAAAAUGAAA-UGUUAUCAAGUCUUCAAA
|||||.||..||||| |....|||||....||||
AAGAUAAACUUGAAAAUAAGCUCAAGCAGACAAA
450
451
15
48
GCUUUCAGAAAAAGAAGAUGCAGUGAA
||||..|||....||||| |||||.||
GCUUGAAGACCUUGAAGA-GCAGUUAA
452
453
15
49
GAAAAAGAAGAUGCAGUGAACAAGAUUCACACAACUGGCUUU
||||..|||...|||||. ||||.| |.|||||.||.|.|
GAAACUGAAAUAGCAGUU--CAAGCU--AAACAACCGGAUGU
454
455

15
51
UGGCUUUAAAGAUCAAAAUGAAAUGUU-AUCAAG
||.|.||.|.|||...||.||.|||.| ||||||
UGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAG
456
457
15
53
UUCAGAAAAAGAAG-AUGCAGUG-AACAAGAUUCACACAACUGGCUUUAA-AGAUCAAAAUGAAAUGUUAUCAAGUCUUCAAAA-ACUGGC
|||||||..||..| |||.|||. ||.||.|....||.|||.||....|| ||.|.| ||||||||||| |||..|||||.| |.||||
UUCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGA--AUGAAAUGUUA--AAGGAUUCAACACAAUGGC
458
459
15
55
UUUAGUGCAUGGCUUUCAGAAAAAGAA
|||..|||.||||||.|||||...|||
UUUCUUGCCUGGCUUACAGAAGCUGAA
460
461
15
57
UUCAGAAAAAGAA-GAUGCA
|||||||..|||| ||||.|
UUCAGAAGCAGAACGAUGUA
462
463
15
59
UGGCUUUCAGAAAAAGA-AGAUG
||.||..||||.|||.| |||||
UGACUGGCAGAGAAAAAUAGAUG
464
465
15
60
UCAGAAAAAGAAGAUG
||.||||.||||..||
UCUGAAAGAGAACGUG
466
467

16
18
AAAAGAAAAAG-CAAU
||||||||||| ||||
AAAAGAAAAAGUCAAU
468
469
16
20
UAAGUCAGUGACCCAGAAGACGGAAGCAUGGCUGGAUAACUUUGCCCGGUGUUGGGAUAAUUUAGUCCAAAAACUUGAAAAGAGUACAGC
|||||.||.|||..|...|.|.|.||.|| |.|.|.|||.| |.....||...|||||....|.|||.||.|.||..|||..|||.|
UAAGUGAGAGACUUAACUGGCUGGAGUAU--CAGAACAACAU---CAUCGCUUUCUAUAAUCAGCUACAACAAUUGGAGCAGAUGACAAC
470
471
16
22
AAGUCAGUGACCCAGAAGACGGAAGCAUGG
||.|.||||.|.|.||..|.|.||.|||||
AACUUAGUGUCACCGACUAUGAAAUCAUGG
472
473
16
23
AAAAGCAAUCCAUGGGCAAACUGUAUUCACUCAAACAAGAUC
||||||.| .|.|.||||| ||.||..||||..|.||..||
AAAAGCUA--GAGGAGCAAA-UGAAUAAACUCCGAAAAAUUC
474
475
16
24
ACCCAGAAGACGGAAGCAUGGCUGGA
||||.|||||. |.|.|||||||.|
ACCCUGAAGAA--AUGGAUGGCUGAA
476
477
16
25
AAGACGGAAGCAUGGCUGGAUAACUUUGCCCGGUGUUGGGAUAAUUUAGUCCAAAAACUUGAAA
||||..||||||..||..||. |||||...|.|....||.|....|.||.||.|||||.|.|
AAGAAUGAAGCAGAGCCAGAG---UUUGCUUCGAGACUUGAGACAGAACUCAAAGAACUUAACA
478
479

16
26
GGGCAAACUGUAUUCACUCAAACAAGAUCU
|.|.||||||||..| |||.|..|||||||
GAGAAAACUGUAAGC-CUCCAGAAAGAUCU
480
481
16
27
UUAAAAGCGGAUCUAGAAA
||||||..|||.||.||||
UUAAAAAAGGAACUUGAAA
482
483
16
28
GAAAAAGCAAUCCAUGGGCAAACUGUAUU
||.|||||||.|.|..|||.||.||.|.|
GAGAAAGCAAACAAGUGGCUAAAUGAAGU
484
485
16
29
CAGAAGACGGAAGCAUGGCUG
||||.|.||||..|||||.||
CAGAUGGCGGAGUCAUGGAUG
486
487
16
30
CCCAGAAGACGGAAGCAU
|||||.||||.|||..||
CCCAGGAGACUGAAAAAU
488
489
16
31
AGAAAAGAAAAAGCA-AUCCAUGGGCA
|||||.|||.||.|| |..||.|||.|
AGAAAUGAAGAAACAUAAUCAGGGGAA
490
491
16
32
UUAGUCCAAAAAC
|||.||||.||||
UUAUUCCAGAAAC
492
493

16
33
CCAAA-AACUUGA--AAAGAGUA-CAGC
||||| ||||||| |||||||| ||||
CCAAAGAACUUGAUGAAAGAGUAACAGC
494
495
16
34
CGGAUCUAGAAAAGAAAAAGCAAUC
|.|||.|.|||..||.||||..|||
CAGAUAUGGAAUUGACAAAGAGAUC
496
497
16
36
GGAUCUAGAAAAGAAAAAGCAAUCC
||||..|..|.||||||||.||.||
GGAUGAAUCAGAGAAAAAGAAACCC
498
499
16
37
AAAAGCGGA-UCUAGAAAAGAAAAAGCA--AUCCAUG--GGCAAACUG
|||.|.||| ||||.|...||..||||| |..|.|| |||||||.|
AAAGGUGGACUCUACACGUGACCAAGCAGCAAACUUGAUGGCAAACCG
500
501
16
38
AUUCACUCAAACAAGAUCUUCUUUCAACACUGAAGAAU--AAGUCAG
|.|||...|.||||.|..|.|||..|.|||||.||..| ||.||||
ACUCAGAUAUACAAAAAUUGCUUGAACCACUGGAGGCUGAAAUUCAG
502
503
16
39
AACUGUAUUCACUCAAACAAGAU-CUUCUUUCAACACUGAAGAAUAAGUCAGUGA
||..|.|||....||||.|.||. |..|||.|||||..|||..|.|..|.||.||
AAAAGAAUUGUUGCAAAGAGGAGACAACUUACAACAAAGAAUCACAGAUGAGAGA
504
505
16
40
AAAAGCGGAUCUAGAAA
||||..||.||||||||
AAAAAAGGCUCUAGAAA
506
507

16
41
CAGAAGACGGAAGCAUGGCUGGAU
|||||||.|.|||....||||.||
CAGAAGAAGAAAGAGGAGCUGAAU
508
509
16
42
ACUGUAUUCACUCA
||||.|.|||||||
ACUGAAAUCACUCA
510
511
16
44
ACUGAAGAAUAAGUCAGUGACCCAGAA-GACGGAA
||.||||...|| ||||..|.||||| |||..||
ACAGAAGCUGAA--CAGUUUCUCAGAAAGACACAA
512
513
16
46
AAAAGCGGAUCUAGAAAAGAAAAAGC
|||||.|.|.|.|..|||..||||||
AAAAGAGCAGCAACUAAAAGAAAAGC
514
515
16
47
AAAAACUUGAAAAGA
|.|||||||||||.|
AUAAACUUGAAAAUA
516
517
16
48
AGCAAUCCAUGGGCAAACUGUAUUCACUCAAAC-AAGA
||.||||..|.||.||..|.||..||..||||| ||||
AGGAAUCAGUUGGAAAUUUAUAACCAACCAAACCAAGA
518
519
16
49
UUUCAACACUGAAGAAUAAGUCAGUGACCCAG
|||..|||..|||.||..||.||.|.|.||||
UUUGUACAAGGAAAAACCAGCCACUCAGCCAG
520
521

16
51
GCAAACUGUAUUCACUCAAACAAGAUCUUCUUUCAACACUGAAG
|.||||||...||.| |||||.|||..|.|..||..|..|||.|
GGAAACUGCCAUCUC-CAAACUAGAAAUGCCAUCUUCCUUGAUG
522
523
16
53
AAAGAAAAAGCAAUCCAUGGGCAAA
|.||.|.|.||||||||...|.|||
ACAGUAGAUGCAAUCCAAAAGAAAA
524
525
16
55
GAAGAAU--AAGUCAGUGACCCAGAAGACGGAAGCAUGGC
|||||.| |||..|||.|...||..||.|.||..|||||
GAAGACUCCAAGGGAGUAAAAGAGCUGAUGAAACAAUGGC
526
527
16
57
UUCACUCAAACAAGAUCUUCUUU--CAACA-CUGAAGAAUAAGUCAGUGACCCAGAAGAC
|||.||..|..||..|||..|.| |.||| |||||..||.|...|.|.|.||.|.||.|
UUCUCUGCAGGAACUUCUGGUGUGGCUACAGCUGAAAGAUGAUGAAUUAAGCCGGCAGGC
528
529
16
59
GCAAUCCAUGGGCAAACUGU--AUUCACUCAAAC-AAGAUCUUCUUUCAACACUGAAG
|||..||.|||||.|.||.. |||.||||...| ||||||..||....|.|.|.|||
GCAGCCCGUGGGCGAUCUCCUCAUUGACUCUCUCCAAGAUCACCUCGAGAAAGUCAAG
530
531
16
60
CAGAAGACGGAAGCAU
||..|||.||||||.|
CACCAGAUGGAAGCUU
532
533
17
18
AUCACUAACACAGACAACUGUAAUGGAAA
||.|||..|.|||| |.||||..||.|.|
AUUACUCGCUCAGA-AGCUGUGUUGCAGA
534
535

17
20
GAACUUCCACCACCACCUCCCCAAAAGA
|||..||||.| |||||.|||||..|||
GAAAAUCCAAC-CCACCACCCCAUCAGA
536
537
17
22
CCACCACUCAGCCAUCA
||||||.|..||.||||
CCACCAAUGCGCUAUCA
538
539
17
23
CACCACCUCCCCAAAAGAAGAGGCAGAUUACUGUGGAUUCUGAAAUUAG
||.||||.|....||||| ||.|..||..|..|.|...|||||||||||
CAGCACCACUGUGAAAGA-GAUGUCGAAGAAAGCGCCCUCUGAAAUUAG
540
541
17
24
UGUGGAUUCUGAAAUUAGGAAAA
||.||||||.||||||...||||
UGGGGAUUCAGAAAUUCUAAAAA
542
543
17
25
AAACAGU---AACUACGGUGACCACAAGGGAA
||||||| ||..|.||||..||.|||..||
AAACAGUGUCAAUGAAGGUGGGCAGAAGAUAA
544
545
17
27
AAGAGGAACUUCCACCACCACCUCCCCAAAAGAAGAGGC
||.||||||||..|.|.|.|.|..||.|..|..||.|||
AAAAGGAACUUGAAACUCUAACCACCAACUACCAGUGGC
546
547
17
28
AACACAGACAACUG--UAAUGGAAACAGUAACUACGGUGACCACAAGGGAACAGAU-CCUGGUAAAGC
||..||.||||.|| |||..|||..||.|..||...|.|..||.|..|||.|.|| |||||...|||
AAAGCAAACAAGUGGCUAAAUGAAGUAGAAUUUAAACUUAAAACCACUGAAAACAUUCCUGGCGGAGC
548
549

17
29
UCCUGGUAAAGCAUGCUCAA-GAGGAACUU
||.|||...||| |..|||| |||||||||
UCAUGGAUGAGC-UAAUCAAUGAGGAACUU
550
551
17
30
AAAAGAAGAGGCAGAUUACUGUGGAUUCUGAAA
||.|||..|..|||..|.|...|||..||||||
AACAGAGCAUCCAGUCUGCCCAGGAGACUGAAA
552
553
17
31
AGGGAACAGAUCCUGGUAAAGCAUGCU
|.|.||||.|..|.||..|||.|.|||
AAGAAACAUAAUCAGGGGAAGGAGGCU
554
555
17
32
CUGUAAUGGAAACAGUAACUACGGUGACCACAAGG-GAACAGAUCCUGGUAAAGCAU
|||.|.||||||||...|.|..||. ||...|||. |.||||...|.|.||||.|||
CUGCAUUGGAAACAAAGAGUGUGGA-ACAGGAAGUAGUACAGUCACAGCUAAAUCAU
556
557
17
33
AGAAGAGGCAGAUUACUGUGGAUUCUGAAAUUAGGAAAAG
|.||.||.|.||.|...|||.|.||||||.| |||||.|
AUAAAAGUCUGAGUGAAGUGAAGUCUGAAGU--GGAAAUG
558
559
17
34
AGGCAGAUUACUGUGGAUUCUGAAAUU
|.||..|.||.|.|||||||||||.||
AUGCCUAGUAAUUUGGAUUCUGAAGUU
560
561
17
35
CACCUCCCCAAAAGAAGAG
||||||||.|..|||||||
CACCUCCCGAGCAGAAGAG
562
563

17
36
CCAAAAGAAGAGG
|.|||||||||.|
CAAAAAGAAGACG
564
565
17
37
CAGACAACUGUAAUGGAAACAGUAACUACGGUGACCAC
|||..|||| |.||||.|| ||..||||||||||
CAGCAAACU-UGAUGGCAA-----ACCGCGGUGACCAC
566
567
17
38
UGGAUUCUGAAAUU
||||..||||||||
UGGAGGCUGAAAUU
568
569
17
39
AAAGAAGAGGCAGAUUACUGUG--GAUUCUGAAAUUAGGAAAAG
|||||.|||.||..||||.... ||.||..|.||.||..||||
AAAGAGGAGACAACUUACAACAAAGAAUCACAGAUGAGAGAAAG
570
571
17
40
CAAAAGAAGAGGCAGAUUACUGUGGAUUCUGAAAU
||..|.|||||||||..|..||... |.|||||||
CAGUACAAGAGGCAGGCUGAUGAUC-UCCUGAAAU
572
573
17
41
CAGAUCCUGGUAAAGCAUGCUCAAGAGGAA
|||||||.|.|.| |||.||.|..|.||.|
CAGAUCCAGCUCA-GCAAGCGCUGGCGGGA
574
575
17
42
AAAAGAAGAGGCAGAUUACUGUGGA
|||.||.||.|..|||.||||..||
AAACGAUGAUGGUGAUGACUGAAGA
576
577

17
44
AAGAGGCAGAUUACUGUGGAUUCUGAA
||||..||.|||.|||.|.|||..|||
AAGACACAAAUUCCUGAGAAUUGGGAA
578
579
17
46
GAAGAGGCAGAUUACUGUG
||.||.||||||.||..||
GAGGAAGCAGAUAACAUUG
580
581
17
47
GACCACAAGGG-AACAGAUCCUGGUAAAGCAUGCUCAAGAGGA
|.|||.|||.| ||.|.|..||.| |||..|.|||||||..||
GCCCAGAAGAGCAAGAUAAACUUG-AAAAUAAGCUCAAGCAGA
582
583
17
48
UACUGUGGAU-UCUGAAAUUAGGAA
|.||||||.| |||...||||||||
UGCUGUGGUUAUCUCCUAUUAGGAA
584
585
17
49
ACCA-CCACUCAGCCA
|||| |||||||||||
ACCAGCCACUCAGCCA
586
587
17
51
AAACAGUAACUACGGUGACCACAA
|.||.||.|||..|||||| ||||
AGACUGUUACUCUGGUGAC-ACAA
588
589
17
53
CCAUCACUAACACAGACAACUGU--AAUGGAA
||.|||..|.|..||.||||.|| ||||.||
CCUUCAGAACCGGAGGCAACAGUUGAAUGAAA
590
591

17
55
CUCCCCAAAAGAAGAGGC
||.|||..|||.|.||||
CUACCCGUAAGGAAAGGC
592
593
17
57
AGCAUGCUCAAGAGGAACUUC
|.|.|.|||...|||||||||
ACCUUUCUCUGCAGGAACUUC
594
595
17
59
GUGACCACAAGGGAACA--GAUCCUGGUAAAGCAUGCUCAAGAGG
|.|.|||.||.|..||. |.|.||...||||||.|||.|.||||
GAGCCCAGAAUGUCACUCGGCUUCUACGAAAGCAGGCUGAGGAGG
596
597
17
60
UUUCACAGGCUGUCACCACCACUCAGCCAUCACU-AACAC
|.||||.|..|..|..||.|||||.|..|...|| |||||
UCUCACCGUAUAACCUCAGCACUCUGGAAGACCUGAACAC
598
599
18
43
GAAGCUGUGUUGCAGAGUCCUGAAUUUGCAAU
||||||.|.|..||| ||..||||.||||
GAAGCUCUCUCCCAG----CUUGAUUUCCAAU
600
601
18
45
GAGUCCUGAAUUUGCAAUCUUUCGGAAGGAAGGCAACU---UCUCAGACUUAAAAGAAA
||..|||||||.|||..|. .|.|.|||...||||.. |.||||||..||||.|.|
GAAGCCUGAAUCUGCGGUG--GCAGGAGGUCUGCAAACAGCUGUCAGACAGAAAAAAGA
602
603
18
54
UAAAAGAAAAAGUCAAU
|||.|||.||..|||||
UAACAGAGAAUAUCAAU
604
605

18
56
GAUGUUGAUAUAAC-UGAACUUCA
||.|||...||||| |||||||||
GACGUUUGGAUAACAUGAACUUCA
606
607
19
20
AGUUCAGAAAACUGCAAGAUGCCAGCAGAUCAGCUCAGGCCCUGGUGGAACAGAUGGUG
|.|.||||.|.|..|||.....|..||||.||.||.|....|.||||||.|..||..||
AAUGCAGAUAGCAUCAAACAAGCCUCAGAACAACUGAACAGCCGGUGGAUCGAAUUCUG
608
609
19
22
UCAGAAAACUGCAAGA-UGCCAGCAGAUCA
||||.|.|| ||.|| |||||.|||..||
UCAGGAGAC--CAUGAGUGCCAUCAGGACA
610
611
19
23
AGCGAGAAAAAGC--UGAGAAGUUCAGAAAACUGCAAGAUGCCAGCAGAUCAGCUCAGGCC--CUGGUGGAACA
|||..||||.|.| |.||||.||.|..|||.||...||.||..|.|||....|||...|| |||||.||.||
AGCCGGAAAUAUCAAUCAGAAUUUGAAGAAAUUGAGGGACGCUGGAAGAAGCUCUCCUCCCAGCUGGUUGAGCA
612
613
19
24
AUCAGCU-CAGGCCCUGGUGGAACAGAUGG-UGAA
||||..| ||..|||||..|.||..||||| ||||
AUCACAUACAAACCCUGAAGAAAUGGAUGGCUGAA
614
615
19
25
AGAGCGAGAAAAAGCUGAGA-AGUUCAGAAA--ACUGCAAGA
|||||.|||....|||..|| |.||.|||.| |||..||||
AGAGCCAGAGUUUGCUUCGAGACUUGAGACAGAACUCAAAGA
616
617

19
26
GCCAUAGAGCGAGAAAAAGCUGAGAAGUUC--AGAAAACUGCAAGAUGCCAGCA-GAUC-AGCUCAG-- GCCCUGGUGGA--ACAGAUGGUGAA
||||.|.|| |||.....|..|.||.|||. |||||||||.|||...||||.| |||| |.|..|| ||.|...|||| |||.|.|.||||
GCCAGAAAG- GAGGCCUUGAAGGGAGGUUUGGAGAAAACUGUAAGCCUCCAGAAAGAUCUAUCAGAGAUGCACGAAUGGAUGACACAAGCUGAA
618
619
19
28
AGCUGAGAAGUUCAGAAAACUGCAAGAU
|||||||.|..||....|..|||.||||
AGCUGAGGAAAUCUCUGAGGUGCUAGAU
620
621
19
29
AGAUGCCAGCAGAUCAGCUCAGGCCCUGGUGGAACAGAUGGUGAA
||||.| |||.||..||.|||.|||| |||||||||.|.|
AGAUUC--GCAUAUUGGCACAGACCCU-----AACAGAUGGCGGA
622
623
19
30
CAUAGAGCGAGAAAAAGCUGAGAAGUUCAGAAAACUG-CAAGAUGCCAGCAGAUCA
|||..|..||.||..||.|| |.||.|.|.|...|.| ||||.||...||||.|||
CAUUCAUUGACAAGCAGUUG-GCAGCUUAUAUUGCAGACAAGGUGGACGCAGCUCA
624
625
19
31
AGAUGCCAGCAGAUCAGCUCAG
|.|.|.||..|||||||.|.||
ACAAGUCAUGAGAUCAGUUUAG
626
627
19
32
AGAAAACUGCAAGAUGCCAGCA
|.||||.|.|||||||.|..||
AAAAAAUUACAAGAUGUCUCCA
628
629

19
33
AGAAAAAGCUGA-GAAGUUCAGAAAACUGCAAGAUGCCAGCAGAUCAGCU
|||||||||.|| |||..||..|||... |..||||..||...|.|||||
AGAAAAAGCAGACGGAAAAUCCCAAAGAA-CUUGAUGAAAGAGUAACAGCU
630
631
19
34
CAUAGAGCGAGAAAAAGCUG-AGAAGUUCAGAAAACUG
||.|.||..||.||.||.|| ||||.|.|...|||.||
CAGAAAGAAAGCAACAGUUGGAGAAAUGCUUGAAAUUG
632
633
19
35
AGCUGAGAAGU-UCAGAAAACUGCAAGAUGCCAGCAGAUCAGCUCAGGCCCUGGUGGAACAGAUGGUGAAUG
|.||||..||| |||.|.|..|...|||.|||...|.|.|||.|..||.|..|..|||...|.|||||.|.|
ACCUGAAGAGUAUCACAGAGGUAGGAGAGGCCUUGAAAACAGUUUUGGGCAAGAAGGAGACGUUGGUGGAAG
634
635
19
37
GCUGAGAAGUUCAGAAAACUGCAAGAUGCCAGCAGAUCAG
|.|||..|.|.|||.|||.|...|||..||...|..||||
GGUGACCACUGCAGGAAAUUAGUAGAGCCCCAAAUCUCAG
636
637
19
38
AGCAGAUCAGCUCAG
|||||.|.|.|||||
AGCAGUUUAACUCAG
638
639
19
39
CAUAGA-GCGAGAAAAAGCUGAGAAGUUCAGA--AAACUGCA
||.||| |.||||||..|....|||.|..||| ||||.|||
CACAGAUGAGAGAAAGCGAGAGGAAAUAAAGAUAAAACAGCA
640
641
19
40
CGAGAAAAAGCUGAGAAGUUCAGAAAACUGCAAGAUGCCAGCAGAUCAGCUCAGGCCCUGGU-GGAACAGAUGGUGAA
|.|||||...||.|..|||... |..|.|.|||||.||..||.|||.|.|||..|...||.| |||..|.||.|..||
CUAGAAAUUUCUCAUCAGUGGU-AUCAGUACAAGAGGCAGGCUGAUGAUCUCCUGAAAUGCUUGGAUGACAUUGAAAA
642
643

19
41
CAGAUC-AGCUCAG---GCCCUGGUGGAACA
|||||| ||||||| ||.||||.||.|.|
CAGAUCCAGCUCAGCAAGCGCUGGCGGGAAA
644
645
19
42
GUGGAACAGAUGGUGAAUG
||||||||..|..|.||||
GUGGAACAACUUCUCAAUG
646
647
19
44
CAUAGAGCGAGAAAAAGCUGAGAAGUUCAGAAAACUGCAAGAUGCCA
||.|.||..|.|||...||||||| ||..|||.| |||.|.||.|.|
CAGAAAGACACAAAUUCCUGAGAA-UUGGGAACA-UGCUAAAUACAA
648
649
19
46
AGAAAAAGCUGAGAAGUUCA
||||||...||||.|..|||
AGAAAAGCUUGAGCAAGUCA
650
651
19
47
AGAAGUUCAGAAAACUGCAAGAUG--CCAGCAGAUCAGCUCAGGC
|.|||..|||||.| |||||||. |..|.|.||.||||||.||
AUAAGCCCAGAAGA--GCAAGAUAAACUUGAAAAUAAGCUCAAGC
652
653
19
49
AGCAGAUCA-GCUCAGGCCCUGG---UGGAACAGAUGGUG
|||||.||| |||.|....|.|| |||||.||||..||
AGCAGUUCAAGCUAAACAACCGGAUGUGGAAGAGAUUUUG
654
655
19
53
GAAAAAGCUGAGAAGUUCAGAAAACUG-CAAGAUGCCAGC
|||.||||||||.||.||..|..||.| |.|||..|.|||
GAAGAAGCUGAGCAGGUCUUAGGACAGGCCAGAGCCAAGC
656
657

19
55
AGAAGUUCAGAAAACUGCAAGAUGCCAGCAG
|||||.|.|.|.||||||.|....||..|||
AGAAGCUGAAACAACUGCCAAUGUCCUACAG
658
659
19
57
GCAAGAUGCCAGCAGAUCAG
||.|..|.|||||||.||||
GCGACUUUCCAGCAGUUCAG
660
661
19
59
AACUGCAAGAUGCCAGCAGAUCAGCUCAGGCCCU
||||.|||||.|||| |.|||.|||| ||.|||
AACUUCAAGAGGCCA-CGGAUGAGCU--GGACCU
662
663
19
60
AGAAGUUCAGAAAACUGCAAGAUGCCAGCAGAUCAGCU
|.||..||||.|..|||.|||| ||.|.|.|.|||.|
AUAACCUCAGCACUCUGGAAGA--CCUGAACACCAGAU
664
665
20
21
AACCCACCACCCCAUCAGAGC-CAACAGCAAUUAAAAGUCAGUUAAAAAUU
||..||.|...|.|||||..| ||||..|||.|..|| |..|||||||||
AAGUCAACCGGCUAUCAGGUCUUCAACCUCAAAUUGAA-CGAUUAAAAAUU
666
667
20
50
ACAACAAUUGGAGC
||.||.||||||||
ACCACUAUUGGAGC
668
669
20
52
CAAUUGGAGCAGAUGACAACUACUGCUGAAAACUGGUUGAAAAUCCAACCCACCACCCCAUCA-GAGCCAACAGCAAUUA
||.|||||..|..|.|..||..||||..||||.| ||||||.|.|..|||.|| |||| |||.|.|.|.||||.|
CAGUUGGAAGAACUCAUUACCGCUGCCCAAAAUU---UGAAAAACAAGACCAGCA----AUCAAGAGGCUAGAACAAUCA
670
671

20
58
ACUGAACAGCCGGUGGAUCGAAU
||.||.|||||..||||..||.|
ACAGAGCAGCCUUUGGAAGGACU
672
673
21
22
CAACCGGCUAUCAGG
|||...|||||||||
CAAUGCGCUAUCAGG
674
675
21
23
UCAAAGCAUAGCCCUGAAAGAGA
||..||||...|..|||||||||
UCUCAGCACCACUGUGAAAGAGA
676
677
21
24
GAUUAA-AAAUUCAAAGCAUAGCCCUGAAAGAG
||||.| ||||||.||..|.....||||||.||
GAUUCAGAAAUUCUAAAAAAGCAGCUGAAACAG
678
679
21
25
CAUUUUAAGCAA-GUCUUUUCUGAUGUGCAGGCCAGAGAGAAAGAGCUACAGACA
||.|.|||.||. |||..|...|.||.||||...|.|.||||.||...|.||.||
CAGUCUAAACAGUGUCAAUGAAGGUGGGCAGAAGAUAAAGAAUGAAGCAGAGCCA
680
681
21
26
AGAAAGAGCUA-CAGACA
|||||||.||| ||||.|
AGAAAGAUCUAUCAGAGA
682
683
21
27
CUGAAAGAGAAAGGACAAG
|||||.|.||||.| ||||
CUGAAUGGGAAAUG-CAAG
684
685

21
28
AUUAAAAAUUCAAAGCA
|||.|||.||.|||.||
AUUUAAACUUAAAACCA
686
687
21
29
GAUUAAAAAUUCAAAGCAUAGCCC
|||...|.|||||.||.|||.|||
GAUGCGACAUUCAGAGGAUAACCC
688
689
21
30
CCUCAAAUUGAACGAUUAAAAAUUCAAAGCAUA
|||||.|||.|..||..|..|.||...|||.||
CCUCACAUUCAUUGACAAGCAGUUGGCAGCUUA
690
691
21
31
AAGUCUUUUCUGAUGUG-CAGGCCA-GAGA
||.||...||||||.|| ||.|.|| ||||
AAAUCCAAUCUGAUUUGACAAGUCAUGAGA
692
693
21
32
UGAAGUC-AACCGGCUAUCAGGUCUUCAACCUCAAAUUGAACGAUUAAAAAUUCAAAGCAUAGCCCUGAAAGA
||||||. ||..||..||.|.|.||..| |.|||.||||.|| |..||||....|..|.|.|.||| |||||
UGAAGUGGAAAUGGUGAUAAAGACUGGA-CGUCAGAUUGUAC-AGAAAAAGCAGACGGAAAAUCCC--AAAGA
694
695
21
33
AAAAAUUCAAAGCAUAGCCCUGAAAGA---
GAAAGGACAAGGACCCAUGUUCCUGGAUGCAGACUUUGUGGCCUUUACAAAU
|.||||.|...|.||.|.||.|.|||| ||||||| ||.|| |||| ||.|| ||||.|...||||...||||.||
AGAAAUGCUUGAAAUUGUCCCGUAAGAUGCGAAAGGA-AAUGA---AUGU--CUUGA--CAGAAUGGCUGGCAGCUACAGAU
696
697

21
34
GUGGCCUUUACAAAUCAUUUUAAGCAAG
|.||||||.| |||...||||..|||||
GAGGCCUUGA-AAACAGUUUUGGGCAAG
698
699
21
35
UUUGUGGCCUUUACAAAUCAUUUUAAG
||||..|||.||.||.|.....|||||
UUUGCAGCCAUUUCACACAGAAUUAAG
700
701
21
36
CUGAAAGAGAAAG
|||||||||.|||
CUGAAAGAGGAAG
702
703
21
39
AAAAAUUCAAAGCAUAGCCCUGAAAGAGAAAGGACA
|||.|.|||.||...||. |||||.||.||||.|
AAAGAAUCACAGAUGAGA---GAAAGCGAGAGGAAA
704
705
21
40
AGCCCUGAAAGAGAAAGGACAA
|||||.||.|. |||||||.||
AGCCCAGAGAU-GAAAGGAAAA
706
707
21
41
AAGCAUAGCCCUGAAAGAGAAAGGACAAGGACCCAUGUUCCUGGAUGCAGACUUUG
||||...|.|..||||..||.||.|.|....|.||..|||...||..|| ||||||
AAGCGCUGGCGGGAAAUUGAGAGCAAAUUUGCUCAGUUUCGAAGACUCA-ACUUUG
708
709
21
42
AGCCCUGAAAGAGAAAGGACAAGGACCCA-UGUUCCUGGAUGCAGACUUUGUGGCCUUUACAAAUCAUUUUAAGCAAG
||||||...|||....|.||||...|.|| ||.|||||....|.|...|.. ||.||||..|.|||..||||||||||
AGCCCUAUUAGAAGUGGAACAACUUCUCAAUGCUCCUGACCUCUGUGCUAA-GGACUUUGAAGAUCUCUUUAAGCAAG
710
711

21
44
ACAAGGACCCAUGUUCCUG
|.||.|||.||..||||||
AGAAAGACACAAAUUCCUG
712
713
21
46
UUACAAAUCAUUUUAA--GCAAGUCUUUUCUGAUGUGCAGGCCAGAGAGAA-AGAGCUA
||.||||....||||| |.|..|.||||.||.| ||.|||....|||.|| |..||||
UUUCAAAGAGAUUUAAAUGAAUUUGUUUUAUGGU-UGGAGGAAGCAGAUAACAUUGCUA
714
715
21
47
AGCCCUGAAAGAGAAAG
|||||.||| |||.|||
AGCCCAGAA-GAGCAAG
716
717
21
48
UUCAACCUCAAAUUGAA
||.||.|||||||..||
UUGAAGCUCAAAUAAAA
718
719
21
49
UGGAUGCAGACUUUGU
||||.| |||.|||||
UGGAAG-AGAUUUUGU
720
721
21
51
CCAUGUUCCUGGAUG
||||.|||||.||||
CCAUCUUCCUUGAUG
722
723
21
53
AAUUGAACGAUUAAAAAUUCAAAGCAUAGCCCUGAAAGAGAAAGGACAAG
|||..||.|.|.||..||||||..||..|.| ||.|||..||.|.|.|||
AAUGAAAUGUUAAAGGAUUCAACACAAUGGC-UGGAAGCUAAGGAAGAAG
724
725

21
55
CCCAUGUUCCUGGAUGCAGACUUUGUGGCCU---UUACAAA
|||.||..|||||| |.|.|||.|.|||| |||||.|
CCCCUGGACCUGGA---AAAGUUUCUUGCCUGGCUUACAGA
726
727
21
57
GAUGAAGUCAACCGGCUAUCAGGUCUU
||||||.|.|.|||||...||..|.||
GAUGAAUUAAGCCGGCAGGCACCUAUU
728
729
21
59
GGCCUUUAC-AAAUCAUUUUAAGCAAGUCUUUUCUGA
|||.|.||| |||.||...|.||.|.|||..|.||||
GGCUUCUACGAAAGCAGGCUGAGGAGGUCAAUACUGA
730
731
21
60
CCCUGAAAGAGAAAG
|.|||||||||||.|
CUCUGAAAGAGAACG
732
733
22
50
GGGUCCAGCAGUCAGAAACCAAACUC
|||...|||||.|.|| ||.|.|||
GGGCAAAGCAGCCUGA--CCUAGCUC
734
735
22
52
CACCAAUGCGCUAUCAGGAGACCAUGAGUGCC
||.||||||...||..|||....|.|.||.||
CAACAAUGCAGGAUUUGGAACAGAGGCGUCCC
736
737
22
58
CGCUAUCAGGAGACCA
|.|||.||||||.|||
CUCUACCAGGAGCCCA
738
739

23
24
AAUAUCAAUCAGAAUUUGAAGAAAUUGAGGG
|||..||..||.|...|||||||||.||.||
AAUCACAUACAAACCCUGAAGAAAUGGAUGG
740
741
23
25
GAAAUAUCAAUCAGAAUUUGAAGAAAUUGA
||.|..|.|..|||||.|..|||||.||.|
GAGACUUGAGACAGAACUCAAAGAACUUAA
742
743
23
26
CUGAAAUUAGCCGGAAAUAUCAAUCAGAAUUUGAAGAAAU--UGAGGGACGCUGGAAGAAG
|||.||....||.||||.|||.||||||..|..|.|||.. |||...|.|||| ||||||
CUGUAAGCCUCCAGAAAGAUCUAUCAGAGAUGCACGAAUGGAUGACACAAGCUG-AAGAAG
744
745
23
27
CUCAGCACCACUGUGAAAGAGAUGUCGAAGA
|||.||||.|...||||.|.||..|..||||
CUCUGCACUAGGCUGAAUGGGAAAUGCAAGA
746
747
23
28
AGAGCAACAAAGUGGC
|.|||||..|||||||
AAAGCAAACAAGUGGC
748
749
23
29
AUCAAUCAG-AAUUUGAAGAAAUUGAGGGACGCUGGAAGAAGCU
||||||.|| ||.||||...|.||.|....||.||||.|.|.||
AUCAAUGAGGAACUUGAGACAUUUAAUUCUCGUUGGAGGGAACU
750
751
23
30
AAAUUG-AGGGACGCUGGAAGAAGCUC
|.|||| ||..|.|.||||.|.|||||
AUAUUGCAGACAAGGUGGACGCAGCUC
752
753

23
31
AUCAGAAUUUGAAGAAAUUGAGGGAC
|||||. ||.||||||||..||..||
AUCAGU-UUAGAAGAAAUGAAGAAAC
754
755
23
32
AGUUCUCUGCAAGAGCAACAAAGUG
|.||..|||||...|.|||||||.|
ACUUGCCUGCAUUGGAAACAAAGAG
756
757
23
33
AAAUUAGCCGGAAAUAUCAAUCAGAAUUUGAAGAAA
|||..||.|||||| |||....||||.||||.||||
AAAGCAGACGGAAA-AUCCCAAAGAACUUGAUGAAA
758
759
23
34
AAGAAAGCGCCCUCUGAAAUUA-GCCGGAAAUAU--CAAUCAGAAUUUGAAGAAAUUGAGGGACGCUGGAAGAAGCUCUCCUCCCAGCUGGUUGAGCAUUGUCAAAAGCU//
||||||||..|...||.|...| ||..|||||.. |..|.|||.....|||.||.|||..|.|. ||..||||...||.....|..|.|.|...|.||||.||||.
AAGAAAGCAACAGUUGGAGAAAUGCUUGAAAUUGUCCCGUAAGAUGCGAAAGGAAAUGAAUGUCU-UGACAGAAUGGCUGGCAGCUACAGAUAUGGAAUUGACAAAG---//
//AGAGGAGCAAAUGAAUAAACUCCGAAAAAUU
|||..||||..||||..||..||.|..||||
//AGAUCAGCAGUUGAAGGAAUGCCUAGUAAUU
760
761
23
35
CCACUGUGAAAGAGAUGUCGAA---GAAAGCGCCCUCUGAA
|.|||...||||||||...||| |||.|.||.| |||||
CUACUCAAAAAGAGAUUGAGAAACAGAAGGUGCAC-CUGAA
762
763

23
36
ACAAAGUGGCCUAUACUAUCUCAG-CACCACUG--UGAAAGAGAUGUCGAAGAAAGCGCCCUCUGAAAUUAGCCG
|||||||||...||.|...||.|. |||...|| ||||..||| |...||||||.| ||..|..|||..||.||
ACAAAGUGGAUCAUUCAGGCUGACACACUUUUGGAUGAAUCAGA-GAAAAAGAAACC-CCAGCAAAAAGAAGACG
764
765
23
37
AUAUCAAUCAGAAUU
||.|||..|||||||
AUUUCACACAGAAUU
766
767
23
38
UUUGAAGAAAUUG
|||||||.|||||
UUUGAAGGAAUUG
768
769
23
39
AAAGCUAGAGGAGCAAAUGAAUAAAC
|||||.||||||...||.||..||||
AAAGCGAGAGGAAAUAAAGAUAAAAC
770
771
23
40
GAAAUAUCA-AUCAGAAUUUGAAGAAAUUGAGGGACGCUGGAAGAAGCUCUCCUCCCA-GCU-GGUUGAGCAUUGUCAAAA
|||||.||. |||||...|...||.|...||||.|.|||| |.|.||||||...| ||| ||.||| |||||..||||
GAAAUUUCUCAUCAGUGGUAUCAGUACAAGAGGCAGGCUG----AUGAUCUCCUGAAAUGCUUGGAUGA-CAUUGAAAAAA
772
773

23
41
AUAUCAAUCAGAAUUUGAAGAAAUUGAGGGACG--CUGGAAGAAGCUCUCCUCCCAGCUGGUUGAGCAUUGUCAAAAGCUAGAGGAGCAA
|.||..|||.|.|.|||.||||...||..||.| |||.|.|.||..|.....|.||||| .|.|| |||||..|.|.|.|.|..||||
AAAUUGAUCGGGAAUUGCAGAAGAAGAAAGAGGAGCUGAAUGCAGUGCGUAGGCAAGCUG--AGGGC-UUGUCUGAGGAUGGGGCCGCAA
774
775
23
42
ACUGUGAAAGAGAUGUC-GAAGAAAGCGCCCUCUGAAAUU
||..|||..|.||||.| |||||.|. |||.|..||||||
ACGAUGAUGGUGAUGACUGAAGACAU-GCCUUUGGAAAUU
776
777
23
44
GAAAUUAGCCGGAAAUAUCAAUCAGAAUUUGAAGAAAUUGAGGGAC--GCUGGAAGAAGCU
||||| |.|||...|.||| |.|..||.|.||||.|||.|...|. |||...|||||||
GAAAU--GGCGGCGUUUUCA-UUAUGAUAUAAAGAUAUUUAAUCAGUGGCUAACAGAAGCU
778
779
23
46
GCUAGAGGAGCAAAUGAAUAAACUCCGAAAAAUUCA
||||||.||.||||.|||||...|...|.||.||||
GCUAGAAGAACAAAAGAAUAUCUUGUCAGAAUUUCA
780
781
23
47
GGAAAUAUCAAUCAGAAUUUGAAGAAAUUGAGGGACGC
||||.|.||||.|| |||..|.||||.||..||||.|
GGAAUUCUCAAACA--AUUAAAUGAAACUGGAGGACCC
782
783

23
48
GAAGAAAUUGAGGGACGCUGGAAGAAGCUCUCCUCCCAGCUGGUUGAGCAUUGUCAAAAGCUAGAGGAGCAAAUGAAUAAACUCC
|.|||||||||.| |.|....|.|||..||....| ||||.|...|..|...|.||.|.||.||.|||||..|.|||.|.||.|
GGAGAAAUUGAAG--CUCAAAUAAAAGACCUUGGGC-AGCUUGAAAAAAAGCUUGAAGACCUUGAAGAGCAGUUAAAUCAUCUGC
784
785
23
49
UGUGAAAGAGAUGUCGAAGAAAGCGC
||||.|||||||.|.|...||||.||
UGUGGAAGAGAUUUUGUCUAAAGGGC
786
787
23
51
UUCUCUGCAAGAGCAA
||||||||..||.|||
UUCUCUGCUUGAUCAA
788
789
23
53
GAAAUAUCAAUCAGAAUUUGAAGAAAUUGAGGGACGCU--GGAAGAAGCU
|||||.|.|| ||.|||..|...|||.|..|||.||| ||||||||||
GAAAUGUUAA--AGGAUUCAACACAAUGGCUGGAAGCUAAGGAAGAAGCU
790
791
23
55
UUUGAAGAAAUUGAGGGACGCUGGAAGAAGCUCUCCUCCCAGCUGGUUGAGCAUUGUCAAAAGCU-AGAGGAGCAAAUGAAUAAACUCCGAA
||.|||||||.|.|..||.....|.|..||.||.||....|.||||...||..|..|.....||| |.||.||| ||||..||||.|.||
UUGGAAGAAACUCAUAGAUUACUGCAACAGUUCCCCCUGGACCUGGAAAAGUUUCUUGCCUGGCUUACAGAAGC---UGAAACAACUGCCAA
792
793

23
57
UUCUCUGCAAGAGC
|||||||||.||.|
UUCUCUGCAGGAAC
794
795
23
59
CUCCUCCCAGCUGGUUGAGCAUUGUCAAAAGCUAGAGGAGCAAAUGAAUAAACUCCGAAAAAUUCA
||.|.|.|.||||..|| |||..| |||..||||.|||....|..|.|.|||||...||.||||
CUGCACUCCGCUGACUG-GCAGAG---AAAAAUAGAUGAGACCCUUGAAAGACUCCAGGAACUUCA
796
797
23
60
GAAGAAAGCGC-CCUCUGAAA
|.|||||..|| |||||||||
GGAGAAAUUGCGCCUCUGAAA
798
799
24
25
AUUCAGA-AAUUCUAAAAAAGCAGCUGAAACAGUG
||||||| ||||| |...|||...||||||||
AUUCAGACAAUUC----AGCCCAGUCUAAACAGUG
800
801
24
26
UGAAGAAAUGGAUGGCUGAAGUUGAUG
||.|..||||||||.|..|||.|||.|
UGCACGAAUGGAUGACACAAGCUGAAG
802
803
24
27
UAAAAAAGCAGCU-GAAAC
||||||||.|.|| |||||
UAAAAAAGGAACUUGAAAC
804
805
24
28
ACAUACAAACCCUGAAGAAAUGGAUGGCUGAAGUUGAUGUUUU-UCUGAAG
||.||.||.|.|||||.|.||...||||.|| |.|||.|...| |||||.|
ACUUAAAACCACUGAAAACAUUCCUGGCGGA-GCUGAGGAAAUCUCUGAGG
806
807

24
29
ACAAACCCUGAAGAAAUGGAUGGCUGAAGUUGAUGUUUUUCUGAAGGAGGAA
|||.||||| ||.|.||||..|..|.|.| ||||...|..|.||.||||||
ACAGACCCU-AACAGAUGGCGGAGUCAUG--GAUGAGCUAAUCAAUGAGGAA
808
809
24
30
AAAAGCAGCUGAAACAGUGCA
|||||..|||..|||||.|||
AAAAGUUGCUUGAACAGAGCA
810
811
24
31
UGGCUGAAGUUGAUGUU
||.||.|..||||||||
UGUCUCAGAUUGAUGUU
812
813
24
32
UGAAGGAGGAAUGGCCUGCCCUUGGGGAUUCAGAAAUUCUAAAAAAGCAGCUGAAACAGU
|||||..|.|.|.||||||..| |||..||.|.|.|.|..||.||.|..|...|||||
UGAAGAUGCACUUGCCUGCAUU---GGAAACAAAGAGUGUGGAACAGGAAGUAGUACAGU
814
815
24
33
ACCCUGAAGAAAUGGAUGGCUGAAGUUGAUGUUUUUCUGAAGGAGGAAUGG
|.|.||.|.|||.|..||..|||||| ||.|| ||||||..|.|||||
AACUUGUAUAAAAGUCUGAGUGAAGU-GAAGU----CUGAAGUGGAAAUGG
816
817
24
34
GAAUGGCCUGCCCUUGGGGAUUCAGAAAUUCUAAAAA----AGCAGCUGAAACAGUGC
|||||||..||...|...|||...|||.|...|||.| |||||.||||..|.|||
GAAUGGCUGGCAGCUACAGAUAUGGAAUUGACAAAGAGAUCAGCAGUUGAAGGAAUGC
818
819
24
35
AGAAAUGGAUGGCUGAAGUUGAUGUUUUUCU--GAAGGAGGAAUGGCCU
|||||..||.|| ||.|..|||.|..|.||. ||.|.||||..|||||
AGAAACAGAAGG-UGCACCUGAAGAGUAUCACAGAGGUAGGAGAGGCCU
820
821

24
36
AAUCACAUACAAAC
||.|||||..||||
AAACACAUGGAAAC
822
823
24
38
ACAUACAAACCCUGAAGAAAUGGAUGGCUGAAGUUGAU------GUUUUUCUGAAGGAGGAA
|||.|.|...|.||||..|.|||| |||||||.||.|. ||...||||||.||||||
ACAAAAAUUGCUUGAACCACUGGA-GGCUGAAAUUCAGCAGGGGGUGAAUCUGAAAGAGGAA
824
825
24
39
UAAAAAAGCAGCUGAAACAG
|||||.||||||||..||||
UAAAACAGCAGCUGUUACAG
826
827
24
40
GAAAUGGAUGGCUGAAGUUGA
||||||..|||.|||..||||
GAAAUGCUUGGAUGACAUUGA
828
829
24
41
AAAAAGCAGCUGAAA-CAGUGC
|||.||.|||||||. ||||||
AAAGAGGAGCUGAAUGCAGUGC
830
831
24
42
CAUACAAACCCUGAAGAAAUG--GAUGG
||.||...||.||||||||.| |||||
CACACUGUCCGUGAAGAAACGAUGAUGG
832
833
24
44
AUCACAUACAAACCCUGAAGAAAUGGAUGGCUGAAGUUGAU--GUUUUUCUGAAGGA
||.|.|||.|.|...|.||..|.|||.|..|.||||.|||. ||||.||.|||.||
AUGAUAUAAAGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAAGA
834
835

24
46
AUGGAUGGCUGAAGUUGAU
||||.|||..||||..|||
AUGGUUGGAGGAAGCAGAU
836
837
24
47
UUUCUGAAGGAGGAAUGGCC--UGCCCUUGGGGAUUCAGAAAUUCUAAAA--AAGCAGCUGAAACAGUGC
||.|||..|||.||.|.||| |||.|..|||.||||..|||...|.||| ||.|.|..|.|.|.||||
UUACUGGUGGAAGAGUUGCCCCUGCGCCAGGGAAUUCUCAAACAAUUAAAUGAAACUGGAGGACCCGUGC
838
839
24
48
GAAAUUCUAAAAAAGCAGCUGAAACA
|||...||..||.|||||.|.||.||
GAAGACCUUGAAGAGCAGUUAAAUCA
840
841
24
49
CUGAAGAAAUGGAUGGCUGAAGUUGAUGUUUUUCUGAAGG
||.||.||..||||| ||.|...||| |||.|||.||||
CUAAACAACCGGAUG--UGGAAGAGAU-UUUGUCUAAAGG
842
843
24
51
UGCCCUUGGGGAU-UCA--GAAAUUCUAAAAAAGCAG
||.|||||.|||| ||| ||.||..|.|..||||||
UGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAG
844
845
24
53
AAUCACAUACAAACCCUGAAGAAAUGGAUGGCUGAAGUUGA-UGUUUUUCUGAAGGA
||..||| |.||..|||..||||..||| |||...|||||| ||...|..|.|||||
AAGUACA-AGAACACCUUCAGAACCGGA-GGCAACAGUUGAAUGAAAUGUUAAAGGA
846
847
24
55
AGGAAUGGCCUGCCCUUGGGGAUUCAGAAAUUCUAAAAAAGCAGCUGAAACAGUG
|||||.|||. |||.|..||.||..|.....|||||.|||.|.|||||||.||
AGGAAAGGCU---CCUAGAAGACUCCAAGGGAGUAAAAGAGCUGAUGAAACAAUG
848
849

24
57
UUCUGAAG-GAGGAAUGGCCUGCCCUUGGGGAUUCAGAAA-UUCUAAAAAAGC---AGCUGAAACA
||||||.. |.||||..|.||||.|.|.....|.|||.|| ||||......|| ||||||||.|
UUCUGACCAGUGGAAGCGUCUGCACCUUUCUCUGCAGGAACUUCUGGUGUGGCUACAGCUGAAAGA
850
851
24
59
UUCUAAAAAAGCAG-CUGA
|||||..||||||| ||||
UUCUACGAAAGCAGGCUGA
852
853
25
26
CUUGAGACAGAACUCAAAGAACUUAACACUC-AGUGGGAUCACA
|||||||.|||..|. |||..|||.|||| ||..|.||.|||
CUUGAGAGAGAUUUU---GAAUAUAAAACUCCAGAUGAAUUACA
854
855
25
27
AAAGAACUUAACACUC
||.||||||.|.||||
AAGGAACUUGAAACUC
856
857
25
29
AGAGUUUGCUUCGAGACUUGAGAC-AGAACUCAAA
|.|.||||.|.|||.| ||.|||. |.|||.||||
AAAAUUUGAUGCGACA-UUCAGAGGAUAACCCAAA
858
859
25
30
GCUUCGAGACUUGAGACAGAACUCAAAGAACUUAACACUCAGU
||.||.||.||....|....|||.|||.|.|.|.|||||.|.|
GCAUCCAGUCUGCCCAGGAGACUGAAAAAUCCUUACACUUAAU
860
861
25
31
ACUUGAGACAGAACUCAAAGAACUUAACACUCAGUGGGA
|.||.||| ||||.|.||..|||.||| ||||.||.|
AGUUUAGA-AGAAAUGAAGAAACAUAA---UCAGGGGAA
862
863

25
32
UAUUCAGACAAUUCAGCCCAGUCUAAACAGUGUCAAUGAAGGUGGGCAGAAGAUAAAGAAUGAAG
|||||. |.||..|||||.|.|.|.|.|||.|||.|. |||...|..|||.|||.....||||||
UAUUCC-AGAAACCAGCCAAUUUUGAGCAGCGUCUAC-AAGAAAGUAAGAUGAUUUUAGAUGAAG
864
865
25
33
UGAAGGUGGGCAGAAGAUAAAGAAUGAAGCAGAGCCAGAGUUUGCUUCGAGACUUGAGACAGAA---CUCAAAGAACUUAA
|||||..|....|..||||||||.||.|. |.|||| |||....||.|....||||.||| |.||||||||||.|
UGAAGUGGAAAUGGUGAUAAAGACUGGAC----GUCAGA--UUGUACAGAAAAAGCAGACGGAAAAUCCCAAAGAACUUGA
866
867
25
34
AAGAUAAAGAAUGAAGCAG
||.|.||||||.|.|.|||
AACAGAAAGAAAGCAACAG
868
869
25
35
AGGUGGGCAGAAGAUAAA
|.||.||..|||||||||
ACGUUGGUGGAAGAUAAA
870
871
25
36
GAAUGAAGCAGAGCCAGAG
|.|||||.|||||..|.||
GGAUGAAUCAGAGAAAAAG
872
873
25
37
CAGUGAUAUUCAGACAAUUCAGCCCAGUCUAAACAGUGUCAA
||..|||.|.|||.||.|||| |.|||..|.||.|.||..||
CAUCGAUUUGCAGCCAUUUCA-CACAGAAUUAAGACUGGAAA
874
875

25
38
CAGAGUUUGCUUCGAG-ACUUGAGACAGAACU
||.|..||||||..|. |||.|||.|.|||.|
CAAAAAUUGCUUGAACCACUGGAGGCUGAAAU
876
877
25
39
AUUCAGACAAUUCAGCCCAGUCUAAACAGUGUCAAUG-AAGGUGGGCAGAAGAUA-AAGAAUGAAGCAGAG
||..|||||||. ||...|.|.|||| ||..|...|| ||.|.||..|.||..|| ||.||.|||.||.||
AUGAAGACAAUG-AGGGUACUGUAAA-AGAAUUGUUGCAAAGAGGAGACAACUUACAACAAAGAAUCACAG
878
879
25
40
AGACAGAA--CUCAAAGAACUUAACACUCAGUGGGAUCA
|||.|.|| |||.|..||.||..|| |||||||.||||
AGAAAAAAGGCUCUAGAAAUUUCUCA-UCAGUGGUAUCA
880
881
25
41
GUGAUAUUCAGA-CAAUUCAGCCCAGUCUAAACAGUGUCAA
|.||.|||.||| |||.|..||.||||.|..| ||..||||
GGGAAAUUGAGAGCAAAUUUGCUCAGUUUCGA-AGACUCAA
882
883
25
42
ACAGUGUCAAUGAAGGUGGGCAGAAGAUAAAGAAUGAAG
|||.||||..|||||....|..||.|.|.|.||.|||||
ACACUGUCCGUGAAGAAACGAUGAUGGUGAUGACUGAAG
884
885
25
44
UCUAAACAGUGUCAAUGAA-GGUGGGCAGAAGAUAAAGAAUGAAGCAGA--GCCAGAGUUUGCUUCGAGACUUGAGA
|.||||.|...|.|||.|. ||....||||||.|.||.|.|....|||| |.||.|..||.|| ||||.|||.||
UAUAAAGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAAGACACAAAUUCCU--GAGAAUUGGGA
886
887
25
46
GACAGAACU-CAAAGA-ACUUAA
|.|||||.| |||||| |.||||
GUCAGAAUUUCAAAGAGAUUUAA
888
889

25
47
CAGCCCAGUCU-AAACAGUGUCAAUGAAGGUGG
|||...|.||| |||||.| |.||||||..|||
CAGGGAAUUCUCAAACAAU-UAAAUGAAACUGG
890
891
25
48
CUUGAGACAGAACUCAAAGAACUUAACACUCAGUGGGAUCACAUG
|||||.|.|.|.||..||||.|||.|....||||...||||..||
CUUGAAAAAAAGCUUGAAGACCUUGAAGAGCAGUUAAAUCAUCUG
892
893
25
49
CAGCCCAGUCUAAACA
|||..||..|||||||
CAGUUCAAGCUAAACA
894
895
25
51
AGUUUGCUUCGAGACUUGAGACAGAACUCAAAGA
||.||.|..|..|.|||| |||||||||.|..||
AGAUUUCAACCGGGCUUG-GACAGAACUUACCGA
896
897
25
53
UCAAAGAACUUAACACUCAGUGGGAUCA
|.|||||| ||.|.|.||||||||||.|
UGAAAGAA-UUCAGAAUCAGUGGGAUGA
898
899
25
55
AGAGUUUGCUUCGAGACUUGAGACAGAA-CUCAAAGAACU
|.|||||..|.|..|.||| |||||| ||.|||.||||
AAAGUUUCUUGCCUGGCUU---ACAGAAGCUGAAACAACU
900
901
25
57
AAGAUAAAGAAUGAAGCAG
|||||.|.||||.||||.|
AAGAUGAUGAAUUAAGCCG
902
903

25
59
AGAGCC-AGAGUUUGCUUCGAGACUUGAGACAGAACUCAAAGAACUU-AACACUCAGUGGGAUCACAUGUGCCAACA
|||||| |||.|.|...|||.....|..||.||.|..|..||.|..| ||.|||.|||||||..|..||..||..||
AGAGCCCAGAAUGUCACUCGGCUUCUACGAAAGCAGGCUGAGGAGGUCAAUACUGAGUGGGAAAAAUUGAACCUGCA
904
905
26
27
AGCUGAAGAAGAGUAUCUUGAGAGAGAUUUUGAAUAUAAAACUCCAGA-UGAAUUACAGAAAGCAGUUGAAGAGAUGAAG
||||.||||||||...|...|.|.|||... |||..|.|||||||..| |||.| |.|.||..|||...|.||.|.|||
AGCUAAAGAAGAGGCCCAACAAAAAGAAGC-GAAAGUGAAACUCCUUACUGAGU--CUGUAAAUAGUGUCAUAGCUCAAG
906
907
26
28
UGAGAGAGAUUUUGAAUAUAAAACUCCAGAUGAAUUACAGAAAGCAGUUGAAGAGAU
|||...|||.|||.||..||||||..|.||..|..|.|.....|.||.|||.||.||
UGAAGUAGAAUUUAAACUUAAAACCACUGAAAACAUUCCUGGCGGAGCUGAGGAAAU
908
909
26
29
CUAUCAGA-GAUGCACGAAUGGAUGACACAAGCUGAAGAA-GAGUAUCUUGAGAGA
|||.|||| |..|.|...|||||||| |||.|..|| |||.|.|||||||.|
CUAACAGAUGGCGGAGUCAUGGAUGA-----GCUAAUCAAUGAGGAACUUGAGACA
910
911
26
31
GAAAGCAGUU--GAAGAGAUGAAG
||.|.||||| |||||.||||||
GAGAUCAGUUUAGAAGAAAUGAAG
912
913
26
32
UAUGCCAGAAAGGAGGCCUUGAAGGGAGGUUUGGAGAAAACUGUAAGCCUCCAGAAAGAUCUAUCAGAGAUGCAC
|||.|||||||..||.|..|...|.|..|..|..|.||.|..|||||. |......||||..|....||||||||
UAUUCCAGAAACCAGCCAAUUUUGAGCAGCGUCUACAAGAAAGUAAGA-UGAUUUUAGAUGAAGUGAAGAUGCAC
914
915
26
33
UAUAAAACUCCAGAUGAAUUACAGAAAGCAGUUGAAGAGAUGA
|||||||.||....||||.|..||...|.|||.|||..|.|||
UAUAAAAGUCUGAGUGAAGUGAAGUCUGAAGUGGAAAUGGUGA
916
917

26
34
AGAGAUGCACGAAUGGAUGACACAAGCUG---AAGAA---GAGUAUCUUGAGAGAGAUUUUGAA---UAUAAAACUCCAGAUGAAUUACAGAA-AGCAGUUGAAGAGAUG
|||.||||..|||....|..|..|||.|| |||.| ||.|.||||||.|||.....||.. ||.|.|..|..|..|||...|.|||. |||||||||||..|||
AGAAAUGCUUGAAAUUGUCCCGUAAGAUGCGAAAGGAAAUGAAUGUCUUGACAGAAUGGCUGGCAGCUACAGAUAUGGAAUUGACAAAGAGAUCAGCAGUUGAAGGAAUG
918
919
26
35
GAGGCCUUGAAGGGAGGUUUGGAGAAAACUGUAAGCCUCCAGAAAGAUCUA-UCAG
|||||||||||...||.|||||..||.|..|..|...|...|.|||||..| ||||
GAGGCCUUGAAAACAGUUUUGGGCAAGAAGGAGACGUUGGUGGAAGAUAAACUCAG
920
921
26
36
AAGGGAGGUUUGGAGAAAACUGUAAGCCUC--CAGAAAG---AUCUAUCAGA--GAUGCACGAAUGGAUGACACA-AGCUGAAGAA
|.||.|..|||.||..|.|.|||...||.| ||.|||| |||..||||. ||..|||...|||||||..|| ||...|||||
AUGGAAACUUUUGACCAGAAUGUGGACCACAUCACAAAGUGGAUCAUUCAGGCUGACACACUUUUGGAUGAAUCAGAGAAAAAGAA
922
923
26
37
AGAUGCACGAAUGGAUGACACAAGCUGAA
|.|.|||..|.||.||||||.|.||..||
AAAGGCAGAACUGAAUGACAUACGCCCAA
924
925

26
38
UCAGAGAUGCACGAAUGGAUGACACAAGCUGAAGAAGAGUAUCUUGAGAGAGAUUUUGAAUAUAAAACUCCAGAUGAAUUACAGAAAG
|||||..|.||..|||.|.|...||.|...||.|..||...||...||.|.| |||||.|.|||.. .||.||.||..|.||||
UCAGAUAUACAAAAAUUGCUUGAACCACUGGAGGCUGAAAUUCAGCAGGGGG----UGAAUCUGAAAGA--GGAAGACUUCAAUAAAG
926
927
26
39
GAGAGAGAUUUUGAAUAUAAAACUCCAGAUGAAUUACAGAAA
|.|||||....|.||.|||||||..|||.|| |||||||.|
GCGAGAGGAAAUAAAGAUAAAACAGCAGCUG--UUACAGACA
928
929
26
40
GAGGUUUGGAGAAAACUGUAAGCCUCCAGAAAGAUCU-AUCAGAGAUGCACGAAUGGAUGACACAAGCUGAAGA
|||||.|..|..||.....|||.|||.|||||..||| |||||.|.| |..|.|..|.||..||.|||||.||
GAGGUCUCAAAGAAGAAAAAAGGCUCUAGAAAUUUCUCAUCAGUGGU--AUCAGUACAAGAGGCAGGCUGAUGA
930
931
26
41
GAAUUACAGAAAGCAGUUGAAGAGAUGAA
|||||.|||||.......||.|||.||||
GAAUUGCAGAAGAAGAAAGAGGAGCUGAA
932
933
26
42
UUUGGAGAAAACUGUAAGC
||||.|||...||.|||||
UUUGAAGAUCUCUUUAAGC
934
935

26
44
AGGUUUGGAGAAAACUGUAAGCCUC--CAGAAAGAUCUAUCAGAGAUGCACGAA-UGGAUGACACAAGCUGAAGAAGAGUAUCUUGAGAGAGA
||.|.||..||.||.||...||.|. ||..|.|||.||. |||.||..|...| |||.|.|||.||||||||.| ||.|||. |||.|||
AGAUCUGUUGAGAAAUGGCGGCGUUUUCAUUAUGAUAUAA-AGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACA---GUUUCUC-AGAAAGA
936
937
26
46
AGAAGAGUAUCUUGAGAGAGAUUUUGAAUAUAAAACUCCAGAUGAAUU
|.||||.|||||||..||| ||||..||.|.| |..|.|||||||
AAAAGAAUAUCUUGUCAGA-AUUUCAAAGAGA----UUUAAAUGAAUU
938
939
26
47
AUGACACAAGCUGAAGAAGAGUAUCUUGAGAG--AGAUUUUGAAUAUAAAACUCCAGAUGA
||.|..|.||..||..||||..|.|||||.|. ||.|...|.|.|.|||.||||||..||
AUAAGCCCAGAAGAGCAAGAUAAACUUGAAAAUAAGCUCAAGCAGACAAAUCUCCAGUGGA
940
941
26
48
UCCAGAAAGAUCUAUCAGAGAUGCACGAAUGGAUGACACAAGCUGAAGAAGAGUAUCUUGAGAGAGAUUUUGAAUAUAAAACUCCAGAUGAAUUACAGAAAGCAGUUGAA
|||||| |.|.||.|.||||..||.|.|...|| ..|||||.||..|.|..|.||||.|. |..||||| ||||..|..||.||..|..| |.|||||||.||
UCCAGA--GCUUUACCUGAGAAACAAGGAGAAAU---UGAAGCUCAAAUAAAAGACCUUGGGC---AGCUUGAA---AAAAAGCUUGAAGACCUUGA-AGAGCAGUUAAA
942
943
26
49
CAAGCUGAAGAAGAGUAUCUUGAGAGAGAUUUUGAAUAUAAAACUCCAGAUGAAUUAC-AGAAAGCAG
||||||.||.||..|.||.|.|| ||||||||||..||.|...|..||..||.|..|. |.|||.|||
CAAGCUAAACAACCGGAUGUGGA-AGAGAUUUUGUCUAAAGGGCAGCAUUUGUACAAGGAAAAACCAG
944
945

26
51
AUGACACAAGCUGAAGAAGAGU-AUCUUGAGAGAGAUUUUGAAUAUAAAACUCCAGAUGAA
||.|||.|.|.|||.|..|.|| |.|||||| ||.||.....|.||.|...||.||..|||
AUCACAGAGGGUGAUGGUGGGUGACCUUGAG-GAUAUCAACGAGAUGAUCAUCAAGCAGAA
946
947
26
53
UGAA-UAUAA-AACUCCAGAUGAAUUACAGAAAGCAGUUGAA-GAGAUG
|||| ||.|| |||.||....|||....||..|.|||||||| ||.|||
UGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAUG
948
949
26
55
GAAAGGAGGCCUUGAAGGGAGGUUUGGAGAAAACUGUAAGCCU-CCAGAAAGAUCUAUCAGAGAUGCACGAAUGGAUGACACAAGCUGAA
||.|||..||.|||.|.|.|..|... |||..||||.||...| ||.....||.||...|.||.|.|..|..|||.|.|||.||||||||
GAGAGGCUGCUUUGGAAGAAACUCAU-AGAUUACUGCAACAGUUCCCCCUGGACCUGGAAAAGUUUCUUGCCUGGCUUACAGAAGCUGAA
950
951
26
57
GAUGAAUUACAGAAAGCAG
||||||||| ||...||||
GAUGAAUUA-AGCCGGCAG
952
953
26
59
CAAGCUGAAGAAGAGUAUCUUGAGAGAGAUU--UUGAAUAUAAAACUCCAGAUGAAUUACAGAAAGCAGUUGAAGAGA
||.|||||.||.|...||..||||.|.||.. |||||..|..| |||| |.|||.|..||||.|..|.|.||.||||
CAGGCUGAGGAGGUCAAUACUGAGUGGGAAAAAUUGAACCUGCA-CUCC-GCUGACUGGCAGAGAAAAAUAGAUGAGA
954
955
27
28
ACAAGAGGCCUUAAAAAAG--GAACUUGAAACUCUAACCAC
|||||.||| |.||..||| |||.||.||..|..||||||
ACAAGUGGC-UAAAUGAAGUAGAAUUUAAACUUAAAACCAC
956
957

27
29
UAAAAAAGGAACUUGAAAC
|.||..||||||||||.||
UCAAUGAGGAACUUGAGAC
958
959
27
30
AGCUCAAGCUCCACCUGUAGCACA
|||||||...||.|..|.|||.||
AGCUCAAAUGCCUCAGGAAGCCCA
960
961
27
31
AAAAGAAGCGAAAGUGAAACUCCUUACUGAGUCUGUAAAUAGUGUCAUAGCUCAAGCUCCACCUGUAGCACA
|||.||| ||||...||.|.....|..|||.|||...|.||.|||.|..|||| |.|..| |||.|||||
AAAUGAA--GAAACAUAAUCAGGGGAAGGAGGCUGCCCAAAGAGUCCUGUCUCA-GAUUGA--UGUUGCACA
962
963
27
32
AGUGGCUCUGCACUAGGCUGAAUGGGAAAUGCAAGACUUUGGAA
||||....||||||.|.|||.||.|||||.. ||||.|.|||||
AGUGAAGAUGCACUUGCCUGCAUUGGAAACA-AAGAGUGUGGAA
964
965
27
33
UGUAAAUAGUGUCAUAG-CUCAAGCUCCACCUGUA--GCACAAGAGGCCUUAAAA----AAGGAACUUGA
||.||||.|||..|.|| ||..|..||....|||| |.|.|||..|.|..|||| ||.||||||||
UGGAAAUGGUGAUAAAGACUGGACGUCAGAUUGUACAGAAAAAGCAGACGGAAAAUCCCAAAGAACUUGA
966
967
27
34
AAGAAGCGAAAG----UGAAACUCCUUACUGAGU
||||.||||||| ||||..||.|.||.||.|
AAGAUGCGAAAGGAAAUGAAUGUCUUGACAGAAU
968
969
27
35
ACUGAGUCUG-UAAAUAGUGUC---AUAGCUCAAGCUCCACCUGUAGCACAAGAGGCCUUAAA
|||.|||||. |.||||||..| ||||||.. |.||.||.| ||||.|||||...|||||
ACUCAGUCUUCUGAAUAGUAACUGGAUAGCUGU--CACCUCCCG-AGCAGAAGAGUGGUUAAA
970
971

27
36
AGAGCUAAAGAAGAGGCCCAACAAAAAGAAG
||||..||||||. .||||.||||||||||
AGAGAAAAAGAAA--CCCCAGCAAAAAGAAG
972
973
27
37
AGUGUCAUAGCUCAAGC-UCCACCUGUAGC
|.|.|||.|||||||.| ||.|..||.|||
AAUCUCAGAGCUCAACCAUCGAUUUGCAGC
974
975
27
38
GGCUGAAUGGGAAAU-GCAAGACUU
||.|||||..||||. |.|||||||
GGGUGAAUCUGAAAGAGGAAGACUU
976
977
27
39
AAAGAAGAGGC--CCAACAA-AAAGAAGCGAAAGUGAAA
|||||.|||.| |..|||| ||||||.|..|..|||.|
AAAGAGGAGACAACUUACAACAAAGAAUCACAGAUGAGA
978
979
27
40
AAAAAAGGAACUUGAAACU-CUAACCA
||||||||..||.||||.| ||.|.||
AAAAAAGGCUCUAGAAAUUUCUCAUCA
980
981
27
41
UGAAUGGGAAAUGCA
|||..|||||.||||
UGAUCGGGAAUUGCA
982
983
27
42
GAAACUCCUUACUGAGUCUGUAAAUAGUGUCAUAGCUCAAGCUCCACCUGUAGCACAAGAGGCCUUAAAAAAGGAAC
||||.|.|||| ||.|.||...|.|..|.|.| ||.||....|.|.|||..||||||.....|||.||..|||||
GAAAUUUCUUA-UGUGCCUUCUACUUAUUUGA---CUGAAAUCACUCAUGUCUCACAAGCCCUAUUAGAAGUGGAAC
984
985

27
44
UCUGUAAAUAGUGUCAUAGCUCAAGCUCCAC
|.|.|||..||||.| ||.|..|||||..||
UAUUUAAUCAGUGGC-UAACAGAAGCUGAAC
986
987
27
46
AGCUAAAGAAGAGGCCCAACAAAAAGAAGCGAAAGUGAAACUC
|.||..|.|||||...||||.|||||||..|...|.|.||.||
ACCUGGAAAAGAGCAGCAACUAAAAGAAAAGCUUGAGCAAGUC
988
989
27
47
AGAAGCGAAAGUGAAACU
|||||.|.|||..|||||
AGAAGAGCAAGAUAAACU
990
991
27
48
AGAGCUAAAGAAGAGGCCCAACAAAAA---GAAGCGAAAGUGAAACUCCUUACUGAGUCUGUAAAUA
||||||..|...|||...|||..|.|| |||||..||.|.|||..||||....||..||.|||.|
AGAGCUUUACCUGAGAAACAAGGAGAAAUUGAAGCUCAAAUAAAAGACCUUGGGCAGCUUGAAAAAA
992
993
27
49
AGCUAAAGAAGAGGCCCAACAAAAAGAAGCGAAAGUGAAA
|.||.||..||..|..|||...|||.||.||.|.|||.||
AACUGAAAUAGCAGUUCAAGCUAAACAACCGGAUGUGGAA
994
995
27
51
UUAAAAAAGGAACUUGAAACUCUAACCACCAACUACCA
|||..||.|.||||...|.|||.||.|...||.|.|||
UUACUAAGGAAACUGCCAUCUCCAAACUAGAAAUGCCA
996
997
27
53
AGCUAAAGAAGAGGCCCAACA
||||||.|||||.||..|.||
AGCUAAGGAAGAAGCUGAGCA
998
999

27
55
ACCAACUACCAGUGGCUCUGCACUAGGCUGAAUGGGAAAUGCAAGACU
|.|||||.|||.||.| ||.||..|.||| |...|.||.|.|||.||
AACAACUGCCAAUGUC-CUACAGGAUGCU--ACCCGUAAGGAAAGGCU
1000
1001
27
57
ACCAGUGGC----UCUGCAC
||||||||. |||||||
ACCAGUGGAAGCGUCUGCAC
1002
1003
27
59
CUGCACUAGGCUGAAUGGGAAA
|||||||..|||||.|||.|.|
CUGCACUCCGCUGACUGGCAGA
1004
1005
27
60
AAGCGAAAGUGAAACUCCUUACUGA
|||.|||.||||..|.|.|.|.|||
AAGAGAACGUGAGCCACGUCAAUGA
1006
1007
28
29
AUUGUCAUACUUGGAGAAAGCA-AACAAGUGGCUAAAUGAAGUAGAAUUUAAACUUAAAACCACUGAAAACAUU
|||..||||.|.|.|.|.|.|. ||||..||||..|.|.|.|.|..|..|||.|....|...|||..|.|||||
AUUCGCAUAUUGGCACAGACCCUAACAGAUGGCGGAGUCAUGGAUGAGCUAAUCAAUGAGGAACUUGAGACAUU
1008
1009
28
30
GUUGGCAUGAGUUAUUGUCAUACUUGGAGAAAGCAAA-CAAGUGGCUAA
|||||||.....||||| ||.||..||.|.|.|||.. |||.||.||.|
GUUGGCAGCUUAUAUUG-CAGACAAGGUGGACGCAGCUCAAAUGCCUCA
1010
1011
28
31
AAAUGAAGUAGAAU
||||||||.|..||
AAAUGAAGAAACAU
1012
1013

28
32
AGAAAGCAAACAAGUGGCUAAAUGAAGUAGAAUUUAAACUUAAAACCACUGAAAACA
||||||.||. |.|....||.||||||| |||..|..||||.....||.||.|||||
AGAAAGUAAG-AUGAUUUUAGAUGAAGU-GAAGAUGCACUUGCCUGCAUUGGAAACA
1014
1015
28
33
ACAAGUGGCUAAAUGAAGUAGAAUUUAAACUUAAAA
|.||..|.||.|.||||||..|.|.|.||.|..|||
AUAAAAGUCUGAGUGAAGUGAAGUCUGAAGUGGAAA
1016
1017
28
34
AGAAAGCAAACAAGUGGCUAAAUG
||||||||| ||..|||..|||||
AGAAAGCAA-CAGUUGGAGAAAUG
1018
1019
28
35
AGCAAACAAGUGGCUAAAU
||||.|..|||||.|||||
AGCAGAAGAGUGGUUAAAU
1020
1021
28
36
GAGAAAGCAAACAAGUGGCUAAAUGAAGUAGAAUUUAA
||||||...||......||.|||.||||..|...||||
GAGAAAAAGAAACCCCAGCAAAAAGAAGACGUGCUUAA
1022
1023
28
37
AGAAUUUAAACUUAAAA
||||||.|.|||..|||
AGAAUUAAGACUGGAAA
1024
1025
28
38
CUAAAUGAAGUAGAAUUUAA
||.||.||.|.|||.||.||
CUGAAAGAGGAAGACUUCAA
1026
1027

28
39
AAACAAGUG--GCUAAAUGAAGUAGAAUUUAAACUUAAAACCACUGA
|||.||.|| ||.||..|.||...|.||..|||..|.||.|||.||
AAAGAAUUGUUGCAAAGAGGAGACAACUUACAACAAAGAAUCACAGA
1028
1029
28
40
GGCUAAAUGAAGUAGAA------UUUAAACUUAAAACCACUGAAAACAUUCCUGGCGGA--GCUGAGGAAAUCUCUGAGGUGCUAG
|.||.||.||||.|.|| |..|||.||...|.||.||..|.||.|.|..|.||. |||||.||..|| ||||..||||.|
GUCUCAAAGAAGAAAAAAGGCUCUAGAAAUUUCUCAUCAGUGGUAUCAGUACAAGAGGCAGGCUGAUGAUCUC-CUGAAAUGCUUG
1030
1031
28
41
CUGAAAACAUUCC-UGGCGGAGCUGAGGAAAUCUCUGAGG
|||||..||.|.| |.|...||||||||...|.|||||||
CUGAAUGCAGUGCGUAGGCAAGCUGAGGGCUUGUCUGAGG
1032
1033
28
42
CUGAGGAAAUCUCUGAGGUGC
||..||||||.|||.|.||||
CUUUGGAAAUUUCUUAUGUGC
1034
1035
28
44
GUUUGGGCAUGUUGGCAUGAGUUAUUGUCAUACUUGGAGAAAGCAAACAAGUGGCUAAAUGAAGUAGAAUUUAAACUUAAAACCACUGAAAACAUUCCUG
|||..|..|||..|||.|.. |.|||.|.||| |..|||.|...||..|||||||||..||||..|||......||.|.||..||..|| |||||||
GUUGAGAAAUGGCGGCGUUU-UCAUUAUGAUA--UAAAGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAAGACACAA---AUUCCUG
1036
1037

28
46
AUGAGUUAUUGUCAUACUUGGAGAAAGCAAACAAG-UGGCUA
||||.||..|.|.||..||||||.|||||.|.||. |.||||
AUGAAUUUGUUUUAUGGUUGGAGGAAGCAGAUAACAUUGCUA
1038
1039
28
47
AAGCAAACAAGUGGCUAAAUGAAGUAGAAUUUAAACUUAA
||||..|.|||.| |.|.||.||.|.|||..|||.||.||
AAGCCCAGAAGAG-CAAGAUAAACUUGAAAAUAAGCUCAA
1040
1041
28
48
AAUGAAGUAGAAUUUAAACUUAAAACCACUGAAAACAUUCCUGGCGGAGCU-GAGGAAAUCUCUGAGGUGCUAGA
||..|||.||||.||.||..|.|||. ||||.| |||.|.|.|||| ||..|||....|||.|..||.||
AAACAAGGAGAAAUUGAAGCUCAAAU-----AAAAGA--CCUUGGGCAGCUUGAAAAAAAGCUUGAAGACCUUGA
1042
1043
28
49
AAAUGAAGUAGAAUUUAAACUUAAA
||.||||.|||.|.||.||..||||
AACUGAAAUAGCAGUUCAAGCUAAA
1044
1045
28
51
CUUGGAGAAAGCAAACA-AGUGGCUAAAUGAAGUAGAAUUUAAACU-UAAAACCACUGAAAACAUUCCUGGCGGAGCU-GAGGAAAUCUCUGAGGUGCU
||||||.|.|.|..||. |.|||||...|....|.|| |.||..| |||||.|||.||......|..|||..||.|| |||||.|||...|||.||.|
CUUGGACAGAACUUACCGACUGGCUUUCUCUGCUUGA--UCAAGUUAUAAAAUCACAGAGGGUGAUGGUGGGUGACCUUGAGGAUAUCAACGAGAUGAU
1046
1047
28
53
AGUAGAAUUUAAACUUAAAACCACUGAAAACAUUC-CUGGCGGAGCUGAGGAAAUCUCUGAG
|||.||||. |||..|.|||..|.|.||.|||.|. |||| .||||.|||||....|||||
AGUUGAAUG-AAAUGUUAAAGGAUUCAACACAAUGGCUGG--AAGCUAAGGAAGAAGCUGAG
1048
1049

28
55
AAACUUAAA-ACCACUGAAAACAUUCCUGGCGGAGCUGAGGAAAUCUCU
|||||.|.| |..||||.||...||||....|||.|||...||.|.|||
AAACUCAUAGAUUACUGCAACAGUUCCCCCUGGACCUGGAAAAGUUUCU
1050
1051
28
57
GCUAAAUGAAGUAGAAUUUA
|||.||.||.|..|||||.|
GCUGAAAGAUGAUGAAUUAA
1052
1053
28
59
GUAGAAUUUAAACUUAAAACCACUGA
|.|.||||.||.||..|..||.||||
GAAAAAUUGAACCUGCACUCCGCUGA
1054
1055
29
30
CUUGAAAAUUUGAUGCGACAUUCAGAGGAUAACCCAAAUCAGAUUCGCAUAUUGGCACAGACCCUAACA
||||||.|....||.|....|.|..||||.|....|||.....|.|.|.||.|.....||.||||.|||
CUUGAACAGAGCAUCCAGUCUGCCCAGGAGACUGAAAAAUCCUUACACUUAAUCCAGGAGUCCCUCACA
1056
1057
29
31
AGUCAUG-GAUGAGCU---AAUCAAUGAGGAA
||||||| |||.||.| ||..|||||.|||
AGUCAUGAGAUCAGUUUAGAAGAAAUGAAGAA
1058
1059
29
32
ACAUUCAGAGGAUAACCCAAAUCAGAUUCGCAUAUUGGCACAGACC
|.|.|.|.|.|||..|.|.|...||.||||..||||. ||.|.|||
AAAAUUACAAGAUGUCUCCAUGAAGUUUCGAUUAUUC-CAGAAACC
1060
1061
29
33
AAAAUUUGAUGCGACAUUCAGAG
|.||.||||||..|.|.|.|.||
AGAACUUGAUGAAAGAGUAACAG
1062
1063

29
34
CAGAUUCGCAUAUUGGCACAGACCCUAACAGAUGGCGGAGU
|||||..|.| ||||.||.|||....|.|||.||..|||.|
CAGAUAUGGA-AUUGACAAAGAGAUCAGCAGUUGAAGGAAU
1064
1065
29
35
AACAGAUGGCGGAGUCAUGGAUGAGCUAAUCAAUGAGGAACUUGAGACAUUUAA
||||||.||.|.| |.|| |.||| .||||..||||.|...|||.|.||.||
AACAGAAGGUGCA--CCUG-AAGAG--UAUCACAGAGGUAGGAGAGGCCUUGAA
1066
1067
29
36
CACUUGAAAA--UUUGAUGCGACAUUCAGAGGAUAACCCAAAUCAGAUUCGCAUAUUGGCACAGACCCUAACAGAUG
|||.||.||| |||||...|| ||...||..|.|.|.||||...||| |||...|||..|.||.||....||||
CACAUGGAAACUUUUGACCAGA-AUGUGGACCACAUCACAAAGUGGAU---CAUUCAGGCUGACACACUUUUGGAUG
1068
1069
29
37
GCAUAUUGGCACAGACCCUAA-CAGAUGGCGGAGUCAUGGAUGAGC
|.|.|||.|.|.||.|||.|| |..|..||..|..|||.|||..||
GGAAAUUAGUAGAGCCCCAAAUCUCAGAGCUCAACCAUCGAUUUGC
1070
1071
29
38
AGGAACUUGAGACAUUUAAUUC
|||||.|.|||...|||||.||
AGGAAUUGGAGCAGUUUAACUC
1072
1073
29
39
GAGUCAUGGAUGAGCUAAUCAAUGAGGAACUUGAGACA
||.|||..||||||..||.....||||||.|..|||.|
GAAUCACAGAUGAGAGAAAGCGAGAGGAAAUAAAGAUA
1074
1075
29
40
UCACUUGAAAA--UUUGAUGCGACAUUCAGA
||.|.|||||. ||.||| ||||||.|.|
UCUCCUGAAAUGCUUGGAU--GACAUUGAAA
1076
1077

29
41
ACCCAAAUCAGAUUC
|.||||.||||||.|
AGCCAACUCAGAUCC
1078
1079
29
42
CACAGACCCUAACAGAUG
||||..|||||..|||.|
CACAAGCCCUAUUAGAAG
1080
1081
29
44
AUUCAGAGGAUAACCCAA----AUCAGAUUCGCAUAUUGGCACAGAC-CCUAACAGAUGG
|.||||.||.||||..|| |.|||.|||.||.|..|.||||.|. |||.|.|..|||
AAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAAGACACAAAUUCCUGAGAAUUGG
1082
1083
29
46
GAUGAGCUAAUCAAUGAGGAACUUGAGACAUUUAA
||..|||.|.|.||.||..|.||||||..|.|.||
GAGCAGCAACUAAAAGAAAAGCUUGAGCAAGUCAA
1084
1085
29
47
ACUUGAAAAUUUGAU---GC-GACA----UUCAGAGGAUAA
||||||||||..|.| || |||| |.|||.||||||
ACUUGAAAAUAAGCUCAAGCAGACAAAUCUCCAGUGGAUAA
1086
1087
29
48
UCACUUGAAAAUUU
|||.|||.||||||
UCAGUUGGAAAUUU
1088
1089
29
49
AGCUAAUCAAUGAGGAACUUGA-GACAUUU
||||||.|||.. |||..|.|| ||.||||
AGCUAAACAACC-GGAUGUGGAAGAGAUUU
1090
1091

29
51
AACUUGAGA---CAU-UUAAUUCUCGUUGGAGGGAACUAC
||||.||.| ||| ||..||...||||||||.|.||.|
AACUAGAAAUGCCAUCUUCCUUGAUGUUGGAGGUACCUGC
1092
1093
29
53
UUGAGACAUUUAAUUCUCGUUGGAGGGAACUACAUGAAGA
||||.|.|.||.|...||..|||...|||.||||.|||.|
UUGAAAGAAUUCAGAAUCAGUGGGAUGAAGUACAAGAACA
1094
1095
29
55
CUUGAAAA-UUUGAUGC--GACAUUCAGAGGAUAACCCAAAUCAGAUUCGCAUAUUGGCACAGACCC-UAACAGAUGGC
||.||||| |||..||| |.|.|.||||.|.|.|..|||.|...|.|..|.||..||.....|||| |||...|.|||
CUGGAAAAGUUUCUUGCCUGGCUUACAGAAGCUGAAACAACUGCCAAUGUCCUACAGGAUGCUACCCGUAAGGAAAGGC
1096
1097
29
57
AUUUGAUGCGACAUUC
|||.||.|||||.|||
AUUGGAGGCGACUUUC
1098
1099
29
59
GAAAAUUUGAUGCGACAUUCAGAGGAUAACCC----AAAUCAGAUUCGCAUAUUGGCACAGACCCUAACAGAUGGCGGAGUC-AUGGAUGAGCU
|||||.||||..|..||.||.|..||....|. |||..||||..|....||| |.||||.|.|..|..|....|||.| |.|||||||||
GAAAAAUUGAACCUGCACUCCGCUGACUGGCAGAGAAAAAUAGAUGAGACCCUUG--AAAGACUCCAGGAACUUCAAGAGGCCACGGAUGAGCU
1100
1101
30
31
UAAGGAGGCAAAAGUUGCUUGAACAGAGCAUCCAGUCU
|||..|||..||.|..||| |..||.||..|||.||||
UAAUCAGGGGAAGGAGGCU-GCCCAAAGAGUCCUGUCU
1102
1103

30
32
ACAAGCAGUUGGCAGCUUAUAUUGCAGACAAGGUG
|.|.|||.|||.|.|| ||||.|.||||.|.|
AGAUGCACUUGCCUGC----AUUGGAAACAAAGAG
1104
1105
30
33
AGGAGACUGAAAAAUCCUUACA-CUUAAUCCAGGAGUCCC-----UCACAUUCAUUGACAAGCAGUUGGCAGC
||.||||.|||||..||..|.| |||.||..|.||||..| |.|.|||...|.|.||..||.|||.|||
AGCAGACGGAAAAUCCCAAAGAACUUGAUGAAAGAGUAACAGCUUUGAAAUUGCAUUAUAAUGAGCUGGGAGC
1106
1107
30
34
UUGACA-AGCAGUUGGCAGCUU---AUAUUGCA--GACAAGGUGGAC-GCAGCUCAA---AUGCCU
|||||| |...|.||||||||. ||||.|.| |||||.|.|..| ||||.|.|| ||||||
UUGACAGAAUGGCUGGCAGCUACAGAUAUGGAAUUGACAAAGAGAUCAGCAGUUGAAGGAAUGCCU
1108
1109
30
35
GUAAGGAGGCAAAAGUUGCUUGAACAGAGCAUCCAGUCUGCCCAGGAG--ACUGAAAA
|.|||.||| |.|.||||.|.|||.|.|. |..||||||.|..|..|| ||||.|.|
GCAAGAAGG-AGACGUUGGUGGAAGAUAA-ACUCAGUCUUCUGAAUAGUAACUGGAUA
1110
1111
30
36
ACAAGCAGUUGGCAGCUUAUAUUGCAGACAAGGUGGACG-CAGCUCAAA-UGCCUCA
|.||.||..|||.|.||| |||...|.||.||||||. ||.|.|||| ||..|||
AGAAACACAUGGAAACUU---UUGACCAGAAUGUGGACCACAUCACAAAGUGGAUCA
1112
1113
30
37
CAAAAGUUGCUUGAAC
|||||.||||||||||
CAAAAAUUGCUUGAAC
1114
1115
30
38
CAGCUUAUAUUGCAGACAA
||||...|.||.|||||||
CAGCAGCUGUUACAGACAA
1116
1117

30
39
CAGCUUAUAUUGCAGACAA
||||...|.||.|||||||
CAGCAGCUGUUACAGACAA
1116
1117
30
40
CAUUGACAAGCAGUUGGC-AGCUUA
||||||.||..|.||.|| |||.||
CAUUGAAAAAAAAUUAGCCAGCCUA
1118
1119
30
41
GUGGACGCAGCUCAAAUGC--CUCAGGAAGCCCAG
|||||..||.||||.||.| |||||.||||.|.|
GUGGAGCCAACUCAGAUCCAGCUCAGCAAGCGCUG
1120
1121
30
42
CCAGUCUGCCCAGGAGACUGAAAAAUCCUUACACUUAAUCCAGGAGUCCCUCA
||..|.|||..||||...||||.|...|||..|...|. |||||||.||.|
CCUCUGUGCUAAGGACUUUGAAGAUCUCUUUAAGCAAG---AGGAGUCUCUGA
1122
1123
30
44
CUCAAAUGCCUCAGGA
|.|||||.|||.||.|
CACAAAUUCCUGAGAA
1124
1125
30
46
CUUGAACAGAGCAUCCAGU
||.|||.||||||.|.|.|
CUGGAAAAGAGCAGCAACU
1126
1127
30
47
UGCUUGAACAGAGCAUCCAGUCUGCCCAGGAGACUGAAAAAUCCUUACACUUAA--UCCAGGAGUC
||||||.| ||.|| |||..|..||||||.|||...|.|.|..|||..|..||| ||.||.||.|
UGCUUGUA-AGUGC-UCCCAUAAGCCCAGAAGAGCAAGAUAAACUUGAAAAUAAGCUCAAGCAGAC
1128
1129

30
48
AUUGACAAGCAGUUGGCAGCUUAUA
|||...||.|||||||.|..|||||
AUUAGGAAUCAGUUGGAAAUUUAUA
1130
1131
30
49
UGUAAGGAGGCAAAAGUUG--CUUGAACAGAGCAUCCAGUCUGCC
|.|||.| ||||..|.||| |..|.|.|.|.||.|||.||.|||
UCUAAAG-GGCAGCAUUUGUACAAGGAAAAACCAGCCACUCAGCC
1132
1133
30
51
GCUUGAACAGAGCAUCCAGUCUGCC
|||||.|||||.|.|.|.|.|||.|
GCUUGGACAGAACUUACCGACUGGC
1134
1135
30
53
GGAGGCAAAAGUUGCUUGAA
||||||||.|||||..||||
GGAGGCAACAGUUGAAUGAA
1136
1137
30
55
GCAAAAGUUGCUUG
|.|||||||.||||
GGAAAAGUUUCUUG
1138
1139
30
57
AAAAAUCCUUACA
|||||||||.|.|
AAAAAUCCUGAGA
1140
1141
30
59
UGAACAGAGCAUCCAGUCUGCCC
|||.||..|.||||.|.|.||||
UGAUCAAGGGAUCCUGGCAGCCC
1142
1143

30
60
UGACAAGCAGUUGGCAGCUUAU
|||..|.|||.|||.|||||.|
UGAACACCAGAUGGAAGCUUCU
1144
1145
31
32
ACAAGUCA-UGAGAUCAGUUUAGAAGAAAUGAAGAAACA
|||||..| |.||||.|.||||||.|||.||||||..||
ACAAGAAAGUAAGAUGAUUUUAGAUGAAGUGAAGAUGCA
1146
1147
31
33
AAGUCAUGAGAUCAGUUU--AGAAGAAAUGAAGAAACAUAAUCAGGGGAAGGAGGCUGCCCAAAGAGU
|||.|..||..||||.|| |.|..|||.|.|||...|.||||. .||.||...||...|||||||
AAGACUGGACGUCAGAUUGUACAGAAAAAGCAGACGGAAAAUCC---CAAAGAACUUGAUGAAAGAGU
1148
1149
31
34
GAUUUGACAAGUCAUGAGAUCAGUU-UAGAAGAAAUG
||.|||||| |.||||||||.. |.||||.||||
GAAUUGACA----AAGAGAUCAGCAGUUGAAGGAAUG
1150
1151
31
35
AGAAGAAAUGAAGAAACAUAA
|.||||.||..|||||||.||
AAAAGAGAUUGAGAAACAGAA
1152
1153
31
36
UUUAGAAGAAAUGAAGAAACAUAAUC
|||.||.|||....|||||.|.||.|
UUUGGAUGAAUCAGAGAAAAAGAAAC
1154
1155
31
37
CAAUCUGAUUUGACAAGU-CAUGAGAUCAGUUUAG
|||.|.|...||||.|.| ||.||.||.|||..||
CAAACCGCGGUGACCACUGCAGGAAAUUAGUAGAG
1156
1157

31
38
UCCAAUCUGAUUUGACAAGUCAUGAGAUCAGUUUAGAAGAAAUGAAGAAACAU
||||.|| .|||| |||..||..||.|||||||....|.||..|.|||.||
UCCAUUC--CUUUG--AAGGAAUUGGAGCAGUUUAACUCAGAUAUACAAAAAU
1158
1159
31
39
AUGAGAUCAGUUUAGAAGAAAUGAAGAAACAUAAUCAG
||||||..|....|||.|||||.||||.|.|..|.|||
AUGAGAGAAAGCGAGAGGAAAUAAAGAUAAAACAGCAG
1160
1161
31
40
UCAUGAGAUCAGUUUAGAAGAAAU-GAAGAAACAUAAUC
||.|||.|| |.||.||.||.|| |||.|||.||.|.|
UCCUGAAAU--GCUUGGAUGACAUUGAAAAAAAAUUAGC
1162
1163
31
41
AUUUGACAAGUCAUGAGAUCAGUUUAGAAGA
|.||||.|....||..|.|||||||.|||||
AAUUGAGAGCAAAUUUGCUCAGUUUCGAAGA
1164
1165
31
42
GAAGAAAUGAAGA
|||||||.||.||
GAAGAAACGAUGA
1166
1167
31
44
AAGAAAUGAAGAAACAUAAUCAGGGG---AAGGAGGCUGCCCA
|.||.||.||||.|..|||||||.|| |..||.||||..||
AUGAUAUAAAGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACA
1168
1169
31
46
UAGAAGAAAUGAAGAA
||||||||...|||||
UAGAAGAACAAAAGAA
1170
1171

31
47
AAGUCAUGAGAUCAGUUUAGAAGAAAUGAAGAAACAU---AAUCAGGGGAAGGAGGC
||||..|...||.||...||||||.....|.||||.| |||.||...|||.||.|
AAGUGCUCCCAUAAGCCCAGAAGAGCAAGAUAAACUUGAAAAUAAGCUCAAGCAGAC
1172
1173
31
48
AAAUCCAAUCUGAUUUGACAAGUCAUGAGAUCAGUUUAGAAGAAA---UGAAGA
||||..||.||.|..|.|.|...|.||.| |||.||..||.||| ||||||
AAAUUGAAGCUCAAAUAAAAGACCUUGGG--CAGCUUGAAAAAAAGCUUGAAGA
1174
1175
31
49
GGGGAAG-GAGGCUGCCCAAAGAG
|.||||| ||...||.|.||||.|
GUGGAAGAGAUUUUGUCUAAAGGG
1176
1177
31
51
UCUGAUUUGACAAGUCAUGAGAUCA
||||.||...|||||.||.|.||||
UCUGCUUGAUCAAGUUAUAAAAUCA
1178
1179
31
53
GGAAGGAGGCUGCCCAAAGAGU
|||||||||.|.||.|.|.|||
GGAAGGAGGGUCCCUAUACAGU
1180
1181
31
55
UAGAAGAAAUGAAGAAACA
||.||||..|||.||||||
UAAAAGAGCUGAUGAAACA
1182
1183
31
57
AUUUGACAAGUCAUGAGAUCAGUUUAGAAGAA
|||.||...|.|.|...|.|||||.|||||.|
AUUGGAGGCGACUUUCCAGCAGUUCAGAAGCA
1184
1185

31
59
UAAUCAGGGGAAGGAGGCUGCCC
|.||||.||||....|||.||||
UGAUCAAGGGAUCCUGGCAGCCC
1186
1187
31
60
AUCAGUUUAGAAGAAAUGAAGA
|.||.|.|.|||||..||||.|
AGCACUCUGGAAGACCUGAACA
1188
1189
32
33
UGAAGUGAAGAUGCACUUGCCUGCAUUGGAAACAAAGAGUGUGGAACAGGAAGUAGUACAGUCACAGC
||||||||||....|..|| |.|.|||..|.|||||.||. ||...|..|.||||||..|.|||
UGAAGUGAAGUCUGAAGUG---GAAAUGGUGAUAAAGACUGG---ACGUCAGAUUGUACAGAAAAAGC
1190
1191
32
34
GUAAGAUGAUUUUAGAUGAAGUGAAGAUGCACUUGCCUGCAU---UGGAAACAAAGAGUGUGGAA
|||||||| ..|.|.|||.||||..| ||||.|.|.|| |||.|.|.|....|.|||||
GUAAGAUG---CGAAAGGAAAUGAAUGU---CUUGACAGAAUGGCUGGCAGCUACAGAUAUGGAA
1192
1193
32
35
AAACAAAGAGUGUGGAACAGGAAGU
|||.|.|||.||.|.|||||.|.||
AAAAAGAGAUUGAGAAACAGAAGGU
1194
1195
32
36
AUUCCAGAAAC-CAGCCAA-- UUUUGAGCAGCGUCUACAAGAAAGUAAGAUGAUUUUAGAUGAAGUGAAGAUGCACUUGCCUGCAUUGGAAACAAAGA
||.|||||||| ||...|| ||||||.|||..|.|..|..|.|..|..|.|....|...|.|.|...|.|..|..|||..||.||..||.|.|||||
AUACCAGAAACACAUGGAAACUUUUGACCAGAAUGUGGACCACAUCACAAAGUGGAUCAUUCAGGCUGACACACUUUUGGAUGAAUCAGAGAAAAAGA
1196
1197

32
37
UCACAGCUAAAUCAUUG
|||.||||.||.|||.|
UCAGAGCUCAACCAUCG
1198
1199
32
38
GAGUGUGGAACAGGAAG
||.|.||.||.||||||
GAAUCUGAAAGAGGAAG
1200
1201
32
39
GGAAACAAAGAGUGUGGAACAGGAAGUAGUACAGUCACAGCUAAAU
|||||.||||| |..|||||.|..|..|||||.||.|.|..|||
GGAAAUAAAGA---UAAAACAGCAGCUGUUACAGACAAAACAUAAU
1202
1203
32
40
UACAAGAAAGUAAGAUGAUUUUAGAUGAAGUGAAGAUGCACUUGCCUG-CAUUGGAAACAAA
|||||||. |.|.|.|||| |||....|||| |||| |||..|| |||||.|||.|||
UACAAGAG-GCAGGCUGAU----GAUCUCCUGAA-AUGC--UUGGAUGACAUUGAAAAAAAA
1204
1205
32
41
GCAUUGGAAACAAAGAGUGUGGAACAGGAAGUAGUAC--AGUCACAGCUAAAUCAUUGUGUG
|.||||.|.|..||||..|.|||.|.|.|.|.|||.| ||.|| ||||.|....||||.||
GAAUUGCAGAAGAAGAAAGAGGAGCUGAAUGCAGUGCGUAGGCA-AGCUGAGGGCUUGUCUG
1206
1207
32
42
AAGUAA-GAUGAUUUUAGAUGAAGUGAAGAUGCACUUGCCUGCAUUGGAAA
|||.|| ||||||..| |||||. |||||| |.||||| |||||||
AAGAAACGAUGAUGGU-GAUGAC-UGAAGA----CAUGCCU---UUGGAAA
1208
1209

32
44
GUUUCGAUUAUUCCAGAAACCAGCCAAUUUUGAGCAGCGUCUACAAGAAAGUAAGAUGAUUUUAGAU GAAGUGAAGAUGCACUUGCCUGC--AUUGGAAACA
||||..|||||...|.|||. |..|||.|.|||.|.|||..||||..| ||..|.|||....||| |||..||..|.||||. |||||.||||
GUUUUCAUUAUGAUAUAAAG-----AUAUUUAAUCAGUGGCUAACAGAAGCU--GAACAGUUUCUCAGAA----AGACACAAAUUCCUGAGAAUUGGGAACA
1210
1211
32
46
AUGAAGUUUCGAUUAUUCCAGA--AACCAGCCAAUUUUGAGCAGCGUCUACAAGAAA
||.|..||.|.|.|||.|||.. ||||.|..||. |||||||..|||.||||||
AUAACAUUGCUAGUAUCCCACUUGAACCUGGAAAA---GAGCAGCAACUAAAAGAAA
1212
1213
32
47
GAGCAGCGUCUACAAGAAAGUAAGAUGA
|||||...|..||..||||.||||.|.|
GAGCAAGAUAAACUUGAAAAUAAGCUCA
1214
1215
32
48
AGAAAGUAAGAUGAUUUUA-GAUGAAGUGAAGAUGCACUUGCCUGCAUUGGAAACAAAGAGUGUGGAACAGGAAGUAGUACAGUCACAGCUAAAUCAU
|||||..|.||..|.||.| |.|.||.|.|| |..|..|.|.|.|| |.||||.||||..||..||.|..|||| || |||.||||||||
AGAAACAAGGAGAAAUUGAAGCUCAAAUAAA-AGACCUUGGGCAGC--UUGAAAAAAAGCUUGAAGACCUUGAAG-AG--------CAGUUAAAUCAU
1216
1217
32
49
AGAAACCAGCCAAU
|.||||||||||.|
AAAAACCAGCCACU
1218
1219

32
51
UUGAGCAGCGUCUACAAGAAAGUAAGAUGAUUUUAGAUGAAGU-GAAGAU
||||.||...|.||.||..|...|.|.||||..|.|.|||..| ||.|||
UUGAUCAAGUUAUAAAAUCACAGAGGGUGAUGGUGGGUGACCUUGAGGAU
1220
1221
32
53
UGGAAACAAAG--AGU-GUGGAACAGGAAGUAGUACAGUC-ACAGCUAA
|||||.|.||| ||. |..||.||||...|||.||||.| |.|||.||
UGGAAGCUAAGGAAGAAGCUGAGCAGGUCUUAGGACAGGCCAGAGCCAA
1222
1223
32
55
CAGAAACCA--GCCAAUUUUGAGCAGCGU-CUACAAGAAAGUAAGAUGAUUUUAGAUGA
|.|||||.| ||||||.|....|||..| ||||..|.|||.|| |.|.|..||||.||
CUGAAACAACUGCCAAUGUCCUACAGGAUGCUACCCGUAAGGAA-AGGCUCCUAGAAGA
1224
1225
32
57
AGCCAAUUUUGAGCAGCG
|||||.||.|||.|||.|
AGCCAGUUCUGACCAGUG
1226
1227
32
59
GAUGAAGUGAAGAUGCACUUGCCUGCAUUGGAAACAAAGA
||..||.||||..||||||...|||..|.|.|.|.|||.|
GAAAAAUUGAACCUGCACUCCGCUGACUGGCAGAGAAAAA
1228
1229
32
60
AGAUGCACUUGCCUGCAUUGGAAACAAAGAGUGUGGAAC
||..|.|.|||| ||.|..||||.|.|..|||.|..||
AGGAGAAAUUGC--GCCUCUGAAAGAGAACGUGAGCCAC
1230
1231
33
34
ACUUGUAUAAAAGUCUGAGUGAAGUGAAGUCUGAAGUGG
|.|||.|..||.|.|| |||.|..||.|.||||||||.|
AGUUGAAGGAAUGCCU-AGUAAUUUGGAUUCUGAAGUUG
1232
1233

33
35
AAUCCCAAAGAACUUGAUGAAAGAGUAACAGCUUUGAAAUUGCAUUAUAAUGAGCUGGGAG
|.||..|||||..|||| ||||.||.|...||.....||..|.||.|.| |||.|.||||
ACUCAAAAAGAGAUUGA-GAAACAGAAGGUGCACCUGAAGAGUAUCACA--GAGGUAGGAG
1234
1235
33
38
AGCAGACGGAAAAUCCCAAAGA-----ACUUGAUGAAAGA
|||||..||..||||..||||| ||||.|..|||||
AGCAGGGGGUGAAUCUGAAAGAGGAAGACUUCAAUAAAGA
1236
1237
33
39
AACUUGUAUAAAAGUCUGAGUGAAGUGAAGUCUGAAGUGGAAAUGGUGAUAAAGACUGGACGUCAGAUUGUACAGAAAAAGCAGA
|||||..|..||||..|.|..||.|.||.......||.||||||...|||||| ||..|||.|..||||||.|||.||.|
AACUUACAACAAAGAAUCACAGAUGAGAGAAAGCGAGAGGAAAUAAAGAUAAA------ACAGCAGCUGUUACAGACAAAACAUA
1238
1239
33
40
GAAGUGAAGUCUGAA-GUGGAAAU--GGUGAUAAAGACUGGACGUCAGAUUGUA-CAGAAAAAG---CAGACGGAAAAUCCC---AAAGAACUUGAUGAAAGAGUAACA
||..|||.||||.|| |..||||. ||...||.|.|.|...|.|||| |.||| |||.|.||| |||.|.||..|||.| |||....|.|||||.|..|.||.|
GAUUUGAGGUCUCAAAGAAGAAAAAAGGCUCUAGAAAUUUCUCAUCAG-UGGUAUCAGUACAAGAGGCAGGCUGAUGAUCUCCUGAAAUGCUUGGAUGACAUUGAAAAA
1240
1241
33
41
UCAGAUU--GUACAGAAAAAGCAGACGGAAAAU
||||||. |..|||.||..||.|.|||.||||
UCAGAUCCAGCUCAGCAAGCGCUGGCGGGAAAU
1242
1243

33
42
UGAAGUGGAAAUGGUGAUAAAGACUGGA
|||||.....|||.||.|.|.|||||.|
UGAAGAAACGAUGAUGGUGAUGACUGAA
1244
1245
33
44
AAAGA-ACUUGAUGAAAGAGUAACAG
||||| |.||.||.|..|..||||||
AAAGAUAUUUAAUCAGUGGCUAACAG
1246
1247
33
46
AACUUGUAUAAAAGUCUGAGUGAAGUGAAG
||||...|.|||||..||||. ||||.|||
AACUAAAAGAAAAGCUUGAGC-AAGUCAAG
1248
1249
33
47
GGAAAAUCCCAAAGAACUUGAUGAAA---GAGUAACAGCU-UUGAAAUUGC
||.||.||.||||.||.|..|||||| |||.|.|.|.. |||.||.|||
GGGAAUUCUCAAACAAUUAAAUGAAACUGGAGGACCCGUGCUUGUAAGUGC
1250
1251
33
48
AAAAUCCCAAAGAACUUGAUGA
||||.|...||||.|||||.||
AAAAGCUUGAAGACCUUGAAGA
1252
1253
33
49
CUGAAGUGGAAAUGGUGAUAAAGACUGGACGUCAGA--UUGUACA--GAAAAAGCAGAC
|.||.|||||| |.|||...|.||..|.|.|||. ||||||| ||||||.|||.|
CGGAUGUGGAA---GAGAUUUUGUCUAAAGGGCAGCAUUUGUACAAGGAAAAACCAGCC
1254
1255
33
51
CAGACGGAAAAUCCCAAAGAACUUGAUGAAAGAG-UAACAGCUUUG--AAAUUGCA
||.||...||||.|||.....|||||||...||| ||.|.|||.|| |.|||.||
CAAACUAGAAAUGCCAUCUUCCUUGAUGUUGGAGGUACCUGCUCUGGCAGAUUUCA
1256
1257

33
53
AGAACUUGAUGAAAGAGU---AACAGCUUUGAAAU--UGCAUUAUAAUGAGCUGGGAGCAAAG
|||||..||.|.||.||| |..|..|.|.|||. |.||..|.|||| |||||.|||.|||
AGAACCGGAGGCAACAGUUGAAUGAAAUGUUAAAGGAUUCAACACAAUG-GCUGGAAGCUAAG
1258
1259
33
55
AAAGAACUUGAUGAAAGAGUAACA
|||||.|| |||||||.|.|..||
AAAGAGCU-GAUGAAACAAUGGCA
1260
1261
33
57
GAAGUGAAGUCUGA--AGUGGAA
||||..|..||||| |||||||
GAAGCCAGUUCUGACCAGUGGAA
1262
1263
33
59
AGUCUGAGUGAAGUGAAGUCUGAAGUGGAAAUGGUGAUAAAG-ACUGGACGUCAGAUUGU-ACAGAAAAAGC----AGACG---GAAAAUCCCAAAGAACUUGAUGA
||.||||| ||.||.||..||||...|||||...|||....| ||| |..|.||.||. |.|||||||.. ||||. ||||..|.|.|.||||||.|.||
AGGCUGAG-GAGGUCAAUACUGAGUGGGAAAAAUUGAACCUGCACU---CCGCUGACUGGCAGAGAAAAAUAGAUGAGACCCUUGAAAGACUCCAGGAACUUCAAGA
1264
1265
33
60
CAAAGAACUUGAU-GAAAGAGUAACAGCUUUGAAAUU
|||.||.||||.| |..||..||.||..||.|..|||
CAAUGACCUUGCUCGCCAGCUUACCACUUUGGGCAUU
1266
1267
34
35
GCUACAGAUAUGGA-AUUGACAAAGAGAUCA-GCAGUUGAAG
|||||..|.|..|| |||||.|||.|||... |||..|||||
GCUACUCAAAAAGAGAUUGAGAAACAGAAGGUGCACCUGAAG
1268
1269

34
36
GAAAGGAAAUGAAUGUCUUGAC-AGAAUG
||||...|..|||..|.||||| ||||||
GAAACACAUGGAAACUUUUGACCAGAAUG
1270
1271
34
37
GAAAUGAAUGUCUUGACAGAAUGGCUGGCAGCUACA
|||.||||||.|.|......|..|.|||...|||||
GAACUGAAUGACAUACGCCCAAAGGUGGACUCUACA
1272
1273
34
38
AGAAAUGCUUGAA--AUUGUCCCGUAAGAUGCGAAAGGAAAUGAAUGUCUUGACAGAAUGGCUGGCAGCUACAGAUAUG
|.||.|||||||| |.||.....|.|.||.|...|||...|||||.|... |.||.|.|.||...| ||.|||||||
AAAAUUGCUUGAACCACUGGAGGCUGAAAUUCAGCAGGGGGUGAAUCUGAA-AGAGGAAGACUUCAA--UAAAGAUAUG
1274
1275
34
39
AAGGAAAUGAAUGUCUUG-ACAGAAUGGCUGGCAGCUACAGAUAUGGAAUUGACAAAGAGAUCAGCAGUUGAAGGAAUGC
|||..|||||..||..|| |.|..|....|.|||...|..............||||||| |||| |||.|||..|||.||
AAGACAAUGAGGGUACUGUAAAAGAAUUGUUGCAAAGAGGAGACAACUUACAACAAAGA-AUCA-CAGAUGAGAGAAAGC
1276
1277
34
41
GAUAUGGAAUUGACAAAGAG--AUCAGCAGUUGAAGGAA-UGCCUAG
|||..|||||||...||||. |..||.||.||||.|.| |||.|||
GAUCGGGAAUUGCAGAAGAAGAAAGAGGAGCUGAAUGCAGUGCGUAG
1278
1279
34
42
AAAUUGUCCCGUAAGAUGCGA--AAGGAAAUGAAUG
|.|.|||||...||||..||| |.||..||||.||
ACACUGUCCGUGAAGAAACGAUGAUGGUGAUGACUG
1280
1281
34
44
AGAAAUGCUUGA-AAUUGUCCCGUAAGAUGCGAAAGGAAAUGAAUGUCUUGA
|.||||.|.||| ||||| |.||.||||.|||...||....|.||||.|
ACAAAUUCCUGAGAAUUG----GGAACAUGCUAAAUACAAAUGGUAUCUUAA
1282
1283

34
46
AAAUGAAUGUCUUGACAGAAU
|||.||||.|||||.||||||
AAAAGAAUAUCUUGUCAGAAU
1284
1285
34
47
AAAGCAACAGUUGGAGAAAUGCUUGAAAUUG-UCCCGUAAGAUGCGAAAGGAAAUGAAUGUCUUGACAGAAUGG-CUGGCAGCUACAGAUAUGGAAUUGACAAAG
||.|.|||.|..|||....||||||.||.|| ||||.||||....|||..|.|| ||....|||||.|..|.|. |..|||| |||.||.|....|.||.||||
AAUGAAACUGGAGGACCCGUGCUUGUAAGUGCUCCCAUAAGCCCAGAAGAGCAA-GAUAAACUUGAAAAUAAGCUCAAGCAG--ACAAAUCUCCAGUGGAUAAAG
1286
1287
34
48
UUGGAGAAAUGCUUGAA
|||.|.|||.|||||||
UUGAAAAAAAGCUUGAA
1288
1289
34
49
CAGAUAUGGAA------UUGACAAAGAGAUCAGCAGUUG---AAGGAAUGCCUAGUAAUUUGGAUUCUGAAG
|.|||.||||| |||.|.|| ||..|||||.||| ||||||...|.||..|.|..|....|||||
CGGAUGUGGAAGAGAUUUUGUCUAA-AGGGCAGCAUUUGUACAAGGAAAAACCAGCCACUCAGCCAGUGAAG
1290
1291
34
51
AGGAAUGCCUAGUAAUUUGGAUUCUGAAGUUGCCUG
||.||||||...|...||| ||..||.||.|.||||
AGAAAUGCCAUCUUCCUUG-AUGUUGGAGGUACCUG
1292
1293

34
53
GAAAGAA---AGCAACAGUUGGA-GAAAUGCUUGAAAUUGUCCCGUAA--GAUGCGAAAG------GAAAUG---AAUGUCUUGACAGAAUGGCUGGCAGCUACAGA
||||||| ||.|.||||.||| |||.|.|..|||....|.|.|.|. ||.||.|.|| |||||| ||.|..|..|||.|||||||||.|||||..||
GAAAGAAUUCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAUGUUAAAGGAUUCAACACAAUGGCUGGAAGCUAAGGA
1294
1295
34
55
ACAGUUGGAGAAAUGCUUGAAAUUGUCCCGUAAGAUGCGAAAGGAAAUGAAUGUCU
||||..|..||||....||..|.|||||...|.|||||.|...|.||.|||.|.||
ACAGAAGCUGAAACAACUGCCAAUGUCCUACAGGAUGCUACCCGUAAGGAAAGGCU
1296
1297
34
57
GGCUGGCAGCUACAGAUAUGGAAUUGACAAAGAGAUCAGCAGUUGAAGGA
|||.||||.|||..|.....||.||..||.. ||.||||.||..|||.||
GGCAGGCACCUAUUGGAGGCGACUUUCCAGC-AGUUCAGAAGCAGAACGA
1298
1299
34
59
UGGAAUUGACAAAGAGAUCAG-CAGUUGAAGGAAUGCCUAGUAAUUU
|||.|..||.|||.||||.|| |..|||||.||.| |.||.||.||
UGGCAGAGAAAAAUAGAUGAGACCCUUGAAAGACU--CCAGGAACUU
1300
1301
34
60
AGUAAUUUGGAUUCUGAA
||.||||..|..||||||
AGAAAUUGCGCCUCUGAA
1302
1303
35
36
GCAAGAAGGAGACGU
||||.|||.||||||
GCAAAAAGAAGACGU
1304
1305

35
37
UGGGCAAGAAGGAGACGUUGGUGGAAGA
||..||||.||.|.|| |||.|||.|.|
UGACCAAGCAGCAAAC-UUGAUGGCAAA
1306
1307
35
38
GCUACUCAAAAAGAGAUUGAGAAACAGAAGG-UGCACCUGA--AGAGUAUCACAGAGGUAGGAGAGGCCUUGAAAACAGUUUUG
|.||..||||||..|.||||...||.|.||| ||.|..|.| ||.|.||.|....|..||..||.|.|||.||.|.||.|.||
GAUAUACAAAAAUUGCUUGAACCACUGGAGGCUGAAAUUCAGCAGGGGGUGAAUCUGAAAGAGGAAGACUUCAAUAAAGAUAUG
1308
1309
35
39
GCUACUCAAAAAGAGAUUGAGAAACAGAAGGUGCACCUGA----AGAGUAUCACAGAGGUAGGAGAG
|.||||..|||||| ||||....|.|||.|...||.||.| |.||.||||||||.|...||.||
GGUACUGUAAAAGA-AUUGUUGCAAAGAGGAGACAACUUACAACAAAGAAUCACAGAUGAGAGAAAG
1310
1311
35
40
CUCAAA-AAGAGAUUGAGAAACAGAAGGUGCACCUGAAGAGUAUCACAGAGGUAGGAGAGGC
|||||| ||||.|....|....||||..|.|.|.|.|...|||||| |||..||||||
CUCAAAGAAGAAAAAAGGCUCUAGAAAUUUCUCAUCAGUGGUAUCA-----GUACAAGAGGC
1312
1313
35
41
GAGUAUCACAGAGGUAGGA-GAGGCCUUGAAAACAGUUU-UGGGCAAGAAGGAGACGUUGGUGGAAGAU
|.|.||..||||.|.||.| ||||...||||..||||.. |.||||||..| ||...|||...||.|||
GGGAAUUGCAGAAGAAGAAAGAGGAGCUGAAUGCAGUGCGUAGGCAAGCUG-AGGGCUUGUCUGAGGAU
1314
1315
35
42
GGCCUUGAAAACAGUUUUGGGCAAGAAGGAGACGUUG
|.|.|||||.|....|||..|||||| ||||.|..||
GACUUUGAAGAUCUCUUUAAGCAAGA-GGAGUCUCUG
1316
1317

35
44
AAAAAGAGAUUGAGAAACAGAAGGU----GCACCUGAAGAGUAUCACAGA
|.|||||.|||. ||.|||..|.| |.|.|||||.|||.||.||||
AUAAAGAUAUUU--AAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGA
1318
1319
35
46
GCUACUCAAA-AAGAGAUUGAGAAACAGAAG
||.|||.||| ||.||.|||||.||...|||
GCAACUAAAAGAAAAGCUUGAGCAAGUCAAG
1320
1321
35
47
UGGAAGAUAAACUCAGUCUUCUGAAUAGUAACUGGAUA
|.|||.||||.||||..|.....|||....|.||||||
UUGAAAAUAAGCUCAAGCAGACAAAUCUCCAGUGGAUA
1322
1323
35
48
UGAGAAACAGAAGGUGCACCUGAAGAGUA--UCACAGAGGUAGGAGAGGCCUUGAAAACAGUUUUG
|||||||| ||||.|.|..|||||...| |.|.|||..|.||..|| ||||||||.|...|||
UGAGAAAC--AAGGAGAAAUUGAAGCUCAAAUAAAAGACCUUGGGCAG--CUUGAAAAAAAGCUUG
1324
1325
35
49
AACAGUUUUGGGCAAGAAGGAGACGUUGGUGGAAGAUAAACUCAGUC
||.||.|||.|.|.|.|.||...|.||.||..|||..|||..|||.|
AAGAGAUUUUGUCUAAAGGGCAGCAUUUGUACAAGGAAAAACCAGCC
1326
1327
35
51
AAAAAGAGAUUGAGAAACAGAAGGUGCACCUGAAGAGUAUCACAGAGGU
||||..|.|..|.|..|..|..||||..|.|||.|| |||||..|||.|
AAAAUCACAGAGGGUGAUGGUGGGUGACCUUGAGGA-UAUCAACGAGAU
1328
1329
35
53
AAACAGAAGGUGCA--CCUGAAGAGUAUCACAGA
|.||||.||.|||| ||..||||..||||||||
AUACAGUAGAUGCAAUCCAAAAGAAAAUCACAGA
1330
1331

35
55
AAAAGAGAUUGAGAAACA
|||||||.|...||||||
AAAAGAGCUGAUGAAACA
1332
1333
35
57
UAGGAGAGGCCUUGAAAACAGUUUUGGGCAAGAAGGA
|.||||..|.|||...|.|||||..|....||||.||
UUGGAGGCGACUUUCCAGCAGUUCAGAAGCAGAACGA
1334
1335
35
59
UCAAAAA-GAGAUUGAGAAACAGAAGGUGCAC-CUGAAGAGUAUCACAGAGG--UAGGAGAGGCC-UUGAAA
||||.|. |||...||.|||..|||..||||| |.|..||.|..||.|||.. |||..|||.|| ||||||
UCAAUACUGAGUGGGAAAAAUUGAACCUGCACUCCGCUGACUGGCAGAGAAAAAUAGAUGAGACCCUUGAAA
1336
1337
35
60
UCAAAAAGAGAUUGAGAAACAGAAGGUGCACCUGA
||.|..|||.||||.|...|.|||.|.|.||.|||
UCGAGGAGAAAUUGCGCCUCUGAAAGAGAACGUGA
1338
1339
36
37
ACUUUUGACCAGAAUGUGGAC----CACAUCACAAAG
||.|..|.||| ||.|||||| |||.|.||.|||
ACAUACGCCCA-AAGGUGGACUCUACACGUGACCAAG
1340
1341
36
38
AGGCUGACA--CACUUUUGGAUGAAUCAGAGAAAAAGAAACCCCAGCAAAAAGAAG
|||||||.| ||.....||.||||||.||.|.|...|.||..||..|||.|.|.|
AGGCUGAAAUUCAGCAGGGGGUGAAUCUGAAAGAGGAAGACUUCAAUAAAGAUAUG
1342
1343
36
39
AUGAAUCAGAGAAAA-AGAAACCCCAGCAAAAAGAAGA
|.||||||.|||..| |||||.|......|||..||||
AAGAAUCACAGAUGAGAGAAAGCGAGAGGAAAUAAAGA
1344
1345

36
40
UUGGAUGAAUCAGAGAAAAAGAA
|||||||| ||..||||||.||
UUGGAUGA--CAUUGAAAAAAAA
1346
1347
36
41
GAAUCAGAGAAAAAGAAACCCCAGCAAAAAGAAG
||||...||||.||||||....|||..||.|.||
GAAUUGCAGAAGAAGAAAGAGGAGCUGAAUGCAG
1348
1349
36
42
AGAAUGUGGACCACAUCACAAAG
||||...|.||.||.||.|||.|
AGAAGUGGAACAACUUCUCAAUG
1350
1351
36
44
AGUGGAUCAUUCAGGCUGACACACUUUUGGAUGAAUCAGAGAAAAAGAAACCCCAGCAAAAAGAAGACGUGCUUAA
|||||.|.|...|.||||| |||.|||. |||||.|.|.|.|||..||.|..||..|...||.||||.||
AGUGGCUAACAGAAGCUGA-ACAGUUUC-------UCAGAAAGACACAAAUUCCUGAGAAUUGGGAACAUGCUAAA
1352
1353
36
46
AAACCCCAGCAAAAAGAAGACGUGCUUAAG
|||...||||||..|.||||...||||.||
AAAGAGCAGCAACUAAAAGAAAAGCUUGAG
1354
1355
36
47
AAAAGAAACCCCAGCAAAAAGA
||||.||.|.|.||||.|.|.|
AAAAUAAGCUCAAGCAGACAAA
1356
1357
36
48
GAAACACAUGGAAACUUUUGACCA
|||.||..||||||.||.|.||||
GAAUCAGUUGGAAAUUUAUAACCA
1358
1359

36
49
AAAAAGAAACCCCAGCAA
|.||.||||..|||||.|
ACAAGGAAAAACCAGCCA
1360
1361
36
51
UGGACCACAUCACAAAGUGGAUCAUUCAGGCUGA
|.||..|.||||...||..|||||| ||.||.||
UUGAGGAUAUCAACGAGAUGAUCAU-CAAGCAGA
1362
1363
36
53
CAGAAACACAUGGAAACUUUUGACCAGAAUGU
|||||.|..| ||.|||..||||....|||||
CAGAACCGGA-GGCAACAGUUGAAUGAAAUGU
1364
1365
36
55
CAGAAUGUGGACCACAUCACAAAGUGGAUCAUUCAGGCUGACACACUUUUGGA
|||||..||.|.||..|..|||.|| |.|.||||.||..||.|.|..|||
CAGAAGCUGAAACAACUGCCAAUGU----CCUACAGGAUGCUACCCGUAAGGA
1366
1367
36
57
UGUGGACCACAUCACAAAGUGGAUCAUUCAGGCUGACA--CACUU-UUGGAUG
||||| |.|||.|..||||..|||.|.|.|.||.|.|| |||.| |||||.|
UGUGG-CUACAGCUGAAAGAUGAUGAAUUAAGCCGGCAGGCACCUAUUGGAGG
1368
1369
36
59
ACCAGAAUGUGGACCACAUCACAAAGUGG--AUCAUUCAGGCUGACACACUUUUGGAUGAAUCAGAGAAAAAGAAA
|.|||..||.|||...||..||..||||| |..|||.|..||| |||.|...||..|| .||||||||||.|.|
AGCAGGCUGAGGAGGUCAAUACUGAGUGGGAAAAAUUGAACCUG-CACUCCGCUGACUG--GCAGAGAAAAAUAGA
1370
1371
36
60
GAAUACCAGAAA--CACAUGGAAACUUUUG
|||.|||.|||. ||.||||||.|||.||
GAAGACCUGAACACCAGAUGGAAGCUUCUG
1372
1373

37
38
GAUUUGCAGCCAUUUCACACAGAAUUA
||.|||.|||..|||.||.||||..||
GAAUUGGAGCAGUUUAACUCAGAUAUA
1374
1375
37
39
UUAAAGGCAGAACUGAAUG
|||.||.||.|||..||||
UUACAGACAAAACAUAAUG
1376
1377
37
40
AAAUUAGUAGAGCC--CCAAAUCUCAGAGCUCAA
|||||||.. |||| ||..|.|.|||||.|.||
AAAUUAGCC-AGCCUACCUGAGCCCAGAGAUGAA
1378
1379
37
41
AGUAGAGCCCCAAAUCUCAGA----GCUCAACCAUCGAUUUGCAGCCAUUUCACACAGAAUU
|||.||||| |.|||||| |||||.|.|.||.|. ||.|..|.||.|.|...||||
AGUGGAGCC----AACUCAGAUCCAGCUCAGCAAGCGCUG-GCGGGAAAUUGAGAGCAAAUU
1380
1381
37
42
AUUAGUAGAGCCCCAAAU-CUCAGAGCUC
|||||.||.|...|||.| ||||..||||
AUUAGAAGUGGAACAACUUCUCAAUGCUC
1382
1383
37
44
AGAGCCCCAAAUCUCAGAG
|.||.|.|||||..|.|||
AAAGACACAAAUUCCUGAG
1384
1385
37
46
AGAGCUCAACCAUCGAUUUGCAGCCAUUUCACACAGAAUUAA
|||.|..||..||...||..|||. ||||||.|.|||.||||
AGAACAAAAGAAUAUCUUGUCAGA-AUUUCAAAGAGAUUUAA
1386
1387

37
47
CAUACGCCCAAAGGUGGACUCUACACGUGA
||||.|||||.|.|.|.|...||.||.|||
CAUAAGCCCAGAAGAGCAAGAUAAACUUGA
1388
1389
37
48
UUUGCAGCCAUUUCACACAGAAUUAAG
|||.|||...|||..|..||||..|||
UUUCCAGAGCUUUACCUGAGAAACAAG
1390
1391
37
49
GCAGCCAUUUCACACAGAA
|||||..||..|||..|||
GCAGCAUUUGUACAAGGAA
1392
1393
37
53
AAAUCUCAGAGCUCAA
|||||.||||...|||
AAAUCACAGAAACCAA
1394
1395
37
55
CAAGCAGCAAACUUGAUGGCAAACCGCGGUGACCACUGCAGGAAAUUAGUAGAGC
||.|..||.|.|...|.||.||..|.|...||..|||.||.|..|.||..|||||
CAGGAUGCUACCCGUAAGGAAAGGCUCCUAGAAGACUCCAAGGGAGUAAAAGAGC
1396
1397
37
57
GUUUAAAGGCAGAACUGAAUGACAUACG
|||.|.|.||||||| ||...|||||.|
GUUCAGAAGCAGAAC-GAUGUACAUAGG
1398
1399
37
59
GCAAACUUGAUGGCAAACCGCGGUGACCACUGCAGGAAAUUAGUAGAGCCCC
|.|||.||||......||..||.||||......||.|||.|||..|||.|||
GAAAAAUUGAACCUGCACUCCGCUGACUGGCAGAGAAAAAUAGAUGAGACCC
1400
1401

37
60
ACGUGA-CCAAG-CAGCAAACUUGAUGGCAAACCGCGGUGACCACUGCAGGAAAUUAG-UAGAGCCCCA-AAUCUCAGAGCUC
|||||| |||.| ||...|.||||.|.||.| |.|.||||||...||.|.|.|| |....||..| ||.|||||..|||
ACGUGAGCCACGUCAAUGACCUUGCUCGCCA-----GCUUACCACUUUGGGCAUUCAGCUCUCACCGUAUAACCUCAGCACUC
1402
1403
38
39
UAUACAAAAAUUGCUUGAACCACUGGAGGCUGAAAUU-CAGCAGGGGGUGA---AUCUGAAAGAGGAAGACUUCAAUAAAGAUA
|.||.||.|||||.|..||..| ||||.| ||.|| ||.||..|..|.| ||..||.|.||..|||... ||||||||||
UGUAAAAGAAUUGUUGCAAAGA--GGAGAC--AACUUACAACAAAGAAUCACAGAUGAGAGAAAGCGAGAGGA-AAUAAAGAUA
1404
1406
38
40
AGGCU---GAAAUUCAGCAGGGGGUGAAUCUGAA--AGAGGAAGACU
||||| ||||||...||...|..|.|||.|.| |||||.||.||
AGGCUCUAGAAAUUUCUCAUCAGUGGUAUCAGUACAAGAGGCAGGCU
1407
1408
38
41
AAUUGGAGCAGUUUA----ACUCAGAUAUACAAAAAUU
||||.|..||||||. |||||..|.|.||.|||||
AAUUUGCUCAGUUUCGAAGACUCAACUUUGCACAAAUU
1409
1410
38
42
UUCAGCAGGGGGUGAAUCUGAA
||.||||.|.||.|..||||||
UUAAGCAAGAGGAGUCUCUGAA
1411
1412

38
44
GAAUUGGAGCAGUUUAACUCAGAUAUACAAAAAUUGCU
|||...||.|||||| ||||||.|.|||.|||||.||
GAAGCUGAACAGUUU--CUCAGAAAGACACAAAUUCCU
1413
1414
38
46
AAAAUUGCUUGAA--CCACUGGAGGCUGAAAUUCAGCAG
||.||||||.|.| |||||.||..|||.||...|||||
AACAUUGCUAGUAUCCCACUUGAACCUGGAAAAGAGCAG
1415
1416
38
47
AAAAAUUGCUUGAACCACUGGAGG
||.||||...|||| ||||||||
AACAAUUAAAUGAA--ACUGGAGG
1417
1418
38
48
UUGAAGGAAUUG--GAGCAGUUUAA
||||||...||| ||||||||.||
UUGAAGACCUUGAAGAGCAGUUAAA
1419
1420
38
49
GAAUCUGAAAGAGGA
|||.||||||.||.|
GAAACUGAAAUAGCA
1421
1422
38
51
AAAUUCAGCAGGGGGUGA
|||.||| |||.||||||
AAAAUCA-CAGAGGGUGA
1423
1424
38
53
UUGAAGGAAUU--GGAGCAGUUUAACUCAGAUAUACAAAAAUUGCUUGAACCACUGGAGGC
|||||.||||| |.|.||||...|. ||..|||||.||...|||.|.. ||.||||||
UUGAAAGAAUUCAGAAUCAGUGGGAU---GAAGUACAAGAACACCUUCAGA-ACCGGAGGC
1425
1426

38
55
AUUGGAGCAGUUUAACUCAGAUAUACAAAAAUUGCUUGAACCACUG---GAGGCUGAAA
|.||.|.|||||...|...||..|..||||.||.||||.....||. ||.|||||||
ACUGCAACAGUUCCCCCUGGACCUGGAAAAGUUUCUUGCCUGGCUUACAGAAGCUGAAA
1427
1428
38
57
GAAAUUCAGCAGGGGGUGAAUCUGAAAGAGGAAGACUUCA
|||.|||.|..|.||.|..|.||||||||.||.||.||.|
GAACUUCUGGUGUGGCUACAGCUGAAAGAUGAUGAAUUAA
1429
1430
38
59
AGGGGGUGAAU-CUGAAAGAGGAAGACUUCAA
|||.|||.||| ||||..| ||||.|.||.||
AGGAGGUCAAUACUGAGUG-GGAAAAAUUGAA
1431
1432
38
60
UCUGAAAGAGGAAG
||||||||||.|.|
UCUGAAAGAGAACG
1433
1434
39
40
GAGAGGAAAUAAAGAUAAA
||||.||||..||.|||||
GAGAUGAAAGGAAAAUAAA
1435
1436
39
41
AGAGGAGACAACUUACAACAA----AG-AAUCACAGAUGAGAGAAAGCGAGAGGAAAU
||.||||.|||||.|.|.|.| || ||.|.|.| |.|.||||..|||||.||||
AGUGGAGCCAACUCAGAUCCAGCUCAGCAAGCGCUG--GCGGGAAAUUGAGAGCAAAU
1437
1438
39
44
AGGAAAUAAAGAUAAAACAGCAGCUGUUA-CAGA
|.||.|||||||||....|.|||..|.|| ||||
AUGAUAUAAAGAUAUUUAAUCAGUGGCUAACAGA
1439
1440

39
46
AACUUACAACAAAGAAUCACAGAUGAGAGAAAGCGAGAGGAAAUAAAG
|||.|..||.|.||.|.||...|..||| |||||..|||.||.|.|||
AACCUGGAAAAGAGCAGCAACUAAAAGA-AAAGCUUGAGCAAGUCAAG
1441
1442
39
47
AGGGUACUGUAAAAGAAUUGUUGCAAAGAGGAGACAACUUACAACAAAGAA-UCACAGAUGAGAGAAAGCGAGAGGAAAUAAAGAUAAAACAGCAGCUGUUACAGACAAAAC
||||.|.|.|.|||.||||.....||||.||||....|.|.|....|||.. ||.||.|.|.....|||.|..|| |||||..|.||| |..||||....||||||||.|
AGGGAAUUCUCAAACAAUUAAAUGAAACUGGAGGACCCGUGCUUGUAAGUGCUCCCAUAAGCCCAGAAGAGCAAG---AUAAACUUGAAA-AUAAGCUCAAGCAGACAAAUC
1443
1444
39
48
GAGAAAGCGAGAGGAAAUAAAGAUAAAACAGCAG
||||||....|||.||.|.|||.|.|||.|..||
GAGAAACAAGGAGAAAUUGAAGCUCAAAUAAAAG
1445
1446
39
49
UGUAAAAGAAUUGUUGCAAAGAGGAGACAACUUACAACAAAGAAUCA
||.||.|||.||..|..||||.|.||......|||||..||.||.||
UGGAAGAGAUUUUGUCUAAAGGGCAGCAUUUGUACAAGGAAAAACCA
1447
1448
39
51
AAAGAAUCACAGAUGAGAGAAAGCGAGAGGAAAUAAAGAUA
|.|.|||||||||.| |.||..|.|.|.|....|.|.||||
AUAAAAUCACAGAGG-GUGAUGGUGGGUGACCUUGAGGAUA
1449
1450

39
53
AAUGAAGA--CAAUGAGGGUACUGUAAAAGAAUUGUUGCA-AAGAGGAGACAAC-- UUACAACAAAGAAUCACAGAUGAGAGAAAGCGAGAGGAAA-UAAAGAUAAAAC--AGCAGCUGUUA
|||..||| ||.|| ||.|...|||.|||||....|.|| ||..||||.|||| ||..|..|||...|.|..|||...|.|.|..|...||||. |||.||..||.| |||||.|.|||
AAUUCAGAAUCAGUG- GGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAUGUUAAAGGAUUCAACACAAUGGCUGGAAG CUAAGGAAGAAGCUGAGCAGGUCUUA
1451
1452
39
55
GAAGACAAUGAGGGUACUGUAAAAGAAUUGUUGCAA
||||||....||||. ||||||||..||.||.||
GAAGACUCCAAGGGA---GUAAAAGAGCUGAUGAAA
1453
1454
39
57
GUUACAGACAAAACAUAAUG
|.|||||...|||.||.|||
GCUACAGCUGAAAGAUGAUG
1455
1456
39
59
CAAAGAAUCACAGAUGAGA
||.||||..|.||||||||
CAGAGAAAAAUAGAUGAGA
1457
1458
39
60
UGAGAGAAAGCGAGAG
|||.|||.|.||.|||
UGAAAGAGAACGUGAG
1459
1460
40
41
AUCUCCUGAAAUGCUUGGAUGACAUUGAAAAAAAAUUAGC
|.|||...||..|||.|...||.|||||.|..|||||.||
AGCUCAGCAAGCGCUGGCGGGAAAUUGAGAGCAAAUUUGC
1461
1462

40
42
AAAAAAGGCUCUAGAAAUUUCUCAU
|.|.|.|.||.|.|||||||||.||
AGACAUGCCUUUGGAAAUUUCUUAU
1463
1464
40
44
AGGCUCUAGAAAUUUCUCAUCAGUGG-UAUCAGUA
|.|.|.||.|.||.|.|.|||||||| ||.|||.|
AUGAUAUAAAGAUAUUUAAUCAGUGGCUAACAGAA
1465
1466
40
46
AUGAUCUCCUGAAAUGCUUGGAUGACAUUGAAAAAAAAUUAGCCAG---
CCUACCUGAGCCCAGAGAUGAAAGGAAAAUAAA
||||..|..|...|||.|||||.||. |.|.|.||..|.||.|| ||.||.|||.||..||.|.||...|.||.||||
AUGAAUUUGUUUUAUGGUUGGAGGAA--- GCAGAUAACAUUGCUAGUAUCCCACUUGAACCUGGAAAAGAGCAGCAACUAAA
1467
1468
40
47
AAAGAAGAAAAAAGGCUCUAGAA-AUUUCUCAUCAGUGG
|||...|||||.|.||||.||.| |....||..||||||
AAACUUGAAAAUAAGCUCAAGCAGACAAAUCUCCAGUGG
1469
1470
40
48
AAAUGCUUGGAUGACAUUGAAAAAAAAUUA
|||.|||||.| |||.|||||.|..|.|||
AAAAGCUUGAA-GACCUUGAAGAGCAGUUA
1471
1472
40
49
UUGAAAAAAAAUUAGCCAGCCUACCUGAGCCCAGAGAUG
|||.|.||..|..|.||||||. ||.|||| ||.||.|
UUGUACAAGGAAAAACCAGCCA--CUCAGCC-AGUGAAG
1473
1474

40
51
UGGAUGACAUUGA
|||.||||.||||
UGGGUGACCUUGA
1475
1476
40
53
AAUUUCUCAUCAGUGGUAUCA-GUACAAGAGGCAGGCUGAUGAUCUCCUGAAAUGCUUGGAUGACAUUGAAAA
||||....||||||||.||.| ||||||||. ||...|.|..|.|....|.||...|||.||||.||...|||
AAUUCAGAAUCAGUGGGAUGAAGUACAAGAA-CACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAUGUUAAA
1477
1478
40
55
UUGAGGUCUCAAAGA-AGAAAAAAGGCUCUAGAAA
|.||.|.|||.|||. ||.||||..|||...||||
UAGAAGACUCCAAGGGAGUAAAAGAGCUGAUGAAA
1479
1480
40
57
AGAAAUUUCUCAUCAGUGGUAUC
||..|.||||.|.||||||.|.|
AGCCAGUUCUGACCAGUGGAAGC
1481
1482
40
59
AAGAAAAAAGGCUCUAGAAAUUUCUCAUCAGUGGUAUCAGUACAAGAGGCAGGCUGAUGAUCUCCUGAAAUGCUUGGAUG ACAUUGAAAAAAAAUUAGCCAGC--//
|.||||...||||...||..|...|..|.|||||.|..|.|..||...|||..|.|.|||....|.||.|....|.|||||.|......|||.|.| ||||.
ACGAAAGCAGGCUGAGGAGGUCAAUACUGAGUGGGAAAAAUUGAACCUGCACUCCGCUGACUGGCAGAGAAAAAUAGAUG AGACCCUUGAAAGACU--CCAGGAA//
//CUACCUGAGCCCAGAGAUGAAAGGAAAAUAAAG
||.|..|||.|||..|||||...|.|..|.|||
//CUUCAAGAGGCCACGGAUGAGCUGGACCUCAAG
1483
1484

40
60
AGAAAUUUCUCAUCAGUGGUAUCAGUACAAGAGGCAGGCUGAUGAUCU
|||||||.|.|.||. |.|..||.||..|||.||.|...||||.||
AGAAAUUGCGCCUCU---GAAAGAGAACGUGAGCCACGUCAAUGACCU
1485
1486
41
42
AAGAAAGAGGAG---CUGAA
|||.|||||||| |||||
AAGCAAGAGGAGUCUCUGAA
1487
1488
41
44
AAUUUGCUCAGUUUCG----AAGACUCAACUU
||..||..|||||||. |||||.|||.||
AAGCUGAACAGUUUCUCAGAAAGACACAAAUU
1489
1490
41
46
GAAGAAAG-AGGAGCUGAAUGCAGUGCGUAGGCAAG
|||.|.|| ||.|.||.||.|.|..||.|..|||||
GAAAAGAGCAGCAACUAAAAGAAAAGCUUGAGCAAG
1491
1492
41
47
GGGAAUUGCAGAAGAAGAAAGAGGAGCUGAAUG--CAGUGCGU
|||||||....||.||..||..|.|.|||.|.| |.||||.|
GGGAAUUCUCAAACAAUUAAAUGAAACUGGAGGACCCGUGCUU
1493
1494
41
48
AGAAGAAGAAAGAGGAGCUGAA
|.|||.|||||..|.||||.||
ACAAGGAGAAAUUGAAGCUCAA
1495
1496
41
49
CAGAUCCAGCUCAGCAAGCGCUGGCGGGAAA
|||.||.||||.|.|||.||...|.||.|.|
CAGUUCAAGCUAAACAACCGGAUGUGGAAGA
1497
1498

41
53
AAUUGCAG-AAG--AAGAAAGAGGAGCUGAAUGCAGUGCGUAGGCAAG--CUGAGG---GCUUGUCUGA-GGAUGG-- GGCCGCAAUGGCAGUGGAGCCAACUCAGA
|||.||.| ||| |||.|||| |||||| ||||..|.||||..|| |.|||. |||||..|.| |||.|| ||.|.|.||. ||||.||..|||..||.|
AAUGGCUGGAAGCUAAGGAAGA--AGCUGA-- GCAGGUCUUAGGACAGGCCAGAGCCAAGCUUGAGUCAUGGAAGGAGGGUCCCUAUA-CAGUAGAUGCAAUCCAAA
1499
1500
41
55
UUGCAGAAGAAGAAAGA
||.||||||..||||.|
UUACAGAAGCUGAAACA
1501
1502
41
57
UCGGGAAUUGCAGAAGAAGAAAGAGGAGCUGAAUGCAGUGCGUAGGCA
||.||..|.||...||..||||||.|| |||||..||...|.|||||
UCUGGUGUGGCUACAGCUGAAAGAUGA--UGAAUUAAGCCGGCAGGCA
1503
1504
41
59
CGGGAAUUGCAGAAGAAGAAAGAGGAGCUGAAUGCAGUGCGUAGGCAAGCUGAGG
|.||||.|.||..||...|..||.||||||.|......||...|.||||||||||
CAGGAACUUCAAGAGGCCACGGAUGAGCUGGACCUCAAGCUGCGCCAAGCUGAGG
1505
1506
41
60
GAGCCAACUCA--GAUCCAGCUCAGCAAGC
||||||..||| ||.|..|||| ||.|||
GAGCCACGUCAAUGACCUUGCUC-GCCAGC
1507
1508
42
44
CUAUUAGAAGUGGAACAACUUCUCA
|||..|||||..|||||..||||||
CUAACAGAAGCUGAACAGUUUCUCA
1509
1510

42
46
UGAAAUCACUCAUGUCUCACAAGCCCUAUUAGAAGUGGAACAACU
|.|.||..||..|.||.|||..|..|....|.|||.|.|.|||||
UAACAUUGCUAGUAUCCCACUUGAACCUGGAAAAGAGCAGCAACU
1511
1512
42
47
UCUCACAAGCCCUAUUAGAAGUGGAACAACUUCUCAAU
||.||.|||||| |..|||....||..|||||...|||
UCCCAUAAGCCC-AGAAGAGCAAGAUAAACUUGAAAAU
1513
1514
42
48
UAAGGACUUUGAAGAUCUCUUUAAGCA
|.|.|||.|||||||.|..||.||.||
UGAAGACCUUGAAGAGCAGUUAAAUCA
1515
1516
42
49
CACACUGUCCGUGAAG
|||.|.|.|.||||||
CACUCAGCCAGUGAAG
1517
1518
42
51
AGAAACGAUGAUGGUGA-UGAC--UGAAGACAU
|.|.|.|.||||||||. |||| |||.||.||
ACAGAGGGUGAUGGUGGGUGACCUUGAGGAUAU
1519
1520
42
53
CACACUGUCCGUGAAGAAACGAUGAUGGUGAUGA---CUGAAGACAUGCC
||||.||.|.|..|...||.||.||.|.|||..| ||.|.||||.|||
CACAAUGGCUGGAAGCUAAGGAAGAAGCUGAGCAGGUCUUAGGACAGGCC
1521
1522
42
55
AGAAG-UGGAACAACUUCUCAAUGCUCCU
||||| ||.|||||||.| ||||| ||||
AGAAGCUGAAACAACUGC-CAAUG-UCCU
1523
1524

42
57
GAAAUUUCUUAUGUGCCUUCUACUUA
|.||.||||..||||.||.|..||.|
GGAACUUCUGGUGUGGCUACAGCUGA
1525
1526
42
59
ACUGUCCGUGAAGAAACGAUGA
||||.|.|.|||.||..|||||
ACUGGCAGAGAAAAAUAGAUGA
1527
1528
42
60
AGAAGUGGAACAACUUCUCAAUGCUCCUGACCUCUGUGCUAAGGACUUUG
||||...||.|.||.| |||||..|.||..|.|.. |||.|..||||||
AGAACGUGAGCCACGU--CAAUGACCUUGCUCGCCA-GCUUACCACUUUG
1529
1530
43
44
AAUGGGAAAAAGUUAA---CAAAAUGUA
|.||||||.|.|.||| ||||..|||
AUUGGGAACAUGCUAAAUACAAAUGGUA
1531
1532
43
46
GAAGACAGCAGCAUUGCAAAGUGCAACGCCUGUGGAA
|||.|.||||||| .|.||..|.||.||.||.|.||
GAAAAGAGCAGCA--ACUAAAAGAAAAGCUUGAGCAA
1533
1534
43
47
AAGAUAGUCUACAACA-AAGCUCAGG
||||||..||..||.| |||||||.|
AAGAUAAACUUGAAAAUAAGCUCAAG
1535
1536
43
48
GCUCUCUCCCAGCUUGAUUUCCAAUGGGAAAAAGUUAACAAAAUGUACAAGGACCGACAA
|.|.|||||.|....||.| ||.|.|||||....||||.||....||.|.||..|||.|
GUUAUCUCCUAUUAGGAAU--CAGUUGGAAAUUUAUAACCAACCAAACCAAGAAGGACCA
1537
1538

43
49
AAAGUUAACAAAAUGUACAAGGACCGACAAG
||||...|..|..||||||||||...||.||
AAAGGGCAGCAUUUGUACAAGGAAAAACCAG
1539
1540
43
51
UUGCAAAGUGCAAC--GCCUGUGGAAAGGGUGAAGCUACAGGAAGCUCUCUCCCAGCUUGAU
|.|||.|.|.|||| |.|| ||||.||.....|.|.||.|| ||.||.|.|||||||
UGGCAGAUUUCAACCGGGCU-UGGACAGAACUUACCGACUGG-----CUUUCUCUGCUUGAU
1541
1542
43
53
CAGCUUGAUUUCCAAUGGGAAAAAGUUAACAAAAUGUACAAGGA
||.|||.|...||...||.||.|..|.||..||||||..|||||
CACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAUGUUAAAGGA
1543
1544
43
55
UGCAACGCCUGUGGAAAGGGU
|||.||.|.|..|||||||.|
UGCUACCCGUAAGGAAAGGCU
1545
1546
43
57
GGUGAAGCUACAG
||||..|||||||
GGUGUGGCUACAG
1547
1548
43
59
AAUGGGAAAAAGUUAAC
|.|||||||||.|.|||
AGUGGGAAAAAUUGAAC
1549
1550
43
60
CUGUGGAAAGGGUGAAG-CUACA-GGAAGCU
||.|||||....||||. |.|.| |||||||
CUCUGGAAGACCUGAACACCAGAUGGAAGCU
1551
1552

44
45
UUAAUCAGUGGCUAACAGAAG--CUG--AACAGUUUCUCAGAAAGACACAA
|.||||.|.|| |..|||.|| ||| |||||.|. |||||.|||.|.||
UGAAUCUGCGG-UGGCAGGAGGUCUGCAAACAGCUG-UCAGACAGAAAAAA
1553
1554
44
54
CAGUGGCUAACAGAAGCUGA
|||||||..|||.|.|..||
CAGUGGCAGACAAAUGUAGA
1555
1556
44
56
AGAAAGACACAAAUUCCUGAGA
|.|.||.||.|||.||||||||
AAACAGCCAAAAAAUCCUGAGA
1557
1558
45
46
GCAACUGGGGAAGAAAUAAUUCAGCAA
||||||. .||||||...||.|||||
GCAACUA--AAAGAAAAGCUUGAGCAA
1559
1560
45
47
CAGCGGCAAACUGUUGUCAGAACAUUGAAUGCAACUGGGGAA
|.|||.||.....||.|||.|..|||.||||.||||||.|.|
CUGCGCCAGGGAAUUCUCAAACAAUUAAAUGAAACUGGAGGA
1561
1562
45
48
UUGGGAAGCCUGAA
|||||.|||.||||
UUGGGCAGCUUGAA
1563
1564
45
49
AGAUGCCAGUAUUC-UACA-GGAAAAA
|.|.|.|||.|||. |||| |||||||
AAAGGGCAGCAUUUGUACAAGGAAAAA
1565
1566

45
51
CAGCAAUCCUCAAAA-ACAGAUGCCA
|.||.|||..||||. |.|.||||||
CUGCCAUCUCCAAACUAGAAAUGCCA
1567
1568
45
53
UCAGAACAUUGAAUGCAACUGGGGAA-GAAAUAAUUCAGCAAUCCUCAAAAACAGAUGCCAGUAUUCUACAGGAAAAA
||||||| .|.|.|||||.|..||| |||||..|..||.|.|| ||.||| |||.|.|.|..||| |||||.||
UCAGAAC--CGGAGGCAACAGUUGAAUGAAAUGUUAAAGGAUUC----AACACA-AUGGCUGGAAGCUA-AGGAAGAA
1569
1570
45
55
AAACAGAUGCCAGUAUUCUACAGGA
|||||..|||||.|.|.||||||||
AAACAACUGCCAAUGUCCUACAGGA
1571
1572
45
57
AUUGGGAAGCCUGAAUCUG--CGGUGGCAGGAGGUCUGCA
|||.|||||||.|. |||| |.||||.|| .|||||||
AUUUGGAAGCCAGU-UCUGACCAGUGGAAG--CGUCUGCA
1573
1574
45
59
CUGCAAACAGCUGUCAGACAGAAAAAA
|||||..|.||||.|.|.||||.||||
CUGCACUCCGCUGACUGGCAGAGAAAA
1575
1576
45
60
CCUCAAAAACAGAUGCCAGUAUUCUACAG
|||.||.|.||||||..||. ||||.|||
CCUGAACACCAGAUGGAAGC-UUCUGCAG
1577
1578
46
54
CACUUGAACCUGGAAAAGAGCAGCAACUAAAAGAAAA
||..|||..|..||||||..||.....|||.|||.||
CAGAUGAUACCAGAAAAGUCCACAUGAUAACAGAGAA
1579
1580

46
56
AACCUGGAAAAGAGCAGCAACUAAA
||||||||..|.|.||||.|..|||
AACCUGGAUGAAAACAGCCAAAAAA
1581
1582
47
48
AGAAGAGCAAGAUAAACUUGAAAAUAAGCU
|.||||.|..|...|.||||||||.|||||
AAAAGACCUUGGGCAGCUUGAAAAAAAGCU
1583
1584
47
49
AAACUUGAAAAUAAGCUCAAGCAGACAAAUCUCCAGUGGA
|||||..||.|..||.||||||..|..||.|....|||||
AAACUGAAAUAGCAGUUCAAGCUAAACAACCGGAUGUGGA
1585
1586
47
51
AGAUAAACUUGAAAAUAAGCUCAAGCAGA
|.||.|||..||..||.| |||||||||
AUAUCAACGAGAUGAUCA--UCAAGCAGA
1587
1588
47
53
AACAAUUAAAUGAAA
||||.||.|||||||
AACAGUUGAAUGAAA
1589
1590
47
55
UGGAAGAGUUGCCCCUGCGCCAGGGAA
||.||.||||.||||||..||.||.||
UGCAACAGUUCCCCCUGGACCUGGAAA
1591
1592
47
57
UUACUGGUGGAAGAGU-UGCCCCUG---CGCCAGGGAAUUCU
|.||..|||||||.|| |||.|||. |..||||.|.||||
UGACCAGUGGAAGCGUCUGCACCUUUCUCUGCAGGAACUUCU
1593
1594

47
59
UACUG-GUGG- AAGAGUUGCCCCUGCGCCAGGGAAUUCUCAAACAAUUAAAUGAAACUGGAGGACCCGUGCUUGUAAGUGCUCCCAUAAGC CCAGAAGAGCAAG-AUAAACUUGAAAAUAAGCU----//
||||| |||| ||.|.|||..||||| |.|.|.|..||....|.|..|||.|.||.||..|. ||||.|||. ||||...||...||..||...|.| ||.|.||.||....|||||
UACUGAGUGGGAAAAAUUGAACCUGC-------ACUCCGCUGACUGGCAGAGAAAAAUAGAUGAGACC--CUUGAAAGA-CUCCAGGAACUUCAAGAGGCCACGGAUGAGCUGGACCUCAAGCUGCGC//
//CAAGCAGA
|||||.||
//CAAGCUGA
1595
1596
47
60
UGGUGGAAGAGUUGCCCCUGCGCCAGGGAAUUCUCAAACAAUUAAAUGA
|.|.|||..|.||||.|||..|..||.|||.. |.|..||..|.|||||
UCGAGGAGAAAUUGCGCCUCUGAAAGAGAACG-UGAGCCACGUCAAUGA
1597
1598
48
49
GAAAUUGAAGCUCAAA-UAAAAGACC
|||||.|.||.||||. ||||..|||
GAAAUAGCAGUUCAAGCUAAACAACC
1599
1600
48
51
CUUGGGCAGCUUGAAAAAAAGCUUGAAGA
||..|||||.||..||....|||||.|.|
CUCUGGCAGAUUUCAACCGGGCUUGGACA
1601
1602
48
53
UGAGAAACAA--GGA-GAAAUUGAAGCUCAAAUAAAAGACCUUGGGCAGC--UUGAAAAAAAGCUUGAAG
|.||||.||. ||| |||.|..|||..||..|..|..|||...||||.| |||||..|||..||.|||
UCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAUGUUAAAG
1603
1604

48
55
GCAGCUUGAAAAAAAGCUUGAAGACCUUGAAGAGCAGUUAAAUCAUCUGCUGCUGU
|.|.||.|||||....||||.....||| |.||.||.|.||.||.||||...|||
GGACCUGGAAAAGUUUCUUGCCUGGCUU--ACAGAAGCUGAAACAACUGCCAAUGU
1605
1606
48
57
UUGAAGACCUUGAAGAGCAGUUAAAUCAUCUGCUGCUGU
|.||||.|..|...||.||||..||.|.|||||..||.|
UGGAAGCCAGUUCUGACCAGUGGAAGCGUCUGCACCUUU
1607
1608
48
59
GGAGAAAUUGAAGCUCAAAUAAAAGACCUUGGGCAGCUUGAAAAAAAGCUUGAAGACCUUGAA
|||.||||||||.||..|.|.......|| |||||. ||||||.||.| ||...|||||||
GGAAAAAUUGAACCUGCACUCCGCUGACU--GGCAGA--GAAAAAUAGAU-GAGACCCUUGAA
1609
1610
48
60
CAAGGAGAAAUUGAAGCUCAAAUAAAAGACCUUGGGCAGCUUGAA
|.|||||||||||...|||..| ||.|||.|.||.||..|.|.||
CGAGGAGAAAUUGCGCCUCUGA-AAGAGAACGUGAGCCACGUCAA
1611
1612
49
51
CAACCGGAUGUGGA-AGAGAUU
|||||||...|||| |||..||
CAACCGGGCUUGGACAGAACUU
1613
1614
49
53
UGAAAUAGCAGUUCAAGCUAAACAACCGGAUG
||||.||..||..||. ||..|.|||||||.|
UGAAGUACAAGAACAC-CUUCAGAACCGGAGG
1615
1616
49
55
GAAACUGAAAUAGCAGUUCAAGCUAAACAACCGGAUGUGGAAGAGAUU-UUGUCU
||||||.|.|.|..|.|.|||......|..|.|||..|||||.||.|| |||.||
GAAACUCAUAGAUUACUGCAACAGUUCCCCCUGGACCUGGAAAAGUUUCUUGCCU
1617
1618

49
57
AGCAGUUCA--AGCUAAACAA
||||||||| |||..|||.|
AGCAGUUCAGAAGCAGAACGA
1619
1620
49
59
UCAAGCUAAAC-AACCGGAUGUGG--AAGAGAUUUUGUC
|||||||...| ||.|.||.|||. |||.|||..||.|
UCAAGCUGCGCCAAGCUGAGGUGAUCAAGGGAUCCUGGC
1621
1622
49
60
GCAGUUCAAGCUAAACAACCGGAUGUGGAAGAGA
|||.|||.||...||....||..|.||.||||||
GCACUUCGAGGAGAAAUUGCGCCUCUGAAAGAGA
1623
1624
50
51
AAGUUAGAAGAUCUGAGCUCUGAGUGGAAGGCGGUAAACCGUUU--ACUUCAA-GAGCUGAGGGCAAAGCAG
||||||.||.|||..||. |.||| |.||.||...|||.|.. |..|||| |||.|||.....||||||
AAGUUAUAAAAUCACAGA---GGGUG-AUGGUGGGUGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAG
1625
1626
50
53
UUAGAAGAUCUGAGCUCUGAGUGGAAGGCGGUAAACCGUUUACUUCAAGAGCUGAGGGCAAAGCAGCCUGACCUAGCUCCUGGACUGACCACUAUUG
||..||||..|.||.. |.|||||.|.|..|||.|.......|||||..|.|.||||..|.||..|..|||..| |.|...|||.|.|.|||.||.|
UUGAAAGAAUUCAGAA-UCAGUGGGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAU-GUUAAAGGAUUCAACACAAUGG
1627
1628
50
55
AGGAAGUUAGAAGAUCUGA
|||.|||.| ||||.||||
AGGGAGUAA-AAGAGCUGA
1629
1630

50
57
AGAUCUGAGCUCUGAGUGGAAGGCGGUAAACCGUUUACUUCAAGAGCU
||.|||||.| ||||||||....|..|||.||..||.||.||.||
AGUUCUGACC----AGUGGAAGCGUCUGCACCUUUCUCUGCAGGAACU
1631
1632
50
59
ACUUCAAGAGCUGAGGGCAAAGCAGCCUGACCU--AGCUCC
||||||||||...|.||...|||.| ||||| ||||.|
ACUUCAAGAGGCCACGGAUGAGCUG---GACCUCAAGCUGC
1633
1634
50
60
UGACCUAGCUCCUGGACUGACCACUAUUGG
||||||.||||.....||.||||||.|.||
UGACCUUGCUCGCCAGCUUACCACUUUGGG
1635
1636
51
52
AUAUCAACGAGAUGAUCAUCAAGCAGAAG
||.|.||..|.|.||.||.|||.||..||
AUUUGAAAAACAAGACCAGCAAUCAAGAG
1637
1638
51
58
ACUAAGGAAACUGCCAUC
|||||.|||.|||..|||
ACUAAAGAACCUGUAAUC
1639
1640
52
53
UUGGAAGAACUCAUUACCGCUGCCCAAAAUUUGAAAAACA-----AGACCAGCAAUCAAGAGGCUAGAACAAUCAUUACGGAUCGAA
|||.|||||.|||..|.|..||.....||.|..||.|||| |||.|.|.|..|||.||...|....|||..|.|.||||..||
UUGAAAGAAUUCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCAACAGUUGAAUGAAAUGUUAAAGGAUUCAA
1641
1642

52
55
UUGGAAGAA-CUCAU
||||||||| |||||
UUGGAAGAAACUCAU
1643
1644
52
57
CCAGCAAUCAAGAGGCUAGAACAAU
||||||.|..|||.|| |||||.||
CCAGCAGUUCAGAAGC-AGAACGAU
1645
1646
52
59
UUGAAAAACAAGACCAGCAA--UCAAGAGGCUA
||||||.||. ||||.|| |||||||||.|
UUGAAAGACU---CCAGGAACUUCAAGAGGCCA
1647
1648
52
60
UGGAAGAACUCAUUACC
|||||||.||.|..|||
UGGAAGACCUGAACACC
1649
1650
53
58
CUGAGCAGGUCUUAGGACAGGCCAGAG
|.||||||. |||.|||..|.|.||||
CAGAGCAGC-CUUUGGAAGGACUAGAG
1651
1652
54
55
CUGAAACUUCUCCGGGAUUAUUCUGCAG-AUGAUACCAGAAAAG
|||||||..||.| .|.|.|.||.||| |||.||||.|.||.|
CUGAAACAACUGC--CAAUGUCCUACAGGAUGCUACCCGUAAGG
1653
1654
54
57
CAGUGGCAGACAAAUGUAGAU
|||..|||||...|||||.||
CAGAAGCAGAACGAUGUACAU
1655
1656

54
59
CUCCGCC-AGUGGCAGACAAAUGUAGAUGUGGCAAAUGACUUGGCCCUGAAACUUC
||||||. |.|||||||.|||..||||||.|.|...|||......||.|.||||||
CUCCGCUGACUGGCAGAGAAAAAUAGAUGAGACCCUUGAAAGACUCCAGGAACUUC
1657
1658
54
60
UCCGCCAGUGGCAGACAAAUGUAGAUGUGGCAAAUGACUUGGCCCUGAAACUU
|.||||..||..|||.||....||....|.||| ||||.|.||.|...|.|||
UGCGCCUCUGAAAGAGAACGUGAGCCACGUCAA-UGACCUUGCUCGCCAGCUU
1659
1660
55
56
GAAGCUGAAACAACUGCCAAUGUCCUACAGGAUGCUACCCGUAAGGAAAGGCU------CCUAGAAGACUCCAAGG
||||||.|.|||..||...||..|...|.|||||..|.|.|..|..|||..|| |||.||||..|||.|.|
GAAGCUCACACAGAUGUUUAUCACAACCUGGAUGAAAACAGCCAAAAAAUCCUGAGAUCCCUGGAAGGUUCCGAUG
1661
1662
56
57
ACAGCCAAAAAAUCCUGAGAUCC-CUGGAAGGUUCCGAU
|||||..|||.||..|||..|.. |.||.|||..||.||
ACAGCUGAAAGAUGAUGAAUUAAGCCGGCAGGCACCUAU
1663
1664
56
59
GGUGAAAUUGAAGCU-CACACAGAUGUUUAUCACA---ACCUGGAUGAAAACAGCCAAAAAAUCCUGAGAUCCCUGGAAGGUUCCGAUGA
||..||||||||.|| |||.|.|.||..|..||.| |..|.|||||.|.|....|||.|.|||.|..|...|..||.|...|.|||||
GGAAAAAUUGAACCUGCACUCCGCUGACUGGCAGAGAAAAAUAGAUGAGACCCUUGAAAGACUCCAGGAACUUCAAGAGGCCACGGAUGA
1665
1666
58
59
ACAGAGCAGCCUUUGGAAGGACUAGAGAAACUCUACCAGG
|.|||..||.|..|.|||.||||..||.||||..|..|||
AUAGAUGAGACCCUUGAAAGACUCCAGGAACUUCAAGAGG
1667
1668
58
60
CUUCAAGAGGGAAUUG
||||.||..|.|||||
CUUCGAGGAGAAAUUG
1669
1670

56
60
CUCCAAGGUGAAAUUGAAGCUCACACAGA
|..|.|||.|||||||...|||..|.|||
CUUCGAGGAGAAAUUGCGCCUCUGAAAGA
1742
1743
10
18
CAGCUUUAGAAGAA
|||..|||.|||||
CAGACUUAAAAGAA
1766
1767
10
18
AUUUCUAAUGAUGUGGAAG
||||..|||..|..|||||
AUUUGCAAUCUUUCGGAAG
1768
1769
10
30
CAUUUGGAAGCUCCU---GAAGACAAG
||.||||.||||..| |.|||||||
CAGUUGGCAGCUUAUAUUGCAGACAAG
1770
1771
10
30
GGAGAGUGAAGUAAACCUGGACCGUUAUCAAACAG
|||||.||||. ||.|||....|.|.|||.|..||
GGAGACUGAAA-AAUCCUUACACUUAAUCCAGGAG
1772
1773
45
55
AUGCAACUGGGGAAGAAA
|.||..||..||||||||
AGGCUGCUUUGGAAGAAA
1774
1775
45
55
AGCCUGAAUCUGCGGUGGCAGGAGGUC
|||..||..||||..|||.||.|..||
AGCGAGAGGCUGCUUUGGAAGAAACUC
1776
1777

Таблица 3
Перечень предпочтительных последовательностей оснований олигонуклеотидов по изобретению. Олигонуклеотиды, содержащие эти последовательности оснований, способны связываться с высоко сходными областями (участки последовательности с >50% идентичностью) в двух различных экзонах DMD (как проиллюстрировано в таблице 2), и они способны индуцировать пропускание этих двух экзонов и любых экзонов между ними с образованием транскрипта DMD в рамке считывания.
Соединение Последовательность* SEQ ID NO
Первый экзон 8 - Второй экзон 19
PS830 GUGAUGUACAUUAAGAUGGACUUC 1671
GYGZYGYZXZYYZZGZYGGZXYYX 1672
YGGZXYYXYYZYXYGGZY 1722
YXYGZZXYYXYXZGXYY 1723
Первый экзон 9 - Второй экзон 22
YXZGZGGYGGYGZXZYZZG 1724
YXZYZGYXGGYGZXZXYZZG 1725
Первый экзон 9 - Второй экзон 30
YXYXZYZYXXXYGYGXYZGZXYG 1726
GZZYXGZGGXYYZGGYGZZGZZG 1727
YYXZGYXYXXYGGGXZGZXYG 1728
GZXYXXYGGZYYZZGYGYZZGG 1729
Первый экзон 10 - Второй экзон 13, 14, 15, 18, 20, 27, 30, 31, 32, 35, 42, 44, 47, 48, 55, 57 или 60
PS811 CUUCCUUCCGAAAGAUUGCAAAUUC 1673
XYYXXYYXXGZZZGZYYGXZZZYYX 1674
PS814 GACUUGUCUUCAGGAGCUUCC 1675
GZXYYGYXYYXZGGZGXYYXX 1676
PS815 CAAAUGACUUGUCUUCAGGAGCUUC 1677
XZZZYGZXYYGYXYYXZGGZGXYYX 1678
PS816 CUGCCAAAUGACUUGUCUUCAGGAG 1679
XYGXXZZZYGZXYYGYXYYXZGGZG 1680
PS1168 CUGCCDDDUGDCUUGUCUUCDGGDG 1681
PS1050 CCAAAUGACUUGUCU 1682

CCAAAYGACYYGYCY 1683
PS1059 CAAAUGACUUGUCUUCAGGAG 1684
PS1138 CAAAUGACUUGUCUUCAGGAG 1685
PS1170 CDDDUGDCUUGUCUUCDGGDG 1686
ZYGZXYYGYXYYXZGGZGGZG 1687
PS1016 CAGUCUCCUGGGCAGACUGGAUGCUC 1688
XZGYXYXXYGGGXZGZXYGGZYGXYX 1689
ZYGZZXYGXXZZZYGZXYYGYX 1690
ZYZZGXYGXXZZXYGXYYGYX 1691
GYXXZGGYYYZXYYXZXY 1692
GYXXZXXYYGYXYGXZZY 1693
XYYXYZZZGXYGYYYGZ 1694
XYYXXYGZGGXZYYYGZ 1695
YYYGZYZZXGGYXXZGGYYYZXYYXZ 1696
ZGGXZYYYGZGXYGXGYXXZ 1697
Первый экзон 23 - Второй экзон 42
YXYYXGZXZYXYXYYYXZXZGY 1698
GXGXYYYXYYXGZXZYXYX 1699
ZZYYYXZGZGGGXGXYYYXYYX 1700
YXYYXZGYXZYXZXXZYXZYXGY 1701
GGXZYGYXYYXZGYXZYXZX 1702
ZZYYYXXZZZGGXZYGYXYYX 1703
Первый экзон 45 - Второй экзон 51
YGGXZYXYGYGYYYGZGGZYYGXYG 1730
YGGXZYYYXYZGYYYGGZGZYGGXZG 1731
Первый экзон 45 - Второй экзон 53
YYXXZXZGYYGXZYYXZZYGYYXYGZ 1732
YYXZZXYGYYGXXYXXZGYYXYGZ 1733
YYXXYGYZGZZYZXYGGXZYXYGY 1734
YYXZZXYGYYGXXYXXGGYYXYGZ 1735
XYYYZZXZYYYXZYYXZZXYGYYGX 1736
YYXYYXXYYZGXYYXXZGXXZYYGYGYY 1737
Первый экзон 45 - Второй экзон 55
UCCUGUAGAAUACUGGCAUCUGUUU 1704
YXXYGYZGZZYZXYGGXZYXYGYYY 1705

PS1185 UCCUGUDGDDUDCUGGCDUCUGUUU 1706
PS1186 UCCUGUDGDDUDCUGGCDUCUGU 1707
UCCUGUAGAAUACUGGCAUCUGU 1708
YXXYGYZGZZYZXYGGXZYXYGY 1709
PS1187 UCCUGUDGGDUDUUGGCDGUUGUUU 1710
UCCUGUAGGAUAUUGGCAGUUGUUU 1711
YXXYGYZGGZYZYYGGXZGYYGYYY 1712
PS1188 UCCUGUDGGDUDUUGGCDGUUGU 1713
UCCUGUAGGAUAUUGGCAGUUGU 1714
YXXYGYZGGZYZYYGGXZGYYGY 1715
UCCUGUAGGACAUUGGCAGUUGU 1716
YXXYGYZGGZXZYYGGXZGYYGY 1717
UCCUGUAGGACAUUGGCAGUUGUUU 1718
YXXYGYZGGZXZYYGGXZGYYGYYY 1719
Первый экзон 45 - Второй экзон 60
ZZYZXYGGXZYXYGYYGYYGZGG 1738
XYGYZGZZYZXYGGXZYXYGYY 1739
GXYYXXZYXYGGYGYYXZGG 1740
XYGXZGZZGXYYXXZYXYGGY 1741
Первый экзон 56 - Второй экзон 60
YXYGYGYGZGXYYXZZYYYXZXXYYGGZG 1720
YCYYYXZGZGGXGXZZYYYXYXXYXGZZG 1721
*D=2,6-диаминопурин; C=5-метилцитозин; X=C или 5-метилцитозин, Y=U или 5-метилурацил; Z=A или 2,6-диаминопурин

Таблица 6
Перечень наиболее предпочтительных и/или дополнительных комбинаций экзонов, наиболее предпочтительных и/или дополнительных областей идентичности экзонов, и наиболее предпочтительных и/или дополнительных олигонуклеотидов с их последовательностями оснований, химическими модификациями и идентификационными номерами последовательностей, где *= LNA, C=5-метилцитозин, U=5-метилурацил, D=2,6-диаминопурин, X=C или 5-метилцитозин, Y=U или 5-метилурацил, Z=A или 2,6-диаминопурин, и < > все 2'-фторнуклеотиды (как в SEQ ID NO: 1844).

Примеры 1-5

Материалы и способы

Конструирование олигонуклеотидов в первую очередь было основано на обратной комплементарности с конкретными высоко сходными участками последовательности в двух различных экзонах DMD, как идентифицировано в EMBOSS Matcher и как описано в таблице 2. Следующими учитываемыми параметрами последовательности были присутствие частично открытых/закрытых структур РНК в указанных участках последовательности (как предсказано с помощью RNA structure версии 4.5 или РНК mfold версии 3.5 (Zuker, M.) и/или присутствие предполагаемых участков связывания SR-белка в указанных участках последовательности (как предсказано с помощью программного обеспечения ESE-finder (Cartegni L, et al. 2002 и Cartegni L, et al., 2003). Все AON были синтезированы в Prosensa Therapeutics B.V. (Leiden, Netherlands) или были получены из коммерческого источника (ChemGenes, США), и они содержат 2'-O-метил-РНК и полноразмерные фосфоротиоатные (PS) основные цепи. Все олигонуклеотиды представляли собой 2'-O-метилфосфоротиоатную РНК, и их синтезировали в масштабе 10 мкмоль с использованием устройства для синтеза OP-10 (GE/ÄKTA Oligopilot), с помощью стандартных протоколов для фосфорамидитов. Олигонуклеотиды расщепляли и из них удаляли защитные группы двухстадийным способом (обработка DIEA, а затем концентрированным NH4OH), очищали с помощь ВЭЖХ и растворяли в воде, и добавляли избыток NaCl для обмена ионами. После упаривания соединения перерастворяли в воде, обессоливали с помощью FPLC и лиофилизировали. Масс-спектрометрия подтвердила идентичность всех соединений, и чистота (определенная с помощью UPLC) была найдена приемлемой для всех соединений (>80%). Для экспериментов in vitro, описанных в настоящем описании, приготавливали 50 мкМ рабочие растворы AON в фосфатном буфере (pH 7,0).

Культивирование тканей, трансфекция и анализ способом ОТ-ПЦР

Дифференцированные здоровые контрольные мышечные клетки человека (мышечные трубочки) трансфицировали в 6-луночных планшетах при стандартной концентрации AON 400 нМ в соответствии со стандартными рабочими методиками, не относящимися к GLP. Для трансфекции использовали полиэтиленимин (ExGen500; Fermentas Netherlands) (2 мкл на мкг AON, в 0,15 M NaCl). Упомянутые выше методики трансфекции были адаптированы из ранее описанных материалов и способов (Aartsma-Rus A., et al., 2003). Через 24 часа после трансфекции РНК выделяли и анализировали способом ОТ-ПЦР. В кратком изложении, для получения кДНК использовали случайную смесь гексамеров (1,6 мкг/мкл; Roche Netherlands) в реакции с обратной транскриптазой (RT) на 500-1000 нг исходной РНК. Затем проводили анализ ПЦР на 3 мкл кДНК для каждого образца, и он включал первую и гнездовую ПЦР с использованием праймеров, специфичных к гену DMD (см. таблицы 4 и 5). Выделение РНК и анализ ОТ-ПЦР проводили в соответствии со стандартными рабочими методиками, не относящимися к GLP, адаптированными из ранее описанных материалов и способов (Aartsma-Rus A., et al., 2002; и Aartsma-Rus A., et al., 2003). Продукты ОТ-ПЦР анализировали гель-электрофорезом (2% агарозные гели). Полученные фрагменты ОТ-ПЦР количественно определяли с помощью анализа DNA Lab-on-a-Chip analysis (Agilent Technologies USA; DNA 7500 LabChips). Данные обрабатывали с помощью программного обеспечения "Agilent 2100 Bioanalyzer" и Excel 2007. Оценивали соотношение меньших продуктов транскрипции (содержащих ожидаемое пропускание множества экзонов) и общего количества продуктов транскрипции (что соответствует эффективности пропускания в процентах), и прямо сравнивали с количеством продуктов транскрипции в нетрансфицированных клетках. Фрагменты ПЦР также выделяли из агарозных гелей (набор для экстракции из геля QIAquick gel extraction kit, Qiagen Netherlands) для подтверждения последовательности (секвенирование по методу Сенгера, BaseClear, Нидерланды).

Таблица 4
Наборы праймеров для ПЦР, использованные для обнаружения пропускания экзонов-мишеней
Экзоны-мишени 1-я ПЦР 2-я ПЦР
прямой обратный прямой обратный
10-18 h7f h20r h8f h19r
10-30 h7f h32r h8f h31r
10-47 h8f h50r h9f h49r
10-57 h8f h64r h9f h63r2
45-55 h43f2 h57r h44f h56r

Таблица 5
Последовательности праймеров
ID праймера Последовательность (5'→3')
h7f agtcagccacacaacgactg
h8f caaggccacctaaagtgactaaa
h9f gagctatgcctacacacagg
h43f2 cctgtggaaagggtgaagc
h44f gcgatttgacagatctgttg
h19r gcatcttgcagttttctgaac
h20r actggcagaattcgatccac
h31r tgtgcaacatcaatctgagac
h32r tagacgctgctcaaaattgg
h49r cactggctgagtggctgg
h50r tcagtccaggagctaggtc
h56r cgtctttgtaacaggactgc
h57r tctgaactgctggaaagtcg
h63r2 gagctctgtcattttgggatg
h64r gggccttctgcagtcttcgga
(SEQ ID NO: 1745-1759)

Результаты

Пример 1. Нацеливание на участок последовательности с высоким сходством в экзонах 10 и 18 посредством AON в различных положениях

Исходя из высоко сходного участка последовательностей (63%) в экзонах 10 (SEQ ID NO: 109) и 18 (SEQ ID NO: 110) конструировали серию AON, распределенных по указанному участку последовательности, на 100% обратно комплементарные либо экзону 10 (PS814; SEQ ID NO: 1675, PS815; SEQ ID NO: 1677, PS816; SEQ ID NO: 1679) или либо экзону 18 (PS811; SEQ ID NO: 1673). После трансфекции в контрольных культурах мышечных трубочек здорового человека анализ ОТ-ПЦР продемонстрировал, что все четыре AON были способны индуцировать пропускание экзонов с 10 по 18 (что подтверждено с помощью анализа последовательности) (фиг.1). PS811 и PS816 обладают наиболее высокими процентами обратной комплементарности с обоими экзонами (фиг. 1B), и они были наиболее эффективными с эффективностью пропускания экзонов с 10 по 18, составляющей 70% и 66%, соответственно (фиг.1C). PS814 был наименее эффективным, что может быть связано с его расположением и/или более короткой длиной (21 против 25 нуклеотидов) и, таким образом, более низкой аффинностью или стабильностью. В необработанных клетках не наблюдали пропускания экзонов с 10 по 18 (NT). Эти результаты были высоко воспроизводимыми (пропускание экзонов с 10 по 18 посредством PS816 при 20/20 различных трансфекциях) и демонстрируют, что пропускание мультиэкзонного участка с 10 по 18 экзоны является осуществимым с использованием одного AON, который способен связываться как с экзоном 10, так и с экзоном 18, в области с высоким сходством последовательности (63%), и который способен индуцировать пропускание этих экзонов и всех экзонов между ними. Хотя в этой области транскрипта могут быть получены дополнительные фрагменты с пропусканием множества экзонов, полученный транскрипт, в котором экзон 9 был прямо сплайсирован с экзоном 19 (транскрипт в рамке считывания), был наиболее распространенным во всех экспериментах.

Пример 2. Нацеливание на участок последовательности с высоким сходством в экзоне 10 и 18 посредством AON различной длины

Учитывая высоко сходные участки последовательности в экзонах 10 (SEQ ID NO: 109) и 18 (SEQ ID NO: 110), авторы настоящего изобретения оценивали эффект AON различной длины для идентификации наиболее эффективной минимальный длины. После трансфекции PS816 (25-мер; SEQ ID NO: 1679), PS1059 (21-мер; SEQ ID NO: 1684) или PS1050 (15-мер; SEQ ID NO: 1682) в контрольных мышечных клетках здорового человека (т.е. дифференцированных мышечных трубочках), анализ ОТ-ПЦР продемонстрировал, что все три AON были способны индуцировать пропускание экзонов с 10 по 18 (что подтверждено с помощью анализа последовательности) (фиг.2A, B). PS816 и PS1059 были наиболее эффективными (68% и 79%, соответственно). Наиболее короткий PS1050 был менее эффективным (25%). В необработанных клетках (NT) не наблюдали пропускания экзонов с 10 по 18. Эти результаты указывают на то, что пропускание мультиэкзонного участка с 10 по 18 экзоны является осуществимым с использованием AON из 15, 21 и 25 нуклеотидов. Также ожидается, что будут действовать более длинные AON. 21-мерный PS1059 был наиболее эффективным наиболее коротким кандидатом. 15-мер PS1050 был наименее эффективным, что может быть связано с его уменьшенной обратной комплементарностью экзону 18 (47%; фиг.2B) и/или уменьшенной аффинностью связывания с РНК-мишенью или стабильностью. Для повышения Tm и, таким образом, аффинности связывания и стабильности дуплекса, 15-меров в целях повышения их биоактивности могут требоваться модификации оснований. Наиболее многочисленным полученным продуктом-транскриптом в этом эксперименте вновь был продукт, в котором экзон 9 был прямо сплайсирован с экзоном 19 (транскрипт в рамке считывания).

Пример 3. Нацеливание на участок последовательности с высоким сходством в экзоне 10 и 18 посредством AON с модифицированной химической структурой оснований

Конкретные характеристики выбранной химической структуры AON, по меньшей мере частично, влияет на доставку AON к транскрипту-мишени: путь введения, биостабильность, биораспределение, внутритканевое распределение и клеточный захват и транспорт. Кроме того, считается, что дальнейшая оптимизация химической структуры олигонуклеотида повысит аффинность связывания и стабильность, повысит активность, улучшит безопасность и/или снизит затраты вследствие уменьшения длины или усовершенствования методик синтеза и/или очистки. В высоко сходном участке последовательностей в экзонах 10 (SEQ ID NO: 109) и 18 (SEQ ID NO: 110) авторы настоящего изобретения оценивали эффект AON на основе 2'-O-метил-РНК с различными модифицированными основаниями (такими как 5-замещенные пиримидины и 2,6-диаминопурины). После трансфекции PS816 (AON с регулярной 2'-O-метил РНК; SEQ ID NO: 1679), PS1168 (PS816, но в котором все As заменены на 2,6-диаминопурин; SEQ ID NO: 1681), PS1059 (AON с регулярной 2'-O-метилфосфоротиоатной РНК; SEQ ID NO: 1684), PS1138 (PS1059, но в котором все Cs заменены на 5-метилцитозин; SEQ ID NO: 1685), или PS1170 (PS1059, но в котором все As заменены на 2,6-диаминопурин; SEQ ID NO: 1686) (фиг.3B) в контрольных мышечных клетках здорового человека (т.е. дифференцированные мышечные трубочки). Анализ ОТ-ПЦР продемонстрировал, что все пять AON были способны индуцировать пропускание экзонов с 10 по 18 (что подтверждено с помощью анализа последовательности) (фиг.3). PS816 был наиболее эффективным (88%). Хотя модификации оснований в этих конкретных последовательностях не повышали биоактивность еще более, они могли иметь более положительный эффект на биораспределение, стабильность и/или безопасность, так что менее эффективные соединения все еще являются предпочтительными для клинической разработки. Эти результаты указывают на то, что пропускание мультиэкзонного участка с 10 по 18 экзоны является осуществимым с использованием AON с модифицированными основаниями. Наиболее многочисленным полученным транскриптом-продуктом в этом эксперименте вновь был транскрипт, в котором экзон 9 был прямо сплайсирован с экзоном 19 (транскрипт в рамке считывания).

Пример 4. PS816 индуцирует пропускание других мультиэкзонных участков в рамке считывания

Высоко сходный участок последовательности в экзонах 10 (SEQ ID NO: 109) и 18 (SEQ ID NO: 110) также (частично) присутствует в экзонах 30 (SEQ ID NO: 128), 31 (SEQ ID NO: 130), 32 (SEQ ID NO: 132), 42 (SEQ ID NO: 152), 47 (SEQ ID NO: 158), 48 (SEQ ID NO: 160), 57(SEQ ID NO: 170) и 60 (SEQ ID NO: 174) (фиг.4A, B, таблица 2). Таким образом, авторы настоящего изобретения сфокусировались на выявлении пропускания мультиэкзонных участков после трансфекции 400 нМ PS816 (SEQ ID NO: 1679). Авторы настоящего изобретения использовали различные наборы праймеров (таблица 4 и 5) для этой цели. Действительно, с помощью анализа ОТ-ПЦР авторы настоящего изобретения выявили пропускание в рамке считывания экзонов с 10 по 30, экзонов с 10 по 42, экзонов с 10 по 47, экзонов с 10 по 57 и/или экзонов с 10 по 60 в множественных экспериментах (подтверждено с помощью анализа последовательности), которое не наблюдалось в необработанных клетках. В качестве примера, на фиг.4C представлено индуцированное PS816 пропускание экзонов с 10 по 18, экзонов с 10 по 30 и экзонов с 10 по 47. Несмотря на дополнительные случаи пропускания множества экзонов (как в рамке считывания, так и не в рамке считывания), полученный транскрипт, в котором экзон 9 был прямо сплайсирован с экзоном 19 (транскрипт в рамке считывания), был наиболее воспроизводимым и оказался наиболее многочисленным во всех экспериментах. Эти результаты подтверждают, что в гене DMD может быть индуцировано пропускание множества экзонов с использованием одного AON, который способен связываться с участком последовательности, который высоко сходен между двумя различными экзонами и способен индуцировать пропускание этих экзонов и всех экзонов между ними с образованием транскрипта DMD в рамке считывания.

Пример 5. Нацеливание на участок последовательности с высоким сходством в экзоне 45 и 55 с помощью AON с модифицированной химической структурой оснований

Исходя из высоко сходного (80%) участка последовательности в экзонах 45 (SEQ ID NO: 1571) и 55 (SEQ ID NO: 1572) была сконструирована серия AON, распределенных по всему указанному участку последовательности, либо на 100% обратно комплементарных экзону 45 (PS1185; SEQ ID NO: 1706, PS1186; SEQ ID NO: 1707), либо на 96% обратно комплементарных экзону 55 (с одним несоответствием оснований) (PS1188; SEQ ID NO: 1713) (фиг.5A). Во всех трех AON As были заменены на 2,6-диаминопурин. После трансфекции в контрольных культурах мышечных трубочек здорового человека анализ ОТ-ПЦР продемонстрировал, что PS1185, PS1186 и PS1188 были способны индуцировать пропускание экзонов с 45 по 55 (что подтверждено с помощью анализа последовательности) (фиг.5B). В необработанных клетках (NT) не наблюдали пропускания экзонов с 45 по 55. Эти результаты демонстрируют, что пропускание другого мультиэкзонного участка с 45 по 55 экзоны является осуществимым с использованием одного AON, который способен связываться как с экзоном 45, так и с экзоном 55 в области с высоким сходством последовательности (80%), и который способен индуцировать пропускание этих экзонов и всех экзонов между ними. Полученный транскрипт, в котором экзон 44 был прямо сплайсирован с экзоном 56, находится в рамке считывания, и он был выявлен во множестве экспериментов. Что касается экспериментов с пропусканием экзонов с 10 по 18 (пример 3), авторы настоящего изобретения вновь продемонстрировали, что можно эффективно использовать AON с модифицированными основаниями. Более того, результаты, полученные с помощью PS1188, указывают на то, что AON не должен быть на 100% обратно комплементарным одному из экзонов-мишеней, но также может быть сконструирован в качестве гибридных структур, в которых отсутствует 100% обратная комплементарность с каким-либо экзоном-мишенью.

Описание чертежей

Фиг. 1. A) Локализация PS811 (SEQ ID NO: 1673), PS814 (SEQ ID NO: 1675), PS815 (SEQ ID NO: 1677) и PS816 (SEQ ID NO: 1679) в участке последовательности, который является высоко сходным (63%) в экзоне 10 и экзоне 18. B) Характеристики и эффективность AON. Указан процент обратной комплементарности (обр. компл.) каждого AON в отношении либо экзона 10, либо экзона 18. C) Анализ способом ОТ-ПЦР. В мышечных клетках здорового человека (т.е. дифференцированных мышечных трубочках) все четыре AON были эффективными в отношении индукции пропускания мультиэкзонного участка с 10 экзона по 18 экзон. PS811 и PS816 были наиболее эффективными. В рамках слева на фигуре представлено содержание амплифицированных способом ПЦР продуктов транскриптов. (M: маркер размера ДНК; NT: не обработанные клетки).

Фиг. 2. A) Анализ ОТ-ПЦР. В мышечных клетках здорового человека (т.е. дифференцированных мышечных трубочках) исследовали AON с различной длиной, однако с одинаковой центральной последовательностью-мишенью в участке последовательности, который является высоко сходным (63%) в экзоне 10 и экзоне 18. PS816 (SEQ ID NO: 1679), 25-мер, и PS1059 (SEQ ID NO: 1684), 21-мер, были наиболее эффективными (пропускание экзонов 10 и 18 составляет 68% и 79%, соответственно). 15-мер PS1050 (SEQ ID NO: 1682) был менее эффективным. В рамках слева на фигуре представлено содержание амплифицированных способом ПЦР продуктов-транскриптов. (M: маркер размера ДНК; NT: необработанные клетки). B) Характеристики и эффективность AON. Указан процент обратной комплементарности (обр. компл.) каждого AON в отношении либо экзона 10, либо экзона 18.

Фигура 3. A) Анализ ОТ-ПЦР. В мышечных клетках здорового человека (т.е. дифференцированные мышечные трубочки) исследовали AON с различной химической структурой оснований: PS816 (AON с регулярной 2'-O-метилфосфоротиоатной РНК; SEQ ID NO: 1679), PS1168 (PS816, но в котором все As заменены на 2,6-диаминопурин; SEQ ID NO: 1681), PS1059 (AON с регулярной 2'-O-метилфосфоротиоатной РНК; SEQ ID NO: 1684), PS1138 (PS1059, но в котором все Cs заменены на 5-метилцитозины; SEQ ID NO: 1685) или PS1170 (PS1059, но в котором все As заменены на 2,6-диаминопурины; SEQ ID NO: 1686). Пропускание экзонов с 10 по 18 наблюдали для всех исследованных AON. PS816 был наиболее эффективным (88%). В этих конкретных последовательностях модификации оснований не повышали далее биоактивность. В рамках слева на фигуре указаны амплифицированные способом ПЦР продукты-транскрипты. (M: маркер размера ДНК; NT: не обработанные клетки). B) Характеристики и эффективность AON.

Фиг. 4. A) Высоко сходные участки последовательности в экзонах 10, 18, 30 и 47 в качестве множественных мишеней для PS816. SEQ ID NO относятся к полноразмерному выравниванию экзонов EMBOSS (как в таблице 2). Серым цветом выделена часть последовательности, которая не была включена в выравнивание EMBOSS, но которая является соседней с частью с высокой обратной комплементарностью с PS816. B) Обзор выравнивания экзонов и процентов обратной комплементарности (обр. компл.) с PS816. C) Анализ ОТ-ПЦР. С помощью PS816 может быть индуцировано пропускание мультиэкзонного участка, обозначаемое в настоящем описание как пропускание экзонов с 10 по 18, экзонов с 10 по 30 и экзонов с 10 по 47. Полученные транскрипты находятся в рамке считывания. Они не были выявлены в необработанных клетках (NT). В рамках слева и справа на фигуре представлено содержание амплифицированных способом ПЦР продуктов транскриптов. (M: маркер размера ДНК).

Фиг. 5. A) Локализация PS1185 (SEQ ID NO: 1706), PS1186 (SEQ ID NO: 1707) и PS1188 (SEQ ID NO: 1713) в участке последовательности, который является высоко сходным (80%) в экзоне 45 и экзоне 55. В таблице обобщенно представлены характеристики AON. Указан процент обратной комплементарности (обр. компл.) каждого AON в отношении либо экзона 45, либо экзона 55. B) Анализ ОТ-ПЦР. В мышечных клетках здорового человека (т.е. дифференцированные мышечные трубочки) все три AON были эффективными в отношении индукции пропускания мультиэкзонного участка с 45 по 55 экзоны. В рамках слева на фигуре представлено содержание амплифицированных способом ПЦР продуктов транскриптов. (M: маркер размера ДНК; NT: необработанные клетки).

Список ссылок

Aartsma-Rus A, Bremmer-Bout M, Janson AA, den Dunnen JT, van Ommen GJ, van Deutekom JC. Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. See 1 article found using an alternative search: Neuromuscul Disord. 2002; 12:S71-7.

Aartsma-Rus A, Janson AA, Kaman WE, Bremmer-Bout M, den Dunnen JT, Baas F, van Ommen GJ, van Deutekom JC. Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet. 2003; 12(8):907-14.

Aartsma-Rus A, Janson AA, Kaman WE, Bremmer-Bout M, van Ommen GJ, den Dunnen JT, van Deutekom JC. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am. J. Hum. Genet. 2004; Jan 74(1):83-92.

Alloza I et al., Genes Immun 2012; 13(3):253-257.

Abeliovich A et al., J Neurochem 2006; 99:1062-1072.

van Ommen GJ, van Deutekom J, Aartsma-Rus A. The therapeutic potential of antisense-mediated exon skipping. Curr Opin Mol Ther. 2008; 10(2):140-9.

Andrade MA, Perez-Iratxeta C, Ponting CP. Protein repeats: structures, functions, and evolution. J Struct Biol. 2001; 134(2-3):117-31.

Arai K, Uchiyama N, Wada T. Synthesis and properties of novel 2'-O-alkoxymethyl-modified nucleic acids. Bioorg Med Chem Lett. 2011; 21(21):6285-7.

Béroud C, Tuffery-Giraud S, Matsuo M, Hamroun D, Humbertclaude V, Monnier N, Moizard MP, Voelckel MA, Calemard LM, Boisseau P, Blayau M, Philippe C, Cossée M, Pagès M, Rivier F, Danos O, Garcia L, Claustres M. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 2007; Feb;28(2):196-202.

Bomont P et al., Nat Genet 2000; 26(3):370-374.

Cartegni L, Chew SL, Krainer AR. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet 2002; 3(4):285-98.

Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res 2003; 31(13):3568-71.

Chabriat H et al., Lancet Neurol 2009; 8(7):643-653.

Cheng AJ and Van Dyke MW. Oligodeoxyribonucleotide length and sequence effects on intramolecular and intermolecular G-quartet formation. Gene. 1997; 197(l-2):253-60.

Cirak S, Arechavala-Gomeza V, Guglieri M, Feng L, Torelli S, Anthony K, Abbs S, Garralda ME, Bourke J, Wells DJ, Dickson G, Wood MJ, Wilton SD, Straub V, Kole R, Shrewsbury SB, Sewry C, Morgan JE, Bushby K, Muntoni F. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. Lancet. 2011; 378(9791):595-605.

Cirak S et al., Brain 2010; 133(Pt 7):2123-2135.

Diebold SS, Massacrier C, Akira S, Paturel C, Morel Y, Reis e Sousa C. Nucleic acid agonists for Toll-like receptor 7 are defined by the presence of uridine ribonucleotides. Eur J Immunol; 2006; 36(12):3256-67.

Dhanoa BS et al., Hum Genomics 2013; 7(1):13.

Dorn A, Kippenberger S. Clinical application of CpG-, non-CpG-, and antisense oligodeoxynucleotides as immunomodulators. Curr Opin Mol Ther. 2008; 10(1):10-20.

Dubosq-Bidot L et al., Eur Heart J 2009; 30(17):2128-2136.

Ehmsen J. et al., J. Cell Sci. 2002, 115 (Pt14):2801-2803.

Fiorillo C et al., Neurogenetics 2012; 13(3):195-203.

Friedman JS et al., Am J Hum genet 2009; 84(6):792-800.

Goemans NM, Tulinius M, van den Akker JT, Burm BE, Ekhart PF, Heuvelmans N, Holling T, Janson AA, Platenburg GJ, Sipkens JA, Sitsen JM, Aartsma-Rus A, van Ommen GJ, Buyse G, Darin N, Verschuuren JJ, Campion GV, de Kimpe SJ, van Deutekom JC. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 2011; 364(16):1513-22.

Goyenvalle A, Wright J, Babbs A, Wilkins V, Garcia L, Davies KE. Engineering Multiple U7snRNA Constructs to Induce Single and Multiexon-skipping for Duchenne Muscular Dystrophy. Mol Ther. 2012 Jun; 20(6):1212-21.

Heemskerk H, de Winter C, van Kuik P, Heuvelmans N, Sabatelli P, Rimessi P, Braghetta P, van Ommen GJ, de Kimpe S, Ferlini A, Aartsma-Rus A, van Deutekom JC. Preclinical PK and PD studies on 2'-O-methyl-phosphorothioate RNA antisense oligonucleotides in the mdx mouse model. Mol Ther. 2010; 18(6):1210-7.

Heneka MT et al., Nature2013; 493(7434):674-678.

Hodgetts S, Radley H, Davies M, Grounds MD. Reduced necrosis of dystrophic muscle by depletion of host neutrophils, or blocking TNFalpha function with Etanercept in mdx mice. Neuromuscul Disord. 2006; 16(9-10):591-602.

Hovnanian A, Cell Tissue Res 2013; 351(2):289-300.

Huang JY et al., Hum Reprod 2013; 28(4):1127-1134.

Knauf F et al., Kidney Int 2013; doi:10.1038/ki.2013.207.

Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995; 374(6522):546-9.

Krieg, AM. The role of CpG motifs in innate immunity. Curr. Opin. Immunol. 2000; 12:35-43.

Kumar L, Pharm. Technol. 2008, 3, 128.

Louis-Dit-Picard H et al., Nat Genet 2012; 44(4):456-460.

Macaya RF, Waldron JA, Beutel BA, Gao H, Joesten ME, Yang M, Patel R, Bertelsen AH, Cook AF. Structural and functional characterization of potent antithrombotic oligonucleotides possessing both quadruplex and duplex motifs. Biochemistry. 1995; 34(13):4478-92.

Manzur AY, Kuntzer T, Pike M, Swan A. Glucocorticoid corticosteroids for Duchenne muscular dystrophy. Cochrane Database Syst Rev. 2008; (1):CD003725.

Monaco A.P., et al., Genomics 1988; 2:90-95.

Peacock H, Fucini RV, Jayalath P, Ibarra-Soza JM, Haringsma HJ, Flanagan WM, Willingham A, Beal PA. Nucleobase and ribose modifications control immunostimulation by a microRNA-122-mimetic RNA. J. Am. Chem. Soc. 2011, 133(24):9200-3.

Mollie A et al., Hum Genet 2011; 129(6):641-654.

Moller RS et al., Epilepsia 2013; 54(2):256-264.

Noris P et al., Blood 2011; 117(24):6673-6680.

Popovic PJ, DeMarco R, Lotze MT, Winikoff SE, Bartlett DL, Krieg AM, Guo ZS, Brown CK, Tracey KJ, Zeh HJ 3rd. High mobility group B1 protein suppresses the human plasmacytoid dendritic cell response to TLR9 agonists. J of Immunol 2006; 177:8701-8707.

Puente XS et al., Nature 2011; 475(7354):101-105.

Raciti GA et al., Diabetologia 2011; 54(11):2911-2922.

Rantamaki T et al., Am J Hum Genet 1999; 64(4):993-1001.

Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000.

Sirmaci A et al., Am J Hum Genet 2011; 89(2):289-294.

Stuart HM et al., Am J Hum Genet 2013; 92(2):259-264.

Suzuki K, Doi T, Imanishi T, Kodama T, Tanaka T. Oligonucleotide aggregates bind to the macrophage scavenger receptor. Eur J Biochem. 1999; 260(3):855-60.

Uchida K et al., Immunology 2005; 116(1):53-63.

van Deutekom JC, Janson AA, Ginjaar IB, Frankhuizen WS, Aartsma-Rus A, Bremmer-Bout M, den Dunnen JT, Koop K, van der Kooi AJ, Goemans NM, de Kimpe SJ, Ekhart PF, Venneker EH, Platenburg GJ, Verschuuren JJ, van Ommen GJ. Local dystrophin restoration with antisense oligonucleotide PRO051. N Engl J Med. 2007; 357(26):2677-86.

van Vliet L, de Winter CL, van Deutekom JC, van Ommen GJ, Aartsma-Rus A. Assessment of the feasibility of exon 45-55 multiexon skipping for Duchenne muscular dystrophy. BMC Med Genet. 2008, Dec 1; 9:105.

Wagner, H., Bacterial CpG DNA activates immune cells to signal infectious danger Adv. Immunol. 1999; 73: 329-368.

Yokota T, Duddy W, Partridge T. Optimizing exon skipping therapies for DMD. Acta Myol. 2007; 26(3):179-84.

Yokota T, Hoffman E, Takeda S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 2011; 709:299-312.

Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003; 31(13), 3406-3415.

1. Олигонуклеотид для обеспечения пропуска двух или более экзонов пре-мРНК дистрофина, содержащий последовательность оснований или ее часть, как определено в SEQ ID NO: 1679, и имеющий длину 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, где указанная часть соответствует последовательности оснований, меньшей на 1, 2, 3, 4 или 5 нуклеотидов, чем определено в указанной последовательности оснований.

2. Композиция для обеспечения пропуска двух или более экзонов пре-мРНК дистрофина, содержащая олигонуклеотид по п.1 и необязательно дополнительно содержащая фармацевтически приемлемый носитель, разбавитель, эксципиент, соль, адъювант и/или растворитель, где концентрация олигонуклеотидов в композиции находится в пределах от 0,02 до 400 нМ.

3. Композиция по п.2, где указанная композиция содержит два или более идентичных олигонуклеотидов, как определено в п.1, связанных противоионом, предпочтительно кальцием.

4. Способ предупреждения, замедления, смягчения и/или лечения мышечной дистрофии Дюшенна (DMD) или мышечной дистрофии Беккера (BMD) у индивидуума, причем указанный способ включает введение указанному индивидууму олигонуклеотида по п.1 или композиции по п.2 или 3.

5. Применение олигонуклеотида по п.1 или композиции по п.2 или 3 для предупреждения, замедления, смягчения и/или лечения BMD или DMD.



 

Похожие патенты:

Предложенная группа изобретений относится к области медицины. Предложены способы доставки защитной изоформы ApoE и кодирующей ее нуклеиновой кислоты в центральную нервную систему млекопитающего.

Группа изобретений относится к полученной генно-инженерным путем термофильной бактериальной клетке, продуцирующей (S)-молочную кислоту, и способу продуцирования энантиомерно чистой (S)-молочной кислоты.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению человеческих белков в клетках СНО, и может быть использовано для получения человеческого антитела к гемагглютинину вируса гриппа А (ВГА) изотипа IgA2m1.

Изобретение относится к области биотехнологии и биохимии, в частности к L-арабинозоизомеразе, обладающей увеличенной активностью превращения D-галактозы в D-тагатозу по сравнению с арабинозоизомеразой, содержащей замещение лейцина в положении 469 пролином, или арабинозоизомеразой дикого типа.

Изобретение относится к области биохимии, в частности к молекуле нуклеиновой кислоты, кодирующей первый полипептид, второй полипептид, сигнальную последовательность mBIP и либо белок оболочки, либо адаптерный белок.

Настоящее изобретение относится к области биотехнологии, конкретно к проникающим в клетку пептидам, и может быть использовано в медицине путем доставки терапевтической карго-молекулы в клетку млекопитающего.

Изобретение относится к области биотехнологии, конкретно к модифицированному олигонуклеотиду, направленно воздействующему на рецептор андрогенов (AR) человека для ингибирования уровней рецептора андрогенов в клетке, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к самособирающейся в наночастицу олигонуклеотидной конструкции, и может быть использовано в медицине. Олигонуклеотидная конструкция согласно настоящему изобретению может быть полезной в качестве системы доставки на основе олигонуклеотида нового типа, а также инструмента для лечения злокачественных заболеваний, инфекционных заболеваний и т.п.

Изобретение относится к области биохимии. Предложен условно-дефектный по репликации цитомегаловирус (CMV) для профилактики против CMV с дестабилизированными белками IE1/2 и UL51, а также способ его получения, применение и композиция.

Изобретение относится к области биотехнологии, конкретно к способу получения неистощенных незрелых дендритных клеток (ДК), происходящих из двух различных аллогенных доноров, с их последующей активацией и получением провоспалительных ДК.

Настоящее изобретение относится к области биотехнологии, конкретно к полипептидному биомаркеру эффективности применения ингибитора FGFR при лечении рака мочевого пузыря и рака легких, что может быть использовано в медицине.

Изобретение относится к области биохимии, в частности к растению подсолнечника, устойчивому к патогену ложной мучнистой росы, а также к его семени и ткани. Также раскрыт способ получения растения подсолнечника, устойчивого к патогену ложной мучнистой росы, содержащий этап введения в растение подсолнечника гена, обеспечивающего устойчивость к ложной мучнистой росе.

Изобретение относится к области биотехнологии, в частности к способу непрерывного культивирования линии клеток яичника китайского хомячка CHO, являющейся продуцентом антител, и применению указанного способа.

Изобретение относится к области биохимии, в частности к мыши для экспрессии гуманизированного белка SIRPα, содержащей замещение экзонов 2, 3 и 4 гена SIRPα мыши в эндогенном локусе SIRPα мыши на экзоны 2, 3 и 4 гена SIRPα человека с образованием гуманизированного гена SIRPα, а также к клетке и ткани вышеуказанной мыши.

Изобретение относится к области биохимии. Предложен способ преимплантационной генетической диагностики спинальной мышечной атрофии, предусматривающий определение делеции 7 экзона гена SMN1, где проводят прямую диагностику с использованием ПЦР-ПДРФ, и косвенную диагностику со специфическими праймерами для анализа наследования молекулярно-генетических маркеров, сцепленных с мутацией.

Изобретение относится к области биохимии, в частности к генетически модифицированному животному-грызуну, экспрессирующему гуманизированный белок April, а также к способу его получения.

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмиде pHlyA. Плазмида pHlyA экспрессирует клонированный ген hlyA (гемолизина) Vibrio cholerae, встроенный по сайтам BamHI-Pstl в полилинкер векторной плазмиды pQE30 под контролем Т5-промотора.

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмиде pSC-A-5EV. Плазмида pSC-A-5EV предназначена для экспрессии клонированных генов биосинтеза сидерофора иерсиниахелина Y.
Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК для инициации транскрипции гетерологической транскрибируемой молекулы ДНК, а также к генетической конструкции для инициации транскрипции гетерологической транскрибируемой молекулы ДНК, ее содержащей.

Настоящее изобретение относится к предоставлению вакцин, которые специфичны к опухолям пациентов и потенциально применимы для иммунотерапии первичной опухоли, а также метастазов опухоли.
Изобретение относится к медицине, стоматологии, рефлексотерапии и медицинской реабилитации и может быть использовано для лечения больных с болевой мышечной дисфункцией височно-нижнечелюстного сустава (ВНЧС).

Данное изобретение относится к биотехнологии. Предложен олигонуклеотид для обеспечения пропуска двух или более экзонов пре-мРНК дистрофина. Также рассмотрена композиция для обеспечения пропуска двух или более экзонов пре-мРНК дистрофина, способ и применение олигонуклеотида и композиции для предупреждения, замедления, смягчения иили лечения мышечной дистрофии Дюшенна и мышечной дистрофии Беккера. Настоящее изобретение может найти дальнейшее применение в терапии различных заболеваний, вызванных мутациями в гене дистрофина. 4 н. и 1 з.п. ф-лы, 5 ил., 6 табл., 5 пр.

Наверх